Reaction pathway towards formation of cobalt single chain magnets and nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)
2010-03-15
With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.
Fusion chain reaction - a chain reaction with charged particles
International Nuclear Information System (INIS)
Peres, A.; Shvarts, D.
1975-01-01
When a DT-plasma is compressed to very high density, the particles resulting from nuclear reactions give their energy mostly to D and T ions, by nuclear collisions, rather than to electrons as usual. Fusion can thus proceed as a chain reaction, without the need of thermonuclear temperatures. In this paper, we derive relations for the suprathermal ion population created by a fusion reaction. Numerical integration of these equations shows that a chain reaction can proceed in a cold infinite DT-plasma at densities above 8.4x10 27 ions.cm -3 . Seeding the plasma with a small amount of 6 Li reduces the critical density to 7.2x10 27 ions.cm -3 (140000times the normal solid density). (author)
Chain chemical reactions during matrix devitrification
International Nuclear Information System (INIS)
Barkalov, I.M.
1980-01-01
Investigation results of chain reaction mechanisms, proceeding at devitrification of glass-like matrices under the effect of γ-irradiation are summarized. Peculiarities of kinetics and mechanism of chain reactions proceeding at devitrification are considered: hydrocarbon chlorination, polymerization of vinyl monomers, copolymerization and graft polymerization. Possible application aspects of the chain reaction conducting during matrix devitrification are also considered
Nuclear chain reaction: forty years later
International Nuclear Information System (INIS)
Sachs, R.G.
1984-01-01
The proceedings from a 1982 symposium 40 years after the first controlled nuclear chain reaction took place in Chicago covers four sessions and public discussion. The session covered the history of the chain reaction; peaceful uses in technology, medicine, and biological science; peaceful uses in power generation; and nuclear weapons control. Among the speakers were Eugene Wigner, Glenn Seaborg, Alvin Weinberg, and others who participated in the first chain reaction experiments. The proceedings reflect differences of opinion among the scientists as well as the general public. References, slides, and tables used to illustrate the individual talks are included with the papers
Method of identification of unbranched chain reaction with cross termination of chain
International Nuclear Information System (INIS)
Poluehktov, V.A.; Begishev, I.R.
1977-01-01
Gas-phase chlorination of unsymmetrical difluoroethane initiated by gamma quanta of Co 60 has been studied. At decreased temperatures the only hydrogen is replaced by a chlorine atom. Over a wide range of ratios of the initial reagents, the reaction occurs with a chain rupture. An analysis of the kinetics of such a reaction provides a method for identification of an unbranched chain reaction with a cross-rupture of the chain
Chain formation of metal atoms
DEFF Research Database (Denmark)
Bahn, Sune Rastad; Jacobsen, Karsten Wedel
2001-01-01
The possibility of formation of single-atomic chains by manipulation of nanocontacts is studied for a selection of metals (Ni, Pd, Pt, Cu, Ag, Au). Molecular dynamics simulations show that the tendency for chain formation is strongest for Au and Pt. Density functional theory calculations indicate...... that the metals which form chains exhibit pronounced many-atom interactions with strong bonding in low coordinated systems....
Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data
Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.
2003-01-01
Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR
DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations
International Nuclear Information System (INIS)
East, L.V.
1994-05-01
A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)
2016-05-06
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.
The formation of carbon chain molecules in IRC + 10216
International Nuclear Information System (INIS)
Howe, D.A.; Millar, T.J.
1990-01-01
This paper considers the formation of carbon-chain molecules, including C 2n H, C n S, HC 2n+1 N (n = 1-3) and SiC n (n = 1-4), in the outflowing envelope of the late-type carbon star IRC + 10216. The results suggest that the organo-sulphur species C 2 S and C 3 S can be formed in ion-molecule reactions involving acetylene ions and parent CS and SiS molecules. In addition to ion-molecule processes, neutral-neutral reactions can play a significant role in the formation of hydrocarbons and cyanopolyynes with up to six heavy atoms and in the formation of SiC 4 , and suggest that SiC 3 might be observable. However, the short time-scales available in the outflow are such that the observed abundances of the cyanopolyynes larger than HC 5 N cannot be reproduced using the parent molecules and abundances adopted here. (author)
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin
Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0
Efficient Synthesis of Single-Chain Polymer Nanoparticles via Amide Formation
Directory of Open Access Journals (Sweden)
Ana Sanchez-Sanchez
2015-01-01
Full Text Available Single-chain technology (SCT allows the transformation of individual polymer chains to folded/collapsed unimolecular soft nanoparticles. In this work we contribute to the enlargement of the SCT toolbox by demonstrating the efficient synthesis of single-chain polymer nanoparticles (SCNPs via intrachain amide formation. In particular, we exploit cross-linking between active methylene groups and isocyanate moieties as powerful “click” chemistry driving force for SCNP construction. By employing poly(methyl methacrylate- (PMMA- based copolymers bearing β-ketoester units distributed randomly along the copolymer chains and bifunctional isocyanate cross-linkers, SCNPs were successfully synthesized at r.t. under appropriate reaction conditions. Characterization of the resulting SCNPs was carried out by means of a combination of techniques including size exclusion chromatography (SEC, infrared (IR spectroscopy, proton nuclear magnetic resonance (1H NMR spectroscopy, dynamic light scattering (DLS, and elemental analysis (EA.
Energy Technology Data Exchange (ETDEWEB)
Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe [Key Laboratory for Green Chemical Technology of Ministry of Education, R& D Center for Petrochemical Technology, Tianjin University, Tianjin 300072 (China); Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Tianjin 300072 (China); Wen, Guobin [Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Tianjin 300072 (China); Zhang, Minhua, E-mail: mhzhang@tju.edu.cn [Key Laboratory for Green Chemical Technology of Ministry of Education, R& D Center for Petrochemical Technology, Tianjin University, Tianjin 300072 (China); Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Tianjin 300072 (China)
2017-08-01
Highlights: • Calculations based on the first-principle density functional theory were carried out to study ethanol formation from syngas on Cu-Co surfaces. • The most controversial reactions in ethanol formation from syngas were researched: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions (CHx + HCO → CHxCHO (x = 1–3))). • Four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) were built to investigate the synergy of the Cu and Co components. • The PDOS of 4d orbitals and d-band center analysis of surface Cu and Co atoms of all surfaces were studied to reveal correlation between electronic property and catalytic performance. - Abstract: Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CH{sub x} + HCO → CH{sub x}CHO (x = 1–3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between
International Nuclear Information System (INIS)
John C. Fisher
2000-01-01
Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of ∼60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N≥12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between 16 O and A Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound 16 O A Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the 16 O and A Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of A Nt is prevented by the buildup of Coulomb energy associated with transforming A Nt into A H in close proximity to 16 O. Thus, it is possible that 16 O A Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the A Nt component can tunnel to an adjacent nucleus, and if the adjacent nucleus is 18 O, a
Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes
Denisov, E. T.; Shestakov, A. F.
2018-05-01
Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.
Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua
2017-08-01
Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.
Cellular chain formation in Escherichia coli biofilms
DEFF Research Database (Denmark)
Vejborg, Rebecca Munk; Klemm, Per
2009-01-01
; type I fimbriae expression significantly reduced cellular chain formation, presumably by steric hindrance. Cellular chain formation did not appear to be specific to E coli K-12. Although many urinary tract infection (UTI) isolates were found to form rather homogeneous, flat biofilms, three isolates...
Tangled nonlinear driven chain reactions of all optical singularities
Vasil'ev, V. I.; Soskin, M. S.
2012-03-01
Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.
Gianturco, F. A.; Satta, M.; Yurtsever, E.; Wester, R.
2017-11-01
We investigate the relative efficiencies of low-temperature chemical reactions in the interstellar medium with H- anion reacting in the gas phase with cyanopolyyne neutral molecules, leading to the formation of anionic {{{C}}}x{{{N}}}- linear chains of different lengths and of H2. All the reactions turn out to be without barriers, highly exothermic reactions that provide a chemical route to the formation of anionic chains of the same length. Some of the anions have been observed in the dark molecular clouds and in the diffuse interstellar envelopes. Quantum calculations are carried out for the corresponding reactive potential energy surfaces for all the odd-numbered members of the series (x = 1, 3, 5, 7). We employ the minimum energy paths to obtain the relevant transition state configurations and use the latter within the variational transition state model to obtain the chemical rates. The present results indicate that at typical temperatures around 100 K, a set of significantly larger rate values exists for x = 3 and x = 5, while the rate values are smaller for CN- and {{{C}}}7{{{N}}}-. At those temperatures, however, all the rates turn out to be larger than the estimates in the current literature for the radiative electron attachment (REA) rates, thus indicating the greater importance of the present chemical path with respect to REA processes at those temperatures. The physical reasons for our findings are discussed in detail and linked with the existing observational findings.
The first nuclear chain reaction
International Nuclear Information System (INIS)
Zinn, W.H.
1989-01-01
The author offers his recollections of the experimental efforts beginning in 1939 which culminated in the Chain Reaction in the squash court on December 2, 1942. Recalled are Columbia University experiments which did much to establish the feasibility of the chain in natural uranium and which stimulated the creation of the Manhattan District. The Columbia group moved to the University of Chicago, where, in early summer of 1942, construction and analysis of a number of subcritical reactors (piles) gave assurance with a high probability that only a reasonable amount of uranium and moderator would be required
Estimation of the reaction efficiency in polymerase chain reaction
Lalam, N.
2006-01-01
Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has
Polymerase chain reaction to search for Herpes viruses in uveitic ...
African Journals Online (AJOL)
Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.
Nasarabadi, Shanavaz [Livermore, CA
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.
Nuclear fission, chain reaction and criticality
International Nuclear Information System (INIS)
Reuss, Paul
2016-01-01
Criticality is, notably for nuclear reactors, the status which separates the case of a fission chain reaction which inexorably decays, from that of a reaction which grows faster and faster until a counter-reaction occurs. If this status is an objective in nuclear reactors, it must not be reached or exceeded in any case in other types of installations in which fissile materials are handled (fabrication, transports, nuclear fuel processing). The author proposes an insight into this notion of criticality, discusses elements of neutron science which allow the multiplication factor to be assessed, analyses accidental scenarios which may happen, and presents associated experiments and computation codes
Study on the kinetics of gel formation in the radiation crosslinking reaction
International Nuclear Information System (INIS)
Wang Mingjun; Liu Yuming
1988-01-01
From the kinetic equation of gel formation obtained by the authors, the mechanism of gel formation may be interpreted clearly as follows: (1) When the degree of crosslinking q g , the system is sol and the crosslinking reaction is only carried out between the sol molecules. (q g is the gel point). (2) When q=q g , there exists a beginning point where the gel is coexisted with the sol, and the system is still sol, and the crosslinking reaction is still carried out between the sol molecules. (3) When q>q g , the crosslinking reaction exceeds the gel point and the gel is coexisted with the sol. The kinetic equation shows clearly that the transformation from sol into gel is caused by crosslinking reaction of the uncrosslinked chain units between the sol and gel molecules. As a result the sol molecules are transformed into the gel molecules gradually, and the sol fraction is reduced. When the chain units P-barw(s)S(1-s)dq in sol are crosslinked with gel, the sol fraction in the system is reduced ds (where P-barw(s) is a function of the radiation dose and s is sol frection). The degree of crosslinking per unit dose (q 0 ) is a reduced function of dose (R). The equation for calculating its value for every irradiation dose is obtained. After knowing the correlation between P-bar W(s) vs R and q 0 vs R, the distribution of gel and sol in the process of radiation crosslinking can be discussed as well
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
The role of chain carriers in fusion reaction kinetics
International Nuclear Information System (INIS)
Harms, A.A.; Krenciglowa, E.M.
1980-01-01
The role of chain carriers as contributors to multiplicative closed cycles in advanced fusion fuels is examined. Emphasis is placed on rate processes which can be used to characterize critical/supercritical/subcritical tendencies of arbitrary closed fusion cycles. Temporal trajectories for the chain carriers which describe both increasing and decreasing multiplicative processes have been found to exist and identified according to their fusion fuel cycle characteristics. Practical criteria to ensure the attainment of steady-state fusion reaction processes have been formulated in terms of fusion reaction rate relationships. (author)
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Polymerase chain reaction versus enzyme-linked immunosorbent ...
African Journals Online (AJOL)
Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.
Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu
2016-04-01
A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.
The application of polymerase chain reaction-denaturing gradient ...
African Journals Online (AJOL)
Jane
2011-05-23
May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.
Spur Reaction Model of Positronium Formation
DEFF Research Database (Denmark)
Mogensen, O. E.
1974-01-01
A new model of positronium (Ps) formation is proposed. Positronium is assumed to be formed by a reaction between a positron and an electron in the positron spur. Ps formation must compete with electron‐ion recombination and electron or positron reactions with solvent molecules and scavenger...
International Nuclear Information System (INIS)
Balogh, Brian.
1991-01-01
Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)
MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS
Wigner, E.P.; Weinberg, A.M.
1961-01-24
A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)
Directory of Open Access Journals (Sweden)
Tuti Susanti Legiastuti
2013-04-01
Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
2012-03-30
Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...
Comparison of polymerase chain reaction (PCR) and loop-mediated ...
African Journals Online (AJOL)
Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...
Determining Annealing Temperatures for Polymerase Chain Reaction
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
Investigating radical cation chain processes in the electrocatalytic Diels-Alder reaction.
Imada, Yasushi; Okada, Yohei; Chiba, Kazuhiro
2018-01-01
Single electron transfer (SET)-triggered radical ion-based reactions have proven to be powerful options in synthetic organic chemistry. Although unique chain processes have been proposed in various photo- and electrochemical radical ion-based transformations, the turnover number, also referred to as catalytic efficiency, remains unclear in most cases. Herein, we disclose our investigations of radical cation chain processes in the electrocatalytic Diels-Alder reaction, leading to a scalable synthesis. A gram-scale synthesis was achieved with high current efficiency of up to 8000%. The reaction monitoring profiles showed sigmoidal curves with induction periods, suggesting the involvement of intermediate(s) in the rate determining step.
Bordetella pertussis diagnosed by polymerase chain reaction
DEFF Research Database (Denmark)
Birkebaek, N H; Heron, I; Skjødt, K
1994-01-01
The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...
Kinetics of Internal-Loop Formation in Polypeptide Chains: A Simulation Study
Doucet, Dana; Roitberg, Adrian; Hagen, Stephen J.
2007-01-01
The speed of simple diffusional motions, such as the formation of loops in the polypeptide chain, places one physical limit on the speed of protein folding. Many experimental studies have explored the kinetics of formation of end-to-end loops in polypeptide chains; however, protein folding more often requires the formation of contacts between interior points on the chain. One expects that, for loops of fixed contour length, interior loops will form more slowly than end-to-end loops, owing to the additional excluded volume associated with the “tails”. We estimate the magnitude of this effect by generating ensembles of randomly coiled, freely jointed chains, and then using the theory of Szabo, Schulten, and Schulten to calculate the corresponding contact formation rates for these ensembles. Adding just a few residues, to convert an end-to-end loop to an internal loop, sharply decreases the contact rate. Surprisingly, the relative change in rate increases for a longer loop; sufficiently long tails, however, actually reverse the effect and accelerate loop formation slightly. Our results show that excluded volume effects in real, full-length polypeptides may cause the rates of loop formation during folding to depart significantly from the values derived from recent loop-formation experiments on short peptides. PMID:17208979
Competing irreversible cooperative reactions on polymer chains
International Nuclear Information System (INIS)
Evans, J.W.; Hoffman, D.K.; Burgess, D.R.
1984-01-01
We analyze model processes involving competition between several irreversible reactions at the sites of a 1D, infinite, uniform polymer chain. These reactions can be cooperative, i.e., the corresponding rates depend on the state of the surrounding sites. An infinite hierarchy of rate equations is readily derived for the probabilities of various subconfigurations. By exploiting a shielding property of suitable blocks of unreacted sites, we show how exact hierarchy truncation and solution is sometimes possible. The behavior of solutions is illustrated in several cases by plotting families of ''reaction trajectories'' for varying ratios of reactant concentrations. As a specific application, we consider competition between coordination of ZnCl 2 to pairs of oxygen atoms and to single oxygen atoms in poly(propylene oxide). The observed glass transition temperature behavior is eludicated
LENUS (Irish Health Repository)
O'Connor, T M
2012-02-03
BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.
Energy Technology Data Exchange (ETDEWEB)
Marteau, C; Gaillard-Cusin, F; James, H [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures
1978-05-01
Investigation of heterogeneous initiation process of gas phase linear chain reactions is carried out through the study of H/sub 2/-D/sub 2/ exchange reaction. Experimental data under study concern mainly the stationary rate of HD formation and the prestationary proceeding. Steady-state method accounts for the first one of these data; it allows to clearly compare the wall process part to the part played by the homogeneous chain reaction towards HD formation. Activation energy of exchange elementary step between chemisorbed hydrogen (on silica) and gaseous deuterium has been evaluated: Esub(e1)=52+-1 Kcal/mole.
Acyl Chain Preference in Foam Cell Formation from Mouse Peritoneal Macrophages.
Fujiwara, Yuko; Hama, Kotaro; Tsukahara, Makoto; Izumi-Tsuzuki, Ryosuke; Nagai, Toru; Ohe-Yamada, Mihoko; Inoue, Keizo; Yokoyama, Kazuaki
2018-01-01
Macrophage foam cells play critical roles in the initiation and development of atherosclerosis by synthesizing and accumulating cholesteryl ester (CE) in lipid droplets. However, in analyzing lipid metabolism in foam cell formation, studies have focused on the sterol group, and little research has been done on the acyl chains. Therefore, we adapted a model system using liposomes containing particular acyl chains and examined the effect of various acyl chains on foam cell formation. Of the phosphatidylserine (PS) liposomes tested containing PS, phosphatidylcholine, and cholesterol, we found that unsaturated (C18:1), but not saturated (C16:0 and C18:0), PS liposomes induced lipid droplet formation, indicating that foam cell formation depends on the nature of the acyl chain of the PS liposomes. Experiments on the uptake and accumulation of cholesterol from liposomes by adding [ 14 C]cholesterol suggested that foam cell formation could be induced only when cholesterol was converted to CE in the case of C18:1 PS liposomes. Both microscopic observations and metabolic analysis suggest that cholesterol incorporated into either C16:0 or C18:0 PS liposomes may stay intact after being taken in by endosomes. The [ 14 C]C18:1 fatty acyl chain in the C18:1 PS liposome was used to synthesize CE and triacylglycerol (TG). Interestingly, the [ 14 C]C16:0 in the C18:1 PS liposome was metabolized to sphingomyelin rather than being incorporated into either CE or TG, which could be because of enzymatic acyl chain selectivity. In conclusion, our results indicate that the acyl chain preference of macrophages could have some impact on their progression to foam cells.
Theoretical study of chain transfer to solvent reactions of alkyl acrylates.
Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud
2014-07-24
This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.
A Double Polymerase Chain Reaction Method for Detecting African ...
African Journals Online (AJOL)
Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.
Koga, Masafumi; Inada, Shinya; Shimizu, Sayoko; Hatazaki, Masahiro; Umayahara, Yutaka; Nishihara, Eijun
2015-01-01
Hb Himeji (β140Ala→Asp) is known as a variant hemoglobin in which glycation is enhanced and HbA1c measured by immunoassay shows a high value. The phenomenon of enhanced glycation in Hb Himeji is based on the fact that the glycation product of variant hemoglobin (HbX1c) shows a higher value than HbA1c. In this study, we investigated whether aldimine formation reaction, the first step of the Maillard early-phase reaction, is enhanced in Hb Himeji in vitro. Three non-diabetic subjects with Hb Himeji and four non-diabetic subjects without variant hemoglobin were enrolled. In order to examine aldimine formation reaction, whole blood cells were incubated with 500 mg/dl of glucose at 37°C for 1 hour and were analyzed by high-performance liquid chromatography. Both HbA1c and HbX1c were not increased in this condition. After incubation with glucose, labile HbA1c (LA1c) fraction increased in the controls (1.1±0.3%). In subjects with Hb Himeji increases in the labile HbX1c (LX1c) fraction as well as the LA1c fraction were observed, and the degree of increase in the LX1c fraction was significantly higher than that of the LA1c fraction (1.8±0.1% vs. 0.5±0.2%, Preaction might be enhanced in Hb Himeji in vitro. The 140th amino acid in β chain of hemoglobin is suggested to be involved in aldimine formation reaction. © 2015 by the Association of Clinical Scientists, Inc.
Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.
Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon
2011-06-07
Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.
Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G
The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,
The Ripple Effect: Citation Chain Reactions of a Nobel Prize
DEFF Research Database (Denmark)
Faber Frandsen, Tove; Nicolaisen, Jeppe
2013-01-01
This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...... citation network. The effect is discussed using innovation decision process theory as a point of departure to identify the factors that created a bandwagon effect leading to the reported observations....... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...
Polymerase chain reaction for the detection of Mycobacterium leprae
Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.
1989-01-01
A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set
Transformational leadership: a cascading chain reaction.
Murphy, Lorraine
2005-03-01
Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.
1993-01-01
OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Use of polymerase chain reaction for detection of Chlamydia trachomatis
DEFF Research Database (Denmark)
Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna
1990-01-01
A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...
Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions
Zhang, Hefeng
2015-05-01
We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.
Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor
International Nuclear Information System (INIS)
Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian
2012-01-01
Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current
Role of Polymerase Chain Reaction (PCR) in the detection of ...
African Journals Online (AJOL)
Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...
Thermal Stability Threshold for Amyloid Formation in Light Chain Amyloidosis
Directory of Open Access Journals (Sweden)
Tanya L. Poshusta
2013-11-01
Full Text Available Light chain (AL amyloidosis is a devastating disease characterized by amyloid deposits formed by immunoglobulin light chains. Current available treatments involve conventional chemotherapy and autologous stem cell transplant. We have recently concluded a phase III trial comparing these two treatments. AL amyloidosis patients who achieve hematological complete response (CR do not necessarily achieve organ response regardless of the treatment they received. In order to investigate the possible correlation between amyloid formation kinetics and organ response, we selected AL amyloidosis patients from the trial with kidney involvement and CR after treatment. Six patients were selected and their monoclonal immunoglobulin light chains were characterized. The proteins showed differences in their stability and their kinetics of amyloid formation. A correlation was detected at pH 7.4, showing that less stable proteins are more likely to form amyloid fibrils. AL-T03 is too unstable to form amyloid fibrils at pH 7.4. This protein was found in the only patient in the study that had organ response, suggesting that partially folded species are required for amyloid formation to occur in AL amyloidosis.
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions
Zhang, Hefeng; Qu, Chengke; He, Junpo
2015-01-01
We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b
Polymerase Chain Reaction (PCR) provides a superior tool for the ...
African Journals Online (AJOL)
Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...
Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M
2013-03-28
This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.
Formation of amyloid fibers by monomeric light chain variable domains.
Brumshtein, Boris; Esswein, Shannon R; Landau, Meytal; Ryan, Christopher M; Whitelegge, Julian P; Phillips, Martin L; Cascio, Duilio; Sawaya, Michael R; Eisenberg, David S
2014-10-03
Systemic light chain amyloidosis is a lethal disease characterized by excess immunoglobulin light chains and light chain fragments composed of variable domains, which aggregate into amyloid fibers. These fibers accumulate and damage organs. Some light chains induce formation of amyloid fibers, whereas others do not, making it unclear what distinguishes amyloid formers from non-formers. One mechanism by which sequence variation may reduce propensity to form amyloid fibers is by shifting the equilibrium toward an amyloid-resistant quaternary structure. Here we identify the monomeric form of the Mcg immunoglobulin light chain variable domain as the quaternary unit required for amyloid fiber assembly. Dimers of Mcg variable domains remain stable and soluble, yet become prone to assemble into amyloid fibers upon disassociation into monomers. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Leone, S.R.
1988-03-01
Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH 2 I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained
Evaluation of a new HTLV-I/II polymerase chain reaction
Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.
1997-01-01
AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA
Exploiting Fission Chain Reaction Dynamics to Image Fissile Materials
Chapman, Peter Henry
Radiation imaging is one potential method to verify nuclear weapons dismantlement. The neutron coded aperture imager (NCAI), jointly developed by Oak Ridge National Laboratory (ORNL) and Sandia National Laboratories (SNL), is capable of imaging sources of fast (e.g., fission spectrum) neutrons using an array of organic scintillators. This work presents a method developed to discriminate between non-multiplying (i.e., non-fissile) neutron sources and multiplying (i.e., fissile) neutron sources using the NCAI. This method exploits the dynamics of fission chain-reactions; it applies time-correlated pulse-height (TCPH) analysis to identify neutrons in fission chain reactions. TCPH analyzes the neutron energy deposited in the organic scintillator vs. the apparent neutron time-of-flight. Energy deposition is estimated from light output, and time-of-flight is estimated from the time between the neutron interaction and the immediately preceding gamma interaction. Neutrons that deposit more energy than can be accounted for by their apparent time-of-flight are identified as fission chain-reaction neutrons, and the image is reconstructed using only these neutron detection events. This analysis was applied to measurements of weapons-grade plutonium (WGPu) metal and 252Cf performed at the Nevada National Security Site (NNSS) Device Assembly Facility (DAF) in July 2015. The results demonstrate it is possible to eliminate the non-fissile 252Cf source from the image while preserving the fissileWGPu source. TCPH analysis was also applied to additional scenes in which theWGPu and 252Cf sources were measured individually. The results of these separate measurements further demonstrate the ability to remove the non-fissile 252Cf source and retain the fissileWGPu source. Simulations performed using MCNPX-PoliMi indicate that in a one hour measurement, solid spheres ofWGPu are retained at a 1sigma level for neutron multiplications M -˜ 3.0 and above, while hollowWGPu spheres are
International Nuclear Information System (INIS)
Andreeva, Tamara L; Kuznetsova, S V; Maslov, Aleksandr I; Sorokin, Vadim N
2009-01-01
The scheme of chemical processes proceeding in the active medium of a pulsed chemical oxygen-iodine laser (COIL) is analysed. Based on the analysis performed, the complete system of differential equations corresponding to this scheme is replaced by a simplified system of equations describing in dimensionless variables the chain dark decomposition of iodides - atomic iodine donors, in the COIL active medium. The procedure solving this system is described, the basic parameters determining the development of the chain reaction are found and its specific time intervals are determined. The initial stage of the reaction is analysed and criteria for the development of the branching chain decomposition reaction of iodide in the COIL active medium are determined. (active media)
Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion
Directory of Open Access Journals (Sweden)
Lei Zhang
2014-01-01
Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.
Felice, A. E.; Alshinawi, C.
1996-01-01
The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and
Single step, pH induced gold nanoparticle chain formation in lecithin/water system.
Sharma, Damyanti
2013-07-01
Gold nanoparticle (AuNP) chains have been formed by a single step method in a lecithin/water system where lecithin itself plays the role of a reductant and a template for AuNP chain formation. Two preparative strategies were explored: (1) evaporating lecithin solution with aqueous gold chloride (HAuCl4) at different pHs and (2) dispersing lecithin vesicles in aqueous HAuCl4 solutions of various pHs in the range of 2.5-11.3. In method 1, at initial pH 2.5, 20-50 nm AuNPs are found attached to lecithin vesicles. When pH is raised to 5.5 there are no vesicles present and 20 nm monodisperse particles are found aggregating. Chain formation of fine nanoparticles (3-5 nm) is observed from neutral to basic pH, between 6.5-10.3 The chains formed are hundreds of nanometers to micrometer long and are usually 2-3 nanoparticles wide. On further increasing pH to 11.3, particles form disk-like or raft-like structures. When method (ii) was used a little chain formation was observed. Most of the nanoparticles formed were found either sitting together as raft like structures or scattered on lecithin structures. Copyright © 2013 Elsevier B.V. All rights reserved.
Amplification of acid formation from diphenyliodonium salt in γ-irradiated polymers
International Nuclear Information System (INIS)
Yamazaki, K.; Iino, K.; Koizumi, H.; Ichikawa, T.
2006-01-01
The G values of acid formation from diphenyliodonium salt in γ-irradiated polymers have been measured for developing chemically amplified radiation resists that have abilities of not only amplifying chemical reactions of polymers by the acid as a catalyst but also amplifying the formation of acid itself by a radiation-induced radical chain reaction. Addition of secondary alcohols as amplifiers for acid formation, to poly(alkyl methacrylates) results in the increase of the G value, though the increase is not so significant as that expected from a liquid-phase amplification reaction. The diffusion of free radicals and added molecules is difficult in the polymers due to cage effects by polymer molecules, which causes increases of the radical combination reaction and therefore decrease of the turnover number of the chain reaction. The G values of acid formation for poly(vinyl acetals) are much higher than those for poly(alkyl methacrylates) even the amplifiers are not added in the former polymers. Poly(vinyl acetals) are synthesized by acetalyzation of poly(vinyl alcohol), a polymer composed of secondary alcohol monomer unit, so that the secondary alcohol remaining in the polymer skeleton acts as an efficient amplifier for acid formation. The secondary alcohol acts as stepping-stones for the diffusion of free radical, so that the free radical can encounter a new iodonium salt molecule to continue the radical chain reaction. (authors)
Real-time TaqMan polymerase chain reaction to quantify the effects ...
African Journals Online (AJOL)
TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1991-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1993-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
The effect of composition of mixture on rate of radiation initiation of chain reactions
International Nuclear Information System (INIS)
Poluehktov, V.A.; Begishev, I.R.; Podkhalyuzin, A.T.; Babkina, Eh.I.; Morozov, V.A.; Shapovalov, V.V.
1977-01-01
The effect of the composition of starting components on the rate of a number of chain liquid-phase reactions initiated by γ-quanta of Co 60 has been investigated at constant temperature and dosage rate. In regard to 1,1-difluoroethane chlorination, cyclohexene phosphorylation and adamantane alkylation with hexafluoropropylene reactions, abnormal effect of the reagent compositions on reaction rates has been discovered. The possible radical - starting molecule complexing reaction and molecular complexing from the starting components have been considered
Formation of flavour compounds in the Maillard reaction
Boekel, van M.A.J.S.
2006-01-01
This paper discusses the importance of the Maillard reaction for food quality and focuses on flavour compound formation. The most important classes of Maillard flavour compounds are indicated and it is shown where they are formed in the Maillard reaction. Some emphasis is given on the kinetics of
DEFF Research Database (Denmark)
Kalia, A.; Jalava, T.; Nieminen, P.
1992-01-01
Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...
EXFOR Basics. A short guide to the neutron reaction data exchange format
International Nuclear Information System (INIS)
McLane, V.; NUCLEAR DATA CENTER NETWORK
2000-01-01
This manual is intended as a guide to users of nuclear reaction data compiled in the EXFOR format, and is not intended as a complete guide to the EXFOR System. EXFOR is the exchange format designed to allow transmission of nuclear reaction data between the Nuclear Reaction Data Centers. In addition to storing the data and its' bibliographic information, experimental information is also compiled. The status (e.g., the source of the data) and history (e.g., date of last update) of the data set is also included. EXFOR is designed for flexibility in order to meet the diverse needs of the nuclear reaction data centers. It was originally conceived for the exchange of neutron data and was developed through discussions among personnel from centers situated in Saclay, Vienna, Livermore and Brookhaven. It was accepted as the official exchange format of the neutron data centers at Saclay, Vienna, Brookhaven and Obninsk, at a meeting held in November 1969.3 As a result of two meetings held in 1975 and 1976 and attended by several charged-particle data centers, the format was further developed and adapted to cover all nuclear reaction data. The exchange format should not be confused with a center-to-user format. Although users may obtain data from the centers in the EXFOR format, other center-to-user formats have been developed to meet the needs of the users within each center's own sphere of responsibility. The EXFOR format, as outlined, allows a large variety of numerical data tables with explanatory and bibliographic information to be transmitted in a format: l that is machine-readable (for checking and indicating possible errors); l that can be read by personnel (for passing judgment on and correcting errors). The data presently included in the EXFOR exchange file include: a complete compilation of experimental neutron-induced reaction data, a selected compilation of charged-particle-induced reaction data, a selected compilation of photon-induced reaction data
Case Report:False-negative HIV-1 polymerase chain reaction in a ...
African Journals Online (AJOL)
Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...
