
Sample records for chain reaction methods

  1. Nested methylation-specific polymerase chain reaction cancer detection method (United States)

    Belinsky, Steven A.; Palmisano, William A.


    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  2. Chain reaction

    International Nuclear Information System (INIS)

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  3. Method of carbon chain extension using novel aldol reaction

    Energy Technology Data Exchange (ETDEWEB)

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek


    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  4. Optimized Adaptor Polymerase Chain Reaction Method for Efficient Genomic Walking

    Institute of Scientific and Technical Information of China (English)

    Peng XU; Rui-Ying HU; Xiao-Yan DING


    Genomic walking is one of the most useful approaches in genome-related research. Three kinds of PCR-based methods are available for this purpose. However, none of them has been generally applied because they are either insensitive or inefficient. Here we present an efficient PCR protocol, an optimized adaptor PCR method for genomic walking. Using a combination of a touchdown PCR program and a special adaptor, the optimized adaptor PCR protocol achieves high sensitivity with low background noise. By applying this protocol, the insertion sites of a gene trap mouse line and two gene promoters from the incompletely sequenced Xenopus laevis genome were successfully identified with high efficiency. The general application of this protocol in genomic walking was promising.

  5. Chain Reaction Polymerization. (United States)

    McGrath, James E.


    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  6. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.


    Dewit, D.; Wootton, M.; Allan, B; Steyn, L


    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not c...

  7. Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Gaurav Solanki


    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  8. Genome editing. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations. (United States)

    Gantz, Valentino M; Bier, Ethan


    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype, whereas individuals homozygous for two copies of the allele will display a mutant phenotype. We have developed a method called the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome-editing system for generating autocatalytic mutations, to produce homozygous loss-of-function mutations. In Drosophila, we found that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome, thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  9. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction.


    Tsai, Y L; Olson, B H


    The polymerase chain reaction (PCR) was used to amplify an Escherichia coli 16S ribosomal gene fragment from sediments with high contents of humic substances. Total DNA was extracted from 1 g of E. coli seeded or unseeded samples by a rapid freeze-and-thaw method. Several approaches (use of Bio-Gel P-6 and P-30 and Sephadex G-50 and G-200 columns, as well as use of the Stoffel fragment) were used to reduce interference with the PCR. The best results were obtained when crude DNA extracts conta...

  10. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  11. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.


    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  12. Polymerase chain reaction


    Gaurav Solanki


    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  13. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Directory of Open Access Journals (Sweden)

    Mohammad Soleimani


    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  14. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou


    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  15. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations (United States)

    Gantz, Valentino M.; Bier, Ethan


    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype while individuals homozygous for two copies of the allele will display a mutant phenotype. Here, we develop a method that we refer to as the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome editing system for generating autocatalytic mutations to generate homozygous loss-of-function mutations. We demonstrate in Drosophila that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  16. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail:; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)


    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  17. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    International Nuclear Information System (INIS)

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

  18. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .


    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.


    Directory of Open Access Journals (Sweden)

    Yu. Rud


    Full Text Available Purpose. To analyse the nucleotide sequences of salmonids Y chromosome and to determine the fragment for specific primers selection and also to develop the PCR based method for sex determination in huchen H. hucho. Methodology. Using the ClustalW algorithm in MEGA 5.2, the nucleotide sequences of salmonids Y chromosome were analysed. For developing of method for rapid diagnostic of huchen sex the polymerase chain reaction (PCR assay was used. Tne nucleotide sequences of amplified products were investigated by sequencing. Findings. Using PCR assay the method of sex determination in huchen H. hucho was developed. It was shown that specific PCR products in size of 450 nucleotides were visible in huchen males only. In addition we showed that selected primers can be used in sex determination of rainbow trout Oncorhynchus mykiss and this fact is proved the high rate of sdY locus similarity and its wide destribution in salmonids. Originality. The nucleotide sequences of salmonids Y chromosome were analysed and highly conservative region of sdY locus for specific primers selection, which covers sex-linked marker, was identified. Practical Value. Rapid sex determination in huchen by the developed method will allow to identify reversal males in process of gormonal sex reversion. At the stage of reversal males screening, this method will allow to identify the genotypic males (XY in experimental group and discard them because only phenotypic males with XX genotype (reversal males must be used in the crosses with native femelas for getting of 100 % all-females stock.

  20. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio


    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  1. [Development of a real-time polymerase chain reaction method for the identification of Candida species]. (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza


    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  2. A novel polymerase chain reaction method for detection of human immunodeficiency virus in dried blood spots on filter paper.


    Yourno, J; Conroy, J.


    A method for detection of proviral human immunodeficiency virus DNA in dried blood spots on filter paper by direct polymerase chain reaction (PCR) has been developed. To develop the method, a standard system was used which was prepared from cells each containing a single integrated provirus and titrated with normal donor blood. This rapid procedure provides virtually quantitative yields of nuclear DNA and exploits most of the standard methodology described for blood specimens. A nested PCR us...

  3. Rapid, simple method for treating clinical specimens containing Mycobacterium tuberculosis to remove DNA for polymerase chain reaction.


    Buck, G E; O'Hara, L C; Summersgill, J T


    Several simplified methods for treating mycobacteria to release DNA for amplification by the polymerase chain reaction (PCR) were investigated. The most effective of the methods was sonication. Samples were placed in screw-capped microcentrifuge tubes that were then placed in a plastic rack. The rack was floated in a dish of water next to the ultrasonic probe so that the ultrasonic energy was transmitted through the walls of the tubes. This allowed multiple samples to be processed safely and ...

  4. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods (United States)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.


    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  5. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in wetlands, western Kenya: confirmation by polymerase chain reaction method. (United States)

    Ohba, Shin-Ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; Sonye, Gorge; Minakawa, Noboru; Takagi, Masahiro


    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  6. Supply chain reaction

    International Nuclear Information System (INIS)

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  7. Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food. (United States)

    Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre


    Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system. PMID:12083257

  8. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.


    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E


    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  9. A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load. (United States)

    Kidd, I M; Clark, D A; Emery, V C


    Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed. PMID:10856765

  10. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda


    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  11. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K


    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity of...

  12. Early detection of Toxoplasma gondii by real-time polymerase chain reaction methods in patients with recurrent spontaneous abortions

    Directory of Open Access Journals (Sweden)

    Parviz Saleh


    Full Text Available Introduction: One of the causes of recurrent spontaneous abortions (RSA is an infection by the toxoplasmosis Protozoa. In comparison, we present detailed results using real-time polymerase chain reaction (PCR methods of detection. In this study, it was tried to detect Toxoplasma gondii (T. gondii by real-time PCR methods in patients with RSA. Methods: Amniotic fluid sampling was performed in the 16-20th weeks of gestation in 50 pregnant women with a history of RSA. The extracted deoxyribonucleic acid (DNA samples were analyzed using quantitative real-time PCR. Results: In all the cases, the detection of T. gondii was negative in the peripheral blood, and amniotic fluid samples by using the molecular methods (real-time PCR. Using the serological detection methods, 6% of patients were diagnosed as positive for the immunoglobulin M (IgM antibody. In addition, the IgG antibody was positive in 46% of the patients. Conclusion: It can be concluded that the serological methods lack specificity.

  13. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte;


    We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

  14. Detection of pathogenic Yersinia enterocolitica in slaughtered pigs by cultural methods and real-time polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Rina Mazzette


    Full Text Available Healthy pigs carrying pathogenic to human Yersinia enterocolitica strains are the main source of entry into slaughterhouse, where cross-contamination of carcasses can happen. The aim of this work was to determine Y. enterocolitica prevalence in slaughtered pigs, investigating the presence of carriers in relation to carcass contamination. A total of 132 pig samples (tonsils, mesenteric lymph nodes, colon content, carcass surface were collected from 4 Sardinian slaughterhouses. All the samples were examined by the ISO 10273:2003 method, and the prevalence was also determined by direct plating on CIN Agar. Moreover, to detect the ail positive Y. enterocolitica strains in enrichment broths and isolates a real-time polymerase chain reaction (PCR was applied. Y. enterocolitica prevalence was 19% with direct plating and 12% with enrichment methods. Carcass surfaces and tonsils prevalence was 5.30% by direct plating, and 5.3% and 2.2%, respectively, by enrichment method. Tonsil samples showed an average contamination level of 3.2×103 CFU/g, while the mean value on carcass was 8.7×102 CFU/g. An overall prevalence of 9.8% of ail positive Y. enterocolitica broths was detected by RT-PCR, that found a higher prevalence in tonsils (7.5% with respect to cultural methods, confirming the greater sensitivity of this technique when applied for tonsils and faeces samples. The results show a relatively low pathogenic Y. enterocolitica prevalence in pigs slaughtered in Sardinia. Good hygiene measures should be applied at slaughterhouse in order to prevent the entry of carriers and control carcass contamination.

  15. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade


    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  16. Direct method for detecting small quantities of hepatitis B virus DNA in serum and plasma using the polymerase chain reaction.


    Zeldis, J B; Lee, J. H.; Mamish, D; Finegold, D J; Sircar, R; Q. Ling; Knudsen, P J; Kuramoto, I K; Mimms, L T


    Serum components inhibit DNA polymerase, thereby obviating direct detection of serum viral DNA sequences by the polymerase chain reaction (PCR). This has necessitated extraction of nucleic acid from sera before performing PCR and has resulted in loss of sensitivity. By adsorbing virus to a solid surface (microcentrifuge tubes or antibody coated microparticles) followed by proteinase K digestion, as little as three viruses per 200 microliters serum may be directly detected by PCR without nucle...

  17. Polymerization as a Model Chain Reaction (United States)

    Morton, Maurice


    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  18. Comparison of RNA isolation and associated methods for extracellular RNA detection by high-throughput quantitative polymerase chain reaction. (United States)

    Tanriverdi, Kahraman; Kucukural, Alper; Mikhalev, Ekaterina; Tanriverdi, Selim E; Lee, Rosalind; Ambros, Victor R; Freedman, Jane E


    MicroRNAs (miRNAs) are small noncoding RNA molecules that function in RNA silencing and posttranscriptional regulation of gene expression. miRNAs in biofluids are being used for clinical diagnosis as well as disease prediction. Efficient and reproducible isolation methods are crucial for extracellular RNA detection. To determine the best methodologies for miRNA detection from plasma, the performance of four RNA extraction kits, including an in-house kit, were determined with miScript miRNA assay technology; all were measured using a high-throughput quantitative polymerase chain reaction (qPCR) platform (BioMark System) with 90 human miRNA assays. In addition, the performances of complementary DNA (cDNA) and preamplification kits for TaqMan miRNA assays and miScript miRNA assays were compared using the same 90 miRNAs on the BioMark System. There were significant quantification cycle (Cq) value differences for the detection of miRNA targets between isolation kits. cDNA, preamplification, and qPCR performances were also varied. In summary, this study demonstrates differences among RNA isolation methods as measured by reverse transcription (RT)-qPCR. Importantly, differences were also noted in cDNA and preamplification performance using TaqMan and miScript. The in-house kit performed better than the other three kits. These findings demonstrate significant variability between isolation and detection methods for low-abundant miRNA detection from biofluids. PMID:26969789

  19. Differential detection of Entamoeba histolytica from Entamoeba dispar by parasitological and nested multiplex polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    esmaiel fallah


    Full Text Available Introduction: Amebiasis is an intestinal illness caused by a one-celled parasite (amoeba called Entamoeba (E histolytica. E histolytica and E dispar are morphologicallyundistinguishable but have genetic and functional differences. E. histolytica is invasive andcause amoebiasis, but E dispar cause an asymptomatic colonization which does not need to bemedically treated. We have performed a nested multiplex Polymerase Chain Reaction (PCRtargeting small subunit rRNA (Ribosomal ribonucleic acid gene for differential detection of Ehistolytica and E dispar directly from stool samples. Methods: All the fecal samples collected without preservation and were screened for amebiccells by parasitological methods. Fecal samples that containing amebic cells were stored at -20ºC until DNA extraction. DNA extraction was down by using a DNA extraction kit. Thegenus specific primers were designed using nucleotide sequences of 18S-rRNA gene ofEntamoeba. Results: Thirty one (4.28% stool samples out of 724 samples were positive for E histolytica/E dispar. The nested multiplex PCR illustrated that the size of diagnostic fragments of PCR products was obviously different for two Entamoeba species, the specific product size for Ehistolytica and E dispar was 439 and 174 bp. The nested multiplex PCR was positive in 25 outof 31 stool specimens that 17 (54.8% samples were positive for E dispar and 8 (25.8%samples were positive for E histolytica. Conclusion: Nested multiplex PCR was useful for the specific detection of E histolytica and Edispar in stool samples. In current study we detected that E dispar was more prevalent in our study area.

  20. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) Larvae in Wetlands, Western Kenya: Confirmation by Polymerase Chain Reaction Method


    Ohba, Shin-ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; SONYE, GORGE; Minakawa, Noboru; Takagi, Masahiro


    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%)....

  1. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in Wetlands, Western Kenya: Confirmation by polymerase chain reaction method


    Ohba, Shin-ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; SONYE, GORGE; Minakawa, Noboru; Takagi, Masahiro


    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%)....


    A rapid direct-extraction method was used to obtain DNA from environmental soil samples. eat, enzymes, and guanidine isothiocyanate were utilized to lyse cells. he DNA was purified by agarose gel electrophoresis, amplified with 16S based primers by use of the polymerase chain rea...

  3. Access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: a randomised, controlled trial

    Directory of Open Access Journals (Sweden)

    Lindh Magnus


    Full Text Available Abstract Background Viral respiratory infections are common worldwide and range from completely benign disease to life-threatening illness. Symptoms can be unspecific, and an etiologic diagnosis is rarely established because of a lack of suitable diagnostic tools. Improper use of antibiotics is common in this setting, which is detrimental in light of the development of bacterial resistance. It has been suggested that the use of diagnostic tests could reduce antibiotic prescription rates. The objective of this study was to evaluate whether access to a multiplex polymerase chain reaction (PCR assay panel for etiologic diagnosis of acute respiratory tract infections (ARTIs would have an impact on antibiotic prescription rate in primary care clinical settings. Methods Adult patients with symptoms of ARTI were prospectively included. Nasopharyngeal and throat swabs were analysed by using a multiplex real-time PCR method targeting thirteen viruses and two bacteria. Patients were recruited at 12 outpatient units from October 2006 through April 2009, and samples were collected on the day of inclusion (initial visit and after 10 days (follow-up visit. Patients were randomised in an open-label treatment protocol to receive a rapid or delayed result (on the following day or after eight to twelve days. The primary outcome measure was the antibiotic prescription rate at the initial visit, and the secondary outcome was the total antibiotic prescription rate during the study period. Results A total sample of 447 patients was randomised. Forty-one were excluded, leaving 406 patients for analysis. In the group of patients randomised for a rapid result, 4.5% (9 of 202 of patients received antibiotics at the initial visit, compared to 12.3% (25 of 204 (P = 0.005 of patients in the delayed result group. At follow-up, there was no significant difference between the groups: 13.9% (28 of 202 in the rapid result group and 17.2% (35 of 204 in the delayed result group (P

  4. International Ring Trial for the Validation of an Event-Specific Golden Rice 2 Quantitative Real-Time Polymerase Chain Reaction Method




    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3′ junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in...

  5. The chain re-action

    CERN Multimedia


    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  6. A rapid method for sequencing of rRNA gene(s) amplified by polymerase chain reaction using an automated DNA sequencer


    Dwivedi, P.P.; Patel, B.K.C.; Rees, G.N.; Ollivier, Bernard


    A method for DNA sequencing of ribosomal RNA (rRNA) genes, amplified by polymerase chain reaction (PCR), using internal primers, designed on the basis of conserved regions of rRNA genes for determining a near complete sequence (99%) of the gene using an automated DNA sequencer (Applied Biosystem Incorporation, USA) is described. The procedure is extremely rapid as cloning of the gene is not required for sequence determination. In addition time consuming steps such as ethanol precipitation and...

  7. Comparative efficacy of conventional diagnostic methods and evaluation of polymerase chain reaction for the diagnosis of bovine brucellosis

    Directory of Open Access Journals (Sweden)

    Raheela Akhtar


    Full Text Available The comparative efficacy of Rose Bengal Plate Test (RBPT and Milk Ring test (MRT was calculated in terms of sensitivity and specificity for the diagnosis of bovine brucellosis in cows (Group A and buffaloes (Group B from Lahore and Okara districts of Punjab, Pakistan. Using bacterial growth as a gold standard RBPT showed high sensitivity values of 100% in both groups. While its specificity was 96.29% (Group A and 90.62% (Group B. On the other hands MRT showed low sensitivity (80.0% in Group A; 86.6% in Group B while its specificity was 100% in all the animals of both groups. The calculated positive predictive and negative predictive values of both groups were in correspondence with their specificity and sensitivity values respectively. High sensitivity and low specificity of RBPT as compare to high specificity and low sensitivity of MRT in all groups suggested the poor efficacy of both tests used individually as compare to bacterial growth. In the continuation of this study polymerase chain reaction (PCR was evaluated for its diagnostic efficacy of quick Brucella abortus isolation from same samples. PCR conducted on serum samples gave more positive results than on milk samples. Therefore, the combination of both conventional tests alongwith serum PCR can be recommended. [Vet. World 2010; 3(2.000: 53-56

  8. A simplified method for sample collection and DNA isolation for polymerase chain reaction detection of Trypanosoma rangeli and Trypanosoma cruzi in triatomine vectors

    Directory of Open Access Journals (Sweden)

    Evandro MM Machado


    Full Text Available Due to the overlapping distribution of Trypanosoma rangeli and T. cruzi in Central and South America, sharing several reservoirs and triatomine vectors, we herein describe a simple method to collect triatomine feces and hemolymph in filter paper for further detection and specific characterization of these two trypanosomes. Experimentally infected triatomines feces and hemolymph were collected in filter paper and specific detection of T. rangeli or T. cruzi DNA by polymerase chain reaction was achieved. This simple DNA collection method allows sample collection in the field and further specific trypanosome detection and characterization in the laboratory.

  9. Hepatitis C Prevalence in Hemodialysis Patients in Mazandaran, Iran: A Survey by Polymerase Chain Reaction and Serological Methods

    Directory of Open Access Journals (Sweden)


    Full Text Available Patients on maintenance hemodialysis are known to have an elevated risk of acquiring Hepatitis C Virus (HCV infection. The reported prevalence among hemodialysis patients in the United States ranges from 8-10% and is considerably higher in many European and Middle Eastern countries. Therefore, a reliable diagnosis of HCV infection is essential in order to prevent the spread of the disease in dialysis units. All hemodialysis patients (n = 186 were interviewed in 2 dialysis units in Imam Khomeini and Fatemeh Zahra hospitals of Sari and Valiasr hospital of Ghaemshahr city / Iran, Between June and august 2006.. Blood samples were collected and serum samples screened for anti-HCV antibodies by Enzyme-Linked Immunosorbent Assay (ELISA. Positive samples were retested for confirmation with Polymerase Chain Reaction (PCR.Statistical analysis was done by means of SPSS (11 software. A total of 186 hemodialysis patients (mean age 58.86±16.9 years were studied. Mean duration of hemodialysis was 3.07±0.3 years. Mean of SGOT and SGPT were 30.64±6 and 32.01±8, respectively. 39 (21% patients were found to be seropositive by ELISA and 12 were confirmed positive by PCR, resulting in an anti-HCV prevalence of 6.5%. association between duration of hemodialysis andHCV seropositivity was statistically significant (p = 0.0001 but there were no significant correlation between number of transfusions and HCV seropositivity. Despite the growing demand for cost-effectiveness in the health system, tight control of HCV infection by PCR and ELISA examination must remain an essential part of the routine screening in hemodialysis patients.



    Kouritzin, Michael A.; Hongwei Long


    In the context of simulating the transport of a chemical or bacterial contaminant through a moving sheet of water, we extend a well-established method of approximating reaction-diffusion equations with Markov chains by allowing convection, certain Poisson measure driving sources and a larger class of reaction functions. Our alterations also feature dramatically slower Markov chain state change rates often yielding a ten to one-hundred-fold simulation speed increase over the previous version o...

  11. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method. (United States)

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco


    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method. PMID:25946377

  12. Mycobacterium avium restriction fragment lenght polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains

    Directory of Open Access Journals (Sweden)

    Patrícia Carvalho de Sequeira


    Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

  13. Determining Annealing Temperatures for Polymerase Chain Reaction (United States)

    Porta, Angela R.; Enners, Edward


    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  14. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    International Nuclear Information System (INIS)

    We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min. (paper)

  15. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo


    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  16. Comparison of detection platforms and post-polymerase chain reaction DNA purification methods for use in conjunction with Cleavase fragment length polymorphism analysis. (United States)

    Sander, T; Olson, S; Hall, J; Siebert, M; Grooms, K; Heisler, L; de Arruda, M; Neri, B


    The removal of impurities and contaminants from PCR-amplified fragments is important for mutation detection methods which identify mutations based on shifts in electrophoretic mobility. This is particularly critical for assays and detection methods which use target DNA that is labeled prior to analysis and electrophoretic detection. We examined several procedures for purifying DNA amplified by the polymerase chain reaction (PCR) and their use in conjunction with a novel DNA scanning method, the Cleavase fragment length polymorphism (CFLP)* assay. In this study, a 480 bp DNA fragment, fluorescently labeled on the 5'-end of one strand, was amplified and subjected to various widely used purification procedures, including several commercially available clean-up kits. We demonstrate that visualization of the fluorescent label, as opposed to simple ethidium bromide staining, reveals the presence of considerable levels of labeled, truncated, amplification products. The various procedures were evaluated on the basis of their ability to remove these unwanted DNA fragments as well as on the degree to which they inhibited or promoted the CFLP reaction. Several procedures are recommended for use with CFLP analysis, including isopropanol precipitation, gel excision, and several commercially available spin columns. Concurrently, we evaluated (compared) a number of commonly used visualization platforms, including fluorescence imaging, chemiluminescence, and post-electrophoretic staining, for the ability to detect CFLP pattern changes. The advantages and disadvantages of different methods are discussed and amounts of DNA to be used for CFLP analysis on different detection platforms are recommended. PMID:10380752

  17. A facile "turn-on" fluorescent method with high sensitivity for Hg(2+) detection using magnetic Fe3O4 nanoparticles and hybridization chain reactions. (United States)

    Lv, Xiaoxiao; Wu, Wenchen; Niu, Chenggang; Huang, Dawei; Wang, Xiaoyu; Zhang, Xuegang


    In this manuscript, the authors molecularly engineered a hybridization chain reactions (HCRs) based probe on magnetic Fe3O4 nanoparticles for the sensitive detection of Hg(2+). The sensing system comprised three probes: capture probe H1, report probe H2, and report probe H3. The capture probe was modified on the surface of magnetic Fe3O4 nanoparticles. The report probes were labeled with fluorescein isothiocyanate (FITC). Without Hg(2+), the report probes were stable as molecular beacons in solution. In the presence of Hg(2+), the T-rich capture probes and report probes will hybridize into double-helical DNA domains with the aid of T-Hg(2+)-T coordination chemistry. Trigged by this reaction, more molecular beacons open and form a super tandem structure. Herein, the fluorescence signal was magnified by capturing more report probes. Separating the target and captured report probes from reaction solution was benefit to decrease the background signal and interference from other metal ions. The detection limit of this method was about 0.36nM, which is much lower than the regulations of World Health Organization and U.S. Environmental Protection Agency on Hg(2+) in drink water. This proposed sensing strategy also showed favorable selectivity over other common metal ions. In addition, it has good practicability in real water samples. PMID:26946010

  18. Molecular diagnosis of strongyloidiasis in tropical areas: a comparison of conventional and real-time polymerase chain reaction with parasitological methods

    Directory of Open Access Journals (Sweden)

    Fabiana Martins de Paula


    Full Text Available This study aimed to evaluate the use of conventional polymerase chain reaction (cPCR and real-time quantitative PCR (qPCR in the diagnosis of human strongyloidiasis from stool samples in tropical areas. Stool samples were collected from individuals and were determined to be positive for Strongyloides stercoralis (group I, negative for S. stercoralis (group II and positive for other enteroparasite species (group III. DNA specific to S. stercoralis was found in 76.7% of group I samples by cPCR and in 90% of group I samples by qPCR. The results show that molecular methods can be used as alternative tools for detecting S. stercoralis in human stool samples in tropical areas.

  19. Quantification of Staphylococcus aureus and Staphylococcus epidermidis on the hands of health-care workers using a real-time polymerase chain reaction method

    DEFF Research Database (Denmark)

    Horn, P; Schouenborg, P Øland; Brandslund, I


    OBJECTIVE: The objective of this study was to test a polymerase chain reaction (PCR) assay intended as a tool for monitoring hand hygiene in hospital wards. METHODS: The hands of 20 health-care workers were sampled for 10 days using real-time PCR for quantification of Staphylococcus aureus and S....... aureus and 211% for S. epidermidis. In an intervention study aimed at better hand hygiene in a ward with n participants, the difference before and after intervention is significant at CDI/sqrt[n] per cent. CONCLUSIONS: The PCR assay can be used to detect change in a group mean of S. aureus and S....... epidermidis in a hospital ward, i.e. before and after an intervention to improve hand hygiene. For the individual, the change in bacteria levels needed for significance is compromised by high intra-individual variation....

  20. Target-selective joint polymerase chain reaction: A robust and rapid method for high-throughput production of recombinant monoclonal antibodies from single cells

    Directory of Open Access Journals (Sweden)

    Isobe Masaharu


    Full Text Available Abstract Background During the development of a therapeutic antibody, large numbers of monoclonal antibodies are required to screen for those that are best suited for the desired activity. Although the single cell-based immunoglobulin variable gene cloning technique is a powerful tool, the current methods remain an obstacle to the rapid production of large numbers of recombinant antibodies. Results We have developed a novel overlap extension polymerase chain reaction, the target-selective joint polymerase chain reaction (TS-jPCR, and applied it to the generation of linear immunoglobulin gene expression constructs. TS-jPCR is conducted using a PCR-amplified immunoglobulin variable gene and an immunoglobulin gene-selective cassette (Ig-cassette that contains all essential elements for antibody expression and overlapping areas of immunoglobulin gene-specific homology. The TS-jPCR technique is simple and specific; the 3'-random nucleotide-tailed immunoglobulin variable gene fragment and the Ig-cassette are assembled into a linear immunoglobulin expression construct, even in the presence of nonspecifically amplified DNA. We also developed a robotic magnetic beads handling instrument for single cell-based cDNA synthesis to amplify immunoglobulin variable genes by rapid amplification of 5' cDNA ends PCR. Using these methods, we were able to produce recombinant monoclonal antibodies from large numbers of single plasma cells within four days. Conclusion Our system reduces the burden of antibody discovery and engineering by rapidly producing large numbers of recombinant monoclonal antibodies in a short period of time.

  1. Detection of Listeria monocytogenes by using the polymerase chain reaction

    International Nuclear Information System (INIS)

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  2. A combined enrichment/polymerase chain reaction based method for the routine screening of Streptococcus agalactiae in pregnant women

    Directory of Open Access Journals (Sweden)

    F.M. Munari


    Full Text Available Group B Streptococcus (GBS is the most common cause of life-threatening infection in neonates. Guidelines from CDC recommend universal screening of pregnant women for rectovaginal GBS colonization. The objective of this study was to compare the performance of a combined enrichment/PCR based method targeting the atr gene in relation to culture using enrichment with selective broth medium (standard method to identify the presence of GBS in pregnant women. Rectovaginal GBS samples from women at ≥36 weeks of pregnancy were obtained with a swab and analyzed by the two methods. A total of 89 samples were evaluated. The prevalence of positive results for GBS detection was considerable higher when assessed by the combined enrichment/PCR method than with the standard method (35.9% versus 22.5%, respectively. The results demonstrated that the use of selective enrichment broth followed by PCR targeting the atr gene is a highly sensitive, specific and accurate test for GBS screening in pregnant women, allowing the detection of the bacteria even in lightly colonized patients. This PCR methodology may provide a useful diagnostic tool for GBS detection and contributes for a more accurate and effective intrapartum antibiotic and lower newborn mortality and morbidity.

  3. Comparison of Four Polymerase Chain Reaction Methods for the Rapid Detection of Human Fecal Pollution in Marine and Inland Waters

    Directory of Open Access Journals (Sweden)

    Dave S. Bachoon


    Full Text Available We compared the effectiveness of three PCR protocols for the detection of Bifidobacterium adolescentis and one PCR protocol for detecting Bacteroidales as indicators of human fecal pollution in environmental samples. Quantitative PCR indicated that a higher concentration of B. adolescentis DNA was recovered from sewage samples on the 0.2 μm filters compared to the 0.45 μm filters, and there was no evidence of qPCR inhibitors in the DNA extracts. With the Matsuki method (1999, B. adolescentis was detected only in undiluted sewage samples. The King method (2007 performed well and detected B. adolescentis in all of the sewage dilutions (from undiluted to 10−4. In contrast, the Bonjoch approach (2004 was effective at detecting B. adolescentis at lower dilutions (10−3 of sewage samples and it gave false positive results with some (3/8 pig fecal samples. Human-specific Bacteroidales (HuBacs were detected in the lower diluents of sewage samples but was positive in pig (6/8 and cattle fecal samples. PCR detection of B. adolescentis in marine samples from Puerto Rico and freshwater samples from Georgia indicated that the PCR method of King et al. (2007 and the modified Layton method for HuBac were in agreement in detecting human fecal pollution in most sites.

  4. Comparison of Four Polymerase Chain Reaction Methods for the Rapid Detection of Human Fecal Pollution in Marine and Inland Waters


    Bachoon, Dave S.; Cortney M. Miller; Green, Christen P.; Ernesto Otero


    We compared the effectiveness of three PCR protocols for the detection of Bifidobacterium adolescentis and one PCR protocol for detecting Bacteroidales as indicators of human fecal pollution in environmental samples. Quantitative PCR indicated that a higher concentration of B. adolescentis DNA was recovered from sewage samples on the 0.2 μm filters compared to the 0.45 μm filters, and there was no evidence of qPCR inhibitors in the DNA extracts. With the Matsuki method (1999), ...

  5. Transformational leadership: a cascading chain reaction. (United States)

    Murphy, Lorraine


    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  6. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections



    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  7. Application of culture and polymerase chain reaction (PCR methods for isolation and identification ofMycoplasma synoviae on broiler chicken farms

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.


