WorldWideScience

Sample records for chain reaction detection

  1. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  2. Detection of Francisella tularensis in blood by polymerase chain reaction.

    OpenAIRE

    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.

    1993-01-01

    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.

  3. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  4. Detection of Listeria monocytogenes by using the polymerase chain reaction

    International Nuclear Information System (INIS)

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  5. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  6. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    Energy Technology Data Exchange (ETDEWEB)

    Liu Jinfeng [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Shen Xingyan [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Zhu Debin [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2005-04-29

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency.

  7. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维

    2003-01-01

    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  8. Nested methylation-specific polymerase chain reaction cancer detection method

    Science.gov (United States)

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  9. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction.

    Science.gov (United States)

    Uphoff, Cord C; Drexler, Hans G

    2011-01-01

    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  10. Early detection of typhoid by polymerase chain reaction

    International Nuclear Information System (INIS)

    Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

  11. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.

    OpenAIRE

    1991-01-01

    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  12. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  13. Chain reaction

    International Nuclear Information System (INIS)

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  14. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease.

    Science.gov (United States)

    Khalil, S H; Siegrist, K; Akhtar, M

    1997-07-01

    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  15. Immunomagnetic Separation Combined with Polymerase Chain Reaction for the Detection of Alicyclobacillus acidoterrestris in Apple Juice

    OpenAIRE

    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen

    2013-01-01

    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agar...

  16. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  17. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  18. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  19. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.

    OpenAIRE

    Patou, G.; Pillay, D.; Myint, S; Pattison, J.

    1993-01-01

    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  20. Detection of Durum Wheat Pasta Adulteration in the Jordanian Market by Polymerase Chain Reaction Technology

    OpenAIRE

    H. Al-Rousan; N.D. Al-Hmoud; Ibrahim, M. A.; B.O. Hayek

    2011-01-01

    Taking into account the impact of monitoring food adulteration on the quality of food products, the aim of this study was to use polymerase chain reaction technology to detect possible adulteration of durum wheat pasta products in the Jordanian market. Cetyltrimethyl ammonium bromide method was applied for extracting genomic DNA from twenty six randomly collected pasta products, the results suggested the suitability of this method for DNA extraction from pasta products. Specific primers were ...

  1. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.

    OpenAIRE

    Tzianabos, T; Anderson, B E; McDade, J E

    1989-01-01

    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinica...

  2. Real-Time Polymerase Chain Reaction for Detection of Strongyloides stercoralis in Stool

    OpenAIRE

    Sultana, Yasmin; Jeoffreys, Neisha; Watts, Matthew R.; Gilbert, Gwendolyn L.; Lee, Rogan

    2013-01-01

    The use of real-time polymerase chain reaction (PCR) for detection of Strongyloides stercoralis in stool has recently been described. We compared five DNA extraction methods by using normal human stool spiked with Strongyloides ratti and tested by using a real-time PCR. The PowerSoil kit was found to be the best technique in terms of sensitivity and ease of use. The PCR detected DNA extracted from one spiked S. ratti larva diluted 10−2. The PowerSoil kit was then used to extract DNA from 160 ...

  3. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain

    2010-02-01

    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  4. Polymerase chain reaction detection of candidatus liberibacter asiatic associated with citrus huanglonbing

    Directory of Open Access Journals (Sweden)

    G.P. Jagtap

    2012-08-01

    Full Text Available Polymerase chain reaction diagnosis of Candidatus liberibacter asiatic associated with citrus Huanglonbing disease is molecular technique which is used for detection of disease when pathogen present is very low concentration in disease sample. Among these three DNA isolation methods viz., commercial kit method, sodium sulphite method and membrane bard nucleic acid technique, sodium sulphite method is cost effective for commercial use. In nucleic acid membrane method for DNA extraction isolation there is no use of liquid nitrogen. Polymerase chain reaction detection of disease is based on principal of thermal cycling in which PCR instrument allow to run generally 60-65 thermal cycle, during PCR operation it allow different stages of cycle at different temperatures for different period of time i.e. initiation (940C, denaturation (940C, primer annealing (600C, extension/elongation step (720C, final elongation (720C and holding temperature (40C. PCR based diagnosis system is developed for detection of greening bacteria. The comparative cost of detection by various combinations of reagent and sampling time was determined and cost effective technology was standardized and validated.

  5. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  6. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane

    2003-04-01

    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  7. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  8. Comparison of a conventional polymerase chain reaction with real-time polymerase chain reaction for the detection of neurotropic viruses in cerebrospinal fluid samples

    OpenAIRE

    M Ramamurthy; Alexander, M; Aaron, S; Kannangai, R.; Ravi, V.; Sridharan, G.; A.M. Abraham

    2011-01-01

    Purpose : To compare a conventional polymerase chain reaction (PCR) and real-time PCR for the detection of neurotropic DNA viruses. Materials and Methods : A total of 147 cerebrospinal fluid (CSF) samples was collected from patients attending a tertiary care hospital in South India for a period from 2005 to 2008. All these samples were tested using a conventional multiplex/uniplex PCR and a real-time multiplex/uniplex PCR. This technique was used to detect a large number of herpes viruses res...

  9. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.

    OpenAIRE

    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J

    1992-01-01

    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...

  10. A highly sensitive aptasensor for OTA detection based on hybridization chain reaction and fluorescent perylene probe.

    Science.gov (United States)

    Wang, Bin; Wu, Yuanya; Chen, Yanfen; Weng, Bo; Xu, Liqun; Li, Changming

    2016-07-15

    An optical aptasensor was developed for ultrasensitive detection of ochratoxin A (OTA) based on hybridization chain reaction (HCR) amplification strategy and fluorescent perylene probe (PAPDI)/DNA composites. Dendritic DNA concatamers were synthesized by HCR strategy and modified on magnetic nanoparticles through aptamer as medium. A large amount of PAPDI probe aggregated under the induction of DNA concatamers and caused fluorescence quenching. In the presence of OTA, the PAPDI/DNA composites were released from magnetic nanoparticles due to the strong affinity between aptamer and OTA. In ethanol, PAPDI monomers disaggregated and produced strong fluorescence. The present method displays excellent sensitivity and selectivity towards OTA. PMID:26938491

  11. Ultra sensitive detection of Listeria monocytogenes in milk by the polymerase chain reaction (PCR).

    Science.gov (United States)

    Starbuck, M A; Hill, P J; Stewart, G S

    1992-12-01

    The polymerase chain reaction (PCR) has been used to detect Listeria monocytogenes in whole milk at a level of 0.1 cfu per 30 ml. This high degree of sensitivity has been achieved following enzymatic digestion, polysulphonone membrane filtration and amplification of a nucleotide sequence within the promoter region of hlyA. Key elements of the procedure are the absence of enrichment culture and a complete solubilization of the membrane filter, ensuring total nucleic acid recovery. The simplicity of the protocol coupled with high sample volumes and exquisite sensitivity extends the relevance of PCR within food and environmental microbiology. PMID:1368996

  12. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.

    OpenAIRE

    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W

    1992-01-01

    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  13. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

    OpenAIRE

    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

    1991-01-01

    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions ...

  14. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  15. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

    OpenAIRE

    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

    1993-01-01

    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  16. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou

    2008-01-01

    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  17. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Directory of Open Access Journals (Sweden)

    Mohammad Soleimani

    2010-01-01

    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  18. RAPID DETECTION OF Salmonella IN SHRIMP BY POLYMERASE CHAIN REACTION [Deteksi Cepat Salmonella pada Udang dengan Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ulfah Amalia

    2014-06-01

    Full Text Available Shrimp is an important non-oil commodity for foreign trade in Indonesia. However, rejection of shrimp exports by the importing countries is still commonly encountered. In 2011, the USFDA recorded two cases of Salmonella spp. contamination in shrimp products from two shrimp processing companies in Indonesia. Analysis of Salmonella spp. in seafood is generally performed using a conventional method which takes at least 5 days. The objective of the study is to get a Salmonellae rapid detection method in shrimp by PCR. In this study, optimization of PCR protocol method to detect Salmonella invA gene was conducted using six different annealing temperatures (59, 59.5, 60.8, 62, 64 and 64.5°C. The results showed that 64°C was the optimum annealing temperature to detect the 284 bp fragment of Salmonella invA gene. The PCR based detection method has a DNA detection limit of 27.81ug/mL and 10°CFU/mL of viable salmonellae with 100% specificity. The PCR protocol is capable of detecting six different Salmonella serovars (S. Enteritidis, S. Hadar, S. Heidelberg, S. Kentucky, S. Paratyphi and S. Typhimurium but none of the non salmonellae isolates. Application of the PCR assay on Salmonella in shrimp after the selective enrichment step suggested that all 16 samples were positive for Salmonella. At the same time, the conventional method could only detected 3 samples for Salmonella positive.

  19. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  20. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2007-01-23

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  1. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    International Nuclear Information System (INIS)

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

  2. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang

    2006-01-01

    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  3. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  4. Detection of hepatopancreatic parvovirus (HPV) in wild shrimp from India by nested polymerase chain reaction (PCR).

    Science.gov (United States)

    Manjanaik, B; Umesha, K R; Karunasagar, Indrani; Karunasagar, Iddya

    2005-02-28

    The prevalence of hepatopancreatic parvovirus (HPV) in wild penaeid shrimp samples from India was studied by nested polymerase chain reaction (PCR) using primers designed in our laboratory. The virus could be detected in 9 out of 119 samples by non-nested PCR. However, by nested PCR 69 out of 119 samples were positive. The PCR results were confirmed by hybridization with digoxigenin-labelled DNA probe. Shrimp species positive by non-nested PCR included Penaeus monodon, Penaeus indicus and Penaeus semisulcatus and by nested PCR Parapenaeopsis stylifera, Penaeus japonicus, Metapenaeus monoceros, M. affinis, M. elegans, M. dobsoni, M. ensis and Solenocera choprai. This is the first report on the prevalence of HPV in captured wild shrimp from India. PMID:15819441

  5. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  6. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction.

    Science.gov (United States)

    Bell, D A

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  7. Leptospira spp detection by Polymerase Chain Reaction (PCR) in clinical samples of captive black-capped Capuchin monkey (Cebus apella)

    OpenAIRE

    Scarcelli Eliana; Piatti Rosa Maria; Fedullo José Daniel Luzes; Simon Faiçal; Cardoso Maristela Vasconcellos; Castro Vanessa; Miyashiro Simone; Genovez Margareth Élide

    2003-01-01

    Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR), in clinical samples from one captive black...

  8. Detection of bovine leukemia virus in cattle by the polymerase chain reaction.

    Science.gov (United States)

    Murtaugh, M P; Lin, G F; Haggard, D L; Weber, A F; Meiske, J C

    1991-06-01

    Bovine leukemia virus (BLV) is widely distributed in U.S. cattle herds. It infects B lymphocytes and causes neoplastic disease in 5-10% of infected animals. Direct economic losses are incurred as a result of death, reduced milk production and condemnation at slaughter. Thus the identification of cattle infected with BLV is of significant concern to the U.S. cattle industry. For this reason, polymerase chain reaction (PCR) amplification was used to examine seropositive and seronegative cattle for the presence of BLV DNA in peripheral blood mononuclear cells. Using an amplification protocol able to detect 1 viral genome in 100,000 cells, BLV was not detected in 7 seronegative cattle in an infected herd. BLV sequences were detected in 13 of 18 seropositive animals with various levels of infection as determined by in vitro lymphocyte culture and electron microscopy. An active infection was demonstrated in one animal, based on the presence of viral RNA. These findings indicate that PCR is a sensitive method for the detection of BLV in cattle and provides new information regarding the dynamics of the infection. PMID:1658030

  9. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays.

    Science.gov (United States)

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua

    2016-07-15

    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. PMID:26922047

  10. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  11. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  12. Chain Reaction Polymerization.

    Science.gov (United States)

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  13. Three sample preparation protocols for polymerase chain reaction based detection of Cryptosporidium parvum in environmental samples.

    Science.gov (United States)

    Kostrzynska, M; Sankey, M; Haack, E; Power, C; Aldom, J E; Chagla, A H; Unger, S; Palmateer, G; Lee, H; Trevors, J T; De Grandis, S A

    1999-02-01

    Cryptosporidium parvum is a protozoan parasite responsible for an increasing number of outbreaks of gastrointestinal illness worldwide. In this report, we describe development of sample preparation protocols for polymerase chain reaction (PCR)-based detection of C. parvum in fecal material and environmental water samples. Two of these methods were found adequate for isolation of Cryptosporidium DNA from filtered water pellet suspensions. The first involved several filtration steps, immunomagnetic separation and freeze-thaw cycles. The second method involved filtration, addition of EnviroAmp lysis reagent, freeze-thaw cycles and precipitation of the DNA with isopropanol. Using nested PCR, we detected 100 oocysts/ml of filtered water pellet suspension, with either of the above sample preparation procedures. Nested PCR increased sensitivity of the assay by two to three orders of magnitude as compared to the primary PCR. The detection limit for seeded fecal samples was 10-fold higher than for filtered environmental water pellet suspension. Nested PCR results showed 62.4 and 91.1% correlation with immunofluorescence assay (IFA) for fecal samples and filtered environmental water pellet suspensions, respectively. This correlation decreased to 47.2% and 44.4%, respectively, when only IFA positive samples were analyzed. However, in fecal samples contaminated with a high number (> 10(5)/g) of C. parvum oocysts, this correlation was 100%. PMID:10076632

  14. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Science.gov (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  15. Polymerase chain reaction for detection of herpesvirus simiae (B virus) in clinical specimens.

    Science.gov (United States)

    Slomka, M J; Brown, D W; Clewley, J P; Bennett, A M; Harrington, L; Kelly, D C

    1993-01-01

    A polymerase chain reaction (PCR) was designed which is specific to Macaca fascicularis (cynomolgus monkey) isolates of B virus. The PCR primers produced the expected 188 basepair product from the Cyno 2 strain and seven other cynomolgus monkey isolates of B virus. Oligomer hybridization with a 31-mer oligonucleotide was used to confirm the origin of this product. The PCR failed to amplify DNA of Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, and other alphaherpesviruses (herpes simplex virus types 1 and 2, four SA 8 isolates and three rhesus isolates of B virus). PCR testing of swabs obtained from four orally-infected cynomolgus monkeys confirmed the presence of B virus DNA in samples previously shown to be positive by culture. In addition, PCR detected B virus in several swabs from infected monkeys that were culture negative. Total DNA extracts from the trigeminal and sacral ganglia of these animals were tested by nested PCR and B virus DNA was detected in the trigeminal ganglia of 3 of the 4 orally-infected cynomolgus monkeys. Nested PCR did not detect B virus DNA in total DNA extracts obtained from the brains of the four monkeys. PMID:8392323

  16. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying

    2007-01-01

    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  17. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    Science.gov (United States)

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  18. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura

    2016-06-01

    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  19. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Directory of Open Access Journals (Sweden)

    Parvin Hassanzadeh

    2012-03-01

    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  20. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini

    2013-12-01

    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  1. Detection of Toxoplasma gondii in venous blood from AIDS patients by polymerase chain reaction.