Mechanism of chain formation in nanofluid based MR fluids
International Nuclear Information System (INIS)
Patel, Rajesh
2011-01-01
Mechanism of structure formation in bidispersed colloids is important for its physical and optical properties. It is microscopically observed that the mechanism of chain formation in magnetic nanofluid based magnetorheological (MR) fluid is quite different from that in the conventional MR fluid. Under the application of magnetic field the magnetic nanoparticles are filled inside the structural microcavities formed due to the association of large magnetic particles, and some of the magnetic nanoparticles are attached at the end of the chains formed by the large particles. The dipolar energy of the large particles in a magnetic nanofluid matrix becomes effective magnetic permeability (μ eff ) times smaller than that of the neutral medium. Inclusion of magnetic nanoparticles (∼10 nm) with large magnetic particles (∼3-5 μm) restricts the aggregation of large particles, which causes the field induced phase separation in MR fluids. Hence, nanofluid based MR fluids are more stable than conventional MR fluids, which subsequently increase their application potentiality. - Research highlights: → In bidispersed magnetic colloids nanoparticles are attached at the end of the chains formed by the large particles. → Inclusion of magnetic nanoparticles (∼10 nm) with large magnetic particles (∼3-5 m) restricts the aggregation of large particles. → Nanofluid based MR fluids are more stable than conventional MR fluids.
The formation reaction of calcium hexa-aluminate
International Nuclear Information System (INIS)
Tuganova, S.Kh.; Sirajiddinov, N.A.
1990-01-01
The formation reaction of CaAl 12 O 19 at interaction of calcium oxide and aluminium in solid form has been studied. Some physical-chemical characteristics of calcium hexa-aluminate are given. (author)
Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens
de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.
1993-01-01
The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Effects of internal friction on contact formation dynamics of polymer chain
Bian, Yukun; Li, Peng; Zhao, Nanrong
2018-04-01
A theoretical framework is presented to study the contact formation dynamics of polymer chains, in accompany with an electron-transfer quenching. Based on a non-Markovian Smoluchowski equation supplemented with an exponential sink term, we derive the mean time of contact formation under Wilemski-Fixman approximation. Our particular attentions are paid to the effect of internal friction. We find out that internal friction induces a novel fractional viscosity dependence, which will become more remarkable as internal friction increases. Furthermore, we clarify that internal friction inevitably promotes a diffusion-controlled mechanism by slowing the chain relaxation. Finally, we apply our theory to rationalise the experimental investigation for contact formation of a single-stranded DNA. The theoretical results can reproduce the experimental data very well with quite reasonable estimation for the intrinsic parameters. Such good agreements clearly demonstrate the validity of our theory which has appropriately addressed the very role of internal friction to the relevant dynamics.
Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk
Directory of Open Access Journals (Sweden)
V.K. Jain
2010-02-01
Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.
Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F
2015-01-01
Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.
Pathogen detection by the polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)
1994-05-01
In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.
On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment
International Nuclear Information System (INIS)
Anghaie, S.; Froelich, P.; Monkhorst, H.J.
1990-01-01
In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, 6 Li nd 7 Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur
Buffering dissociation/formation reaction of biogenic calcium carbonate.
Ichikawa, Kazuhiko
2007-01-01
The oscillating stability of coral reef seawater pH has been maintained at around physiological pH values over the past 300 years (Pelejero et al., 2005). The stability mechanism of its pH has been interpreted in terms of the buffering dissolution/formation reaction of CaCO(3) as well as the proton consumption/generation reaction in CaCO(3)-saturated water. Here the pH-dependent solubility product [HCO(3)(-)][Ca(2+)] has been derived on the basis of the actual pH-dependent reactions for the atmospheric CO(2)/CO(2 (aq.))/HCO(3)(-)/CO(3)(2-)/Ca(2+)/CaCO(3) system. Overbasic pH peaks appeared between pH approximately 8 and approximately 9.5 during sodium hydroxide titration, as a result of simultaneous CaCO(3) formation and proton generation. The spontaneous and prompt water pH recovery from the acidic to the physiological range has been confirmed by the observation of acid/base time evolution, because of simultaneous CaCO(3) dissolution and proton consumption. The dissolution/formation of CaCO(3) in water at pH 7.5-9 does not take place without a proton consumption/generation reaction, or a buffering chemical reaction of HCO(3)(-)+Ca(2+)right arrow over left arrowCaCO(3)+H(+). SEM images of the CaCO(3) fragments showed that the acid water ate away at the CaCO(3) formed at physiological pH values. Natural coral reefs can thus recover the physiological pH levels of seawater from the acidic range through partial dissolution of their own skeletons.
RADIOCHEMICAL YIELDS OF GRAFT POLYMERIZATION REACTIONS OF CELLULOSE
Energy Technology Data Exchange (ETDEWEB)
Arthur, Jr, J C; Blouin, F A
1963-12-15
The preparation of radioinduced graft polymers of cotton cellulose, while retaining the fibrous nature and high molecular weight of the cellulose, depended primarily on the radiochemical yields of cellulose reactions and of graft polymerization reactions. Yields of the initial major molecular changes in cellulosic polymer indicated that, in the case of scission of the molecule and carboxyl group formation, chain reactions were not initiated by radiation; however, in the case of carbonyl group formation chain reactions were initiated but quickly terminated. Generally, experimental procedures, used in graft polymerization reactions, were: simultaneous irradiation reactions, that is, application of monomers or solutions of monomers to cellulose or chemically modified celluloses, then irradiation; and post-irradiation reactions, that is, irradiation of cellulose or chemically modified celluloses, then after removal from the field of radiation, contacting the irradiated cellulose with monomer. Some of the most important factors influencing the radiochemical yields of graft polymerization reactions, of styrene and acrylonitrile onto cellulose were: concentration of monomer in treating solution; solvent; ratio of monomer solution to cellulose; prior chemical modification of cellulose; and absence of oxygen, particularly in post-irradiation reactions. Experimental data are presented, and the direct and indirect effects of Co/sup 60/ gamma radiation on these reactions are discussed. (auth)
A hydrodynamic microchip for formation of continuous cell chains
Khoshmanesh, Khashayar; Zhang, Wei; Tang, Shi-Yang; Nasabi, Mahyar; Soffe, Rebecca; Tovar-Lopez, Francisco J.; Rajadas, Jayakumar; Mitchell, Arnan
2014-05-01
Here, we demonstrate the unique features of a hydrodynamic based microchip for creating continuous chains of model yeast cells. The system consists of a disk shaped microfluidic structure, containing narrow orifices that connect the main channel to an array of spoke channels. Negative pressure provided by a syringe pump draws fluid from the main channel through the narrow orifices. After cleaning process, a thin layer of water is left between the glass substrate and the polydimethylsiloxane microchip, enabling leakage beneath the channel walls. A mechanical clamp is used to adjust the operation of the microchip. Relaxing the clamp allows leakage of liquid beneath the walls in a controllable fashion, leading to formation of a long cell chain evenly distributed along the channel wall. The unique features of the microchip are demonstrated by creating long chains of yeast cells and model 15 μm polystyrene particles along the side wall and analysing the hydrogen peroxide induced death of patterned cells.
EXFOR basics: A short guide to the nuclear reaction data exchange format
International Nuclear Information System (INIS)
McLane, V.
1996-07-01
This manual is intended as a guide to users of nuclear reaction data compiled in the EXFOR format, and is not intended as a complete guide to the EXFOR System. EXFOR is the exchange format designed to allow transmission of nuclear data between the Nuclear Reaction Data Centers. In addition to storing the data and its' bibliographic information, experimental information, including source of uncertainties, is also compiled. The status and history of the data set is also included, e.g., the source of the data, any updates which have been made, and correlations to other data sets. EXFOR is designed for flexibility in order to meet the diverse needs of the nuclear data compilation centers. This format should not be confused with a center-to-user format. Although users may obtain data from the centers in the EXFOR format, other center-to-user formats have been developed to meet the needs of the users within each center's own sphere of responsibility. The exchange format, as outlined, allows a large variety of numerical data tables with explanatory and bibliographic information to be transmitted in an easily machine-readable format (for checking and indicating possible errors) and a format that can be read by personnel (for passing judgment on and correcting any errors indicated by the machine). The data presently included in the EXFOR exchange include: a complete compilation of experimental neutron-induced reaction data, a selected compilation of charged-particle induced reaction data, a selected compilation of photon-induced reaction data
2009-01-01
On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
FORMATION OF DISTRIBUTION SYSTEMS WITH THE INVOLVEMENT OF THE GLOBAL RETAIL CHAINS
Directory of Open Access Journals (Sweden)
L. Kudyrko
2015-08-01
Full Text Available The purpose of the article is to analyze the features of formation and functioning of multi-marketing distribution systems involving global retail chains and identify the causes of conflicts between participants in the global supply chain and suggest possible ways to displace them. The article represents the author’s definition of the term “global retail chain”. The role and responsibilities of international retailers in the formation of marketing structures on international markets are discovered. The algorithm of the relationship between the participants in the traditional vertical marketing system with the definition of international components is determined. The conflict causes between the participants within the distribution channel are identified.
Hilton, Margaret J; Xu, Li-Ping; Norrby, Per-Ola; Wu, Yun-Dong; Wiest, Olaf; Sigman, Matthew S
2014-12-19
The mechanism of the redox-relay Heck reaction was investigated using deuterium-labeled substrates. Results support a pathway through a low energy palladium-alkyl intermediate that immediately precedes product formation, ruling out a tautomerization mechanism. DFT calculations of the relevant transition structures at the M06/LAN2DZ+f/6-31+G* level of theory show that the former pathway is favored by 5.8 kcal/mol. Palladium chain-walking toward the alcohol, following successive β-hydride eliminations and migratory insertions, is also supported in this study. The stereochemistry of deuterium labels is determined, lending support that the catalyst remains bound to the substrate during the relay process and that both cis- and trans-alkenes form from β-hydride elimination.
False-negative HIV-1 polymerase chain reaction in a 15-month-old ...
African Journals Online (AJOL)
Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.
Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.
Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W
2007-04-01
Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.
Reactions of phenols and alcohols over thoria: mechanism of ether formation
International Nuclear Information System (INIS)
Karuppannasamy, S.; Narayanan, K.; Pillai, C.N.
1980-01-01
The dehydration of phenols and alkylation of phenols by alcohols over thoria were studied at 400 to 500 0 C and atmospheric pressure. Phenol and cresols, when dehydrated gave diaryl ethers as main products. With para-substituted phenols such as p-methoxy, p-t-butyl, p-chloro, and p-nitrophenol no ether formation was noticed. All the reactions were accompanied by considerable amount of coke formation. Alkylation of phenols by alcohols gave a mixture of O- and C-alkylated products under the same reaction conditions. O-alkylation and C-alkylation are parallel reactions. The mechanistic aspects of the reactions are discussed. 3 figures, 3 tables
Chain radiation-chemical oxidation of aromatic amines in polyvinylchloride films
International Nuclear Information System (INIS)
Kolninov, O.V.; Lisovskaya, I.A.; Milinchuk, V.K.
1983-01-01
Radiation-chemical oxidation of tetramethyldiaminediphenylmethane in polyvinylchloride (PVC) and polystyrene (PS) films was investigated in the presence of CBr 4 at 300 K. Radiation yields (G) of 70 and 1 were obtained for an oxidized amine form (Am + ) in PVC and PS, resp. High yields of Am + in PVC matrix indicate the chain character of an oxidation reaction. Triplet states, which form exciplexes with CBr 4 were established to participate in oxidation reactions. The kinetic scheme suggested for the chain radiation oxidation of Am takes into account energy transfer, formation and degradation of the excited states of molecules resulting in the initiation and propagation of the chain on the account of active particles. (author)
Kinetics of the Br2-CH3CHO Photochemical Chain Reaction
Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.
1997-01-01
Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).
EXFOR Systems Manual Nuclear reaction Data Exchange Format
International Nuclear Information System (INIS)
McLane, V.
2000-01-01
EXFOR is an exchange format designed to allow transmission of nuclear reaction data between the members of the Nuclear Data Centers Network. This document has been written for use by the members of the Network and includes matters of procedure and protocol, as well as detailed rules for the compilation of data. Users may prefer to consult EXFOR Basics' for a brief description of the format
EXFOR SYSTEMS MANUAL NUCLEAR REACTION DATA EXCHANGE FORMAT.
Energy Technology Data Exchange (ETDEWEB)
MCLANE,V.; NUCLEAR DATA CENTER NETWORK
2000-05-19
EXFOR is an exchange format designed to allow transmission of nuclear reaction data between the members of the Nuclear Data Centers Network. This document has been written for use by the members of the Network and includes matters of procedure and protocol, as well as detailed rules for the compilation of data. Users may prefer to consult EXFOR Basics' for a brief description of the format.
MODESTY, Statistical Reaction Cross-Sections and Particle Spectra in Decay Chain
International Nuclear Information System (INIS)
Mattes, W.
1977-01-01
1 - Nature of the physical problem solved: Code MODESTY calculates all energetically possible reaction cross sections and particle spectra within a nuclear decay chain. 2 - Method of solution: It is based on the statistical nuclear model following the method of Uhl (reference 1) where the optical model is used in the calculation of partial widths and the Blatt-Weisskopf single particle model for gamma rays
International Nuclear Information System (INIS)
Li, Lin; Borry, Richard W.; Iglesia, Enrique
2000-01-01
Detailed kinetic-transport models were used to explore thermodynamic and kinetic barriers in the non-oxidative conversion of CH4 via homogeneous and homogeneous-heterogeneous pathways and the effects of continuous hydrogen removal and of catalytic sites on attainable yields of useful C2-C10 products. The homogeneous kinetic model combines separately developed models for low-conversion pyrolysis and for chain growth to form large aromatics and carbon. The H2 formed in the reaction decreases CH4 pyrolysis rates and equilibrium conversions and it favors the formation of lighter products. The removal of H2 along tubular reactors with permeable walls increases reaction rates and equilibrium CH4 conversions. C2-C10 yields reach values greater than 90 percent at intermediate values of dimensionless transport rates (delta=1-10), defined as the ratio hydrogen transport and methane conversion rates. Homogeneous reactions require impractical residence times, even with H2 removal, because of slow initiation and chain transfer rates. The introduction of heterogeneous chain initiation pathways using surface sites that form methyl radicals eliminates the induction period without influencing the homogeneous product distribution. Methane conversion, however, occurs predominately in the chain transfer regime, within which individual transfer steps and the formation of C2 intermediates become limited by thermodynamic constraints. Catalytic sites alone cannot overcome these constraints. Catalytic membrane reactors with continuous H2 removal remove these thermodynamic obstacles and decrease the required residence time. Reaction rates become limited by homogeneous reactions of C2 products to form C6+ aromatics. Higher delta values lead to subsequent conversion of the desired C2-C10 products to larger polynuclear aromatics. We conclude that catalytic methane pyrolysis at the low temperatures required for restricted chain growth and the elimination of thermodynamics constraints via
National Research Council Canada - National Science Library
McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L
2005-01-01
...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...
International Nuclear Information System (INIS)
Nakagawa, Seiko
2015-01-01
Methanol and 2-propanol solutions of 1,2-dibromotetrafluoroethane and 1,1,2-trichlorotrifluoroethane were irradiated with γ-rays after perfect de-oxygenation. The product, formed by the substitution of one of the bromine or chlorine atoms with a hydrogen atom, was observed by radiation-induced degradation and the product was also de-halogenated. The G-value of de-halogenation was more than a thousand times higher than G(e solv − ) and increased with the decreasing dose rate, meaning that a chain reaction is involved in the process. The efficiency of the degradation in 2-propanol was several times higher than that in methanol. It is concluded that the charge transfer from an alcohol radical will be the trigger of the chain reaction the same as in the degradation of hexachloroethane in alcohol solutions (Sawai et al., 1978). - Highlights: • Halone2402 and Furon113 were de-halogenated by radiation-induced chain reaction in pure alcohol. • The efficiency of the degradation in 2-propanol was several times higher than that in methanol. • The charge transfer from an alcohol radical will be the trigger of the chain reaction
The formation of illite from nontronite by mesophilic and thermophilic bacterial reaction
Jaisi, Deb P.; Eberl, Dennis D.; Dong, Hailiang; Kim, Jinwook
2011-01-01
The formation of illite through the smectite-to-illite (S-I) reaction is considered to be one of the most important mineral reactions occurring during diagenesis. In biologically catalyzed systems, however, this transformation has been suggested to be rapid and to bypass the high temperature and long time requirements. To understand the factors that promote the S-I reaction, the present study focused on the effects of pH, temperature, solution chemistry, and aging on the S-I reaction in microbially mediated systems. Fe(III)-reduction experiments were performed in both growth and non-growth media with two types of bacteria: mesophilic (Shewanella putrefaciens CN32) and thermophilic (Thermus scotoductus SA-01). Reductive dissolution of NAu-2 was observed and the formation of illite in treatment with thermophilic SA-01 was indicated by X-ray diffraction (XRD) and high-resolution transmission electron microscopy (HRTEM). A basic pH (8.4) and high temperature (65°C) were the most favorable conditions for the formation of illite. A long incubation time was also found to enhance the formation of illite. K-nontronite (non-permanent fixation of K) was also detected and differentiated from the discrete illite in the XRD profiles. These results collectively suggested that the formation of illite associated with the biologically catalyzed smectite-to-illite reaction pathway may bypass the prolonged time and high temperature required for the S-I reaction in the absence of microbial activity.
Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.
Borkar, Santosh Ramdas; Aidhen, Indrapal Singh
2017-04-18
Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.
Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms
International Nuclear Information System (INIS)
Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin
2005-01-01
With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency
Pattern formation in reaction diffusion systems with finite geometry
International Nuclear Information System (INIS)
Borzi, C.; Wio, H.
1990-04-01
We analyze the one-component, one-dimensional, reaction-diffusion equation through a simple inverse method. We confine the system and fix the boundary conditions as to induce pattern formation. We analyze the stability of those patterns. Our goal is to get information about the reaction term out of the preknowledgment of the pattern. (author). 5 refs
Fluctuation-Induced Pattern Formation in a Surface Reaction
DEFF Research Database (Denmark)
Starke, Jens; Reichert, Christian; Eiswirth, Markus
2006-01-01
Spontaneous nucleation, pulse formation, and propagation failure have been observed experimentally in CO oxidation on Pt(110) at intermediate pressures ($\\approx 10^{-2}$mbar). This phenomenon can be reproduced with a stochastic model which includes temperature effects. Nucleation occurs randomly...... due to fluctuations in the reaction processes, whereas the subsequent damping out essentially follows the deterministic path. Conditions for the occurence of stochastic effects in the pattern formation during CO oxidation on Pt are discussed....
DEFF Research Database (Denmark)
Pattison, D I; Davies, Michael Jonathan
2001-01-01
, absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......Hypochlorous acid (HOCl) is a potent oxidant, which is produced in vivo by activated phagocytes. This compound is an important antibacterial agent, but excessive or misplaced production has been implicated in a number of human diseases, including atherosclerosis, arthritis, and some cancers....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...
An in-situ FTIR study of the side-chain alkylation of toluene with methanol
International Nuclear Information System (INIS)
King, S.T.; Garces, J.
1985-01-01
The side-chain alkylation of toluene with methanol to styrene and ethylbenzene can be an economically attractive industrial process if it has high enough conversion and selectivity. This process has been investigated by many others using zeolites or metal oxides as the catalyst. It has been generally accepted that high basicity in certain size pores in the catalyst is required for such side-chain alkylation. However, the actual reaction mechanism is still not understood. In this paper the results of an in-situ FT-IR study of the side-chain alkylation in Li, Na, K, Rb and Cs exchanged X zeolites is discussed. It was found that the KX, RbX and CsX zeolites, which are capable of side-chain alkylation, also form surface formate and a surface precursor of formate from methanol decomposition. While the surface formate itself is not the alkylation agent, the observed formate precursor may be the intermediate for side-chain alkylation
Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique
İLHAK, O. İrfan; ARSLAN, Ali
2014-01-01
The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...
Zr alkoxide chain effect on the sol-gel synthesis of lithium metazirconate
International Nuclear Information System (INIS)
Pfeiffer, Heriberto; Bosch, Pedro; Bulbulian, Silvia
2003-01-01
Lithium metazirconate (Li 2 ZrO 3 ) was synthesized by the sol-gel method, using four different Zr alkoxides: zirconium ethoxide, zirconium iso-propoxide, zirconium propoxide and zirconium butoxide. The syntheses were made under two different catalytic regimes, acid and basic. The resulting powders were mixtures of Li 2 ZrO 3 and ZrO 2 . The best yield of Li 2 ZrO 3 (100%) was obtained when the sol-gel reaction was developed with lithium methoxide and zirconium ethoxide under acid catalysis regime. This study establishes that, for base-catalyzed reactions the ZrO 2 formation decreases when the alkyl-chain increases in the alkoxides. By contrast, for acid-catalyzed reactions the ZrO 2 formation increases as the alkyl-chain increases. Finally, when Zr propoxide and Zr iso-propoxide were used, the Li 2 ZrO 3 amounts were different due to steric effects
Early detection of typhoid by polymerase chain reaction
International Nuclear Information System (INIS)
Haque, A.; Qureshi, Javed A.; Ahmed, J.
1999-01-01
Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)
Chain reaction. History of the atomic bomb
International Nuclear Information System (INIS)
Mania, Hubert
2010-01-01
Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing
2016-10-01
The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Alpatov, S.V.; Golovanova, Eh.Z.; Gorskaya, E.A.; Dobryanskij, V.M.; Makan'kin, A.M.; Puzynin, V.I.; Samojlov, V.N.; Cheker, A.V.
1996-01-01
The substantiation of choice of the hardware and software for integration in program-technical complex is given. The complex is intended for automation of the physical experiments connected with chain nuclear reaction investigations. The subsystem for energy supplying control of experiment is considered in detail. For building the subsystem the 'client-server' architecture is used. The subsystem includes the work station and VMEbus measuring modules in the net. The description of the programs and result formats are given. 5 refs., 6 figs
DEFF Research Database (Denmark)
Hougs, L; Barington, T; Madsen, HO
1993-01-01
reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...
Formation and structural phase transition in Co atomic chains on a Cu(775) surface
International Nuclear Information System (INIS)
Syromyatnikov, A. G.; Kabanov, N. S.; Saletsky, A. M.; Klavsyuk, A. L.
2017-01-01
The formation of Co atomic chains on a Cu(775) surface is investigated by the kinetic Monte Carlo method. It is found that the length of Co atomic chains formed as a result of self-organization during epitaxial growth is a random quantity and its mean value depends on the parameters of the experiment. The existence of two structural phases in atomic chains is detected using the density functional theory. In the first phase, the separations between an atom and its two nearest neighbors in a chain are 0.230 and 0.280 nm. In the second phase, an atomic chain has identical atomic spacings of 0.255 nm. It is shown that the temperature of the structural phase transition depends on the length of the atomic chain.
Formation and structural phase transition in Co atomic chains on a Cu(775) surface
Energy Technology Data Exchange (ETDEWEB)
Syromyatnikov, A. G.; Kabanov, N. S.; Saletsky, A. M.; Klavsyuk, A. L., E-mail: klavsyuk@physics.msu.ru [Moscow State University (Russian Federation)
2017-01-15
The formation of Co atomic chains on a Cu(775) surface is investigated by the kinetic Monte Carlo method. It is found that the length of Co atomic chains formed as a result of self-organization during epitaxial growth is a random quantity and its mean value depends on the parameters of the experiment. The existence of two structural phases in atomic chains is detected using the density functional theory. In the first phase, the separations between an atom and its two nearest neighbors in a chain are 0.230 and 0.280 nm. In the second phase, an atomic chain has identical atomic spacings of 0.255 nm. It is shown that the temperature of the structural phase transition depends on the length of the atomic chain.
Bi, Sai; Yue, Shuzhen; Zhang, Shusheng
2017-07-17
Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.
Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.
Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q
2011-03-01
The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.
Rethinking pattern formation in reaction-diffusion systems
Halatek, J.; Frey, E.
2018-05-01
The present theoretical framework for the analysis of pattern formation in complex systems is mostly limited to the vicinity of fixed (global) equilibria. Here we present a new theoretical approach to characterize dynamical states arbitrarily far from (global) equilibrium. We show that reaction-diffusion systems that are driven by locally mass-conserving interactions can be understood in terms of local equilibria of diffusively coupled compartments. Diffusive coupling generically induces lateral redistribution of the globally conserved quantities, and the variable local amounts of these quantities determine the local equilibria in each compartment. We find that, even far from global equilibrium, the system is well characterized by its moving local equilibria. We apply this framework to in vitro Min protein pattern formation, a paradigmatic model for biological pattern formation. Within our framework we can predict and explain transitions between chemical turbulence and order arbitrarily far from global equilibrium. Our results reveal conceptually new principles of self-organized pattern formation that may well govern diverse dynamical systems.
Choi, Junghoon; Valentine, Richard L
2002-02-01
Studies have been conducted specifically to investigate the hypothesis that N-nitrosodimethylamine (NDMA) can be produced by reactions involving monochloramine. Experiments were conducted using dimethylamine (DMA) as a model precursor. NDMA was formed from the reaction between DMA and monochloramine indicating that it should be considered a potential disinfection by-product. The formation of NDMA increased with increased monochloramine concentration and showed maximum in yield when DMA was varied at fixed monochloramine concentrations. The mass spectra of the NDMA formed from DMA and 15N isotope labeled monochloramine (15NH2Cl) showed that the source of one of the nitrogen atoms in the nitroso group in NDMA was from monochloramine. Addition of 0.05 and 0.5 mM of preformed monochloramine to a secondarily treated wastewater at pH 7.2 also resulted in the formation of 3.6 and 111 ng/L of NDMA, respectively, showing that this is indeed an environmentally relevant NDMA formation pathway. The proposed NDMA formation mechanism consists of (i) the formation of 1,1-dimethylhydrazine (UDMH) intermediate from the reaction of DMA with monochloramine followed by, (ii) the oxidation of UDMH by monochloramine to NDMA, and (iii) the reversible chlorine transfer reaction between monochloramine and DMA which is parallel to (i). We conclude that reactions involving monochloramine in addition to classical nitrosation reactions are potentially important pathways for NDMA formation.
International Nuclear Information System (INIS)
Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.
1990-01-01
Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction
Directory of Open Access Journals (Sweden)
Carlos Alberto Scrideli
2001-09-01
Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.
International Nuclear Information System (INIS)
Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping
2013-01-01
Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling
Kuznietsova, I.; Rudzinski, K. J.; Szmigielski, R.; Laboratory of the Environmental Chemistry
2011-12-01
Atmospheric aerosols exhibit an important role in the environment. They have implications on human health and life, and - in the larger scale - on climate, the Earth's radiative balance and the cloud's formation. Organic matter makes up a significant fraction of atmospheric aerosols (~35% to ~90%) and may originate from direct emissions (primary organic aerosol, POA) or result from complex physico-chemical processes of volatile organic compounds (secondary organic aerosol, SOA). Isoprene (2-methyl-buta-1,3-diene) is one of the relevant volatile precursor of ambient SOA in the atmosphere. It is the most abundant non-methane hydrocarbon emitted to the atmosphere as a result of living vegetation. According to the recent data, the isoprene emission rate is estimated to be at the level of 500 TgC per year. While heterogeneous transformations of isoprene have been well documented, aqueous-phase reactions of this hydrocarbon with radical species that lead to the production of new class of wet SOA components such as polyols and their sulfate esters (organosulfates), are still poorly recognized. The chain reactions of isoprene with sulfoxy radical-anions (SRA) are one of the recently researched route leading to the formation of organosulfates in the aqueous phase. The letter radical species originate from the auto-oxidation of sulfur dioxide in the aqueous phase and are behind the phenomenon of atmospheric acid rain formation. This is a complicated chain reaction that is catalyzed by transition metal ions, such as manganese(II), iron(III) and propagated by sulfoxy radical anions . The presented work addresses the chemical interaction of isoprene with sulfoxy radical-anions in the water solution in the presence of nitrite ions and nitrous acid, which are important trace components of the atmosphere. We showed that nitrite ions and nitrous acid significantly altered the kinetics of the auto-oxidation of SO2 in the presence of isoprene at different solution acidity from 2 to 8
Energy Technology Data Exchange (ETDEWEB)
Marteau, Chantal; Gaillard-Cusin, Francoise; James, Henri [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures
1978-05-01
Investigation of experimental data related to evolution period exhibited by H/sub 2/-D/sub 2/ exchange process requires to take into account the variation against time of every atomic species -adsorbed or not- implied in the reaction mechanism. The formation of first chain carriers involves: - chemisorption of either gaseous reactant on the surface active centres (..sigma..), e.g.: ..sigma.. + 1/2 H/sub 2/ reversible ..sigma..H; - consecutive generation of atomic species through hetero-homogeneous transfer between chemisorbed species (..sigma..H) and gaseous molecules: ..sigma..H+H/sub 2/..--> sigma..+H/sub 2/+H/sup 0/, ..sigma..H+D/sub 2/..--> sigma..+HD+D/sup 0/. Therefore, it can be shown that the heterogeneous initiation process of a gas phase reaction identifies to a chain linear mechanism. Such an heterogeneous sequence conditions the further proceeding of the homogeneous chain reaction; both evolutions being kinematically connected. Rate constant of hydrogen adsorption on silica glass: ksub(a1) approximately 10/sup 14/ exp(-47/RT)Isup(0,5).molesup(-0,5).S/sup -1/ has been evaluated.
EXFOR systems manual: Nuclear reaction data exchange format
International Nuclear Information System (INIS)
McLane, V.
1996-07-01
This document describes EXFOR, the exchange format designed to allow transmission of nuclear reaction data between the members of the Nuclear Data Centers Network. In addition to storing the data and its bibliographic information, experimental information, including source of uncertainties, is also compiled. The status and history of the data set is also included, e.g., the source of the data, any updates which have been made, and correlations to other data sets. The exchange format, as outlined, is designed to allow a large variety of numerical data tables with explanatory and bibliographic information to be transmitted in an easily machine-readable format (for checking and indicating possible errors) and a format that can be read by personnel (for passing judgment on and correcting any errors indicated by the machine)
Directory of Open Access Journals (Sweden)
Aaron J. Stevens
2017-03-01
Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.
Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)
Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.
1999-01-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-01-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...
Zhang, Junjun; Zhang, Wenjuan; Guo, Jinjin; Wang, Junchun; Zhang, Yuzhong
2017-12-15
In this study, a sandwich-type electrochemical immunosensor for the detection of C-reactive protein (CRP) is described. In design, Copper nanoparticles (Cu NPs) were used for signal tag and hybridization chain reaction (HCR)amplified output signal. The immunosensor fabrication involved three steps: (i) primary antibodies (Ab 1 ) were immobilized on the surface of gold nanoparticles (Au NPs); (ii) the sandwich-type structure formation contained "primary antibodies-antigen-secondary antibodies conjugated with primer (Ab 2 -S 0 )"; and (iii) long DNA concatemers intercalating amounts of Cu NPs was linked to the sandwich-type structure via hybridization reaction. Differential pulse voltammetry (DPV) was used to record the response signal of the immunosensor in phosphate-buffered saline (PBS). Under optimal conditions, the anodic peak currents of Cu NPs at the peak potential of about 0.08V(VS.SCE) were linear with the logarithm of CRP concentration in the range of 1.0 fg mL -1 to 100 ng mL -1 with a detection limit of 0.33 fg mL -1 (at signal/noise [S/N] = 3). In addition, the practical application of immunosensor was evaluated by analyzing CRP in real human serum samples, the recoveries obtained were within 95.3%-103.8%, indicating the immunosensor possessed potential application ability for practical disease diagnosis. Copyright © 2017 Elsevier Inc. All rights reserved.
George, C.; Passananti, M.; Kong, L.; Shang, J.; Perrier, S.; Jianmin, C.; Donaldson, D. J.
2016-12-01
The atmospheric formation of organosulfur derivatives through reaction with SO2 is generally mediated by oxidants such as O3, OH; recently we have proposed a direct reaction between SO2 and unsaturated compounds as another possible pathway for organosulfate formation in the troposphere. For the first time it was shown recently that a heterogeneous reaction between SO2 and oleic acid (OA; an unsaturated fatty acid) takes place and leads efficiently to the formation of organosulfur products. Here, we demonstrate that this reaction proceeds on various unsaturated compounds, and may therefore have a general environmental impact. We used different experimental strategies i.e., a coated flow tube (CFT), an aerosol flow tube (AFT) and a DRIFT (diffuse reflectance infrared Fourier transform) cell. The reaction products were analyzed by means of liquid chromatography coupled to a high resolution mass spectrometer (LC-HR-MS). We report indeed that SO2 reacts with large variety of C=C unsaturations and that even in the presence of ozone, SO2 reacts with OA leading to organosulfur products. A strong enhancement in product formation is observed under actinic illumination, increases the atmospheric significance of this chemical pathway. This is probably due to the chromophoric nature of the SO2 adduct with C=C bonds, and means that the contribution of this direct addition of SO2 could be in excess of 5%. The detection in atmospheric aerosols of organosulfur compounds with the same chemical formulae as the products identified here seems to confirm the importance of this reaction in the atmosphere.