    Full Text Available Mycoplasma synoviae (M. synoviae is a major worldwide poultry pathogen that causes serious economiclosses in the poultry industry. This study was designed to detect M. synoviae through culture isolation andpolymerase chain reaction (PCR assay to demonstrated the involvement of M. synoviae infection in tracheaand the lung/air sac samples taken from commercial broiler chicken farms in 3 main provinces of Iran(Tehran, Markazi and Qazvin, with clinical signs of the disease. Total of 43 samples were cultured inPPLO broth media supplemented for M. synoviae isolation. The bacteria DNAs were extracted byphenol/chloroform method and the PCR assay amplifying the conserved region of 16S rRNA gene wasapplied for the detection of Mycoplasma genus in 163bp fragment and M. synoviae in 207bp fragment fromculture as same as in clinical samples. Of the 43 swabs 28(65.1% yielded one of the potentially pathogenicmycoplasmas evaluated for using PPLO agar culture diagnostic method, and 33(76.8% yielded one of thepotentially pathogenic Mycoplasmas evaluated for using Mycoplasma genus PCR as diagnostic method, and24(55.9% of the swabs yielded M. synoviae for using M. synoviae PCR as diagnostic method. In this studywe had observed the highest quantity of M. synoviae infections in broiler chicken with PCR test. In conclusion, PCR is a more rapid, effective, sensitive and inexpensive method than the standard culture technique, that could be used as an alternative method for traditional culture and showed the real number of the M. synoviae contaminated broiler chicken farms.

  8. Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

    International Nuclear Information System (INIS)

    Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

  9. The stress kit: A new method based on competitive reverse transcriptase-polymerase chain reaction to quantify the expression of human αB-crystallin, Hsp27, and Hsp60

    NARCIS (Netherlands)

    Bajramović, J.J.; Geutskens, S.B.; Bsibsi, M.; Boot, M.; Hassankhan, R.; Verhulst, K.C.; Noort, J.M. van


    We describe a reverse transcriptase-polymerase chain reaction method for the semiquantitative detection of mRNAs encoding the human heat shock proteins αβ-crystallin, Hsp27, and Hsp60. The method involves the coamplification of cellular mRNA-derived cDNA with a dilution series of a competitor fragme

  10. Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127. (United States)

    Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao


    For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products. PMID:22087473

  11. Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation. (United States)

    Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing


    In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. PMID:26853743

  12. Giardia duodenalis in Damascus, Syria: Identification of Giardia genotypes in a sample of human fecal isolates using polymerase chain reaction and restriction fragment length polymorphism analyzing method. (United States)

    Skhal, Dania; Aboualchamat, Ghalia; Al Nahhas, Samar


    Giardia duodenalis is a common gastrointestinal parasite that infects humans and many other mammals. It is most prevalent in many developing and industrialized countries. G. duodenalis is considered to be a complex species. While no morphological distinction among different assemblages exist, it can be genetically differentiated into eight major assemblages: A to H. The aim of this study was to determine the genetic heterogeneity of G. duodenalis in human isolates (a study conducted for the first time in Syria). 40 fecal samples were collected from three different hospitals during the hot summer season of 2014. Extraction of genomic DNA from all Giardia positive samples (based on a microscopic examination) was performed using QIAamp DNA Stool Mini Kit. β-giardin gene was used to differentiate between different Giardia assemblages. The 514 bp fragment was amplified using the Polymerase Chain Reaction method, followed by digestion in HaeIII restriction enzyme. Our result showed that genotype A was more frequent than genotype B, 27/40 (67.5%); 4/40 (10%) respectively. A mixed genotype of A+B was only detected in 9 isolates (22.5%). This is the first molecular study performed on G. duodenalis isolates in Syria in order to discriminate among the different genotypes. Further expanded studies using more genes are needed to detect and identify the Giardia parasite at the level of assemblage and sub-assemblage. PMID:26524628

  13. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  14. Application of real time polymerase chain reaction targeting kex 1 gene & its comparison with the conventional methods for rapid detection of Pneumocystis jirovecii in clinical specimens


    Mani Revathy; Kulandai Lily Therese; Radhakishnan Bagyalakshmi; Chokaliingam Chandrasekar; Suria Kumar; Madhavan, Hajib N.


    Background & objectives: As there are no standard laboratory techniques for the rapid detection of Pneumocystis jirovecii in India, this study was undertaken to evaluate and establish an optimal and rapid technique for the detection of P. jirovecii by comparing three different techniques - staining technique, application of a real time polymerase chain reaction (RT-PCR) targeting kex 1 gene and application of nested PCR targeting mitochondrial large subunit (mtLSU) gene for rapid detection of...

  15. 仅采用 PCR 进行分子克隆的方法探索%An efficient method of molecular cloning only by polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    薛奋勤; 许晴; 魏华; 李华; 薛冰


    Objective Due to the high cost in both time and money in gene cloning, a simple molecular cloning method based on polymerase chain reaction(PCR) is presented. Methods The vector and insert are amplified by PCR separately. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli DH5 cells to obtain the desired clones. Results Here we report a highly simplified,reliable and efficient PCR-based cloning technique to subclone total α-synuclein gene(cDNA) from vector pET into vector pGEX-4T-1, and place total nAChRβ2 gene from vector pCDNA3. 1 into vector pGEMHE. Conclusion This technique has many advantages over other cloning methods. First, we can insert any interested DNA sequences into a vector anywhere by primer designation, and it does not need to consider the restriction of multiple cloning site. Second, there is no need for any specialized enzyme digestion, gel purification of PCR product and linearized vector and enzyme ligation.%目的:针对目前各种费时且易失败的克隆方法和价格昂贵的试剂盒等问题,对一种仅采用聚合酶链反应(polymerase chain reaction,PCR)分子克隆方法进行了探索。方法利用高保真的 DNA 聚合酶具有3'-核酸外切酶活性的特点,采用 PCR 把载体和插入片段扩增出来,二者的扩增产物先加限制性内切酶 DpnI 后再按一定比例混合来消化甲基化的 DNA 模板,最后把DpnI 消化产物直接转化到感受态细胞来得到克隆基因。结果是一种简单、高效、可靠、且仅采用 PCR 的分子克隆方法,并利用此方法成功地把构建在载体 pET 上的α-突触核蛋白全长基因和构建在 pCDNA3.1上的乙酰胆碱受体亚基的全长基因分别重新构建在载体 pGEX-4T-1和 pGEMHE 上。结论在 PCR 扩增时能够通过引物设计来确定克隆位点,所以该方法可以把任何 DNA片段插入到

  16. Detection of Polymorphism at the Insulin Like Growth Factor-I Gene in Mazandaran Native Chicken using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Method

    Directory of Open Access Journals (Sweden)

    Hossein A. Abbasi


    Full Text Available Problem statement: Molecular genetics selection on individual genes is a promising method to genetically improve economically important traits in chickens. The Insulin like Growth Factor-I (IGF1 gene may play important roles in growth of multiple tissues, including muscle cells, cartilage and bone. Approach: In the present study polymorphism of the promoter and 5' untranslated region of IGF-1 gene of Mazandaran native fowls was investigated. In order to evaluate the IGF-1 gene polymorphism we have used a Restriction Fragment Length Polymorphism (RFLP method. Blood samples were collected from randomly chosen 100 Mazandaran native fowls. Genomic DNA was extracted using modified salting-out method and used amplified polymerase chain reaction technique. The promoter and 5' untranslated region of the fowl IGF-1 gene was amplified to produce a 621 bp fragment. The PCR products were electrophoresed on 2.5% agarose gel and stained by etidium bromide. Results: Then, they were digested of amplicon with PstI and revealed two alleles A and B. Data were analyzed using Pop Gene 32 package. In this population, AA, AB, BB genotype have been identified with the 25.88, 50.23, 23.89% frequencies. A and B alleles frequencies were 0.51, 0.49, respectively. The Chi-square (÷2 test was significant and the population was in Hardy-Weinberg equilibrium (pConclusion: The PCR technique amplified a DNA fragment of IGF-1 with 621 bp. The results of the RFLP analysis showed two fragment 257 and 354bp after restriction with enzyme with PstI that identify changes in 5' untranslated region. In according to action modes and importance of IGF-1, its polymorphisms can be related to economical traits such as body weight, muscle cells and bone.

  17. Association of diverse bacterial communities in human bile samples with biliary tract disorders: a survey using culture and polymerase chain reaction-denaturing gradient gel electrophoresis methods. (United States)

    Tajeddin, E; Sherafat, S J; Majidi, M R S; Alebouyeh, M; Alizadeh, A H M; Zali, M R


    Bacterial infection is considered a predisposing factor for disorders of the biliary tract. This study aimed to determine the diversity of bacterial communities in bile samples and their involvement in the occurrence of biliary tract diseases. A total of 102 bile samples were collected during endoscopic retrograde cholangiopancreatography (ERCP). Characterization of bacteria was done using culture and polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) methods. Antimicrobial susceptibility of the isolates was determined based on the Clinical and Laboratory Standards Institute (CLSI) guidelines and identity of the nucleotide sequences of differentiated bands from the DGGE gels was determined based on GenBank data. In total, 41.2 % (42/102) of the patients showed bacterial infection in their bile samples. This infection was detected in 21 % (4/19), 45.4 % (5/11), 53.5 % (15/28), and 54.5 % (24/44) of patients with common bile duct stone, microlithiasis, malignancy, and gallbladder stone, respectively. Escherichia coli showed a significant association with gallstones. Polymicrobial infection was detected in 48 % of the patients. While results of the culture method established coexistence of biofilm-forming bacteria (Pseudomonas aeruginosa, E. coli, Klebsiella pneumoniae, Enterococcus spp., and Acinetobacter spp.) in different combinations, the presence of Capnocytophaga spp., Lactococcus spp., Bacillus spp., Staphylococcus haemolyticus, Enterobacter or Citrobacter spp., Morganella spp., Salmonella spp., and Helicobacter pylori was also characterized in these samples by the PCR-DGGE method. Multidrug resistance phenotypes (87.5 %) and resistance to third- and fourth-generation cephalosporins and quinolones were common in these strains, which could evolve through their selection by bile components. Ability for biofilm formation seems to be a need for polymicrobial infection in this organ. PMID:27193890

  18. Comparison of disc and MIC reduction methods with polymerase chain reaction for the detection of metallo-β-lactamase in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    S Buchunde


    Full Text Available Purpose: The present study was undertaken to evaluate the screening antibiotic, confirmatory phenotypic test and agent against PCR as gold standard and to detect the prevalent MBL gene. Materials and Methods: Three hundred and twenty-six Pseudomonas aeruginosa isolates were screened for resistance to Imipenem (IPM, Meropemem (MEM and Ceftazidime (CAZ by disc diffusion. Isolates resistant to any of these were considered screen test-positive for MBL and were subjected to Double disc synergy test (DDST and Disc potentiation test (DPT: Using IPM, MEM and CAZ alone and with EDTA, Minimum inhibitory concentration (MIC reduction [four-fold or more reduction in MIC of IPM and MEM in presence of chelators: EDTA and 1,10-phenanthroline (EPI/EPM: EDTA-phenanthroline- Imipenem/Meropenem Broth Microdilution method] and polymerase chain reaction (PCR for blaIMP and blaVIM . Results: Screen test-positives by MEM and CAZ were 19.3% as against 17.8% by IPM. MEMDDST, DPT and EPM confirmed 100% screen-test positives as against 93.7% by CAZ DDST and DPT-2, 76.2% by CAZ DPT-1, 88.9% by IPM DDST, 85.7% by IPM DPT-1 and 92.1% by EPI. IPMand CAZ DDST together confirmed 100% while IPM and CAZ DPT-2 confirmed 96.8%. All 63 screen-test positives showed the presence of blaVIM . Conclusions: MEM was found to be the best screening and confirmatory agent for MBL detection and blaVIM was found to be the prevalent MBL gene in this part of the country.

  19. Comparative Analysis of Real-Time Polymerase Chain Reaction Methods to Typing HLA-B*57:01 in HIV-1-Positive Patients. (United States)

    Falasca, Francesca; Dello Russo, Cinzia; Mora, Barbara; Pirazzoli, Antonella; Fantauzzi, Alessandra; Navarra, Pierluigi; Pizzuti, Antonio; De Vito, Corrado; Antonelli, Guido; Turriziani, Ombretta


    The HLA-B*57:01 allele is strongly associated with the hypersensitivity reaction to Abacavir (ABC). Therefore, treatment guidelines recommend that patients initiating ABC are preventively tested for the presence of this allele. To date, four different commercial assays based on the real-time quantitative polymerase chain reaction (Q-PCR) technique are available for the detection of HLA-B*57:01: Duplicα-RealTime Reagent Set HLA-B*57:01 by Euroclone, HLA-B*57:01 Real-TM by Sacace Biotechnologies, COBAS AmpliPrep/COBAS TaqMan HLA-B*57:01 Screening Test by Roche Diagnostic, and HLA-B*57:01 by Nuclear Laser Medicine. The study was carried out to compare the performance of the first three commercially available Q-PCR kits in a routine clinical setting. A total of 98 samples from Policlinico Umberto I Hospital were tested. Results obtained by the Duplicα-RealTime Genotyping kit and AmpliPrep/TaqMan system were 100% concordant. In contrast, genotyping by the HLA-B*57:01 Real-TM kit showed poor agreement with the other systems, that is, 12 out of 33 positive samples were detected as HLA-B*57:01 negative. To confirm the correct genotype of these discordant samples, two additional methods with rapid turnaround times and already implemented into routine clinical practice were used, that is, a PCR-based microsequence-specific primer DNA typing test and a laboratory-developed screening test in Q-PCR. All 12 discordant samples were genotyped as HLA-B*57:01-positive samples using these two additional methods in a single-blinded manner, thus confirming the low sensitivity of HLA-B*57:01 Real-TM test. These findings underline the need to compare results obtained with commercial assays before choosing a test suitable for use in a routine clinical laboratory. PMID:26750774

  20. Application of real time polymerase chain reaction targeting kex 1 gene & its comparison with the conventional methods for rapid detection of Pneumocystis jirovecii in clinical specimens

    Directory of Open Access Journals (Sweden)

    Mani Revathy


    Full Text Available Background & objectives: As there are no standard laboratory techniques for the rapid detection of Pneumocystis jirovecii in India, this study was undertaken to evaluate and establish an optimal and rapid technique for the detection of P. jirovecii by comparing three different techniques - staining technique, application of a real time polymerase chain reaction (RT-PCR targeting kex 1 gene and application of nested PCR targeting mitochondrial large subunit (mtLSU gene for rapid detection of P. jirovecii in HIV positive patients. Methods: One hundred and fifty sputum specimens from HIV positive (n = 75 and HIV negative (n = 75 patients were subjected to three different techniques -KOH/Calcoflour and Grocott methanamine silver staining (GMS, RT-PCR targeting kex1 gene, PCR targeting mtLSU region followed by DNA sequencing and BLAST analysis. Results: Among the 75 HIV positive patients, P. jirovecii was detected in 19 (25.33% patients by the staining techniques, and in 23 (30.65% patients each by PCR targeting mtLSU region and by RT- PCR targeting kex1 gene of P. jirovecii. PCR based DNA sequencing targeting mtLSU region revealed 97-100 per cent sequence homology with P. jirovecii sequences in GenBank. Interpretation & conclusions: Of the three techniques for detection of P. jirovecii evaluated in this study, false negativity was found to be more in staining technique and it also required high technical expertise to interpret the result. Both nested PCR and RT-PCR were reliable and equally sensitive, in rapid detection of P. jirovecii, but RT-PCR technique also generated the copy numbers for knowing the severity of infection.

  1. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani


    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  2. Hepatitis C prevalence and risk factors in hemodialysis patients in Central Brazil: a survey by polymerase chain reaction and serological methods

    Directory of Open Access Journals (Sweden)

    Carneiro Megmar AS


    Full Text Available An hemodialysis population in Central Brazil was screened by polymerase chain reaction (PCR and serological methods to assess the prevalence of hepatitis C virus (HCV infection and to investigate associated risk factors. All hemodialysis patients (n=428 were interviewed in eight dialysis units in Goiânia city. Blood samples were collected and serum samples screened for anti-HCV antibodies by an enzyme-linked immunosorbent assay (ELISA. Positive samples were retested for confirmation with a line immunoassay (LIA. All samples were also tested for HCV RNA by the PCR. An overall prevalence of 46.7% (CI 95%: 42-51.5 was found, ranging from 20.7% (CI 95%: 8.8-38.1 to 90.4% (CI 95%: 79.9-96.4 depending on the dialysis unit. Of the 428 patients, 185 were found to be seropositive by ELISA, and 167 were confirmed positive by LIA, resulting in an anti-HCV prevalence of 39%. A total of 131 patients were HCV RNA-positive. HCV viremia was present in 63.5% of the anti-HCV-positive patients and in 10.3% of the anti-HCV-negative patients. Univariate analysis of risk factors showed that the number of previous blood transfusions, transfusion of blood before mandatory screening for anti-HCV, length of time on hemodialysis, and treatment in multiple units were associated with HCV positivity. However, multivariate analysis revealed that blood transfusion before screening for anti-HCV and length of time on hemodialysis were significantly associated with HCV infection in this population. These data suggest that nosocomial transmission may play a role in the spread of HCV in the dialysis units studied. In addition to anti-HCV screening, HCV RNA detection is necessary for the diagnosis of HCV infection in hemodialysis patients.

  3. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维


    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  4. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte;


    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... commercial kits used in the ring trial could identify all different PRRSV strains with an optimal analytical and diagnostic sensitivity. The genetic variability of the PRRSV strains, which is supposed to hinder the diagnostic of the RT-PCR because of mutations at the primer binding sites, was also confirmed...

  5. Robust quantification of polymerase chain reactions using global fitting.

    Directory of Open Access Journals (Sweden)

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  6. Radioinitiation of Chain Branched Reactions and its Sensitization

    International Nuclear Information System (INIS)

    This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author)

  7. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  8. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    Energy Technology Data Exchange (ETDEWEB)

    Liu Jinfeng [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail:; Shen Xingyan [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Zhu Debin [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)


    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency.

  9. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle


    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  10. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M


    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  11. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy


    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  12. Detection of Francisella tularensis in blood by polymerase chain reaction.


    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.


    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.

  13. A chain reaction approach to modelling gene pathways. (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen


    applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the

  14. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction. (United States)

    Uphoff, Cord C; Drexler, Hans G


    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  15. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.



    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  16. Polymerase chain reaction: A molecular diagnostic tool in periodontology (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  17. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang


    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  18. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed


    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  19. Polymerase chain reaction: A molecular diagnostic tool in periodontology. (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  20. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Directory of Open Access Journals (Sweden)

    Rajendran Maheaswari


    Full Text Available This review discusses the principles of polymerase chain reaction (PCR and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  1. Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney. (United States)

    Chase, D M; Pascho, R J


    Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. Development of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively. PMID:9925428

  2. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe


    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  3. Supply chain management tools and methods


    IVANOVA, Ivelina


    In today's business environment, manufacturers need to manage their enterprises as an inseparable part of a supply chain. Key to achieving this is the creation of an extended and integrated information system. In an attempt to find out what needs to be done to improve current supply chain methods and tools, the current research project 1) reviewed the literature to establish current approaches to Supply Chain Management (SCM); 2) identified what tools and methods are availab...

  4. The generalised self-sustaining chain reaction theory about ADS

    International Nuclear Information System (INIS)

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  5. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna


    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  6. Characteristics of a chain thermal explosion as a function of the kinetic properties of reaction chains (United States)

    Azatyan, V. V.; Piloyan, A. A.; Saikova, G. R.; Smirnov, N. N.


    Study of the combustion and explosion of hydrogen‒carbon oxide‒air mixtures shows that the sharpness of a chain thermal explosion depends on the frequency of branching in a given branch of a reaction chain. It is established that varying the CO: H2 concentration allows us to observe and eliminate the degeneration of an explosion while maintaining the regimes of ignition and deflagration.

  7. Spectral methods for quantum Markov chains

    International Nuclear Information System (INIS)

    The aim of this project is to contribute to our understanding of quantum time evolutions, whereby we focus on quantum Markov chains. The latter constitute a natural generalization of the ubiquitous concept of a classical Markov chain to describe evolutions of quantum mechanical systems. We contribute to the theory of such processes by introducing novel methods that allow us to relate the eigenvalue spectrum of the transition map to convergence as well as stability properties of the Markov chain.

  8. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi


    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  9. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study


    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana


    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  10. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes


    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  11. The chain gas phase reactions. The present problems

    International Nuclear Information System (INIS)

    The results of investigations of chain gas phase reactions which are directed for solving practically important problems have been carried out. The problem of increasing methanol formation selectivity in the direct natural gas oxidation process is discussed. The peculiarities of cool flame of cyclic hydrocarbons, particularly cyclohexane which are containing in the different kinds of fuel. The influence of cool flame on intensity and full consumption of fuels burning is examined. Conjugated processes of SO2 conversion to SO3 and sulfur under effect of hydrocarbon and hydrogen oxidation chain gas phase reactions are considered. The results of discussed investigations can be served as a basis for the developing of industrial processes for conversion natural hydrocarbon row materials and also the ecological problems of utilization of SO2 gas ejected from thermoelectric power stations and metallurgical plants

  12. Identifying of meat species using polymerase chain reaction (PCR) (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  13. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  14. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  15. Polymerase chain reaction: A molecular diagnostic tool in periodontology


    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology w...

  16. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.


    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S


    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  17. Reaction chain modeling of denitrification reactions during a push-pull test (United States)

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.


    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  18. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    International Nuclear Information System (INIS)

    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

  19. Convective polymerase chain reaction around micro immersion heater (United States)

    Hennig, Martin; Braun, Dieter


    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  20. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence. (United States)

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing


    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates. PMID:19860467

  1. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease. (United States)

    Khalil, S H; Siegrist, K; Akhtar, M


    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  2. Polyvinylpyrrolidone-Agarose Gel Electrophoresis Purification of Polymerase Chain Reaction-Amplifiable DNA from Soils


    Young, Charles C.; Burghoff, Robert L.; Keim, Lois G.; Minak-Bernero, Vera; Lute, James R.; Hinton, Stephen M.


    This communication describes a modification of agarose gel electrophoresis to provide a rapid and simple method for the purification of polymerase chain reaction-amplifiable DNA from soil. This modification is to add polyvinylpyrrolidone to the agarose gel. The polyvinylpyrrolidone addition retards the electrophoretic mobility of denaturing phenolic compounds so that they do not comigrate with nucleic acids.

  3. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    International Nuclear Information System (INIS)

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  4. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique


    İLHAK, O. İrfan; Arslan, Ali


    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  5. Identification of Erwinia stewartii by a ligase chain reaction assay.


    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A


    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...


    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏


    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  7. Numerical methods in Markov chain modeling (United States)

    Philippe, Bernard; Saad, Youcef; Stewart, William J.


    Several methods for computing stationary probability distributions of Markov chains are described and compared. The main linear algebra problem consists of computing an eigenvector of a sparse, usually nonsymmetric, matrix associated with a known eigenvalue. It can also be cast as a problem of solving a homogeneous singular linear system. Several methods based on combinations of Krylov subspace techniques are presented. The performance of these methods on some realistic problems are compared.

  8. Method for preparation of single chain antibodies (United States)

    Cheung, Nai-Kong V.; Guo, Hong-fen


    This invention provides a method for identifying cells expressing a target single chain antibody (scFv) directed against a target antigen from a collection of cells that includes cells that do not express the target scFv, comprising the step of combining the collection of cells with an anti-idiotype directed to an antibody specific for the target antigen and detecting interaction, if any, of the anti-idiotype with the cells, wherein the occurrence of an interaction identifies the cell as one which expresses the target scFv. This invention also provides a method for making a single chain antibody (scFv) directed against an antigen, wherein the selection of clones is made based upon interaction of those clones with an appropriate anti-idiotype, and heretofore inaccessible scFv so made. This invention provides the above methods or any combination thereof. Finally, this invention provides various uses of these methods.

  9. Uji Diagnostik Polymerase Chain Reaction –Restriction Fragment Length Polymorphism Dalam Menegakkan Diagnosis Onikomikosis.


    Lubis, Nova Zairina


    Background: Onychomycosis is a fungal infection of one or more units of the nail caused by dermatophytes, or mold and nondermatophytes yeast. Investigations are needed to establish the diagnosis of onychomycosis before starting treatment. Several investigations methods for diagnosing onychomycosis such as microscopic examination with 20% KOH, fungal culture, histopathology examination with PAS staining (Periodic acid Schiff) and PCR (Polymerase Chain Reaction), for culture methods require a l...

  10. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction


    Harmey, Judith H.; Harmey, Matthew A.


    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  11. Detection of Durum Wheat Pasta Adulteration in the Jordanian Market by Polymerase Chain Reaction Technology


    H. Al-Rousan; N.D. Al-Hmoud; Ibrahim, M. A.; B.O. Hayek


    Taking into account the impact of monitoring food adulteration on the quality of food products, the aim of this study was to use polymerase chain reaction technology to detect possible adulteration of durum wheat pasta products in the Jordanian market. Cetyltrimethyl ammonium bromide method was applied for extracting genomic DNA from twenty six randomly collected pasta products, the results suggested the suitability of this method for DNA extraction from pasta products. Specific primers were ...

  12. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou


    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  13. Early detection of typhoid by polymerase chain reaction

    International Nuclear Information System (INIS)

    Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

  14. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes

    International Nuclear Information System (INIS)

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement. (paper)

  15. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed


    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  16. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard;


    . However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

  17. Chemical reaction and separation method

    NARCIS (Netherlands)

    Jansen, J.C.; Kapteijn, F.; Strous, S.A.


    The invention is directed to process for performing a chemical reaction in a reaction mixture, which reaction produces water as by-product, wherein the reaction mixture is in contact with a hydroxy sodalite membrane, through which water produced during the reaction is removed from the reaction mixtu

  18. Controlling Hybridization Chain Reactions with pH. (United States)

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco


    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  19. Circulating polymerase chain reaction chips utilizing multiple-membrane activation (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin


    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  20. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction. (United States)

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S


    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  1. Comparison of a conventional polymerase chain reaction with real-time polymerase chain reaction for the detection of neurotropic viruses in cerebrospinal fluid samples


    M Ramamurthy; Alexander, M; Aaron, S; Kannangai, R.; Ravi, V.; Sridharan, G.; A.M. Abraham


    Purpose : To compare a conventional polymerase chain reaction (PCR) and real-time PCR for the detection of neurotropic DNA viruses. Materials and Methods : A total of 147 cerebrospinal fluid (CSF) samples was collected from patients attending a tertiary care hospital in South India for a period from 2005 to 2008. All these samples were tested using a conventional multiplex/uniplex PCR and a real-time multiplex/uniplex PCR. This technique was used to detect a large number of herpes viruses res...

  2. Optimization of asymmetric polymerase chain reaction for rapid fluorescent DNA sequencing. (United States)

    Wilson, R K; Chen, C; Hood, L


    A high-throughput method for the preparation of single-stranded template DNA, which is suitable for sequence analysis using fluorescent labeling chemistry, is described here. In this procedure, the asymmetric polymerase chain reaction is employed to amplify recombinant plasmid or bacteriophage DNA directly from colonies or plaques. The use of amplification primers located at least 200 base pairs 5' to the site of sequencing primer annealing removes the need for extensive purification of the asymmetric polymerase chain reaction product. Instead, the single-stranded product DNA is purified by a simple isopropanol precipitation step and then directly sequenced using fluorescent dye-labeled oligonucleotides. This method significantly reduces the time and labor required for template preparation and improves fluorescent DNA sequencing strategies by providing a much more uniform yield of single-stranded DNA. PMID:2317375

  3. DNA amplification by polymerase chain reaction from brain tissues embedded in paraffin.


    Gall, K; Pavelić, J.; Jadro-Santel, D.; Poljak, M; Pavelić, K.


    A method which enables analysis of DNA from archival paraffin embedded normal and malignant brain tissue is described. The demonstration of a 317-bp long beta-actin DNA sequence by the polymerase chain reaction (PCR) was used to identify which fixation procedure, deparaffinization time and DNA extraction procedure would give the best results. Tissue specimens 1-39 years old were included in the experiments. Specimens fixed in either 10% formalin, Carnoy's or AMeX fixative were found to be bes...

  4. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J


    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  5. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis


    Padmavathy L; Rao L; Veliath A


    Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR) is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patien...

  6. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.


    Tzianabos, T; Anderson, B E; McDade, J E


    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinica...