    Science.gov (United States)

    Dupouy-Camet, J; de Souza, S L; Maslo, C; Paugam, A; Saimot, A G; Benarous, R; Tourte-Schaefer, C; Derouin, F

    1993-01-01

    Detection of Toxoplasma gondii in blood by means of the polymerase chain reaction (PCR) may facilitate the diagnosis and follow-up of cerebral toxoplasmosis in patients with AIDS. We evaluated this approach with seven patients with tissue culture-proven parasitemia, 14 patients with presumptive cerebral toxoplasmosis, and 17 healthy human immunodeficiency virus-positive controls. Each sample of blood was assayed on three different occasions by a PCR assay based on detection of the gene encoding the P30 surface protein. A positive PCR diagnosis required positivity in at least two of the three PCR tests. None of the controls had a positive PCR diagnosis, but six of the seven patients with parasitemia did. Cerebral toxoplasmosis was confirmed in 13 of the 14 patients with a presumptive diagnosis; diagnosis by PCR was positive before treatment for 9 of these 13 patients, whereas tissue culture was positive for only 1 patient. During treatment, blood samples were taken from 14 patients at regular intervals until day 12. PCR diagnosis became negative on ethidium-stained gels, but persistent signals were observed after hybridization, in some cases, for up to 12 days after initiation of therapy. PCR on venous blood could thus be a sensitive and noninvasive method for the diagnosis of cerebral and disseminated toxoplasmosis in AIDS patients and could be a potential tool for monitoring the effects of treatment. PMID:8349765

  2. Rapid diagnosis of enterovirus infection by magnetic bead extraction and polymerase chain reaction detection of enterovirus RNA in clinical specimens.

    OpenAIRE

    Muir, P; Nicholson, F; Jhetam, M; Neogi, S; Banatvala, J E

    1993-01-01

    We describe a rapid method for extraction and detection of enterovirus RNA in clinical samples. By using magnetic bead technology, enterovirus RNA was efficiently and rapidly extracted from cerebrospinal fluid, stool, saliva, blood, pericardial fluid, urine, and cryopreserved or formalin-fixed solid tissue. Enterovirus RNA was then detected by reverse transcription followed by polymerase chain reaction amplification with primers designed to allow detection of most enterovirus serotypes. For d...

  3. Detection of Listeria monocytogenes in salmon using the Probelia polymerase chain reaction system.

    Science.gov (United States)

    Wan, Jason; King, Kerryn; Forsyth, Santina; Coventry, M John

    2003-03-01

    A validation was conducted on the performance of a commercially available polymerase chain reaction (PCR) kit (Probelia) in comparison with International Organization for Standardization (ISO) method 11290-1 (adopted as an Australian New Zealand Standard Method, AS/NZS 1766.2.16.1:1998) for the detection of Listeria monocytogenes in salmon samples. The validation was conducted following the guidelines of an Australian New Zealand Standard (Guide to Determining the Equivalence of Food Microbiology Test Methods, Part 1, Qualitative Tests, AS/NZS 4659.1:1999), which adopts an approach similar to that recommended by the Association of Analytical Communities Microbiology Method Validation Program for Performance Tested and Peer Verified Methods. The validation study involved the use of five cultures of L. monocytogenes, each challenged at a single level of inoculation into five different types of salmon samples. A total of 60 salmon samples (30 unchallenged and 30 challenged) were tested using both the PCR method and the ISO method. Results from this study indicated that the Probelia PCR method is equivalent to the ISO method. In addition, the detection sensitivity of the Probelia PCR system was determined as approximately 0.5 CFU per PCR assay (equivalent to 20 CFU/ml broth culture) for a pure culture of L. monocytogenes. The Probelia PCR method offers the advantage of detecting L. monocytogenes to genetic specificity within 48 to 50 h, whereas the ISO method requires 5 days for negative results with additional days for confirmed positive results by the use of other biochemical and cultural tests. PMID:12636297

  4. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine

    Directory of Open Access Journals (Sweden)

    K.R. Caleffi

    2012-02-01

    Full Text Available Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT and dapsone, rifampicin and clofazimine for borderline (BB and lepromatous (LL forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73 of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306. In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386. PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033. Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  5. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    Science.gov (United States)

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  6. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction.

    Science.gov (United States)

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E

    1996-12-01

    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  7. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.; Schonenbrucher, H.; Cook, N.; Heuvelink, A.E.; Hoorfar, Jeffrey

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  8. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot hybrid...... where viral replication is absent, or where genomic copies are present at such low numbers that they are otherwise undetectable....

  9. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    Science.gov (United States)

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  10. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  11. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  12. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Jong Gyun Ahn

    2012-11-01

    Full Text Available <B>Purpose:</B> Methods for quick and reliable detection of <I>Streptococcus pneumoniae</I> are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving <I>S. pneumoniae -positive</i> results. <B>Methods:</B> Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. <B>Results:</B> Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. <B>Conclusion:</B> As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  13. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  14. Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Eustaquio T

    2012-11-01

    Full Text Available Trisha Eustaquio, James F LearyWeldon School of Biomedical Engineering, Purdue University, West Lafayette, IN, USABackground: Determination of the fate of nanoparticles (NPs in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR, coined “nanobarcoding,” is demonstrated.Methods: Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV.Results: Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs, while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas.Conclusion: Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further

  15. Direct method for detecting small quantities of hepatitis B virus DNA in serum and plasma using the polymerase chain reaction.

    OpenAIRE

    Zeldis, J B; Lee, J. H.; Mamish, D; Finegold, D J; Sircar, R; Q. Ling; Knudsen, P J; Kuramoto, I K; Mimms, L T

    1989-01-01

    Serum components inhibit DNA polymerase, thereby obviating direct detection of serum viral DNA sequences by the polymerase chain reaction (PCR). This has necessitated extraction of nucleic acid from sera before performing PCR and has resulted in loss of sensitivity. By adsorbing virus to a solid surface (microcentrifuge tubes or antibody coated microparticles) followed by proteinase K digestion, as little as three viruses per 200 microliters serum may be directly detected by PCR without nucle...

  16. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    OpenAIRE

    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

    2004-01-01

    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  17. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples.

    Science.gov (United States)

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal

    2008-07-01

    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  18. Detection of Mycoplasma pneumoniae by polymerase chain reaction and nonradioactive hybridization in microtiter plates.

    OpenAIRE

    Lüneberg, E; Jensen, J S; M. Frosch

    1993-01-01

    In order to improve the diagnosis of a Mycoplasma pneumoniae infection, we developed a polymerase chain reaction (PCR)-based assay. The gene encoding elongation factor Tu (tuf) was selected as the target sequence. Oligonucleotides derived from variable stretches of the tuf gene were able to prime the amplification of a 950-bp fragment exclusively when M. pneumoniae DNA was used as the template. The sensitivity of the assay was increased 10-fold when the amplification products were hybridized ...

  19. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  20. Preliminary evaluation of the ligase chain reaction for specific detection of Neisseria gonorrhoeae.

    OpenAIRE

    Birkenmeyer, L; Armstrong, A S

    1992-01-01

    Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the ...

  1. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff

    2000-01-01

    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  2. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.;

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The...... selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  3. Polymerase chain reaction

    OpenAIRE

    Gaurav Solanki

    2015-01-01

    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  4. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    OpenAIRE

    Parvin Hassanzadeh; Hosein Sharifi; Abdollah Bazargani; Reza Khashei; Amir Emami; Mohammad Motamedifar

    2012-01-01

    Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain r...

  5. Direct detection of Mycobacterium tuberculosis in sputum by polymerase chain reaction and DNA hybridization.

    OpenAIRE

    Nolte, F S; Metchock, B; McGowan, J. E.; Edwards, A; Okwumabua, O; Thurmond, C; Mitchell, P S; Plikaytis, B; Shinnick, T

    1993-01-01

    A polymerase chain reaction (PCR) assay for the rapid diagnosis of pulmonary tuberculosis was developed by using oligonucleotide primers to amplify a fragment of IS6110, an insertion sequence repeated multiple times in the chromosome of Mycobacterium tuberculosis. Sediment obtained from sputa processed by the N-acetyl-L-cysteine-NaOH method was suspended in a simple lysis buffer and was heated at 100 degrees C for 30 min prior to amplification. A dUTP-uracil N-glycosylase PCR protocol was use...

  6. Use of the Polymerase Chain Reaction in the Detection of Bovine Leukosis

    OpenAIRE

    Kelly, Emma Jane

    1992-01-01

    A diagnostic test for bovine leukosis was developed using the polymerase chain reaction (PCR) to amplify a 375 base pair region in the gag gene of the proviral genome. Blood samples were collected from 3 adult Holstein cows shown to be infected with bovine leukosis virus (BLV) by the agar-gel immunodiffusion (AGID) technique. The 3 samples were mixed and the composite blood was used to inoculate 10 cows. Five of the cows were inoculated with 0.1 ml of blood, and the other cows were inocula...

  7. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    OpenAIRE

    T. M. Nabeel Muhammad; Sreedevi, B.

    2015-01-01

    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasa...

  8. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    OpenAIRE

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have d...

  9. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    OpenAIRE

    Krøjgaard Louise H; Krogfelt Karen A; Albrechtsen Hans-Jørgen; Uldum Søren A

    2011-01-01

    Abstract Background Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the useful...

  10. Rapid Detection/pathotyping of Newcastle disease virus isolates in clinical samples using real time polymerase chain reaction assay

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Abdul Wajid, Muhammad Wasim, Tahir Yaqub, Shafqat F Rehmani, Tasra Bibi, Nadia Mukhtar, Javed Muhammad, Umar Bacha, Suliman Qadir Afridi, Muhammad Nauman Zahid, Zia u ddin, Muhammad Zubair Shabbir, Kamran Abbas & Muneer Ahmad ### Abstract In the present protocol we describe the real time reverse transcription polymerase chain reaction (rRT-PCR) assay for the rapid detection/pathotyping of Newcastle disease virus (NDV) isoaltes in clinical samples. Fusion gene and matrix ...

  11. A novel polymerase chain reaction method for detection of human immunodeficiency virus in dried blood spots on filter paper.

    OpenAIRE

    Yourno, J; Conroy, J.

    1992-01-01

    A method for detection of proviral human immunodeficiency virus DNA in dried blood spots on filter paper by direct polymerase chain reaction (PCR) has been developed. To develop the method, a standard system was used which was prepared from cells each containing a single integrated provirus and titrated with normal donor blood. This rapid procedure provides virtually quantitative yields of nuclear DNA and exploits most of the standard methodology described for blood specimens. A nested PCR us...

  12. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.

    OpenAIRE

    Lunkenheimer, K; Hufert, F. T.; Schmitz, H.

    1990-01-01

    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specim...

  13. Detection of Adenoviruses from clinical samples in bone marrow transplant patients by nested PCR (polymerase chain reaction)

    OpenAIRE

    Fatemeh Sabagh; Michael Roggendorf

    2012-01-01

    Adenoviruses are recognized as common human pathogens that are responsible for a wide variety of infectious syndromes. Bone marrow transplant patients are prone to life threatening opportunistic infections like adenoviruses. The nested polymerase chain reaction has provided an alternative, sensitive diagnostic method for detection of Adenoviruses. In this study we developed PCR from hexon genes as rapid diagnostic method of Advs infections on different clinical samples. Adenovirus infections ...

  14. Pilot Study of COBAS PCR and Ligase Chain Reaction for Detection of Rectal Infections Due to Chlamydia trachomatis

    OpenAIRE

    Matthew R Golden; Astete, Sabina G.; Galvan, Rosa; Lucchetti, Aldo; Sanchez, Jorge; Celum, Connie L.; Whittington, William L. H.; Stamm, Walter E.; Holmes, King K.; Totten, Patricia A.

    2003-01-01

    We tested rectal specimens from men who have sex with men for Chlamydia trachomatis by using COBAS PCR (Roche Diagnostics) and ligase chain reaction LCR (Abbott laboratories) and compared three PCR specimen-processing procedures. Chlamydiae were detected by one or more procedures in 22 of 186 specimens. All three PCR tests were positive for 17 specimens, all of which also tested positive by LCR.

  15. Use of the Polymerase Chain Reaction to Detect Helicobacter pylori in the Dental Plaque of Healthy and Symptomatic Individuals

    OpenAIRE

    Banatvala, N.; Lopez, C. Romero; Owen, R J; Hurtado, A; Abdi, Y; Davies, G. R.; Hardie, J. M.; Feldman, R A

    2011-01-01

    A polymerase chain reaction (PCR) assay, based on the amplification of a species specific ureA (urease) gene internal sequence, was used to detect Helicobacter pylori. Total DNA extracts were obtained from dental plaque in patients attending an endoscopy clinic and from apparently healthy schoolchildren of Bangladeshi origin. Of the 54 samples of dental plaque from endoscopy patients examined, 39 were positive (72 per cent). There was 63 per cent correlation (34/54) between H. pylori in the s...

  16. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    Science.gov (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  17. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction.

    Science.gov (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-01-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  18. Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Gaurav Solanki

    2012-10-01

    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  19. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-04-01

    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  20. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  1. Evaluation of polymerase chain reaction for the detection of Paracoccidioides brasiliensis DNA on serum samples from patients with paracoccidioidomycosis

    Directory of Open Access Journals (Sweden)

    Cecília Eugenia Charbel

    2006-03-01

    Full Text Available The aim of this study was to demonstrate the DNA of Paracoccidioides brasiliensis in human serum samples of patients with paracoccidioidomycosis using the polymerase chain reaction (PCR. The diagnosis of paracoccidioidomycosis (PCM was defined by microscopic observation of the fungus on direct exam or histopathology, culture, and serological positivity. DNA from serum of 33 patients with PCM was extracted and submitted to nested-PCR using primers from the gp 43 gene. Only one sample was positive on nested-PCR. We conclude that the prevalence of fungemia in patients with different clinical forms of PCM is low, limiting the use of serum DNA detection as an alternative diagnostic tool.