Directory of Open Access Journals (Sweden)
Norbert Haider
1998-01-01
Full Text Available The preparation of a series of new 3-(alkynyl-X-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2] cycloaddition reaction.
Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.
Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti
2015-08-01
This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Directory of Open Access Journals (Sweden)
Wen-Pin Chou
2017-02-01
Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.
Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E
1993-01-01
Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...
EXFOR systems manual: Nuclear reaction data exchange format. Revision 97/1
International Nuclear Information System (INIS)
McLane, V.
1997-07-01
This document describes EXFOR, the exchange format designed to allow transmission of nuclear reaction data between the members of the Nuclear Data Center Network. In addition to storing the data and its' bibliographic information, experimental information, including source of uncertainties, is also compiled. The status and history of the data set is also included, e.g., the source of the data, any updates which have been made, and correlations to other data sets. EXFOR is designed for flexibility rather than optimization of data processing in order to meet the diverse needs of the nuclear reaction data centers. The exchange format should not be confused with a center-to-user format. Although users may obtain data from the centers in the EXFOR format, other center-to-user formats have been developed to meet the needs of the users within each center's own sphere of responsibility. The exchange format, as outlined, is designed to allow a large variety of numerical data tables with explanatory and bibliographic information to be transmitted in an easily machine-readable format (for checking and indicating possible errors) and a format that can be read by personnel (for passing judgment on and correcting any errors indicated by the machine)
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Skeletal Diversity in Combinatorial Fashion: A New Format for the Castagnoli-Cushman Reaction.
Lepikhina, Anastasia; Dar'in, Dmitry; Bakulina, Olga; Chupakhin, Evgeny; Krasavin, Mikhail
2017-11-13
A new format for the Castagnoli-Cushman reaction of structurally diverse dicarboxylic acids, amines, and aldehydes in the presence of acetic anhydride as dehydrating agent is described. The reaction is distinctly amenable to parallel format: the combinatorial array of 180 reactions delivered 157 products of >85% purity without chromatographic purification (of this number, 143 compounds had >94% purity). The new method offers a convenient preparation of the skeletally and peripherally diverse, lead- and druglike γ- and δ-lactam carboxylic acids with high diastereoselectivity in combinatorial fashion.
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Han, Yuemei; Kawamura, Kimitaka; Chen, Qingcai; Mochida, Michihiro
2016-02-01
A laboratory study on the heterogeneous reactions of straight-chain aldehydes was performed by exposing n-octanal, nonanal, and decanal vapors to ambient aerosol particles. The aerosol and blank filters were extracted using methanol. The extracts were nebulized and the resulting compositions were examined using a high-resolution time-of-flight aerosol mass spectrometer. The mass spectral analysis showed that the exposures of the aldehydes to aerosol samples increased the peak intensities in the high mass range. The peaks in the mass spectra of the aerosol samples after exposure to different aldehydes were characterized by a homologous series of peak shifts due to the addition of multiple CH2 units. This result is explained by the formation of high-molecular-weight (HMW) compounds that contain single or multiple aldehyde moieties. The HMW fragment peaks for the blank filters exposed to n-aldehydes were relatively weak, indicating an important contribution from the ambient aerosol components to the formation of the HMW compounds. Among the factors affecting the overall interaction of aldehydes with atmospheric aerosol components, gas phase diffusion possibly limited the reactions under the studied conditions; therefore, their occurrence to a similar degree in the atmosphere is not ruled out, at least for the reactions involving n-nonanal and decanal. The major formation pathways for the observed HMW products may be the self-reactions of n-aldehydes mediated by atmospheric aerosol components and the reactions of n-aldehydes with organic aerosol components. The observed formation of HMW compounds encourages further investigations into their effects on the aerosol properties as well as the organic aerosol mass in the atmosphere.
Reaction of oxygen with the respiratory chain in cells and tissues.
Chance, B
1965-09-01
This paper considers the way in which the oxygen reaction described by Dr. Nicholls and the ADP control reactions described by Dr. Racker could cooperate to establish a purposeful metabolic control phenomenon in vivo. This has required an examination of the kinetic properties of the respiratory chain with particular reference to methods for determinations of oxygen affinity (K(m)). The constant parameter for tissue respiration is k(1), the velocity constant for the reaction of oxygen with cytochrome oxidase. Not only is this quantity a constant for a particular tissue or mitochondria; it appears to vary little over a wide range of biological material, and for practical purposes a value of 5 x 10(7) at 25 degrees close to our original value (20) is found to apply with adequate accuracy for calculation of K(m) for mammalia. The quantity which will depend upon the tissue and its metabolic state is the value of K(m) itself, and K(m) may be as large as 0.5 microM and may fall to 0.05 microM or less in resting, controlled, or inhibited states. The control characteristic for ADP may depend upon the electron flux due to the cytochrome chain (40); less ADP is required to activate the slower electron transport at lower temperatures than at higher temperatures. The affinity constants for ADP control appear to be less dependent upon substrate supplied to the system. The balance of ADP and oxygen control in vivo is amply demonstrated experimentally and is dependent on the oxygen concentration as follows. In the presence of excess oxygen, control may be due to the ADP or phosphate (or substrate), and the kinetics of oxygen utilization will be independent of the oxygen concentration. As the oxygen concentration is diminished, hemoglobin becomes disoxygenated, deep gradients of oxygen concentration develop in the tissue, and eventually cytochrome oxidase becomes partially and then completely reduced. DPN at this point will become reduced and the electron flow diminished. The rate
Automated generation of burnup chain for reactor analysis applications
International Nuclear Information System (INIS)
Tran Viet Phu; Tran Hoai Nam; Akio Yamamoto; Tomohiro Endo
2015-01-01
This paper presents the development of an automated generation of a new burnup chain for reactor analysis applications. The JENDL FP Decay Data File 2011 and Fission Yields Data File 2011 were used as the data sources. The nuclides in the new chain are determined by restrictions of the half-life and cumulative yield of fission products or from a given list. Then, decay modes, branching ratios and fission yields are recalculated taking into account intermediate reactions. The new burnup chain is output according to the format for the SRAC code system. Verification was performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Further development and applications are being planned with the burnup chain code. (author)
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION
Directory of Open Access Journals (Sweden)
Honcharova S.Y.
2015-08-01
Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.
Process for fracturing underground formations
Energy Technology Data Exchange (ETDEWEB)
Kiel, O M
1974-01-25
This invention concerns a process for fracturing underground formations and has as one object the mixing of viscous compositions. Through a borehole, a fluid is injected into the formation. This fluid contains a complex prepared by the reaction of an aliphatic quaternary ammonium compound with a water-soluble compound chosen from monosaccharides, disaccharides, trisaccharides, polysaccharides, and synthetic hydroxylated polymers with long chains. These complexes are formed at temperatures between 20/sup 0/ and 205/sup 0/C. The process also includes production of formation fluid into the borehole.
Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples
Hatta, Mochammad; Smits, Henk L.
2007-01-01
A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,
Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati
2014-01-01
Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...
Effects of medium-chain triacylglycerols on Maillard reaction in bread baking.
Toyosaki, Toshiyuki
2018-06-01
To investigate the relationship between the fatty acid composition of medium-chain triacylglycerols (MCTs) and the Maillard reaction induced during bread baking, a comparison with various fatty acids was conducted. Saturated fatty acids had a remarkable inhibitory effect on the amount of advanced glycation end products (AGEs) generated from the Maillard reaction in bread baking compared to unsaturated fatty acids. The amount of AGEs produced by each fatty acid (mg kg -1 ) was as follows: C18:0, 18.7; C12:0, 35.2; C16:0, 21.4; C18:0, 38.2; C18:1, 68.7; C18:2, 80.1; C20:4, 80.8; C22:4, 89.8. Saturated fatty acids were possibly involved in the Maillard reaction and, as a result, acted to inhibit it. In the case of unsaturated fatty acids, amounts of AGEs during the Maillard reaction in baking tended to increase as the degree of unsaturation increased. In other words, there was a positive correlation between the degree of unsaturation and the amount of AGEs. It was also confirmed that the air pore distribution in baked bread was closely related to AGEs. These results led us to conclude that the fatty acid composition of the added lipids also influences properties that determine the tastiness of bread. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Markov chain aggregation and its applications to combinatorial reaction networks.
Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz
2014-09-01
We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Campbell, J; Lowe, J; Walz, S; Ezzell, J
1993-01-01
We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.
Introduction;Commemorating the first self-sustaining nuclear chain reaction on 2 December 1942
Energy Technology Data Exchange (ETDEWEB)
Eklund, S [International Atomic Energy Agency, Vienna (Austria)
1962-12-02
On the occasion of the 20th anniversary of the conducting of the first self-sustaining nuclear chain reaction and following development of nuclear reactors, the article reviews the work and scientific development behind this achievement. The impact of atomic energy on economics, benefits of nuclear reactors for electricity production and the by-product - radio isotopes, used in different areas such as industry, medicine, agriculture etc. are pointed out
Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A
2017-03-10
Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-01-01
Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...
Formation kinetics of gemfibrozil chlorination reaction products: analysis and application.
Krkosek, Wendy H; Peldszus, Sigrid; Huck, Peter M; Gagnon, Graham A
2014-07-01
Aqueous chlorination kinetics of the lipid regulator gemfibrozil and the formation of reaction products were investigated in deionized water over the pH range 3 to 9, and in two wastewater matrices. Chlorine oxidation of gemfibrozil was found to be highly dependent on pH. No statistically significant degradation of gemfibrozil was observed at pH values greater than 7. Gemfibrozil oxidation between pH 4 and 7 was best represented by first order kinetics. At pH 3, formation of three reaction products was observed. 4'-C1Gem was the only reaction product formed from pH 4-7 and was modeled with zero order kinetics. Chlorine oxidation of gemfibrozil in two wastewater matrices followed second order kinetics. 4'-C1Gem was only formed in wastewater with pH below 7. Deionized water rate kinetic models were applied to two wastewater effluents with gemfibrozil concentrations reported in literature in order to calculate potential mass loading rates of 4'C1Gem to the receiving water.
DEFF Research Database (Denmark)
Meldgaard, Michael; Morling, N
1997-01-01
Detection on automated DNA sequencers of polymerase chain reaction (PCR) products of tetra- and penta-nucleotide short tandem repeat (STR) loci frequently reveals one or more extra peaks along with the true, major allele peak. The most frequent extra peak pattern is a single smaller peak which...... is one repeat unit shorter than the true allele peak. The existence of such artificial peaks is of special importance when the methods are used for forensic investigations because the artificial extra peaks may simulate true alleles when samples containing mixtures of DNA from different individuals...... are analyzed. We have investigated the relative levels of formation of extra peaks in 14 STR marker systems. We found that not only the parameters of the PCR but also factors determining the stringency during the post-PCR and pre-electrophoresis handling of samples were of importance for the formation of extra...
Automated generation of burnup chain for reactor analysis applications
International Nuclear Information System (INIS)
Tran, Viet-Phu; Tran, Hoai-Nam; Yamamoto, Akio; Endo, Tomohiro
2017-01-01
This paper presents the development of an automated generation of burnup chain for reactor analysis applications. Algorithms are proposed to reevaluate decay modes, branching ratios and effective fission product (FP) cumulative yields of a given list of important FPs taking into account intermediate reactions. A new burnup chain is generated using the updated data sources taken from the JENDL FP decay data file 2011 and Fission yields data file 2011. The new burnup chain is output according to the format for the SRAC code system. Verification has been performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Burnup calculations using the new burnup chain have also been performed based on UO_2 and MOX fuel pin cells and compared with a reference chain th2cm6fp193bp6T.
Automated generation of burnup chain for reactor analysis applications
Energy Technology Data Exchange (ETDEWEB)
Tran, Viet-Phu [VINATOM, Hanoi (Viet Nam). Inst. for Nuclear Science and Technology; Tran, Hoai-Nam [Duy Tan Univ., Da Nang (Viet Nam). Inst. of Research and Development; Yamamoto, Akio; Endo, Tomohiro [Nagoya Univ., Nagoya-shi (Japan). Dept. of Materials, Physics and Energy Engineering
2017-05-15
This paper presents the development of an automated generation of burnup chain for reactor analysis applications. Algorithms are proposed to reevaluate decay modes, branching ratios and effective fission product (FP) cumulative yields of a given list of important FPs taking into account intermediate reactions. A new burnup chain is generated using the updated data sources taken from the JENDL FP decay data file 2011 and Fission yields data file 2011. The new burnup chain is output according to the format for the SRAC code system. Verification has been performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Burnup calculations using the new burnup chain have also been performed based on UO{sub 2} and MOX fuel pin cells and compared with a reference chain th2cm6fp193bp6T.
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
Energy Technology Data Exchange (ETDEWEB)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
DEFF Research Database (Denmark)
Abdulmawjood, A.; Bulte, M.; Roth, S.
2004-01-01
A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...
Reactions of acid bisphosphonodithioates with nitriles
International Nuclear Information System (INIS)
Kutyrev, G.A.; Korolev, O.S.; Yarkova, E.G.; Cherkasov, R.A.; Pudovik, A.N.
1986-01-01
The reactions of acid bisphosphonodithioates with aceto- and benzo-nitriles go with the intermediate formation of a 1:1 adduct, which breaks down into a thioamide and a cyclic trithiopyrophosphonate. The stability of the latter falls with the lengthening of the carbon chain in the original thiophosphorus reactant. A detailed analysis of IR and NMR spectra is given to confirm these results
Reaction of Hydrogen Sulfide with Oxygen in the Presence ofSulfite
Energy Technology Data Exchange (ETDEWEB)
Weres, Oleh; Tsao, Leon
1983-01-01
Commonly, abatement of hydrogen sulfide emissions from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One Mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. The authors studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDT are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use.
Reaction of hydrogen sulfide with oxygen in the presence of sulfite
Energy Technology Data Exchange (ETDEWEB)
Weres, O.; Tsao, L.
1983-01-14
Commonly, abatement of hydrogen sulfide emission from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. We studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDTA are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use. 33 figures, 9 tables.
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...
Formation of phosphonates and pyrophosphates in the reactions of ...
Indian Academy of Sciences (India)
Bu-4-Me-C6H2O)2P(O)]2O (8) could be isolated, although the reaction mixture showed several other compounds in the phosphorus NMR. A possible pathway for the formation of phosphonate salts is proposed. The X-ray crystal structures of 4, ...
Harmey, Judith H.; Harmey, Matthew A.
1993-01-01
We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.
2007-01-01
After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and
Fragment formation in light-ion induced reactions
International Nuclear Information System (INIS)
Hirata, Yuichi
2001-01-01
The intermediate mass fragment (IMF) formation in the 12 GeV proton induced reaction on Au target is analyzed by the quantum molecular dynamics model combined with the JAM hadronic cascade model and the non-equilibrated percolation model. We show that the sideward peaked angular distribution of IMF occur in the multifragmentation at very short time scale around 20 fm/c where non-equilibrated features of the residual nucleus fluctuates the nucleon density and fragments in the repulsive Coulomb force are pushed for the sideward direction. (author)
Identification of aflatoxigenic fungi using polymerase chain reaction-based assay
Directory of Open Access Journals (Sweden)
Šošo Vladislava M.
2014-01-01
Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009
Formation and properties of metal-oxygen atomic chains
DEFF Research Database (Denmark)
Thijssen, W.H.A.; Strange, Mikkel; de Brugh, J.M.J.A.
2008-01-01
of longer atomic chains. The mechanical and electrical properties of these diatomic chains have been investigated by determining local vibration modes of the chain and by measuring the dependence of the average chain-conductance on the length of the chain. Additionally, we have performed calculations......Suspended chains consisting of single noble metal and oxygen atoms have been formed. We provide evidence that oxygen can react with and be incorporated into metallic one-dimensional atomic chains. Oxygen incorporation reinforces the linear bonds in the chain, which facilitates the creation...
DEFF Research Database (Denmark)
Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre
2013-01-01
Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...
Can Dietary Polyphenols Prevent the Formation of Toxic Compounds from Maillard Reaction?
Del Turco, Serena; Basta, Giuseppina
2016-01-01
Polyphenols are functional compounds in edible vegetable and food such as tea, coffee and red wine and increasing evidence demonstrates a positive link between consumption of polyphenol-rich foods and disease prevention. In this review we have focused on the current knowledge of the potential anti-glycation effects of polyphenols, particularly in regard to their influence on Maillard reaction, a non-enzymatic reaction between amino acids and reducing sugars that contributes to the production of toxic compounds, mainly reactive carbonyl species, advanced glycation end-products (AGEs) and other toxicants. The Maillard reaction occurs in the human body during hyperglycemic condition, but it is well known as browning reaction in thermally processed foods and it is responsible for flavor and toxicant formation. Dietary polyphenols can have anti-glycation effects and actively participate in Maillard reaction, mitigating the AGE formation and the heat-induced production of toxic compounds. In a time in which the role of a healthy diet in the prevention of chronic diseases is welcome and the borderline between food and medicine is becoming very thin, an improved mechanistic knowledge of how polyphenols can function to reduce harmful and unhealthy substances is mandatory.
Formation of RNA phosphodiester bond by histidine-containing dipeptides
DEFF Research Database (Denmark)
Wieczorek, Rafal; Dörr, Mark; Chotera, Agata
2013-01-01
A new scenario for prebiotic formation of nucleic acid oligomers is presented. Peptide catalysis is applied to achieve condensation of activated RNA monomers into short RNA chains. As catalysts, L-dipeptides containing a histidine residue, primarily Ser-His, were used. Reactions were carried out...... in self-organised environment, a water-ice eutectic phase, with low concentrations of reactants. Incubation periods up to 30 days resulted in the formation of short oligomers of RNA. During the oligomerisation, an active intermediate (dipeptide-mononucleotide) is produced, which is the reactive species...... by a transamination mechanism. Because peptides are much more likely products of spontaneous condensation than nucleotide chains, their potential as catalysts for the formation of RNA is interesting from the origin-of-life perspective. Finally, the formation of the dipeptide-mononucleotide intermediate and its...
International Nuclear Information System (INIS)
Belijar, G; Valdez-Nava, Z; Diaham, S; Laudebat, L; Lebey, T; Jones, T B
2017-01-01
Polymer/ceramic composite materials are of great interest for their many potential applications because of their ability to combine at least two properties of the constitutive elements: particles and matrix. In most cases, such enhanced properties are required only in one direction. Orthotropic materials can be elaborated by applying an ac electric field to form particle chain structures in the direction of the electric field due to the dielectrophoretic interactions affecting the particles. However, there is still a lack in the understanding of the impact of the structures on the properties of the material. The aim of this study is to propose a predictive model for the evolution of the permittivity during the chain formation, by including micro- and macroscopic phenomena. The chaining model is based on dipole–dipole interactions and the dielectric permittivity is computed through a finite element method. In parallel, an experimental study is performed with online permittivity measurements of composites during chaining. The developed model is able to predict the experimental results from 1 vol% while taking into account parameters such as the resin viscosity and permittivity and the transient evolution of the applied electric field. The formation of particle chains inside a material has applications in many domains such as electrorheological fluids, anisotropic composites, self-recovery materials etc. Such a developed model is a valuable tool for the tailoring of materials. (paper)
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
CHAINS-PC, Decay Chain Atomic Densities
International Nuclear Information System (INIS)
1994-01-01
1 - Description of program or function: CHAINS computes the atom density of members of a single radioactive decay chain. The linearity of the Bateman equations allows tracing of interconnecting chains by manually accumulating results from separate calculations of single chains. Re-entrant loops can be treated as extensions of a single chain. Losses from the chain are also tallied. 2 - Method of solution: The Bateman equations are solved analytically using double-precision arithmetic. Poles are avoided by small alterations of the loss terms. Multigroup fluxes, cross sections, and self-shielding factors entered as input are used to compute the effective specific reaction rates. The atom densities are computed at any specified times. 3 - Restrictions on the complexity of the problem: Maxima of 100 energy groups, 100 time values, 50 members in a chain
Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.
Lorenz, Todd C
2012-05-22
In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling
Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.
2008-01-01
Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to
Zhao, Yue; Wingen, Lisa M; Perraud, Véronique; Greaves, John; Finlayson-Pitts, Barbara J
2015-05-21
Ozonolysis of alkenes is an important source of secondary organic aerosol (SOA) in the atmosphere. However, the mechanisms by which stabilized Criegee intermediates (SCI) react to form and grow the particles, and in particular the contributions from oligomers, are not well understood. In this study, ozonolysis of trans-3-hexene (C6H12), as a proxy for small alkenes, was investigated with an emphasis on the mechanisms of particle formation and growth. Ozonolysis experiments were carried out both in static Teflon chambers (18-20 min reaction times) and in a glass flow reactor (24 s reaction time) in the absence and presence of OH or SCI scavengers, and under different relative humidity (RH) conditions. The chemical composition of polydisperse and size-selected SOA particles was probed using different mass spectrometric techniques and infrared spectroscopy. Oligomers having SCI as the chain unit are found to be the dominant components of such SOA particles. The formation mechanism for these oligomers suggested by our results follows the sequential addition of SCI to organic peroxy (RO2) radicals, in agreement with previous studies by Moortgat and coworkers. Smaller particles are shown to have a relatively greater contribution from longer oligomers. Higher O/C ratios are observed in smaller particles and are similar to those of oligomers resulting from RO2 + nSCI, supporting a significant role for longer oligomers in particle nucleation and early growth. Under atmospherically relevant RH of 30-80%, water vapor suppresses oligomer formation through scavenging SCI, but also enhances particle nucleation. Under humid conditions, or in the presence of formic or hydrochloric acid as SCI scavengers, peroxyhemiacetals are formed by the acid-catalyzed particle phase reaction between oligomers from RO2 + nSCI and a trans-3-hexene derived carbonyl product. In contrast to the ozonolysis of trans-3-hexene, oligomerization involving RO2 + nSCI does not appear to be prevalent in the
Religion, Repulsion, and Reaction Formation: Transforming Repellent Attractions and Repulsions.
Cohen, Dov; Kim, Emily; Hudson, Nathan W
2017-06-12
Protestants were more likely than non-Protestants to demonstrate phenomena consistent with the use of reaction formation. Lab experiments showed that when manipulations were designed to produce taboo attractions (to unconventional sexual practices), Protestants instead showed greater repulsion. When implicitly conditioned to produce taboo repulsions (to African Americans), Protestants instead showed greater attraction. Supportive evidence from other studies came from clinicians' judgments, defense mechanism inventories, and a survey of respondent attitudes. Other work showed that Protestants who diminished and displaced threatening affect were more likely to sublimate this affect into creative activities; the present work showed that Protestants who do not or cannot diminish or displace such threatening affect instead reverse it. Traditional individual difference variables showed little ability to predict reaction formation, suggesting that the observed processes go beyond what we normally study when we talk about self-control. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Polymerase chain reaction: A molecular diagnostic tool in periodontology
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822
Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology
Directory of Open Access Journals (Sweden)
Kordo B. A. Saeed
2013-11-01
Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.
Convergent mechanisms favor fast amyloid formation in two lambda 6a Ig light chain mutants.
Valdés-García, Gilberto; Millán-Pacheco, César; Pastor, Nina
2017-08-01
Extracellular deposition as amyloids of immunoglobulin light chains causes light chain amyloidosis. Among the light chain families, lambda 6a is one of the most frequent in light chain amyloidosis patients. Its germline protein, 6aJL2, and point mutants, R24G and P7S, are good models to study fibrillogenesis, because their stability and fibril formation characteristics have been described. Both mutations make the germline protein unstable and speed up its ability to aggregate. To date, there is no molecular mechanism that explains how these differences in amyloidogenesis can arise from a single mutation. To look into the structural and dynamical differences in the native state of these proteins, we carried out molecular dynamics simulations at room temperature. Despite the structural similarity of the germline protein and the mutants, we found differences in their dynamical signatures that explain the mutants' increased tendency to form amyloids. The contact network alterations caused by the mutations, though different, converge in affecting two anti-aggregation motifs present in light chain variable domains, suggesting a different starting point for aggregation in lambda chains compared to kappa chains. © 2017 Wiley Periodicals, Inc.
Asymptotics of Toeplitz determinants and the emptiness formation probability for the XY spin chain
International Nuclear Information System (INIS)
Franchini, Fabio; Abanov, Alexander G
2005-01-01
We study an asymptotic behaviour of a special correlator known as the emptiness formation probability (EFP) for the one-dimensional anisotropic XY spin-1/2 chain in a transverse magnetic field. This correlator is essentially the probability of formation of a ferromagnetic string of length n in the antiferromagnetic ground state of the chain and plays an important role in the theory of integrable models. For the XY spin chain, the correlator can be expressed as the determinant of a Toeplitz matrix and its asymptotical behaviours for n → ∞ throughout the phase diagram are obtained using known theorems and conjectures on Toeplitz determinants. We find that the decay is exponential everywhere in the phase diagram of the XY model except on the critical lines, i.e. where the spectrum is gapless. In these cases, a power-law prefactor with a universal exponent arises in addition to an exponential or Gaussian decay. The latter Gaussian behaviour holds on the critical line corresponding to the isotropic XY model, while at the critical value of the magnetic field the EFP decays exponentially. At small anisotropy one has a crossover from the Gaussian to the exponential behaviour. We study this crossover using the bosonization approach
Determination of the number of radicals in the initial chain reactions by mathematical methods
Directory of Open Access Journals (Sweden)
Pejović Branko B.
2009-01-01
Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.
Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.
2018-05-01
It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.
International Nuclear Information System (INIS)
Snieckus, Darius
2000-01-01
'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives
Energy Technology Data Exchange (ETDEWEB)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing, E-mail: shisq@nwu.edu.cn; Gong, Yongkuan
2016-11-15
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH{sub 2}) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
International Nuclear Information System (INIS)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing; Gong, Yongkuan
2016-01-01
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH 2 ) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2015-12-01
Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Directory of Open Access Journals (Sweden)
Mohammad Rubayet Hasan
2014-01-01
Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.
Lim, Sungeun; Lee, Woongbae; Na, Soyoung; Shin, Jaedon; Lee, Yunho
2016-11-15
Compounds with N,N-dimethylhydrazine moieties ((CH 3 ) 2 N-N-) form N-nitrosodimethylamine (NDMA) during ozonation, but the relevant reaction chemistry is hitherto poorly understood. This study investigated the reaction kinetics and mechanisms of NDMA formation during ozonation of unsymmetrical dimethylhydrazine (UDMH) and daminozide (DMZ) as structural model N,N-dimethylhydrazine compounds. The reaction of ozone with these NDMA precursor compounds was fast, and k O3 at pH 7 was 2 × 10 6 M -1 s -1 for UDMH and 5 × 10 5 M -1 s -1 for DMZ. Molar NDMA yields (i.e., Δ[NDMA]/Δ[precursor] × 100) were 84% and 100% for UDMH and DMZ, respectively, determined at molar ozone dose ratio ([O 3 ] 0 /[precursor] 0 ) of ≥4 in the presence of tert-butanol as hydroxyl radical (OH) scavenger. The molar NDMA yields decreased significantly in the absence of tert-butanol, indicating OH formation and its subsequent reaction with the parent precursors forming negligible NDMA. The k OH at pH 7 was 4.9 × 10 9 M -1 s -1 and 3.4 × 10 9 M -1 s -1 for UDMH and DMZ, respectively. Reaction mechanisms are proposed in which an ozone adduct is formed at the nitrogen next to N,N-dimethylamine which decomposes via homolytic and heterolytic cleavages of the -N + -O-O-O - bond, forming NDMA as a final product. The heterolytic cleavage pathway explains the significant OH formation via radical intermediates. Overall, significant NDMA formation was found to be unavoidable during ozonation or even O 3 /H 2 O 2 treatment of waters containing N,N-dimethylhydrazine compounds due to their rapid reaction with ozone forming NDMA with high yield. Thus, source control or pre-treatment of N,N-dimethylhydrazine precursors and post-treatment of NDMA are proposed as the mitigation options. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kinetics of exciplex formation/dissipation in reaction following Weller Scheme II
Fedorenko, S. G.; Burshtein, A. I.
2014-09-01
Creation of exciplexes from the charged products of photoionization is considered by means of Integral Encounter Theory. The general kinetic equations of such a reaction following the Weller scheme II are developed. The special attention is given to the particular case of irreversible remote ionization of primary excited electron donor. Kinetics of exciplex formation is considered at fast biexponential geminate transformation of exciplexes in cage that gives way to subsequent bulk reaction of equilibrated reaction products controlled by power law recombination of ions. It is shown that the initial geminate stage of exciplex kinetics is observed only in diffusion controlled regime of the reaction and disappears with increasing mobility of ions in passing to kinetic regime. The quantum yield of exciplexes is studied along with their kinetics.
Kinetics of exciplex formation/dissipation in reaction following Weller Scheme II
Energy Technology Data Exchange (ETDEWEB)
Fedorenko, S. G. [Voevodsky Institute of Chemical Kinetics and Combustion, Novosibirsk (Russian Federation); Burshtein, A. I. [Weizmann Institute of Science, 76100, Rehovot (Israel)
2014-09-21
Creation of exciplexes from the charged products of photoionization is considered by means of Integral Encounter Theory. The general kinetic equations of such a reaction following the Weller scheme II are developed. The special attention is given to the particular case of irreversible remote ionization of primary excited electron donor. Kinetics of exciplex formation is considered at fast biexponential geminate transformation of exciplexes in cage that gives way to subsequent bulk reaction of equilibrated reaction products controlled by power law recombination of ions. It is shown that the initial geminate stage of exciplex kinetics is observed only in diffusion controlled regime of the reaction and disappears with increasing mobility of ions in passing to kinetic regime. The quantum yield of exciplexes is studied along with their kinetics.
Kinetics of exciplex formation/dissipation in reaction following Weller Scheme II
International Nuclear Information System (INIS)
Fedorenko, S. G.; Burshtein, A. I.
2014-01-01
Creation of exciplexes from the charged products of photoionization is considered by means of Integral Encounter Theory. The general kinetic equations of such a reaction following the Weller scheme II are developed. The special attention is given to the particular case of irreversible remote ionization of primary excited electron donor. Kinetics of exciplex formation is considered at fast biexponential geminate transformation of exciplexes in cage that gives way to subsequent bulk reaction of equilibrated reaction products controlled by power law recombination of ions. It is shown that the initial geminate stage of exciplex kinetics is observed only in diffusion controlled regime of the reaction and disappears with increasing mobility of ions in passing to kinetic regime. The quantum yield of exciplexes is studied along with their kinetics
International Nuclear Information System (INIS)
Leone, S.R.
1990-01-01
Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C 2 H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH 3 ; and ammonia, which produces NH 2 . In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes
Polymerase chain reaction: Theory, practice and application: A review
Directory of Open Access Journals (Sweden)
S E Atawodi
2010-01-01
Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.
Supercoil Formation During DNA Melting
Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan
2009-03-01
Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...
Directory of Open Access Journals (Sweden)
Людмила Мар’янівна Іщенко
2016-11-01
Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer
DEFF Research Database (Denmark)
Blair, D.; Waycott, M.; Byrne, L.
2006-01-01
This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...
Directory of Open Access Journals (Sweden)
Hang Yang
2014-01-01
Full Text Available Nowadays, a trend of forming dynamic supply chains with different trading partners over different e-marketplaces has emerged. These supply chains, which are called “supply mesh,” generally refer to heterogeneous electronic marketplaces in which dynamic supply chains, as per project (often make-to-order, are formed across different parties. Conceptually, in a supply mesh a dynamic supply chain is formed vertically, mediating several companies for a project. Companies that are on the same level horizontally are either competitors or cohorts. A complex scenario such as this makes it challenging to find the right group of members for a dynamic supply chain. Earlier on, a multiagent model called the collaborative single machine earliness/tardiness (CSET model was proposed for the optimal formation of make-to-order supply chains. This paper contributes the particular agent designs, for enabling the mediation of CSET in a supply mesh, and the possibilities are discussed. It is demonstrated via a computer simulation, based on samples from the U.S. textile industry, that by using intelligent agents under the CSET model it is possible to automatically find an ideal group of trading partners from a supply mesh.