  7. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  8. [Investigation of human papillomavirus prevalence in women in Eskişehir, Turkey by Pap smear, hybrid capture 2 test and consensus real-time polymerase chain reaction and typing with pyrosequencing method]. (United States)

    Aslan, Ferhat Gürkan; Us, Tercan; Kaşifoğlu, Nilgün; Özalp, Sabit Sinan; Akgün, Yurdanur; Öge, Tufan


    Human papillomavirus (HPV) infections have a broad range of clinical spectrum from subclinical or asymptomatic infection to anogenital carcinoma. The detection of HPV-DNA and determination of the risk groups in cervical cancer (CC) screening is very important because CC is considered to be a preventable illness which is the third most common cancer type of women in the world. The aims of this study were to investigate the presence of HPV-DNA in women by two different molecular methods and to compare their results together with the results of cytology, in Eskişehir, Central Anatolia, Turkey. A total of 1081 women aged between 30-65 years, who applied to Eskişehir Early Diagnosis, Screening and Training of Cancer Center (KETEM) for screening were included in the study. Three separate cervical samples were collected simultaneously from the participants for cytologic examination and molecular studies. In the first step of the study, all cervical samples were investigated for the presence of HPV-DNA by Hybrid Capture 2 (HC2; Qiagen, Germany) method. In the second part of the study, consensus real-time polymerase chain reaction (RT-PCR) (Takara Bio Inc., Japan) was performed in 152 samples which included HC2 positive and randomly selected negative samples, and then the HPV genotypes were detected by using a commercial kit based on pyrosequencing method (Diatech Pharmacogenetics S.R.L, Italy). In the first part of the study, HC2 test was found positive in 3% (32/1081) of the women, while in 4.4% (47/1081) Pap smear was positive alone or with HC2 test. Five (0.5%) samples yielded positive results with both of the methods, and four of them were positive for high risk HPV types. Cytology results were negative in 19 out of 23 (23/1081, 2.1%) samples that were reported as high risk HPV by HC2 test. On the other hand, 42 (42/1081, 3.9%) samples that were positive by cytology yielded negative results by HC2 test. In the second part of the study, 32 (21.1%) of 152 selected

  9. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng


    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  10. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E


    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  11. Detecting Down syndrome with a novel dual-color competitive quantitative fluorescent polymerase chain reaction method%双色竞争性荧光定量PCR检测唐氏综合征

    Institute of Scientific and Technical Information of China (English)

    吴苹; 李启杰; 夏增亮; 张发强; 岳琳琳; 陈清英; 王泓; 范春元; 夏庆杰


    Objective To develop a rapid method for the detection of Down syndrome (DS) using dual-color competitive quantitative fluorescent polymerase chain reaction(DCC-QF-PCR),and to assess its feasibility for the prenatal diagnosis of Down syndrome.Methods DNA was extracted from peripheral blood of 30 DS patients and 60 normal men,common primers for DSCR and USC2 genes and respective TaqMan probes were designed and synthesized.The results of DCC-QF-PCR were compared with those of QF-PCR which measured the ratio between DSCR and GAPDH. Forty-six amniotic fluid samples were assayed with DCC-QF-PCR.The results were compared with that of karyotyping.Monoclone fragments for DSCR and USC2 genes were obtained from direct cloning of PCR products.DCC-QF-PCR was carried out using different DNA ratios of DSCR and USC2 as the template.The dosage ratio between DSCR and USC2 was calculated.Results The gene dosage ratio of the DS patients was 1.41-1.74,which was significantly higher than that of normal men (0.93-1.15).The dosage ratio range of DSCR and GAPDH by QF-PCR was comparatively greater than that of DSCR and USC2.Three samples were diagnosed as DS,which was in good agreement with that of karyotyping analysis.There was no significant difference between the gene dosage ratio from DCC-QF-PCR and that of predetermined(P>0.05).Conclusion DCC-QF-PCR is an accurate,rapid,and low cost method,which only requires tiny amount of sample and therefore has broad application in the genetic and prenatal diagnosis.%目的 建立一种快速检测唐氏综合征(Down syndrome,DS)的双色竞争性荧光定量聚合酶链反应(dual-color competitive quantitative fluorescent polymerase chain reaction,DCC-QF-PCR)方法,并探讨其应用于DS产前诊断的可能性.方法 提取30例DS患者和60名正常人的外周血DNA,设计DSCR和USC2两基因的特异共用引物和双色特异性TaqMan探针,同一反应管中进行两基因的DCC-QF-PCR,并与DSCR和GAPDH两基因的QF-PCR

  12. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C2H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH3; and ammonia, which produces NH2. In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  13. Long-Range (17.7 kb) Allele-Specific Polymerase Chain Reaction Method for Direct Haplotyping of R117H and IVS-8 Mutations of the Cystic Fibrosis Transmembrane Regulator Gene


    Pont-Kingdon, Genevieve; Jama, Mohamed; Miller, Christine; Millson, Alison; Lyon, Elaine


    Genotyping of genetic polymorphisms is widely used in clinical molecular laboratories to confirm or predict diseases due to single locus mutations. In contrast, very few molecular methods determine the phase or haplotype of two or more mutations that are kilobases apart. In this report, we describe a new method for haplotyping based on long-range allele-specific PCR. Reaction conditions were established to circumvent the incompatibility of using allele-specific primers and a polymerase with p...

  14. Polymerase chain reaction detection of candidatus liberibacter asiatic associated with citrus huanglonbing

    Directory of Open Access Journals (Sweden)

    G.P. Jagtap


    Full Text Available Polymerase chain reaction diagnosis of Candidatus liberibacter asiatic associated with citrus Huanglonbing disease is molecular technique which is used for detection of disease when pathogen present is very low concentration in disease sample. Among these three DNA isolation methods viz., commercial kit method, sodium sulphite method and membrane bard nucleic acid technique, sodium sulphite method is cost effective for commercial use. In nucleic acid membrane method for DNA extraction isolation there is no use of liquid nitrogen. Polymerase chain reaction detection of disease is based on principal of thermal cycling in which PCR instrument allow to run generally 60-65 thermal cycle, during PCR operation it allow different stages of cycle at different temperatures for different period of time i.e. initiation (940C, denaturation (940C, primer annealing (600C, extension/elongation step (720C, final elongation (720C and holding temperature (40C. PCR based diagnosis system is developed for detection of greening bacteria. The comparative cost of detection by various combinations of reagent and sampling time was determined and cost effective technology was standardized and validated.

  15. A New Topological Description Method of Kinematic Chain

    Institute of Scientific and Technical Information of China (English)

    Ding Huafeng; Huang Zhen; Cao Yi


    This paper presents a novel method for the description of kinematic chains, namely the canonical description of kinematic chains including the synthetic degree-sequences and the canonical adjacency matrices sets of kinematic chains. The most important characteristic of this new description method is its uniqueness. Based on the new principle the isomorphism identification becomes easy and the structures of all kinds of kinematic chains can be stored in computer for the benefits of the realization of automation and intelligence of machine design.

  16. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman


    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  17. The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

    International Nuclear Information System (INIS)

    Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

  18. Direct detection of Mycobacterium tuberculosis in sputum by polymerase chain reaction and DNA hybridization.


    Nolte, F S; Metchock, B; McGowan, J. E.; Edwards, A; Okwumabua, O; Thurmond, C; Mitchell, P S; Plikaytis, B; Shinnick, T


    A polymerase chain reaction (PCR) assay for the rapid diagnosis of pulmonary tuberculosis was developed by using oligonucleotide primers to amplify a fragment of IS6110, an insertion sequence repeated multiple times in the chromosome of Mycobacterium tuberculosis. Sediment obtained from sputa processed by the N-acetyl-L-cysteine-NaOH method was suspended in a simple lysis buffer and was heated at 100 degrees C for 30 min prior to amplification. A dUTP-uracil N-glycosylase PCR protocol was use...

  19. A highly sensitive aptasensor for OTA detection based on hybridization chain reaction and fluorescent perylene probe. (United States)

    Wang, Bin; Wu, Yuanya; Chen, Yanfen; Weng, Bo; Xu, Liqun; Li, Changming


    An optical aptasensor was developed for ultrasensitive detection of ochratoxin A (OTA) based on hybridization chain reaction (HCR) amplification strategy and fluorescent perylene probe (PAPDI)/DNA composites. Dendritic DNA concatamers were synthesized by HCR strategy and modified on magnetic nanoparticles through aptamer as medium. A large amount of PAPDI probe aggregated under the induction of DNA concatamers and caused fluorescence quenching. In the presence of OTA, the PAPDI/DNA composites were released from magnetic nanoparticles due to the strong affinity between aptamer and OTA. In ethanol, PAPDI monomers disaggregated and produced strong fluorescence. The present method displays excellent sensitivity and selectivity towards OTA. PMID:26938491

  20. Real-Time Polymerase Chain Reaction for Detection of Strongyloides stercoralis in Stool


    Sultana, Yasmin; Jeoffreys, Neisha; Watts, Matthew R.; Gilbert, Gwendolyn L.; Lee, Rogan


    The use of real-time polymerase chain reaction (PCR) for detection of Strongyloides stercoralis in stool has recently been described. We compared five DNA extraction methods by using normal human stool spiked with Strongyloides ratti and tested by using a real-time PCR. The PowerSoil kit was found to be the best technique in terms of sensitivity and ease of use. The PCR detected DNA extracted from one spiked S. ratti larva diluted 10−2. The PowerSoil kit was then used to extract DNA from 160 ...

  1. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction. (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M


    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples. PMID:25197027

  2. Comprehensive cosmographic analysis by Markov chain method

    International Nuclear Information System (INIS)

    We study the possibility of extracting model independent information about the dynamics of the Universe by using cosmography. We intend to explore it systematically, to learn about its limitations and its real possibilities. Here we are sticking to the series expansion approach on which cosmography is based. We apply it to different data sets: Supernovae type Ia (SNeIa), Hubble parameter extracted from differential galaxy ages, gamma ray bursts, and the baryon acoustic oscillations data. We go beyond past results in the literature extending the series expansion up to the fourth order in the scale factor, which implies the analysis of the deceleration q0, the jerk j0, and the snap s0. We use the Markov chain Monte Carlo method (MCMC) to analyze the data statistically. We also try to relate direct results from cosmography to dark energy (DE) dynamical models parametrized by the Chevallier-Polarski-Linder model, extracting clues about the matter content and the dark energy parameters. The main results are: (a) even if relying on a mathematical approximate assumption such as the scale factor series expansion in terms of time, cosmography can be extremely useful in assessing dynamical properties of the Universe; (b) the deceleration parameter clearly confirms the present acceleration phase; (c) the MCMC method can help giving narrower constraints in parameter estimation, in particular for higher order cosmographic parameters (the jerk and the snap), with respect to the literature; and (d) both the estimation of the jerk and the DE parameters reflect the possibility of a deviation from the ΛCDM cosmological model.

  3. Immersion-histo polymerase chain reaction: a practical tool for visualization of single-copy genes in tissue sections.


    L. Pan; Diss, T C; Peng, H.; Isaacson, P G


    A method, immersion-histo polymerase chain reaction (IH-PCR), was developed for visualization of single-copy DNA sequences in cells in paraffin-embedded tissue sections. Sections were mounted on coverslips, cut into small pieces, and immersed in reaction mixtures in micro-tubes for specific DNA amplification using a conventional thermal cycler. This was followed by in situ hybridization, in micro-tubes, with PCR-generated, digoxigenin-labeled probes. Epstein-Barr virus, chromosomal translocat...

  4. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura


    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  5. A coding method for decay pathways in successive decay chain

    International Nuclear Information System (INIS)

    The decay pathways in successive decay chain were coded with binary digits. Based the coding approach and by using the E-factor method and recursion algorithm, a general purpose computer code DecayChain for calculation of the growth and decay of any member in a successive decay chain was written. The usage of decay chain code was demonstrated by the calculation of individual activities of each progenies and the total activity for the successive decay chain 228Th through 208Pb (9 members). When the relative detection efficiencies of chain members happen to meet an equation deduced in this paper the total counting rate will exponentially decrease with time with a single half-life. This conclusion was verified by the calculation performed with DecayChain for a 4-membered decay chain. (authors)

  6. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail:


    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  7. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.


    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  8. Polymerase chain reaction for the diagnosis of viral hepatitis B and C.


    Bréchot, C


    Polymerase chain reaction is a highly sensitive technique for the detection of hepatitis B virus-DNA and hepatitis C virus-RNA in serum, liver tissue, and peripheral mononuclear blood cells. In chronic hepatitis B, it is particularly useful for identification of infectious subjects who are hepatitis B surface antigen positive and anti-hepatitis B e antigen antibody-positive, and for follow up of hepatitis B virus infections in liver transplantation programmes. Polymerase chain reaction detect...

  9. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.


    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  10. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction


    P. D. Luka; A. R. Jambol; B. Yakubu


    Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT) remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR) depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction ...

  11. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria


    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  12. A novel rapid genotyping technique for Collie eye anomaly: SYBR Green-based real-time polymerase chain reaction method applicable to blood and saliva specimens on Flinders Technology Associates filter paper. (United States)

    Chang, Hye-Sook; Mizukami, Keijiro; Yabuki, Akira; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Arai, Toshiro; Yamato, Osamu


    Collie eye anomaly (CEA) is a canine inherited ocular disease that shows a wide variety of manifestations and severity of clinical lesions. Recently, a CEA-associated mutation was reported, and a DNA test that uses conventional polymerase chain reaction (PCR) has now become available. The objective of the current study was to develop a novel rapid genotyping technique by using SYBR Green-based real-time PCR for future large-scale surveys as a key part in the strategy to eradicate CEA by selective breeding. First, a SYBR Green-based real-time PCR assay for genotyping of CEA was developed and evaluated by using purified DNA samples from normal, carrier, and affected Border Collies in which genotypes had previously been determined by conventional PCR. This real-time PCR assay demonstrated appropriate amplifications in all genotypes, and the results were consistent with those of conventional PCR. Second, the availability of Flinders Technology Associates filter paper (FTA card) as DNA templates for the real-time PCR assay was evaluated by using blood and saliva specimens to determine suitability for CEA screening. DNA-containing solution prepared from a disc of blood- or saliva-spotted FTA cards was available directly as templates for the real-time PCR assay when the volume of solution was 2.5% of the PCR mixture. In conclusion, SYBR Green-based real-time PCR combined with FTA cards is a rapid genotyping technique for CEA that can markedly shorten the overall time required for genotyping as well as simplify the sample preparation. Therefore, this newly developed technique suits large-scale screening in breeding populations of Collie-related breeds. PMID:20807925

  13. Surrogate nuclear reaction methods for astrophysics

    International Nuclear Information System (INIS)

    A brief outline of the Surrogate reaction method, an indirect approach for determining compound-nuclear reaction cross sections, is given. The assumptions introduced in the analysis of a typical Surrogate experiment are discussed and prospects for using the Surrogate method to obtain cross sections relevant to the astrophysical s-process are considered

  14. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Francisco Danilo Ferreira Paula


    Full Text Available ABSTRACT Introduction: Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. Objective: The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig and T-cell receptor (TCR gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Methods: Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Results: Nine patients (15.8% were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25% by real-time polymerase chain reaction considering a cut-off point of 1 × 10−3 for precursor B-cell acute lymphoblastic leukemia and 1 × 10−2 for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia- free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1% ± 5.6% versus 41.7% ± 17.3%, respectively; p-value = 0.004. There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Conclusion: Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative.

  15. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G


    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  16. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing. (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo


    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  17. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan


    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  18. On the Markov Chain Monte Carlo (MCMC) method

    Indian Academy of Sciences (India)

    Rajeeva L Karandikar


    Markov Chain Monte Carlo (MCMC) is a popular method used to generate samples from arbitrary distributions, which may be specified indirectly. In this article, we give an introduction to this method along with some examples.

  19. Polymerase chain reaction as a succesful biotechnological application. Ways we use PCR in the fields of bioinformatics forensics and genetics


    Λάζαρη, Σπυριδούλα


    Molecular genetics use molecular methods that amplify specific fragments of DNA. Today, the molecular techniques which were developed for amplification and detection of specific sequences of nucleic acids helped in a great deal to understand the structure of many diseases. Polymerase chain reaction or PCR is a technique that is used for isolation and amplification of a specific sequence of DNA. PCR is an in vitro method that exploits the in vivo procedure of replication of DNA. DNA polyme...

  20. Detection of Adenoviruses from clinical samples in bone marrow transplant patients by nested PCR (polymerase chain reaction)


    Fatemeh Sabagh; Michael Roggendorf


    Adenoviruses are recognized as common human pathogens that are responsible for a wide variety of infectious syndromes. Bone marrow transplant patients are prone to life threatening opportunistic infections like adenoviruses. The nested polymerase chain reaction has provided an alternative, sensitive diagnostic method for detection of Adenoviruses. In this study we developed PCR from hexon genes as rapid diagnostic method of Advs infections on different clinical samples. Adenovirus infections ...

  1. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction


    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.


    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  2. Stereoselective synthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-ulose via autoxidation reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Hong-Min; ZHANG Fuyi; TAO Jing-Chao


    Many different approaches for synthesis of branched chain sugars have beenestablished,1 because they are very useful intermediates for synthesis of other non-sugar chiralmolecules, and usually occur in nature. Branched chain glycosidulose can be used for construction offive- and six-membered carbocyclic rings to which two chiral carbons of sugar are incorporated byintramolecular aldol condensation and Robinson annulation,2 Therefore they are useful in thesynthesis of natural products which consist of annulated carbohydrates or where a highlyfunctionalised enantiomerically pure cyclopentane or cyclohexane is required. Also, this type ofbranched chain sugar can be considered as the synthons of monoterpenoid natural products of theiridoid class which have the cyclopentan-(c)-pyran structure. In view of the importance of branchedchain glycosiduloses, it is desirable to have a general, convenient methodology to their synthesis.However, none of the literature methods was reported on their synthesis by a nuclephilic addition toa partially protected glycosidulose, due to the fact that these glycosiduloses are very difficult tosynthesize selectively and unstable;3 and what is more, one-step synthesis branched chainglycosidulose using this method is almost impossible.In this paper, we report on a general, convenient method for stereoselective syntheses of2,2-bis(C-branched-chain)glucopyranosid-3-uloses by the new reaction of 1 with various activemethylene compounds. The generality of this method was examined in detail. The optimumtemperature was 18-25℃. The solvent DMF was better than the others. In all cases he yields werehigher than 60%.All the 2,2-bis(C-branched-chain)glucopyranosid-3-uloses were characterized by X-raycrystallographic analyses. In addition, the important iintermediate in this reaction was isolated,which is the product of autoxidation of 1 at C-3 position. Thus the reaction mechanism for thesynthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-uloses

  3. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang


    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  4. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction. (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P


    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted. Images PMID:1696290

  5. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina


    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  6. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications. (United States)

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav


    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  7. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.


    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  8. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))


    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  9. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis

    Directory of Open Access Journals (Sweden)

    Padmavathy L


    Full Text Available Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patients with various types of cutaneous tuberculosis were subjected to PCR. Results: An overall positivity of 64% was observed, which is comparable to other series. Seventy five percent of lupus vulgaris cases, 62.2% of tuberculosis verrucosa cutis and 50% of scrofuloderma cases showed PCR positivity. Conclusion: Though useful, the cost and the technique involved limit the use of PCR in developing countries like ours.

  10. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.


    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  11. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra


    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  12. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction. (United States)

    Bell, D A


    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  13. Rapid isolation of DNA from fresh and preserved fish scales for polymerase chain reaction. (United States)

    Yue, G H; Orban, L


    We developed a simple and inexpensive method to extract DNA from fresh and preserved fish scales. The procedure is based on boiling the scales in 5% Chelex 100, followed by digestion with proteinase K and subsequent absorption of genomic DNA using silica. A single fresh scale from larger species (e.g., tilapia) or a few scales from smaller species (e.g., 4 scales from zebrafish) provide over 200 ng of DNA, enough for at least 40 polymerase chain reaction amplifications. The procedure is applicable for DNA isolation not only from fresh and ethanol-preserved scales, but also from dried and formaldehyde-treated samples, and thus might be useful for investigating specimens stored in museums and other collections. Since the removal of a few scales is a gentle means of sample collection, this technique will allow analysis of genetic diversity, mating systems, and parentage in populations of endangered or ornamental fish with minimal experimental influence. PMID:14961356

  14. Kinematical coincidence method in transfer reactions

    Energy Technology Data Exchange (ETDEWEB)

    Acosta, L.; Amorini, F. [INFN—Laboratori Nazionali del Sud, Via S. Sofia, Catania (Italy); Auditore, L. [INFN Gruppo Collegato di Messina and Dipartimento di Fisica, Università di Messina (Italy); Berceanu, I. [Institute for Physics and Nuclear Engineering, Bucharest (Romania); Cardella, G., E-mail: [INFN—Sezione di Catania, Via S. Sofia, 95123 Catania (Italy); Chatterjiee, M.B. [Saha Institute for Nuclear Physics, Kolkata (India); De Filippo, E. [INFN—Sezione di Catania, Via S. Sofia, 95123 Catania (Italy); Francalanza, L.; Gianì, R. [INFN—Laboratori Nazionali del Sud, Via S. Sofia, Catania (Italy); Dipartimento di Fisica e Astronomia, Università di Catania, Via S. Sofia, Catania (Italy); Grassi, L. [INFN—Sezione di Catania, Via S. Sofia, 95123 Catania (Italy); Rudjer Boskovic Institute, Zagreb (Croatia); Grzeszczuk, A. [Institut of Physics, University of Silesia, Katowice (Poland); La Guidara, E. [INFN—Sezione di Catania, Via S. Sofia, 95123 Catania (Italy); Centro Siciliano di Fisica Nucleare e Struttura della Materia, Catania (Italy); Lanzalone, G. [INFN—Laboratori Nazionali del Sud, Via S. Sofia, Catania (Italy); Facoltà di Ingegneria e Architettura, Università Kore, Enna (Italy); Lombardo, I. [INFN—Laboratori Nazionali del Sud, Via S. Sofia, Catania (Italy); Dipartimento di Scienze Fisiche, Università Federico II and INFN Sezione di Napoli (Italy); Loria, D.; Minniti, T. [INFN Gruppo Collegato di Messina and Dipartimento di Fisica, Università di Messina (Italy); Pagano, E.V. [INFN—Laboratori Nazionali del Sud, Via S. Sofia, Catania (Italy); Dipartimento di Fisica e Astronomia, Università di Catania, Via S. Sofia, Catania (Italy); and others


    A new method to extract high resolution angular distributions from kinematical coincidence measurements in binary reactions is presented. Kinematics is used to extract the center of mass angular distribution from the measured energy spectrum of light particles. Results obtained in the case of {sup 10}Be+p→{sup 9}Be+d reaction measured with the CHIMERA detector are shown. An angular resolution of few degrees in the center of mass is obtained. The range of applicability of the method is discussed.

  15. Polymerase chain reaction in the diagnosis of tuberculosis


    Sritharan, Manjula; Sritharan, Venkataraman


    A rapid, sensitive, specific and yet economical method for the diagnosis ofM. tuberculosis and other mycobacteria in clinical specimen is a desperate and urgent requirement of the day in the laboratory diagnosis and hence management of tuberculosis. This need is further accentuated by emerging diseases like multi drug resistant tuberculosis, tuberculosis in AIDS patients and opportunistic mycobacterial infections, which do not respond to conventional anti TB therapy. Molecular methods, partic...

  16. Limitations of clonality analysis of B cell proliferations using CDR3 polymerase chain reaction


    Hoeve, M A; Krol, A D G; Philippo, K; Derksen, P W B; Veenendaal, R. A.; Schuuring, E; Kluin, Ph M; Krieken, J.H.J.M. van


    Background/Aims—Detection of clonal immunoglobulin heavy chain (IgH) rearrangements by the polymerase chain reaction (PCR) is an attractive alternative to Southern blotting in lymphoma diagnostics. However, the advantages and limitations of PCR in clonality analysis are still not fully appreciated. In this study, clonality was analysed by means of PCR, focusing in particular on the sample size requirements when studying extremely small samples of polyclonal and monoclonal lesions.

  17. A coalescent approach to the polymerase chain reaction.


    Weiss, G.; von Haeseler, A


    A versatile algorithm is developed to model PCR on a computer. The method is based on a modification of the coalescent process and provides a general framework to analyse data from PCR. It allows for incorporation of the dynamics of the replication process as described in terms of the number of starting template molecules and cycle-dependent PCR efficiency. The simulation method generates, as a first step, the genealogy of a set of sequences sampled from a final PCR product. In a second step ...

  18. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF


    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  19. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei


    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  20. Multiplex polymerase chain reaction (PCR) on a SU-8 chip

    DEFF Research Database (Denmark)

    Christensen, Troels Balmer; Bang, Dang Duong; Wolff, Anders


    We present the detection of Campylobacter at species level using multiplex PCR in a micro fabricated PCR chip. The chip is based on the polymer SU-8 that allows integration with different microfluidic components, e.g., sample pre-treatment before PCR, and DNA detection simultaneously with or after...... the PCR. The chip performs very well with respect to heating and cooling rates with values up to around 40 °C/s and 20 °C/s, respectively, and has low power consumption (0.5–2.5 W depending on temperature). Multiplex DNA amplification by PCR for the detection of Campylobacter at species level...... was performed successfully on the chip with results comparable to conventional PCR methods. Microsystems often show serious PCR inhibition due to a high surface to volume ratio which causes an increased proclivity of the PCR mix ingredients to stick to the surfaces. To avoid this, a simple method of dynamic...

  1. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh


    T. M. Nabeel Muhammad; Sreedevi, B.


    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasa...

  2. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer



    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have d...

  3. Viral etiology of respiratory infections in children in southwestern Saudi Arabia using multiplex reverse-transcriptase polymerase chain reaction


    Al-Ayed, Mohamed S.; Asaad, Ahmed M; Qureshi, Mohamed A.; Ameen, Mohammed S.


    Objectives: To investigate 15 respiratory viruses in children with acute respiratory tract infections (ARTIs) using multiplex reverse-transcriptase polymerase chain reaction (RT-PCR), and to analyze the clinical and epidemiological features of these viruses. Methods: In a cross-sectional study, 135 children, ≤5 years of age who presented with ARTIs in Najran Maternity and Children Hospital, Najran, Saudi Arabia between October 2012 and July 2013 were included. The clinical and sociodemographi...

  4. Rapid diagnosis of enterovirus infection by magnetic bead extraction and polymerase chain reaction detection of enterovirus RNA in clinical specimens.


    Muir, P; Nicholson, F; Jhetam, M; Neogi, S; Banatvala, J E


    We describe a rapid method for extraction and detection of enterovirus RNA in clinical samples. By using magnetic bead technology, enterovirus RNA was efficiently and rapidly extracted from cerebrospinal fluid, stool, saliva, blood, pericardial fluid, urine, and cryopreserved or formalin-fixed solid tissue. Enterovirus RNA was then detected by reverse transcription followed by polymerase chain reaction amplification with primers designed to allow detection of most enterovirus serotypes. For d...

  5. Value of Candida polymerase chain reaction and vaginal cytokine analysis for the differential diagnosis of women with recurrent vulvovaginitis.


    Stephanie Weissenbacher; Witkin, Steven S.; Vera Tolbert; Paulo Giraldo; Iara Linhares; Andrea Haas; E. Rainer Weissenbacher; Ledger, William J.


    Objectives: Recurrent vulvovaginitis remains difficult to diagnose accurately and to treat. The present investigation evaluated the utility of testing vaginal specimens from women with symptomatic recurrent vulvovaginitis for Candida species by polymerase chain reaction (PCR) and for cytokine responses.Methods: Sixty-one consecutive symptomatic women with pruritus, erythema, and/or a thick white discharge and a history of recurrent vulvovaginitis and 31 asymptomatic women with no such history...

  6. Isolation and Identification of Mycoplasma synoviae From Suspected Ostriches by Polymerase Chain Reaction, in Kerman Province, Iran


    Tebyanian, Hamid; Mirhosseiny, Seyed Hanif; Kheirkhah, Babak; Hassanshahian, Mehdi; farhadian, Hamze


    Background: Mycoplasma synoviae is an important avian pathogen which can cause both respiratory disease and synovial joint inflammation (synovitis) in poultry. Mycoplasmas spp. may cause the respiratory system infection in ostriches with symptoms such as inflammation of the nose, trachea and also damages of lungs. Objectives: The current study aimed to use the M. synoviae specific Polymerase Chain Reaction (PCR) and microbiological methods in order to isolate and identify M. synoviae from sus...

  7. Differentiation of Neisseria gonorrhoeae strains by polymerase chain reaction and restriction fragment length polymorphism of outer membrane protein IB genes.


    Lau, Q C; Chow, V T; Poh, C. L.


    OBJECTIVES--To employ polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis for the rapid differentiation of Neisseria gonorrhoeae protein IB (PIB) isolates and to compare its usefulness with the widely accepted auxotype/serovar classification scheme. METHODS--The outer membrane protein IB genes of 47 gonococcal isolates belonging to 10 different serovars were amplified by PCR. The approximately 1 kb DNA products were then digested separately with restri...


    Directory of Open Access Journals (Sweden)



    Full Text Available Chemical additives (fertilizers and plant protection preparations are largely used for improving the production yield of food produce. Their application often causes the contamination of raw materials for food production, which can be dangerous for the health of consumers. Alternative methods are developed and implemented to improve and ensure the safety of on-farm production. The substitution of chemical fertilizers and soil additives with alternative treatment methods, such as irradiation, ultrasound and the use of electromagnetic energy are discussed. Successful application of physical methods in different stages of food-preparation is recommended.

  9. Time-resolved studies of free radicals and laser-initiated chain reactions: Final report, 1 April 1979-31 March 1988

    International Nuclear Information System (INIS)

    Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH2I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained





    Chemical additives (fertilizers and plant protection preparations) are largely used for improving the production yield of food produce. Their application often causes the contamination of raw materials for food production, which can be dangerous for the health of consumers. Alternative methods are developed and implemented to improve and ensure the safety of on-farm production. The substitution of chemical fertilizers and soil additives with alternative treatment methods, such as irradiation,...

  11. Detection of Listeria monocytogenes in salmon using the Probelia polymerase chain reaction system. (United States)

    Wan, Jason; King, Kerryn; Forsyth, Santina; Coventry, M John


    A validation was conducted on the performance of a commercially available polymerase chain reaction (PCR) kit (Probelia) in comparison with International Organization for Standardization (ISO) method 11290-1 (adopted as an Australian New Zealand Standard Method, AS/NZS 1766.2.16.1:1998) for the detection of Listeria monocytogenes in salmon samples. The validation was conducted following the guidelines of an Australian New Zealand Standard (Guide to Determining the Equivalence of Food Microbiology Test Methods, Part 1, Qualitative Tests, AS/NZS 4659.1:1999), which adopts an approach similar to that recommended by the Association of Analytical Communities Microbiology Method Validation Program for Performance Tested and Peer Verified Methods. The validation study involved the use of five cultures of L. monocytogenes, each challenged at a single level of inoculation into five different types of salmon samples. A total of 60 salmon samples (30 unchallenged and 30 challenged) were tested using both the PCR method and the ISO method. Results from this study indicated that the Probelia PCR method is equivalent to the ISO method. In addition, the detection sensitivity of the Probelia PCR system was determined as approximately 0.5 CFU per PCR assay (equivalent to 20 CFU/ml broth culture) for a pure culture of L. monocytogenes. The Probelia PCR method offers the advantage of detecting L. monocytogenes to genetic specificity within 48 to 50 h, whereas the ISO method requires 5 days for negative results with additional days for confirmed positive results by the use of other biochemical and cultural tests. PMID:12636297

  12. Kinematical coincidence method in transfer reactions

    CERN Document Server

    Acosta, L; Auditore, L; Berceanu, I; Cardella, G; Chatterjiee, M B; De Filippo, E; FrancalanzA, L; Gianì, R; Grassi, L; Grzeszczuk, A; La Guidara, E; Lanzalone, G; Lombardo, I; Loria, D; Minniti, T; Pagano, E V; Papa, M; Pirrone, S; Politi, G; Pop, A; Porto, F; Rizzo, F; Rosato, E; Russotto, P; Santoro, S; Trifirò, A; Trimarchi, M; Verde, G; Vigilante, M


    A new method to extract high resolution angular distributions from kinematical coincidence measurements in binary reactions is presented. Kinematic is used to extract the center of mass angular distribution from the measured energy spectrum of light particles. Results obtained in the case of 10Be+p-->9Be+d reaction measured with the CHIMERA detector are shown. An angular resolution of few degrees in the center of mass is obtained.