  2. Detection of Sphingomonas paucimobilis Infections in Domestic Animals by VITEK ® Compaq 2 and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    S Cengiz

    2015-01-01

    Full Text Available This case report presents the first cases of Sphingomonas paucimobilis in Turkey, which was isolated and identified from two cows, a calf and a lamb by conventional methods, VITEK Compaq® 2 system and Polymerase Chain Reaction (PCR. Compatible findings were reached among clinical history, necropsy findings and bacteriologic results. In conclusion, S. paucimobilis should be considered as a causative agent particularly for respiratory diseases, septicemia and foot infections with resistance to antibiotic treatment. Also, detection methods must be arranged not only for common pathogens but also for S. paucimobilis.

  3. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda

    2014-12-01

    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  4. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction.

    Science.gov (United States)

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su

    2012-01-01

    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time. PMID:22079620

  5. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki [System Instruments Co., Ltd., 776-2 Komiya-cho, Hachioji, Tokyo 192-0031 (Japan); Noda, Mamoru; Igimi, Shizunobu [Division of Biomedical Food Research, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ikebukuro, Kazunori, E-mail: ikebu@cc.tuat.ac.jp [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan)

    2013-11-01

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10{sup 6} copies.

  6. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 106 copies

  7. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.;

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  8. Leptospira spp detection by Polymerase Chain Reaction (PCR in clinical samples of captive black-capped Capuchin monkey (Cebus apella

    Directory of Open Access Journals (Sweden)

    Scarcelli Eliana

    2003-01-01

    Full Text Available Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR, in clinical samples from one captive black-capped Capuchin monkey (Cebus apella, which presented characteristics compatible with leptospirosis (jaundice and haemorrhagic kdney in the macroscopic post-mortem examination. A friable kidney fragment and urine sample were cultured and submitted to experimental inoculation in guinea pigs and PCR using genus specific primer pair targeting the 16S rRNA region from Leptospira interrogans serovar canicola. Isolation of the agent was negative both in culture and experimental inoculation. The PCR amplification of the clinical samples showed a 330 pb amplified fragment that corresponds to the Leptospira genus. Based on these results PCR was considered an important tool for leptospira detection in nonhumam primates, more sensitive and specific than other techniques, especially considering that the viability of the pathogen was not possible. These advantages enable the detection of the leptospiras in urine and kidney, even when autolysed, frozen or badly conserved, which prevented the isolation and experimental inoculation from positive results.

  9. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis.

    Science.gov (United States)

    Chase, Dorothy M; Elliott, Diane G; Pascho, Ronald J

    2006-07-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids. PMID:16921877

  10. Molecular detection of the carriage rate of four intestinal protozoa with real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L;

    2015-01-01

    -Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...... intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells...... (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage...

  11. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen; Uldum, Søren A.

    2011-01-01

    samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the......Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

  12. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    Science.gov (United States)

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  13. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  14. Differential detection of turkey coronavirus, infectious bronchitis virus, and bovine coronavirus by a multiplex polymerase chain reaction.

    Science.gov (United States)

    Loa, C C; Lin, T L; Wu, C C; Bryan, T A; Hooper, T A; Schrader, D L

    2006-01-01

    The objective of the present study was to develop a multiplex polymerase chain reaction (PCR) method for differential detection of turkey coronavirus (TCoV), infectious bronchitis coronavirus (IBV), and bovine coronavirus (BCoV). Primers were designed from conserved or variable regions of nucleocapsid (N) or spike (S) protein gene among TCoV, IBV, and BCoV and used in the same PCR reaction. Reverse transcription followed by the PCR reaction was used to amplify a portion of N or S gene of the corresponding coronaviruses. The PCR products were detected on agarose gel stained with ethidium bromide. Two PCR products, a 356-bp band corresponding to N gene and a 727-bp band corresponding to S gene, were obtained for TCoV isolates. In contrast, one PCR product of 356 bp corresponding to a fragment of N gene was obtained for IBV strains and one PCR product of 568 bp corresponding to a fragment of S gene was obtained for BCoV. There were no PCR products with the same primers for Newcastle disease virus, Marek's disease virus, turkey pox virus, pigeon pox virus, fowl pox virus, reovirus, infectious bursal disease virus, enterovirus, astrovirus, Salmonella enterica, Escherichia coli, and Mycoplasma gallisepticum. Performance of the assay with serially diluted RNA demonstrated that the multiplex PCR could detect 4.8x10(-3) microg of TCoV RNA, 4.6x10(-4) microg of IBV RNA, and 8.0x10(-2) microg of BCoV RNA. These results indicated that the multiplex PCR as established in the present study is a rapid, sensitive, and specific method for differential detection of TCoV, IBV, and BCoV in a single PCR reaction. PMID:16137773

  15. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  16. Efficacy of a commercial polymerase chain reaction-based assay for detection of Salmonella spp. in animal feeds.

    Science.gov (United States)

    Maciorowski, K G; Pillai, S D; Ricke, S C

    2000-10-01

    Salmonellosis is a cyclic problem in the food industry, to which animal feed has been contributory. Current conventional methods of Salmonella spp. detection require 96 h for detection and confirmation. With modern and just-in-time production schedules, a 96-h hold represents a significant expense in storage and decontamination. The commercially available assay, 'BAX for Screening/Salmonella' (BAX), is based on the principle of the polymerase chain reaction and may represent a significant decrease in assay time. Seven fresh feed formulations, two fresh feed ingredients, seven stored feeds and two stored feed ingredients were artificially contaminated with a primary poultry isolate of Salmonella typhimurium and analysed by conventional and BAX methodology. The results of BAX agreed with conventional plating results for 16 of 18 samples spiked with 1200 cfu 10 g(-1) of feed and 13 of 18 samples spiked with 40 cfu 10 g(-1) of feed. Indigenous Salmonella spp. were detected in five of eight samples of poultry diets by conventional methods. With BAX, Salmonella spp. could not be detected in any of the samples after only 7 h of enrichment but could be detected in two dietary samples after 13 h of enrichment and four dietary samples after 24 h of enrichment. Specific sequences of salmonella DNA that were extracted from poultry diets could be detected with BAX. PMID:11054177

  17. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    Directory of Open Access Journals (Sweden)

    Ji Yeon Kwon

    2013-09-01

    Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

  18. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction

    Science.gov (United States)

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.

    2016-01-01

    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  19. Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre;

    2013-01-01

    Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

  20. Development and application of reverse transcriptase nested polymerase chain reaction test for the detection of exogenous avian leukosis virus.

    Science.gov (United States)

    García, Maricarmen; El-Attrache, John; Riblet, Sylva M; Lunge, Vagner R; Fonseca, André S K; Villegas, Pedro; Ikuta, Nilo

    2003-01-01

    A polymerase chain reaction (PCR) assay that utilizes nested primers to amplify a fragment of the long terminal repeat of exogenous avian leukosis virus (ALV) was developed and evaluated for detection of ALV subgroup J directly from clinical samples. Compilation of sequence data from different endogenous and exogenous ALVs allowed the selection of a conserved set of nested primers specific for the amplification of exogenous ALV subgroups A, B, C, D, and J and excluded amplification of endogenous viruses or endogenous viral sequences within the chicken genome. The nested primers were successfully used in both PCR and reverse transcriptase (RT)-PCR assays to detect genetically diverse ALV-J field isolates. Detection limits of ALV-J isolate ADOL-Hc1 DNA by nested PCR and RNA by RT-nested PCR were superior to detection of group-specific antigen by enzyme-linked immunosorbent assay (ELISA) in cell culture. Detection of ALV-J in cloacal swabs by RT-nested PCR was compared with direct detection by antigen-capture (ac)-ELISA; RT-nested PCR detected fewer positive samples than ac-ELISA, suggesting that RT-nested PCR excluded detection of endogenous virus in clinical samples. Detection of ALV-J in plasma samples by RT-nested PCR was compared with virus isolation in C/E chicken embryo fibroblasts; the level of agreement between both assays as applied to plasma samples ranged from low to moderate. The main disagreement between both assays was observed for a group of plasma samples found positive by RT-nested PCR and negative by virus isolation, suggesting that RT-nested PCR detected ALV-J genome in plasma samples of transiently or intermittently infected birds. ALV-J transient and intermittent infection profiles are characterized by inconsistent virus isolation responses throughout the life of a naturally infected flock. PMID:12713157

  1. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    Science.gov (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. PMID:26879193

  2. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    Science.gov (United States)

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. PMID:27072123

  3. DETECTION OF BORRELIA BURGDOFERI DNA IN GRANULOMATOUS TISSUES FROM PATIENTSWITH SARCOIDOSIS USING POLYMERASE CHAIN REACTION IN SITU TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    徐作军; 马东来; 罗慰慈; 朱元珏

    1996-01-01

    To investigate the correlation between sarcoidosis and Borrelia burgdorferi (Bb) infection,flagella DNA of Bb were detected in 23 granulomatous tissue specimens from patients with confirmed sarcoidosis usingpolymerase chain reaction in situ technique (in situ PCR) and the antibodies to Bb were examined in 55 serum samples obtained from the patients by indirect immunoflurescence assays. Our data presented that =(1) None of granulomatous tissues was found to have Bb DNA in 23 tissue samples. (2) Thirty of 55(54.6%) patients with sarcoidosis were found antibodies to Bh positive,in contrast,six of 60 (10%) norreal subjects had antibodies against Bb,the positive rate was remarkably higher in patient group than thatin healthy group (P(0. 005). The results suggest that Bb might not be the causative agent of sarcoidosis,the elevated titres of serum antibodies against Bb in patients with sarcoidosis is a nonspecific response.

  4. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.

    Science.gov (United States)

    Lunkenheimer, K; Hufert, F T; Schmitz, H

    1990-01-01

    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specimens of patients with acute Lassa fever, viral RNA could be demonstrated. Negative results were obtained with all serum and urine specimens of healthy subjects. Our data suggest that PCR may be applied as an alternative to virus isolation in the rapid diagnosis of Lassa fever. Images PMID:2279999

  5. Development of a multiplex polymerase chain reaction to detect five common Gram-negative bacteria of aquatic animals.

    Science.gov (United States)

    Tsai, M-A; Ho, P-Y; Wang, P-C; E, Y-J; Liaw, L-L; Chen, S-C

    2012-07-01

    A multiplex polymerase chain reaction (m-PCR) technique was developed as a rapid and accurate diagnostic tool for identifying five major Gram-negative bacilli -Vibrio vulnificus, V. parahaemolyticus, Aeromonas hydrophila, Chryseobacterium meningosepticum and Edwardsiella tarda- that cause major diseases in cultured aquatic animals in Taiwan. The expected amplicons for V. vulnificus, V. parahaemolyticus, A. hydrophila, C. meningosepticum and E. tarda were 410, 368, 685, 180 and 230bp, respectively. The assay was shown to be specific for the target pathogens. The sensitivities of detection were estimated to be 20.5fg∼200pg of genomic DNA or 10(2) ∼10(4) colony-forming units (cfu) of bacterial isolates when adopted as PCR templates. The m-PCR was capable of simultaneously amplifying target fragments from bacterial genome DNA mixed with the DNA extracted from viscera and tissues taken from fish without affecting the performance of the method. PMID:22571515

  6. Detection of Nesopora caninum-specific DNA from cerebrospinal fluid by polymerase chain reaction in a dog with confirmed neosporosis.

    Science.gov (United States)

    Ishigaki, Kyohei; Noya, Masahiko; Kagawa, Yumiko; Ike, Kazunori; Orima, Hiromitsu; Imai, Soichi

    2012-08-01

    A one-month male Greyhound dog presented with a swinging gait of the hindlimbs, and later developed muscular atrophy of the femoral region and hyperextension of hindlimbs. The dog had positive serum IFAT titers to Neospora caninum, but a negative titer in the cerebrospinal fluid (CSF). N. caninum-specific DNA was amplified from the CSF using a semi-nested polymerase chain reaction assay. Clusters of protozoa in biopsied muscle fibers were subsequently confirmed as N. caninum tachyzoites by immunohistochemical examination. Early recognition and treatment are necessary for effective recovery of clinical canine neosporosis, but antemortem diagnosis is difficult. We suggest that the detection of parasite deoxyribonucleic acid in the CSF is a useful antemortem diagnostic method in facilitating treatment of this disease. PMID:22446406

  7. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. PMID:23541117

  8. Early detection of Toxoplasma gondii by real-time polymerase chain reaction methods in patients with recurrent spontaneous abortions

    Directory of Open Access Journals (Sweden)

    Parviz Saleh

    2014-11-01

    Full Text Available Introduction: One of the causes of recurrent spontaneous abortions (RSA is an infection by the toxoplasmosis Protozoa. In comparison, we present detailed results using real-time polymerase chain reaction (PCR methods of detection. In this study, it was tried to detect Toxoplasma gondii (T. gondii by real-time PCR methods in patients with RSA. Methods: Amniotic fluid sampling was performed in the 16-20th weeks of gestation in 50 pregnant women with a history of RSA. The extracted deoxyribonucleic acid (DNA samples were analyzed using quantitative real-time PCR. Results: In all the cases, the detection of T. gondii was negative in the peripheral blood, and amniotic fluid samples by using the molecular methods (real-time PCR. Using the serological detection methods, 6% of patients were diagnosed as positive for the immunoglobulin M (IgM antibody. In addition, the IgG antibody was positive in 46% of the patients. Conclusion: It can be concluded that the serological methods lack specificity.