LENUS (Irish Health Repository)
Drew, Richard J
2012-03-01
Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.
Chemical-Reaction-Controlled Phase Separated Drops: Formation, Size Selection, and Coarsening
Wurtz, Jean David; Lee, Chiu Fan
2018-02-01
Phase separation under nonequilibrium conditions is exploited by biological cells to organize their cytoplasm but remains poorly understood as a physical phenomenon. Here, we study a ternary fluid model in which phase-separating molecules can be converted into soluble molecules, and vice versa, via chemical reactions. We elucidate using analytical and simulation methods how drop size, formation, and coarsening can be controlled by the chemical reaction rates, and categorize the qualitative behavior of the system into distinct regimes. Ostwald ripening arrest occurs above critical reaction rates, demonstrating that this transition belongs entirely to the nonequilibrium regime. Our model is a minimal representation of the cell cytoplasm.
Hazan, Ronen; Que, Yok Ai; Maura, Damien; Strobel, Benjamin; Majcherczyk, Paul Anthony; Hopper, Laura Rose; Wilbur, David J.; Hreha, Teri N.; Barquera, Blanca; Rahme, Laurence G.
2015-01-01
Summary Bacterial programmed cell death and quorum sensing are direct examples of prokaryote group behaviors, wherein cells coordinate their actions to function cooperatively like one organism for the benefit of the whole culture. We demonstrate here that 2-n-heptyl-4-hydroxyquinoline-N-oxide (HQNO), a Pseudomonas aeruginosa quorum sensing -regulated low-molecular-weight excreted molecule, and triggers autolysis by self-perturbing the electron transfer reactions of the cytochrome bc1 complex. HQNO induces specific self-poisoning by disrupting the flow of electrons through the respiratory chain at the cytochrome bc1 complex, causing a leak of reducing equivalents to O2 whereby electrons that would normally be passed to cytochrome c are donated directly to O2. The subsequent mass production of reactive oxygen species (ROS) reduces membrane potential and disrupts membrane integrity, causing bacterial cell autolysis and DNA release. DNA subsequently promotes biofilm formation and increases antibiotic tolerance to beta-lactams, suggesting that HQNO-dependent cell autolysis is advantageous to the bacterial populations. These data both identify a new programmed cell death system, and a novel role for HQNO as a critical-inducer of biofilm formation and antibiotic tolerance. This newly identified pathway suggests intriguing mechanistic similarities with the initial mitochondrial-mediated steps of eukaryotic apoptosis. PMID:26776731
The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers
International Nuclear Information System (INIS)
Sun Jiazhen
2003-01-01
Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type
Is the 'Bromine Explosion' generated from the reaction BrO HO2 alone?
Behnke, Wolfgang; Zetzsch, Cornelius
2010-05-01
We observed bromine explosions (a fast production of atomic Br and Cl under tropospheric conditions) in various smog chamber experiments in Teflon bags at room temperature at a relative humidity of about 80% in the presence of NaCl/NaBr-aerosol, simulated sunlight and ozone (200 - 400 ppb). Time profiles of ozone and hydrocarbons (HCs: n-butane, 2,2-dimethylbutane, tetramethylbutane and toluene, initially about 2 ppb each) were monitored to determine concentrations and source strengths of OH radicals, atomic Cl and Br and the corresponding time profiles of BrCl and Br2 as their photolytic precursors. The number and size of aerosols are measured as well as their chemical composition (Br-, Cl- and oxalic acid). Full records of raw data from the smog chamber runs are available at www.eurochamp.org for potential users. Chemical box model calculations deliver concentrations of various intermediates, such as aldehydes, HO2 and RO2 radicals and the inorganic halogen compounds ClO, BrO, HOCl and HOBr, where HOBr from O3 + Br- => BrO- + O2 in the aqueous/adsorbed phase induces the following gas-phase/ heterogeneous chain reaction Br + O3 => BrO + O2(1) BrO + HO2 => HOBr + O2(2a) HOBr + (Aerosol) => HOBrad(3) Surface-adsorbed HOBr reacts with Br- or Cl- to produce Br2 or BrCl, both of which are released and photolysed. Formation of Br2 should prevail up to Cl-/Br- -ratios of about 104 (Fickert, S., J.W. Adams, J.N. Crowley, J. Geophys. Res., D104, 23719-23727, 1999). A maximum of this ratio is reached about 30 minutes after the beginning and decreases during the next hours - probably by reaction of Br2 with oxalate and absorption of HBr, formed from the reaction of Br with aldehydes. Parallel to chain reaction (1)-(3) a chain reaction replacing Br by Cl seems possible but can not be realized, since the main sink of atomic Cl is its reaction with hydrocarbons - leading to chain termination - in contrast to atomic Br (ratio of rates: kCl[O3]/kCl[HC] ~ 0.1; kBr[O3]/k
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Kalia, Neena; Auger, Jocelyn M; Atkinson, Ben; Watson, Steve P
2008-05-01
The role of collagen receptor complex GPVI-FcR gamma-chain, PLCgamma2 and LAT in laser-induced thrombosis is unclear. Controversy surrounds whether collagen is exposed in this model or whether thrombosis is dependent on thrombin. This study hypothesized that collagen exposure plays a critical role in thrombus formation in this model, which was tested by investigating contributions of FcR gamma-chain, LAT, PLCgamma2 and thrombin. Thrombi were monitored using intravital microscopy in anesthetized wild-type and FcR gamma-chain, LAT and PLCgamma2 knockout mice. Hirudin (thrombin inhibitor) was administered to wild-type and FcR gamma-chain knockout mice. Significantly reduced thrombus formation was observed in FcR gamma-chain and PLCgamma2 knockouts with a greater decrease observed in LAT knockouts. Dramatic reduction was observed in wild-types treated with hirudin, with abolished thrombus formation only observed in FcR gamma-chain knockouts treated with hirudin. GPVI-FcR gamma-chain, LAT and PLCgamma2 are essential for thrombus generation and stability in this laser-induced model of injury. More importantly, a greater role for LAT was identified, which may reflect a role for it downstream of a second matrix protein receptor. However, inhibition of platelet activation by matrix proteins and thrombin generation are both required to maximally prevent thrombus formation.
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
International Nuclear Information System (INIS)
Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei
2017-01-01
Highlights: • CsPbBr_3 perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr_3 nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr_3 nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr_3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr_3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr_3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr_3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr_3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of
Energy Technology Data Exchange (ETDEWEB)
Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei, E-mail: awtang@bjtu.edu.cn
2017-05-31
Highlights: • CsPbBr{sub 3} perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr{sub 3} nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr{sub 3} nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr{sub 3} nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr{sub 3} NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr{sub 3} NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr{sub 3} NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr{sub 3} NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the
Solid-Phase Reactions of Iminium Ions: Cyclized Peptide Derivatives
DEFF Research Database (Denmark)
Wang, Yuanyuan
formation of N,N’-aminals by nucleophilic attack of the peptide backbone is reversible under strongly acidic conditions and the N,N’-aminal is likely to be the kinetic product of many INCIC reactions. In addition, the N,N’-aminals are stable in the absence of acid but could be converted to the THIQ...... derivatives in solution phase under acid conditions in the presence of an active C-nucleophile in the side chain. The high yielding nature of the aminal formation is confirmed by solution phase synthesis. The introduced azide and alkyne residues in the side chain of N,N’-aminal products were further......BB may undergo auto-oxidation to quinazoline-2,4-diones in the absence of a suitable nucleophile on the side chain or backbone of the peptide (Chapter 4). The structure is confirmed by comparison with products obtained from solution-phase synthesis under the same conditions, one of which was confirmed...
Simple model of inhibition of chain-branching combustion processes
Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.
2017-11-01
A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.
Energy Technology Data Exchange (ETDEWEB)
Domburg, G E; Skripchenko, T N
1982-01-01
ESR spectra were determined for samples of softwood (spruce) lignin and hardwood (aspen or birch) lignin at 20-400 degrees C and after cooling to 20 degrees C. Results provide evidence for a change from low-temperature to high-temperature reactions at 300-350 degrees C (higher in hardwoods than softwoods) associated with increased formation and recombination of paramagnetic centres (free radicals). A scheme is presented for the sequence of reactions leading to charcoal formation over the temperature range 100-500 degrees C.
Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi
The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30
Hobin, Erin; Lebenbaum, Michael; Rosella, Laura; Hammond, David
2015-03-01
To assess the availability, location, and format of nutrition information in fast-food chain restaurants in Ontario. Nutrition information in restaurants was assessed using an adapted version of the Nutrition Environment Measures Study for Restaurants (NEMS-R). Two raters independently visited 50 restaurants, 5 outlets of each of the top-10 fast-food chain restaurants in Canada. The locations of the restaurants were randomly selected within the Waterloo, Wellington, and Peel regions in Ontario, Canada. Descriptive results are presented for the proportion of restaurants presenting nutrition information by location (e.g., brochure), format (e.g., use of symbols), and then by type of restaurant (e.g., quick take-away, full-service). Overall, 96.0% (n = 48) of the restaurants had at least some nutrition information available in the restaurant. However, no restaurant listed calorie information for all items on menu boards or menus, and only 14.0% (n = 7) of the restaurants posted calorie information and 26.0% (n = 13) of restaurants posted other nutrients (e.g., total fat) for at least some items on menus boards or menus. The majority of the fast-food chain restaurants included in our study provided at least some nutrition information in restaurants; however, very few restaurants made nutrition information readily available for consumers on menu boards and menus.
Saed, Mohand O.; Torbati, Amir H.; Nair, Devatha P.; Yakacki, Christopher M.
2016-01-01
This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addi...
Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G
The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial
C—C bond formation in the intramolecular Diels-Alder reaction of triene amides
Directory of Open Access Journals (Sweden)
Abdelilah Benallou
2018-02-01
Full Text Available The mechanism nature of the intramolecular Diels–Alder reaction has been performed; and thus, the changes of C—C bond forming/breaking along IRC are characterized in this study. Conceptual DFT analyses of the most favorable adduct fused/exo shows that the flux electronic will take place from diene to dienophile moiety. Moreover, ELF topological analysis based on the electron density predicts that C—C bond is formed by the coupling of two pseudoradical centers generated at the most significant atoms of the molecules. However, C2 vs C3, also C1 and C4 interaction comes mainly from the global electron density transfer which takes place along the reaction. Two- stage one-step is the proposed mechanism of this reaction, the first stage aims for the formation of C2—C3 σ bond while the second stage aims for C1—C4 σ bond formation. Interestingly, the observed asynchronicity of this IMDA reaction due principally to the asymmetric reorganization of electron density at the most attractive centers.
C-C bond formation in the intramolecular Diels-Alder reaction of triene amides.
Benallou, Abdelilah; El Alaoui El Abdallaoui, Habib; Garmes, Hocine
2018-02-01
The mechanism nature of the intramolecular Diels-Alder reaction has been performed; and thus, the changes of C-C bond forming/breaking along IRC are characterized in this study. Conceptual DFT analyses of the most favorable adduct fused/exo shows that the flux electronic will take place from diene to dienophile moiety. Moreover, ELF topological analysis based on the electron density predicts that C-C bond is formed by the coupling of two pseudoradical centers generated at the most significant atoms of the molecules. However, C2 vs C3, also C1 and C4 interaction comes mainly from the global electron density transfer which takes place along the reaction. Two- stage one-step is the proposed mechanism of this reaction, the first stage aims for the formation of C2-C3 σ bond while the second stage aims for C1-C4 σ bond formation. Interestingly, the observed asynchronicity of this IMDA reaction due principally to the asymmetric reorganization of electron density at the most attractive centers.
Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M
2016-01-19
This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials.
Effects of online advertising format and persuasion knowledge on audience reactions
Tutaj, K.; van Reijmersdal, E.A.
2012-01-01
In an experiment (N = 99), effects of subtle and prominent online advertising formats, respectively sponsored content and banner ads, on audience reactions toward the advertisement are tested. In addition, the role of several persuasion knowledge elements such as understanding of persuasive intent
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
The generation of radiolabeled DNA and RNA probes with polymerase chain reaction
International Nuclear Information System (INIS)
Schowalter, D.B.; Sommer, S.S.
1989-01-01
By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence
Heterogeneous reactions and aerosol formation in flue gas cleaning by electron beam
International Nuclear Information System (INIS)
Baumann, W.; Jordan, S.; Leichsenring, C.H.; Maetzing, H.; Paur, H.R.; Schikarski, W.
1990-08-01
The electron beam dry scrubbing process is a simultaneous method for the removal of SO 2 and NO x from flue gas. By electron irradiation radicals (OH, O 2 H, O) are formed from the main flue gas components which oxidize NO x and SO 2 into the acids HNO 3 and H 2 SO 4 . These are then neutralized by the injection of NH 3 . A submicron aerosol consisting of ammonium salts is formed which is filtered from the offgas. The main pathways of the gas phase chemistry and product formation have been elucidated by experimental and theoretical studies. Back reactions which occur in the gas and the particle phase limit the energy efficiency of the process. By recirculation of irradiated gas into the reaction vessel (multiple irradiation) a significant improvement of removal yields was obtained. This enhancement of the energy efficiency requires the removal of products between the irradiation steps. Studies show that the material balance is complete. Deficits in the N and S balance of the process are due to the additional formation of molecular nitrogen and the deposition of ammonium sulfate in the ducts. Aerosol formation participates only with 30% in the material balance. The remaining 70% of the product are formed by surface reactions in the filter cake (40%) and in the ducts (30%). (orig.) With 38 figs., 29 tabs [de
Directory of Open Access Journals (Sweden)
Sefrita Tri Utami
2014-01-01
Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR
DEFF Research Database (Denmark)
Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline
2015-01-01
BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...
Additional chain-branching pathways in the low-temperature oxidation of branched alkanes
Wang, Zhandong
2015-12-31
Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS). Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C8H14O4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C8H16O5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C8H16O5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O2 addition, intramolecular isomerization, and OH release; C8H14O4 species are proposed to result from subsequent reactions of C8H16O5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth\\'s troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. The results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances. © 2015 The Combustion Institute.
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
International Nuclear Information System (INIS)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.
1998-01-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
Energy Technology Data Exchange (ETDEWEB)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences
1998-07-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.
Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François
2010-04-01
To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.
Pattern formation in three-dimensional reaction-diffusion systems
Callahan, T. K.; Knobloch, E.
1999-08-01
Existing group theoretic analysis of pattern formation in three dimensions [T.K. Callahan, E. Knobloch, Symmetry-breaking bifurcations on cubic lattices, Nonlinearity 10 (1997) 1179-1216] is used to make specific predictions about the formation of three-dimensional patterns in two models of the Turing instability, the Brusselator model and the Lengyel-Epstein model. Spatially periodic patterns having the periodicity of the simple cubic (SC), face-centered cubic (FCC) or body-centered cubic (BCC) lattices are considered. An efficient center manifold reduction is described and used to identify parameter regimes permitting stable lamellæ, SC, FCC, double-diamond, hexagonal prism, BCC and BCCI states. Both models possess a special wavenumber k* at which the normal form coefficients take on fixed model-independent ratios and both are described by identical bifurcation diagrams. This property is generic for two-species chemical reaction-diffusion models with a single activator and inhibitor.
International Nuclear Information System (INIS)
Kaiser, R.I.; Stranges, D.; Bevsek, H.M.; Lee, Y.T.; Suits, A.G.
1997-01-01
The reaction between ground state carbon atoms and propylene, C 3 H 6 , was studied at average collision energies of 23.3 and 45.0 kJmol -1 using the crossed molecular beam technique. Product angular distributions and time-of-flight spectra of C 4 H 5 at m/e=53 were recorded. Forward-convolution fitting of the data yields a maximum energy release as well as angular distributions consistent with the formation of methylpropargyl radicals. Reaction dynamics inferred from the experimental results suggest that the reaction proceeds on the lowest 3 A surface via an initial addition of the carbon atom to the π-orbital to form a triplet methylcyclopropylidene collision complex followed by ring opening to triplet 1,2-butadiene. Within 0.3 endash 0.6 ps, 1,2-butadiene decomposes through carbon endash hydrogen bond rupture to atomic hydrogen and methylpropargyl radicals. The explicit identification of C 4 H 5 under single collision conditions represents a further example of a carbon endash hydrogen exchange in reactions of ground state carbon with unsaturated hydrocarbons. This versatile machine represents an alternative pathway to build up unsaturated hydrocarbon chains in combustion processes, chemical vapor deposition, and in the interstellar medium. copyright 1997 American Institute of Physics
The formation of urea in space. I. Ion-molecule, neutral-neutral, and radical gas-phase reactions
Brigiano, Flavio Siro; Jeanvoine, Yannick; Largo, Antonio; Spezia, Riccardo
2018-02-01
Context. Many organic molecules have been observed in the interstellar medium thanks to advances in radioastronomy, and very recently the presence of urea was also suggested. While those molecules were observed, it is not clear what the mechanisms responsible to their formation are. In fact, if gas-phase reactions are responsible, they should occur through barrierless mechanisms (or with very low barriers). In the past, mechanisms for the formation of different organic molecules were studied, providing only in a few cases energetic conditions favorable to a synthesis at very low temperature. A particularly intriguing class of such molecules are those containing one N-C-O peptide bond, which could be a building block for the formation of biological molecules. Urea is a particular case because two nitrogen atoms are linked to the C-O moiety. Thus, motivated also by the recent tentative observation of urea, we have considered the synthetic pathways responsible to its formation. Aims: We have studied the possibility of forming urea in the gas phase via different kinds of bi-molecular reactions: ion-molecule, neutral, and radical. In particular we have focused on the activation energy of these reactions in order to find possible reactants that could be responsible for to barrierless (or very low energy) pathways. Methods: We have used very accurate, highly correlated quantum chemistry calculations to locate and characterize the reaction pathways in terms of minima and transition states connecting reactants to products. Results: Most of the reactions considered have an activation energy that is too high; but the ion-molecule reaction between NH2OHNH2OH2+ and formamide is not too high. These reactants could be responsible not only for the formation of urea but also of isocyanic acid, which is an organic molecule also observed in the interstellar medium.
Kang, Q.; Wang, M.; Lichtner, P. C.
2008-12-01
In geologic CO2 sequestration, pore-scale interfacial phenomena ultimately govern the key processes of fluid mobility, chemical transport, adsorption, and reaction. However, spatial heterogeneity at the pore scale cannot be resolved at the continuum scale, where averaging occurs over length scales much larger than typical pore sizes. Natural porous media, such as sedimentary rocks and other geological media encountered in subsurface formations, are inherently heterogeneous. This pore-scale heterogeneity can produce variabilities in flow, transport, and reaction processes that take place within a porous medium, and can result in spatial variations in fluid velocity, aqueous concentrations, and reaction rates. Consequently, the unresolved spatial heterogeneity at the pore scale may be important for reactive transport modeling at the larger scale. In addition, current continuum models of surface complexation reactions ignore a fundamental property of physical systems, namely conservation of charge. Therefore, to better understand multiphase flow and reaction involving CO2 sequestration in geologic formations, it is necessary to quantitatively investigate the influence of the pore-scale heterogeneity on the emergent behavior at the field scale. We have applied the lattice Boltzmann method to simulating the injection of CO2 saturated brine or supercritical CO2 into geological formations at the pore scale. Multiple pore-scale processes, including advection, diffusion, homogeneous reactions among multiple aqueous species, heterogeneous reactions between the aqueous solution and minerals, ion exchange and surface complexation, as well as changes in solid and pore geometry are all taken into account. The rich pore scale information will provide a basis for upscaling to the continuum scale.
Boisvert, Luc; Denney, Melanie C; Hanson, Susan Kloek; Goldberg, Karen I
2009-11-04
The reaction of (bipy)PdMe(2) (1) (bipy = 2,2'-bipyridine) with molecular oxygen results in the formation of the palladium(II) methylperoxide complex (bipy)PdMe(OOMe) (2). The identity of the product 2 has been confirmed by independent synthesis. Results of kinetic studies of this unprecedented oxygen insertion reaction into a palladium alkyl bond support the involvement of a radical chain mechanism. Reproducible rates, attained in the presence of the radical initiator 2,2'-azobis(2-methylpropionitrile) (AIBN), reveal that the reaction is overall first-order (one-half-order in both [1] and [AIBN], and zero-order in [O(2)]). The unusual rate law (half-order in [1]) implies that the reaction proceeds by a mechanism that differs significantly from those for organic autoxidations and for the recently reported examples of insertion of O(2) into Pd(II) hydride bonds. The mechanism for the autoxidation of 1 is more closely related to that found for the autoxidation of main group and early transition metal alkyl complexes. Notably, the chain propagation is proposed to proceed via a stepwise associative homolytic substitution at the Pd center of 1 with formation of a pentacoordinate Pd(III) intermediate.
Chen, Zhuo; Valentine, Richard L
2006-12-01
This paper presents mechanistic studies on the formation of NDMA, a newly identified chloramination disinfection byproduct, from reactions of monochloramine with natural organic matter. A kinetic model was developed to validate proposed reactions and to predict NDMA formation in chloraminated water during the time frame of 1-5 days. This involved incorporating NDMA formation reactions into an established comprehensive model describing the oxidation of humic-type natural organic matter by monochloramine. A rate-limiting step involving the oxidation of NOM is theorized to control the rate of NDMA formation which is assumed to be proportional to the rate of NOM oxidized by monochloramine. The applicability of the model to describe NDMA formation in the presence of three NOM sources over a wide range in water quality (i.e., pH, DOC, and ammonia concentrations) was evaluated. Results show that with accurate measurement of monochloramine demand for a specific supply, NDMA formation could be modeled over an extended range of experimental conditions by considering a single NOM source-specific value of thetaNDMA, a stoichiometric coefficient relating the amount of NDMA produced to the amount of NOM oxidized, and several kinetic parameters describing NOM oxidation. Furthermore, the oxidation of NOM is the rate-limiting step governing NDMA formation. This suggests that NDMA formation over a 1-5 day time frame may be estimated from information on the chloramine or free chlorine demand of the NOM and the source-specific linear relationship between this demand and NDMA formation. Although the proposed model has not yet been validated for shorter time periods that may better characterize the residence time in some distribution systems, the improved understanding of the important reactions governing NDMA formation and the resulting model should benefit the water treatment industry as a tool in developing strategies that minimize NDMA formation.
Ozone decomposition in water studied by pulse radiolysis. 2. OH and HO4 as chain intermediates
International Nuclear Information System (INIS)
Staehelin, J.; Buehler, R.E.; Hoigne, J.
1984-01-01
Ozone decomposition in pure water involves a chain mechanism, initiated by the reaction OH - +O 3 and propogated by O 2 - and OH. In the present studies this chain is initiated by pulse radiolysis of aqueous solutions of ozone. The chain propogation steps were studied in two parts. By computer simulation of the rate curves, it is shown that from OH + O 3 and intermediate HO 4 must be formed, most likely a charge-transfer complex (HO.O 3 ), which eventually decays into HO 2 . The derived rate constants for the formation of the various species are included. The spectrum of HO 4 is derived. It is similar to the one of ozone, but the absorption coefficients are about 50% larger. In the presence of high ozone concentration, the dominant chain termination reactions are HO 4 + HO 4 and HO 4 + HO 3 . The effect on chain length, dose, overall rate, and pH and of added scavengers is described. The implications for the natural ozone decay mechanism are discussed
Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei
2017-05-01
All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55-80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of oleylamine (OLAm), but only flat nanoplates are observed in the products in the presence of OTAm at 120 °C. The results indicate that the lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr3 NCs. This work opens up an alternative approach to controllable-synthesis of perovskite NCs through varying the carbon chain length of organic surfactants, and enlightens
Kinetics of contrail particles formation and heterogeneous reactions on such particles
Energy Technology Data Exchange (ETDEWEB)
Kogan, M.N.; Butkovsky, A.V.; Erofeev, A.I.; Freedlender, O.G.; Makashev, N.K. [Central Aerohydrodynamic Inst., Zhukovsky (Russian Federation)
1997-12-31
The research of impact of aircraft emissions upon the atmosphere is very complex and difficult problem. More than two decades of intensive investigations of the problem of ozone decay do not permit to make definite conclusions. Many important problems still remain unsolved in the aircraft/atmosphere interaction: engine, nozzle, jet, jet/vortex system interaction, vortex breakdown, contrail formation, meso-scale and global processes, their effects on climate. The particles formation and heterogeneous reactions play an important role in some of these processes. These problems are discussed. (author) 11 refs.
Kinetics of contrail particles formation and heterogeneous reactions on such particles
Energy Technology Data Exchange (ETDEWEB)
Kogan, M N; Butkovsky, A V; Erofeev, A I; Freedlender, O G; Makashev, N K [Central Aerohydrodynamic Inst., Zhukovsky (Russian Federation)
1998-12-31
The research of impact of aircraft emissions upon the atmosphere is very complex and difficult problem. More than two decades of intensive investigations of the problem of ozone decay do not permit to make definite conclusions. Many important problems still remain unsolved in the aircraft/atmosphere interaction: engine, nozzle, jet, jet/vortex system interaction, vortex breakdown, contrail formation, meso-scale and global processes, their effects on climate. The particles formation and heterogeneous reactions play an important role in some of these processes. These problems are discussed. (author) 11 refs.
Dichotomous-noise-induced pattern formation in a reaction-diffusion system
Das, Debojyoti; Ray, Deb Shankar
2013-06-01
We consider a generic reaction-diffusion system in which one of the parameters is subjected to dichotomous noise by controlling the flow of one of the reacting species in a continuous-flow-stirred-tank reactor (CSTR) -membrane reactor. The linear stability analysis in an extended phase space is carried out by invoking Furutzu-Novikov procedure for exponentially correlated multiplicative noise to derive the instability condition in the plane of the noise parameters (correlation time and strength of the noise). We demonstrate that depending on the correlation time an optimal strength of noise governs the self-organization. Our theoretical analysis is corroborated by numerical simulations on pattern formation in a chlorine-dioxide-iodine-malonic acid reaction-diffusion system.
Gamez-Garcia, Victoria G; Galano, Annia
2017-10-05
A massive search for chemical routes leading to methanol formation in gas phase has been conducted using computational chemistry, at the CBS-QB3 level of theory. The calculations were performed at five different temperatures (100, 80, 50, 20, and 10 K) and at three pressures (0.1, 0.01, and 0.001 atm) for each temperature. The search was focused on identifying reactions with the necessary features to be viable in the interstellar medium (ISM). A searching strategy was applied to that purpose, which allowed to reduce an initial set of 678 possible reactions to a subset of 11 chemical routes that are recommended, for the first time, as potential candidates for contributing to methanol formation in the gas phase of the ISM. They are all barrier-less, and thus they are expected to take place at collision rates. Hopefully, including these reactions in the currently available models, for the gas-phase methanol formation in the ISM, would help improving the predicted fractional abundance of this molecule in dark clouds. Further investigations, especially those dealing with grain chemistry and electronic excited states, would be crucial to get a complete picture of the methanol formation in the ISM.
Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.
Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry
2012-11-16
The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.
Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Toshiaki Higashi
2012-04-01
Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.
Evidence of simian retrovirus type D by polymerase chain reaction.
Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A
2017-06-01
Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Formation and reactions of radical cations of substituted benzenes in aqueous media
International Nuclear Information System (INIS)
Holcman, J.
1977-08-01
Radical cations of anisole, methylated benzenes, ethylbenzene, isopropylbenzene, tert-butylbenzene and N,N-dimethylaniline were studied in aqueous media by pulse radiolytic technique. Absorption spectra and reaction kinetics of the radical cations were recorded. The radical cations are formed from the corresponding OH adducts by the elimination of OH - , either by a simple dissociation or by an acid catalyzed reaction. The rate constants of the formation of the radical cations and their reactions with water, OH - and Fe 2+ , or the reaction of a proton loss, were measured. The rate constants for the reaction with water and OH - , together with the rate constants for the dissociation of the OH adducts, are correlated with the ionization potential of the parent compound. These correlations offer a possibility of predicting the acid-base properties of radical cations of substituted benzenes, or the estimation of their ionization potential. (author)
Directory of Open Access Journals (Sweden)
Irina A. Safronova
2016-01-01
Full Text Available This article analyzes the value chain of high-tech products in Asia and the role of this phenomenon in the further consolidation of trade blocs and alliances in the region. The presence of these chains and their gradual transition from a vertically integrated model to a system of horizontal linkages and interdependence leads to the formation of mechanisms of economic de-facto integration (so-called regionalization process. The East Asian region has demonstrated unprecedented high rates of economic growth in recent decades. The countries are actively developing mechanisms of multilateral cooperation, involving partners from across the Asia-Pacific region. Particular features of a new regional architecture of economic relations are becoming more tangible, and the essential element of this architecture is the intra-regional integration. The author presents an assessment of further developments of the Regional comprehensive economic partnership (RCEP using the structural-functional approach and analytical instruments of the international political economy, The creation of this trade block will help less advanced countries of ASEAN to accelerate economic growth and improve the conditions for integration into global value chains. For advanced economies, participation in the RCEP seems controversial, because production chains have well-established formats within the framework of ASEAN +. The political standoff between Washington and Beijing has an impact on dynamics of regional integration. The split among the East Asian countries was galvanized by the Trans-Pacific Partnership Project (TTP, because TPP has objectives that are very similar to those of RCEP (trade liberalization and economic integration. The author concludes that the extension of this partnership in the ASEAN countries can seriously complicate the operation RVEP and enhance the impact of political factors on economic cooperation. In this case, the value of production and supply chains
Pan, Xiaohua; Zhang, Yan; Sun, Xiaobo; Pan, Wei; Yu, Guifeng; Si, Shuxin; Wang, Jinping
2018-04-01
Carbon dots (CDs) have attracted increasing attention due to their high performances and potential applications in wide range of areas. However, their emission mechanism is not clear so far. In order to reveal more factors contributing to the emission of CDs, the effect of carbon chain length of starting materials on the formation of CDs and their optical properties was experimentally investigated in this work. In order to focus on the effect of carbon chain length, the starting materials with C, O, N in fully identical forms and only carbon chain lengths being different were selected for synthesizing CDs, including citric acid (CA) and adipic acid (AA) as carbon sources, and diamines with different carbon chain lengths (H2N(CH2)nNH2, n = 2, 4, 6) as nitrogen sources, as well as ethylenediamine (EDA) as nitrogen source and diacids with different carbon chain lengths (HOOC(CH2)nCOOH, n = 0, 2, 4, 6) as carbon sources. Therefore, the effect of carbon chain length of starting materials on the formation and optical properties of CDs can be systematically investigated by characterizing and comparing the structures and optical properties of as-prepared nine types of CDs. Moreover, the density of –NH2 on the surface of the CDs was quantitatively detected by a spectrophotometry so as to elucidate the relationship between the –NH2 related surface state and the optical properties.
Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E
1992-01-01
Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.
Directory of Open Access Journals (Sweden)
Jennifer A. Scoble
2013-10-01
Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.
Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.
Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck
2013-01-01
Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.
Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat
Directory of Open Access Journals (Sweden)
Carla Bertechini Faria
2012-03-01
Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.
Formation of substrate-based gold nanocage chains through dealloying with nitric acid
Directory of Open Access Journals (Sweden)
Ziren Yan
2015-06-01
Full Text Available Metal nanocages have raised great interest because of their new properties and wide applications. Here, we report on the use of galvanic replacement reactions to synthesize substrate-supported Ag–Au nanocages from silver templates electrodeposited on transparent indium tin oxide (ITO film coated glass. The residual Ag in the composition was dealloyed with 10% nitric acid. It was found that chains of Au nanocages were formed on the substrate surface during dealloying. When the concentration of HNO3 increased to 20%, the structures of nanocages were damaged and formed crescent or semi-circular shapes. The transfer process on the substrate surface was discussed.
Directory of Open Access Journals (Sweden)
Trioso Purnawarman
2014-04-01
Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.
International Nuclear Information System (INIS)
Kupchishin, A.A.; Kupchishin, A.I.; Omarbekova, Zh.