  13. Immunomagnetic Separation Combined with Polymerase Chain Reaction for the Detection of Alicyclobacillus acidoterrestris in Apple Juice


    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen


    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agar...

  14. RAPID DETECTION OF Salmonella IN SHRIMP BY POLYMERASE CHAIN REACTION [Deteksi Cepat Salmonella pada Udang dengan Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ulfah Amalia


    Full Text Available Shrimp is an important non-oil commodity for foreign trade in Indonesia. However, rejection of shrimp exports by the importing countries is still commonly encountered. In 2011, the USFDA recorded two cases of Salmonella spp. contamination in shrimp products from two shrimp processing companies in Indonesia. Analysis of Salmonella spp. in seafood is generally performed using a conventional method which takes at least 5 days. The objective of the study is to get a Salmonellae rapid detection method in shrimp by PCR. In this study, optimization of PCR protocol method to detect Salmonella invA gene was conducted using six different annealing temperatures (59, 59.5, 60.8, 62, 64 and 64.5°C. The results showed that 64°C was the optimum annealing temperature to detect the 284 bp fragment of Salmonella invA gene. The PCR based detection method has a DNA detection limit of 27.81ug/mL and 10°CFU/mL of viable salmonellae with 100% specificity. The PCR protocol is capable of detecting six different Salmonella serovars (S. Enteritidis, S. Hadar, S. Heidelberg, S. Kentucky, S. Paratyphi and S. Typhimurium but none of the non salmonellae isolates. Application of the PCR assay on Salmonella in shrimp after the selective enrichment step suggested that all 16 samples were positive for Salmonella. At the same time, the conventional method could only detected 3 samples for Salmonella positive.

  15. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  16. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota


    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  17. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)


    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  18. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    International Nuclear Information System (INIS)

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

  19. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.


    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam


    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  1. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints." (United States)

    Phelps, Tara L.; And Others


    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  2. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory (United States)

    Elkins, Kelly M.


    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  3. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.; Ahlford, A.; Syvänen, A.-C; Kutter, Jörg Peter; Wolff, Anders

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple and...

  4. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan


    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  5. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction. (United States)

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham


    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  6. Methods for Coordinated Inventory Control in Supply Chain Management

    DEFF Research Database (Denmark)

    Larsen, Christian; Thorstenson, Anders


    Purpose of this paper Achieving effective and efficient inventory control in supply chain management is a task that requires insights into the workings of multi-stage inventory systems with uncertainty about future demand and supply. In this paper we analyze and compare two basic principles for...... and heuristic control methods for coordination. The numerical results obtained by simulation are compared with the solutions found when inventories in the supply chain are controlled independently of each other. Findings Coordinated inventory control can offer a significant potential for cost...... wider set of cases. The set of inventory control policies investigated here is also limited and could be extended in future research. Practical implications Guidelines to supply chain managers for allocating safety stocks in supply chains. What is original/value of paper The comparison of effects of...

  7. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Directory of Open Access Journals (Sweden)

    Parvin Hassanzadeh


    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  8. Three sample preparation protocols for polymerase chain reaction based detection of Cryptosporidium parvum in environmental samples. (United States)

    Kostrzynska, M; Sankey, M; Haack, E; Power, C; Aldom, J E; Chagla, A H; Unger, S; Palmateer, G; Lee, H; Trevors, J T; De Grandis, S A


    Cryptosporidium parvum is a protozoan parasite responsible for an increasing number of outbreaks of gastrointestinal illness worldwide. In this report, we describe development of sample preparation protocols for polymerase chain reaction (PCR)-based detection of C. parvum in fecal material and environmental water samples. Two of these methods were found adequate for isolation of Cryptosporidium DNA from filtered water pellet suspensions. The first involved several filtration steps, immunomagnetic separation and freeze-thaw cycles. The second method involved filtration, addition of EnviroAmp lysis reagent, freeze-thaw cycles and precipitation of the DNA with isopropanol. Using nested PCR, we detected 100 oocysts/ml of filtered water pellet suspension, with either of the above sample preparation procedures. Nested PCR increased sensitivity of the assay by two to three orders of magnitude as compared to the primary PCR. The detection limit for seeded fecal samples was 10-fold higher than for filtered environmental water pellet suspension. Nested PCR results showed 62.4 and 91.1% correlation with immunofluorescence assay (IFA) for fecal samples and filtered environmental water pellet suspensions, respectively. This correlation decreased to 47.2% and 44.4%, respectively, when only IFA positive samples were analyzed. However, in fecal samples contaminated with a high number (> 10(5)/g) of C. parvum oocysts, this correlation was 100%. PMID:10076632

  9. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples. (United States)

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.


    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  10. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying


    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  11. Polymerase chain reaction amplification of a GC rich region by adding 1,2 propanediol

    Directory of Open Access Journals (Sweden)

    Zeinab Mousavian


    Full Text Available Background : Apolipoprotein E (ApoE is one of the most important carriers of lipids in mammalians. The gene for this lipoprotein (ApoE is located on chromosome 19 which is related with the pathogenesis of some nervous system disease. ApoE gene is identified as a high guanine-cytosine (GC content fragment. Detection and amplification of these templates are extensively laborious and baffling. The aim of this study was to find a practical and feasible method for the amplification of the number of GC rich genes such as ApoE. Materials and Methods: We experimented with simple polymerase chain reaction (PCR, nested PCR and PCR with 1-2 propanediol, dimethylsulfoxide (DMSO, and ethyleneglicol as additive substances to enhance the amplification ApoE gene and used the 40 samples of the human whole blood were collected in test tubes with a pre-treatment of ethylene diaminetetraacetic acid. Results: According to our observations, presence of 1-2 propanediol, DMSO, and ethyleneglicol as additive substances resulted to enhanced amplification of ApoE gene. Addition of 1-2 propanediol showed the best results, caused optimization and revealed more specific and sharp bands. Conclusion: According to our findings 1-2 propanediol are the best organic reagent for improving the amplification of ApoE gene. Optimization procedure for each GC rich sequence is recommended to be performed separately in order to identify which of the additive agent is more efficient and applicable for a particular target.

  12. Use of the polymerase chain reaction in epizootiological studies of viral diseases

    International Nuclear Information System (INIS)

    The polymerase chain reaction (PCR) has become a powerful diagnostic tool in veterinary virology. The research team at the Department of Virology of the National Veterinary Institute, Uppsala, Sweden, was among the first groups to develop and apply routine diagnostic PCR assays in veterinary virology, to develop PCR diagnostic kits and to introduce assays of molecular epizootiology, based on comparative nucleotide sequence analysis of the PCR products. In the paper the experiences of 10 years of application of these techniques are summarized, with special regard to technical developments, i.e. simplified methods of sample preparation, precautions to avoid false positive or negative results, comparison of standard and nested PCR and simple assays of visualization. The viruses involved in the routine PCR diagnostic work are listed in two tables. Examples are given concerning the problems of routine PCR diagnosis in veterinary virology. The use of the PCR as a basic method of 'molecular epizootiology' is discussed and illustrated with several examples. The approaches of molecular epizootiology are based on direct sequence analysis of the PCR products, comparative analysis of the sequences and construction of phylogenetic trees. By this approach the phylogenetic relations are determined and the viruses are rapidly identified and grouped. The accurate genetic identification of virus variants provides novel means to the epizootiologists to trace the geographic distribution of the viruses and to determine the origin of a given outbreak. (author)

  13. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples. (United States)

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H


    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  14. Reduction Methods for Total Reaction Cross Sections (United States)

    Gomes, P. R. S.; Mendes Junior, D. R.; Canto, L. F.; Lubian, J.; de Faria, P. N.


    The most frequently used methods to reduce fusion and total reaction excitation functions were investigated in a very recent paper Canto et al. (Phys Rev C 92:014626, 2015). These methods are widely used to eliminate the influence of masses and charges in comparisons of cross sections for weakly bound and tightly bound systems. This study reached two main conclusions. The first is that the fusion function method is the most successful procedure to reduce fusion cross sections. Applying this method to theoretical cross sections of single channel calculations, one obtains a system independent curve (the fusion function), that can be used as a benchmark to fusion data. The second conclusion was that none of the reduction methods available in the literature is able to provide a universal curve for total reaction cross sections. The reduced single channel cross sections keep a strong dependence of the atomic and mass numbers of the collision partners, except for systems in the same mass range. In the present work we pursue this problem further, applying the reduction methods to systems within a limited mass range. We show that, under these circumstances, the reduction of reaction data may be very useful.

  15. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma... (United States)


    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... sample (100 to 2000 ng/5 μl) with one of the following 45 μl PCR cocktails: (i) 5 μl 10x PCR buffer, 1...

  16. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.;


    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  17. Development of two dimensional electrophoresis method using single chain DNA

    International Nuclear Information System (INIS)

    By combining a separation method due to molecular weight and a method to distinguish difference of mono-bases, it was aimed to develop a two dimensional single chain DNA labeled with Radioisotope (RI). From electrophoretic pattern difference of parent and variant strands, it was investigated to isolate the root module implantation control gene. At first, a Single Strand Conformation Polymorphism (SSCP) method using concentration gradient gel was investigated. As a result, it was formed that intervals between double chain and single chain DNAs expanded, but intervals of both single chain DNAs did not expand. On next, combination of non-modified acrylic amide electrophoresis method and Denaturing Gradient-Gel Electrophoresis (DGGE) method was examined. As a result, hybrid DNA developed by two dimensional electrophoresis arranged on two lines. But, among them a band of DNA modified by high concentration of urea could not be found. Therefore, in this fiscal year's experiments, no preferable result could be obtained. By the used method, it was thought to be impossible to detect the differences. (G.K.)

  18. Rapid and inexpensive species differentiation using a multiplex real-time polymerase chain reaction high-resolution melt assay. (United States)

    Elkins, Kelly M; Perez, Anjelica C U; Sweetin, Katherine C


    We demonstrate a method for developing real-time polymerase chain reaction (PCR) high-resolution melt (HRM) assays to identify multiple species present in a mixture simultaneously using LCGreen Plus and melt temperatures. Highly specific PCR primers are designed to yield amplicons with different melt temperatures for simple routine species identification compared with differentiating melt curve kinetics traces or difference plots. This method is robust and automatable, and it leads to savings in time and reagent costs, is easily modified to probe any species of interest, eliminates the need for post-PCR gel or capillary electrophoresis in routine assays, and requires no expensive dye-labeled primers. PMID:26836486

  19. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff


    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  20. Detection of Sphingomonas paucimobilis Infections in Domestic Animals by VITEK ® Compaq 2 and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    S Cengiz


    Full Text Available This case report presents the first cases of Sphingomonas paucimobilis in Turkey, which was isolated and identified from two cows, a calf and a lamb by conventional methods, VITEK Compaq® 2 system and Polymerase Chain Reaction (PCR. Compatible findings were reached among clinical history, necropsy findings and bacteriologic results. In conclusion, S. paucimobilis should be considered as a causative agent particularly for respiratory diseases, septicemia and foot infections with resistance to antibiotic treatment. Also, detection methods must be arranged not only for common pathogens but also for S. paucimobilis.

  1. New methods for quantum mechanical reaction dynamics

    International Nuclear Information System (INIS)

    Quantum mechanical methods are developed to describe the dynamics of bimolecular chemical reactions. We focus on developing approaches for directly calculating the desired quantity of interest. Methods for the calculation of single matrix elements of the scattering matrix (S-matrix) and initial state-selected reaction probabilities are presented. This is accomplished by the use of absorbing boundary conditions (ABC) to obtain a localized (L2) representation of the outgoing wave scattering Green's function. This approach enables the efficient calculation of only a single column of the S-matrix with a proportionate savings in effort over the calculation of the entire S-matrix. Applying this method to the calculation of the initial (or final) state-selected reaction probability, a more averaged quantity, requires even less effort than the state-to-state S-matrix elements. It is shown how the same representation of the Green's function can be effectively applied to the calculation of negative ion photodetachment intensities. Photodetachment spectroscopy of the anion ABC- can be a very useful method for obtaining detailed information about the neutral ABC potential energy surface, particularly if the ABC- geometry is similar to the transition state of the neutral ABC. Total and arrangement-selected photodetachment spectra are calculated for the H3O- system, providing information about the potential energy surface for the OH + H2 reaction when compared with experimental results. Finally, we present methods for the direct calculation of the thermal rate constant from the flux-position and flux-flux correlation functions. The spirit of transition state theory is invoked by concentrating on the short time dynamics in the area around the transition state that determine reactivity. These methods are made efficient by evaluating the required quantum mechanical trace in the basis of eigenstates of the Boltzmannized flux operator

  2. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao


    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  3. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    V Makeshkumar


    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  4. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain


    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  5. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples. (United States)

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal


    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  6. Light chain editing generates polyreactive antibodies in chronic graft-versus-host reaction


    Witsch, Esther J.; Cao, Hong; Fukuyama, Hidehiro; Weigert, Martin


    The chronic graft-versus-host (cGvH) reaction is a model of induced lupus caused by alloreactive CD4+ T cells from a Bm-12 mouse in a C57BL/6 recipient. We used this cGvH reaction in C57BL/6 anti-DNA H chain transgenic mice, 56R/B6, to understand the structure, specificity, and origin of the induced autoantibodies (auto-Abs). We found anti-DNA Abs that reacted to several different antigens, such as phosphatidylserine, myelin basic protein, thyroglobulin, histone, insulin, cytochrome C, and β-...

  7. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin


    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  8. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei


    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  9. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini


    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  10. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction. (United States)

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T


    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  11. Detection of bovine leukemia virus in cattle by the polymerase chain reaction. (United States)

    Murtaugh, M P; Lin, G F; Haggard, D L; Weber, A F; Meiske, J C


    Bovine leukemia virus (BLV) is widely distributed in U.S. cattle herds. It infects B lymphocytes and causes neoplastic disease in 5-10% of infected animals. Direct economic losses are incurred as a result of death, reduced milk production and condemnation at slaughter. Thus the identification of cattle infected with BLV is of significant concern to the U.S. cattle industry. For this reason, polymerase chain reaction (PCR) amplification was used to examine seropositive and seronegative cattle for the presence of BLV DNA in peripheral blood mononuclear cells. Using an amplification protocol able to detect 1 viral genome in 100,000 cells, BLV was not detected in 7 seronegative cattle in an infected herd. BLV sequences were detected in 13 of 18 seropositive animals with various levels of infection as determined by in vitro lymphocyte culture and electron microscopy. An active infection was demonstrated in one animal, based on the presence of viral RNA. These findings indicate that PCR is a sensitive method for the detection of BLV in cattle and provides new information regarding the dynamics of the infection. PMID:1658030

  12. Trends and advances in food analysis by real-time polymerase chain reaction. (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin


    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  13. Detection of Toxoplasma gondii in venous blood from AIDS patients by polymerase chain reaction. (United States)

    Dupouy-Camet, J; de Souza, S L; Maslo, C; Paugam, A; Saimot, A G; Benarous, R; Tourte-Schaefer, C; Derouin, F


    Detection of Toxoplasma gondii in blood by means of the polymerase chain reaction (PCR) may facilitate the diagnosis and follow-up of cerebral toxoplasmosis in patients with AIDS. We evaluated this approach with seven patients with tissue culture-proven parasitemia, 14 patients with presumptive cerebral toxoplasmosis, and 17 healthy human immunodeficiency virus-positive controls. Each sample of blood was assayed on three different occasions by a PCR assay based on detection of the gene encoding the P30 surface protein. A positive PCR diagnosis required positivity in at least two of the three PCR tests. None of the controls had a positive PCR diagnosis, but six of the seven patients with parasitemia did. Cerebral toxoplasmosis was confirmed in 13 of the 14 patients with a presumptive diagnosis; diagnosis by PCR was positive before treatment for 9 of these 13 patients, whereas tissue culture was positive for only 1 patient. During treatment, blood samples were taken from 14 patients at regular intervals until day 12. PCR diagnosis became negative on ethidium-stained gels, but persistent signals were observed after hybridization, in some cases, for up to 12 days after initiation of therapy. PCR on venous blood could thus be a sensitive and noninvasive method for the diagnosis of cerebral and disseminated toxoplasmosis in AIDS patients and could be a potential tool for monitoring the effects of treatment. PMID:8349765

  14. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Directory of Open Access Journals (Sweden)

    Mari Tuyama


    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  15. Evaluation of a rapid polymerase chain reaction based identification technique for Vibrio cholerae isolates. (United States)

    le Roux, W J; Masoabi, D; de Wet, C M E; Venter, S N


    Rapid and accurate identification of waterborne pathogens, such as Vibrio cholerae, in drinking-water sources is important to enable effective resource management and public health protection. Phenotypic systems currently being used for the identification of Vibrio cholerae isolates are time-consuming and the need exists for the development of suitable molecular techniques that can offer both fast and reliable identification. During this study, isolates identified as Vibrio cholerae by means of two different biochemical test systems (API 20E and VITEK 32) were analysed with the polymerase chain reaction (PCR) to compare the reliability of the various identification systems. The selected PCR technique amplified a sequence within the outer membrane protein of Vibrio cholerae, a gene specific for V. cholerae. It was found that out of 243 isolates biochemically identified as V. cholerae with either the API or VITEK system, 21 isolates did not give a positive result with the PCR detection method. Sequencing the 16S rDNA of more than half of these isolates and comparison of the sequences with Internet databases indicated that most of the isolates belonged to the genus Aeromonas. The results indicated that the rapid PCR procedure was more accurate than the API or VITEK systems currently being used for the phenotypic identification of Vibrio cholerae isolates. PMID:15318514

  16. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas


    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  17. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu


    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  18. GSH2 promoter methylation in pancreatic cancer analyzed by quantitative methylation-specific polymerase chain reaction (United States)



    Tumor suppressor gene silencing via promoter hypermethylation is an important event in pancreatic cancer pathogenesis. Aberrant DNA hypermethylation events are highly tumor specific, and may provide a diagnostic tool for pancreatic cancer patients. The objective of the current study was to identify novel methylation-related genes that may potentially be used to establish novel therapeutic and diagnostic strategies against pancreatic cancer. The methylation status of the GS homeobox 2 (GSH2) gene was analyzed using the sodium bisulfite sequencing method. The GSH2 methylation ratio was examined in primary carcinomas and corresponding normal tissues derived from 47 patients with pancreatic cancer, using quantitative methylation-specific polymerase chain reaction. Methylation ratios were found to be associated with the patient's clinicopathological features. GSH2 gene methylation was detected in 26 (55.3%) of the 47 pancreatic cancer patients, indicating that it occurs frequently in pancreatic cancer. A significant association with methylation was observed for tumor-node-metastasis stage (P=0.031). GSH2 may be a novel methylation-sensitive tumor suppressor gene in pancreatic cancer and may be a tumor-specific biomarker of the disease. PMID:26171036

  19. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    Institute of Scientific and Technical Information of China (English)

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan


    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  20. Microdissection and polymerase chain reaction amplification of genomic DNA from histological tissue sections.


    Moskaluk, C A; Kern, S.E.


    Polymerase chain reaction (PCR)-based assays are being used increasingly to study the molecular genetic changes that occur in minute cellular lesions that are identified in histological sections. It is often desirable to microdissect the cells of interest in a lesion, isolating them from surrounding normal tissue to obtain the purest representation of genomic DNA possible. We present here an optimized microdissection and DNA extraction protocol that reliably produces PCR-amplifiable DNA from ...

  1. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.


    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P


    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate p...

  2. Detection of Mycoplasma pneumoniae by polymerase chain reaction and nonradioactive hybridization in microtiter plates.


    Lüneberg, E; Jensen, J S; M. Frosch


    In order to improve the diagnosis of a Mycoplasma pneumoniae infection, we developed a polymerase chain reaction (PCR)-based assay. The gene encoding elongation factor Tu (tuf) was selected as the target sequence. Oligonucleotides derived from variable stretches of the tuf gene were able to prime the amplification of a 950-bp fragment exclusively when M. pneumoniae DNA was used as the template. The sensitivity of the assay was increased 10-fold when the amplification products were hybridized ...

  3. Amplification of human minisatellites by the polymerase chain reaction: towards DNA fingerprinting of single cells.


    Jeffreys, A J; Wilson, V.; Neumann, R.; Keyte, J


    Hypervariable minisatellites can be amplified from human DNA by the polymerase chain reaction, using primers from DNA flanking the minisatellite to amplify the entire block of tandem repeat units. Minisatellite alleles up to 5-10 kb long can be faithfully amplified. At least six minisatellite loci can be co-amplified from the same DNA sample and simultaneously detected to provide a reproducible and highly variable DNA fingerprint which can be obtained from nanogram quantities of human DNA. Th...

  4. Genomic fingerprints of Staphylococcus aureus of bovine origin by polymerase chain reaction-based DNA fingerprinting.


    Matthews, K R; Kumar, S. J.; O'Conner, S. A.; Harmon, R J; Pankey, J W; Fox, L. K.; Oliver, S P


    Staphylococcus aureus (n = 75) isolated from mammary secretions of cows with subclinical and clinical mastitis from several geographic locations in the USA were examined using polymerase chain reaction-based DNA fingerprinting. DNA fingerprints were produced using a synthetic oligonucleotide primer (5'GTAACGCC3') to produce a distinct spectrum of amplified DNA fragments facilitating a high degree of resolution for differentiating S. aureus strains. PCR-based DNA fingerprinting grouped the 75 ...

  5. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics


    Li Jiang; Matthew Mancuso; Zhengda Lu; Gunkut Akar; Ethel Cesarman; David Erickson


    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics ...

  6. Compact-like kink in a real electrical reaction-diffusion chain

    International Nuclear Information System (INIS)

    We demonstrate experimentally the compact-like kinks existence in a real electrical reaction-diffusion chain. Our measures show that such entities are strictly localized and consequently present a finite spatial extent. We show equally that the kink velocity is threshold-dependent. A theoretical quantification of the critical coupling under which propagation fails is also achieved and reveals that nonlinear coupling leads to a propagation failure reduction

  7. The design and construction of an electronic model of the chain reaction process

    International Nuclear Information System (INIS)

    The design and construction of an electronic model simulating the nuclear chain reaction process up to three successive neutron generations is briefly described. This model is equipped with a special sound effect. However, a tape recorder can be attached and replayed in synchronism with the display with minimum hardware modifications. In this manner, it can function as a useful educational aid. The circuit is built around easily available ttl integrated circuits. (author)

  8. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti


    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.


    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  9. Effect of fungal and plant secondary metabolites on polimerase chain reaction (PCR)


    Thaler, Nejc; Bajc, Marko


    Secondary metabolites are organic compounds that can be found in both fungi and plants, where they play an important role as defensive and signal molecules, or provide other kinds of advantage in natural selection, but are not directly involved in normal growth, development and reproduction of an organism. When working with DNA techniques, it is the secondary metabolites that most often affect the efficiency of polymerase chain reaction (PCR), either by hindering cell lysis, causing ...

  10. Preliminary evaluation of the ligase chain reaction for specific detection of Neisseria gonorrhoeae.


    Birkenmeyer, L; Armstrong, A S


    Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the ...

  11. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.


    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W; Atlas, R M


    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can di...

  12. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.


    Alexander, H S; Key, D.W.; Nagy, E.


    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb Ba...

  13. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  14. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q


    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  15. Aplicabilidade da metodologia de reação de polimerase em cadeia em tempo real na determinação do percentual de organismos geneticamente modificados em alimentos Applicability of the real-time polymerase chain reaction based-methods in quantification of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Natália Eudes Fagundes de Barros


    2003, which requires labeling for all foods or food ingredients, with a stricter labeling threshold of 1%. Although polymerase chain reaction technology has some limitations, the high sensitivity and specificity explain why it has been the first choice of most analytical laboratories interested in detection of genetically modified organisms and their derived products. Among the currently available methods, polymerase chain reaction-based methods are accepted, considering the sensitivity and reliability for detection of genetically modified-derived material in routine analysis. In this paper, a review of currently available polymerase chain reaction methods for screening and quantifying genetically modified-derived ingredients is presented, discussing their applicability and limitations.

  16. Silica Microcapsules Prepared by Interfacial Reaction Methods

    Institute of Scientific and Technical Information of China (English)

    M; Fujiwara; K; Shiokawa; Y; Nakahara


    1 Results Silica spherical particles with hollow structure are directly prepared by interfacial reaction methods using W/O/W emulsion (schematic diagram in Fig.1)[1].Fig.1 Silica microcapsule formationThe mixing of W/O emulsion consisting of sodium silicate solution (inner water phase) and n-hexane solution (oil phase) to outer water phase dissolving NH4HCO3 or other salts affords silica microcapsules.The critical feature of this method is the direct formation of hollow structure.Therefore,the core com...

  17. Quantitative Methods in Supply Chain Management Models and Algorithms

    CERN Document Server

    Christou, Ioannis T


    Quantitative Methods in Supply Chain Management presents some of the most important methods and tools available for modeling and solving problems arising in the context of supply chain management. In the context of this book, “solving problems” usually means designing efficient algorithms for obtaining high-quality solutions. The first chapter is an extensive optimization review covering continuous unconstrained and constrained linear and nonlinear optimization algorithms, as well as dynamic programming and discrete optimization exact methods and heuristics. The second chapter presents time-series forecasting methods together with prediction market techniques for demand forecasting of new products and services. The third chapter details models and algorithms for planning and scheduling with an emphasis on production planning and personnel scheduling. The fourth chapter presents deterministic and stochastic models for inventory control with a detailed analysis on periodic review systems and algorithmic dev...

  18. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products. (United States)

    Infante, Carlos; Manchado, Manuel


    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  19. A string reaction coordinate for the folding of a polymer chain (United States)

    Leitold, Christian; Lechner, Wolfgang; Dellago, Christoph


    We investigate the crystallization mechanism of a single, flexible homopolymer chain with short range attractions. For a sufficiently narrow attractive well, the system undergoes a first-order like freezing transition from an expanded disordered coil to a compact crystalline state. Based on a maximum likelihood analysis of committor values computed for configurations obtained by Wang-Landau sampling, we construct a non-linear string reaction coordinate for the coil-to-crystal transition. In contrast to a linear reaction coordinate, the string reaction coordinate captures the effect of different degrees of freedom controlling different stages of the transition. Our analysis indicates that a combination of the energy and the global crystallinity parameter Q6 provide the most accurate measure for the progress of the transition. While the crystallinity paramter Q6 is most relevant in the initial stages of the crystallization, the later stages are dominated by a decrease in the potential energy.

  20. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)


    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  1. Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Conventional methods for the diagnosis of tubercolosis based on microscopic examination and in vitro culture is both time consuming and tedious. Molecular methods of diagnosis have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determined the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. An aliquot of each specimen were kept for analysis by in vitro amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. All specimens were analysed in quintriplicate, with 2 samples unspiked and 3 sampled spiked with M. tuberculosis. Appropriate positive and negative controls were included in all essays. Following amplification, the specimens were analysed by agarose gel electrophoresis (AGE). All specimens were further subject to hybridization studies using a specific radiolabelled probe. The sensitivity of the amplification assay coupled with visualization of the amplified targets using eithidium bromide staining was found to be about 1 fg of DNA. A total of 40 smear positive specimens were analyzed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive by PCR/hybridization analysis. (author). 13 refs, 1 tab

  2. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Directory of Open Access Journals (Sweden)

    Grace Q. Chen


    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.

  3. Human von Willebrand factor gene and pseudogene: Structural analysis and differentiation by polymerase chain reaction

    International Nuclear Information System (INIS)

    Structural analysis of the von Willebrand factor gene located on chromosome 12 is complicated by the presence of a partial unprocessed pseudogene on chromosome 22q11-13. The structures of the von Willebrand factor pseudogene and corresponding segment of the gene were determined, and methods were developed for the rapid differentiation of von Willebrand factor gene and pseudogene sequences. The pseudogene is 21-29 kilobases in length and corresponds to 12 exons (exons 23-34) of the von Willebrand factor gene. Approximately 21 kilobases of the gene and pseudogene were sequenced, including the 5' boundary of the pseudogene. The 3' boundary of the pseudogene lies within an 8-kb region corresponding to intron 34 of the gene. The presence of splice site and nonsense mutations suggests that the pseudogene cannot yield functional transcripts. The pseudogene has diverged ∼3.1% in nucleotide sequence from the gene. This suggests a recent evolutionary origin ∼19-29 million years ago, near the time of divergence of humans and apes from monkeys. Several repetitive sequences were identified, including 4 Alu, one Line-1, and several short simple sequence repeats. Several of these simple repeats differ in length between the gene and pseudogene and provide useful markers for distinguishing these loci. Sequence differences between the gene and pseudogene were exploited to design oligonucleotide primers for use in the polymerase chain reaction to selectivity amplify sequences corresponding to exons 23-34 from either the von Willebrand factor gene or the pseudogene. This method is useful for the analysis of gene defects in patients with von Willebrand disease, without interference from homologous sequences in the pseudogene

  4. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Jong Gyun Ahn


    Full Text Available &lt;B&gt;Purpose:&lt;/B&gt; Methods for quick and reliable detection of &lt;I&gt;Streptococcus pneumoniae&lt;/I&gt; are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving &lt;I&gt;S. pneumoniae -positive&lt;/i&gt; results. &lt;B&gt;Methods:&lt;/B&gt; Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. &lt;B&gt;Results:&lt;/B&gt; Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. &lt;B&gt;Conclusion:&lt;/B&gt; As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  5. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection (United States)

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve


    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  6. Projection methods for the numerical solution of Markov chain models (United States)

    Saad, Youcef


    Projection methods for computing stationary probability distributions for Markov chain models are presented. A general projection method is a method which seeks an approximation from a subspace of small dimension to the original problem. Thus, the original matrix problem of size N is approximated by one of dimension m, typically much smaller than N. A particularly successful class of methods based on this principle is that of Krylov subspace methods which utilize subspaces of the form span(v,av,...,A(exp m-1)v). These methods are effective in solving linear systems and eigenvalue problems (Lanczos, Arnoldi,...) as well as nonlinear equations. They can be combined with more traditional iterative methods such as successive overrelaxation, symmetric successive overrelaxation, or with incomplete factorization methods to enhance convergence.