  9. Detection of Aeromonas salmonicida by reverse transcription-multiplex polymerase chain reaction.

    Science.gov (United States)

    Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

    2012-01-01

    Aeromonas salmonicida is one of the major fish pathogens causing economically devastating losses in aquaculture. A. salmonicida subsp. salmonicida is a typical A. salmonicida causing furunculosis, while the other subspecies are atypical strains causing ulcer diseases. PCR-based methods of detecting A. salmonicida suffer from the drawback that they do not distinguish living (pathogenic) from dead cells. In this study, a method of detecting A. salmonicida was developed based on reverse transcription-multiplex PCR (RT-MPCR) using two sets of primers, SV1/SV2 and SF1/SF2, specific to the vapA gene and the fstB gene of A. salmonicida respectively. This method was found to detect A. salmonicida specifically with detection limits of 10 CFU in pure culture and 30 CFU in the presence of tissue debris. It was also found distinguish not only between viable and nonviable cells but also between typical and atypical strains of A. salmonicida. Using RT-MPCR, two DNA fragments, of 542 and 1,258 bp, were amplified from RNA of typical A. salmonicida, whereas only one DNA fragment, of 542 bp, was amplified from the RNA of the atypical ones. The proposed assay was also used successfully to detect A. salmonicida in artificially infected rainbow trout (Oncorhyncus mykiss). PMID:22484927

  10. DETECTION OF BREAST CANCER MICROMETASTASES IN BONE MARROW USING REVERSE-TRANSCRIPTASE CHAIN REACTION AND SOUTHERN HYBRIDIZATION

    Institute of Scientific and Technical Information of China (English)

    LI Jin-feng; ZHANG Lei; SUN Su-lian

    1999-01-01

    Objective: The aim of this study was to detect micrometastases in bone marrow of primary breast cancer patients, and compare with other clinical parameters.Methods: Cytokeratin 19 (CK-19) gene mRNA expression was detected by reverse transcriptase-polymerase chain reaction (RT-PCR) and Southern blot hybridization.Human breast cancer cell line T47D was mixed with bone marrow cells in different proportions. The positive detection rate was compared among RT-PCR, Southern blotting and immunohistochemistry (IHC) methods. Results: Cytokeratin 19 gene was expressed in all 6 positive control samples while the expression was not seen in 8 negative control samples. In all 54 patients 14 cases were CK-19 positive (25.9%) by RT-PCR, another positive signal was obtained in 5/54 (9.3%) of bone marrow samples by Southern blotting. The total positive cases are 19/54 (35.2%).CK-19 IHC+ cells were detected at a dilution of one T47D cell in 5×104 bone marrow cells, while the sensitivity detected by PCR and Southern blot hybridization was at 1:5×105 and 1:1×106, respectively. This demonstrates that RT-PCR and Southern blotting was at least 20 times more sensitive than the IHC method. The micrometastases positive rate of the larger tumor size group (>5.0 cm) was significantly (P<0.05) greater than that of the smaller tumor size group (0-2.0 cm). Conclusion: detection of micrometastases in bone marrow by RT-PCR and Southern blotting, using CK-19 as a biological marker, is highly sensitive and it is a method to be used for anticipating the prognosis of breast cancer patients.

  11. Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus.

    Science.gov (United States)

    Mahmoudian, Alireza; Kirkpatrick, Naomi C; Coppo, Mauricio; Lee, Sang-Won; Devlin, Joanne M; Markham, Philip F; Browning, Glenn F; Noormohammadi, Amir H

    2011-06-01

    Infectious laryngotracheitis is an acute viral respiratory disease of chickens with a worldwide distribution. Sensitive detection of the causative herpesvirus is particularly important because it can persist in the host at a very low copy number and be transmitted to other birds. Quantification of viral genome copy number is also useful for clinical investigations and experimental studies. In the study presented here, a quantitative polymerase chain reaction (qPCR) assay was developed using SYBR Green chemistry and the viral gene UL15a to detect and quantify infectious laryngotracheitis virus (ILTV) in ILTV-inoculated chicken embryos or naturally infected birds. The specificity of the assay was confirmed using a panel of viral and bacterial pathogens of poultry. The sensitivity of the assay was compared with two conventional PCR assays, virus titration and an antigen-detecting enzyme-linked immunosorbent assay. The qPCR developed in this study was highly sensitive and specific, and has potential for quantification of ILTV in tissues from naturally and experimentally infected birds and embryos. PMID:21711182

  12. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction.

    Science.gov (United States)

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga

    2015-09-01

    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  13. Polymerase Chain Reaction Detection of C. pseudotuberculosis in the Brain of Mice Following Oral Inoculation

    Directory of Open Access Journals (Sweden)

    Faez Firdaus Jesse

    2013-02-01

    Full Text Available The aim of present study was to detect the presence of C. pseudotuberculosis in the brain of the mice following oral inoculation as a model using PCR. Caseous lymphadenitis is a chronic and subclinical disease of sheep and goats which has universal distributions, presenting enormous animal and flock prevalence. Total of 16 mice were used for this study, 8 mice were inoculated orally with 1.0 mL sterile phosphate buffered saline pH 7, while another 8 mice were inoculated with 1.0 mL of 109 colony forming unit of C. pseudotuberculosis. Seven different organs were collected during post mortem for the detection ofC. pseudotuberculosis The result indicated 3 positive samples in lymph nodes, 5 in the brain and 1 in the liver. The PCR used in the present study may successfully be applied for the detection and diagnosis of C. pseudotuberculosis in the brain of the mice following oral inoculation.

  14. Opisthorchis viverrini: Detection by polymerase chain reaction (PCR) in human stool samples

    Digital Repository Service at National Institute of Oceanography (India)

    Umesha, K.R.; SanathKumar; Parvathi, A.; Duenngai, K.; Sithithaworn, P.; Karunasagar, Indrani; Karunasagar, Iddya

    /ml ethidium bromide and the gel was analyzed using the Gel doc System (Herolab, Germany). 2.3. Determination of sensitivity of detection in stool specimens artificially spiked with O. viverrini eggs To determine the sensitivity of primers for detection... of different numbers of O. viverrini eggs in human stool, 1 g of a PCR negative stool specimen was artificially spiked with different numbers (1, 5, 10, 50, 100, 250 and 500) of O. viverrini eggs. The total DNA was extracted by CTAB method as described...

  15. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  16. Detection of Salmonella enterica serovar Dublin by polymerase chain reaction in multiplex format.

    Science.gov (United States)

    Zhai, Ligong; Kong, Xiaohan; Lu, Zhaoxin; Lv, Fengxia; Zhang, Chong; Bie, Xiaomei

    2014-05-01

    S. Dublin has caused widespread concerns in cattle produce. Using a comparative genomic method, two specific targets like SeD_A1118 and SeD_A2283 for S. Dublin identification were firstly obtained. An efficient multiplex PCR for S. Dublin detection based on the two novel specific genes and invA was therefore developed. PMID:24607499

  17. A polymerase chain reaction (PCR) system to detect Babesia equi in blood of Italian horses

    International Nuclear Information System (INIS)

    The aim was to develop a new and more sensitive diagnostic alternative to detect Babesia equi infection in horses. A PCR system, which amplified a 664bp region of the 16S-like rRNA coding region, was designed and validated by comparing its diagnostic performance with those of the complement fixation test (CFT) and the microscopic examination

  18. DETECTION OF HUMAN PAPILLOMAVIRUS DNA SEQUENCES IN ORAL LESIONS USING POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    M. R. Zarei

    2007-07-01

    Full Text Available "nThe purpose of the present study was to estimate the frequency of HPV DNA in four groups of oral lesions, including oral squamous cell carcinoma. Sixty paraffin-embedded oral tissue samples were examined for the presence of HPV DNAs using the PCR technique. These specimens were obtained from patients with oral squamous cell carcinoma (OSCC, leukoplakia, oral lichen planus (OLP, and pyogenic granuloma (PG. Consensus primers for L1 region (MY09 and MY11 and specific primers were used for detection of HPV DNA sequences in this study. we detected HPV DNA in 60% (9 out of 15 of OSCCs, 26.7% (4 out of 15 of leukoplakia, 13.3% (2 out of 15 of OLPs, and 6.7% (1 out of 15 of PGs. Statistical analysis showed that the prevalence of HPV in OSCC was significantly higher than other groups (P < 0.05. The frequency of HPV-16 and 18 detection in OSCC samples were 40% and 20%, respectively. The prevalence of these high risk HPVs was significantly higher in OSCC group (P < 0.05. The results of the present study show a successive increase of detection rate of HPV-16 and 18 DNAs from low level in samples of pyogenic granuloma and non-premalignant or questionably premalignant lesions of OLP to premalignant leukoplakia and to OSCC."n "n "n "n "n 

  19. Polymerase chain reaction assay for the detection of Bacillus cereus group cells

    DEFF Research Database (Denmark)

    Hansen, Bjarne Munk; Leser, Thomas D.; Hendriksen, Niels Bohse

    2001-01-01

    Recent investigations have shown that members of the Bacillus cereus group carry genes which have the potential to cause gastrointestinal and somatic diseases. Although most cases of diseases caused by the B. cereus group bacteria are relatively mild, it is desirable to be able to detect members of...... the B. cereus group in food and in the environment. Using 16S rDNA as target, a PCR assay for the detection of B. cereus group cells has been developed. Primers specific for the 16S rDNA of the B. cereus group bacteria were selected and used in combination with consensus primers for 165 rDNA as...... internal PCR procedure control. The PCR procedure was optimized with respect to annealing temperature. When DNA from the B. cereus group bacteria was present, the PCR assay yielded a B. cereus specific fragment, while when non-B. cereus prokaryotic DNA was present, the consensus 165 rDNA primers directed...

  20. Polymerase chain reaction detection of adenovirus DNA sequences in human lymphocytes

    Directory of Open Access Journals (Sweden)

    Araújo Aufra A.

    2001-01-01

    Full Text Available Human lymphoid cells frequently carry adenoviruses and DNA sequences have been identified in peripheral blood lymphocytes by Southern blot and PCR, although these cells are not permissive for virus replication, suggesting persistence of the viral genome. In order to investigate this phenomenon we screened non-symptomatic volunteers for adenovirus DNA presence and E1A gene expression. DNA samples extracted from peripheral blood mononuclear cells of 51 volunteers were submitted to PCR using primers for a conserved hexon sequence, followed by nested PCR. Adenovirus sequences were detected in 27 samples (52.9%. After more than one year, new samples of these positive volunteers were analyzed and in 70.8% of the cases the result was maintained. Since this could be due to a possible persistence we checked if the early gene E1A was involved analyzing its expression by RT-PCR. For that purpose we developed a pair of primers to target a conserved region in the E1A gene. The RT-PCR results for E1A were negative for all samples. Using these primers it was possible to detect adenovirus sequences directly by PCR in DNA samples and we found 84% agreement in comparison to the hexon analysis. Our data suggest a high occurrence and persistence of adenovirus genome sequences in human lymphoid cells, and an indication that a region other than E1A is involved in persistence. We also can say that E1A gene is a good choice for amplification as a tool in adenovirus detection, avoiding the high risk of contamination in the nested PCR procedure necessary for hexon detection.

  1. Supply chain reaction

    International Nuclear Information System (INIS)

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  2. Simultaneous detection of pyrethroid, organophosphate, and cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex polymerase chain reaction.

    Science.gov (United States)

    Domingues, Luísa N; Guerrero, Felix D; Foil, Lane D

    2014-09-01

    The horn fly, Haematobia irritans irritans (L., 1758) (Diptera: Muscidae), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex polymerase chain reaction (PCR) assay to simultaneously detect target site resistance to pyrethroids (kdr mutation), organophosphates (G262A acetylcholinesterase mutation), and cyclodienes (Rdl mutation) and used the new procedure to follow the progression of these three mutations after exposure to different insecticide pressure. We assayed flies collected at the Macon Ridge research station, Winnsboro, LA, from 2008 to 2012. The multiplex PCR showed robust results in all our assays. The kdr mutation remained at high frequencies during all years, even after 4 yr with no use of pyrethroids. The G262A acetylcholinesterase mutation fluctuated from 7.5 to 23.8% during the studied years, while the Rdl mutation was rare in 2008, 2009, and June 2010, and then significantly increased after the first use of endosulfan. The possibility of screening for all the known target site resistance mutations in a single PCR reaction makes the multiplex PCR a useful and affordable tool that can be used to help diagnose insecticide resistance. PMID:25276924

  3. Avian haemosporidian parasites (Haemosporida): A comparative analysis of different polymerase chain reaction assays in detection of mixed infections.

    Science.gov (United States)

    Bernotienė, Rasa; Palinauskas, Vaidas; Iezhova, Tatjana; Murauskaitė, Dovilė; Valkiūnas, Gediminas

    2016-04-01

    Mixed infections of different species and genetic lineages of haemosporidian parasites (Haemosporida) predominate in wildlife, and such infections are particularly virulent. However, currently used polymerase chain reaction (PCR)-based detection methods often do not read mixed infections. Sensitivity of different PCR assays in detection of mixed infections has been insufficiently tested, but this knowledge is essential in studies addressing parasite diversity in wildlife. Here, we applied five different PCR assays, which are broadly used in wildlife avian haemosporidian research, and compared their sensitivity in detection of experimentally designed mixed infections of Haemoproteus and Plasmodium parasites. Three of these PCR assays use primer sets that amplify fragments of cytochrome b gene (cyt b), one of cytochrome oxidase subunit I (COI) gene, and one target apicoplast genome. We collected blood from wild-caught birds and, using microscopic and PCR-based methods applied in parallel, identified single infections of ten haemosporidian species with similar parasitemia. Then, we prepared 15 experimental mixes of different haemosporidian parasites, which often are present simultaneously in wild birds. Similar concentration of total DNA was used in each parasite lineage during preparation of mixes. Positive amplifications were sequenced, and the presence of mixed infections was reported by visualising double-base calling in sequence electropherograms. This study shows that the use of each single PCR assay markedly underestimates biodiversity of haemosporidian parasites. The application of at least 3 PCR assays in parallel detected the majority, but still not all lineages present in mixed infections. We determined preferences of different primers in detection of parasites belonging to different genera of haemosporidians during mixed infections. PMID:26821298

  4. Comparison of RNA isolation and associated methods for extracellular RNA detection by high-throughput quantitative polymerase chain reaction.

    Science.gov (United States)

    Tanriverdi, Kahraman; Kucukural, Alper; Mikhalev, Ekaterina; Tanriverdi, Selim E; Lee, Rosalind; Ambros, Victor R; Freedman, Jane E

    2016-05-15

    MicroRNAs (miRNAs) are small noncoding RNA molecules that function in RNA silencing and posttranscriptional regulation of gene expression. miRNAs in biofluids are being used for clinical diagnosis as well as disease prediction. Efficient and reproducible isolation methods are crucial for extracellular RNA detection. To determine the best methodologies for miRNA detection from plasma, the performance of four RNA extraction kits, including an in-house kit, were determined with miScript miRNA assay technology; all were measured using a high-throughput quantitative polymerase chain reaction (qPCR) platform (BioMark System) with 90 human miRNA assays. In addition, the performances of complementary DNA (cDNA) and preamplification kits for TaqMan miRNA assays and miScript miRNA assays were compared using the same 90 miRNAs on the BioMark System. There were significant quantification cycle (Cq) value differences for the detection of miRNA targets between isolation kits. cDNA, preamplification, and qPCR performances were also varied. In summary, this study demonstrates differences among RNA isolation methods as measured by reverse transcription (RT)-qPCR. Importantly, differences were also noted in cDNA and preamplification performance using TaqMan and miScript. The in-house kit performed better than the other three kits. These findings demonstrate significant variability between isolation and detection methods for low-abundant miRNA detection from biofluids. PMID:26969789

  5. Polymerase chain reaction in detecting Leishmania sp in symptomatic and asymptomatic seropositive dogs

    Directory of Open Access Journals (Sweden)

    M. J. V. Soares

    2005-12-01

    Full Text Available In human and canine renal histological studies of visceral leishmaniasis (VL, the etiological agent is rarely found in situ. The objective of this study was to evaluate PCR in identifying the etiological agent in spleen, liver, lymph node, and kidneys of VL-seropositive dogs. Twenty-five symptomatic (case group and 15 asymptomatic (control group VL-seropositive dogs of different breeds, sexes, and ages from Teresina, Piauí State, Brazil, were used. Serologic diagnosis was made by enzyme-linked immunosorbent assay and indirect immunofluorescence test. Animals were subjected to euthanasia and necropsy. Renal fragments were immersed in buffered formaldehyde solution. Spleen, liver, lymph node, and kidney samples were collected and frozen at -70ºC until DNA extraction. After dehydration and diaphanization, renal fragments were infiltrated and embedded in paraffin, cut at 3 µm, and stained with hematoxylin-eosin (HE. DNA amplification used an automatic thermocycler with specific Leishmania primers. All case-group dogs and 2 controls showed positive results in spleen, liver, or lymph node PCRs. There was a significant difference by Fisher exact test. In symptomatic seropositive dogs, renal histopathological evaluation showed one animal (4% with amastigote forms of Leishmania in inflammatory infiltrate, and kidney PCRs detected Leishmania DNA in eight animals (32%. The conclusion was that PCR is more precise than the conventional histopathology in detecting the Leishmania parasite in kidney.