2001-01-01
In the work an experimental data analysis by integral σ(E 1 ) and differential [dσ(E 1 ,E 2 )]/dE 2 neutron interaction cross sections with reactor materials with the secondary protons and alpha particles generation as well as with the primarily knock-on atoms production in such reactions are carried out. It is shown, that in the (n,p) and (n',α) reactions the recoil nuclei receive essential energy portion and they are the patriarchs for atom-atom cascades in the substance. Nuclear reactions with formation of the secondary α-particles and and recoil nuclei are considered. It is shown, that these reactions are effectively proceeding within neutrons energy range 0.3-15 MeV. The nuclear reactions kinematics of above mentioned processes is studied. Energy conservation law for these reaction is applied. Deferential cross section conservation and transformation law for radiation defect formation in the (n,α) reaction are considered as well
Directory of Open Access Journals (Sweden)
Gusti Ayu Yuniati Kencana
2013-07-01
Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.
Identifying of meat species using polymerase chain reaction (PCR)
International Nuclear Information System (INIS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-01-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing
Identifying of meat species using polymerase chain reaction (PCR)
Energy Technology Data Exchange (ETDEWEB)
Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)
2013-11-27
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
Franz, Marcus; Wolheim, Anke; Richter, Petra; Umbreit, Claudia; Dahse, Regine; Driemel, Oliver; Hyckel, Peter; Virtanen, Ismo; Kosmehl, Hartwig; Berndt, Alexander
2010-04-01
The contribution of stromal laminin chain expression to malignant potential, tumour stroma reorganization and vessel formation in oral squamous cell carcinoma (OSCC) is not fully understood. Therefore, the expression of the laminin chains alpha2, alpha3, alpha4, alpha5 and gamma2 in the stromal compartment/vascular structures in OSCC was analysed. Frozen tissue of OSCC (9x G1, 24x G2, 8x G3) and normal (2x)/hyperplastic (11x) oral mucosa was subjected to laminin chain and alpha-smooth muscle actin (ASMA) immunohistochemistry. Results were correlated to tumour grade. The relation of laminin chain positive vessels to total vessel number was assessed by immunofluorescence double labelling with CD31. Stromal laminin alpha2 chain significantly decreases and alpha3, alpha4, alpha5 and gamma2 chains and also ASMA significantly increase with rising grade. The amount of stromal alpha3, alpha4 and gamma2 chains significantly increased with rising ASMA positivity. There is a significant decrease in alpha3 chain positive vessels with neoplastic transformation. Mediated by myofibroblasts, OSCC development is associated with a stromal up-regulation of laminin isoforms possibly contributing to a migration promoting microenvironment. A vascular basement membrane reorganization concerning alpha3 and gamma2 chain laminins during tumour angioneogenesis is suggested.
Energy Technology Data Exchange (ETDEWEB)
Liu, Shaogang [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, University of Chinese Academy of Sciences, Chinese Academy of Sciences, 18 Shuang-qing Road, Beijing, 100085 (China); Guangxi Colleges and Universities Key Laboratory of Food Safety and Pharmaceutical Analytical Chemistry, Guangxi Key Laboratory of Chemistry and Engineering of Forest Products, School of Chemistry and Chemical Engineering, Guangxi University for Nationalities, Nanning, 530006, Guangxi (China); Li, Zhenlin [Guangxi Colleges and Universities Key Laboratory of Food Safety and Pharmaceutical Analytical Chemistry, Guangxi Key Laboratory of Chemistry and Engineering of Forest Products, School of Chemistry and Chemical Engineering, Guangxi University for Nationalities, Nanning, 530006, Guangxi (China); Dong, Huiyu [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, University of Chinese Academy of Sciences, Chinese Academy of Sciences, 18 Shuang-qing Road, Beijing, 100085 (China); Goodman, Bernard A. [College of Physical Science and Engineering, State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangxi University, Nanning, 520004, Guangxi (China); Qiang, Zhimin, E-mail: qiangz@rcees.ac.cn [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, University of Chinese Academy of Sciences, Chinese Academy of Sciences, 18 Shuang-qing Road, Beijing, 100085 (China)
2017-01-05
This study investigated systematically the factors influencing the formation of iodinated disinfection by-products (I-DBPs) during chloramination of I{sup −}-containing waters, including reaction time, NH{sub 2}Cl dose, I{sup −} concentration, pH, natural organic matter (NOM) concentration, Br{sup −}/I{sup −} molar ratio, and water matrix. Among the I-DBPs detected, iodoform (CHI{sub 3}), iodoacetic acid (IAA), diiodoacetic acid (DIAA), triiodoacetic acid (TIAA), and diiodoacetamide (DIAcAm) were the major species produced from reactions between reactive iodine species (HOI/I{sub 2}) and NOM. A kinetic model involving the reactions of NH{sub 2}Cl auto-decomposition, iodine species transformation and NOM consumption was developed, which could well describe NH{sub 2}Cl decay and HOI/I{sub 2} evolution. Higher concentrations of CHI{sub 3}, IAA, DIAA, TIAA, and DIAcAm were observed in chloramination than in chlorination, whereas IO{sub 3}{sup −} was only formed significantly in chlorination. Maximum formation of I-DBPs occurred at pH 8.0, but acidic conditions favored the formation of iodinated haloacetic acids and DIAcAm. Increasing Br{sup −}/I{sup −} molar ratio from 1 to 10 did not increase the total amount of I-DBPs, but produced more bromine-substituting species. In addition, chloramination of 18 model compounds indicated that low-SUVA{sub 254} (specific ultraviolet absorbance at 254 nm) NOM generally favored the formation of I-DBPs compared to high-SUVA{sub 254} NOM. Finally, potential pathways for I-DBPs formation from chloramination of NOM were proposed.
Study of reaction sequences for formation of solid solution: 0,48 ...
African Journals Online (AJOL)
... of a low concentration of ions forming the perovskite structure PZT (Pb2+, Zr4+ et Ti4+) by other ions (Zn2+, Cr3+ et Sb+5 in our study) alters the reaction sequences training of the solid solution PZT and especially the formation of intermediate phase. Keywords: PZT / Calcination / TGA / DTA / RX / Piezoelectric Ceramics ...
DEFF Research Database (Denmark)
Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld
2007-01-01
Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....
Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases
Directory of Open Access Journals (Sweden)
Sharma J
2010-01-01
Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.
Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo
2018-04-01
Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.
Size Dependence of Doping by a Vacancy Formation Reaction in Copper Sulfide Nanocrystals
Energy Technology Data Exchange (ETDEWEB)
Elimelech, Orian [The Institute of Chemistry and The Center for Nanoscience and Nanotechnology, The Hebrew University of Jerusalem, Jerusalem 91904 Israel; Liu, Jing [Department of Materials Science and Chemical Engineering, Stony Brook University, Stony Brook NY 11794 USA; Plonka, Anna M. [Department of Materials Science and Chemical Engineering, Stony Brook University, Stony Brook NY 11794 USA; Frenkel, Anatoly I. [Department of Materials Science and Chemical Engineering, Stony Brook University, Stony Brook NY 11794 USA; Banin, Uri [The Institute of Chemistry and The Center for Nanoscience and Nanotechnology, The Hebrew University of Jerusalem, Jerusalem 91904 Israel
2017-07-19
Doping of nanocrystals (NCs) is a key, yet underexplored, approach for tuning of the electronic properties of semiconductors. An important route for doping of NCs is by vacancy formation. The size and concentration dependence of doping was studied in copper(I) sulfide (Cu2S) NCs through a redox reaction with iodine molecules (I2), which formed vacancies accompanied by a localized surface plasmon response. X-ray spectroscopy and diffraction reveal transformation from Cu2S to Cu-depleted phases, along with CuI formation. Greater reaction efficiency was observed for larger NCs. This behavior is attributed to interplay of the vacancy formation energy, which decreases for smaller sized NCs, and the growth of CuI on the NC surface, which is favored on well-defined facets of larger NCs. This doping process allows tuning of the plasmonic properties of a semiconductor across a wide range of plasmonic frequencies by varying the size of NCs and the concentration of iodine. Controlled vacancy doping of NCs may be used to tune and tailor semiconductors for use in optoelectronic applications.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.
Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S
2010-03-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats
Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.
2010-01-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.
2015-07-01
Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.
Siqueira, José F; Rôças, Isabela N
2003-08-01
Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and
Study of radiation formation of methyl-iodide Part 2
International Nuclear Information System (INIS)
Bartonicek, B.; Schweiner, Z.; Bednar, J.; Hladky, E.
1975-01-01
Purified methane, ethylene, iodine, methyl iodide, ethyl iodide and hydrogen iodide were irradiated and/or pyrolyzed in Pyrex ampoules by 60 Co-γ-radiation at temperatures between 150 and 450 deg C. The results on radiolysis and pyrolysis were as follows: 1., The most thermally stable product is hydrogen iodide in which already at 450 deg C essen-tially all originally present iodine appears. 2., The radiolytic formation of methyl iodide and hydrogen iodide is positively influenced by the rise in temperature, This and the absolute values of yields indicate a chain mechanism of radiolytic (and pyrolytic) decomposition of the mixture. 3., The ratio of equilibrium concentrations [HI]/[CH 3 I] increases with increasing temperature of pyrolysis showing that HI is the end product of the thermal chain reaction. Methyl iodide is likely to contribute (by its thermal decomposition) to the initiation and propagation of this chain reaction. 4., The negligible temperature dependence of G(H 2 ) and the absence of molecular hydrogen among the products of pyrolytic decomposition of methane-iodine mixtures shows, that (up to 450 deg C) H atoms do not play any role in the thermal chain decomposition of these mixtures. (K.A.)
Botulinum neurotoxin type A radiolabeled at either the light or the heavy chain
International Nuclear Information System (INIS)
Dekleva, M.L.; DasGupta, B.R.; Sathyamoorthy, V.
1989-01-01
Botulinum neurotoxin (NT) has two distinct structural regions called L and H chains (approximately 50 and approximately 100 kDa, respectively). Although the H chain is responsible for binding of the NT to neuronal cells, it is not known which of the subunits is internalized and therefore responsible for causing the blockage of acetylcholine release in susceptible neuronal cells. In this report we describe for the first time the preparation of type A NT which is selectively radiolabeled at either the L or the H chain subunit. Such NT preparations will be useful as tools for determining the distribution of L and H chains in poisoned neuronal cells and the role that each subunit plays in inducing toxicity. The L and H chains of the NT (approximately 150 kDa) were separated, purified, and then individually radiolabeled by reductive methylation of the lysine residues using [3H]- or [14C]formaldehyde. The labeled L and H chains were reconjugated with the complementary unlabeled L and H chains. Formation of -S-S- and noncovalent bonds between the L and H chains regenerated the approximately 150 kDa NT. Autoradiographs of sodium dodecyl sulfate polyacrylamide gels confirmed that each reconstituted NT preparation was labeled at only one subunit chain. NT selectively labeled at either the L or the H chain had specific radioactivities of ca. 25-30 and 45-55 microCi/mumol, respectively, and toxicity (mouse LD50/mg protein) values of 2.2 +/- 1.1 X 10(7) and 3.0 +/- 1.0 X 10(7), respectively. A linear increase in the specific radioactivity of L and H chain subunits was observed with increasing concentrations of 3H- or 14C-labeled formaldehyde in the reaction mixture and with increasing concentrations of L or H chain in the reaction mixture
Radiation induced Maillard reactions (the kinetic of colour formation during heating)
International Nuclear Information System (INIS)
Tegota, A.; Bachman, S.
1998-01-01
The results are presented of the investigation of the effect of ionizing radiation from 60 Co on the acceleration of the Maillard reactions in a model system containing an aqueous solution of fructose (F) at 0.03 mol/dm 3 and alanine (Ala) at 0.01 mol/dm 3 . Solutions of F/Ala irradiated with 5 to 30 kGy at a dose rate 1.4 Gy/s were then heated for a few hours at different temperatures: 400, 600, 800, and 1000 deg C. The colour intensity of the solutions was measured via their absorbance at 450 nm. The reaction constant estimates increased with increasing radiation dose and temperature. The activation energy of colour development determined over the range of 600 deg C to 1000 deg C decreased with dose from 70.6 kJ/mol for 5 kGy to 60.7 kJ/mol for 30 kGy. The results confirmed the formation of carbonyl products from fructose radiolysis and their participation in the acceleration of the non-enzymatic browning reactions. The aldehyde products formed from the amino acids as a result of the Strecker degradation are responsible for the formation of odour typical of the Maillard reaction during heating. The changes in the F and Ala concentrations during irradiation of the solutions were proportional to the radiation dose. The radiation yield of fructose and alanine decomposition was G = 2.6 and 0.22, respectively. In the irradiated solutions of F/Ala, serine has been found, which has not been mentioned so far as a product of alanine radiolysis. The study demonstrates the influence of radiation and acceleration of the Maillard reaction during subsequent heating at 400 deg C up to 1000 deg C of systems containing reducing sugars and amino acids. It should be taken under consideration in the studies on introducing radiation technology of food products preservation connected with further thermal treatment
Effect of Gemini-type surfactant on methane hydrate formation
Energy Technology Data Exchange (ETDEWEB)
Jeong, K.E.; Park, J.M.; Kim, C.U.; Chae, H.J.; Jeong, S.Y. [Korea Research Inst. of Chemical Technology, Jang-Dong, Yuseong-Gu, Daejeon (Korea, Republic of)
2008-07-01
Natural gas hydrates are formed from water and natural gas molecules at particular temperatures and pressures that become ice-like inclusion compounds. Gas hydrates offer several benefits such as energy resource potential and high storage capacity of natural gas in the form of hydrates. However, the application of natural gas hydrates has been deterred by its low formation rate and low conversion ratio of water into hydrate resulting in low actual storage capacity. This paper presented an experimental study to determine the effect of adding a novel Gemini-type surfactant on methane hydrate formation. The experimental study was described with reference to the properties of prepared diols and properties of prepared disulfonates. Gemini surfactant is the family of surfactant molecules possessing more than one hydrophobic tail and hydrophilic head group. They generally have better surface-active properties than conventional surfactants of equal chain length. The paper presented the results of the study in terms of the reactions of diols with propane sultone; storage capacity of hydrate formed with and without surfactant; and methane hydrate formation with and without disulfonate. It was concluded that the methane hydrate formation was accelerated by the addition of novel anionic Gemini-type surfactants and that hydrate formation was influenced by the surfactant concentration and alkyl chain length. For a given concentration, the surfactant with the highest chain length demonstrated the highest formation rate and storage capacity. 5 refs., 3 tabs., 4 figs.
Oyarzún, Bernardo; Mognetti, Bortolo Matteo
2018-03-01
We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.
Boron-Based Catalysts for C-C Bond-Formation Reactions.
Rao, Bin; Kinjo, Rei
2018-05-02
Because the construction of the C-C bond is one of the most significant reactions in organic chemistry, the development of an efficient strategy has attracted much attention throughout the synthetic community. Among various protocols to form C-C bonds, organoboron compounds are not just limited to stoichiometric reagents, but have also made great achievements as catalysts because of the easy modification of the electronic and steric impacts on the boron center. This review presents recent developments of boron-based catalysts applied in the field of C-C bond-formation reactions, which are classified into four kinds on the basis of the type of boron catalyst: 1) highly Lewis acidic borane, B(C 6 F 5 ) 3 ; 2) organoboron acids, RB(OH) 2 , and their ester derivatives; 3) borenium ions, (R 2 BL)X; and 4) other miscellaneous kinds. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis
Directory of Open Access Journals (Sweden)
Anupam Berwal
2017-01-01
Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.
Modified lignin: Preparation and use in reversible gel via Diels-Alder reaction.
Zhou, Wanpeng; Zhang, Hui; Chen, Fangeng
2018-02-01
In this study, popular soda lignin was modified with either furan or maleimide ring, and the modified lignins were subjected to reversible Diels-Alder reaction. A new process was proposed to prepare the functionalized lignin. A long chain was introduced to the hydroxyl groups of lignin, and then either the furan or maleimide ring was added to the other end of the chain. The test results confirmed that either the furan ring or the maleimide ring was bound to lignin. Furan- and maleimide-functionalized lignins were also combined to generate crosslinking via Diels-Alder [4+2] cycloaddition reaction. Under appropriate conditions, the formation of a gel was identified, which reverted to liquid state after retro Diels-Alder reaction upon heating at 120°C. This study reveals the significant versatility and potential of the developed strategy for the utilization of lignin-based recyclable networks. Copyright © 2017 Elsevier B.V. All rights reserved.
Yin, Zi; Sun, Qian; Zhang, Xi; Jing, Hao
2014-05-01
A blue colour can be formed in the xylose (Xyl) and glycine (Gly) Maillard reaction (MR) model system. However, there are fewer studies on the reaction conditions for the blue Maillard reaction products (MRPs). The objective of this study is to investigate characteristic colour formation and antioxidant activities in four different MR model systems and to determine the optimum reaction conditions for the blue colour formation in a Xyl-Gly MR model system, using the random centroid optimisation program. The blue colour with an absorbance peak at 630 nm appeared before browning in the Xyl-Gly MR model system, while no blue colour formation but only browning was observed in the xylose-alanine, xylose-aspartic acid and glucose-glycine MR model systems. The Xyl-Gly MR model system also showed higher antioxidant activity than the other three model systems. The optimum conditions for blue colour formation were as follows: xylose and glycine ratio 1:0.16 (M:M), 0.20 mol L⁻¹ NaHCO₃, 406.1 mL L⁻¹ ethanol, initial pH 8.63, 33.7°C for 22.06 h, which gave a much brighter blue colour and a higher peak at 630 nm. A characteristic blue colour could be formed in the Xyl-Gly MR model system and the optimum conditions for the blue colour formation were proposed and confirmed. © 2013 Society of Chemical Industry.
DEFF Research Database (Denmark)
Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager
2017-01-01
transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...
Siahaan, P.; Salimah, S. N. M.; Sipangkar, M. J.; Hudiyanti, D.; Djunaidi, M. C.; Laksitorini, M. D.
2018-04-01
Chitosan application in pharmaceutics and cosmeceutics industries is limited by its solubility issue. Modification of -NH2 and -OH fuctional groups of chitosan by adding carboxyl group has been shown to improve its solubility and application. Attempt to synthesize carboxymethyl chitosan (CMC) from monocloroacetic acid (MCAA) has been done prior this report. However no information is available wether –OH (-O-C bonding formation) or -NH2 (-N-C bonding formation) is the preference for - CH2COOH to attach. In the current study, the reaction mechanism between chitosan and MCAA reactants into carboxymethyl chitosan (CMC) was examined by computational approach. Dimer from of chitosan used as a molecular model in calculation All the molecular structure involved in the reaction mechanism was optimized by ab initio computational on the theory and basis set HF/6-31G(d,p). The results showed that the - N-C bonding formation via SN2 than the -O-C bonding formation via SN2 which have activation energy 469.437 kJ/mol and 533.219 kJ/mol respectively. However, the -O-C bonding formation more spontaneous than the -N-C bonding formation because ΔG the formation of O-CMC-2 reaction is more negative than ΔG of formation N-CMC-2 reaction is -4.353 kJ/mol and -1.095 kJ/mol respectively. The synthesis of N,O-CMC first forms -O-CH2COOH, then continues to form -NH-CH2COOH. This information is valuable to further optimize the reaction codition for CMC synthesis.
International Nuclear Information System (INIS)
Fomin, Vitaliy N.; Gogol, Daniil B.; Rozhkovoy, Ivan E.; Ponomarev, Dmitriy L.
2017-01-01
This article provides a thermodynamic evaluation of the reactions of humic and fulvic acids in the process of malachite and azurite mineralogenesis. Semi-empirical methods AM/1, MNDO, PM3, PM5, PM6 and PM7 were used to compute the heat of formation, enthalpy and entropy for thermodynamic calculations of the reactions performed on the basis of Hess's law. It is shown that methods PM6 and PM7 in the MOPAC software package provide good compliance with experimental and calculated heats of formation for copper complexes and alkaline earth metal complexes with organic acids. It is found that the malachite and azurite formation processes involving humus complexing substances are thermodynamically possible. - Highlights: • Copper and alkali-earth metal complexes with humic and fulvic acids are considered. • Quantum chemical calculation of thermodynamics for the structures was performed. • Semi-empirical methods PM6 and PM7 provide best correlation for the properties. • Parameters of basic copper carbonate formation reactions were obtained by Hess's law. • Processes of malachite and azurite formation from humus complexes are possible.
Augmentation of chain formation in a magnetic fluid by the addition of halloysite nanotubes
International Nuclear Information System (INIS)
Desai, Rucha; Upadhyay, R V; Mehta, R V
2014-01-01
The study aims to investigate the effect of the addition of nanotubes of halloysite on the augmentation of chains observed in an aqueous magnetic fluid consisting of co-precipitated magnetite particles stabilized with lauric acid. Three samples of the mixture containing 0.5%, 1% and 2% of halloysite nanotubes (HNTs) and a pure magnetic fluid are used for this study. A room temperature magnetization study shows that for 0.5% and 1% of HNT, the magnetization of the mixture significantly increases, while for the higher concentration (2%) it decreases. Such concentration dependent behaviour on the addition of a nonmagnetic system to a magnetic fluid has not previously been observed. The increase in the magnetization is attributed to smaller sized (<5–6 nm) magnetite attached to the HNT, forming a magnetite–HNT composite. Additionally, field-induced chaining is augmented by the addition of HNT in the magnetic fluid. The augmentation of chain formation is confirmed by optical microscopy, field-induced transmission changes and field-dependent diffraction effects. The augmentation will be useful in enhancing other properties of the composite, such as the viscosity and thermal conductivity of nanofluids. (paper)
Oh, Inrok; Choi, Saehyun; Jung, YounJoon; Kim, Jun Soo
2015-08-28
Phase separation in a biological cell nucleus occurs in a heterogeneous environment filled with a high density of chromatins and thus it is inevitably influenced by interactions with chromatins. As a model system of nuclear body formation in a cell nucleus filled with chromatins, we simulate the phase separation of a low-density Lennard-Jones (LJ) fluid interacting with a long, condensed polymer chain. The influence of the density variation of LJ particles above and below the phase boundary and the role of attractive interactions between LJ particles and polymer segments are investigated at a fixed value of strong self-interaction between LJ particles. For a density of LJ particles above the phase boundary, phase separation occurs and a dense domain of LJ particles forms irrespective of interactions with the condensed polymer chain whereas its localization relative to the polymer chain is determined by the LJ-polymer attraction strength. Especially, in the case of moderately weak attractions, the domain forms separately from the polymer chain and subsequently associates with the polymer chain. When the density is below the phase boundary, however, the formation of a dense domain is possible only when the LJ-polymer attraction is strong enough, for which the domain grows in direct contact with the interacting polymer chain. In this work, different growth behaviors of LJ particles result from the differences in the density of LJ particles and in the LJ-polymer interaction, and this work suggests that the distinct formation of activity-dependent and activity-independent nuclear bodies (NBs) in a cell nucleus may originate from the differences in the concentrations of body-specific NB components and in their interaction with chromatins.
Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Stephen Duffett
2012-01-01
Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.
The polymerase chain reaction and its application to clinical plastic surgery.
LENUS (Irish Health Repository)
Rea, S
2012-02-03
Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.
Performance of an HF chain-reaction laser with high initiation efficiency
International Nuclear Information System (INIS)
Whittier, J.S.; Kerber, R.L.
1974-01-01
Output-pulse observations are presented for a transverse electrically initiated, helium-diluted HF laser pumped by the H 2 + F 2 chain reaction. Performance of this laser is studied over a wide range of the gas composition and for initial pressures between 0.1 and 0.5 atm. The gas mixture was stabilized by premixing O 2 , F 2 , and He and flowing this mixture into a cold trap (84 0 K) before mixing with H 2 . Optimum conversion of electrical-initiation energy into laser energy was found for a 240-torr mixture with a mole ratio 1 F 2 :0.23 H 2 :0.08 O 2 :12 He which, when initiated with a 25-kV, 333-pF discharge, gave a pulse energy of 0.150 J. This corresponds to a ratio of laser output energy to electrical input energy of 144 percent. After unnecessary losses are taken into account, this ratio becomes 160 percent. (U.S.)
Detecting beef meatball contamination with polymerase chain reaction
Directory of Open Access Journals (Sweden)
Hoda A.
2017-10-01
Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Andriani .
2013-08-01
Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.
Mechanism of chimera formation during the Multiple Displacement Amplification reaction
Directory of Open Access Journals (Sweden)
Stockwell Timothy B
2007-04-01
Full Text Available Abstract Background Multiple Displacement Amplification (MDA is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Results Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2–21 nucleotides (nts in the new templates. Conclusion Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications.
Oxygen vacancy chain and conductive filament formation in hafnia
Xue, Kan-Hao; Miao, Xiang-Shui
2018-04-01
The stability and aggregation mechanisms of oxygen vacancy chains are studied for hafnia using self-energy corrected density functional theory. While oxygen vacancies tend not to align along the c-axis of monoclinic HfO2, oxygen vacancy chains along a-axis and b-axis are energetically favorable, with cohesive energies of 0.05 eV and 0.03 eV per vacancy, respectively. Nevertheless, with an increase of the cross section area, intensive oxygen vacancy chains become much more stable in hafnia, which yields phase separation into Hf-clusters and HfO2. Compared with disperse single vacancy chains, intensive oxygen vacancy chains made of 4, 6, and 8 single vacancy chains are energetically more favorable by 0.17, 0.20, and 0.30 eV per oxygen vacancy, respectively. On the other hand, while a single oxygen vacancy chain exhibits a tiny electronic energy gap of around 0.5 eV, metallic conduction emerges for the intensive vacancy chain made of 8 single vacancy chains, which possesses a filament cross section area of ˜0.4 nm2. This sets a lower area limit for Hf-cluster filaments from metallic conduction point of view, but in real hafnia resistive RAM devices the cross section area of the filaments can generally be much larger (>5 nm2) for the sake of energy minimization. Our work sets up a bridge between oxygen vacancy ordering and phase separation in hafnia, and shows a clear trend of filament stabilization with larger dimensions. The results could explain the threshold switching phenomenon in hafnia when a small AFM tip was used as the top electrode, as well as the undesired multimode operation in resistive RAM cells with 3 nm-thick hafnia.
Lalam, N.; Jacob, C.
2007-01-01
The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of
Directory of Open Access Journals (Sweden)
Laurent Dacheux
2016-07-01
Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Radji, M.
2010-01-01
Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.
Influence of phase transition on pattern formation during catalytic reactions
Andrade, Roberto Fernandes Silva; Lima, D.; Cunha, F. B.
2000-01-01
p.434–445 We investigate the influence of the order of surface phase transitions on pattern formation during chemical reaction on mono-crystal catalysts. We use a model consisting of two partial differential equations, one of which describes the dynamics of the surface state with the help of a Ginzburg–Landau potential. Second- or first-order transitions are described by decreasing or increasing the relative value of the third-order coefficient of the potential. We concentrate on the stabi...
Exploring single chain amphiphile self-assembly and their possible roles in light transduction
DEFF Research Database (Denmark)
Monnard, Pierre-Alain
2011-01-01
Self-assembled structures of single-chain amphiphiles have been used as hosts for biochemical, and chemical reactions. Their use as models for protocells (i.e., precursors to the first biological cells) has been extensively researched by various groups because the availability of single chain......: the medium composition in terms of ionic strengths and the medium physical parameters, such as temperature, significantly influence the formation of structures, as well as their subsequent stability. In addition, membranes composed of a single amphiphile type seem to be implausible as no potential amphiphile...... source studied to date can supply one single type of amphiphile at concentrations conducive to self-assembly. Mixtures of single-chain amphiphiles were therefore proposed to better model primitive membranes and potentially enhance their structural integrity1-3. Recently, we have established that complex...
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
Andosova, L D; Kontorshchikova, K N; Blatova, O L; Kudel'kina, S Iu; Kuznetsova, I A; Belov, A V; Baĭkova, R A
2011-07-01
The polymerase chain reaction technique was applied in "real time" format to evaluate the occurrence rate and infection ratio of various genotypes of human papilloma of high carcinogenic risk in virus-positive women and contact persons. The examination sampling consisted of 738 women aged of 17-50 years. The examination results permitted to establish high percentage of infection of 546 patients (74%) by carcinogenic papilloma viruses. The analysis of detection rate of various genotypes of human papilloma of high carcinogenic risk established that the 56th and 16th types of high carcinogenic risk are revealed more often than others--in 33% and 15.4% correspondingly. In males, first place in occurrence rate is for those types of virus of human papilloma: the 56th n = 10 (33.3%), 16th n = 3 (10%), 45th n = 3 (10%), 51th n = 3 (10%). The rest of genotypes are detected in 3-7% cases.
Real-time ligation chain reaction for DNA quantification and identification on the FO-SPR.
Knez, Karel; Spasic, Dragana; Delport, Filip; Lammertyn, Jeroen
2015-05-15
Different assays have been developed in the past years to meet point-of-care diagnostic tests requirements for fast and sensitive quantification and identification of targets. In this paper, we developed the ligation chain reaction (LCR) assay on the Fiber Optic Surface Plasmon Resonance (FO-SPR) platform, which enabled simultaneous quantification and cycle-to-cycle identification of DNA during amplification. The newly developed assay incorporated FO-SPR DNA melting assay, previously developed by our group. This required establishment of several assay parameters, including buffer ionic strength and thermal ramping speed as these parameters both influence the ligation enzyme performance and the hybridization yield of the gold nanoparticles (Au NPs) on the FO-SPR sensor. Quantification and identification of DNA targets was achieved over a wide concentration range with a calibration curve spanning 7 orders of magnitude and LOD of 13.75 fM. Moreover, the FO-SPR LCR assay could discriminate single nucleotide polymorphism (SNPs) without any post reaction analysis, featuring thus all the essential requirements of POC tests. Copyright © 2014 Elsevier B.V. All rights reserved.
Many-body formation and dissociation of a dipolar chain crystal
International Nuclear Information System (INIS)
You, Jhih-Shih; Wang, Daw-Wei
2014-01-01
We propose an experimental scheme to effectively assemble chains of dipolar gases with a uniform length in a multi-layer system. The obtained dipolar chains can form a chain crystal with the system temperature easily controlled by the initial lattice potential and the external field strength during processing. When the density of chains increases, we further observe a second order quantum phase transition for the chain crystal to be dissociated toward layers of 2D crystal, where the quantum fluctuation dominates the classical energy and the compressibility diverges at the phase boundary. The experimental implication of such a dipolar chain crystal and its quantum phase transition is also discussed. (paper)
DEFF Research Database (Denmark)
Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L
2015-01-01
Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...
In-situ X-ray diffraction : a useful tool to investigate hydride-formation reactions
Notten, P.H.L.; Daams, J.L.C.; Veirman, de A.E.M.; Staals, A.A.
1994-01-01
A high-pressure X-ray diffraction (XRD) cell has been designed which allowed us to study simultaneously hydrogen absorption/desorption isotherms and XRD powder diffraction patterns on (de)hydrided intermetallic compounds. The hydride formation reaction was investigated in the case of LaNi5 under
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
DEFF Research Database (Denmark)
Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen
2011-01-01
Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...
Physics of positronium acceptor complex formation reactions
International Nuclear Information System (INIS)
Gangopadhyay, Debarshi; Ganguly, Bichitra Nandi; Mukherjee, Tapas; Dutta-Roy, Binayak
2002-01-01
Positronium (P s ) reaction rates (κ) with weak Acceptors (Ac) leading to the formation of Ps-Ac complexes show several interesting features: non-monotonic temperature dependence of κ(departing from the usual Arrhenius behaviour), considerable variability of κ with respect to different solvents, and anomalies in response to external pressure at ambient temperature. The object of this work is to explain all these phenomena using a remarkably simple bubble model (the widely used model for the pick-off component of ortho-positronium decay in liquids), which has been revisited several times in the context and as a result smooth diffuse boundary of the bubble was suggested that yields reasonable agreement of the experimental data. The contractile force on the bubble relies much on the surface tension of the liquid, through our calculation the notion of critical surface tension emerges and enables us to explain the experimental observations satisfactorily. (author)
Directory of Open Access Journals (Sweden)
Burkhard Koenig
2011-01-01
Full Text Available N-Arylated aliphatic and aromatic amines are important substituents in many biologically active compounds. In the last few years, transition-metal-mediated N-aryl bond formation has become a standard procedure for the introduction of amines into aromatic systems. While N-arylation of simple aromatic halides by simple amines works with many of the described methods in high yield, the reactions may require detailed optimization if applied to the synthesis of complex molecules with additional functional groups, such as natural products or drugs. We discuss and compare in this review the three main N-arylation methods in their application to the synthesis of biologically active compounds: Palladium-catalysed Buchwald–Hartwig-type reactions, copper-mediated Ullmann-type and Chan–Lam-type N-arylation reactions. The discussed examples show that palladium-catalysed reactions are favoured for large-scale applications and tolerate sterically demanding substituents on the coupling partners better than Chan–Lam reactions. Chan–Lam N-arylations are particularly mild and do not require additional ligands, which facilitates the work-up. However, reaction times can be very long. Ullmann- and Buchwald–Hartwig-type methods have been used in intramolecular reactions, giving access to complex ring structures. All three N-arylation methods have specific advantages and disadvantages that should be considered when selecting the reaction conditions for a desired C–N bond formation in the course of a total synthesis or drug synthesis.