  7. Renormalization group methods for the spectra of disordered chains

    International Nuclear Information System (INIS)

    A family of real space renormalization techniques for calculating the Green's functions of disordered chains is developed and explored. The techniques are based on a recently proposed renormalization method which is rederived here and shown to be equivalent to a virtual crystal approximation on a renormalized Hamiltonian. The derivation suggests how other conventional alloy methods can be coupled to the renormalization concept. Various examples are discussed. Short-range order in the occupation of alloy sites and very general disorder in the Hamiltonian; diagonal, off-diagonal and environmental, are readily incorporated. The techniques are exact in the limits of high and low concentration and of complete short-range order, and for the Lloyd model. All states are found to be localized in agreement with exact treatments. Results for the alloy density of states are presented for various cases and compared to numerical simulations on long chains (105 atoms). (Author)

  8. A Bootstrap Algebraic Multilevel method for Markov Chains

    CERN Document Server

    Bolten, M; Brannick, J; Frommer, A; Kahl, K; Livshits, I


    This work concerns the development of an Algebraic Multilevel method for computing stationary vectors of Markov chains. We present an efficient Bootstrap Algebraic Multilevel method for this task. In our proposed approach, we employ a multilevel eigensolver, with interpolation built using ideas based on compatible relaxation, algebraic distances, and least squares fitting of test vectors. Our adaptive variational strategy for computation of the state vector of a given Markov chain is then a combination of this multilevel eigensolver and associated multilevel preconditioned GMRES iterations. We show that the Bootstrap AMG eigensolver by itself can efficiently compute accurate approximations to the state vector. An additional benefit of the Bootstrap approach is that it yields an accurate interpolation operator for many other eigenmodes. This in turn allows for the use of the resulting AMG hierarchy to accelerate the MLE steps using standard multigrid correction steps. The proposed approach is applied to a rang...

  9. Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Eustaquio T


    Full Text Available Trisha Eustaquio, James F LearyWeldon School of Biomedical Engineering, Purdue University, West Lafayette, IN, USABackground: Determination of the fate of nanoparticles (NPs in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR, coined “nanobarcoding,” is demonstrated.Methods: Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV.Results: Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs, while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas.Conclusion: Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further

  10. Updating the Nuclear Reaction Rate Library (REACLIB) I. Experimental Reaction Rates of the Proton-Proton Chain

    International Nuclear Information System (INIS)

    REACLIB is one of the most comprehensive and popular astrophysical reaction rate libraries. However, its experimentally obtained rates for light isotopes still rely mainly on the Caughlan and Fowler (1988) compilation and have never been updated despite the progress in many relevant nuclear astrophysics experiments. Moreover, due to fitting errors REACLIB is not reliable at temperatures lower than 107K. In this work we establish the formalism for updating the obsolete Caughlan-Fowler experimental rates of REACLIB. Then we use the NACRE compilation and results from the LUNA experiments to update some important charged-particle induced rates of REACLIB focusing on the proton-proton chain. The updated rates (available also in digital form) can now be used in the low temperature regime (below 107K) which was forbidden to the old version of REACLIB. (authors)

  11. Relevance of semen polymerase chain reaction positive for tuberculosis in asymptomatic men undergoing infertility evaluation

    Directory of Open Access Journals (Sweden)

    Subodh Kumar Regmi


    Full Text Available OBJECTIVE: Male partners of infertile women with genital tuberculosis (TB are often screened for genital TB. We aimed to evaluate the clinical significance of a positive screening semen polymerase chain reaction (PCR for Mycobacterium tuberculosis test (TB-PCR in asymptomatic men undergoing infertility evaluation and determine the need for a detailed investigation and treatment for TB. MATERIALS AND METHODS: Between March 2012 and January 2013, male partners of 15 infertile women with a diagnosis of genitourinary TB (GUTB as the cause of infertility, tested positive either on semen PCR for TB (13 cases, or Mycobacterium Growth Indicator Tube-960 test (2 cases. These asymptomatic men underwent infertility evaluation along with evaluation for GUTB. Diagnosis of GUTB was based on standard clinical criteria, which included a high index of suspicion along with clinical, laboratory, and/or radiological evidence of GUTB. Men who had no clinical evidence of GUTB were followed up with clinical evaluation, semen analysis, and repeat semen PCR for TB after 6 months. RESULTS: Fourteen subjects consented for inclusion in the study. One had a history of pulmonary TB 20 years earlier. Another patient was found to have mediastinal lymphadenopathy (tubercular. All except one had a normal semen analysis. None of the patients met the standard clinical criteria for GUTB diagnosis. 8 patients followed up at 6 months with repeat semen analysis, which was similar to the baseline values and no clinical evidence of TB. INTERPRETATION AND CONCLUSIONS: Asymptomatic men with positive screening semen PCR for TB do not have clinical evidence of TB. Male partners of women with infertility and GUTB should not be screened if they have no symptoms.

  12. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine

    Directory of Open Access Journals (Sweden)

    K.R. Caleffi


    Full Text Available Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT and dapsone, rifampicin and clofazimine for borderline (BB and lepromatous (LL forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73 of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306. In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386. PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033. Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.


    Directory of Open Access Journals (Sweden)

    López-Montanero Edith Elizabeth


    Full Text Available Introduction: The citomegalovirus (CMV is an important virus worldwide. The early and mass-produced detection of the viral load for CMV helps to treat in an early way the infection and to avoid the disease in immunodeficient patients that in several cases could be lethal. Objective: To determine the prevalence of CMV in immunodeficient children who received bone marrow transplantation by means of real-time polymerase chain reaction. Methods: Retrospective, descriptive and cross-sectional study. The viral load was determined in plasma samples recollected since 2009 to 2012 in children who received bone marrow transplantation in the Hospital de la Sociedad de Lucha contra el Cáncer (SOLCA in Guayaquil, Ecuador. Results: 38 samples were analyzed. The average age was 7.2 years, and 57.9% (n=22 were men and 42.1% (n=16 women, with a male-female relationship 1:4. Of the analyzed samples, five patients presented positive results in the mentioned technique, who were the 80% of the female gender. And the population with the higher number of cases with positive results were Los Ríos, Guayas and Esmeraldas. The patients who were transplanted due to acute lymphoblastic leukemia and lymphoma with leukemization to acute lymphoblastic leukemia had positive results for active infection by CMV, 80% and 20%, respectively. Conclusion: The prevalence of CMV in children who received bone marrow transplantation by means of real-time polymerase chain reaction was of 13%, higher in the female gender. Rev.cienc.biomed. 2015;6(1:53-59 KEYWORDS Cytomegalovirus; Cytomegalovirus Infections; Transplant Recipients; Polymerase Chain Reaction.

  14. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G


    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  15. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan


    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  16. Zoster ... "a lmost" ... sine herpete: diagnostic utility of real time-polymerase chain reaction. (United States)

    Vena, Gino A; Apruzzi, Doriana; Vestita, Michelangelo; Calvario, Agata; Foti, Caterina; Cassano, Nicoletta


    Zoster sine herpete is a particular form of varicella zoster virus (VZV) infection characterized by segmental pain and dysesthesia, without any cutaneous lesions ever becoming perceptible. This report describes the case of a female patient, presenting with intercostal pain associated with a single papulo-vesicular lesion localized within the same area. Thanks to such a lesion, real time-polymerase chain reaction (PCR) analysis on vesicle fluid swab was possible, thus revealing a significant number of VZV genome copies. This innovative tool has proven essential to diagnose this abortive form of herpes zoster, which would otherwise have remained unidentified. PMID:21213602

  17. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.


    Patou, G.; Pillay, D.; Myint, S; Pattison, J.


    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  18. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.


    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J


    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...



    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini


    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  20. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots


    Liang Gaofeng; Ma Chao; Zhu Yanliang; Li Shuchun; Shao Youhua; Wang Yong; Xiao Zhongdang


    Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase ...

  1. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Miagostovich Marize Pereira


    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  2. Development and validation of a Myxoma virus real-time polymerase chain reaction assay


    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A


    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  3. Development and validation of a Myxoma virus real-time polymerase chain reaction assay. (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea


    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  4. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA


    Ana Lisa do Vale Gomes; Fábio L Melo; Roberto P Werkhauser; Frederico GC Abath


    This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR) protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA). Th...

  5. Ultra sensitive detection of Listeria monocytogenes in milk by the polymerase chain reaction (PCR). (United States)

    Starbuck, M A; Hill, P J; Stewart, G S


    The polymerase chain reaction (PCR) has been used to detect Listeria monocytogenes in whole milk at a level of 0.1 cfu per 30 ml. This high degree of sensitivity has been achieved following enzymatic digestion, polysulphonone membrane filtration and amplification of a nucleotide sequence within the promoter region of hlyA. Key elements of the procedure are the absence of enrichment culture and a complete solubilization of the membrane filter, ensuring total nucleic acid recovery. The simplicity of the protocol coupled with high sample volumes and exquisite sensitivity extends the relevance of PCR within food and environmental microbiology. PMID:1368996

  6. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.


    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W


    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  7. Use of the Polymerase Chain Reaction in the Detection of Bovine Leukosis


    Kelly, Emma Jane


    A diagnostic test for bovine leukosis was developed using the polymerase chain reaction (PCR) to amplify a 375 base pair region in the gag gene of the proviral genome. Blood samples were collected from 3 adult Holstein cows shown to be infected with bovine leukosis virus (BLV) by the agar-gel immunodiffusion (AGID) technique. The 3 samples were mixed and the composite blood was used to inoculate 10 cows. Five of the cows were inoculated with 0.1 ml of blood, and the other cows were inocula...

  8. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction


    Alexandrakis, G.; JALALI, S; Gloor, P


    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In o...

  9. A Novel Nested Polymerase Chain Reaction (n-PCR) Assay for Identifying Sorghum nitidum


    Wei, Shasha; Zhirui DENG; Liping YIN; Yi, Jianping; Renqi WU; Qin CHEN


    This work developed a novel nested polymerase chain reaction (n-PCR) assay to identify Sorghum nitidum (S. nitidum). It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band ...

  10. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.


    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D


    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions ...

  11. Synthesis and Intramolecular [4+2] Cycloaddition Reactions of 4-Pyridazinecarbonitriles with Alkyne Side Chains


    Norbert Haider; Günther Fülep


    The preparation of a series of new 3-(alkynyl-X)-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH) is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2]...

  12. LISA data analysis using Markov chain Monte Carlo methods

    International Nuclear Information System (INIS)

    The Laser Interferometer Space Antenna (LISA) is expected to simultaneously detect many thousands of low-frequency gravitational wave signals. This presents a data analysis challenge that is very different to the one encountered in ground based gravitational wave astronomy. LISA data analysis requires the identification of individual signals from a data stream containing an unknown number of overlapping signals. Because of the signal overlaps, a global fit to all the signals has to be performed in order to avoid biasing the solution. However, performing such a global fit requires the exploration of an enormous parameter space with a dimension upwards of 50 000. Markov Chain Monte Carlo (MCMC) methods offer a very promising solution to the LISA data analysis problem. MCMC algorithms are able to efficiently explore large parameter spaces, simultaneously providing parameter estimates, error analysis, and even model selection. Here we present the first application of MCMC methods to simulated LISA data and demonstrate the great potential of the MCMC approach. Our implementation uses a generalized F-statistic to evaluate the likelihoods, and simulated annealing to speed convergence of the Markov chains. As a final step we supercool the chains to extract maximum likelihood estimates, and estimates of the Bayes factors for competing models. We find that the MCMC approach is able to correctly identify the number of signals present, extract the source parameters, and return error estimates consistent with Fisher information matrix predictions

  13. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana


    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  14. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto


    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  15. Vibrational nonequilibrium in chain branching reactions of hydrogen combustion using quasi-classical trajectory analysis (United States)

    Voelkel, Stephen; Raman, Venkat; Varghese, Philip


    In high-speed reactive flows in scramjets, thermal nonequilibrium is introduced in the flow via shock waves. Though rotational and translational energy modes relax back to equilibrium quickly, vibrational relaxation is comparable to the bulk mixing and reaction timescales. The discrepancy between vibration and rotation/translation energy distributions can dramatically alter on the initiation of the fuel oxidation process. For continuum-scale applications, thermal nonequilibrium effects are derived from the rovibrational state-specific reaction and scattering rates associated with the chemical mechanism. In this work, the state-specific reaction rates are calculated for the chain branching reactions in the hydrogen combustion mechanism using a quasi-classical trajectory (QCT) framework. The state-specific rates are incorporated into a multiple temperature continuum-scale model whereby each species is characterized by a Boltzmann distribution parametrized by its own vibrational temperature. The flame ignition rates are implemented in a CFD code to simulate a reactive coflow. Funded by AFOSR FA9550-12-1-0460.

  16. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction. (United States)

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin


    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems. PMID:17904730

  17. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. (Univ. of Illinois, Chicago (USA)); Wunder, J.S.; Andrulis, I.L. (Mount Sinai Hospital, Toronto, Ontario (Canada)); Gazdar, A.F. (National Cancer Inst., Bethesda, MD (USA)); Willman, C.L.; Griffith, B. (Univ. of New Mexico, Albuquerque (USA)); Von Hoff, D.D. (Univ. of Texas, San Antonio (USA))


    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  18. Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications. (United States)

    Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai


    Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA

  19. On Diagnostic Index and Method of Healthy Wetland Food Chain

    Directory of Open Access Journals (Sweden)

    Li-Juan Cui


    Full Text Available Wetland food chain is the channel of the matter and energy transfer or flow in the wetland ecosystem. From wetland food chain scission mechanism, the structure and functional characteristics of the wetland food chain scission were analyzed, while building a healthy wetland food chain diagnostic index system. Depending on wetland ecosystem health research results, this study brought forward the wetland food chain structure stability and functions of wetland energy measures and their quantitative calculation formula and finally we gave the healthy wetland food chain diagnosis process in order to provide scientific basis for wetland food chain restoration.

  20. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  1. On Diagnostic Index and Method of Healthy Wetland Food Chain


    Li-Juan Cui; Xin-sheng Zhao; Wei Li


    Wetland food chain is the channel of the matter and energy transfer or flow in the wetland ecosystem. From wetland food chain scission mechanism, the structure and functional characteristics of the wetland food chain scission were analyzed, while building a healthy wetland food chain diagnostic index system. Depending on wetland ecosystem health research results, this study brought forward the wetland food chain structure stability and functions of wetland energy measures and their quantitati...

  2. Implementation of polymerase chain reaction (PCR and Real-Time PCR in quick identification of bovine herpesvirus 1

    Directory of Open Access Journals (Sweden)

    Milić Nenad


    Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.

  3. Semiclassical methods in chemical reaction dynamics

    International Nuclear Information System (INIS)

    Semiclassical approximations, simple as well as rigorous, are formulated in order to be able to describe gas phase chemical reactions in large systems. We formulate a simple but accurate semiclassical model for incorporating multidimensional tunneling in classical trajectory simulations. This model is based on the existence of locally conserved actions around the saddle point region on a multidimensional potential energy surface. Using classical perturbation theory and monitoring the imaginary action as a function of time along a classical trajectory we calculate state-specific unimolecular decay rates for a model two dimensional potential with coupling. Results are in good comparison with exact quantum results for the potential over a wide range of coupling constants. We propose a new semiclassical hybrid method to calculate state-to-state S-matrix elements for bimolecular reactive scattering. The accuracy of the Van Vleck-Gutzwiller propagator and the short time dynamics of the system make this method self-consistent and accurate. We also go beyond the stationary phase approximation by doing the resulting integrals exactly (numerically). As a result, classically forbidden probabilties are calculated with purely real time classical trajectories within this approach. Application to the one dimensional Eckart barrier demonstrates the accuracy of this approach. Successful application of the semiclassical hybrid approach to collinear reactive scattering is prevented by the phenomenon of chaotic scattering. The modified Filinov approach to evaluating the integrals is discussed, but application to collinear systems requires a more careful analysis. In three and higher dimensional scattering systems, chaotic scattering is suppressed and hence the accuracy and usefulness of the semiclassical method should be tested for such systems

  4. Semiclassical methods in chemical reaction dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Keshavamurthy, S.


    Semiclassical approximations, simple as well as rigorous, are formulated in order to be able to describe gas phase chemical reactions in large systems. We formulate a simple but accurate semiclassical model for incorporating multidimensional tunneling in classical trajectory simulations. This model is based on the existence of locally conserved actions around the saddle point region on a multidimensional potential energy surface. Using classical perturbation theory and monitoring the imaginary action as a function of time along a classical trajectory we calculate state-specific unimolecular decay rates for a model two dimensional potential with coupling. Results are in good comparison with exact quantum results for the potential over a wide range of coupling constants. We propose a new semiclassical hybrid method to calculate state-to-state S-matrix elements for bimolecular reactive scattering. The accuracy of the Van Vleck-Gutzwiller propagator and the short time dynamics of the system make this method self-consistent and accurate. We also go beyond the stationary phase approximation by doing the resulting integrals exactly (numerically). As a result, classically forbidden probabilties are calculated with purely real time classical trajectories within this approach. Application to the one dimensional Eckart barrier demonstrates the accuracy of this approach. Successful application of the semiclassical hybrid approach to collinear reactive scattering is prevented by the phenomenon of chaotic scattering. The modified Filinov approach to evaluating the integrals is discussed, but application to collinear systems requires a more careful analysis. In three and higher dimensional scattering systems, chaotic scattering is suppressed and hence the accuracy and usefulness of the semiclassical method should be tested for such systems.

  5. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes (United States)

    Thabit, Abrar K; Nicolau, David P


    Background Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated. Aim We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day), length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting. Methods Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest. Results The most common ribotypes were 027 (38%), 014/020 (21%), and 106/174 (21%). Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2). The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively). Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6). Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters), although the degree of nausea/vomiting did not differ between the three groups (P=0.3). A serum creatinine level ≥1.5 times the premorbid level was seen in only three patients, each infected with a different ribotype. Conclusion Although these data provide a baseline assessment of outcomes to aid in the design of future studies, the diversity of C. difficile ribotypes within the population must be considered, and additional work with other ribotypes

  6. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    Directory of Open Access Journals (Sweden)

    Thabit AK


    Full Text Available Abrar K Thabit,1,2 David P Nicolau1,3 1Center for Anti-Infective Research and Development, Hartford Hospital, Hartford, CT, USA; 2Faculty of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia; 3Division of Infectious Diseases, Hartford Hospital, Hartford, CT, USA Background: Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated.Aim: We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day, length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting.Methods: Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest.Results: The most common ribotypes were 027 (38%, 014/020 (21%, and 106/174 (21%. Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2. The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively. Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6. Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters, although the degree of nausea/vomiting did not differ between the three groups (P=0.3. A serum creatinine level ≥1.5 times the premorbid level was seen in only three

  7. Determining the Diagnostic Value of Mycobacterium Tuberculosis DNA in the Differentiation of Blood Samples of Patients with Active Pulmonary Tuberculosis and Healthy Controls Using Polymerase Chain Reaction


    Abasali Niazi; Nezarali Muolai; Mosayeb Shahriar; Reza Karimian; Farzaneh Peykfalak


    Background: Tuberculosis (TB) is now a major cause of mortality and morbidity in the world. Nowadays, different methods are used to diagnose tuberculosis. Although classical microbiological methods (such as sputum smear) are specific, they have little sensitivity and the culture is also time-consuming. Using Polymerase Chain Reaction (PCR) in blood samples in terms of Mycobacterium tuberculosis DNA, this study examines diagnostic power of this test in the diagnosis of pulmonary tuberculosis c...

  8. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection


    Vasuki Venkatesan; Sugeerappa Laxmanappa Hoti; Nagalakshmi Kamaraj; Somnath Ghosh; Kaushik Rajaram


    Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence ...

  9. Novel enzyme immunoassay and optimized DNA extraction for the detection of polymerase-chain-reaction-amplified viral DNA from paraffin-embedded tissue.


    Merkelbach, S.; Gehlen, J.; Handt, S.; Füzesi, L


    Four different DNA extraction methods were compared to determine their ability to provide DNA for amplification of viral sequences from paraffin-embedded human tissue samples by polymerase chain reaction (PCR). The suitability of extraction methods was assessed using parameters like DNA yield, length of recovered DNA fragments, and duration. Furthermore, the efficiency of amplifying a human single-copy gene, the beta-globin gene, from DNA samples was tested. The best preservation of DNA molec...


    Directory of Open Access Journals (Sweden)

    A. Geekie


    Full Text Available

    ENGLISH ABSTRACT: Methods for sizing project and feeding buffers for critical chain project management are investigated. Experiments indicate that – in the absence of bias, and for certain classes of bias – buffer consumption is independent of the mean duration of a chain. Generally the popular method – a buffer size equal to 50% of the longest path leading to it – gives rise to excessively large buffers. Buffers sized according to the square root of the sum of squares perform well in the absence of bias, but with bias present the performance is unacceptably poor. A new approach to buffer sizing is proposed.

    AFRIKAANSE OPSOMMING: Metodes vir groottebepaling van projek- en saamvloeibuffers vir kritieke-ketting projekbestuur word ondersoek. Eksperimente dui daarop dat – in die afwesigheid van onewewigtigheid, en vir sekere tipes onewewigtigheid – bufferverbruik onafhanklik is van die gemiddelde lengte van ’n ketting. Oor die algemeen veroorsaak die metode van buffergrootte – gelyk aan 50% van die langste pad wat tot die buffer lei – onnodige groot buffers. Buffers bepaal met die metode van die vierkantswortel van die som van kwadrate, vaar goed in die afwesigheid van onewewigtigheid, maar vaar onaanvaarbaar swak wanneer onewewigtigheid teenwoordig is. ’n Nuwe metode vir die bepaling van buffergrootte word voorgestel.

  11. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women


    Parvin Hassanzadeh; Hosein Sharifi; Abdollah Bazargani; Reza Khashei; Amir Emami; Mohammad Motamedifar


    Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain r...



    Esterhuizen, Dirk; van Rooyen, C.J.


    The South African agricultural industry is consistently challenged to increase its competitiveness. The agribusiness supply chain starts with the input sector. The objective of this paper is therefore to determine the competitiveness of the various agricultural input industries in South Africa by using Balassa's method of Revealed Comparative Trade Advantage. This status will then be related to performance of the agricultural industry as a whole. South African manufacturing of farming requisi...

  13. [The use of polymerase chain reaction in laboratory diagnosis of dermatophytosis]. (United States)

    Tiryaki, Yasin; Gültekin Korkmazgil, Berna; Eyigör, Mete; Aydın, Neriman


    Dermatophytes are among the common causes of fungal infections in the community. Classical diagnostic tests for dermatophytosis have some disadvantages such as failure of direct microscopy in species differentiation and culture methods being time consuming and having low sensitivity. The aim of this study was to investigate the performance of polymerase chain reaction (PCR) in the identification of dermatophytes directly from the clinical samples and the cultures. A total of 123 samples that comprise 63 skin and 60 nail scrapings obtained from 110 patients (69 female, 41 male; age range: 4-82 years) who were prediagnosed as dermatophytosis, were included in the study. Samples were examined with routine direct microscopy, culture and two different nested PCR (nPCR) protocols. The first was a pan-dermatophyte nPCR protocol targeting chitin synthase gene (CHS-1) of dermatophytes and the second was a nPCR protocol which targets specific ITS-1 genes of Trichophyton rubrum and T.mentagrophytes. Similar PCR methods were also applied to cultivated strains. Sequence analysis was performed for the samples that yielded positive results in pan-dermatophyte nPCR and negative results in T.rubrum/T.mentagrophytes - specific nPCR. Hyphae and/or spore structures were observed in 62 (50%) samples with direct microscopic examination and dermatophytes were isolated in 30 (24%) samples. Twenty-eight of the isolates grown in culture were identified as T.rubrum, and two as T.mentagrophytes with T.rubrum/T.mentagrophytes-specific nPCR protocol. In direct application, 67 (55%) of the clinical samples were found positive with pan-dermatophyte nPCR and 65 (53%) were positive with T.rubrum/T.mentagrophytes-specific nPCR. Samples which were negative in direct microscopic examination were also negative in culture. Nine of them were found positive with pan-dermatophyte nPCR and eight were positive with T.rubrum/T.mentagrophytes-specific nPCR. Two of the 30 samples which were positive in culture

  14. Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis.

    Directory of Open Access Journals (Sweden)

    Melissa K Gregory

    Full Text Available BACKGROUND: Δ6-Desaturase (Fads2 is widely regarded as rate-limiting in the conversion of dietary α-linolenic acid (18:3n-3; ALA to the long-chain omega-3 polyunsaturated fatty acid docosahexaenoic acid (22:6n-3; DHA. However, increasing dietary ALA or the direct Fads2 product, stearidonic acid (18:4n-3; SDA, increases tissue levels of eicosapentaenoic acid (20:5n-3; EPA and docosapentaenoic acid (22:5n-3; DPA, but not DHA. These observations suggest that one or more control points must exist beyond ALA metabolism by Fads2. One possible control point is a second reaction involving Fads2 itself, since this enzyme catalyses desaturation of 24:5n-3 to 24:6n-3, as well as ALA to SDA. However, metabolism of EPA and DPA both require elongation reactions. This study examined the activities of two elongase enzymes as well as the second reaction of Fads2 in order to concentrate on the metabolism of EPA to DHA. METHODOLOGY/PRINCIPAL FINDINGS: The substrate selectivities, competitive substrate interactions and dose response curves of the rat elongases, Elovl2 and Elovl5 were determined after expression of the enzymes in yeast. The competitive substrate interactions for rat Fads2 were also examined. Rat Elovl2 was active with C(20 and C(22 polyunsaturated fatty acids and this single enzyme catalysed the sequential elongation reactions of EPA→DPA→24:5n-3. The second reaction DPA→24:5n-3 appeared to be saturated at substrate concentrations not saturating for the first reaction EPA→DPA. ALA dose-dependently inhibited Fads2 conversion of 24:5n-3 to 24:6n-3. CONCLUSIONS: The competition between ALA and 24:5n-3 for Fads2 may explain the decrease in DHA levels observed after certain intakes of dietary ALA have been exceeded. In addition, the apparent saturation of the second Elovl2 reaction, DPA→24:5n-3, provides further explanations for the accumulation of DPA when ALA, SDA or EPA is provided in the diet. This study suggests that Elovl2 will be

  15. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    P. D. Luka


    Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.

  16. Surrogate reaction methods for neutron induced cross-sections

    International Nuclear Information System (INIS)

    A brief discussion on surrogate reaction methods and some of the recent results on neutron induced fission cross-section measurements carried out by our group and the possibility of extending the measurements for determining (n,g), (n,2n) and (n,p) reaction cross-sections by surrogate reaction method are presented

  17. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan


    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  18. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi


    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  19. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  20. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Directory of Open Access Journals (Sweden)

    Liang Gaofeng


    Full Text Available Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR. Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA. The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  1. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane


    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  2. Detection of hepatopancreatic parvovirus (HPV) in wild shrimp from India by nested polymerase chain reaction (PCR). (United States)

    Manjanaik, B; Umesha, K R; Karunasagar, Indrani; Karunasagar, Iddya


    The prevalence of hepatopancreatic parvovirus (HPV) in wild penaeid shrimp samples from India was studied by nested polymerase chain reaction (PCR) using primers designed in our laboratory. The virus could be detected in 9 out of 119 samples by non-nested PCR. However, by nested PCR 69 out of 119 samples were positive. The PCR results were confirmed by hybridization with digoxigenin-labelled DNA probe. Shrimp species positive by non-nested PCR included Penaeus monodon, Penaeus indicus and Penaeus semisulcatus and by nested PCR Parapenaeopsis stylifera, Penaeus japonicus, Metapenaeus monoceros, M. affinis, M. elegans, M. dobsoni, M. ensis and Solenocera choprai. This is the first report on the prevalence of HPV in captured wild shrimp from India. PMID:15819441

  3. Midtrimester fetal herpes simplex-2 diagnosis by serology, culture and quantitative polymerase chain reaction. (United States)

    Curtin, William M; Menegus, Marilyn A; Patru, Maria-Magdalena; Peterson, C Jeanne; Metlay, Leon A; Mooney, Robert A; Stanwood, Nancy L; Scheible, Amy L; Dorgan, Angela


    The acquisition of herpes simplex virus (HSV) in utero comprises a minority of neonatal herpes infections. Prenatal diagnosis is rare. We describe a midtrimester diagnosis of fetal HSV-2 infection. Ultrasound at 20 weeks for elevated maternal serum α-fetoprotein (MSAFP) showed lagging fetal growth, echogenic bowel, echogenic myocardium, and liver with a mottled pattern of echogenicity. Amniocentesis demonstrated normal karyotype, elevated AFP and positive acetylcholinesterase. Culture isolated HSV-2 with an aberrant growth pattern. Maternal serology was positive for HSV-2. Quantitative DNA polymerase chain reaction (PCR) showed 59 million copies/ml. Fetal autopsy demonstrated widespread tissue necrosis but only sparse HSV-2 inclusions. Fetal HSV-2 infection can be suspected when an elevated MSAFP accompanies ultrasound findings suggesting perinatal infection. Maternal HSV serology, amniotic fluid culture and quantitative PCR are recommended for diagnostic certainty and counseling. PMID:23075531

  4. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Directory of Open Access Journals (Sweden)

    Seiki Kuramitsu


    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  5. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction. (United States)

    Alexander, H S; Key, D W; Nagy, E


    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb BamHI fragment of the Ontario 1598 ILTV strain. Thirty-four of the Ontario isolates and all of the New Brunswick isolates were amplified successfully. This suggests that the selected primers would be useful for the majority of the isolates encountered in outbreaks of ILTV. Images Figure 1. Figure 2. PMID:9442943

  6. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S


    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.


    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha


    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  8. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction. (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng


    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  9. Functional Bethe ansatz methods for the open XXX chain

    International Nuclear Information System (INIS)

    We study the spectrum of the integrable open XXX Heisenberg spin chain subject to non-diagonal boundary magnetic fields. The spectral problem for this model can be formulated in terms of functional equations obtained by separation of variables or, equivalently, from the fusion of transfer matrices. For generic boundary conditions the eigenvalues cannot be obtained from the solution of finitely many algebraic Bethe equations. Based on careful finite size studies of the analytic properties of the underlying hierarchy of transfer matrices we devise two approaches to analyze the functional equations. First we introduce a truncation method leading to Bethe-type equations determining the energy spectrum of the spin chain. In a second approach, the hierarchy of functional equations is mapped to an infinite system of nonlinear integral equations of TBA type. The two schemes have complementary ranges of applicability and facilitate an efficient numerical analysis for a wide range of boundary parameters. Some data are presented on the finite-size corrections to the energy of the state which evolves into the antiferromagnetic ground state in the limit of parallel boundary fields.