  6. A species-specific polymerase chain reaction assay for rapid and sensitive detection of Colletotrichum capsici.

    Science.gov (United States)

    Torres-Calzada, C; Tapia-Tussell, R; Quijano-Ramayo, A; Martin-Mex, R; Rojas-Herrera, R; Higuera-Ciapara, I; Perez-Brito, D

    2011-09-01

    Colletotrichum capsici is an important fungal species that causes anthracnose in many genera of plants causing severe economic losses worldwide. A primer set was designed based on the sequences of the ribosomal internal transcribed spacer (ITS1 and ITS2) regions for use in a conventional PCR assay. The primer set (CcapF/CcapR) amplified a single product of 394 bp with DNA extracted from 20 Mexican isolates of C. capsici. The specificity of primers was confirmed by the absence of amplified product with DNA of four other Colletotrichum species and eleven different fungal genera. This primer set is capable of amplifying only C. capsici from different contaminated tissues or fungal structures, thereby facilitating rapid diagnoses as there is no need to isolate and cultivate the fungus in order to identify it. The sensitivity of detection with this PCR method was 10 pg of genomic DNA from the pathogen. This is the first report of a C. capsici-specific primer set. It allows rapid pathogen detection and provides growers with a powerful tool for a rational selection of fungicides to control anthracnose in different crops and in the post-harvest stage. PMID:21253896

  7. Detection of Legionella by quantitative-polymerase chain reaction (qPCR for monitoring and risk assessment

    Directory of Open Access Journals (Sweden)

    Krøjgaard Louise H

    2011-11-01

    Full Text Available Abstract Background Culture and quantitative polymerase chain reaction (qPCR assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a circulation water b water from empty apartments c water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool for risk assessment. Results In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6*105GU/L while L. pneumophila were detected in a range from LOQ to 6.8*105 GU/L. By culturing, the legionellae were detected in the range from below detection limit (> 10 CFU/L to 1.6*106 CFU/L. In circulating water and in first flush water from shower hoses, culture and qPCR showed the same tendencies. The overall correlation between the bacteria number detected by culture and the two developed qPCR assays (L. spp and L. pneumophila was relatively poor (r2 = 0.31 for culture and Legionella spp. assay, r2 = 0.20 for culture and L. pneumophila assay. Conclusion Detection by qPCR was suitable for monitoring changes in the concentration of Legionella but the precise determination of bacteria is difficult. Risk assessment by qPCR only on samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the other hand, the detection of a low number of bacteria by qPCR is a strong indication for the absence of risk.

  8. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  9. Detection and characterization of human pathogenic viruses circulating in community wastewater using multi target microarrays and polymerase chain reaction.

    Science.gov (United States)

    Wong, Mark V M; Hashsham, Syed A; Gulari, Erdogan; Rouillard, Jean-Marie; Aw, Tiong Gim; Rose, Joan B

    2013-12-01

    Sewage pollution remains the most significant source of human waterborne pathogens. This study describes the detection and characterization of human enteric viruses in community wastewaters using cell culture coupled with multiple target microarrays (with a total of 780 unique probes targeting 27 different groups of both DNA and RNA viruses) and polymerase chain reaction (PCR) assays. Over a 13-month sampling period, RNA viruses (astroviruses and enteroviruses) were more frequently detected compared to DNA viruses (adenoviruses, particularly type 41 and BK polyomavirus). Overall, many more viruses were shed during the winter months (December-February) compared to the summer months. Exploration of the multiple types of enteric viruses particularly in winter months identified much more significant prevalence of key viral pathogens associated with sewage pollution of the water environment than previously realized and seasonal disinfection used in some parts of the world may lead to a seeding of ambient waters. Molecular characterization of pathogenic viruses in community wastewater will improve the understanding of the potential risk of waterborne disease transmission of viral pathogens. PMID:24334840

  10. DETECTION OF Leishmania (Viannia IN Nyssomyia neivai AND Nyssomyia whitmani BY MULTIPLEX POLYMERASE CHAIN REACTION, IN SOUTHERN BRAZIL

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu

    2014-09-01

    Full Text Available Sandflies transmit pathogens of leishmaniasis. The natural infection of sandflies by Leishmania (Viannia was assessed in municipalities, in the state of Paraná, in Southern Brazil. Sandflies were collected with Falcão and Shannon traps. After dissection in search of flagellates in digestive tubes and identification of the species, female sandflies were submitted to the Multiplex Polymerase Chain Reaction (multiplex PCR for detection of the fragment of the kDNA of Leishmania (Viannia and the fragment from the IVS6 cacophony gene region of the phlebotomine insects. The analysis was performed in pools containing seven to 12 guts from females of the same species. A total of 510 female sandflies were analyzed, including nine Migonemyia migonei, 17 Pintomyia fischeri, 216 Nyssomyia neivai, and 268 Nyssomyia whitmani. Although none of the females was found naturally infected by flagellates through dissection, the fragment of DNA from Leishmania (Viannia was shown by multiplex PCR in one sample of Ny. neivai (0.46% and three samples of Ny. whitmani (1.12%. It was concluded that Ny. neivai and Ny. whitmani are susceptible to Leishmania infection, and that multiplex PCR can be used in epidemiological studies to detect the natural infection of the sandfly vector, because of its sensitivity, specificity and feasibility.

  11. Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sundaran S. Tinky

    2015-04-01

    Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

  12. Babesia bovis and B. bigemina DNA detected in cattle and ticks from Zimbabwe by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    I. Smeenk

    2000-07-01

    Full Text Available From blood collected from 94 cattle at 12 locations in the eastern and northeastern areas of Zimbabwe, DNA was extracted and analysed by polymerase chain reaction with primers previously reported to be specific for Babesia bigemina and Babesia bovis. Overall, DNA of Babesia bigemina was detected in the blood of 33/94 (35 % cattle and DNA from B. bovis was detected in 27/58 (47 % of cattle. The prevalence of DNA of B. bigemina was significantly higher in young animals (<2 years (23/46 than in animals over 2 years of age (10/48; (chi2 = 8.77; P < 0.01 %. Although tick sampling was not thorough, Boophilus decoloratus could be collected at 7/9 sites sampled and Boophilus microplus at 4/9 sites. Of the 20 B. decoloratus allowed to oviposit before PCR analysis, 1 (5 % contained DNA that could be amplified with primers for B. bigemina while 12 (60 % were positive with primers for B. bovis. Of the B. microplus allowed to oviposit, 11/16 (69 % were positive for B. bovis DNAby PCR and 2/16 (12 % were positive for B. bigemina.

  13. Cyclometalated iridium complex-based label-free photoelectrochemical biosensor for DNA detection by hybridization chain reaction amplification.

    Science.gov (United States)

    Li, Chunxiang; Wang, Hongyang; Shen, Jing; Tang, Bo

    2015-04-21

    Photoactive material is the most crucial factor which intimately determines analytical performances of the photoelectrochemical sensor. On the basis of the high affinity of dipyrido [3,2-a:2',3'-c] phenazine (dppz) with DNA helix, a novel photoactive intercalator, [(ppy)2Ir(dppz)](+)PF6(-)(ppy = 2-phenylpyridine and dppz = dipyrido [3,2-a:2',3'-c] phenazine) was prepared and characterized by UV-vis absorption spectroscopy, fluorescence spectroscopy, and cyclic voltammetry. The photoelectrochemical properties of the as-prepared iridium(III) complex immobilized on the ITO electrode was investigated. Either cathodic or anodic photocurrent generation can be observed when triethanolamine (TEOA) or dissolved O2 is used as a sacrificial electron donor/acceptor, respectively. The probable photocurrent-generation mechanisms are speculated. A highly sensitive iridium(III) complex-based photoelectrochemical sensor was proposed for DNA detection via hybridization chain reaction (HCR) signal amplification. Under optimal conditions, the biosensor was found to be linearly proportional to the logarithm of target DNA concentration in the range from 0.025 to 100 pmol L(-1) with a detection limit of 9.0 fmol L(-1) (3σ). Moreover, the proposed sensor displayed high selectivity and good reproducibility, demonstrating efficient and stable photoelectric conversion ability of the Ir(III) complex. PMID:25816127

  14. Detection of hepatitis E virus RNA in sera of patients with hepatitis E by polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Zhen-Yu Zhao; Bing Ruan; Hui Shao; Zhen-Juan Chen; She-Lan Liu

    2007-01-01

    BACKGROUND: The duration of viremia during hepatitis E virus (HEV) infection has rarely been reported. This study was undertaken to detect HEV RNA in sera of patients with hepatitis E and to understand the process of HEV infection more thoroughly. METHODS:HEV RNA was detected in the serum samples of hospitalized patients with acute hepatitis E by reverse transcriptase-nested polymerase chain reaction (RT-nPCR) using two pairs of primers from open reading frame (ORF) 1 of the HEV genome. RESULTS:The serum samples from 44 (70%) of 62 patients were positive for HEV RNA. Thirty-two of these patients, with 288 serial serum specimens, were followed up for the whole process, and 24 patients (75%) were positive for HEV RNA. The positive rates declined with the course of the disease, serum HEV RNA persisting for 20.6 days on average after onset of illness. Serum HEV RNA remained positive in 36 (81.8%) of the 44 patients at the time their alanine aminotransferase (ALT) began to decrease. There was no difference in HEV RNA positivity between serum with high levels of HEV antibody (peak P/N ratio ≥4.0) and that with low levels (peak P/N ratio0.05), respectively. CONCLUSIONS: There is a relatively long period of HEV viremia in patients with hepatitis E. The proportion of HEV viremia and its duration are not directly related to serum ALT values or HEV antibody levels.

  15. Overcoming RNA inhibition in the fluorescent polymerase chain reaction assay to enhance detection of bovine DNA in cattle feeds.

    Science.gov (United States)

    Sawyer, Mary; Rensen, Gabriel; Smith, Wayne; Yee, Melanie; Wong, Alice; Osburn, Bennie; Cullor, James

    2004-01-01

    The practice of incorporating mammalian protein in ruminant feeds was banned in the United States in 1997 as a measure to avoid transmission of bovine spongiform encephalopathy (BSE). A sensitive means of identifying the banned additives in feeds would be by detection of species-specific DNA using the polymerase chain reaction (PCR). However, problems may arise in the PCR due to the presence of inhibitory substances. Using human DNA as an internal PCR control, inhibitory substances were evident in the DNA extraction products of cattle feeds. The results of heating experiments excluded enzymes as a cause of inhibition, and spectrophotometric calculations suggested the possibility of RNA contamination. Co-electrophoresis of untreated and RNAse digested extracts confirmed the presence of RNA in the undigested product. Seven cattle feeds were spiked with predetermined amounts of bovine meat and bone meal (BMBM). The DNA extracted products were treated with RNAse and the bovine specific mitochondrial DNA (B-mtDNA) was amplified by PCR. The minimum level of detection of B-mtDNA was influenced by RNAse treatment and feed composition. RNAse treatment decreased false-negative results overall by 75%. False-negative results were decreased 100% in the higher BMBM concentrations and 50% in the lower BMBM concentrations. Also, each cattle feed was spiked to attain a 2% wt/wt concentration with each swine, fish, sheep, or poultry product, or cattle dried blood. Amplification of B-mtDNA occurred only with the cattle dried blood and only in three feeds in which B-mtDNA was detected at the only level tested (2%). A commercial immunochromotographic assay (Neogen) detected the spiked BMBM in only one of the seven feeds and only at the upper concentration (1%). PMID:15992269

  16. Innovative use of platinum compounds to selectively detect live microorganisms by polymerase chain reaction.

    Science.gov (United States)

    Soejima, Takashi; Minami, Jun-Ichi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-02-01

    PCR cannot distinguish live microorganisms from dead ones. To circumvent this disadvantage, ethidium/propidium-monoazide (EMA/PMA) and psoralen to discriminate live from dead bacteria have been used for 2 decades. These methods require the use of numerous laborious procedures. We introduce an innovative method that uses platinum compounds, which are primarily used as catalysts in organic chemistry and partly used as anti-cancer drugs. Microorganisms are briefly exposed to platinum compounds in vivo, and these compounds penetrate dead (compromised) microorganisms but not live ones and are chelated by chromosomal DNA. The use of platinum compounds permits clear discrimination between live and dead microorganisms in water and milk (including Cronobacter sakazakii and Escherichia coli) via PCR compared with typically used PMA. This platinum-PCR method could enable the specific detection of viable coliforms in milk at a concentration of 5-10 CFU mL(-1) specified by EU/USA regulations after a 4-h process. For sample components, environmental water contains lower levels of PCR inhibitors than milk does, and milk is similar to infant formula, skim milk and blood; thus, the use of the platinum-PCR method could also prevent food poisoning due to the presence of C. sakazakii in dairy products. This method could provide outstanding rapidity for use in environmental/food/clinical tests. Platinum-PCR could also be a substitute for the typical culture-based methods currently used. PMID:26192088

  17. Use of Polymerase Chain Reaction Enzyme Linked Oligonucleotide Sorbent Assay (Pcr-Elosa for Detection of Disease Agents

    Directory of Open Access Journals (Sweden)

    Simson Tarigan

    2016-03-01

    Full Text Available Diagnostic tool comprises one of the vital components in the control of infectious diseases. One of the most common techniques in the diagnosis of infectious disease currently available is the polymerase chain reaction (PCR because this technique is very sensitive, specific, and rapid. This technique requires an adjunct technique to indicate the formation of the right reaction product. Agarose gel electrophoresis has been the most common technique to visualise the PCR product or amplicon. Enzyme linked oligonucleotide sorbent assay (ELOSA is an alternative technique which is more sensitive and gives more important identity of the amplicon. This technique can be more than 100 times as sensitive as a gel agarose electrophoresis, and very specific since confirmation of the amplicon is carried out by DNA hibridisation. The capacity of the ELOSA can also be extended to the detection of disease-causal agent at subtype level, or detection of mutation at particular location in a gene. Since the equipment used for ELOSA is similar to that for ELISA (enzyme linked immunosorbent assay, a large number of samples can be accomplished rapidly. As in ELISA, a number of variation can be made in ELOSA depend on the requirement. Nucleotide can be immobilised on the microwell plate either by passive adsorbtion, by first conjugation of nucleotide with biotin then immobilisation on streptavidin-coated microwell plate, or immobilisaion by covalent bonding. The PCR and ELOSA can be performed at separate or in a single tube by first immobilising the PCR primers on the surface of microwell plates.