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
International Nuclear Information System (INIS)
Jin, Jun-Cheng; Tong, Wen-Quan; Fu, Ai-Yun; Xie, Cheng-Gen; Chang, Wen-Gui; Wu, Ju; Xu, Guang-Nian; Zhang, Ya-Nan; Li, Jun; Li, Yong; Yang, Peng-Qi
2015-01-01
Four unexpected 2D lanthanide coordination polymers have been synthesized through in situ reactions of DMF solvent under solvothermal conditions. The isostructural complexes 1–3 contain four types of 2 1 helical chains. While the Nd(III) ions are bridged through μ 2 -HIDC 2− and oxalate to form a 2D sheet along the bc plane without helical character in 4. Therefore, complex 1 exhibits bright red solid-state phosphorescence upon exposure to UV radiation at room temperature. - Graphical abstract: Four unexpected 2D lanthanide coordination polymers have been synthesized through in situ reactions of solvent DMF to formate acid or oxalic acid under solvothermal conditions. The isostructural complexes 1–3 contain four types of different 2 1 helical chains in the 2D layer and 1 exhibits bright red solid-state phosphorescence upon UV radiation. - Highlights: • Four unexpected 2D lanthanide coordination compounds have been synthesized through in situ reactions under solvothermal conditions. • The complexes 1–3 contain four types of 2 1 helical chains in the layer. • Complex 1 exhibits bright red solid-state phosphorescence upon exposure to UV radiation at room temperature
Romano, V.; Gregg, P. M.; Zhan, Y.; Fornari, D. J.; Perfit, M. R.; Battaglia, M.
2017-12-01
The OASIS (Off-Axis Seamount Investigations at Siqueiros) expedition is a multidisciplinary effort to systematically investigate the 8˚20'N Seamount Chain to better understand the melting processes in the southern portion of the 9-10˚N segment of the East Pacific Rise (EPR). The 8˚20'N Seamount Chain extends 160 km west from its initiation, 15km northwest of the EPR-Siqueiros ridge transform intersection (RTI). To investigate the emplacement of the 8˚20'N Seamounts, shipboard EM-122 multibeam, BGM-3 gravity, and towed magnetometer data were collected using the R/V Atlantis in November 2016. Multibeam data show that the seamount chain is characterized by discrete seamounts in the distal portion of the chain, while east of 105˚20' W, the chain is a nearly-continuous volcanic ridge comprised of small cones and coalesced edifices. Free Air Anomalies are used to calculate isostatic anomalies along several profiles crossing the main edifices of the seamount chain, and indicate that the seamounts formed within 100 km of the EPR ridge axis. Excess crustal thickness variations of 0.5 to 1 km, derived from the Residual Mantle Bouguer Anomaly, suggest an increase in melt flux eastward along the chain. Consistently high emplacement volumes are observed east of -105 ˚20' W, 130 km from the ridge axis corresponding with lithosphere younger than 2 Myr. Inverted three-dimensional magnetization data indicate that the seamounts have recorded a series of magnetic reversals along the chain, which correlate to reversals recorded in the surrounding seafloor upon which the seamounts were built. However, reversals along the eastern portion of the chain appear skewed to the west indicating that seamount formation is likely long-lived. While the geophysical observations indicate that the overall seamount chain is age progressive, they suggest coeval volcanism in a region 15-100km from the EPR. The seamounts do not follow absolute plate motions, but are located consistently 15-20 km
Klieger, Yair; Almogi-Hazan, Osnat; Ish-Shalom, Eliran; Pato, Aviad; Pauker, Maor H; Barda-Saad, Mira; Wang, Lynn; Baniyash, Michal
2014-01-01
TCR-mediated activation induces receptor microclusters that evolve to a defined immune synapse (IS). Many studies showed that actin polymerization and remodeling, which create a scaffold critical to IS formation and stabilization, are TCR mediated. However, the mechanisms controlling simultaneous TCR and actin dynamic rearrangement in the IS are yet not fully understood. Herein, we identify two novel TCR ζ-chain motifs, mediating the TCR's direct interaction with actin and inducing actin bundling. While T cells expressing the ζ-chain mutated in these motifs lack cytoskeleton (actin) associated (cska)-TCRs, they express normal levels of non-cska and surface TCRs as cells expressing wild-type ζ-chain. However, such mutant cells are unable to display activation-dependent TCR clustering, IS formation, expression of CD25/CD69 activation markers, or produce/secrete cytokine, effects also seen in the corresponding APCs. We are the first to show a direct TCR-actin linkage, providing the missing gap linking between TCR-mediated Ag recognition, specific cytoskeleton orientation toward the T-cell-APC interacting pole and long-lived IS maintenance. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Rasmussen, Helena; Sørensen, Hanne R.; Meyer, Anne S.
2014-01-01
, several aldehydes and ketones and many different organic acids and aromatic compounds may be generated during hydrothermal treatment of lignocellulosic biomass. The reaction mechanisms are of interest because the very same compounds that are possible inhibitors for biomass processing enzymes......The degradation compounds formed during pretreatment when lignocellulosic biomass is processed to ethanol or other biorefinery products include furans, phenolics, organic acids, as well as mono- and oligomeric pentoses and hexoses. Depending on the reaction conditions glucose can be converted to 5......-(hydroxymethyl)-2-furaldehyde (HMF) and/or levulinic acid, formic acid and different phenolics at elevated temperatures. Correspondingly, xylose can follow different reaction mechanisms resulting in the formation of furan-2-carbaldehyde (furfural) and/or various C-1 and C-4 compounds. At least four routes...
A new building block for DNA network formation by self-assembly and polymerase chain reaction.
Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas
2014-01-01
The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.
Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.
1989-01-01
The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained
Evolution of SUMO Function and Chain Formation in Insects.
Ureña, Enric; Pirone, Lucia; Chafino, Silvia; Pérez, Coralia; Sutherland, James D; Lang, Valérie; Rodriguez, Manuel S; Lopitz-Otsoa, Fernando; Blanco, Francisco J; Barrio, Rosa; Martín, David
2016-02-01
SUMOylation, the covalent binding of Small Ubiquitin-like Modifier (SUMO) to target proteins, is a posttranslational modification that regulates critical cellular processes in eukaryotes. In insects, SUMOylation has been studied in holometabolous species, particularly in the dipteran Drosophila melanogaster, which contains a single SUMO gene (smt3). This has led to the assumption that insects contain a single SUMO gene. However, the analysis of insect genomes shows that basal insects contain two SUMO genes, orthologous to vertebrate SUMO1 and SUMO2/3. Our phylogenetical analysis reveals that the SUMO gene has been duplicated giving rise to SUMO1 and SUMO2/3 families early in Metazoan evolution, and that later in insect evolution the SUMO1 gene has been lost after the Hymenoptera divergence. To explore the consequences of this loss, we have examined the characteristics and different biological functions of the two SUMO genes (SUMO1 and SUMO3) in the hemimetabolous cockroach Blattella germanica and compared them with those of Drosophila Smt3. Here, we show that the metamorphic role of the SUMO genes is evolutionary conserved in insects, although there has been a regulatory switch from SUMO1 in basal insects to SUMO3 in more derived ones. We also show that, unlike vertebrates, insect SUMO3 proteins cannot form polySUMO chains due to the loss of critical lysine residues within the N-terminal part of the protein. Furthermore, the formation of polySUMO chains by expression of ectopic human SUMO3 has a deleterious effect in Drosophila. These findings contribute to the understanding of the functional consequences of the evolution of SUMO genes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Dastur P
2004-01-01
Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Study of Reaction of Curium Oxy-Compound Formation in Molten Chlorides
Energy Technology Data Exchange (ETDEWEB)
Osipenko, A.G.; Mayorshin, A.A.; Bychkov, A.V. [Dimitrovgrad-10, Ulyanovsk region, 433510 (Russian Federation)
2008-07-01
The method of potentiometric titration using oxygen sensors with solid electrolyte membrane was applied for the study of the interaction of curium cations with oxygen anions in the molten alkali metal chlorides in the temperature range of 450-850 C degrees depending on oxy-acidity of the environment. Assumptions were made concerning ion and phase composition of the obtained high-temperature compounds and chemical reactions taking place in the melts. This scheme assumes that as the basicity of the melt increases, initially the formation of soluble curium oxychlorides takes place in the melt (presumably CmO{sup -}) that is followed by formation of solid CmOCl and finally sesquioxide Cm{sub 2}O{sub 3}. Basic thermodynamic values were calculated for the resultant curium oxy-compounds.
Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D
1995-06-01
A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.
Lithofacies cyclicity determination in the guaduas formation (Colombia using Markov chains
Directory of Open Access Journals (Sweden)
Jorge Eliecer Mariño Martinez
2016-07-01
Full Text Available Statistical embedded Markov Chain processes were used to analyze facies transitions and to determine the stacking pattern of the lithofacies of the Guaduas Formation. Twelve Lithofacies were found and characterized based on lithology and sedimentary structures in four stratigraphic sections. The findings were compared with a previous assemblage of lithofacies, interpretations of sedimentary environments, and depositional systems. As a result, four depositional Systems were established. Through the statistical analyses of facies transitions it was found that tidal facies are prevalent in the Socota section, especially in the upper part, whereas in the Sogamoso, Umbita and Peñas de Sutatausa sections, fluvial facies are prevalent in the upper part of the sections, and follow a regressive sequence with more continental deposits around the upper part of the sections. For each of these sections the Markov Chain transition matrices illustrates a strong interaction between tidal facies and fluvial facies, specially in the Peñas de Sutatausa matrix, where facies 6, made up of tidal deposits, appears several times. From the facies model and Markov Chain analyses, it is evident that the Guaduas Formation is a cyclic sequence in which the Markov facies repetitions are consistent with the lithofacies analyses conducted in previous stratigraphic studies. The results reveal that the Markov Chain statistical process can be used to predict stratigraphy in order to correlate contiguous geologically unexplored areas in the Guaduas Formation, where much work relating to correlation and the continuity of coal beds has yet to be done. Determinacion de la ciclicidad de las facies en la formacion Guaduas (Colombia usando las cadenas de Markov Resumen Se utilizaron los procesos estadísticos de las cadenas de Markov para analizar las transiciones de facies y para determinar el patrón de apilamiento de las litofacies de la formación Guaduas. Se encontraron y
Chain reaction. History of the atomic bomb; Kettenreaktion. Die Geschichte der Atombombe
Energy Technology Data Exchange (ETDEWEB)
Mania, Hubert
2010-07-01
Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...
International Nuclear Information System (INIS)
Cohen, S.G.
1975-10-01
A chain reaction may be formulated at alkaline pH in terms of e - /sub aq/ acting as a source of - OH as a reactant and H. regenerating e - /sub aq/. This may account for radiolytic conversion of CO to formate with high G. 60 Co γ-radiolysis of alkaline aqueous acetonitrile and acetamide gave no evidence of a chain; extensive hydrolysis of methyl acetate is now attributed to non-radiolytic, normal hydrolysis. Aromatic mercaptans are found to retard photoreduction of a benzophenone by aliphatic amines, largely by hydrogen atom-transfer repair reactions. Aliphatic mercaptans accelerate photoreduction, apparently by affecting the reduction to quenching ratio in the intermediate charge-transfer complex. In photoreduction of a benzophenone by 2,3-butylene glycol at pH 3, the glycol is converted, not to 3-hydroxy-2-butanone, but to 2-butanone, and about 4 molecules of this are formed per molecule of ketone reduced. A short chain appears to be established. Mercaptan appears to accelerate the reduction of the ketone and retard the formation of 2-butanone
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
DEFF Research Database (Denmark)
Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard
2015-01-01
Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...
EXFOR basics. A short guide to the nuclear reaction data exchange format
International Nuclear Information System (INIS)
McLane, Victoria
2000-01-01
EXFOR is the agreed exchange format for the transmission of experimental nuclear reaction data between national and international nuclear data centers for the benefit of nuclear data users in all countries. This report is intended as a guide to data users. For a complete guide to the EXFOR system see: EXFOR Systems Manual, IAEA-NDS-207 (BNL-NCS-63330-00/04-Rev.) (author)
Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui
2016-05-01
In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.
Kinetics of the chain uranium decay
International Nuclear Information System (INIS)
Zel'dovich, Ya.B.; Khariton, Yu.B.
1984-01-01
The development of chain reaction in uranium mass, when passing through the mass critical value, is studied. It is shown that thermal expanson is a powerful regulating factor, making the limit passing quite safe. The case of convergence of two uranium masses of precritical dimensions is considered in particular. The critical mass value is assessed and it is shown that its gradual increase above the critical value results in the reaction vibrational regime with the period inversely proportional to the square root of uranium supply rate. The role of delaying neutrons in the fission chain reaction development is pointed out
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
ÖZKUL, Aykut
2002-01-01
In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...
Haryani, S.; Kurniawan, C.; Kasmui
2018-04-01
Synthesis of complex compound is one field of research which intensively studied. Metal-dithiocarbamate complexes find wide-ranging applications in nanomaterial and metal separation science, and have potential use as chemotherapeutic, pesticides, and as additives to lubricants. However, the information about is reaction kinetic and mechanism are very much lacking. The research and analyzes results show that reaction synthesis ligand DBDTC and complex compounds Cu-DBDTC. Optimum reaction condition of formation of complex compounds Cu with DBDTC at pH=3, [DBDTC] = 4.10-3 M, and the time of reaction 5 minutes. Based the analysis varian reaction of complex compounds at pH 3 and 4, diffrence significance at the other pH: 5; 5,5; 6; 6,5 ; 7; and 8. The various of mole with reactants comosition difference sigbificance, those the time reaction for 5 and 6 minutes diffrence by significance with the other time, it is 3,4,8, and 10 minutes. The great product to at condition pH 6, the time optimum at 5 minutes and molar ratio of logam: ligand = 1:2. The reaction kinetic equation of complex compound Cu with chelathing ligand DBDTC is V=0.917106 [Cu2+]0.87921 [DBDTC]2.03021. Based on the kinetic data, and formed complex compounds estimation, the mechanism explaining by 2 stages. In the first stage formation of [Cu(DBDTC)], and then [Cu(DBDTC)2] with the last structure geomethry planar rectangle. The result of this research will be more useful if an effort is being done in reaction mechanism by chemical computation method for obtain intermediate, and for constant “k” in same stage, k1.k2. and compound complex constanta (β).
Kakitani, Yoshinori; Fujii, Ritsuko; Hayakawa, Yoshihiro; Kurahashi, Masahiro; Koyama, Yasushi; Harada, Jiro; Shimada, Keizo
2007-06-19
Rubrivivax gelatinosus having both the spheroidene and spirilloxanthin biosynthetic pathways produces carotenoids (Cars) with a variety of conjugated chains, which consist of different numbers of conjugated double bonds (n), including the C=C (m) and C=O (o) bonds. When grown under anaerobic conditions, the wild type produces Cars for which n = m = 9-13, whereas under semiaerobic conditions, it additionally produces Cars for which n = m + o = 10 + 1, 13 + 1, and 13 + 2. On the other hand, a mutant, in which the latter pathway is genetically blocked, produces only Cars for which n = 9 and 10 under anaerobic conditions and n = 9, 10, and 10 + 1 under semianaerobic conditions. Those Cars that were extracted from the LH2 complex (LH2) and the reaction center (RC), isolated from the wild-type and the mutant Rvi. gelatinosus, were analyzed by HPLC, and their structures were determined by mass spectrometry and 1H NMR spectroscopy. The selective binding of Cars to those pigment-protein complexes has been characterized as follows. (1) Cars with a shorter conjugated chain are selectively bound to LH2 whereas Cars with a longer conjugated chain to the RC. (2) Shorter chain Cars with a hydroxyl group are bound to LH2 almost exclusively. This rule holds either in the absence or in the presence of the keto group. The natural selection of shorter chain Cars by LH2 and longer chain Cars by the RC is discussed, on the basis of the results now available, in relation to the light-harvesting and photoprotective functions of Cars.
International Nuclear Information System (INIS)
Verevkin, Sergey P.; Zaitsau, Dzmitry H.; Emel’yanenko, Vladimir N.; Ralys, Ricardas V.; Yermalayeu, Andrei V.; Schick, Christoph
2013-01-01
Graphical abstract: We have shown that enthalpies of formation, enthalpies of vaporization, and lattice potential energies of alkylsubstituted imidazolium, pyridinium, and pyrrolidinium based ionic liquids with Cl and Br anions are linearly dependant on the alkyl chain length. The thermochemical properties of ILs are generally obey the group additivity rules and the values of the additivity parameters for enthalpies of formation and vaporization are very close to those for molecular compounds. - Highlights: • Alkyl substituted imidazolium, pyridinium, and pyrrolidinium based ionic liquids with anions [Cl] and [Br] were studied using DSC and ab initio methods. • The thermochemical properties of ILs generally obey the group additivity rules. • A linear dependence on the chain length of the alkyl chain of cation was found. - Abstract: DSC was used for determination of reaction enthalpies of synthesis of ionic liquids [C n mim][Cl]. A combination of DSC with quantum chemical calculations presents an indirect way to study thermodynamics of ionic liquids. The indirect procedure for vaporization enthalpy was validated with the direct experimental measurements by using thermogravimetry. First-principles calculations of the enthalpy of formation in the gaseous phase have been performed for the ionic species using the CBS-QB3 and G3 (MP2) theory. Experimental DSC data for homologous series of alkyl substituted imidazolium, pyridinium, and pyrrolidinium based ionic liquids with anions [Cl] and [Br] were collected from the literature. We have shown that enthalpies of formation, enthalpies of vaporization, and lattice potential energies are linearly dependant on the alkyl chain length. The thermochemical properties of ILs generally obey the group additivity rules and the values of the additivity parameters for enthalpies of formation and vaporization seem to be very close to those for molecular compounds
Toward a Kinetic Model for Acrylamide Formation in a Glucose-Asparagine Reaction System
Knol, J.J.; Loon, W.A.M.; Linssen, J.P.H.; Ruck, A.L.; Boekel, van M.A.J.S.
2005-01-01
A kinetic model for the formation of acrylamide in a glucose-asparagine reaction system is pro-posed. Equimolar solutions (0.2 M) of glucose and asparagine were heated at different tempera-tures (120-200 C) at pH 6.8. Besides the reactants, acrylamide, fructose, and melanoidins were quantified after
Zhou, Tingting; Lou, Jianfeng; Zhang, Yangeng; Song, Huajie; Huang, Fenglei
2016-07-14
We report million-atom reactive molecular dynamic simulations of shock initiation of β-cyclotetramethylene tetranitramine (β-HMX) single crystals containing nanometer-scale spherical voids. Shock induced void collapse and subsequent hot spot formation as well as chemical reaction initiation are observed which depend on the void size and impact strength. For an impact velocity of 1 km s(-1) and a void radius of 4 nm, the void collapse process includes three stages; the dominant mechanism is the convergence of upstream molecules toward the centerline and the downstream surface of the void forming flowing molecules. Hot spot formation also undergoes three stages, and the principal mechanism is kinetic energy transforming to thermal energy due to the collision of flowing molecules on the downstream surface. The high temperature of the hot spot initiates a local chemical reaction, and the breakage of the N-NO2 bond plays the key role in the initial reaction mechanism. The impact strength and void size have noticeable effects on the shock dynamical process, resulting in a variation of the predominant mechanisms leading to void collapse and hot spot formation. Larger voids or stronger shocks result in more intense hot spots and, thus, more violent chemical reactions, promoting more reaction channels and generating more reaction products in a shorter duration. The reaction products are mainly concentrated in the developed hot spot, indicating that the chemical reactivity of the hmx crystal is greatly enhanced by void collapse. The detailed information derived from this study can aid a thorough understanding of the role of void collapse in hot spot formation and the chemical reaction initiation of explosives.
Directory of Open Access Journals (Sweden)
Kosuke Nakamura
2016-06-01
Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
DEFF Research Database (Denmark)
Andresen, K; Gasim, S; Elhassan, A M
1997-01-01
We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...
Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H
Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI
Formation of amorphous Ti-50at.%Pt by solid state reactions during mechanical alloying
CSIR Research Space (South Africa)
Mahlatji, ML
2013-10-01
Full Text Available Mechanical alloying of an equiatomic mixture of crystalline elemental powders of Ti and Pt in a high-energy ball mill results in formation of an amorphous alloy by solid-state reactions. Mechanical alloying was carried out in an argon atmosphere...
Price formation and transmission along the food commodity chain
Directory of Open Access Journals (Sweden)
Ivana Blažková
2012-01-01
Full Text Available The article is focused on analysis of price transmission along the wheat commodity chain in the Czech Republic, with the distinction on wheat products with low value added (wheat flour, respectively high value added (wheat rolls. The degree of vertical price transmission is measured to identify potential market failures, because asymmetric price transmission can be the result of existence of market power within the food commodity chain. The data basis is made up from monthly prices on partial markets of the analyzed commodity chain published by Czech Statistical Office and Ministry of Agriculture of the Czech Republic. The monitored time period is from January 2000 till October 2009. The analysis is based on calculation of the price transmission elasticity coefficient (evaluation of price transmission along the chain and the intensity of dependency of positive and negative inter-market price differences (evaluation whether positive or negative price changes are better transmitted among particular vertical markets. Time lag is tested as well. The assessment of price transmission along the wheat commodity chain confirmed the existence of market power especially on the retail stage and low impact of price changes of farm prices on final consumer food prices.
Formation, separation and detection of evaporation residues produced in complete fusion reactions
Sagaidak, R N
2015-01-01
Some aspects of formation, separation and detection of evaporation residues (ERs) produced in complete fusion reactions induced by accelerated heavy ions are considered. These reactions allow to obtain heavy neutron-deficient nuclei and to study their properties. The statistical model analysis of the production cross sections for these nuclei obtained in a wide range of their neutron numbers allows to trace the changes in their macroscopic properties such as fission barriers. The fusion probability of massive projectile and target nuclei is of interest. Empirical estimates of this value allow to verify the predictions of theoretical models for the optimal ways of synthesis of unknown nuclei. Some peculiarities in the separation and detection of ERs in experiments are briefly considered by the example of the Ra ERs produced in the 12 C+Pb reactions. The reliable cross sections for ERs produced in very asymmetric projectile-target combination, such as 12 C+Pb, are important for the em...
Glyoxal Oxidation Mechanism: Implications for the Reactions HCO + O2 and OCHCHO + HO2
DEFF Research Database (Denmark)
Fassheber, Nancy; Friedrichs, Gernot; Marshall, Paul
2015-01-01
density ranges. HCO concentration–time profiles have been detected by frequency modulation spectroscopy at a wavelength of λ = 614.752 nm. The temperature range of available direct rate constant data of the high-temperature key reaction HCO + O2 → CO + HO2 has been extended up to 1705 K and confirms.......73 kJ/mol/RT). At intermediate temperatures, the reaction OCHCHO + HO2 becomes more important. A detailed reanalysis of previous experimental data as well as more recent theoretical predictions favor the formation of a recombination product in contrast to the formerly assumed dominating and fast OH......-forming channel. Modeling results of the present study support the formation of HOCH(OO)CHO and provide a 2 orders of magnitude lower rate constant estimate for the OH channel. Hence, low-temperature generation of chain carriers has to be attributed to secondary reactions of HOCH(OO)CHO....
Sleeve reaction chamber system
Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA
2009-08-25
A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.
Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals
Directory of Open Access Journals (Sweden)
Mayara C. Lombardi
2014-12-01
Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.
International Nuclear Information System (INIS)
Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.
1990-01-01
The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy
Study of the Radical Chain Mechanism of Hydrocarbon Oxidation for In Situ Combustion Process
Directory of Open Access Journals (Sweden)
Alexandra Ushakova
2017-01-01
Full Text Available Despite the abundance of in situ combustion models of oil oxidation, many of the effects are still beyond consideration. For example, until now, initial stages of oxidation were not considered from a position of radical chain process. This is a serious difficulty for the simulation of oil recovery process that involves air injection. To investigate the initial stages of oxidation, the paper considers the sequence of chemical reactions, including intermediate short-living compounds and radicals. We have attempted to correlate the main stages of the reaction with areas of heat release observed in the experiments. The system of differential equations based on the equations of oxidation reactions was solved. Time dependence of peroxides formation and start of heat release is analytically derived for the initial stages. We have considered the inhibition of initial oxidation stages by aromatic oil compounds and have studied the induction time in dependence on temperature. Chain ignition criteria for paraffins and crude oil in presence of core samples were obtained. The calculation results are compared with the stages of oxidation that arise by high-pressure differential scanning calorimetry. According to experimental observations we have determined which reactions are important for the process and which can be omitted or combined into one as insignificant.
Zou, Tingting; Liu, Jianbin; Song, Huanlu; Liu, Ye
2018-05-10
Knowledge of the role of peptides in the Maillard reaction is rather limited. In this study, peptide Maillard reaction model systems were established. Volatile and nonvolatile MRPs (Maillard reaction products) were investigated by GC-O-MS and LC-MS. Carbohydrate module labeling (CAMOLA) experiments were performed to elucidate the carbon skeleton of these compounds. Results showed that the peptide reaction system generated more pyrazines than the free amino acid group. Several new Amadori-type conjugates were identified as novel Maillard reaction products that could greatly influence the formation of pyrazines. Our work suggested anew mechanism involving these Amadori-type conjugates and subsequent investigation revealed that the conjugates could be important intermediate products in the reaction between dicarbonyl and dipeptide. Our findings demonstrate anew pyrazine generation mechanism in the dipeptide Maillard reaction. We found that a dipeptide Maillard reaction system generated more pyrazines than a reaction system composed of free amino acids. New cross-linked peptide-sugar compounds were identified and found to impact the formation of pyrazines. The results of this study may help in the preparation of thermal reaction flavors using enzymatically hydrolyzed vegetable/animal proteins, which contain a considerable amount of peptides, as one of the major reactants. © 2018 Institute of Food Technologists®.
Directory of Open Access Journals (Sweden)
Gelencsér
2005-01-01
Full Text Available In a simple conceptual cloud-aerosol model the mass of secondary organic aerosol (SOA that may be formed in multiphase reaction in an idealized scenario involving two cloud cycles separated with a cloud-free period is evaluated. The conditions are set to those typical of continental clouds, and each parameter used in the model calculations is selected as a mean of available observational data of individual species for which the multiphase SOA formation route has been established. In the idealized setting gas and aqueous-phase reactions are both considered, but only the latter is expected to yield products of sufficiently low volatility to be retained by aerosol particles after the cloud dissipates. The key variable of the model is the Henry-constant which primarily determines how important multiphase reactions are relative to gas-phase photooxidation processes. The precursor considered in the model is assumed to already have some affinity to water, i.e. it is a compound having oxygen-containing functional group(s. As a principal model output an aerosol yield parameter is calculated for the multiphase SOA formation route as a function of the Henry-constant, and has been found to be significant already above H~103 M atm-1. Among the potential precursors that may be eligible for this mechanism based on their Henry constants, there are a suite of oxygenated compounds such as primary oxidation products of biogenic and anthropogenic hydrocarbons, including, for example, pinonaldehyde. Finally, the analogy of multiphase SOA formation to in-cloud sulfate production is exploited.
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
Energy Technology Data Exchange (ETDEWEB)
Lomnicki, S.; Khachatryan, L.; Dellinger, B. [Louisiana State Univ., Baton Rouge (United States). Dept. of Chemistry
2004-09-15
One of the major challenges in developing predictive models of the surface mediated pollutant formation and fuel combustion is the construction of reliable reaction kinetic mechanisms and models. While the homogeneous, gas-phase chemistry of various light fuels such as hydrogen and methane is relatively well-known large uncertainties exist in the reaction paths of surface mediated reaction mechanisms for even these very simple species. To date, no detailed kinetic consideration of the surface mechanisms of formation of complex organics such as PCDD/F have been developed. In addition to the complexity of the mechanism, a major difficulty is the lack of reaction kinetic parameters (pre-exponential factor and activation energy) of surface reactions, Consequently, numerical studies of the surface-mediated formation of PCDD/F have often been incorporated only a few reactions. We report the development of a numerical multiple-step surface model based on experimental data of surface mediated (5% CuO/SiO2) conversion of 2-monochlorphenol (2-MCP) to PCDD/F under pyrolytic or oxidative conditions. A reaction kinetic model of the catalytic conversion of 2-MCP on the copper oxide catalyst under pyrolytic conditions was developed based on a detailed multistep surface reaction mechanism developed in our laboratory. The performance of the chemical model is assessed by comparing the numerical predictions with experimental measurements. SURFACE CHEMKIN (version 3.7.1) software was used for modeling. Our results confirm the validity of previously published mechanism of the reaction and provides new insight concerning the formation of PCDD/F formation in combustion processes. This model successfully explains the high yields of PCDD/F at low temperatures that cannot be explained using a purely gas-phase mode.
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.
Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio
2009-01-01
Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.
Chaparala, Sree Vidya; Raj, Abhijeet; Chung, Suk-Ho
2015-01-01
and accurate kinetics for NOx formation. Based on the nitrogen-containing functional groups on coke, model molecules are selected to study reactions between coke-bound nitrogen and O2 to form NO and NO2 using density functional theory. The reaction kinetics
Directory of Open Access Journals (Sweden)
Susan Maphilindawati Noor
2014-10-01
Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.
Watts, Heath D; Mohamed, Mohamed Naseer Ali; Kubicki, James D
2011-12-21
Five potential reaction mechanisms, each leading to the formation of an α-O-4-linked coniferyl alcohol dimer, and one scheme leading to the formation of a recently proposed free-radical coniferyl alcohol trimer were assessed using density functional theory (DFT) calculations. These potential reaction mechanisms were evaluated using both the calculated Gibbs free energies, to predict the spontaneity of the constituent reactions, and the electron-density mapped Fukui function, to determine the most reactive sites of each intermediate species. The results indicate that each reaction in one of the six mechanisms is thermodynamically favorable to those in the other mechanisms; what is more, the Fukui function for each free radical intermediate corroborates with the thermochemical results for this mechanism. This mechanism proceeds via the formation of two distinct free-radical intermediates, which then react to produce the four α-O-4 stereoisomers.
Pressure Dependent Product Formation in the Photochemically Initiated Allyl + Allyl Reaction
Directory of Open Access Journals (Sweden)
Thomas Zeuch
2013-11-01
Full Text Available Photochemically driven reactions involving unsaturated radicals produce a thick global layer of organic haze on Titan, Saturn’s largest moon. The allyl radical self-reaction is an example for this type of chemistry and was examined at room temperature from an experimental and kinetic modelling perspective. The experiments were performed in a static reactor with a volume of 5 L under wall free conditions. The allyl radicals were produced from laser flash photolysis of three different precursors allyl bromide (C3H5Br, allyl chloride (C3H5Cl, and 1,5-hexadiene (CH2CH(CH22CHCH2 at 193 nm. Stable products were identified by their characteristic vibrational modes and quantified using FTIR spectroscopy. In addition to the (re- combination pathway C3H5+C3H5 → C6H10 we found at low pressures around 1 mbar the highest final product yields for allene and propene for the precursor C3H5Br. A kinetic analysis indicates that the end product formation is influenced by specific reaction kinetics of photochemically activated allyl radicals. Above 10 mbar the (re- combination pathway becomes dominant. These findings exemplify the specificities of reaction kinetics involving chemically activated species, which for certain conditions cannot be simply deduced from combustion kinetics or atmospheric chemistry on Earth.