  10. The use of polymerase chain reaction for early diagnosis of tuberculosis in Mycobacterium tuberculosis culture

    Directory of Open Access Journals (Sweden)

    M. Chagas


    Full Text Available Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7% and specificity (60% were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

  11. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.


    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  12. Method for predicting enzyme-catalyzed reactions (United States)

    Hlavacek, William S.; Unkefer, Clifford J.; Mu, Fangping; Unkefer, Pat J.


    The reactivity of given metabolites is assessed using selected empirical atomic properties in the potential reaction center. Metabolic reactions are represented as biotransformation rules. These rules are generalized from the patterns in reactions. These patterns are not unique to reactants but are widely distributed among metabolites. Using a metabolite database, potential substructures are identified in the metabolites for a given biotransformation. These substructures are divided into reactants or non-reactants, depending on whether they participate in the biotransformation or not. Each potential substructure is then modeled using descriptors of the topological and electronic properties of atoms in the potential reaction center; molecular properties can also be used. A Support Vector Machine (SVM) or classifier is trained to classify a potential reactant as a true or false reactant using these properties.

  13. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization. (United States)

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J


    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968


    Directory of Open Access Journals (Sweden)



    Full Text Available Yeast Saccharomyces cerevisiae is an excellent model to studi genes function of eukarotic cells such as study of gene encoding protein phosphatase PTC2. Novel phenotypic caused by mutated gene is an important step to study function of gene. In this study constructed mutant of PTC2 gene encoding protein phosphatase. Method that used in this construction was replacement of target gene (PTC2 with auxotroph marker Candida albicans HIS3 by Polymer Chain Reaction (PCR or called by PCR-mediated disruption. Mutant colonies which grew in selective medium SC without histidine were confirmed by PCR amplification. By using 1% Agarose gel electrophoresis the result showed that size of ptc2D::CgHIS3 transformant was 3.52 kb while wild type strain was 2.9 kb, indicated that ptc2D::CgHIS3 has integrated on chromosome V replacing PTC2 wild type.

  15. Quantification of Porcine Follicle-stimulating Hormone Receptor Messenger Ribonucleic Acid by Reverse Transcription-competitive Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)


    An easy and reliable method was developed for construction and quantification of competitive templates, which shared the same sequence as the amplified target DNA except for a 20-bp insertion in the middle by recombinant polymerase chain reaction (PCR). Among the advantages of competitive PCR is that any predictable or unpredictable variable that affects amplification has the same effect on both target and competitor species and that the final ratio of amplified products reflects exactly the initial targets. The utilization of a thermostable reverse transcriptase in the RT step was proposed to overcome the problem of the efficiency of target cDNA synthesis. In addition, to obtain reliable measurements, it was recommended to perform four PCR with amounts of competitive template flanking the concentration of the target mRNA.

  16. An allele-specific polymerase chain reaction assay for the differentiation of members of the Anopheles culicifacies complex

    Indian Academy of Sciences (India)

    O P Singh; Geeta Goswami; N Nanda; K Raghavendra; D Chandra; S K Subbarao


    Anopheles culicifacies, the principal vector of malaria in India, is a complex of five cryptic species which are morphologically indistinguishable at any stage of life. In view of the practical difficulties associated with classical cytotaxonomic method for the identification of members of the complex, an allele-specific polymerase chain reaction (ASPCR) assay targeted to the D3 domain of 28S ribosomal DNA was developed. The assay discriminates An. culicifacies species A and D from species B, C and E. The assay was validated using chromosomally-identified specimens of An. culicifacies from different geographical regions of India representing different sympatric associations. The assay correctly differentiates species A and D from species B, C and E. The possible use of this diagnostic assay in disease vector control programmes is discussed.

  17. Development of a multiplex polymerase chain reaction to detect five common Gram-negative bacteria of aquatic animals. (United States)

    Tsai, M-A; Ho, P-Y; Wang, P-C; E, Y-J; Liaw, L-L; Chen, S-C


    A multiplex polymerase chain reaction (m-PCR) technique was developed as a rapid and accurate diagnostic tool for identifying five major Gram-negative bacilli -Vibrio vulnificus, V. parahaemolyticus, Aeromonas hydrophila, Chryseobacterium meningosepticum and Edwardsiella tarda- that cause major diseases in cultured aquatic animals in Taiwan. The expected amplicons for V. vulnificus, V. parahaemolyticus, A. hydrophila, C. meningosepticum and E. tarda were 410, 368, 685, 180 and 230bp, respectively. The assay was shown to be specific for the target pathogens. The sensitivities of detection were estimated to be 20.5fg∼200pg of genomic DNA or 10(2) ∼10(4) colony-forming units (cfu) of bacterial isolates when adopted as PCR templates. The m-PCR was capable of simultaneously amplifying target fragments from bacterial genome DNA mixed with the DNA extracted from viscera and tissues taken from fish without affecting the performance of the method. PMID:22571515

  18. Detection of Nesopora caninum-specific DNA from cerebrospinal fluid by polymerase chain reaction in a dog with confirmed neosporosis. (United States)

    Ishigaki, Kyohei; Noya, Masahiko; Kagawa, Yumiko; Ike, Kazunori; Orima, Hiromitsu; Imai, Soichi


    A one-month male Greyhound dog presented with a swinging gait of the hindlimbs, and later developed muscular atrophy of the femoral region and hyperextension of hindlimbs. The dog had positive serum IFAT titers to Neospora caninum, but a negative titer in the cerebrospinal fluid (CSF). N. caninum-specific DNA was amplified from the CSF using a semi-nested polymerase chain reaction assay. Clusters of protozoa in biopsied muscle fibers were subsequently confirmed as N. caninum tachyzoites by immunohistochemical examination. Early recognition and treatment are necessary for effective recovery of clinical canine neosporosis, but antemortem diagnosis is difficult. We suggest that the detection of parasite deoxyribonucleic acid in the CSF is a useful antemortem diagnostic method in facilitating treatment of this disease. PMID:22446406

  19. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

    International Nuclear Information System (INIS)

    Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

  20. Method of integral transforms for calculating few-body reactions


    Efros, V. D.; Leidemann, W.; Orlandini, G.


    A non-conventional approach to calculating reactions in quantum mechanics is presented. Reaction observables are obtained with bound state calculation techniques. The accuracy of the method to calculate few-nucleon response functions is discussed.

  1. Differential detection of turkey coronavirus, infectious bronchitis virus, and bovine coronavirus by a multiplex polymerase chain reaction. (United States)

    Loa, C C; Lin, T L; Wu, C C; Bryan, T A; Hooper, T A; Schrader, D L


    The objective of the present study was to develop a multiplex polymerase chain reaction (PCR) method for differential detection of turkey coronavirus (TCoV), infectious bronchitis coronavirus (IBV), and bovine coronavirus (BCoV). Primers were designed from conserved or variable regions of nucleocapsid (N) or spike (S) protein gene among TCoV, IBV, and BCoV and used in the same PCR reaction. Reverse transcription followed by the PCR reaction was used to amplify a portion of N or S gene of the corresponding coronaviruses. The PCR products were detected on agarose gel stained with ethidium bromide. Two PCR products, a 356-bp band corresponding to N gene and a 727-bp band corresponding to S gene, were obtained for TCoV isolates. In contrast, one PCR product of 356 bp corresponding to a fragment of N gene was obtained for IBV strains and one PCR product of 568 bp corresponding to a fragment of S gene was obtained for BCoV. There were no PCR products with the same primers for Newcastle disease virus, Marek's disease virus, turkey pox virus, pigeon pox virus, fowl pox virus, reovirus, infectious bursal disease virus, enterovirus, astrovirus, Salmonella enterica, Escherichia coli, and Mycoplasma gallisepticum. Performance of the assay with serially diluted RNA demonstrated that the multiplex PCR could detect 4.8x10(-3) microg of TCoV RNA, 4.6x10(-4) microg of IBV RNA, and 8.0x10(-2) microg of BCoV RNA. These results indicated that the multiplex PCR as established in the present study is a rapid, sensitive, and specific method for differential detection of TCoV, IBV, and BCoV in a single PCR reaction. PMID:16137773

  2. Computational Catalysis Using the Artificial Force Induced Reaction Method. (United States)

    Sameera, W M C; Maeda, Satoshi; Morokuma, Keiji


    The artificial force induced reaction (AFIR) method in the global reaction route mapping (GRRM) strategy is an automatic approach to explore all important reaction paths of complex reactions. Most traditional methods in computational catalysis require guess reaction paths. On the other hand, the AFIR approach locates local minima (LMs) and transition states (TSs) of reaction paths without a guess, and therefore finds unanticipated as well as anticipated reaction paths. The AFIR method has been applied for multicomponent organic reactions, such as the aldol reaction, Passerini reaction, Biginelli reaction, and phase-transfer catalysis. In the presence of several reactants, many equilibrium structures are possible, leading to a number of reaction pathways. The AFIR method in the GRRM strategy determines all of the important equilibrium structures and subsequent reaction paths systematically. As the AFIR search is fully automatic, exhaustive trial-and-error and guess-and-check processes by the user can be eliminated. At the same time, the AFIR search is systematic, and therefore a more accurate and comprehensive description of the reaction mechanism can be determined. The AFIR method has been used for the study of full catalytic cycles and reaction steps in transition metal catalysis, such as cobalt-catalyzed hydroformylation and iron-catalyzed carbon-carbon bond formation reactions in aqueous media. Some AFIR applications have targeted the selectivity-determining step of transition-metal-catalyzed asymmetric reactions, including stereoselective water-tolerant lanthanide Lewis acid-catalyzed Mukaiyama aldol reactions. In terms of establishing the selectivity of a reaction, systematic sampling of the transition states is critical. In this direction, AFIR is very useful for performing a systematic and automatic determination of TSs. In the presence of a comprehensive description of the transition states, the selectivity of the reaction can be calculated more accurately

  3. Semi-Nested Real-Time Reverse Transcription Polymerase Chain Reaction Methods for the Successful Quantitation of Cytokeratin mRNA Expression Levels for the Subtyping of Non-Small-Cell Lung Carcinoma Using Paraffin-Embedded and Microdissected Lung Biopsy Specimens

    International Nuclear Information System (INIS)

    In patients with inoperable advanced non-small cell lung carcinomas (NSCLCs), histological subtyping using small-mount biopsy specimens was often required to decide the indications for drug treatment. The aim of this study was to assess the utility of highly sensitive mRNA quantitation for the subtyping of advanced NSCLC using small formalin fixing and paraffin embedding (FFPE) biopsy samples. Cytokeratin (CK) 6, CK7, CK14, CK18, and thyroid transcription factor (TTF)-1 mRNA expression levels were measured using semi-nested real-time quantitative (snq) reverse-transcribed polymerase chain reaction (RT-PCR) in microdissected tumor cells collected from 52 lung biopsies. Our results using the present snqRT-PCR method showed an improvement in mRNA quantitation from small FFPE samples, and the mRNA expression level using snqRT-PCR was correlated with the immunohistochemical protein expression level. CK7, CK18, and TTF-1 mRNA were expressed at significantly higher levels (P<0.05) in adenocarcinoma (AD) than in squamous cell carcinoma (SQ), while CK6 and CK14 mRNA expression was significantly higher (P<0.05) in SQ than in AD. Each histology-specific CK, particularly CK18 in AD and CK6 in SQ, were shown to be correlated with a poor prognosis (P=0.02, 0.02, respectively). Our results demonstrated that a quantitative CK subtype mRNA analysis from lung biopsy samples can be useful for predicting the histology subtype and prognosis of advanced NSCLC

  4. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;


    reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  5. Leptospira spp detection by Polymerase Chain Reaction (PCR) in clinical samples of captive black-capped Capuchin monkey (Cebus apella)


    Scarcelli Eliana; Piatti Rosa Maria; Fedullo José Daniel Luzes; Simon Faiçal; Cardoso Maristela Vasconcellos; Castro Vanessa; Miyashiro Simone; Genovez Margareth Élide


    Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR), in clinical samples from one captive black...

  6. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation. (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K


    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  7. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction (United States)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant


    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  8. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip (United States)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang


    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  9. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  10. Real-time polymerase chain reaction for diagnosis and quantitation of negative strand of chikungunya virus. (United States)

    Chiam, Chun Wei; Chan, Yoke Fun; Loong, Shih Keng; Yong, Sara Su Jin; Hooi, Poh Sim; Sam, I-Ching


    Quantitative real-time polymerase chain reaction (qRT-PCR) is useful for diagnosis and studying virus replication. We developed positive- and negative-strand qRT-PCR assays to detect nsP3 of chikungunya virus (CHIKV), a positive-strand RNA alphavirus that causes epidemic fever, rash, and arthritis. The positive- and negative-strand qRT-PCR assays had limits of quantification of 1 and 3 log10 RNA copies/reaction, respectively. Compared to a published E1 diagnostic assay using 30 laboratory-confirmed clinical samples, the positive-strand nsP3 qRT-PCR assay had higher R(2) and efficiency and detected more positive samples. Peak viral load of 12.9 log(10) RNA copies/mL was reached on day 2 of illness, and RNA was detectable up to day 9, even in the presence of anti-CHIKV IgM. There was no correlation between viral load and persistent arthralgia. The positive-strand nsP3 assay is suitable for diagnosis, while the negative-strand nsP3 assay, which uses tagged primers to increase specificity, is useful for study of active viral replication kinetics. PMID:23886793

  11. Comparison of the direct fluorescence assay and real-time polymerase chain reaction for the detection of influenza virus A and B in immunocompromised patients

    Directory of Open Access Journals (Sweden)

    Ana Helena Perosa


    Full Text Available OBJECTIVE: This study evaluated the diagnostic performance of two methods for the detection of influenza virus in immunocompromised transplant patients. METHODS: A total of 475 respiratory samples, 236 from patients in a hematopoietic stem cell transplantation program and 239 from kidney transplant patients, were analyzed by a direct fluorescence assay and the Centers for Disease Control real-time polymerase chain reaction protocol for influenza A and B detection. RESULTS: Influenza detection using either method was 7.6% in the hematopoietic stem cell transplant group and 30.5% in the kidney transplant patient group. Influenza detection by real-time polymerase chain reaction yielded a higher positive rate compared with fluorescence than that reported by other studies, and this difference was more pronounced for influenza A. The fluorescence assay sensitivity, specificity, positive and negative predictive values, and kappa coefficient were 17.6%, 100%, 1, 0.83, and 0.256, respectively, and lower detection rates occurred in the kidney transplant patients. CONCLUSIONS: The real-time polymerase chain reaction performance and the associated turnaround time for a large number of samples support the choice of this method for use in different routine diagnostic settings and influenza surveillance in high-risk patients.

  12. Prenatal diagnosis of Down syndrome using cell-free fetal DNA in amniotic fluid by quantitative fluorescent polymersase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wu Dan; Chi Hongbin; Shao Minjie; Wu Yao; Jin Hongyan; Wu Baiyan; Qiao Jie


    Backgroud Amniotic fluid (AF) supernatant contains cell-free fetal DNA (cffDNA) fragments.This study attempted to take advantage of cffDNA as a new material for prenatal diagnosis,which could be combined with simple quantitative fluorescent polymerase chain reaction (QF-PCR) to provide an ancillary method for the prenatal diagnosis of trisomy 21 syndrome.Methods AF supernatant samples were obtained from 27 women carrying euploid fetuses and 28 women carrying aneuploid fetuses with known cytogenetic karyotypes.Peripheral blood samples of the parents were collected at the same time.Short tandem repeat (STR) fragments on chromosome 21 were amplified by QF-PCR.Fetal condition and the parental source of the extra chromosome could be determined by the STR peaks.Results The sensitivity of the assay for the aneuploid was 93% (26/28; confidence interval,CI:77%-98%) and the specificity was 100% (26/26; CI:88%-100%).The determination rate of the origin of the extra chromosome was 69%.The sensitivity and the specificity of the assay in the euploid were 100% (27/27).Conclusions Trisomy 21 can be prenatally diagnosed by the QF-PCR method in AF supernatant.This karyotype analysis method greatly reduces the requirement for the specimen size.It will be a benefit for early amniocentesis and could avoid pregnancy complications.The method may become an ancillary method for prenatal diagnosis of trisomy 21.

  13. Estimation and Preparation of the Hypervariable Regions I/II Templates for Mitochondrial DNA Typing From Human Bones and Teeth Remains Using Singleplex Quantitative Polymerase Chain Reaction. (United States)

    Le, Thien Ngoc; Van Phan, Hieu; Dang, Anh Tuan Mai; Nguyen, Vy Thuy


    A method was designed for estimating and sequencing of mitochondrial DNA (mtDNA) that effectively and more quickly provides a complete mtDNA profile. In this context, we have developed this novel strategy for typing mtDNA from 10 bones and teeth remains (3 months to 44 years). The quantification of mtDNA was achieved by singleplex real-time polymerase chain reaction of the hypervariable region I fragment (445 bp) and hypervariable region II fragment (617 bp). Combined with the melting curve analysis, we have determined as little as 10 pg of mtDNA template that is suitable for sequence analysis. Furthermore, quantitative polymerase chain reaction products were directly used for following step of mtDNA typing by Sanger sequencing. This method allows the profile to be completely provided for faster human identification. PMID:27356010

  14. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools. (United States)

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma


    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. PMID:23000800

  15. Qualitative and quantitative assessment of genetically modified soy in enteral nutrition formulas by polymerase chain reaction based methods Avaliação qualitativa e quantitativa de soja geneticamente modificada em fórmulas de nutrição enteral

    Directory of Open Access Journals (Sweden)

    Natália Eudes Fagundes de Barros


    Full Text Available OBJECTIVE: The aim of this work was to investigate the occurrence of Roundup Ready soybean in enteral nutrition formulas sold in Brazil. METHODS: A duplex Polymerase Chain Reaction based on the amplification of the lectin gene and the construction of the recombinant deoxyribonucleic acid of transgenic glyphosate-tolerant soybean (35S promoter and chloroplast transit peptide gene was performed in order to analyze the deoxyribonucleic acid obtained from nine soy protein isolate-containing formulas. RESULTS: Despite the highly processed nature of the food matrices, amplifiable deoxyribonucleic acid templates were obtained from all tested samples, as judged by the amplification of the lectin gene sequence. However, amplicons relative to the presence of Roundup Ready soybean were restricted to one of the nine enteral nutrition formulas analyzed as well as to the soybean reference powder, as expected. Quantitative analysis of the genetically modified formula by real-time Polymerase Chain Reaction showed a content of approximately 0.3% (w/w of recombinant deoxyribonucleic acid from the Roundup Ready soybean. CONCLUSION: The results show that one of the formulas contained genetically modified soy, pointing to the need of regulating the use of transgenic substances and of specific labeling in this product category.OBJETIVO: Investigar a ocorrência de soja transgênica em fórmulas de suporte nutricional comercializadas no Brasil. MÉTODOS: Foi desenvolvido o método da reação em cadeia da polimerase duplex, com base na amplificação do gene na lectina, e na construção do ácido desoxirribonucléico recombinante da soja transgênica tolerante a glifosato (promotor 35S e gene de peptídeo de trânsito de cloroplasto, a fim de avaliar o ácido desoxirribonucléico extraído a partir das nove fórmulas contendo isolado protéico de soja. RESULTADOS: Apesar do alto grau de processamento aos quais os produtos avaliados foram submetidos, foi poss

  16. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases. (United States)

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing


    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  17. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction. (United States)

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su


    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time. PMID:22079620

  18. Markov chain Monte Carlo methods: an introductory example (United States)

    Klauenberg, Katy; Elster, Clemens


    When the Guide to the Expression of Uncertainty in Measurement (GUM) and methods from its supplements are not applicable, the Bayesian approach may be a valid and welcome alternative. Evaluating the posterior distribution, estimates or uncertainties involved in Bayesian inferences often requires numerical methods to avoid high-dimensional integrations. Markov chain Monte Carlo (MCMC) sampling is such a method—powerful, flexible and widely applied. Here, a concise introduction is given, illustrated by a simple, typical example from metrology. The Metropolis-Hastings algorithm is the most basic and yet flexible MCMC method. Its underlying concepts are explained and the algorithm is given step by step. The few lines of software code required for its implementation invite interested readers to get started. Diagnostics to evaluate the performance and common algorithmic choices are illustrated to calibrate the Metropolis-Hastings algorithm for efficiency. Routine application of MCMC algorithms may be hindered currently by the difficulty to assess the convergence of MCMC output and thus to assure the validity of results. An example points to the importance of convergence and initiates discussion about advantages as well as areas of research. Available software tools are mentioned throughout.

  19. Chlamydia trachomatis-specific antibodies in patients with pelvic inflammatory disease: comparison with isolation in tissue culture or detection with polymerase chain reaction.


    Theunissen, J J; Minderhoud-Bassie, W; Wagenvoort, J H; Stolz, E; Michel, M F; Huikeshoven, F.J.


    OBJECTIVE--The detection of acute phase antibodies against C trachomatis and its comparison with tissue culture or polymerase chain reaction (PCR) on samples of cervix and urethra obtained from patients with pelvic inflammatory disease (PID). METHODS--In the academic hospital Dijkzigt, Rotterdam, The Netherlands, prospective investigations were performed on 49 consecutive patients who were admitted with the diagnosis of PID. Infections with C trachomatis were traced using tissue culture, PCR ...

  20. Chlamydia trachomatis infection in a high-risk population: comparison of polymerase chain reaction and cell culture for diagnosis and follow-up.


    Vogels, W H; van Voorst Vader, P C; Schröder, F P


    A study to compare the polymerase chain reaction (PCR) test with the cell culture method in diagnosing urogenital Chlamydia trachomatis infections was performed. From 497 patients (212 women, 285 men) attending an outpatient clinic for sexually transmitted diseases, a total of 814 samples (female patients, cervix and urethra; male patients, urethra) were collected. This total included follow-up samples from 35 women and 35 men positive for C. trachomatis by cell culture and/or PCR test, which...

  1. Synthesis of α,β-unsaturated esters via a chemo-enzymatic chain elongation approach by combining carboxylic acid reduction and Wittig reaction


    Yitao Duan; Peiyuan Yao; Yuncheng Du; Jinhui Feng; Qiaqing Wu; Dunming Zhu


    α,β-Unsaturated esters are versatile building blocks for organic synthesis and of significant importance for industrial applications. A great variety of synthetic methods have been developed, and quite a number of them use aldehydes as precursors. Herein we report a chemo-enzymatic chain elongation approach to access α,β-unsaturated esters by combining an enzymatic carboxylic acid reduction and Wittig reaction. Recently, we have found that Mycobacterium sp. was able to reduce phenylacetic aci...

  2. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction


    M. Mansoor Bhat; Mir Salahuddin; Imtiyaz A. Mantoo; Sheikh Adil; Henna Jalal; M. Ashraf Pal


    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materia...

  3. [The development of a test-system for the quantitative and qualitative evaluation of DNA content in criminalistic objects by the real-time polymerase chain reaction]. (United States)

    Lapenkov, M I; Plakhina, N V; Alekseev, Ia I; Varlamov, D A


    An original test-system for the preliminary quantitative and qualitative evaluation of isolated DNA is proposed by the polymerase chain reaction in real time (PCR-RT) based on the TaqMan technology. This test-system permits to simultaneously measure the amount of DNA in the sample, identify the genetic gender, and detect PCR inhibitors. The method has been approbated in the practical work of forensic medical experts. PMID:21735715

  4. Use of urine polymerase chain reaction to define the prevalence and clinical presentation of Trichomonas vaginalis in men attending an STD clinic


    Wendel, K; Erbelding, E; Gaydos, C.; Rompalo, A.


    Methods: Men attending a public STD clinic in Baltimore, Maryland, were evaluated between March and July 2000. Clinicians recorded a standardised history and clinical examination. Urethral swab specimens were collected for Gram stain and Neisseria gonorrhoeae culture. First fraction urine samples were evaluated with TV culture and chlamydia and TV polymerase chain reaction (PCR). True positive TV was defined as a positive TV culture or a positive TV PCR confirmed with a second primer set.

  5. Usability application of multiplex polymerase chain reaction in the diagnosis of microorganisms isolated from urine of patients treated in cancer hospital


    Cybulski, Zefiryn; Schmidt, Katarzyna; Grabiec, Alicja; Talaga, Zofia; Bociąg, Piotr; Wojciechowicz, Jacek; Roszak, Andrzej; Kycler, Witold


    Background The objective of this study was: i) to compare the results of urine culture with polymerase chain reaction (PCR) -based detection of microorganisms using two commercially available kits, ii) to assess antimicrobial susceptibility of urine isolates from cancer patients to chosen antimicrobial drugs and, if necessary, to update the recommendation of empirical therapy. Materials and methods. A one-year hospital-based prospective study has been conducted in Greater Poland Cancer Centre...

  6. Implementation and Evaluation of a Tutor-Supported Computer-Based Practical Biochemistry Course "Polymerase Chain Reaction (PCR)" in Preclinical Education


    Kröncke, KD; Becher, T


    Background: The polymerase chain reaction (PCR) is an example of a technology that for many medical students is not easy to understand. We investigated whether a tutor-supported e-learning teaching unit is suitable to teach undergraduate medical students the PCR. Methods: We developed a computer-based practical course (attendance is compulsory) that uses an open source-based system as a learning platform. The students learned to search in scientific medical databases to find PCR-releva...

  7. Analysis of the rDNA internal transcribed spacer region of the Fusarium species by polymerase chain reaction-restriction fragment length polymorphism




    The Fusarium species are a widely spread phytopathogen identified in an extensive variety of hosts. The Fusarium genus is one of the most heterogeneous fungi and is difficult to classify. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis is a useful method in detection of DNA polymorphism in objective sequences. The aim of the present study was to identify the phylogenetic associations and usefulness of the internal transcribed spacer (ITS) region as a gen...

  8. Path optimization by a variational reaction coordinate method. I. Development of formalism and algorithms. (United States)

    Birkholz, Adam B; Schlegel, H Bernhard


    The development of algorithms to optimize reaction pathways between reactants and products is an active area of study. Existing algorithms typically describe the path as a discrete series of images (chain of states) which are moved downhill toward the path, using various reparameterization schemes, constraints, or fictitious forces to maintain a uniform description of the reaction path. The Variational Reaction Coordinate (VRC) method is a novel approach that finds the reaction path by minimizing the variational reaction energy (VRE) of Quapp and Bofill. The VRE is the line integral of the gradient norm along a path between reactants and products and minimization of VRE has been shown to yield the steepest descent reaction path. In the VRC method, we represent the reaction path by a linear expansion in a set of continuous basis functions and find the optimized path by minimizing the VRE with respect to the linear expansion coefficients. Improved convergence is obtained by applying constraints to the spacing of the basis functions and coupling the minimization of the VRE to the minimization of one or more points along the path that correspond to intermediates and transition states. The VRC method is demonstrated by optimizing the reaction path for the Müller-Brown surface and by finding a reaction path passing through 5 transition states and 4 intermediates for a 10 atom Lennard-Jones cluster. PMID:26723645

  9. Path optimization by a variational reaction coordinate method. I. Development of formalism and algorithms

    International Nuclear Information System (INIS)

    The development of algorithms to optimize reaction pathways between reactants and products is an active area of study. Existing algorithms typically describe the path as a discrete series of images (chain of states) which are moved downhill toward the path, using various reparameterization schemes, constraints, or fictitious forces to maintain a uniform description of the reaction path. The Variational Reaction Coordinate (VRC) method is a novel approach that finds the reaction path by minimizing the variational reaction energy (VRE) of Quapp and Bofill. The VRE is the line integral of the gradient norm along a path between reactants and products and minimization of VRE has been shown to yield the steepest descent reaction path. In the VRC method, we represent the reaction path by a linear expansion in a set of continuous basis functions and find the optimized path by minimizing the VRE with respect to the linear expansion coefficients. Improved convergence is obtained by applying constraints to the spacing of the basis functions and coupling the minimization of the VRE to the minimization of one or more points along the path that correspond to intermediates and transition states. The VRC method is demonstrated by optimizing the reaction path for the Müller-Brown surface and by finding a reaction path passing through 5 transition states and 4 intermediates for a 10 atom Lennard-Jones cluster

  10. Contribution to an effective design method for stationary reaction-diffusion patterns

    Energy Technology Data Exchange (ETDEWEB)

    Szalai, István; Horváth, Judit [Laboratory of Nonlinear Chemical Dynamics, Institute of Chemistry, Eötvös Loránd University, P.O. Box 32, H-1518 Budapest 112 (Hungary); De Kepper, Patrick [Centre de Recherche Paul Pascal, CNRS, University of Bordeaux, 115, Avenue Schweitzer, F-33600 Pessac (France)


    The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences.

  11. Contribution to an effective design method for stationary reaction-diffusion patterns (United States)

    Szalai, István; Horváth, Judit; De Kepper, Patrick


    The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences.

  12. Contribution to an effective design method for stationary reaction-diffusion patterns

    International Nuclear Information System (INIS)

    The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences

  13. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load


    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY


    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  14. Seriation in paleontological data using markov chain Monte Carlo methods.

    Directory of Open Access Journals (Sweden)

    Kai Puolamäki


    Full Text Available Given a collection of fossil sites with data about the taxa that occur in each site, the task in biochronology is to find good estimates for the ages or ordering of sites. We describe a full probabilistic model for fossil data. The parameters of the model are natural: the ordering of the sites, the origination and extinction times for each taxon, and the probabilities of different types of errors. We show that the posterior distributions of these parameters can be estimated reliably by using Markov chain Monte Carlo techniques. The posterior distributions of the model parameters can be used to answer many different questions about the data, including seriation (finding the best ordering of the sites and outlier detection. We demonstrate the usefulness of the model and estimation method on synthetic data and on real data on large late Cenozoic mammals. As an example, for the sites with large number of occurrences of common genera, our methods give orderings, whose correlation with geochronologic ages is 0.95.