  18. Detection of equine herpesvirus type 1 using a real-time polymerase chain reaction.

    Science.gov (United States)

    Diallo, Ibrahim S; Hewitson, Glen; Wright, Lucia; Rodwell, Barry J; Corney, Bruce G

    2006-01-01

    Equid herpesvirus 1 (EHV1) is a major disease of equids worldwide causing considerable losses to the horse industry. A variety of techniques, including PCR have been used to diagnose EHV1. Some of these PCRs were used in combination with other techniques such as restriction enzyme analysis (REA) or hybridisation, making them cumbersome for routine diagnostic testing and increasing the chances of cross-contamination. Furthermore, they involve the use of suspected carcinogens such as ethidium bromide and ultraviolet light. In this paper, we describe a real-time PCR, which uses minor groove-binding probe (MGB) technology for the diagnosis of EHV1. This technique does not require post-PCR manipulations thereby reducing the risk of cross-contamination. Most importantly, the technique is specific; it was able to differentiate EHV1 from the closely related member of the Alphaherpesvirinae, equid herpesvirus 4 (EHV4). It was not reactive with common opportunistic pathogens such as Escherichia coli, Klebsiella oxytoca, Pseudomonas aeruginosa and Enterobacter agglomerans often involved in abortion. Similarly, it did not react with equine pathogens such as Streptococcus equi, Streptococcus equisimilis, Streptococcus zooepidemicus, Taylorella equigenitalis and Rhodococcus equi, which also cause abortion. The results obtained with this technique agreed with results from published PCR methods. The assay was sensitive enough to detect EHV1 sequences in paraffin-embedded tissues and clinical samples. When compared to virus isolation, the test was more sensitive. This test will be useful for the routine diagnosis of EHV1 based on its specificity, sensitivity, ease of performance and rapidity. PMID:16137772

  19. Application of real time polymerase chain reaction targeting kex 1 gene & its comparison with the conventional methods for rapid detection of Pneumocystis jirovecii in clinical specimens

    OpenAIRE

    Mani Revathy; Kulandai Lily Therese; Radhakishnan Bagyalakshmi; Chokaliingam Chandrasekar; Suria Kumar; Madhavan, Hajib N.

    2014-01-01

    Background & objectives: As there are no standard laboratory techniques for the rapid detection of Pneumocystis jirovecii in India, this study was undertaken to evaluate and establish an optimal and rapid technique for the detection of P. jirovecii by comparing three different techniques - staining technique, application of a real time polymerase chain reaction (RT-PCR) targeting kex 1 gene and application of nested PCR targeting mitochondrial large subunit (mtLSU) gene for rapid detection of...

  20. Development of Multiplex Real-Time Polymerase Chain Reaction for Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in Clinical Specimens

    OpenAIRE

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-01-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolyt...

  1. Performance of polymerase chain reaction techniques detecting perforin in the diagnosis of acute renal rejection: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Yushu Shang

    Full Text Available BACKGROUND: Studies in the past have shown that perforin expression is up-regulated during acute renal rejection, which provided hopes for a non-invasive and reliable diagnostic method to identify acute rejection. However, a systematic assessment of the value of perforin as a diagnostic marker of acute renal rejection has not been performed. We conducted this meta-analysis to document the diagnostic performance of perforin mRNA detection and to identify potential variables that may affect the performance. METHODOLOGY/PRINCIPAL FINDINGS: Relevant materials that reported the diagnostic performance of perforin mRNA detection in acute renal rejection patients were extracted from electronic databases. After careful evaluation of the studies included in this analysis, the numbers of true positive, true negative, false positive and false negative cases of acute renal rejection identified by perforin mRNA detection were gathered from each data set. The publication year, sample origin, mRNA quantification method and housekeeping gene were also extracted as potential confounding variables. Fourteen studies with a total of 501 renal transplant subjects were included in this meta-analysis. The overall performance of perforin mRNA detection was: pooled sensitivity, 0.83 (95% confidence interval: 0.78 to 0.88; pooled specificity, 0.86 (95% confidence interval: 0.82 to 0.90; diagnostic odds ratio, 28.79 (95% confidence interval: 16.26 to 50.97; and area under the summary receiver operating characteristic curves value, 0.9107±0.0174. The univariate analysis of potential variables showed some changes in the diagnostic performance, but none of the differences reached statistical significance. CONCLUSIONS/SIGNIFICANCE: Despite inter-study variability, the test performance of perforin mRNA detected by polymerase chain reaction was consistent under circumstances of methodological changes and demonstrated both sensitivity and specificity in detecting acute renal

  2. Differential detection of Entamoeba histolytica from Entamoeba dispar by parasitological and nested multiplex polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    esmaiel fallah

    2014-02-01

    Full Text Available Introduction: Amebiasis is an intestinal illness caused by a one-celled parasite (amoeba called Entamoeba (E histolytica. E histolytica and E dispar are morphologicallyundistinguishable but have genetic and functional differences. E. histolytica is invasive andcause amoebiasis, but E dispar cause an asymptomatic colonization which does not need to bemedically treated. We have performed a nested multiplex Polymerase Chain Reaction (PCRtargeting small subunit rRNA (Ribosomal ribonucleic acid gene for differential detection of Ehistolytica and E dispar directly from stool samples. Methods: All the fecal samples collected without preservation and were screened for amebiccells by parasitological methods. Fecal samples that containing amebic cells were stored at -20ºC until DNA extraction. DNA extraction was down by using a DNA extraction kit. Thegenus specific primers were designed using nucleotide sequences of 18S-rRNA gene ofEntamoeba. Results: Thirty one (4.28% stool samples out of 724 samples were positive for E histolytica/E dispar. The nested multiplex PCR illustrated that the size of diagnostic fragments of PCR products was obviously different for two Entamoeba species, the specific product size for Ehistolytica and E dispar was 439 and 174 bp. The nested multiplex PCR was positive in 25 outof 31 stool specimens that 17 (54.8% samples were positive for E dispar and 8 (25.8%samples were positive for E histolytica. Conclusion: Nested multiplex PCR was useful for the specific detection of E histolytica and Edispar in stool samples. In current study we detected that E dispar was more prevalent in our study area.

  3. POLYMERASE CHAIN REACTION DETECTION OF PASTEURELLA MULTOCIDA TYPE B: 2 IN MICE INFECTED WITH CONTAMINATED RIVER WATER

    Directory of Open Access Journals (Sweden)

    Faez Firdaus Jesse Abdullah

    2013-01-01

    Full Text Available Hemorrhagic septicemia is an acute, deadly disease of cattle and buffaloes associated with colossal economic loss in the livestock industry in the Asian regions particularly Malaysia. Therefore, this study was conducted to investigate on the Polymerase chain reaction detection of Pasteurella multocida type B: 2 in mice inoculated through different routes with river water contaminated with infected mice carcasses. Sixty five mice were used for the study; five mice were placed in each tank containing river water for 24, 48 and 72 h. The groups comprise of five mice each made up of the control, intraperitoneal, oral and the aerosol routes. A dose of 1 mL 109 CFU of Pasteurella multocida type B: 2 obtained from the infected river water were inoculated into each group intraperitoneally and the aerosol route while, 0.4 mL of 109 CFU of Pasteurella multocida type B: 2 was inoculated orally into the group. The control group was inoculated with 1 mL buffer saline pH 7. The PCR results in the present study revealed the presence of P. multocida type B: 2 from the following organs brain, kidney, heart, spleen, lung and liver in the mice inoculated through intraperitoneal, oral and aerosol route. In the river water kept for 24 h P. multocida type B: 2 were detected in the organs through the intraperitoneal, oral and the aerosol routes. The river water kept for 48 and 72 h were positive for the isolation of P. multocida inoculated via the intraperitoneal and oral route, except the aerosol route where no significant P. multocida was detected in the organs using PCR. In conclusion, this model could be used to enhance the understanding of the progression of the disease and control of the natural disease through the various routes of the disease transmission. This study also postulated that the outbreak of HS among buffaloes and cattle could be due to the consumption of river water contaminated with infected HS carcasses.

  4. Detection of gastrin mRNA in fresh human colonic carcinomas by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Monges, G; Biagini, P; Cantaloube, J F; Chicheportiche, C; Frances, V; Brandini, D; Parc, P; Seitz, J F; Giovannini, M; Sauvan, R

    1993-10-01

    To investigate the hypothesis that gastrin might be synthesized by tumour tissues in cancer of the colon, samples from six human colon tumours, one hepatic metastasis, four normal colonic mucosal samples and two antral and one fundic gastric mucosal samples from nine patients were analysed to determine whether gastrin mRNA was present. RNA was extracted from surgical specimens by ultracentrifugation on a CsCl cushion, purified using the guanidinium thiocyanate method, reverse-transcribed and amplified by polymerase chain reaction. Gastrin mRNA was detected in each colonic carcinoma sample (including the hepatic metastasis), while no such signal was observed in normal colon biopsies. Positive and negative controls (gastric antrum and fundus respectively) gave the expected results. In each of the positive samples, the chemiluminescent revelation of amplified products after Southern blotting corresponded to gastrin mRNA without the intron. These findings demonstrate the ability of primary and metastatic human colonic tumours to produce gastrin mRNA. Since malignant cell lines have been reported to produce gastrin peptide, and since gastrin receptors were present in some cases, our results support the idea that gastrin may be involved in an autocrine mechanism. PMID:7507679

  5. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    Directory of Open Access Journals (Sweden)

    T. M. Nabeel Muhammad

    2015-01-01

    Full Text Available Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasal swabs were tested by PCR. Results: PCR analysis showed 56 positives (71.7% for infectious coryza out of total 78 samples tested. Of 56 infra orbital sinus swabs tested, 47 were positive (83.9% and 9 nasal swabs (40.9% out of 22 tested had given positive results for infectious coryza. Samples collected from birds at acute stage of disease and samples collected before treatment with antibiotics were given better results on PCR. Conclusion: For preventing the economic losses associated with the disease, an early, accurate and rapid diagnosis is essential. PCR is a rapid and highly sensitive diagnostic technique which can substitute conventional cultural examination.

  6. Plasmodium spp. and Haemoproteus spp. infection in birds of the Brazilian Atlantic Forest detected by microscopy and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raquel Tostes

    2015-01-01

    Full Text Available In recent years haemosporidian infection by protozoa of the genus Plasmodium and Haemoproteus, has been considered one of the most important factors related to the extinction and/or population decline of several species of birds worldwide. In Brazil, despite the large avian biodiversity, few studies have been designed to detect this infection, especially among wild birds in captivity. Thus, the objective of this study was to analyze the prevalence of Plasmodium spp. and Haemoproteus spp. infection in wild birds in captivity in the Atlantic Forest of southeastern Brazil using microscopy and the polymerase chain reaction. Blood samples of 119 different species of birds kept in captivity at IBAMA during the period of July 2011 to July 2012 were collected. The parasite density was determined based only on readings of blood smears by light microscopy. The mean prevalence of Plasmodium spp. and Haemoproteus spp. infection obtained through the microscopic examination of blood smears and PCR were similar (83.19% and 81.3%, respectively, with Caracara plancus and Saltator similis being the most parasitized. The mean parasitemia determined by the microscopic counting of evolutionary forms of Plasmodium spp. and Haemoproteus spp. was 1.51%. The results obtained from this study reinforce the importance of the handling of captive birds, especially when they will be reintroduced into the wild.

  7. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    International Nuclear Information System (INIS)

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  8. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    P. D. Luka

    2014-10-01

    Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.

  9. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction.

    Science.gov (United States)

    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A

    2004-12-15

    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  10. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  11. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  12. Evaluation of Clearview and Magic Lite tests, polymerase chain reaction, and cell culture for detection of Chlamydia trachomatis in urogenital specimens

    NARCIS (Netherlands)

    J.A.J.W. Kluytmans (Jan); W.H.F. Goessens (Wil); J.W. Mouton (Johan); J.H. van Rijsoort-Vos; H.G.M. Niesters (Bert); W.G.V. Quint (Wim); L. Habbema; E. Stolz (Ernst); J.H. Wagenvoort

    1993-01-01

    textabstractThe Clearview Chlamydia test (CV; Unipath Ltd., Bedford, United Kingdom), the Magic Lite Chlamydia test (ML; CIBA Corning, Medfield, Mass.), a polymerase chain reaction (PCR), and cell culture (CC) were evaluated for detection of Chlamydia trachomatis in urogenital spec

  13. Detection of DNA from Leishmania (Viannia: accuracy of polymerase chain reaction for the diagnosis of cutaneous leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu

    Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.

  14. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie

    2013-12-01

    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  15. Detection of pathogenic Yersinia enterocolitica in slaughtered pigs by cultural methods and real-time polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Rina Mazzette

    2015-05-01

    Full Text Available Healthy pigs carrying pathogenic to human Yersinia enterocolitica strains are the main source of entry into slaughterhouse, where cross-contamination of carcasses can happen. The aim of this work was to determine Y. enterocolitica prevalence in slaughtered pigs, investigating the presence of carriers in relation to carcass contamination. A total of 132 pig samples (tonsils, mesenteric lymph nodes, colon content, carcass surface were collected from 4 Sardinian slaughterhouses. All the samples were examined by the ISO 10273:2003 method, and the prevalence was also determined by direct plating on CIN Agar. Moreover, to detect the ail positive Y. enterocolitica strains in enrichment broths and isolates a real-time polymerase chain reaction (PCR was applied. Y. enterocolitica prevalence was 19% with direct plating and 12% with enrichment methods. Carcass surfaces and tonsils prevalence was 5.30% by direct plating, and 5.3% and 2.2%, respectively, by enrichment method. Tonsil samples showed an average contamination level of 3.2×103 CFU/g, while the mean value on carcass was 8.7×102 CFU/g. An overall prevalence of 9.8% of ail positive Y. enterocolitica broths was detected by RT-PCR, that found a higher prevalence in tonsils (7.5% with respect to cultural methods, confirming the greater sensitivity of this technique when applied for tonsils and faeces samples. The results show a relatively low pathogenic Y. enterocolitica prevalence in pigs slaughtered in Sardinia. Good hygiene measures should be applied at slaughterhouse in order to prevent the entry of carriers and control carcass contamination.