New paradigm for simplified combustion modeling of energetic solids: Branched chain gas reaction
Energy Technology Data Exchange (ETDEWEB)
Brewster, M.Q.; Ward, M.J. [Univ. of Illinois, Urbana, IL (United States); Son, S.F. [Los Alamos National Lab., NM (United States)
1997-09-01
Two combustion models with simple but rational chemistry are compared: the classical high gas activation energy (E{sub g}/RT {much_gt} 1) Denison-Baum-Williams (DBW) model, and a new low gas activation energy (E{sub g}/RT {much_lt} 1) model recently proposed by Ward, Son, and Brewster (WSB). Both models make the same simplifying assumptions of constant properties, Lewis number unity, single-step, second order gas phase reaction, and single-step, zero order, high activation energy condensed phase decomposition. The only difference is in the gas reaction activation energy E{sub g} which is asymptotically large for DBW and vanishingly small for WSB. For realistic parameters the DBW model predicts a nearly constant temperature sensitivity {sigma}{sub p} and a pressure exponent n approaching 1. The WSB model predicts generally observed values of n = 0.7 to 0.9 and {sigma}{sub p}(T{sub o},P) with the generally observed variations with temperature (increasing) and pressure (decreasing). The WSB temperature profile also matches measured profiles better. Comparisons with experimental data are made using HMX as an illustrative example (for which WSB predictions for {sigma}{sub p}(T{sub o},P) are currently more accurate than even complex chemistry models). WSB has also shown good agreement with NC/NG double base propellant and HNF, suggesting that at the simplest level of combustion modeling, a vanishingly small gas activation energy is more realistic than an asymptotically large one. The authors conclude from this that the important (regression rate determining) gas reaction zone near the surface has more the character of chain branching than thermal decomposition.
Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao
2016-04-01
An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.
Shock-induced hotspot formation and chemical reaction initiation in PETN containing a spherical void
International Nuclear Information System (INIS)
Shan, Tzu-Ray; Thompson, Aidan P
2014-01-01
We present results of reactive molecular dynamics simulations of hotspot formation and chemical reaction initiation in shock-induced compression of pentaerythritol tetranitrate (PETN) with the ReaxFF reactive force field. A supported shockwave is driven through a PETN crystal containing a 20 nm spherical void at a sub-threshold impact velocity of 2 km/s. Formation of a hotspot due to shock-induced void collapse is observed. During void collapse, NO 2 is the dominant species ejected from the upstream void surface. Once the ejecta collide with the downstream void surface and the hotspot develops, formation of final products such as N 2 and H 2 O is observed. The simulation provides a detailed picture of how void collapse and hotspot formation leads to initiation at sub-threshold impact velocities.
Free-radical-induced chain scission and cross-linking of polymers in aqueous solution. An overview
International Nuclear Information System (INIS)
Von Sonntag, C.
2002-01-01
Complete text of publication follows. In the radiolysis of N 2 O-saturated aqueous solutions OH are generated. In their reactions with polymers, they give rise to polymer-derived radicals. The kinetics of the formation and decay of these radicals are reviewed. The rate of reaction of a polymer with a reactive free radical is noticeably lower than that of an equivalent concentration of monomer due to the non-random distribution of the reaction sites. Once a larger number of radicals are formed on one polymer molecule, e.g. upon pulse radiolysis, close-by radicals recombine more rapidly while the more distant ones survive for much longer times than an equivalent concentration of freely diffusing radicals. Intermolecular cross-linking (between two polymer chains, increase in molecular weight) and intramolecular cross-linking (formation of small loops, no increase in polymer weight) are competing processes, and their relative yields thus depend on the dose rate and polymer concentration. Hydrogen-transfer reactions within the polymer, e.g. transformation of a secondary radical into a tertiary one, are common and facilitated by the high local density of reactive sites. Due to repulsive forces, the lifetime of radicals of charged polymers is substantially increased. This enables even relatively slow b-fragmentation reactions to become of importance. In the case of poly(methacrylic acid), where β-fragmentation is comparatively fast, this even leads to an unzipping, and as a consequence of the efficient release of methacrylic acid the situation of equilibrium polymerization is approached. Heterolytic β-fragmentation is possible when adequate leaving groups are available, e.g. in polynucleotides and DNA. In the presence of O 2 , chain scission occurs via oxyl radicals as intermediates. Some implications for technical applications are discussed
The Features of Formation of Supply Chains of Retail Trade Enterprise
Kochubei Dmytro V.; Grygorenko Tetyana M.
2017-01-01
The article explores the features of functioning of retail trade enterprises in supply chains; boundaries and dimensions of the supply chain of retail trade enterprise have been defined; a differentiation of methods for managing and assessing the efficiency of supply chain of retail trade enterprise has been proposed. The leading role of the logistic service of retail trade enterprises in generating service flows in terms of supply chain has been defined. The concept of supply chain driven by...
Char and coke formation as unwanted side reaction of the hydrothermal biomass gasification
Energy Technology Data Exchange (ETDEWEB)
Karayildirim, T. [Department of Chemistry, Science Faculty, Ege University, Bornova-Izmir (Turkey); Sinag, A. [Department of Chemistry, Science Faculty, Ankara University, Besevler-Ankara (Turkey); Kruse, A. [Institut fuer Technische Chemie CPV, Forschungszentrum Karlsruhe GmbH, Karlsruhe (Germany)
2008-11-15
The hydrothermal biomass gasification is a promising technology to produce hydrogen and/or methane from wet biomass with a water content of {>=}80 % (g/g). In the process, the coke formation usually is very low, but already low amounts may cause problems like, e.g., fouling in the heat exchanger. To learn more about the product formation, the results of the hydrothermal treatment (at 400,500,600 C and 1 h) of different biomass feedstocks (artichoke stalk, pinecone, sawdust, and cellulose as model biomass) in a microreactor are compared. The gas composition and the total organic carbon content of the aqueous phase were determined after reaction. The gas formation rises with increasing temperature. The formation of carbon deposits and their characterization has been investigated by scanning electron microscopy (SEM). The variation of the solid morphology during the hydrothermal conversion is discussed based on chemical pathways occurring during hydrothermal biomass degradation. (Abstract Copyright [2008], Wiley Periodicals, Inc.)
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
Directory of Open Access Journals (Sweden)
Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.
2011-11-01
Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms. Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354. The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.
Effects of reaction-kinetic parameters on modeling reaction pathways in GaN MOVPE growth
Zhang, Hong; Zuo, Ran; Zhang, Guoyi
2017-11-01
In the modeling of the reaction-transport process in GaN MOVPE growth, the selections of kinetic parameters (activation energy Ea and pre-exponential factor A) for gas reactions are quite uncertain, which cause uncertainties in both gas reaction path and growth rate. In this study, numerical modeling of the reaction-transport process for GaN MOVPE growth in a vertical rotating disk reactor is conducted with varying kinetic parameters for main reaction paths. By comparisons of the molar concentrations of major Ga-containing species and the growth rates, the effects of kinetic parameters on gas reaction paths are determined. The results show that, depending on the values of the kinetic parameters, the gas reaction path may be dominated either by adduct/amide formation path, or by TMG pyrolysis path, or by both. Although the reaction path varies with different kinetic parameters, the predicted growth rates change only slightly because the total transport rate of Ga-containing species to the substrate changes slightly with reaction paths. This explains why previous authors using different chemical models predicted growth rates close to the experiment values. By varying the pre-exponential factor for the amide trimerization, it is found that the more trimers are formed, the lower the growth rates are than the experimental value, which indicates that trimers are poor growth precursors, because of thermal diffusion effect caused by high temperature gradient. The effective order for the contribution of major species to growth rate is found as: pyrolysis species > amides > trimers. The study also shows that radical reactions have little effect on gas reaction path because of the generation and depletion of H radicals in the chain reactions when NH2 is considered as the end species.
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.
2002-01-01
A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or
Directory of Open Access Journals (Sweden)
Takayoshi Kobayashi
2013-02-01
Full Text Available Chemical bond breaking and formation during chemical reactions can be observed using “transition state spectroscopy”. Comparing the measurement result of the transition state spectroscopy with the simulation result of single direct-dynamics trajectory, we have elucidated the reaction dynamics of Claisen rearrangement of allyl vinyl ether. Observed the reaction of the neat sample liquid, we have estimated the time constants of transformation from straight-chain structure to aromatic-like six-membered ring structure forming the C1-C6 bond. The result clarifies that the reaction proceeds via three steps taking longer time than expected from the gas phase calculation. This finding provides new hypothesis and discussions, helping the development of the field of reaction mechanism analysis.
Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping
2017-03-15
This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Imshennik, V.S.
2006-01-01
Within the conditions of Heavy-Ion Fusion (HIF) arises a possibility to obtain the fission chain reaction for a cylindrical HIF target. The paper contains the solution interpolated with the diffusion approximation in order to receive the general approximation expressions for the bar critical radius as well as for over-critical state. The obtained critical parameters generalized for uranium envelope are used for rough evaluation of the energy release in HIF hybrid targets [ru
Directory of Open Access Journals (Sweden)
Lulu Arafani
2016-03-01
Full Text Available White spot syndrome virus (WSSV is one of the most threatening diseases in shrimp and othercrustaceans affecting global shrimp farming. Since firstly detected in Taiwan in 1992, the disease hasspread globally and followed with considerable socio-economic consequences. This research was performedto detect the WSSV infection in shrimp farming in Lombok Island’s (West Nusa Tenggara using real-timepolymerase chain reaction. Samples of vaname (Litopenaeus vannamei were collected from several shrimpfarming in Lombok. Results indicated that the spread of WSSV has reached shrimp farms in Lombok,especially in Lendang Jae, West Lombok. Therefore, a biosurveillance program is strongly recommendedto government to avoid and halt the spread of the disease in East Indonesia region .
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Directory of Open Access Journals (Sweden)
Dastur R
2003-01-01
Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler
Directory of Open Access Journals (Sweden)
Chan-Young Park
2016-10-01
Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Sukkel, W.; Hommes, M.
2009-01-01
In their pursuit of growth and professionalisation, the Dutch organic sector focuses primarily on market development. But how do you stimulate the market for organic foods? This is the subject of many research projects concerning market, consumer preferences and the supply chain. These projects focus specifically at consumer purchasing behaviour, product development, supply chain formation and minimising cost price. As a rule, this research takes place in close cooperation with chain actors
Directory of Open Access Journals (Sweden)
Eduardus Bimo Aksono
2017-06-01
Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup
Monte Carlo evidence for the gluon-chain model of QCD string formation
International Nuclear Information System (INIS)
Greensite, J.; San Francisco State Univ., CA
1988-08-01
The Monte Carlo method is used to calculate the overlaps string vertical stroken gluons>, where Ψ string [A] is the Yang-Mills wavefunctional due to a static quark-antiquark pair, and vertical stroken gluons > are orthogonal trial states containing n=0, 1, or 2 gluon operators multiplying the true ground state. The calculation is carried out for SU(2) lattice gauge theory in Coulomb gauge, in D=4 dimensions. It is found that the string state is dominated, at small qanti q separations, by the vacuum ('no-gluon') state, at larger separations by the 1-gluon state, and, at the largest separations attempted, the 2-gluon state begins to dominate. This behavior is in qualitative agreement with the gluon-chain model, which is a large-N colors motivated theory of QCD string formation. (orig.)
Emotional reactions of different interface formats: Comparing digital and traditional board games
Directory of Open Access Journals (Sweden)
Yu-Min Fang
2016-03-01
Full Text Available Some games provide both traditional board games and digital versions at the same time in the market. Why the rise of virtual games has not forced traditional physical board games to disappear? Do traditional physical games evoke different emotional reactions and interpersonal relationships? This article explored the subjects’ preferences toward traditional and digital versions of the same game and investigated social interaction while playing games. Based on Norman’s three emotional design levels—visceral, behavioral, and reflective levels—this study examined players’ satisfaction degree. This study also applied Positive and Negative Affect Schedule to measure subjects’ emotional reactions. Monopoly and Jenga games were selected as stimuli. A total of 77 subjects received tests of three different interface formats (physical, desktop, and tablet and then filled out the questionnaire. The findings successfully evidenced the significant differences between digital and traditional board games. The statistical results indicated that satisfaction degrees of digital games declined in visceral, behavioral, and reflective levels. Traditional games not only evoked users’ stronger emotional reactions but also received higher preferences. Traditional games could improve interpersonal relationships as well.
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Energy Technology Data Exchange (ETDEWEB)
Liu, Cong; Assary, Rajeev S.; Curtiss, Larry A.
2014-06-26
Upgrading of furan and small oxygenates obtained from the decomposition of cellulosic materials via formation of carbon-carbon bonds is critical to effective conversion of biomass to liquid transportation fuels. Simulation-driven molecular level understanding of carbon-carbon bond formation is required to design efficient catalysts and processes. Accurate quantum chemical methods are utilized here to predict the reaction energetics for conversion of furan (C4H4O) to C5-C8 ethers and the transformation of furfural (C5H6O2) to C13-C26 alkanes. Furan, can be coupled with various C1 to C4 lower molecular weight carbohydrates obtained from the pyrolysis via Diels-Alder type reactions in the gas phase to produce C5-C8 cyclic ethers. The computed reaction barriers for these reactions (~25 kcal/mol) are lower than the cellulose activation or decomposition reactions (~50 kcal/mol). Cycloaddition of C5-C8 cyclo-ethers with furans can also occur in the gas phase, and the computed activation energy is similar to that of the first Diels-Alder reaction. Furfural, obtained from biomass, can be coupled with aldehydes or ketones with α-hydrogen atoms to form longer chain aldol products and these aldol products can undergo vapor phase hydrocycloaddition (activation barrier of ~20 kcal/mol) to form the precursors of C26 cyclic hydrocarbons. These thermochemical studies provide the basis for further vapor phase catalytic studies required for upgrading of furans/furfurals to longer chain hydrocarbons.
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
DEFF Research Database (Denmark)
Andresen, K; Gaafar, A; El-Hassan, A M
1996-01-01
We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....
Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy
2014-01-01
Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...
Formation of Broensted acids sites in the reaction of cyclohexanol on NaCeY zeolites
International Nuclear Information System (INIS)
Vogt, O.; Nattich, M.; Datka, J.; Gil, B.
2002-01-01
This study was undertaken to elucidate why the catalytic activity of NaCeY in cyclohexanol reactions carried out in a pulse reactor increases with the pulse number. We studied therefore the effect of cyclohexanol and also of ethanol and water on catalytic activity NaCeY (of exchange degrees 36 and 72%) in cyclohexanol reactions: isomerization and disproportionation. We also studied the reaction of cyclohexanol and water with NaCeY zeolite by IR spectroscopy. Our results evidenced that new Broensted acid sites were formed by the reaction of cyclohexanol and water. This was shown by IR spectroscopy: the increase of Si-O 1 H-Al band 3638 cm -1 and in increase of ammonium ions band (upon ammonia adsorption). The new sites were formed by hydrolysis of Ce 3+ ions with water introduced in a pulse, or produced by dehydration of cyclohexanol catalyzed by acid sites. Formation of new Broensted acid sites resulted in an increase of catalytic activity of NaCeY in cyclohexane reaction as observed in this study and also in cyclohexanol reactions. (author)
Qu, Lin; Sun, Peng; Wu, Ying; Zhang, Ke; Liu, Zhengping
2017-08-01
An efficient metal-free homodifunctional bimolecular ring-closure method is developed for the formation of cyclic polymers by combining reversible addition-fragmentation chain transfer (RAFT) polymerization and self-accelerating click reaction. In this approach, α,ω-homodifunctional linear polymers with azide terminals are prepared by RAFT polymerization and postmodification of polymer chain end groups. By virtue of sym-dibenzo-1,5-cyclooctadiene-3,7-diyne (DBA) as small linkers, well-defined cyclic polymers are then prepared using the self-accelerating double strain-promoted azide-alkyne click (DSPAAC) reaction to ring-close the azide end-functionalized homodifunctional linear polymer precursors. Due to the self-accelerating property of DSPAAC ring-closing reaction, this novel method eliminates the requirement of equimolar amounts of telechelic polymers and small linkers in traditional bimolecular ring-closure methods. It facilitates this method to efficiently and conveniently produce varied pure cyclic polymers by employing an excess molar amount of DBA small linkers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Garrison, W.M.
1983-11-01
The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included
Formation of long carbon chain molecules during laser vaporization of graphite
International Nuclear Information System (INIS)
Heath, J.R.; Zhang, Q.; O'Brien, S.C.; Curl, R.F.; Kroto, H.W.; Smalley, R.E.
1987-01-01
Graphite is laser vaporized into a He carrier gas containing various simple molecules such as H 2 , H 2 O, NH 3 , and CH 3 CN, supersonically expanded, and skimmed into a molecular beam, and the beam is interrogated by photoionization time-of-flight mass spectrometry. Without added reactants in the He carrier gas, C/sub n/ species up to n = 130 are readily observed. Two distributions separated at about n = 40 appear to be present with the low n species the focus of this work. In the presence of added reagents, new species appear as a result of reaction. These are satisfactorily explained on the basis that a significant proportion of the C/sub n/ species initially formed are reactive radicals with linear carbon chain structures which can readily add H, N, or CN at the ends to form relatively stable polyynes or cyanopolyynes. Some of the cyanopolyynes detected have also been observed in the interstellar medium, and circumstellar carbon condensation processes in the atmospheres of carbon-rich stars similar to those studied here are suggested as possible synthetic sources
Lopez, Karen M; Fleming, Gregory J; Mylniczenko, Natalie D
2016-12-01
Reports of equine herpesvirus (EHV) 1 and EHV-9 causing clinical disease in a wide range of species have been well documented in the literature. It is thought that zebras are the natural hosts of EHV-9 both in the wild and in captive collections. Concerns about potential interspecies transmission of EHV-1 and EHV-9 in a mixed species savannah exhibit prompted serologic and polymerase chain reaction surveys. Eighteen Burchell's zebras ( Equus quagga ), 11 Hartmann's mountain zebras ( Equus zebra hartmannae), and 14 Thomson's gazelles ( Eudorcas thomsonii ) cohabitating the same exhibit were examined for EHV-1 virus neutralization titers, and evidence of virus via EHV 1-5 polymerase chain reactions. None of the animals had previous exposure to vaccination with EHV-1 or EHV-4. All tested zebras had positive EHV-1 titers, ranging from 4 to 384. All zebras and Thomson's gazelles had negative polymerase chain reaction results for all targeted equine herpesviruses. EHV-9-specific assays are not available but EHV-1, EHV-4, and EHV-9 cross-react serologically. Positive serology results indicate a potential latent equine herpesvirus in the zebra population, which prompted initiation of an equine herpesvirus vaccine protocol, changes in pregnant zebra mare management, and equine herpesvirus polymerase chain reaction screening prior to shipment to or from the study site.
Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.
Formation of interstellar methanol ice prior to the heavy CO freeze-out stage
Qasim, D.; Chuang, K.-J.; Fedoseev, G.; Ioppolo, S.; Boogert, A. C. A.; Linnartz, H.
2018-04-01
Context. The formation of methanol (CH3OH) on icy grain mantles during the star formation cycle is mainly associated with the CO freeze-out stage. Yet there are reasons to believe that CH3OH also can form at an earlier period of interstellar ice evolution in CO-poor and H2O-rich ices. Aims: This work focuses on CH3OH formation in a H2O-rich interstellar ice environment following the OH-mediated H-abstraction in the reaction, CH4 + OH. Experimental conditions are systematically varied to constrain the CH3OH formation yield at astronomically relevant temperatures. Methods: CH4, O2, and hydrogen atoms are co-deposited in an ultrahigh vacuum chamber at 10-20 K. OH radicals are generated by the H + O2 surface reaction. Temperature programmed desorption - quadrupole mass spectrometry (TPD-QMS) is used to characterize CH3OH formation, and is complemented with reflection absorption infrared spectroscopy (RAIRS) for CH3OH characterization and quantitation. Results: CH3OH formation is shown to be possible by the sequential surface reaction chain, CH4 + OH → CH3 + H2O and CH3 + OH → CH3OH at 10-20 K. This reaction is enhanced by tunneling, as noted in a recent theoretical investigation Lamberts et al. (2017, A&A, 599, A132). The CH3OH formation yield via the CH4 + OH route versus the CO + H route is approximately 20 times smaller for the laboratory settings studied. The astronomical relevance of the new formation channel investigated here is discussed.
Effect of Ag additions on the β phase formation reaction in the Cu–9 wt.%Al–6 wt.%Mn alloy
Energy Technology Data Exchange (ETDEWEB)
Adorno, A.T., E-mail: atadorno@iq.unesp.br [Departamento de Físico-Química, Instituto de Química, UNESP, Caixa Postal 355, 14801-970 Araraquara, SP (Brazil); Carvalho, T.M. [Departamento de Físico-Química, Instituto de Química, UNESP, Caixa Postal 355, 14801-970 Araraquara, SP (Brazil); Silva, R.A.G. [Departamento de Ciências Exatas e da Terra, UNIFESP, 09972-270 Diadema, SP (Brazil); Santos, C.M.A.; Magdalena, A.G. [Departamento de Físico-Química, Instituto de Química, UNESP, Caixa Postal 355, 14801-970 Araraquara, SP (Brazil)
2015-09-15
Highlights: • The results suggest a multi-step process involving reversible reactions. • Ag solubilizes preferably at the Cu matrix. • Ag additions decrease the activation energy for the process. - Abstract: The influence of 4 and 5 wt.%Ag additions on the kinetics of β [T{sub 7}-(CuMn){sub 3}Al] phase formation reaction in the Cu–9 wt.%Al–6 wt.%Mn alloy was studied using differential scanning calorimetry (DSC), X-ray diffractometry (XRD) and scanning electron microscopy (SEM). The results indicate that the conversion dependence of the activation energy has a descending shape, suggesting a multi-step process involving reversible reactions. The presence of Ag facilitates the formation of the β phase. The results also showed that the Ag precipitates formation includes the dissolution of Mn and Al atoms, thus decreasing the partial fraction of these elements available to react.
International Nuclear Information System (INIS)
Wang Sufan; Smith, Sean C.
2006-01-01
The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information
Microfabricated sleeve devices for chemical reactions
Northrup, M. Allen
2003-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Study on the formation of fission isomer via 232Th + α reaction
International Nuclear Information System (INIS)
Vianna, D.M.
1982-01-01
The formation of fission isomer through 232 Th+α reaction is studied using the distance-recoil method, employing policarbonate MAKROFOL detector. The total isomeric half-life measured has the value T 1/2 = 0.23 ± 0.03 ns and an ratio of formation of isomeric fission relative to prompt fission(σ i /σ p =0.75x10 -5 ). According to the energy of incident particle (Eα = 28 MeV), the cross-sections presented in the literature and the low value found for the total isomeric half-life, we attribute these half-life value to the 234 U isomer (even-even nucleus). The results were compared with those existent in the literature (La69, E170, Re70, Wo70, Po70, Br71) for this isomer. (author) [pt
Directory of Open Access Journals (Sweden)
Zhouli Wang
Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.
Energy Technology Data Exchange (ETDEWEB)
Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.
2017-10-31
Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.
Hou, Li; Xie, Jianchun; Zhao, Jian; Zhao, Mengyao; Fan, Mengdie; Xiao, Qunfei; Liang, Jingjing; Chen, Feng
2017-10-01
To explore initial Maillard reaction pathways and mechanisms for maximal formation of meaty flavors in heated cysteine-xylose-glycine systems, model reactions with synthesized initial Maillard intermediates, Gly-Amadori, TTCA (2-threityl-thiazolidine-4-carboxylic acids) and Cys-Amadori, were investigated. Relative relativities were characterized by spectrophotometrically monitoring the development of colorless degradation intermediates and browning reaction products. Aroma compounds formed were determined by solid-phase microextraction combined with GC-MS and GC-olfactometry. Gly-Amadori showed the fastest reaction followed by Cys-Amadori then TTCA. Free glycine accelerated reaction of TTCA, whereas cysteine inhibited that of Gly-Amadori due to association forming relatively stable thiazolidines. Cys-Amadori/Gly had the highest reactivity in development of both meaty flavors and brown products. TTCA/Gly favored yielding meaty flavors, whereas Gly-Amadori/Cys favored generation of brown products. Conclusively, initial formation of TTCA and pathway involving TTCA with glycine were more applicable to efficiently produce processed-meat flavorings in a cysteine-xylose-glycine system. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong
2007-01-01
Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity
James, Natalie C.; Um, Joann M.; Padias, Anne B.; Hall, H. K.; Houk, K. N.
2013-01-01
The energetics of the Diels-Alder cycloaddition reactions of several 1,3-dienes with acrylonitrile, and the energetics of formation of diradicals, were investigated with density functional theory (B3LYP and M06-2X) and compared to experimental data. For the reaction of 2,3-dimethyl-1,3-butadiene with acrylonitrile, the concerted reaction is favored over the diradical pathway by 2.5 kcal/mol using B3LYP/6-31G(d); experimentally this reaction gives both cycloadduct and copolymer. The concerted cycloaddition of cyclopentadiene with acrylonitrile is preferred computationally over the stepwise pathway by 5.9 kcal/mol; experimentally, only the Diels-Alder adduct is formed. For the reactions of (E)-1,3-pentadiene and acrylonitrile, both cycloaddition and copolymerization were observed experimentally; these trends were mimicked by the computational results, which showed only a 1.2 kcal/mol preference for the concerted pathway. For the reactions of (Z)-1,3-pentadiene and acrylonitrile, the stepwise pathway is preferred by 3.9 kcal/mol, in agreement with previous experimental findings that only polymerization occurs. M06-2X is known to give more accurate activation and reaction energetics but the energies of diradicals are too high. PMID:23758325
Mechanism of trans-vinylene groups formation in the radiolysis of polyethylene and n-alkanes
International Nuclear Information System (INIS)
Borzov, S.M.; Sukhov, F.F.; Slovokhotova, N.A.
1984-01-01
Infrared spectra of polyethylene and some n-alkanes were studied after their irradiation at 20 K with 1-MeV electrons and subsequent heating to 160 K. The mechanism of trans-vinylene groups formation is suggested, which takes into account the decay of excited states of molecules in primary processes and the intra-chain recombination of free radicals in post-irradiation reactions. (author)
Radiation-induced linking reactions in polyethylene
International Nuclear Information System (INIS)
Zoepfl, F.J.
1983-01-01
Three types of measurements are reported relating to chemical reactions in polyethylene induced by ionizing radiation: 1) viscometric and low-angle laser light scattering measurements to determine the effect of a radical scavenger on the yield of links; 2) calorimetric measurements to determine the effect of radiation-induced linking on the melting behavior of polyethylene; and 3) high-resolution solution carbon 13 nuclear magnetic resonance (NMR) spectrometry measurements to determine the nature of the links and the method of their formation. The NMR results present the first direct detection of radiation-induced long-chain branching (Y links) in polyethylene, and place an apparent upper limit on the yield of H-shaped crosslinks that are formed when polyethylene is irradiated to low absorbed doses. The effect of radiation-induced linking on the melting behavior of polyethylene was examined using differential scanning calorimetry (DSC). It was found that radiation-induced links do not change the heat of fusion of polythylene crystals, but decrease the melt entropy and increase the fold surface free energy per unit area of the crystals. The carbon 13 NMR results demonstrate that long-chain branches (Y links) are formed much more frequently than H-shaped crosslinks at low absorbed doses. The Y links are produced by reactions of alkyl free radicals with terminal vinyl groups in polyethylene
A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems
Directory of Open Access Journals (Sweden)
Elisa Morganti
2011-01-01
Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.
OH+ Formation in the Low-temperature O+(4S) + H2 Reaction
Kovalenko, Artem; Dung Tran, Thuy; Rednyk, Serhiy; Roučka, Štěpán; Dohnal, Petr; Plašil, Radek; Gerlich, Dieter; Glosík, Juraj
2018-04-01
Formation of OH+ in collisions of ground-state O+(4S) ions with normal H2 has been studied using a variable temperature 22-pole RF ion trap. From 300 to 30 K the measured reaction rate coefficient is temperature-independent, with a small decrease toward 15 K. The recent wave packet calculation predicts a slightly steeper temperature dependence. The rate coefficients at 300 and 15 K are almost the same, (1.4 ± 0.3) × 10‑9 cm3 s‑1 and (1.3 ± 0.3) × 10‑9 cm3 s‑1, respectively. The influence of traces of the two metastable ions, O+(2D) and O+(2P), has been examined by monitoring the H+ products of their reactions with H2, as well as by chemically probing them with N2 reactant gas.
Energy Technology Data Exchange (ETDEWEB)
Nadtochenko, V.; Dzhabiev, T.S.; Rubtsov, I.V.
1985-12-10
The authors present data on photosensitized reduction of methylviologen (MV/sup 2 +/) by disodium ethylenediaminetetraacetate (EDTA) in micellar systems modeling, in a first approximation, the structural organization of components of the chain of energy and electron transfer in natural photosynthesis. Photosensitized reduction of methylviologen by EDTA in micellar solutions can model photosystem I of plants with structure formation of reagents and transfer of excitation energy before the step of occurrence of a redox reaction in the active center.
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Paul, Shibashis; Ghosh, Shyamolina; Ray, Deb Shankar
2018-02-01
We consider a reaction-diffusion system with linear, stochastic activator-inhibitor kinetics where the time evolution of concentration of a species at any spatial location depends on the relative average concentration of its neighbors. This self-regulating nature of kinetics brings in spatial correlation between the activator and the inhibitor. An interplay of this correlation in kinetics and disparity of diffusivities of the two species leads to symmetry breaking non-equilibrium transition resulting in stationary pattern formation. The role of initial noise strength and the linear reaction terms has been analyzed for pattern selection.
A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction
Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng
2016-08-01
In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.
Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978
Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris
2003-06-01
Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.
Directory of Open Access Journals (Sweden)
João Bortoletti Filho
2013-01-01
Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.
Silicon-based sleeve devices for chemical reactions
Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.
1996-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
International Nuclear Information System (INIS)
Hossain, M.M.; Tsuchie, H.; Detorio, M.A.; Shirono, H.; Hara, C.; Nishimoto, A.; Saji, A.; Koga, J.; Takata, N.; Maniar, J.K.; Saple, D.G.; Taniguchi, K.; Kageyama, S.; Ichimura, H.; Kurimura, T.
1998-01-01
A search for gene(s) associated with anti-human immunodeficiency virus type 1 (HIV-l) activity of CD8 + T cells was attempted using molecular cloning and the relation between the anti-HIV activity of CD8 + T cells and the interleukin-9 receptor a chain (IL-9R-α) mRNA expression from the cDNA clones obtained was examined. The anti-HIV-l activity of CD8 + T cell culture supernatants was assessed by measuring the level of HIV-l replication in a CD4 + T cell line transfected with an infectious HIV-l DNA clone. IL-9R-a mRNA was assayed by reverse transcriptase-polymerase chain reaction (RT-PCR). Of 5 cases showing high level of anti-HIV-l activity (more than 80% suppression of HIV-l replication), the mRNA was detected in 4 cases. Of 10 cases showing low level of anti-HIV-l activity (less than 80% suppression of HIV-l replication), the mRNA was detected in one case. Soluble recombinant human IL-9 receptor (rhIL-9sR) did not suppress HIV-l replication at a concentration of 1 μg/ml. These data suggest that the IL-9R-a mRNA formation in CD8 + T cells may correlate with and play some role in the anti-HIV-l activity of CD8+ T cells from HIV-l-infected individuals. Key words: CD8+ T cells; anti-HIV-l activity; cytokines; interleukin-9 receptor (authors)
Matsumoto, Suzuka; Kanazawa, Arihiro; Kanaoka, Shokyoku; Aoshima, Sadahito
2017-06-14
A unique tandem reaction of sequence-controlled cationic copolymerization and site-specific hetero-Diels-Alder (DA) reaction is demonstrated. In the controlled cationic copolymerization of furfural and 2-acetoxyethyl vinyl ether (AcOVE), only the furan ring adjacent to the propagating carbocation underwent the hetero-DA reaction with the aldehyde moiety of another furfural molecule. A further and equally important feature of the copolymerization is that the obtained copolymers had unprecedented 2:(1 + 1)-type alternating structures of repeating sequences of two VE and one furfural units in the main chain and one furfural unit in the side chain. The specific DA reaction is attributed to the delocalization of the positive charge to the side furan ring.
Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism
Directory of Open Access Journals (Sweden)
Gildo Almeida da Silva
Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.
Brandt-Pollmann, U; Lebiedz, D; Diehl, M; Sager, S; Schlöder, J
2005-09-01
Theoretical and experimental studies related to manipulation of pattern formation in self-organizing reaction-diffusion processes by appropriate control stimuli become increasingly important both in chemical engineering and cellular biochemistry. In a model study, we demonstrate here exemplarily the application of an efficient nonlinear model predictive control (NMPC) algorithm to real-time optimal feedback control of pattern formation in a bacterial chemotaxis system modeled by nonlinear partial differential equations. The corresponding drift-diffusion model type is representative for many (bio)chemical systems involving nonlinear reaction dynamics and nonlinear diffusion. We show how the computed optimal feedback control strategy exploits the system inherent physical property of wave propagation to achieve desired control aims. We discuss various applications of our approach to optimal control of spatiotemporal dynamics.