    Directory of Open Access Journals (Sweden)

    Reni Herman


    Full Text Available In monitoring the treatment of malaria with Dihydroartemisinin-piperaquine (DHP, microscopic cross check and Polymerase Chain Reaction (PCR performed to validate the results of laboratory examinations in the field. This study used finger prick samples from subjects with a diagnosis of malaria in monitoring the treatment of malaria with DHP in Kalimantan and Sulawesi. Samples taken at day 0, blood smears made on slides for microscopic and blood spot on filter paper for PCR examination. The PCR method used is a single-round multiplex polymerase chain reaction that has been modified, the examination of each species carried out in different tubes to distinguish the species P. falciparum or P. Vivax. Target of DNA amplification is a species-specific gene sequences in the small-subunit ribosomal RNA (SSUrRNA, 300 bp for P. falciparum and 276 bp for P.vivax.  P. falciparum and P.vivax identified in 229 samples of blood smears and blood spots. Microscopic and PCR gave the same results, positive 93.4% and negative 6.6% with a sensitivity of  99% and specificity 93.3%. P.falciparum sensitivity and specificity of 92% and 99%, P.vivax 97% and 94%, PCR as a gold standard. There are differences in the results of examination of 5 samples, ie with microscopic examination identified as P.vivax  while the PCR as P. falciparum. In this study, identification of  the microscopic parasite similar to the results of identification by PCR, but differ in determining the types of parasites. In general, the ability to microscopic diagnosis of malaria is very good, but confirmation by PCR is still needed.AbstrakPada monitoring pengobatan malaria  dengan Dihydroartemisinin-piperaquine (DHP,cek silang mikroskopis dan Polymerase Chain Reaction (PCR dilakukan untuk memvalidasi hasil pemeriksaan di laboratorium lapangan. Penelitian ini menggunakan sediaan darah jari dari subyek dengan diagnosis malaria pada monitoring pengobatan malaria dengan DHP di Kalimantan dan Sulawesi

  16. An amplified electrochemical aptasensor based on hybridization chain reactions and catalysis of silver nanoclusters (United States)

    Chen, Ling; Sha, Liang; Qiu, Yuwei; Wang, Guangfeng; Jiang, Hong; Zhang, Xiaojun


    In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear range of 10-10 M to 10-5 M.In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear

  17. Fuzzy Entropy Method for Quantifying Supply Chain Networks Complexity (United States)

    Zhang, Jihui; Xu, Junqin

    Supply chain is a special kind of complex network. Its complexity and uncertainty makes it very difficult to control and manage. Supply chains are faced with a rising complexity of products, structures, and processes. Because of the strong link between a supply chain’s complexity and its efficiency the supply chain complexity management becomes a major challenge of today’s business management. The aim of this paper is to quantify the complexity and organization level of an industrial network working towards the development of a ‘Supply Chain Network Analysis’ (SCNA). By measuring flows of goods and interaction costs between different sectors of activity within the supply chain borders, a network of flows is built and successively investigated by network analysis. The result of this study shows that our approach can provide an interesting conceptual perspective in which the modern supply network can be framed, and that network analysis can handle these issues in practice.

  18. The new possibility of the fusion p + 11B chain reaction being induced by intense laser pulses (United States)

    Belyaev, V. S.; Krainov, V. P.; Matafonov, A. P.; Zagreev, B. V.


    We discuss the experimental and theoretical principal schemes of a thermonuclear reactor, based on the fusion reaction p + 11B: beam collisions, fusion in degenerate plasmas, ignition at the plasma, particle acceleration by nonlinear ponderomotive forces and irradiation of the solid 11B target by a proton beam at the Coulomb explosion of hydrogen microdroplets. The fusion reaction p + 11B can be initiated by ultrashort high intensity laser pulses under conditions far from thermodynamic equilibrium. This may result in fusion products containing a small amount of neutrons and other nuclear radiation effects. It was found that the fusion reaction p + 11B produces further nuclear reactions and generates high-energy protons. The latter can support the chain reaction process. Our approach allows us to also investigate nuclear reactions in the early Universe and in stars.

  19. Investigation on the electromagnetic wave absorption properties of Ni chains synthesized by a facile solvothermal method

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Biao [School of Materials Science and Engineering, Zhengzhou University, Zhengzhou 450001, Henan (China); Zhengzhou Aeronautical Institute of Industry Management, Zhengzhou 450046, Henan (China); Fan, Bingbing; Shao, Gang [School of Materials Science and Engineering, Zhengzhou University, Zhengzhou 450001, Henan (China); Wang, Binbin; Pian, Xiaoxuan; Li, Wen [School of Materials Science and Engineering, Zhengzhou University, Zhengzhou 450001, Henan (China); Zhengzhou Aeronautical Institute of Industry Management, Zhengzhou 450046, Henan (China); Zhang, Rui, E-mail: [School of Materials Science and Engineering, Zhengzhou University, Zhengzhou 450001, Henan (China); Zhengzhou Aeronautical Institute of Industry Management, Zhengzhou 450046, Henan (China)


    One-dimension Ni chains have been successfully prepared by a facile solvothermal method. The as-prepared products were characterized by X-ray diffraction (XRD), field emission scanning electron microscope (FE–SEM), energy dispersive X-ray spectroscopy (EDS), Fourier transform infrared (FT-IR), thermogravimetric and differential thermal analysis (TG–DTA). The effects of the concentration of NaOH, solvent, reaction time on the morphologies of Ni samples were investigated. The experimental results showed that the volume ratios of ethylene glycol (EG) to water and the amounts of NaOH played critical roles in the formation of novel Ni chains. A probable formation mechanism of the chain-like Ni was proposed based on time-dependent experiments. The measured electromagnetic parameters showed that the absorption bandwidth with reflection loss (RL) less than -10 dB was up to 4.3 GHz in the high frequency range of 13.7–18.0 GHz by adjusting the thickness of 0.8–1.0 mm. A minimum RL value of -19.9 dB was observed at 17.2 GHz with a thickness of 0.8 mm. The excellent electromagnetic absorption mostly arises from dielectric loss rather than magnetic loss.

  20. Investigation on the electromagnetic wave absorption properties of Ni chains synthesized by a facile solvothermal method

    International Nuclear Information System (INIS)

    One-dimension Ni chains have been successfully prepared by a facile solvothermal method. The as-prepared products were characterized by X-ray diffraction (XRD), field emission scanning electron microscope (FE–SEM), energy dispersive X-ray spectroscopy (EDS), Fourier transform infrared (FT-IR), thermogravimetric and differential thermal analysis (TG–DTA). The effects of the concentration of NaOH, solvent, reaction time on the morphologies of Ni samples were investigated. The experimental results showed that the volume ratios of ethylene glycol (EG) to water and the amounts of NaOH played critical roles in the formation of novel Ni chains. A probable formation mechanism of the chain-like Ni was proposed based on time-dependent experiments. The measured electromagnetic parameters showed that the absorption bandwidth with reflection loss (RL) less than −10 dB was up to 4.3 GHz in the high frequency range of 13.7–18.0 GHz by adjusting the thickness of 0.8–1.0 mm. A minimum RL value of −19.9 dB was observed at 17.2 GHz with a thickness of 0.8 mm. The excellent electromagnetic absorption mostly arises from dielectric loss rather than magnetic loss.


    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen


    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  2. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.; Schonenbrucher, H.; Cook, N.; Heuvelink, A.E.; Hoorfar, Jeffrey


    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  3. Identification of related DNA sequences in Borrelia burgdorferi and two strains of Leptospira interrogans by using polymerase chain reaction.


    Kron, M A; Gupta, A; Mackenzie, C. D.


    The suitability of a polymerase chain reaction assay for Borrelia burgdorferi in epidemiological studies of infected tick populations was evaluated by using 28 strains of Leptospira interrogans and lysates of fixed adult Ixodes tick tissues. Two false positives representing leptospires were differentiated from B. burgdorferi by using an oligonucleotide probe.

  4. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp (United States)

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  5. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld


    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  6. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;


    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot hybrid...... where viral replication is absent, or where genomic copies are present at such low numbers that they are otherwise undetectable....

  7. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses. (United States)

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola


    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  8. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma... (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... test for Mycoplasma gallisepticum (MGLP ReTi). (a) DNA extraction. Use Qiagen Qiamp Mini Kit for...

  9. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan


    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  10. Testing vaccines in human experimental malaria: statistical analysis of parasitemia measured by a quantitative real-time polymerase chain reaction.

    NARCIS (Netherlands)

    Hermsen, C.C.; Vlas, S.J. de; Gemert, G.J.A. van; Telgt, D.S.C.; Verhage, D.F.; Sauerwein, R.W.


    Clinical trials are an essential step in evaluation of safety and efficacy of malaria vaccines, and human experimental malaria infections have been used for evaluation of protective immunity of Plasmodium falciparum malaria. In this study, a quantitative real-time polymerase chain reaction was used

  11. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;


    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR-BM). M...

  12. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;


    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  13. Modeling the Manipulation of Natural Populations by the Mutagenic Chain Reaction. (United States)

    Unckless, Robert L; Messer, Philipp W; Connallon, Tim; Clark, Andrew G


    The use of recombinant genetic technologies for population manipulation has mostly remained an abstract idea due to the lack of a suitable means to drive novel gene constructs to high frequency in populations. Recently Gantz and Bier showed that the use of CRISPR/Cas9 technology could provide an artificial drive mechanism, the so-called mutagenic chain reaction (MCR), which could lead to rapid fixation of even a deleterious introduced allele. We establish the near equivalence of this system to other gene drive models and review the results of simple models showing that, when there is a fitness cost to the MCR allele, an internal equilibrium may exist that is usually unstable. In this case, introductions must be at a frequency above this critical point for the successful invasion of the MCR allele. We obtain estimates of fixation and invasion probabilities for the appropriate scenarios. Finally, we discuss how polymorphism in natural populations may introduce sources of natural resistance to MCR invasion. These modeling results have important implications for application of MCR in natural populations. PMID:26232409

  14. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader (United States)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng


    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  15. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  16. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes


    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  17. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Gleichweit, Christoph; Amende, Max; Bauer, Udo; Schernich, Stefan; Höfert, Oliver; Lorenz, Michael P. A.; Zhao, Wei; Bachmann, Philipp; Papp, Christian, E-mail: [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Müller, Michael; Koch, Marcus [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Wasserscheid, Peter [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Libuda, Jörg; Steinrück, Hans-Peter [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany)


    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H{sub 12}-NEC), dodecahydro-N-propylcarbazole (H{sub 12}-NPC), and dodecahydro-N-butylcarbazole (H{sub 12}-NBC), on Pt(111) and on Al{sub 2}O{sub 3}-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al{sub 2}O{sub 3}, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC.

  18. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. (United States)

    Ote, Isabelle; Taminiau, Bernard; Duprez, Jean-Noël; Dizier, Isabelle; Mainil, Jacques G


    Staphylococcus aureus is recognized worldwide as a pathogen causing many serious diseases in humans and animals, and is the most common aetiological agent of clinical and subclinical bovine mastitis. The importance of evaluating the combination of S. aureus virulence factors has been emphasized both in human and veterinary medicine, and knowledge about the genetic variability within different S. aureus populations would help in the design of efficient treatments. The aim of the present study was to determine the genetic profiles of S. aureus strains isolated from milk of cows suffering from clinical and subclinical mastitis in Belgium. The presence of about forty virulence-associated genes was investigated by specific polymerase chain reaction (PCR) amplification. A high number of genotypic subtypes were observed, demonstrating further the large variation in the presence of virulence genes in S. aureus isolates and the considerable diversity of strains populations that are able to cause mastitis in cows. In accordance with other studies, we showed that some genes are associated with mastitis-causing S. aureus isolates, whereas others are absent or rarely present. We also further highlighted the presence of conserved gene combinations, namely the enterotoxigenic egc-cluster and the bovine pathogenicity island SaPIbov. Importantly, the presence of isolates carrying genes coding for toxins involved in important human infections makes the milk of cows with mastitis a potential reservoir for these toxins, and therefore a potential danger in human health, which strengthens the importance to consider raw milk consumption and its processing very carefully. PMID:21708435

  19. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism. (United States)

    Souza, M T; Carvalho-Zilse, G A


    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  20. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes


    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  1. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction. (United States)

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E


    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  2. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays. (United States)

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua


    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. PMID:26922047

  3. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics (United States)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David


    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  4. Polymerase chain reaction for detection of herpesvirus simiae (B virus) in clinical specimens. (United States)

    Slomka, M J; Brown, D W; Clewley, J P; Bennett, A M; Harrington, L; Kelly, D C


    A polymerase chain reaction (PCR) was designed which is specific to Macaca fascicularis (cynomolgus monkey) isolates of B virus. The PCR primers produced the expected 188 basepair product from the Cyno 2 strain and seven other cynomolgus monkey isolates of B virus. Oligomer hybridization with a 31-mer oligonucleotide was used to confirm the origin of this product. The PCR failed to amplify DNA of Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, and other alphaherpesviruses (herpes simplex virus types 1 and 2, four SA 8 isolates and three rhesus isolates of B virus). PCR testing of swabs obtained from four orally-infected cynomolgus monkeys confirmed the presence of B virus DNA in samples previously shown to be positive by culture. In addition, PCR detected B virus in several swabs from infected monkeys that were culture negative. Total DNA extracts from the trigeminal and sacral ganglia of these animals were tested by nested PCR and B virus DNA was detected in the trigeminal ganglia of 3 of the 4 orally-infected cynomolgus monkeys. Nested PCR did not detect B virus DNA in total DNA extracts obtained from the brains of the four monkeys. PMID:8392323


    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿


    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.


    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈


    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  7. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    International Nuclear Information System (INIS)

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H12-NEC), dodecahydro-N-propylcarbazole (H12-NPC), and dodecahydro-N-butylcarbazole (H12-NBC), on Pt(111) and on Al2O3-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al2O3, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC

  8. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Directory of Open Access Journals (Sweden)

    Lei Zhang


    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  9. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  10. Improving Nuclear Safety of Fast Reactors by Slowing Down Fission Chain Reaction

    Directory of Open Access Journals (Sweden)

    G. G. Kulikov


    Full Text Available Light materials with small atomic mass (light or heavy water, graphite, and so on are usually used as a neutron reflector and moderator. The present paper proposes using a new, heavy element as neutron moderator and reflector, namely, “radiogenic lead” with dominant content of isotope 208Pb. Radiogenic lead is a stable natural lead. This isotope is characterized by extremely low micro cross-section of radiative neutron capture (~0.23 mb for thermal neutrons, which is smaller than graphite and deuterium cross-sections. The reflector-converter for a fast reactor core is the structure capable of transforming some part of prompt neutrons leaked from the core into the reflected neutrons with properties similar to those of delayed neutrons, that is, sufficiently large contribution to reactivity at the level of effective fraction of delayed neutrons and relatively long lifetime, comparable with lifetimes of radionuclides-emitters of delayed neutrons. It is evaluated that the use of radiogenic lead makes it possible to slow down the chain fission reaction on prompt neutrons in the fast reactor. This can improve the fast reactor safety and reduce some requirements to the technologies used to fabricate fuel for the fast reactor.

  11. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis. (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T


    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  12. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  13. Platypus chain reaction: directional and ordered meiotic pairing of the multiple sex chromosome chain in Ornithorhynchus anatinus. (United States)

    Daish, Tasman; Casey, Aaron; Grützner, Frank


    Monotremes are phylogenetically and phenotypically unique animals with an unusually complex sex chromosome system that is composed of ten chromosomes in platypus and nine in echidna. These chromosomes are alternately linked (X1Y1, X2Y2, ...) at meiosis via pseudoautosomal regions and segregate to form spermatozoa containing either X or Y chromosomes. The physical and epigenetic mechanisms involved in pairing and assembly of the complex sex chromosome chain in early meiotic prophase I are completely unknown. We have analysed the pairing dynamics of specific sex chromosome pseudoautosomal regions in platypus spermatocytes during prophase of meiosis I. Our data show a highly coordinated pairing process that begins at the terminal Y5 chromosome and completes with the union of sex chromosomes X1Y1. The consistency of this ordered assembly of the chain is remarkable and raises questions about the mechanisms and factors that regulate the differential pairing of sex chromosomes and how this relates to potential meiotic silencing mechanisms and alternate segregation. PMID:19874721

  14. An Improved Supplier Driven Packaging Design and Development Method for Supply Chain Efficiency

    DEFF Research Database (Denmark)

    Sohrabpour, Vahid; Oghazi, Pejvak; Olsson, Annika


    Packaging and the role it plays in supply chain efficiency are overlooked in most design and development research. An opportunity exists to meet the needs of supply chains to increase efficiency. This research presents three propositions on how to reduce the gap between supply chain needs...... and satisfaction in interaction with the product and packaging system. It also proposes a supply chain focused packaging design and development method to better satisfy supply chain needs placed on packaging. An extensive literature review was conducted, and a Tetra Pak derived case study was developed....... The propositions were formulated and became the basis for improving Tetra Pak's existing packaging design and development method by better integrating supply chain needs. This was accomplished by using an expanded operational life cycle perspective that includes the entire supply chain. The resulting supply chain...

  15. A Scalable Multi-chain Markov Chain Monte Carlo Method for Inverting Subsurface Hydraulic and Geological Properties (United States)

    Bao, J.; Ren, H.; Hou, Z.; Ray, J.; Swiler, L.; Huang, M.


    We developed a novel scalable multi-chain Markov chain Monte Carlo (MCMC) method for high-dimensional inverse problems. The method is scalable in terms of number of chains and processors, and is useful for Bayesian calibration of computationally expensive simulators typically used for scientific and engineering calculations. In this study, we demonstrate two applications of this method for hydraulic and geological inverse problems. The first one is monitoring soil moisture variations using tomographic ground penetrating radar (GPR) travel time data, where challenges exist in the inversion of GPR tomographic data for handling non-uniqueness and nonlinearity and high-dimensionality of unknowns. We integrated the multi-chain MCMC framework with the pilot point concept, a curved-ray GPR forward model, and a sequential Gaussian simulation (SGSIM) algorithm for estimating the dielectric permittivity at pilot point locations distributed within the tomogram, as well as its spatial correlation range, which are used to construct the whole field of dielectric permittivity using SGSIM. The second application is reservoir porosity and saturation estimation using the multi-chain MCMC approach to jointly invert marine seismic amplitude versus angle (AVA) and controlled-source electro-magnetic (CSEM) data for a layered reservoir model, where the unknowns to be estimated include the porosity and fluid saturation in each reservoir layer and the electrical conductivity of the overburden and bedrock. The computational efficiency, accuracy, and convergence behaviors of the inversion approach are systematically evaluated.

  16. Polymerase chain reaction of peripheral blood as a tool for the diagnosis of visceral leishmaniasis in children

    Directory of Open Access Journals (Sweden)

    Thiago Leite Fraga


    Full Text Available The diagnosis of visceral leishmaniasis (VL generally requires the use of invasive tests for the collection of infected tissue (aspirates of bone marrow, spleen, liver or lymph nodes. This difficulty has led to the search for safer and less painful techniques to confirm the occurrence of the disease in children. Polymerase chain reaction (PCR is a method that is advantageous in that it allows the use of peripheral blood samples for diagnosis. This paper reports the utilisation of PCR on peripheral blood samples to diagnose VL in 45 children in Mato Grosso do Sul, Brazil. This technique is compared with methods carried out using tissue collected by invasive procedures, including direct microscopy, culture and detection of Leishmania DNA by PCR in bone marrow aspirates. The results show that PCR of peripheral blood provides great sensitivity (95.6% that is similar to that from the PCR of bone marrow aspirates (91.1% and higher than that achieved with microscopy (80% or culture (26.7% methods. PCR of peripheral blood proved to be a suitable tool for the diagnosis of VL in children because it is highly sensitive and safe, with tissue collection being less invasive than in traditional tests.

  17. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam


    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  18. Simulation Optimisation Methods in Supply Chain Applications: a Review


    Arisha, Amr; Abo-Hamad, Waleed


    The competitiveness and dynamic nature of today’s marketplace is due to rapid advances in information technology, short product life cycles and the continuing trend in global outsourcing. Managing the resulting supply chain networks effectively is challenged by high levels of uncertainty in supply and demand, confl ict objectives, vagueness of information, numerous decision variables and constraints. With such levels of complexity, supply chain optimisation has the potential to make a signifi...

  19. Chain ladder method: Bayesian bootstrap versus classical bootstrap


    Peters, Gareth W.; Mario V. W\\"uthrich; Shevchenko, Pavel V.


    The intention of this paper is to estimate a Bayesian distribution-free chain ladder (DFCL) model using approximate Bayesian computation (ABC) methodology. We demonstrate how to estimate quantities of interest in claims reserving and compare the estimates to those obtained from classical and credibility approaches. In this context, a novel numerical procedure utilising Markov chain Monte Carlo (MCMC), ABC and a Bayesian bootstrap procedure was developed in a truly distribution-free setting. T...

  20. A Theoretical Investigation on the Reaction Mechanism of the C8H+·10 Side-Chain Decomposition Processes

    Institute of Scientific and Technical Information of China (English)

    CHENG Xue-Li; ZHAO Yan-Yun; LI Feng


    The dissociation of ethylbenzene cation C8H+·10 served as a prototype to investigate the decompasition mechanisms of alkylbenzene cations.The reactions of C8H+·10 decomposition reaction system have been studied extensively at the B3L YP/6-311++G** level with Gaussion 98 package.The chain reaction of C8H+·10 dissociation is initiated by C-H bond rupture.All reaction channels were fully investigated with the vibrational mode analysis to confirm the transition states and reveal the reaction mechanism.The energetically most favorable pathway is C8H+·10→TS4→·P2+H· and the channel ieading to C8H+·10 and C2H4 is also competitive.

  1. Correlation between API 50 CH and multiplex polymerase chain reaction for the identification of vaginal lactobacilli in isolates

    Directory of Open Access Journals (Sweden)

    Eliane Melo Brolazo


    Full Text Available Identification of Lactobacillus sp. strains by phenotypic methods may lead to doubtful results possibly interfering in the reliability of the epidemiological and probiotics studies. Therefore this study aimed to determine the best methodology for the identification of the large diversity of lactobacilli species found in the vagina by comparing two techniques, one based on their biochemical profile and other employing molecular biology. A carbohydrate fermentation test (API 50 CH was compared with multiplex polymerase chain reaction (PCR for the identification of species of vaginal lactobacilli from 135 healthy women. The kappa index was used to evaluate agreement between the methods. Using the molecular technique, L. crispatus (32.6%, L. jensenii (25% and L. gasseri (20.6% were the most frequent species. However, using the biochemical technique, the most frequent species were: L. acidophilus (34.8%, L. crispatus (27.2% and L. fermentum (13%. Although L. acidophilus was the most frequent specie found by biochemical tests, no strain of this microorganism was detected by PCR. Agreement between the methods was low for identification of all the most common species. Although rates of L. crispatus detected were similar using both methods (32.6% and 27.2%, agreement between them was relatively low (kappa = 0.52. Conclusions: Our results confirmed the limitation of the biochemical method and the applicability of a previously published molecular method (Multiplex PCR for the identification of lactobacilli in the vaginal tract, focusing on further necessity of its improvement for also targeting L. vaginalis and L. iners.

  2. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie


    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  3. A quantitative real time polymerase chain reaction approach for estimating processed animal proteins in feed: preliminary data

    Directory of Open Access Journals (Sweden)

    Maria Cesarina Abete


    Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.

  4. Efficacy of a commercial polymerase chain reaction-based assay for detection of Salmonella spp. in animal feeds. (United States)

    Maciorowski, K G; Pillai, S D; Ricke, S C


    Salmonellosis is a cyclic problem in the food industry, to which animal feed has been contributory. Current conventional methods of Salmonella spp. detection require 96 h for detection and confirmation. With modern and just-in-time production schedules, a 96-h hold represents a significant expense in storage and decontamination. The commercially available assay, 'BAX for Screening/Salmonella' (BAX), is based on the principle of the polymerase chain reaction and may represent a significant decrease in assay time. Seven fresh feed formulations, two fresh feed ingredients, seven stored feeds and two stored feed ingredients were artificially contaminated with a primary poultry isolate of Salmonella typhimurium and analysed by conventional and BAX methodology. The results of BAX agreed with conventional plating results for 16 of 18 samples spiked with 1200 cfu 10 g(-1) of feed and 13 of 18 samples spiked with 40 cfu 10 g(-1) of feed. Indigenous Salmonella spp. were detected in five of eight samples of poultry diets by conventional methods. With BAX, Salmonella spp. could not be detected in any of the samples after only 7 h of enrichment but could be detected in two dietary samples after 13 h of enrichment and four dietary samples after 24 h of enrichment. Specific sequences of salmonella DNA that were extracted from poultry diets could be detected with BAX. PMID:11054177

  5. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous


    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  6. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction. (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn


    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  7. Investigation on natural diets of larval marine animals using peptide nucleic acid-directed polymerase chain reaction clamping. (United States)

    Chow, Seinen; Suzuki, Sayaka; Matsunaga, Tadashi; Lavery, Shane; Jeffs, Andrew; Takeyama, Haruko


    The stomach contents of the larvae of marine animals are usually very small in quantity and amorphous, especially in invertebrates, making morphological methods of identification very difficult. Nucleotide sequence analysis using polymerase chain reaction (PCR) is a likely approach, but the large quantity of larval (host) DNA present may mask subtle signals from the prey genome. We have adopted peptide nucleic acid (PNA)-directed PCR clamping to selectively inhibit amplification of host DNA for this purpose. The Japanese spiny lobster (Panulirus japonicus) and eel (Anguilla japonica) were used as model host and prey organisms, respectively. A lobster-specific PNA oligomer (20 bases) was designed to anneal to the sequence at the junction of the 18 S rDNA gene and the internal transcribed spacer 1 (ITS1) of the lobster. PCR using eukaryote universal primers for amplifying the ITS1 region used in conjunction with the lobster-specific PNA on a mixed DNA template of lobster and eel demonstrated successful inhibition of lobster ITS1 amplification while allowing efficient amplification of eel ITS1. This method was then applied to wild-caught lobster larvae of P. japonicus and P. longipes bispinosus collected around Ryukyu Archipelago, Japan. ITS1 sequences of a wide variety of animals (Ctenophora, Cnidaria, Crustacea, Teleostei, Mollusca, and Chaetognatha) were detected. PMID:20535520

  8. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction. (United States)

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga


    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  9. Detection of DNA from Leishmania (Viannia: accuracy of polymerase chain reaction for the diagnosis of cutaneous leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu

    Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.

  10. Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR Methods of DNA extraction from archived materials and rare sources for utilization in polymer chain reaction

    Directory of Open Access Journals (Sweden)

    Jaqueline A. Barea


    Full Text Available Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina, para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR. Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad; Insta Gene® (BioRad e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb, Factor V Leiden (220 pb e Abelson (106 pb. De acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.The present work aimed at comparing five different methods of DNA extraction of samples from archived materials (paraffin-embedded tissues, peripheral blood smears - stained or not with Leishman, aspired bone marrow smears and Guthrie card bloodspots and from rare sources (oral cells, one and three capillary bulbs, 2 mL of urine, to evaluate the ease of application and the possibility of amplification of this DNA by the polymerization chain reaction (PCR technique. The methods included proteinase K digestion - followed or not by phenol/chloroform purification, Chelex 100® (BioRad, InstaGene® (BioRad and boiling in the sterile water. The DNA obtained was tested for amplification of three genic fragments: the brain-derived neutrophic factor gene (764 bp

  11. Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

  12. Use of polymerase chain reaction in the diagnosis of Whipple's disease. (United States)

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi


    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight. PMID:26390825

  13. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito


    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  14. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta


    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  15. Sensitive and simultaneous analysis of five transgenic maizes using multiplex polymerase chain reaction, capillary gel electrophoresis, and laser-induced fluorescence


    García-Cañas, Virginia; González García, Ramón; Cifuentes, Alejandro


    The benefits of using multiplex polymerase chain reaction (PCR) followed by capillary gel electrophoresis with laser-induced fluorescence (CGE-LIF) for the simultaneous detection of five transgenic maizes (Bt11, T25, MON810, GA21, and Bt176) are demonstrated. The method uses a hexaplex PCR protocol to amplify the five mentioned transgenic amplicons plus the zein gene used as reference, followed by a CGE-LIF method to analyze the six DNA fragments. CGE-LIF was demonstrated very useful and info...

  16. Detection of MDR1 single nucleotide polymorphisms C3435T and G2677T using real-time polymerase chain reaction: MDR1 single nucleotide polymorphism genotyping assay


    Song, Pengfei; Li, Shen; Meibohm, Bernd; Gaber, A. Osama; Honaker, Marsha R.; Kotb, Malak; Yates, Charles R.


    The objective of this study was to develop a real-time polymerase chain reaction (PCR) method to detect MDR1 (human multidrug resistance gene) single nucleotide polymorphisms (SNPs) C3435T and G2677T. C3435T and G2677T are linked to MDR1*2, which is associated with enhanced efflux activity in vitro. Using the Smart Cycler, an allele-specific real-time PCR-based genotyping method was developed to detect C3435T and G2677T. The MDR1 genotype of human genomic DNA templates was determined by direc...

  17. Recent Developments in Methods for Identifying Reaction Coordinates

    CERN Document Server

    Li, Wenjin


    In the study of rare events in complex systems with many degrees of freedom, a key element is to identify the reaction coordinates of a given process. Over recent years, a number of methods and protocols have been developed to extract the reaction coordinates based on limited information from molecular dynamics simulations. In this review, we provide a brief survey over a number of major methods developed in the past decade, some of which are discussed in greater detail, to provide an overview of the problems that are partially solved and challenges that still remain. A particular emphasis has been placed on methods for identifying reaction coordinates that are related to the committor.

  18. Removal of round off errors in the matrix exponential method for solving the heavy nuclide chain

    International Nuclear Information System (INIS)

    Many nodal codes for core simulation adopt the micro-depletion procedure for the depletion analysis. Unlike the macro-depletion procedure, the microdepletion procedure uses micro-cross sections and number densities of important nuclides to generate the macro cross section of a spatial calculational node. Therefore, it needs to solve the chain equations of the nuclides of interest to obtain their number densities. There are several methods such as the matrix exponential method (MEM) and the chain linearization method (CLM) for solving the nuclide chain equations. The former solves chain equations exactly even when the cycles that come from the alpha decay exist in the chain while the latter solves the chain approximately when the cycles exist in the chain. The former has another advantage over the latter. Many nodal codes for depletion analysis, such as MASTER, solve only the hard coded nuclide chains with the CLM. Therefore, if we want to extend the chain by adding some more nuclides to the chain, we have to modify the source code. In contrast, we can extend the chain just by modifying the input in the MEM because it is easy to implement the MEM solver for solving an arbitrary nuclide chain. In spite of these advantages of the MEM, many nodal codes adopt the chain linearization because the former has a large round off error when the flux level is very high or short lived or strong absorber nuclides exist in the chain. In this paper, we propose a new technique to remove the round off errors in the MEM and we compared the performance of the two methods

  19. Chain extension and branching of poly(L-lactic acid produced by reaction with a DGEBA-based epoxy resin

    Directory of Open Access Journals (Sweden)


    Full Text Available Dicarboxylated poly(L-lactic acid (PLLA was synthesized by reacting succinic anhydride with L-lactic acid prepolymer prepared by melt polycondensation. PLLA and epoxy resin based on diglycidyl ether of bisphenol A (DGEBA copolymers were prepared by chain extension of dicarboxylated PLLA with DGEBA. Infrared spectra confirmed the formation of dicarboxylated PLLA and PLLA/DGEBA copolymer. Influences of reaction temperature, reaction time, and the amount of DGEBA on the molecular weight and gel content of PLLA/DGEBA copolymer were studied. The viscosity average molecular weight of PLLA/DGEBA copolymer reached 87 900 when reaction temperature, reaction time, and mol ratio of dicarboxylated PLLA to DGEBA is 150°C, 30 min, and 1:1 respectively, while gel content of PLLA/DGEBA copolymer is almost zero.