  16. Detection and characterization of cry1Ac transgene construct in Bt cotton: multiple polymerase chain reaction approach.

    Science.gov (United States)

    Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N

    2007-01-01

    To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach

  17. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection

    OpenAIRE

    Vasuki Venkatesan; Sugeerappa Laxmanappa Hoti; Nagalakshmi Kamaraj; Somnath Ghosh; Kaushik Rajaram

    2013-01-01

    Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence ...

  18. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    OpenAIRE

    P. D. Luka; A. R. Jambol; B. Yakubu

    2014-01-01

    Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT) remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR) depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction ...

  19. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    OpenAIRE

    Camila Ximenes; Eduardo Brandão; Paula Oliveira; Abraham Rocha; Tamisa Rego; Rafael Medeiros; Ana Aguiar-Santos; João Ferraz; Christian Reis; Paulo Araujo; Luiz Carvalho; Melo, Fabio L

    2014-01-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuche...

  20. Detection of colonic cells in peripheral blood of colorectal cancer patients by means of reverse transcriptase and polymerase chain reaction.

    OpenAIRE

    Castells, A.; Boix, L.; Bessa, X; Gargallo, L.; Piqué, J M

    1998-01-01

    Circulating tumour cells play a central role in the metastatic process, but little is known about the relationship between this cellular subpopulation and the development of secondary disease. This study was aimed at assessing the presence of colonic cells in peripheral blood of patients with colorectal cancer in different evolutionary stages, by means of reverse transcriptase polymerase chain reaction (RT-PCR) targeted to carcinoembryonic antigen (CEA) mRNA. In vitro sensitivity was establis...

  1. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    Directory of Open Access Journals (Sweden)

    Mahmood Shishegar

    2011-12-01

    Full Text Available Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2% of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%. Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensi-tivity profile in our geographic area.

  2. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    Science.gov (United States)

    Shishegar, Mahmood; Faramarzi, Abolhasan; Kazemi, Tayyebe; Bayat, Akbar; Motamedifar, Mohammad

    2011-01-01

    Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR) assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2%) of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%). Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensitivity profile in our geographic area. PMID:23115412

  3. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

    Science.gov (United States)

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

    2015-03-01

    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. PMID:23000800

  4. Comparison of the direct fluorescence assay and real-time polymerase chain reaction for the detection of influenza virus A and B in immunocompromised patients

    Directory of Open Access Journals (Sweden)

    Ana Helena Perosa

    2013-09-01

    Full Text Available OBJECTIVE: This study evaluated the diagnostic performance of two methods for the detection of influenza virus in immunocompromised transplant patients. METHODS: A total of 475 respiratory samples, 236 from patients in a hematopoietic stem cell transplantation program and 239 from kidney transplant patients, were analyzed by a direct fluorescence assay and the Centers for Disease Control real-time polymerase chain reaction protocol for influenza A and B detection. RESULTS: Influenza detection using either method was 7.6% in the hematopoietic stem cell transplant group and 30.5% in the kidney transplant patient group. Influenza detection by real-time polymerase chain reaction yielded a higher positive rate compared with fluorescence than that reported by other studies, and this difference was more pronounced for influenza A. The fluorescence assay sensitivity, specificity, positive and negative predictive values, and kappa coefficient were 17.6%, 100%, 1, 0.83, and 0.256, respectively, and lower detection rates occurred in the kidney transplant patients. CONCLUSIONS: The real-time polymerase chain reaction performance and the associated turnaround time for a large number of samples support the choice of this method for use in different routine diagnostic settings and influenza surveillance in high-risk patients.

  5. Hematobiochemical alterations and direct blood polymerase chain reaction detection of Theileria annulata in naturally infected crossbred cows

    Directory of Open Access Journals (Sweden)

    Anita Ganguly

    2015-01-01

    Full Text Available Aim: The aim was to determine hemato-biochemical changes and rapid diagnosis of Theileria annulata in naturally infected crossbred cows. Materials and Methods: Blood samples from lactating crossbred cows (n=40 between 3 and 7 years of age and showing clinical signs of tropical theileriosis were collected, with or without anticoagulant, and analyzed for tropical theileriosis by direct smear, direct blood polymerase chain reaction (PCR detection of merozoite-piroplasm surface antigen (Tams1 gene specific amplicon, estimation of hematological and biochemical parameters. Healthy crossbred cows (n=6, examined free from hemoprotozoan infections were included as control. Results: The infected crossbred cows revealed significantly (p<0.001 lower values of total erythrocytic counts (4.46±0.2× 106/μL, hemoglobin (Hb 6.025±0.39 g%, packed cell volume (17.05±1.1%, mean corpuscular volume (37.94±1.70 fL and mean corpuscular Hb (13.5±0.48 pg; p<0.002 compared with healthy control. The serum samples of infected cows revealed profound (p<0.05 hyponatremia (Na 133.21±2.36 mEq/l and hypocalcemia (Ca 8.39±0.34 mg%. Infected crossbred cows showed a significant increase (p<0.05 of mean serum activity of alanine aminotransferase (61.45±13.36 U/L, aspartate aminotransferase (146.1±20.97 U/L, blood urea nitrogen (28.26±3.90 mg%, creatinine (1.55±0.13 mg%, direct bilirubin (0.33±0.04 mg%; p<0.001 and lactate dehydrogenase (3001.32±167.0 U/L; p<001. Blood direct PCR revealed a 721-bp fragment amplified from the target gene encoding 30-kDa major merozoite surface antigen of T. annulata using specific primer pairs. This assay was positive for all the infected animals. Conclusion: The assessments of hemato-biochemical parameters in T. annulata infected crossbred cows may be useful in understanding disease pathogenesis, prognosis and corrective measures for supportive therapy. Moreover, blood direct PCR can reliably be used for rapid detection of T. annulata

  6. A simplified method for sample collection and DNA isolation for polymerase chain reaction detection of Trypanosoma rangeli and Trypanosoma cruzi in triatomine vectors

    Directory of Open Access Journals (Sweden)

    Evandro MM Machado

    2000-12-01

    Full Text Available Due to the overlapping distribution of Trypanosoma rangeli and T. cruzi in Central and South America, sharing several reservoirs and triatomine vectors, we herein describe a simple method to collect triatomine feces and hemolymph in filter paper for further detection and specific characterization of these two trypanosomes. Experimentally infected triatomines feces and hemolymph were collected in filter paper and specific detection of T. rangeli or T. cruzi DNA by polymerase chain reaction was achieved. This simple DNA collection method allows sample collection in the field and further specific trypanosome detection and characterization in the laboratory.

  7. Chlamydia trachomatis-specific antibodies in patients with pelvic inflammatory disease: comparison with isolation in tissue culture or detection with polymerase chain reaction.

    OpenAIRE

    Theunissen, J J; Minderhoud-Bassie, W; Wagenvoort, J H; Stolz, E; Michel, M F; Huikeshoven, F.J.

    1994-01-01

    OBJECTIVE--The detection of acute phase antibodies against C trachomatis and its comparison with tissue culture or polymerase chain reaction (PCR) on samples of cervix and urethra obtained from patients with pelvic inflammatory disease (PID). METHODS--In the academic hospital Dijkzigt, Rotterdam, The Netherlands, prospective investigations were performed on 49 consecutive patients who were admitted with the diagnosis of PID. Infections with C trachomatis were traced using tissue culture, PCR ...

  8. Comparison of subgingival bacterial sampling with oral lavage for detection and quantification of periodontal pathogens by real-time polymerase chain reaction

    OpenAIRE

    Boutaga, Khalil; Savelkoul, Paul H. M.; Winkel, Edwin G.; van Winkelhoff, Arie J.

    2007-01-01

    Background: Saliva has been studied for the presence of subgingival pathogens in periodontitis patients. With the anaerobic culture technique, the discrepancy between salivary recovery and subgingival presence has been significant, which makes this approach not suitable for practical use in the microbial diagnosis of periodontitis patients. The real-time polymerase chain reaction (PCR) technique represents a very sensitive technique to detect and quantify bacterial pathogens. The aim of the s...

  9. Detection of varicella-zoster virus DNA by polymerase chain reaction in the cerebrospinal fluid of patients suffering from neurological complications associated with chicken pox or herpes zoster.

    OpenAIRE

    Puchhammer-Stöckl, E; Popow-Kraupp, T; Heinz, F X; Mandl, C W; Kunz, C.

    1991-01-01

    The polymerase chain reaction (PCR) was used to detect varicella-zoster virus (VZV) DNA in the cerebrospinal fluid of patients with VZV infection associated with neurological symptoms. Positive results were obtained in three of five children with post-chicken pox cerebellitis and in seven of seven herpes zoster patients with neurological symptoms. The PCR thus provides a useful tool for the early diagnosis of VZV-associated neurological disease.

  10. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    Science.gov (United States)

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary. PMID:19610365

  11. Detection of MDR1 single nucleotide polymorphisms C3435T and G2677T using real-time polymerase chain reaction: MDR1 single nucleotide polymorphism genotyping assay

    OpenAIRE

    Song, Pengfei; Li, Shen; Meibohm, Bernd; Gaber, A. Osama; Honaker, Marsha R.; Kotb, Malak; Yates, Charles R.

    2002-01-01

    The objective of this study was to develop a real-time polymerase chain reaction (PCR) method to detect MDR1 (human multidrug resistance gene) single nucleotide polymorphisms (SNPs) C3435T and G2677T. C3435T and G2677T are linked to MDR1*2, which is associated with enhanced efflux activity in vitro. Using the Smart Cycler, an allele-specific real-time PCR-based genotyping method was developed to detect C3435T and G2677T. The MDR1 genotype of human genomic DNA templates was determined by direc...

  12. Detection of Human Parvovirus B19 Nonstrutural Protein DNA by Nested-Polymerase Chain Reaction in Gravida Serum and Pregnant Tissues

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    A new nested-polymerase chain reaction (nested-PCR) assay was developed to detect human parvovirus B19 DNA corresponding to the nonstructural protein in clinical specimens in a routine diagnostic laboratory. The sensitivity of this highly specific assay was up to 0. 005 fg of B19 DNA. Parvovirus B19 was identified in sera of 20 pregnant women with abnormal pregnant outcome. Among these 20 cases, intrauterine parvovirus infection did exist in 7 pregnant women because parvovirus B19 DNA was detected in the pregnant tissues of them such as placenta tissues,chorionic villi, amniotic fluid, fetal spleen, liver and abdominal fluids.

  13. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito

    2015-05-01

    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  14. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

    Science.gov (United States)

    Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

  15. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    Science.gov (United States)

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. PMID:26880717

  16. Polymerization as a Model Chain Reaction

    Science.gov (United States)

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  17. Influences of bracket bonding on mutans streptococcus in plaque detected by real time fluorescence-quantitative polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    AI Hong; LU Hong-fei; LIANG Huan-you; WU Jian; LI Ruo-lan; LIU Guo-ping; XI Yun

    2005-01-01

    Background Enamel demineralization occurs frequently during orthodontic treatment. In this study, we evaluated the changes of the density of mutans streptococcus (MS) in plaque after bracket bonding and using fluoride adhesive on maxillary incisors by real time fluorescence-quantitative polymerase chain reaction (RT-FQ PCR).Methods The study was designed as a self-paired test. Brackets were bonded with fluoride adhesive on the left side, while non-fluoride adhesive on the right side for each patient. Plaque samples were taken from the surfaces around the brackets of four maxillary incisors before brackets bonding and after the bonding 4 weeks later. The amount of MS was measured by RT-FQ PCR. The data obtained were analyzed statistically using the SPSS 11.5 version and the alpha level was set at 0.05 (2-tailed).Results The amount of MS in plaque increased significantly after bracket bonding (P0.05), and among the incisors using and not using fluoride adhesive (P>0.05).Conclusions The increase of the density of MS in plaque after bracket bonding is one of the etiological factors for enamel demineralization in orthodontic patients. The result of this study did not support what we observed clinically that the incidence of enamel demineralization for lateral incisors was higher than that for central incisors. Using fluoride adhesive for bonding did not affect the amount of MS in plaque in our study. Further study is needed.

  18. Usefulness of long-distance inverse polymerase chain reaction for molecular detection of 14q32 translocation in a clinical setting.

    OpenAIRE

    Ishizaki, Akiko; Sugahara, Kazuyuki; Tsuruda, Kazuto; Hasegawa, Hiroo; Yanagihara, Katsunori; Tsukasaki, Kunihiro; Yamada, Yasuaki; Kamihira, Shimeru

    2008-01-01

    All mature B-cell leukaemias and lymphomas have a clonal Ig gene recombination, and half of them have a reciprocal chromosomal translocation involving the 14q32 locus. The 14q32 translocation partners are variable, such as BCL-2, BCL-1 and BCL-6, thus accounting for the difficulty in molecular detection by the current genomic polymerase chain reaction (PCR) method. To identify B-cell clones efficiently with an Ig gene rearrangement and reciprocal inter-chromosomal translocation, we verified t...

  19. Babesia infection in naturally exposed pet dogs from a north-eastern state (Assam) of India: detection by microscopy and polymerase chain reaction

    OpenAIRE

    Laha, R.; Bhattacharjee, K.; P. C. Sarmah; Das, M; Goswami, A.; Sarma, D; Sen, A

    2013-01-01

    The objective of the study was to detect Babesia infections in pet dogs of a north-eastern state of India. The diagnostic efficacy of Babesia infection by polymerase chain reaction (PCR) technique has been compared with microscopy examination. For this, a total of 111 blood samples of pet dogs presented at clinical complex of the College of Veterinary Science, Guwahati, Assam with clinical signs suspected for Babesia infection subjected to the study. A total of 44 (39.63 %) dogs were diagnose...