Correlation between Gas Bubble Formation and Hydrogen Evolution Reaction Kinetics at Nanoelectrodes.
Chen, Qianjin; Luo, Long
2018-04-17
We report the correlation between H 2 gas bubble formation potential and hydrogen evolution reaction (HER) activity for Au and Pt nanodisk electrodes (NEs). Microkinetic models were formulated to obtain the HER kinetic information for individual Au and Pt NEs. We found that the rate-determining steps for the HER at Au and Pt NEs were the Volmer step and the Heyrovsky step, respectively. More interestingly, the standard rate constant ( k 0 ) of the rate-determining step was found to vary over 2 orders of magnitude for the same type of NEs. The observed variations indicate the HER activity heterogeneity at the nanoscale. Furthermore, we discovered a linear relationship between bubble formation potential ( E bubble ) and log( k 0 ) with a slope of 125 mV/decade for both Au and Pt NEs. As log ( k 0 ) increases, E bubble shifts linearly to more positive potentials, meaning NEs with higher HER activities form H 2 bubbles at less negative potentials. Our theoretical model suggests that such linear relationship is caused by the similar critical bubble formation condition for Au and Pt NEs with varied sizes. Our results have potential implications for using gas bubble formation to evaluate the HER activity distribution of nanoparticles in an ensemble.
Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina
2013-01-01
We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.
Modeling impurity-assisted chain creation in noble-metal break junctions
International Nuclear Information System (INIS)
Di Napoli, S; Thiess, A; Blügel, S; Mokrousov, Y
2012-01-01
In this work we present the generalization of the model for chain formation in break junctions, introduced by Thiess et al (2008 Nano Lett. 8 2144), to zigzag transition-metal chains with s and p impurities. We apply this extended model to study the producibility trends for noble-metal chains with impurities, often present in break junction experiments, namely, Cu, Ag and Au chains with H, C, O and N adatoms. Providing the material-specific parameters for our model from systematic full-potential linearized augmented plane-wave first-principles calculations, we find that the presence of such impurities crucially affects the binding properties of the noble-metal chains. We reveal that both the impurity-induced bond strengthening and the formation of zigzag bonds can lead to a significantly enhanced probability for chain formation in break junctions. (paper)
Effect of Heterogeneous Chemical Reactions on the Köhler Activation of Aqueous Organic Aerosols.
Djikaev, Yuri S; Ruckenstein, Eli
2018-05-03
We study some thermodynamic aspects of the activation of aqueous organic aerosols into cloud droplets considering the aerosols to consist of liquid solution of water and hydrophilic and hydrophobic organic compounds, taking into account the presence of reactive species in the air. The hydrophobic (surfactant) organic molecules on the surface of such an aerosol can be processed by chemical reactions with some atmospheric species; this affects the hygroscopicity of the aerosol and hence its ability to become a cloud droplet either via nucleation or via Köhler activation. The most probable pathway of such processing involves atmospheric hydroxyl radicals that abstract hydrogen atoms from hydrophobic organic molecules located on the aerosol surface (first step), the resulting radicals being quickly oxidized by ubiquitous atmospheric oxygen molecules to produce surface-bound peroxyl radicals (second step). These two reactions play a crucial role in the enhancement of the Köhler activation of the aerosol and its evolution into a cloud droplet. Taking them and a third reaction (next in the multistep chain of relevant heterogeneous reactions) into account, one can derive an explicit expression for the free energy of formation of a four-component aqueous droplet on a ternary aqueous organic aerosol as a function of four independent variables of state of a droplet. The results of numerical calculations suggest that the formation of cloud droplets on such (aqueous hydrophilic/hydrophobic organic) aerosols is most likely to occur as a Köhler activation-like process rather than via nucleation. The model allows one to determine the threshold parameters of the system necessary for the Köhler activation of such aerosols, which are predicted to be very sensitive to the equilibrium constant of the chain of three heterogeneous reactions involved in the chemical aging of aerosols.
Formation of hydrogen during heterogeneous thermoradiolysis of water
International Nuclear Information System (INIS)
Rustamov, V.R.; Bugaenko, L.T.; Kerimov, V.K.; Kurbanov, M.A.; Mamedov, S.G.; Ali-Zade, Sh.N.
1986-01-01
At fairly high temperatures, the action of ionizing radiation on water should lead to chain decomposition of water, if in the system there is an acceptor for hydroxyl radical, which transforms it into a hydrogen atom by the reaction OH + X → XO + H, followed by the reaction of hydrogen atoms with a water molecule and formation of molecular hydrogen H + H 2 O → OH. This sequence has been realized in a homogeneous system containing carbon monoxide as an acceptor-transformer. It has been suggested that the same reactions can take place on the surface of solid bodies as in the gaseous phase. In the present work, results are reported of a study of radiational-chemical processes in water at 400 0 C in the presence of a highly dispersed iron(III) oxide with a specific surface of 5 x 10 3 m 2 /kg
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
Wijburg, F. A.; Feller, N.; Scholte, H. R.; Przyrembel, H.; Wanders, R. J.
1989-01-01
We investigated the time course of the formation of lactate and pyruvate from glucose in cultured skin fibroblasts from controls, from a patient with a cytochrome c oxidase deficiency and from controls treated with inhibitors of the individual respiratory chain complexes. Fibroblasts from the
Directory of Open Access Journals (Sweden)
Xinxu Yuan
2018-06-01
Full Text Available Short chain fatty acids (SCFAs, a family of gut microbial metabolites, have been reported to promote preservation of endothelial function and thereby exert anti-atherosclerotic action. However, the precise mechanism mediating this protective action of SCFAs remains unknown. The present study investigated the effects of SCFAs (acetate, propionate and butyrate on the activation of Nod-like receptor pyrin domain 3 (Nlrp3 inflammasome in endothelial cells (ECs and associated carotid neointima formation. Using a partial ligated carotid artery (PLCA mouse model fed with the Western diet (WD, we found that butyrate significantly decreased Nlrp3 inflammasome formation and activation in the carotid arterial wall of wild type mice (Asc+/+, which was comparable to the effect of gene deletion of the adaptor protein apoptosis-associated speck-like protein gene (Asc-/-. Nevertheless, both acetate and propionate markedly enhanced the formation and activation of the Nlrp3 inflammasome as well as carotid neointima formation in the carotid arteries with PLCA in Asc+/+, but not Asc-/- mice. In cultured ECs (EOMA cells, butyrate was found to significantly decrease the formation and activation of Nlrp3 inflammasomes induced by 7-ketocholesterol (7-Ket or cholesterol crystals (CHC, while acetate did not inhibit Nlrp3 inflammasome activation induced by either 7-Ket or CHC, but itself even activated Nlrp3 inflammsomes. Mechanistically, the inhibitory action of butyrate on the Nlrp3 inflammasome was attributed to a blockade of lipid raft redox signaling platforms to produce O2•- upon 7-Ket or CHC stimulations. These results indicate that SCFAs have differential effects on endothelial Nlrp3 inflammasome activation and associated carotid neointima formation. Keywords: Arterial endothelium, Short chain fatty acids, Inflammation, Neointima, Atherosclerosis
Kelly, Michael J. B.; Fallot, Lucas B.; Gustafson, Jeffrey L.; Bergdahl, B. Mikael
2016-01-01
The synthesis of alkenes using the Wittig reaction is a traditional part of many undergraduate organic chemistry teaching laboratory curricula. The aqueous medium version of the Wittig reaction presented is a reliable adaptation of this alkene formation reaction as a very safe alternative in the introductory organic chemistry laboratory. The…
DEFF Research Database (Denmark)
Jensen, Frank Bo
2008-01-01
The nitrite reductase activity of deoxyhemoglobin has received much recent interest because the nitric oxide produced in this reaction may participate in blood flow regulation during hypoxia. The present study used spectral deconvolution to characterize the reaction of nitrite with carp and rabbit...... hemoglobin at different constant oxygen tensions that generate the full range of physiological relevant oxygen saturations. Carp is a hypoxia-tolerant species with very high hemoglobin oxygen affinity, and the high R-state character and low redox potential of the hemoglobin is hypothesized to promote...... NO generation from nitrite. The reaction of nitrite with deoxyhemoglobin leads to a 1 : 1 formation of nitrosylhemoglobin and methemoglobin in both species. At intermediate oxygen saturations, the reaction with deoxyhemoglobin is clearly favored over that with oxyhemoglobin, and the oxyhemoglobin reaction...
Takizawa, Yuumi; Shimomura, Takeshi; Miura, Toshiaki
2013-05-23
We study the initial nucleation dynamics of poly(3-hexylthiophene) (P3HT) in solution, focusing on the relationship between the ordering process of main chains and that of side chains. We carried out Langevin dynamics simulation and found that the initial nucleation processes consist of three steps: the ordering of ring orientation, the ordering of main-chain vectors, and the ordering of side chains. At the start, the normal vectors of thiophene rings aligned in a very short time, followed by alignment of main-chain end-to-end vectors. The flexible side-chain ordering took almost 5 times longer than the rigid-main-chain ordering. The simulation results indicated that the ordering of side chains was induced after the formation of the regular stack structure of main chains. This slow ordering dynamics of flexible side chains is one of the factors that cause anisotropic nuclei growth, which would be closely related to the formation of nanofiber structures without external flow field. Our simulation results revealed how the combined structure of the planar and rigid-main-chain backbones and the sparse flexible side chains lead to specific ordering behaviors that are not observed in ordinary linear polymer crystallization processes.
Energy Technology Data Exchange (ETDEWEB)
Barelko, E V; Kartashova, L I; Komarov, P N; Proskurnin, M A [Karpov Physico-Chemical Institute, Moscow, Union of Soviet Socialist Republics (Russian Federation)
1960-07-15
This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author) [French] Dans ce memoire, les auteurs presentent les resultats d'une etude consacree a l'amorcage sous rayonnement de reactions, d'oxydation des composes organiques, par ramification en chaine. Ils montrent le role des rayonnements en tant qu'agents d'amorcage de la reaction, en citant comme exemples l'oxydation de certains hydrocarbures non satures et du butanol. La reaction possede un caractere d'auto-acceleration et continue spontanement lorsque l'action des rayonnements a cesse. La reaction d'oxydation du benzene a ete etudiee en detail; elle est caracterisee par la haute stabilite de la substance vis-a-vis de l'action des rayonnements. Les auteurs formulent les principes de la sensibilisation, par l'action de substances instables vis-a-vis des rayonnements de l'amorcage sous rayonnement de la reaction d'oxydation de substances stables vis-a-vis des rayonnements et chimiquement inertes. Le memoire fournit les caracteristiques quantitatives
Dechlorination of short chain chlorinated paraffins by nanoscale zero-valent iron.
Zhang, Zhi-Yong; Lu, Mang; Zhang, Zhong-Zhi; Xiao, Meng; Zhang, Min
2012-12-01
In this study, nanoscale zero-valent iron (NZVI) particles were synthesized and used for the reductive dehalogenation of short chain chlorinated paraffins (SCCPs) in the laboratory. The results show that the dechlorination rate of chlorinated n-decane (CP(10)) by NZVI increased with decreased solution pH. Increasing the loading of NZVI enhanced the dechlorination rate of CP(10). With an increase in temperature, the degradation rate increased. The reduction of CP(10) by NZVI was accelerated with increasing the concentration of humic acid up to 15 mg/L but then was inhibited. The dechlorination of CP(10) within the initial 18 h followed pseudo-first order rate model. The formation of intermediate products indicates a stepwise dechlorination pathway of SCCPs by NZVI. The carbon chain length and chlorination degree of SCCPs have a polynominal impact on dechlorination reactions. Copyright © 2012 Elsevier B.V. All rights reserved.
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.
2007-01-01
Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.
Ionothermal synthesis and crystal structures of metal phosphate chains
Wragg, D.; Le Ouay, B.; Beale, A.M.; O'Brien, M.G.; Slawin, A.M.Z.; Warren, J.E.; Prior, T.J.; Morris, R.E.
2013-01-01
We have prepared isostructural aluminium and gallium phosphate chains by ionothermal reactions in 1-ethyl-3-methylimidazolium bromide and 1-ethylpyridinium bromide under a variety of conditions. The chains can be prepared as pure phases or along with three dimensional framework phases. The chains
Xu, Yao; Zheng, Zhi
2016-05-15
We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.
Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.
2003-01-01
An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical
Fragment formation in GeV-energy proton and light heavy-ion induced reactions
International Nuclear Information System (INIS)
Murakami, T.; Haga, M.; Haseno, M.
2002-01-01
We have investigated similarities and differences among the fragment formation processes in GeV-energy light-ion and light heavy-ion induced reactions. We have newly measured inclusive and exclusive energy spectra of intermediate mass fragments (3 ≤ Z ≤ 30; IMFs) for 8-GeV 16 O and 20 Ne and 12-GeV 20 Ne induced target multifragmentations (TMFs) in order to compare them with those previously measured for 8- and 12-GeV proton induced TMFs. We fond noticeable difference in their spectrum shapes and magnitudes but all of them clearly indicate the existence of sideward-peaked components, indicating fragment formations are mainly dictated not by a incident energy per nucleon but by a total energy of the projectile. (author)
DEFF Research Database (Denmark)
Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper
2007-01-01
OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
Ab initio computational study of reaction mechanism of peptide bond formation on HF/6-31G(d,p) level
Siahaan, P.; Lalita, M. N. T.; Cahyono, B.; Laksitorini, M. D.; Hildayani, S. Z.
2017-02-01
Peptide plays an important role in modulation of various cell functions. Therefore, formation reaction of the peptide is important for chemical reactions. One way to probe the reaction of peptide synthesis is a computational method. The purpose of this research is to determine the reaction mechanism for peptide bond formation on Ac-PV-NH2 and Ac-VP-NH2 synthesis from amino acid proline and valine by ab initio computational approach. The calculations were carried out by theory and basis set HF/6-31G(d,p) for four mechanisms (path 1 to 4) that proposed in this research. The results show that the highest of the rate determining step between reactant and transition state (TS) for path 1, 2, 3, and 4 are 163.06 kJ.mol-1, 1868 kJ.mol-1, 5685 kJ.mol-1, and 1837 kJ.mol-1. The calculation shows that the most preferred reaction of Ac-PV-NH2 and Ac-VP-NH2 synthesis from amino acid proline and valine are on the path 1 (initiated with the termination of H+ in proline amino acid) that produce Ac-PV-NH2.
Hydrogen isotope exchange reaction rates in tritium, hydrogen and deuterium mixed gases
International Nuclear Information System (INIS)
Uda, Tatsuhiko
1992-01-01
Hydrogen isotope exchange reaction rates in H 2 +T 2 , D 2 +T 2 and H 2 +D 2 +T 2 mixed gases, as induced by tritium decay and beta radiation, were experimentally measured by laser Raman spectrometry. Initially a glass cell was filled with T 2 gas to a pressure of 30-40 kPa, and an equivalent partial pressure of H 2 and/or D 2 was added. The first-order hydrogen isotope exchange reaction rates were 5.54x10 -2 h -1 for H 2 +T 2 mixed gas and 4.76x10 -2 h -1 for D 2 +T 2 . The actual HT producing rate was nearly equivalent to the rate of DT, but the reverse reaction rate of HT was faster than that of DT. The exchange reaction rates between H, D and T showed the isotope effect, HD>HT>DT. The hydrogen isotope exchange reaction rates observed were about twenty times larger than ion formation rates by beta radiation. This result suggests that a free radical chain reaction in hydrogen isotopes is occurring. (orig.)
Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo
2004-01-01
We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...
Directory of Open Access Journals (Sweden)
PD Andrade
2013-01-01
Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.
Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin
2016-08-24
A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Bramastha Rosadi
2015-01-01
Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease.
Liu, Chang; Ma, Qingxin; Liu, Yongchun; Ma, Jinzhu; He, Hong
2012-02-07
Sulfate is one of the most important aerosols in the atmosphere. A new sulfate formation pathway via synergistic reactions between SO(2) and NO(2) on mineral oxides was proposed. The heterogeneous reactions of SO(2) and NO(2) on CaO, α-Fe(2)O(3), ZnO, MgO, α-Al(2)O(3), TiO(2), and SiO(2) were investigated by in situ Diffuse Reflectance Infrared Fourier Transform Spectroscopy (in situ DRIFTS) at ambient temperature. Formation of sulfate from adsorbed SO(2) was promoted by the coexisting NO(2), while surface N(2)O(4) was observed as the crucial oxidant for the oxidation of surface sulfite. This process was significantly promoted by the presence of O(2). The synergistic effect between SO(2) and NO(2) was not observed on other mineral particles (such as CaCO(3) and CaSO(4)) probably due to the lack of the surface reactive oxygen sites. The synergistic reaction between SO(2) and NO(2) on mineral oxides resulted in the formation of internal mixtures of sulfate, nitrate, and mineral oxides. The change of mixture state will affect the physicochemical properties of atmospheric particles and therefore further influence their environmental and climate effects.
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
Open-chain poly(organophosphazenes). Synthesis and properties
International Nuclear Information System (INIS)
Vinogradova, Svetlana V; Tur, Dzidra R; Vasnev, Valery A
1998-01-01
Various methods for the synthesis of open-chain poly(organophosphazenes) are considered. The mechanism of polymerisation of hexachlorocyclotriphosphazene and the basic principles of formation of poly(organophosphazene) macromolecules by polymeranalogous reactions of poly(dichloro-phosphazene) with various nucleophilic reagents are analysed from a new viewpoint. The potential of this synthetic method for targeted design of poly(organophosphazenes) of various structures is shown. The possibility of synthesising poly(organophosphazenes) by polymerisation of cyclophosphazenes is also discussed. The problem of unit non-uniformity of poly(organophosphazenes) and its influence on the properties of these polymers are considered. The properties of poly(organophosphazenes) are considered in detail and it is shown that these polymers possess unusual valuable properties, which provide opportunities for their successful practical application. The bibliography includes 276 references.
Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.
1996-01-01
A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific
Knol, J.J.; Linssen, J.P.H.; Boekel, van M.A.J.S.
2010-01-01
A kinetic model for the formation of acrylamide in a fructose–asparagine reaction system at initial pH 5.5 is proposed, based on an approach called multiresponse kinetic modelling. The formation of acetic acid and formic acid from the degradation of fructose and its isomer glucose was included in
International Nuclear Information System (INIS)
Headlam, H.A.; Davies, M.J.; Mortimer, A.; Easton, C.J.
2000-01-01
Full text: Exposure of proteins to radicals in the presence of O 2 brings about multiple changes including side-chain oxidation, backbone fragmentation, cross-linking, unfolding, changes in hydrophobicity and conformation, altered susceptibility to proteolytic enzymes and formation of new reactive groups (e.g. hydroperoxides and 3,4-dihydroxyphenylalanine). All of these processes can result in loss of structural or enzymatic activity. The mechanisms that give rise to backbone cleavage are only partly understood. Whilst it is known that direct hydrogen atom abstraction at a-carbon sites gives backbone cleavages it has also been proposed that initial attack at side-chain sites might also give rise to backbone cleavage. In this study we have examined whether initial attack at the β- (C-3) position can give rise to α-carbon radicals (and hence backbone cleavage) via the formation, and subsequent β- scission, of C-3 alkoxyl radicals. This process has been observed previously with protected amino acids in organic solvents (J. Chem. Soc. Perkin Trans. 2, 1997, 503-507) but the occurrence of such reactions with proteins in aqueous solution has not been explored. Alkoxyl radicals were generated at the C-3 position of a variety of protected amino acids and small peptides by two methods: metal-ion catalysed decomposition of hydroperoxides formed as a result of γ-radiolysis in the presence of O 2 , and UV photolysis of nitrate esters. In most cases radicals have been detected by EPR spectroscopy using nitroso and nitrone spin traps, which can be assigned by comparison with literature data to α-carbon radicals; in some case assignments were confirmed by the generation of the putative species by other routes. With Ala peptide hydroperoxides and nitrate esters, and MNP as the spin trap, the major radical detected in each case has been assigned to the adduct of an α-carbon radical with partial structure - NH- . CH-C(O) - consistent with the rapid occurrence of the above
Energy Technology Data Exchange (ETDEWEB)
Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)
2011-10-25
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
International Nuclear Information System (INIS)
Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David
2011-01-01
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
Directory of Open Access Journals (Sweden)
JANNOTTI-PASSOS Liana Konovaloff
2000-01-01
Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.
Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H
2007-03-01
A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.
Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M
1993-01-01
A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.
International Nuclear Information System (INIS)
Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.
2005-01-01
Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)
Directory of Open Access Journals (Sweden)
Edina Rodrigues Pires
1997-01-01
Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive
Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma
2015-03-01
Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.
Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C
2002-01-01
Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.
Energy Technology Data Exchange (ETDEWEB)
Soorkia, Satchin; Taatjes, Craig A.; Osborn, David L.; Selby, Talitha M.; Trevitt, Adam J.; Wilson, Kevin R.; Leone, Stephen R.
2010-03-16
The reaction of the ground state methylidyne radical CH (X2Pi) with pyrrole (C4H5N) has been studied in a slow flow tube reactor using Multiplexed Photoionization Mass Spectrometry coupled to quasi-continuous tunable VUV synchrotron radiation at room temperature (295 K) and 90 oC (363 K), at 4 Torr (533 Pa). Laser photolysis of bromoform (CHBr3) at 248 nm (KrF excimer laser) is used to produce CH radicals that are free to react with pyrrole molecules in the gaseous mixture. A signal at m/z = 79 (C5H5N) is identified as the product of the reaction and resolved from 79Br atoms, and the result is consistent with CH addition to pyrrole followed by Helimination. The Photoionization Efficiency curve unambiguously identifies m/z = 79 as pyridine. With deuterated methylidyne radicals (CD), the product mass peak is shifted by +1 mass unit, consistent with the formation of C5H4DN and identified as deuterated pyridine (dpyridine). Within detection limits, there is no evidence that the addition intermediate complex undergoes hydrogen scrambling. The results are consistent with a reaction mechanism that proceeds via the direct CH (CD) cycloaddition or insertion into the five-member pyrrole ring, giving rise to ring expansion, followed by H atom elimination from the nitrogen atom in the intermediate to form the resonance stabilized pyridine (d-pyridine) molecule. Implications to interstellar chemistry and planetary atmospheres, in particular Titan, as well as in gas-phase combustion processes, are discussed.
Larksarp, C; Sellier, O; Alper, H
2001-05-18
The first palladium-catalyzed ring-expansion reaction of 2-vinylthiiranes with heterocumulenes to form sulfur-containing five-membered-ring heterocycles is described. This regioselective reaction requires 5 mol % of Pd(2)(dba)(3).CHCl(3) and 10 mol % of bidendate phosphine ligand (dppp, BINAP), at 50-80 degrees C, in THF. The reaction of 2-vinylthiiranes with carbodiimides, isocyanates, and ketenimines affords 1,3-thiazolidine derivatives, whereas the reaction with diphenylketene or isothiocyanates results in the formation of 1,3-oxathiolane or 1,3-dithiolane compounds in good to excellent isolated yields and in up to 78% ee.
Postradiation reactions of free radicals in crystalline carbohydrates
International Nuclear Information System (INIS)
Yudin, I.V.; Filyanin, G.A.; Panasyuk, S.L.
1990-01-01
In order to determine the nature of the elementary stages of chain process of formation of molecular products in irradiated carbohydrates, the kinetics of their accumulation in crystalline matrices at 100-400 K were investigated. Chain formation of carbonyl products in xylose crystals irradiated at 100 K was identified at temperatures above 240 K and in saccharose, rhamnose, and arabinose crystals at T > 273 K. Chain formation of hydroxy acids with a radiochemical yield of ∼ 150 molecules/100 eV was confirmed in crystalline lactose
A Hierarchy of Homodesmotic Reactions for Thermochemistry
Schleyer, Paul v. R.
2009-01-01
Chemical equations that balance bond types and atom hybridization to different degrees are often used in computational thermochemistry, for example, to increase accuracy when lower levels of theory are employed. We expose the widespread confusion over such classes of equations and demonstrate that the two most widely used definitions of “homodesmotic” reactions are not equivalent. New definitions are introduced and a consistent hierarchy of reaction classes (RC1 – RC5) for hydrocarbons is constructed: isogyric (RC1) ⊇ isodesmic (RC2) ⊇ hypohomodesmotic (RC3) ⊇ homodesmotic (RC4) ⊇ hyperhomodesmotic (RC5). Each of these successively conserves larger molecular fragments. The concept of isodesmic bond separation reactions is generalized to all classes in this hierarchy, providing a unique sectioning of a given molecule for each reaction type. Several ab initio and density functional methods are applied to the bond separation reactions of 38 hydrocarbons containing five or six carbon atoms. RC4 and RC5 reactions provide bond separation enthalpies with errors consistently less than 0.4 kcal mol−1 across a wide range of theoretical levels, performing significantly better than the other reaction types and far superior to atomization routes. Our recommended bond separation reactions were demonstrated by determining the enthalpies of formation (at 298 K) of 1,3,5-hexatriyne (163.7 ± 0.4 kcal mol−1), 1,3,5,7-octatetrayne (217.6 ± 0.6 kcal mol−1), the larger polyynes C10H2 through C26H2, and an infinite acetylenic carbon chain. PMID:19182999
The gas phase reaction of ozone with 1,3-butadiene: formation yields of some toxic products
Kramp, Franz; Paulson, Suzanne E.
The formation yields of acrolein, 1,2-epoxy-3-butene and OH radicals have been measured from reaction of ozone with 1,3-butadiene at room temperature and atmosphere pressure. 1,3,5-Trimethyl benzene was added to scavenge OH radicals in measurements of product yields. In separate experiments, small quantities of 1,3,5-trimethyl benzene were added as a tracer for OH. Formation yields of acrolein of (52±7)%, 1,2-epoxy-3-butene of (3.1±0.5)% and OH radicals of (13±3)% were observed. In addition, the rate coefficient of the gas-phase reaction of ozone with 1,2-epoxy-3-butene was measured both directly and relative to propene, finding an average of (1.6±0.4)×10 -18 cm 3 molecule -1 s -1, respectively, at 296±2 K. The results are briefly discussed in terms of the effect of atmospheric processing on the toxicity of 1,3-butadiene.
DEFF Research Database (Denmark)
Telschow, Samira; Jappe Frandsen, Flemming; Theisen, Kirsten
2012-01-01
Cement production has been subject to several technological changes, each of which requires detailed knowledge about the high multiplicity of processes, especially the high temperature process involved in the rotary kiln. This article gives an introduction to the topic of cement, including...... an overview of cement production, selected cement properties, and clinker phase relations. An extended summary of laboratory-scale investigations on clinkerization reactions, the most important reactions in cement production, is provided. Clinker formations by solid state reactions, solid−liquid and liquid......−liquid reactions are discussed, as are the influences of particles sizes on clinker phase formation. Furthermore, a mechanism for clinker phase formation in an industrial rotary kiln reactor is outlined....
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
Kullerud, K.
2009-12-01
At Nusfjord in Lofoten, Norway, three 0.3 - 3 m thick shear zones occur in a gabbro-anorthosite. During deformation, the shear zones were infiltrated by a hydrous fluid enriched in Cl. In the central parts of the shear zones, fluid-rock interaction resulted in complete break-down of the primary mafic silicates. Complete hydration of these minerals to Cl-free amphibole and biotite suggests that the hydrous fluid was present in excess during deformation in these parts of the shear zones. Along the margins of the shear zones, however, the igneous mafic silicates (Cpx, Bt, Opx) were only partly overgrown by hydrous minerals. Here, Cl-enriched minerals (Amph, Bt, Scp, Ap) can be observed. Amphibole shows compositions covering the range 0.1 - 4.0 wt % Cl within single thin sections. Mineral textures and extreme compositional variations of the Cl-bearing minerals indicate large chemical gradients of the fluid phase. Relics of primary mafic silicates and compositionally zoned reaction coronas around primary mafic silicates suggest that the free fluid was totally consumed before the alteration of the primary phases were completed. The extreme variations in the Cl-content of amphibole are inferred to monitor a gradual desiccation of the Cl-bearing grain-boundary fluid during fluid-mineral reactions accordingly: 1) The first amphibole that formed during the reactions principally extracted water from the fluid, resulting in a slight increase in the Cl content of the fluid. 2) Continued amphibole-forming reactions resulted in gradual consumption of the free fluid phase, principally by extracting water from the fluid, resulting in an increase in its Cl-content. Higher Cl-content of the fluid resulted in higher Cl-content of the equilibrium amphibole. 3) The most Cl-enriched amphibole (4 wt % Cl) formed in equilibrium with the last volumes of the grain-boundary fluid, which had evolved to a highly saline solution. Mineral reactions within a 1-2 thick zone of the host rock along
Helmig, Sarah; Gothelf, Kurt Vesterager
2017-10-23
Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Polymerase chain reaction as a tool for developing stress protein probes
Energy Technology Data Exchange (ETDEWEB)
Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)
1994-08-01
Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.
Sub-barrier quasifission in heavy element formation reactions with deformed actinide target nuclei
Hinde, D. J.; Jeung, D. Y.; Prasad, E.; Wakhle, A.; Dasgupta, M.; Evers, M.; Luong, D. H.; du Rietz, R.; Simenel, C.; Simpson, E. C.; Williams, E.
2018-02-01
Background: The formation of superheavy elements (SHEs) by fusion of two massive nuclei is severely inhibited by the competing quasifission process. Low excitation energies favor SHE survival against fusion-fission competition. In "cold" fusion with spherical target nuclei near 208Pb, SHE yields are largest at beam energies significantly below the average capture barrier. In "hot" fusion with statically deformed actinide nuclei, this is not the case. Here the elongated deformation-aligned configurations in sub-barrier capture reactions inhibits fusion (formation of a compact compound nucleus), instead favoring rapid reseparation through quasifission. Purpose: To determine the probabilities of fast and slow quasifission in reactions with prolate statically deformed actinide nuclei, through measurement and quantitative analysis of the dependence of quasifission characteristics at beam energies spanning the average capture barrier energy. Methods: The Australian National University Heavy Ion Accelerator Facility and CUBE fission spectrometer have been used to measure fission and quasifission mass and angle distributions for reactions with projectiles from C to S, bombarding Th and U target nuclei. Results: Mass-asymmetric quasifission occurring on a fast time scale, associated with collisions with the tips of the prolate actinide nuclei, shows a rapid increase in probability with increasing projectile charge, the transition being centered around projectile atomic number ZP=14 . For mass-symmetric fission events, deviations of angular anisotropies from expectations for fusion fission, indicating a component of slower quasifission, suggest a similar transition, but centered around ZP˜8 . Conclusions: Collisions with the tips of statically deformed prolate actinide nuclei show evidence for two distinct quasifission processes of different time scales. Their probabilities both increase rapidly with the projectile charge. The probability of fusion can be severely
Huang, Feng; Tahmasebi, Arash; Maliutina, Kristina; Yu, Jianglong
2017-12-01
The formation of nitrogen-containing compounds in bio-oil during microwave pyrolysis of Chlorella and Spirulina microalgae has been investigated in this study. Activated carbon (AC) and magnetite (Fe 3 O 4 ) were used as microwave receptors during microwave pyrolysis experiments. It has been found that the use of Fe 3 O 4 increased the total yield of bio-oil. The use of different microwave receptors did not seem to have affected the total yield of nitrogen-containing compounds in the bio-oil. However, Fe 3 O 4 promoted the formation of nitrogen-containing aliphatics, thereby reducing the formation of nitrogen-containing aromatics. The use of AC promoted the dehydration reactions during amino acid decomposition, thereby enhancing the formation of nitrogen-containing aromatics during pyrolysis. From the gas chromatography-mass spectrometry (GC-MS) analysis results, the major high-value nitrogen-containing compounds in the pyrolysis bio-oil of Chlorella and Spirulina were identified as indole and dodecamide. The formation mechanisms of nitrogen-containing compounds were proposed and discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.
Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen
2007-06-01
Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.
Critical analysis: use of polymerase chain reaction to diagnose leprosy
Directory of Open Access Journals (Sweden)
Flaviane Granero Maltempe
Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.