  20. Alteration in sample preparation to increase the yield of multiplex Polymerase Chain Reaction assay for diagnosis of genital ulcer disease

    Directory of Open Access Journals (Sweden)

    G Rao


    Full Text Available Purpose: Genital Ulcer Disease (GUD is common sexually transmitted infection (STI. Multiple studies have shown that GUDs are strongly associated with the transmission and the acquisition of HIV infection. An accurate diagnosis of common etiology of GUD namely Herpes, syphilis and Chancroid is possible using Multiplex PCR (M-PCR. However, frequent presence of Polymerase Chain Reaction inhibitors in the ulcer swab specimen limits the performance of the assay. In order to overcome this problem, alternative specimen preparation method was used. Materials and Methods: To determine the common etiology, GUD specimens obtained under an STI operations research study were tested with M-PCR after the samples were prepared using Roche Amplicor specimen preparation kit. PCR inhibiting samples were identified from that, which showed negative results. These samples were subjected to phenol-chloroform extraction and ethanol precipitation before the conduct of M-PCR on them. Results: Of the 237 GUD specimens tested, in 145 etiologies could be detected, whereas 92 samples were found negative. Further spiking with one of the target DNA, 128 of the negative samples were found to contain the inhibitors. These 126 samples were then subjected to phenol chloroform extraction and ethanol precipitation followed by M-PCR. Using this method for sample preparation, etiology could be determined in 46 (23% additional samples. This success rate of altered sample preparation method has been lower than that has reported. Conclusion: The results indicate that sample preparation using phenol chloroform extraction and ethanol precipitation, prior to M-PCR helps to eliminate the inhibitors and increase the yield of the assay. However, being a laborious procedure, it may be used for samples giving negative results after the screening by Roche Amplicor specimen preparation kit.


    Institute of Scientific and Technical Information of China (English)

    LI Jin-feng; ZHANG Lei; SUN Su-lian


    Objective: The aim of this study was to detect micrometastases in bone marrow of primary breast cancer patients, and compare with other clinical parameters.Methods: Cytokeratin 19 (CK-19) gene mRNA expression was detected by reverse transcriptase-polymerase chain reaction (RT-PCR) and Southern blot hybridization.Human breast cancer cell line T47D was mixed with bone marrow cells in different proportions. The positive detection rate was compared among RT-PCR, Southern blotting and immunohistochemistry (IHC) methods. Results: Cytokeratin 19 gene was expressed in all 6 positive control samples while the expression was not seen in 8 negative control samples. In all 54 patients 14 cases were CK-19 positive (25.9%) by RT-PCR, another positive signal was obtained in 5/54 (9.3%) of bone marrow samples by Southern blotting. The total positive cases are 19/54 (35.2%).CK-19 IHC+ cells were detected at a dilution of one T47D cell in 5×104 bone marrow cells, while the sensitivity detected by PCR and Southern blot hybridization was at 1:5×105 and 1:1×106, respectively. This demonstrates that RT-PCR and Southern blotting was at least 20 times more sensitive than the IHC method. The micrometastases positive rate of the larger tumor size group (>5.0 cm) was significantly (P<0.05) greater than that of the smaller tumor size group (0-2.0 cm). Conclusion: detection of micrometastases in bone marrow by RT-PCR and Southern blotting, using CK-19 as a biological marker, is highly sensitive and it is a method to be used for anticipating the prognosis of breast cancer patients.

  2. Direct polymerase chain reaction from blood and tissue samples for rapid diagnosis of bovine leukemia virus infection. (United States)

    Nishimori, Asami; Konnai, Satoru; Ikebuchi, Ryoyo; Okagawa, Tomohiro; Nakahara, Ayako; Murata, Shiro; Ohashi, Kazuhiko


    Bovine leukemia virus (BLV) infection induces bovine leukemia in cattle and causes significant financial harm to farmers and farm management. There is no effective therapy or vaccine; thus, the diagnosis and elimination of BLV-infected cattle are the most effective method to eradicate the infection. Clinical veterinarians need a simpler and more rapid method of diagnosing infection, because both nested polymerase chain reaction (PCR) and real-time PCR are labor intensive, time-consuming, and require specialized molecular biology techniques and expensive equipment. In this study, we describe a novel PCR method for amplifying the BLV provirus from whole blood, thus eliminating the need for DNA extraction. Although the sensitivity of PCR directly from whole blood (PCR-DB) samples as measured in bovine blood containing BLV-infected cell lines was lower than that of nested PCR, the PCR-DB technique showed high specificity and reproducibility. Among 225 clinical samples, 49 samples were positive by nested PCR, and 37 samples were positive by PCR-DB. There were no false positive samples; thus, PCR-DB sensitivity and specificity were 75.51% and 100%, respectively. However, the provirus loads of the samples detected by nested PCR and not PCR-DB were quite low. Moreover, PCR-DB also stably amplified the BLV provirus from tumor tissue samples. PCR-DB method exhibited good reproducibility and excellent specificity and is suitable for screening of thousands of cattle, thus serving as a viable alternative to nested PCR and real-time PCR. PMID:26911373

  3. Direct polymerase chain reaction from blood and tissue samples for rapid diagnosis of bovine leukemia virus infection (United States)

    NISHIMORI, Asami; KONNAI, Satoru; IKEBUCHI, Ryoyo; OKAGAWA, Tomohiro; NAKAHARA, Ayako; MURATA, Shiro; OHASHI, Kazuhiko


    Bovine leukemia virus (BLV) infection induces bovine leukemia in cattle and causes significant financial harm to farmers and farm management. There is no effective therapy or vaccine; thus, the diagnosis and elimination of BLV-infected cattle are the most effective method to eradicate the infection. Clinical veterinarians need a simpler and more rapid method of diagnosing infection, because both nested polymerase chain reaction (PCR) and real-time PCR are labor intensive, time-consuming, and require specialized molecular biology techniques and expensive equipment. In this study, we describe a novel PCR method for amplifying the BLV provirus from whole blood, thus eliminating the need for DNA extraction. Although the sensitivity of PCR directly from whole blood (PCR-DB) samples as measured in bovine blood containing BLV-infected cell lines was lower than that of nested PCR, the PCR-DB technique showed high specificity and reproducibility. Among 225 clinical samples, 49 samples were positive by nested PCR, and 37 samples were positive by PCR-DB. There were no false positive samples; thus, PCR-DB sensitivity and specificity were 75.51% and 100%, respectively. However, the provirus loads of the samples detected by nested PCR and not PCR-DB were quite low. Moreover, PCR-DB also stably amplified the BLV provirus from tumor tissue samples. PCR-DB method exhibited good reproducibility and excellent specificity and is suitable for screening of thousands of cattle, thus serving as a viable alternative to nested PCR and real-time PCR. PMID:26911373

  4. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu


    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  5. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.;


    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The...... selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  6. Detection of gastrin mRNA in fresh human colonic carcinomas by reverse transcription-polymerase chain reaction. (United States)

    Monges, G; Biagini, P; Cantaloube, J F; Chicheportiche, C; Frances, V; Brandini, D; Parc, P; Seitz, J F; Giovannini, M; Sauvan, R


    To investigate the hypothesis that gastrin might be synthesized by tumour tissues in cancer of the colon, samples from six human colon tumours, one hepatic metastasis, four normal colonic mucosal samples and two antral and one fundic gastric mucosal samples from nine patients were analysed to determine whether gastrin mRNA was present. RNA was extracted from surgical specimens by ultracentrifugation on a CsCl cushion, purified using the guanidinium thiocyanate method, reverse-transcribed and amplified by polymerase chain reaction. Gastrin mRNA was detected in each colonic carcinoma sample (including the hepatic metastasis), while no such signal was observed in normal colon biopsies. Positive and negative controls (gastric antrum and fundus respectively) gave the expected results. In each of the positive samples, the chemiluminescent revelation of amplified products after Southern blotting corresponded to gastrin mRNA without the intron. These findings demonstrate the ability of primary and metastatic human colonic tumours to produce gastrin mRNA. Since malignant cell lines have been reported to produce gastrin peptide, and since gastrin receptors were present in some cases, our results support the idea that gastrin may be involved in an autocrine mechanism. PMID:7507679

  7. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    Directory of Open Access Journals (Sweden)

    T. M. Nabeel Muhammad


    Full Text Available Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasal swabs were tested by PCR. Results: PCR analysis showed 56 positives (71.7% for infectious coryza out of total 78 samples tested. Of 56 infra orbital sinus swabs tested, 47 were positive (83.9% and 9 nasal swabs (40.9% out of 22 tested had given positive results for infectious coryza. Samples collected from birds at acute stage of disease and samples collected before treatment with antibiotics were given better results on PCR. Conclusion: For preventing the economic losses associated with the disease, an early, accurate and rapid diagnosis is essential. PCR is a rapid and highly sensitive diagnostic technique which can substitute conventional cultural examination.

  8. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    International Nuclear Information System (INIS)

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  9. Diagnosis of foot-and mouth disease by real time reverse transcription polymerase chain reaction under field conditions in Brazil

    Directory of Open Access Journals (Sweden)

    Clarke Neville P


    Full Text Available Abstract Background Foot-and-mouth disease (FMD is an economically important and highly contagious viral disease that affects cloven-hoofed domestic and wild animals. Virus isolation and enzyme-linked immunosorbent assay (ELISA are the gold standard tests for diagnosis of FMD. As these methods are time consuming, assays based on viral nucleic acid amplification have been developed. Results A previously described real-time reverse transcriptase polymerase chain reaction (RT-PCR assay with high sensitivity and specificity under laboratorial and experimental conditions was used in the current study. To verify the applicability of this assay under field conditions in Brazil, 460 oral swabs from cattle were collected in areas free of FMD (n = 200 and from areas with outbreaks of FMD (n = 260. Three samples from areas with outbreaks of FMD were positive by real-time RT-PCR, and 2 of those samples were positive by virus isolation and ELISA. Four other samples were considered inconclusive by real-time RT-PCR (threshold cycle [Ct] > 40; whereas all 200 samples from an area free of FMD were real-time RT-PCR negative. Conclusion real-time RT-PCR is a powerful technique for reliable detection of FMDV in a fraction of the time required for virus isolation and ELISA. However, it is noteworthy that lack of infrastructure in certain areas with high risk of FMD may be a limiting factor for using real-time RT-PCR as a routine diagnostic tool.

  10. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction (United States)

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.


    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  11. Validation and Identification of Invasive Salmonella Serotypes in Sub-Saharan Africa by Multiplex Polymerase Chain Reaction. (United States)

    Al-Emran, Hassan M; Krumkamp, Ralf; Dekker, Denise Myriam; Eibach, Daniel; Aaby, Peter; Adu-Sarkodie, Yaw; Ali, Mohammad; Rubach, Mathew P; Bjerregaard-Andersen, Morten; Crump, John A; Cruz Espinoza, Ligia Maria; Løfberg, Sandra Valborg; Gassama Sow, Amy; Hertz, Julian T; Im, Justin; Jaeger, Anna; Kabore, Leon Parfait; Konings, Frank; Meyer, Christian G; Niang, Aissatou; Pak, Gi Deok; Panzner, Ursula; Park, Se Eun; Rabezanahary, Henintsoa; Rakotozandrindrainy, Raphaël; Raminosoa, Tiana Mirana; Razafindrabe, Tsiriniaina Jean Luco; Sampo, Emmanuel; Schütt-Gerowitt, Heidi; Sarpong, Nimako; Soura, Abdramane Bassiahi; Tall, Adama; von Kalckreuth, Vera; Wierzba, Thomas F; May, Jürgen; Marks, Florian


    Salmonella enterica serovar Typhi and nontyphoidal Salmonella (NTS) cause the majority of bloodstream infections in sub-Saharan Africa; however, serotyping is rarely performed. We validated a multiplex polymerase chain reaction (PCR) assay with the White-Kauffmann-Le Minor (WKLM) scheme of serotyping using 110 Salmonella isolates from blood cultures of febrile children in Ghana and applied the method in other Typhoid Fever Surveillance in Africa Program study sites. In Ghana, 47 (43%) S. Typhi, 36 (33%) Salmonella enterica serovar Typhimurium, 14 (13%) Salmonella enterica serovar Dublin, and 13 (12%) Salmonella enterica serovar Enteritidis were identified by both multiplex PCR and the WKLM scheme separately. Using the validated multiplex PCR assay, we identified 42 (66%) S. Typhi, 14 (22%) S. Typhimurium, 2 (3%) S. Dublin, 2 (3%) S. Enteritidis, and 4 (6%) other Salmonella species from the febrile patients in Burkina Faso, Guinea-Bissau, Madagascar, Senegal, and Tanzania. Application of this multiplex PCR assay in sub-Saharan Africa could advance the knowledge of serotype distribution of Salmonella. PMID:26933026

  12. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia. (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn


    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. PMID:23541117

  13. Influences of bracket bonding on mutans streptococcus in plaque detected by real time fluorescence-quantitative polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    AI Hong; LU Hong-fei; LIANG Huan-you; WU Jian; LI Ruo-lan; LIU Guo-ping; XI Yun


    Background Enamel demineralization occurs frequently during orthodontic treatment. In this study, we evaluated the changes of the density of mutans streptococcus (MS) in plaque after bracket bonding and using fluoride adhesive on maxillary incisors by real time fluorescence-quantitative polymerase chain reaction (RT-FQ PCR).Methods The study was designed as a self-paired test. Brackets were bonded with fluoride adhesive on the left side, while non-fluoride adhesive on the right side for each patient. Plaque samples were taken from the surfaces around the brackets of four maxillary incisors before brackets bonding and after the bonding 4 weeks later. The amount of MS was measured by RT-FQ PCR. The data obtained were analyzed statistically using the SPSS 11.5 version and the alpha level was set at 0.05 (2-tailed).Results The amount of MS in plaque increased significantly after bracket bonding (P0.05), and among the incisors using and not using fluoride adhesive (P>0.05).Conclusions The increase of the density of MS in plaque after bracket bonding is one of the etiological factors for enamel demineralization in orthodontic patients. The result of this study did not support what we observed clinically that the incidence of enamel demineralization for lateral incisors was higher than that for central incisors. Using fluoride adhesive for bonding did not affect the amount of MS in plaque in our study. Further study is needed.

  14. Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sundaran S. Tinky


    Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

  15. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription

    Institute of Scientific and Technical Information of China (English)

    Stephen Johnston; Zachary Gallaher; Krzysztof Czaja


    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2-ΔΔCt normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  16. Diagnosis of human herpesvirus 6B primary infection by polymerase chain reaction in young children with exanthematic disease

    Directory of Open Access Journals (Sweden)

    Ivna de Melo Magalhães


    Full Text Available INTRODUCTION: Exanthem subitum is a classical rash disease of early childhood caused by human herpesvirus 6B (HHV-6B. However, the rash is frequently misdiagnosed as that of either measles or rubella. METHODS: In this study, a nested multiplex polymerase chain reaction (PCR was used to diagnose HHV-6B primary infection, differentiate it from infections caused by HHV-6A and compare it to antibody avidity tests. The samples were separated into case group and control group according to the results of the indirect immunofluorescence assay (IFA technique. RESULTS: From the saliva samples analyzed, HHV-6A DNA was detected in 3.2% of the case group and in 2.6% of the control group. Regarding HHV-6B, PCR detected viral DNA in 4.8% of the case group and in 1.3% of the control group. Among the serum samples studied, a frequency of 1.7% was determined for HHV-6A in the case group and 1.2% in the control group. PCR did not detect HHV-6B DNA in serum samples. The sensitivity and specificity of the PCR technique ranged from 0% to 4.8% and 97.5% to 100%, respectively, compared to IFA. CONCLUSIONS: The PCR technique was not suitable for diagnosing primary infection by HHV-6B in children with exanthematic disease and should not substitute the IFA.

  17. Detection of hepatitis E virus RNA in sera of patients with hepatitis E by polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Zhen-Yu Zhao; Bing Ruan; Hui Shao; Zhen-Juan Chen; She-Lan Liu


    BACKGROUND: The duration of viremia during hepatitis E virus (HEV) infection has rarely been reported. This study was undertaken to detect HEV RNA in sera of patients with hepatitis E and to understand the process of HEV infection more thoroughly. METHODS:HEV RNA was detected in the serum samples of hospitalized patients with acute hepatitis E by reverse transcriptase-nested polymerase chain reaction (RT-nPCR) using two pairs of primers from open reading frame (ORF) 1 of the HEV genome. RESULTS:The serum samples from 44 (70%) of 62 patients were positive for HEV RNA. Thirty-two of these patients, with 288 serial serum specimens, were followed up for the whole process, and 24 patients (75%) were positive for HEV RNA. The positive rates declined with the course of the disease, serum HEV RNA persisting for 20.6 days on average after onset of illness. Serum HEV RNA remained positive in 36 (81.8%) of the 44 patients at the time their alanine aminotransferase (ALT) began to decrease. There was no difference in HEV RNA positivity between serum with high levels of HEV antibody (peak P/N ratio ≥4.0) and that with low levels (peak P/N ratio0.05), respectively. CONCLUSIONS: There is a relatively long period of HEV viremia in patients with hepatitis E. The proportion of HEV viremia and its duration are not directly related to serum ALT values or HEV antibody levels.

  18. Alteration in sample preparation to increase the yield of multiplex Polymerase Chain Reaction assay for diagnosis of genital ulcer disease


    Rao, G.; A Das; Prabhakar, P.; V Nema; Risbud, A. R.


    Purpose: Genital Ulcer Disease (GUD) is common sexually transmitted infection (STI). Multiple studies have shown that GUDs are strongly associated with the transmission and the acquisition of HIV infection. An accurate diagnosis of common etiology of GUD namely Herpes, syphilis and Chancroid is possible using Multiplex PCR (M-PCR). However, frequent presence of Polymerase Chain Reaction inhibitors in the ulcer swab specimen limits the performance of the assay. In order to overcome this proble...

  19. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture



    Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR) assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by...

  20. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment


    Krøjgaard Louise H; Krogfelt Karen A; Albrechtsen Hans-Jørgen; Uldum Søren A


    Abstract Background Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the useful...

  1. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase


    Diaz, R S; Sabino, E. C.


    For certain applications of the polymerase chain reaction (PCR), it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq) DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We use...

  2. Magnetic isotope effect and oxygen enrichment by 17O isotope in chain oxidation reactions. Communication 1. Theory

    International Nuclear Information System (INIS)

    The theory of magnetic isotope effect and enrichment of molecular oxygen by 17O isotope in chain oxidation reactions of organic compounds is presented. Recombination probabilities of perioxide radicals differing by isotope composition by oxygen are calculated; the magnetic isotope effect and its dependence on diffusion and viscosity coefficients are determined. Some geochemical and space-chemical consequences of the magnetic isotope effect are discussed

  3. Rapid Detection/pathotyping of Newcastle disease virus isolates in clinical samples using real time polymerase chain reaction assay




    Authors: Abdul Wajid, Muhammad Wasim, Tahir Yaqub, Shafqat F Rehmani, Tasra Bibi, Nadia Mukhtar, Javed Muhammad, Umar Bacha, Suliman Qadir Afridi, Muhammad Nauman Zahid, Zia u ddin, Muhammad Zubair Shabbir, Kamran Abbas & Muneer Ahmad ### Abstract In the present protocol we describe the real time reverse transcription polymerase chain reaction (rRT-PCR) assay for the rapid detection/pathotyping of Newcastle disease virus (NDV) isoaltes in clinical samples. Fusion gene and matrix ...

  4. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems


    Camila Ximenes; Eduardo Brandão; Paula Oliveira; Abraham Rocha; Tamisa Rego; Rafael Medeiros; Ana Aguiar-Santos; João Ferraz; Christian Reis; Paulo Araujo; Luiz Carvalho; Melo, Fabio L


    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuche...

  5. Diagnosis of human trypanosomiasis, due to Trypanosoma brucei gambiense in central Africa, by the polymerase chain reaction


    Penchenier, Laurent; Simo, G.; Grébaut, Pascal; Nkinin, S.; Laveissière, Claude; Herder, Stéphane


    During a mass screening of sleeping sickness conducted in 1998 and 1999, and involving 27,932 persons in Cameroon and the Central African Republic, we tested the polymerase chain reaction (PCR) on whole blood for the diagnosis of human African trypanosomiasis due to #Trypanosoma brucei gambiense$. The 1858 samples obtained were from 4 groups : 155 infected patients, 1432 serological suspects detected by the card agglutination test for trypanosomiasis (CATT), 222 negative controls living in th...



    Reni Herman; Endah Ariyanti; Ervi Salwati; Delima -; Emiliana Tjitra


    In monitoring the treatment of malaria with Dihydroartemisinin-piperaquine (DHP), microscopic cross check and Polymerase Chain Reaction (PCR) performed to validate the results of laboratory examinations in the field. This study used finger prick samples from subjects with a diagnosis of malaria in monitoring the treatment of malaria with DHP in Kalimantan and Sulawesi. Samples taken at day 0, blood smears made on slides for microscopic and blood spot on filter paper for PCR examination. The P...

  7. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.


    Lunkenheimer, K; Hufert, F. T.; Schmitz, H.


    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specim...

  8. Pilot Study of COBAS PCR and Ligase Chain Reaction for Detection of Rectal Infections Due to Chlamydia trachomatis


    Matthew R Golden; Astete, Sabina G.; Galvan, Rosa; Lucchetti, Aldo; Sanchez, Jorge; Celum, Connie L.; Whittington, William L. H.; Stamm, Walter E.; Holmes, King K.; Totten, Patricia A.


    We tested rectal specimens from men who have sex with men for Chlamydia trachomatis by using COBAS PCR (Roche Diagnostics) and ligase chain reaction LCR (Abbott laboratories) and compared three PCR specimen-processing procedures. Chlamydiae were detected by one or more procedures in 22 of 186 specimens. All three PCR tests were positive for 17 specimens, all of which also tested positive by LCR.

  9. Detection of colonic cells in peripheral blood of colorectal cancer patients by means of reverse transcriptase and polymerase chain reaction.


    Castells, A.; Boix, L.; Bessa, X; Gargallo, L.; Piqué, J M


    Circulating tumour cells play a central role in the metastatic process, but little is known about the relationship between this cellular subpopulation and the development of secondary disease. This study was aimed at assessing the presence of colonic cells in peripheral blood of patients with colorectal cancer in different evolutionary stages, by means of reverse transcriptase polymerase chain reaction (RT-PCR) targeted to carcinoembryonic antigen (CEA) mRNA. In vitro sensitivity was establis...

  10. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome


    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo


    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  11. Use of the Polymerase Chain Reaction to Detect Helicobacter pylori in the Dental Plaque of Healthy and Symptomatic Individuals


    Banatvala, N.; Lopez, C. Romero; Owen, R J; Hurtado, A; Abdi, Y; Davies, G. R.; Hardie, J. M.; Feldman, R A


    A polymerase chain reaction (PCR) assay, based on the amplification of a species specific ureA (urease) gene internal sequence, was used to detect Helicobacter pylori. Total DNA extracts were obtained from dental plaque in patients attending an endoscopy clinic and from apparently healthy schoolchildren of Bangladeshi origin. Of the 54 samples of dental plaque from endoscopy patients examined, 39 were positive (72 per cent). There was 63 per cent correlation (34/54) between H. pylori in the s...

  12. Development and validation of a Pneumocystis jirovecii real-time polymerase chain reaction assay for diagnosis of Pneumocystis pneumonia


    Church, Deirdre L; Ambasta, Anshula; Wilmer, Amanda; Williscroft, Holly; Ritchie, Gordon; Pillai, Dylan R.; Champagne, Sylvie; Daniel G Gregson


    Pneumocystis pneumonia is caused by Pneumocystis jirovecii, an opportunistic fungal pathogen. Presently, many clinical microbiology laboratories rely on direct microscopic detection of P jirovecii. The validation, and clinical and laboratory development of a qualitative P jirovecii real-time polymerase chain reaction assay for the rapid detection of Pneumocystis pneumonia is discussed by the authors. In addition, this new technique is compared with the existing gold-standard immunofluorescenc...

  13. Fite-Faraco staining in combination with multiplex polymerase chain reaction: A new approach to leprosy diagnosis


    Abu Hena Hasanoor Reja; Nibir Biswas; Supratik Biswas; Sarbani Dasgupta; Imran Hussain Chowdhury; Surajita Banerjee; Tapas Chakraborty; Pijush Kumar Dutta; Basudev Bhattacharya


    Background: Leprosy is not always an easy disease to diagnose, and patients can remain undiagnosed for longtime, not only at the peripheral clinics but also even at places with higher medical facilities, so, there is an urgent need for rapid and definitive modalities for leprosy diagnosis. This prospective study evaluates the ability of Fite-Faraco staining (FF staining) and multiplex polymerase chain reaction (PCR) over hematoxylin and eosin staining (H and E staining) and Ziehl-Neelsen stai...

  14. Optimisation Methods in Supply Chain Applications: a Review


    Arisha, Amr; Abo-Hamad, Waleed


    The competitiveness and dynamic nature of today’s marketplace is due to rapid advances in information technology, short product life cycles and the continuing trend in global outsourcing. Managing the resulting supply chain networks effectively is a complex and challenging task which is imputable to high level of uncertainty in supply-demand, conflict objectives, vagueness of information, numerous decision variables and constraints. With such level of complexity in the environment, supply cha...

  15. A microfluidic device providing continuous-flow polymerase chain reaction heating and cooling

    International Nuclear Information System (INIS)

    The objective of this study is to describe a new type of microfluidic device that could be used to manipulate fluid temperature in many microfluidic applications. The key component is a composite material containing a thermally conductive phase placed in a purposeful manner to manipulate heat flow into and out of an embedded microchannel. In actual use, the device is able to vary temperature along a defined flow path with remarkable precision. As a demonstration of capability, a functional prototype was designed and fabricated using four layers of patterned copper laminated between alternating layers of polyimide and acrylic. The key fabrication steps included laser micromachining, acid etching, microchannel formation, and hot lamination. In order to achieve the desired temperature variations along the microchannel, an outer optimization loop and an inner finite element analysis loop were used to iteratively obtain a near-optimal copper pattern. With a minor loss of generality, admissible forms were restricted to comb-like patterns. For a given temperature profile, the pattern was found by refining a starting guess based on a deterministic rubric. Thermal response was measured using fine thermocouples placed at critical locations along the microchannel wall. At most of these points, the agreement between measured and predicted temperatures was within 1 °C, and temperature gradients as high as ±45 °C mm−1 (equivalent to ±90 °C s−1 at 2 μl min−1 flow rate) were obtained within the range of 59–91 °C. The particular profile chosen for case study makes it possible to perform five cycles of continuous-flow polymerase chain reaction (PCR) in less than 15 s, i.e. it entails five successive cycles of cooling from 91 to 59 °C, rapid reheating from 59 to 73 °C, slow reheating from 73 to 76 °C, and a final reheating from 73 to 91 °C, using a resistively heated source at 100 °C at and a thermoelectrically cooled sink at 5

  16. A microfluidic device providing continuous-flow polymerase chain reaction heating and cooling (United States)

    Harandi, A.; Farquhar, T.


    The objective of this study is to describe a new type of microfluidic device that could be used to manipulate fluid temperature in many microfluidic applications. The key component is a composite material containing a thermally conductive phase placed in a purposeful manner to manipulate heat flow into and out of an embedded microchannel. In actual use, the device is able to vary temperature along a defined flow path with remarkable precision. As a demonstration of capability, a functional prototype was designed and fabricated using four layers of patterned copper laminated between alternating layers of polyimide and acrylic. The key fabrication steps included laser micromachining, acid etching, microchannel formation, and hot lamination. In order to achieve the desired temperature variations along the microchannel, an outer optimization loop and an inner finite element analysis loop were used to iteratively obtain a near-optimal copper pattern. With a minor loss of generality, admissible forms were restricted to comb-like patterns. For a given temperature profile, the pattern was found by refining a starting guess based on a deterministic rubric. Thermal response was measured using fine thermocouples placed at critical locations along the microchannel wall. At most of these points, the agreement between measured and predicted temperatures was within 1 °C, and temperature gradients as high as ±45 °C mm-1 (equivalent to ±90 °C s-1 at 2 μl min-1 flow rate) were obtained within the range of 59-91 °C. The particular profile chosen for case study makes it possible to perform five cycles of continuous-flow polymerase chain reaction (PCR) in less than 15 s, i.e. it entails five successive cycles of cooling from 91 to 59 °C, rapid reheating from 59 to 73 °C, slow reheating from 73 to 76 °C, and a final reheating from 73 to 91 °C, using a resistively heated source at 100 °C at and a thermoelectrically cooled sink at 5 °C.

  17. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S


    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  18. Polymerase Chain Reaction-based Suppression of Repetitive Sequences in Whole Chromosome Painting Probes for FISH

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Pattee, M; Williams, J; Eklund, M; Bedford, J S; Christian, A T


    We have developed a method to suppress the PCR amplification of repetitive sequences in whole chromosome painting probes by adding Cot-1 DNA to the amplification mixture. The repetitive sequences in the Cot-1 DNA bind to their homologous sequences in the probe library, prevent the binding of primers, and interfere with extension of the probe sequences, greatly decreasing PCR efficiency selectively across these blocked regions. A second labeling reaction is then done and this product is resuspended in FISH hybridization mixture without further addition of blocking DNA. The hybridization produces little if any non-specific binding on any other chromosomes. We have been able to successfully use this procedure with both human and rat chromosome probes. This technique should be applicable in producing probes for CGH, M-FISH and SKY, as well as reducing the presence of repetitive DNA in genomic libraries.

  19. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α32P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  20. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from sheep of Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.


    Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.