  20. Optimisation of a quantitative polymerase chain reaction-based strategy for the detection and quantification of human herpesvirus 6 DNA in patients undergoing allogeneic haematopoietic stem cell transplantation

    Directory of Open Access Journals (Sweden)

    Miriam YH Ueda

    2015-06-01

    Full Text Available Human herpesvirus 6 (HHV-6 may cause severe complications after haematopoietic stem cell transplantation (HSCT. Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.

  1. Comparison of a TaqMan real-time polymerase chain reaction assay with a loop-mediated isothermal amplification assay for detection of Gallid herpesvirus 1.

    Science.gov (United States)

    Ou, Shan-Chia; Giambrone, Joseph J; Macklin, Kenneth S

    2012-01-01

    A TaqMan real-time polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) assay were developed to detect Gallid herpesvirus 1 (GaHV-1, formerly Infectious laryngotracheitis virus). The standard curve of real-time PCR was established, and the sensitivity reached 10 copies/μl. In the current study, the conversion between viral titer and GaHV-1 genomic copy number was constructed. Six primers for LAMP assay amplified target gene at 65°C within 45 min, and the detection limit was 60 copies/μl. The 6 primers were highly specific, sensitive, and reproducible for detection of GaHV-1. Although the sensitivity of LAMP was lower than that of real-time PCR, LAMP was faster, less expensive, and did not require a thermocycler. The LAMP assay would be a viable alternative assay in diagnostic laboratories that do not employ real-time PCR technology. PMID:22362944

  2. Sensitive detection of Renibacterium salmoninarum in whole fry, blood, and other tissues of pacific salmon by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Rhodes, L D; Nilsson, W B; Strom, M S

    1998-12-01

    A sensitive, reproducible assay for detecting Renibacterium salmoninarum in a variety of tissues, including blood, has been developed. This assay, based on reverse transcription-polymerase chain reaction (RT-PCR) of 16S ribosomal RNA, exhibited sensitivity to detection, and this sensitivity was increased 10-fold by Southern blotting. There was a strong association (p <.001) between blood and ovarian fluid for the presence of bacteria in spawning salmon, and in 17.9% of the infected fish, bacteria were detected in blood but not in ovarian fluid. The ability to analyze multiple tissues, the reproducibility, and sensitivity of 16S RT-PCR make it a useful tool for both research and husbandry applications. PMID:9892717

  3. Detection of Phakopsora pachyrhizi fungus by Polymerase Chain Reaction technique (PCR) after soy grains treatment by electron beams

    International Nuclear Information System (INIS)

    Today Brazil, as the largest soy exporter in the world, has undergone the consequences of the contamination of these crops by the Asian dust fungus, being harmed since the plantation up to the harvest, with losses in its productivity ranging 10-80%. As it is a new disease in the Americas, there are not any resistant species to this fungus attack. The grains contamination harms the exportation for countries which do not want to have their crops contaminated, affecting therefore the international commerce and agro-business relationship with those countries Brazil has trade with. The Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is of difficult control, since occurs through the wind dispersion. The P. pachyrhizi is an Asian fungus and was recently found in South Africa, Paraguay, Argentina and Brazil. As an alternative process to minimize these losses is the process to preserve the grains by radiation, the use of the electron accelerator was indicated, since its advantage for the grains exportation industry is fundamental. Besides the possibility of being disconnected when not in use, this source does not need to be recharged, is easily available and has high dose rate, streamlining the process and reducing logistics costs. The present work aims to identify, by the Polymerase Chain Reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soy grains, at doses 1 and 2 kGy, at the IPEN-CNEN electron Accelerator, a Dynamitron Machine (Radiation Dynamics Co. model JOB, New York, USA), with 1.5 MeV power and 2.5 mA electrical current. (author)

  4. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4.

    Science.gov (United States)

    Lin, Ying-Hong; Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  5. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4

    Science.gov (United States)

    Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  6. Comparison of detection platforms and post-polymerase chain reaction DNA purification methods for use in conjunction with Cleavase fragment length polymorphism analysis.

    Science.gov (United States)

    Sander, T; Olson, S; Hall, J; Siebert, M; Grooms, K; Heisler, L; de Arruda, M; Neri, B

    1999-06-01

    The removal of impurities and contaminants from PCR-amplified fragments is important for mutation detection methods which identify mutations based on shifts in electrophoretic mobility. This is particularly critical for assays and detection methods which use target DNA that is labeled prior to analysis and electrophoretic detection. We examined several procedures for purifying DNA amplified by the polymerase chain reaction (PCR) and their use in conjunction with a novel DNA scanning method, the Cleavase fragment length polymorphism (CFLP)* assay. In this study, a 480 bp DNA fragment, fluorescently labeled on the 5'-end of one strand, was amplified and subjected to various widely used purification procedures, including several commercially available clean-up kits. We demonstrate that visualization of the fluorescent label, as opposed to simple ethidium bromide staining, reveals the presence of considerable levels of labeled, truncated, amplification products. The various procedures were evaluated on the basis of their ability to remove these unwanted DNA fragments as well as on the degree to which they inhibited or promoted the CFLP reaction. Several procedures are recommended for use with CFLP analysis, including isopropanol precipitation, gel excision, and several commercially available spin columns. Concurrently, we evaluated (compared) a number of commonly used visualization platforms, including fluorescence imaging, chemiluminescence, and post-electrophoretic staining, for the ability to detect CFLP pattern changes. The advantages and disadvantages of different methods are discussed and amounts of DNA to be used for CFLP analysis on different detection platforms are recommended. PMID:10380752

  7. Detection of EWS-FLI1 fusion transcripts in paraffin embedded tissues of peripheral primitive neuroectodermal tumors by nested reverse transcription polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Qixing Gong; Qinhe Fan; Zhihong Zhang; Weiming Zhang

    2005-01-01

    Objective: To assess the feasibility and significance of detecting EWS-FLIlfusion transcripts in paraffin embedded tissues of peripheral primitive neuroectodermal tumors (PNETs) by nested reverse transcription polymerase chain reaction (RT-PCR).Methods: Twelve formalin-fixed and paraffin-embedded (FFPE) samples of PNET were retrieved from archive and consultation materials,together with eight cases of controlled tumor. EWS-FLI1 fusion transcripts were detected by nested RT-PCR. Home-keeping gene β-actin was used to detect the quality of mRNA. Results: β-actin mRNA was detected in 9 of the 12 tumor cases. EWS-FLI1 fusion transcripts were detected in 6 cases, among which 4 had a "type 1" fusion transcript and 2 had a "type 2" fusion transcript. None of the controlled tumor was detected the fusion gene. Conclusion: RT-PCR is a feasible method for the detection of EWS-FLI1 fusion transcripts in FFPE tissues in PNET and the result is meaningful in differential diagnosis and prognostic evaluation.

  8. Use of sodC versus ctrA for real-time polymerase chain reaction-based detection of Neisseria meningitidis in sterile body fluids

    Directory of Open Access Journals (Sweden)

    Fábio Takenori Higa

    2013-04-01

    Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.

  9. Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

    Directory of Open Access Journals (Sweden)

    C Coelho

    2003-06-01

    Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

  10. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    Science.gov (United States)

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate. PMID:16302741

  11. A facile "turn-on" fluorescent method with high sensitivity for Hg(2+) detection using magnetic Fe3O4 nanoparticles and hybridization chain reactions.

    Science.gov (United States)

    Lv, Xiaoxiao; Wu, Wenchen; Niu, Chenggang; Huang, Dawei; Wang, Xiaoyu; Zhang, Xuegang

    2016-05-01

    In this manuscript, the authors molecularly engineered a hybridization chain reactions (HCRs) based probe on magnetic Fe3O4 nanoparticles for the sensitive detection of Hg(2+). The sensing system comprised three probes: capture probe H1, report probe H2, and report probe H3. The capture probe was modified on the surface of magnetic Fe3O4 nanoparticles. The report probes were labeled with fluorescein isothiocyanate (FITC). Without Hg(2+), the report probes were stable as molecular beacons in solution. In the presence of Hg(2+), the T-rich capture probes and report probes will hybridize into double-helical DNA domains with the aid of T-Hg(2+)-T coordination chemistry. Trigged by this reaction, more molecular beacons open and form a super tandem structure. Herein, the fluorescence signal was magnified by capturing more report probes. Separating the target and captured report probes from reaction solution was benefit to decrease the background signal and interference from other metal ions. The detection limit of this method was about 0.36nM, which is much lower than the regulations of World Health Organization and U.S. Environmental Protection Agency on Hg(2+) in drink water. This proposed sensing strategy also showed favorable selectivity over other common metal ions. In addition, it has good practicability in real water samples. PMID:26946010

  12. A Rapid and Sensitive Detection of Aflatoxin-producing Fungus Using an Optimized Polymerase Chain Reaction (PCR)

    Science.gov (United States)

    Bintvihok, Anong; Treebonmuang, Supitchaya; Srisakwattana, Kitiya; Nuanchun, Wisut; Patthanachai, Koranis; Usawang, Sungworn

    2016-01-01

    Aflatoxin B1 (AFB1) is produced by Aspergillus flavus growing in feedstuffs. Early detection of maize contamination by aflatoxigenic fungi is advantageous since aflatoxins exert adverse health effects. In this study, we report the development of an optimized conventional PCR for AFB1 detection and a rapid, sensitive and simple screening Real-time PCR (qPCR) with SYBR Green and two pairs of primers targeting the aflR genes which involved aflatoxin biosynthesis. AFB1 contaminated maize samples were divided into three groups by the toxin concentration. Genomic DNA was extracted from those samples. The target genes for A. flavus were tested by conventional PCR and the PCR products were analyzed by electrophoresis. A conventional PCR was carried out as nested PCR to verify the gene amplicon sizes. PCR-RFLP patterns, obtained with Hinc II and Pvu II enzyme analysis showed the differences to distinguish aflatoxin-producing fungi. However, they are not quantitative and need a separation of the products on gel and their visualization under UV light. On the other hand, qPCR facilitates the monitoring of the reaction as it progresses. It does not require post-PCR handling, which reduces the risk of cross-contamination and handling errors. It results in a much faster throughout. We found that the optimal primer annealing temperature was 65°C. The optimized template and primer concentration were 1.5 μL (50 ng/μL) and 3 μL (10 μM/μL) respectively. SYBR Green qPCR of four genes demonstrated amplification curves and melting peaks for tub1, afIM, afIR, and afID genes are at 88.0°C, 87.5°C, 83.5°C, and 89.5°C respectively. Consequently, it was found that the four primers had elevated annealing temperatures, nevertheless it is desirable since it enhances the DNA binding specificity of the dye. New qPCR protocol could be employed for the determination of aflatoxin content in feedstuff samples. PMID:26977262

  13. The chain re-action

    CERN Multimedia

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  14. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection

    Directory of Open Access Journals (Sweden)

    Vasuki Venkatesan

    2013-09-01

    Full Text Available Single-stranded DNA (ssDNA is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring.

  15. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection.

    Science.gov (United States)

    Venkatesan, Vasuki; Hoti, Sugeerappa Laxmanappa; Kamaraj, Nagalakshmi; Ghosh, Somnath; Rajaram, Kaushik

    2013-09-01

    Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring. PMID:24037206

  16. A Comparative Analysis of Routine Techniques: Reverse Transcriptase Polymerase Chain Reaction (RT-PCR and Five Cell Lines for Detection of Enteroviruses in Stool Specimens

    Directory of Open Access Journals (Sweden)

    F Abbasian

    2011-06-01

    Full Text Available Background and objectives: Each year, Enteroviruses infect millions of people and cause different diseases. The agents are usually detected using cell culture. RD (Rhabdomyosarcoma and L20B (L cells are among the recommended cells by the World Health Organisation (WHO for this purpose. Even though cell culture is the most common method used in diagnosing Enteroviruses in stool specimens, this particular method poses some problems, which include false positive or negative results, lack of a unique cell line for diagnosing all Enterovirus types in addition to being time consuming. For these reasons, an attempt was made to find better techniques of Enterovirus detection. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction is a technique used in place of the cell culture method. In this study, the cell culture method was compared with RT-PCR for detection of Enteroviruses in stool specimens.Material and method: First, the chloroform treated stool samples were inoculated onto five cell lines, including RD, L20B, Hep-2 (Human Epidermoid carcinoma cell line, Vero (Verde Reno and GMK (Green Monkey Kidney. The results were then compared with data from Enterovirus detection using the RT-PCR technique.Results and conclusion: The difference between RT-PCR and cell culture results was significant. Enteroviruses were detected in 24% of specimens using RT-PCR while cell lines could isolate Enteroviruses in just 14.4% of the samples.

  17. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    Science.gov (United States)

    Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

    2012-12-01

    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. PMID:23017260

  18. The StepOne real-time polymerase chain reaction detection of Salmonella sp., Salmonella enterica ser. typhimurium and enteritidis in milk and meat.

    Science.gov (United States)

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lejková, Jadža; Fikselová, Martina; Kunová, Simona; Kluz, Maciej

    2011-01-01

    The aim of this study was to follow contamination of ready to eat milk and meat products with Salmonella spp. by using the StepOne real-time polymerase chain reaction (PCR). Classical microbiological methods for detection of foodborne bacteria involve the use of pre-enrichment and/or specific enrichment, following isolation of bacteria in solid media and the final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Salmonella spp. Detection Kit for pursuance of the real-time PCR (Applied Biosystems). In samples without incubation we detected strain of Salmonella sp. in 5 out of 25 samples (swabs), as well as in the internal positive control (IPC), which was positive in all samples. This StepOne real-time PCR assay is extremely useful for any laboratory equipped by real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready-to-eat food. This could prevent infection caused by Salmonella, and also could benefit food manufacturing companies by extending their product's shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. PMID:21879831

  19. Application of semi-nested polymerase chain reaction targeting internal transcribed spacer region for rapid detection of panfungal genome directly from ocular specimens

    Directory of Open Access Journals (Sweden)

    Bagyalakshmi R

    2007-01-01

    Full Text Available Background: The incidence of fungal endophthalmitis has dramatically increased in recent years and rapid detection of fungi using nucleic acid-based amplification techniques is helpful in management. Aim: To evaluate semi-nested polymerase chain reaction (PCR targeting internal transcribed spacer (ITS region for detection of panfungal genome in ocular specimens. Statistical analysis used: Z test for two proportion. Materials and Methods: Standardization of PCR targeting ITS primers was carried out by determining analytical sensitivity and specificity. The sensitivity and specificity of PCR was determined by serial tenfold dilutions of C. albicans (ATCC 24433 DNA and DNA extracts of laboratory isolates of Aspergillus fumigatus , Fusarium lichenicola (4, other fungal and closely related bacterial strains and also human DNA. Semi-nested PCR was applied onto a total of 168 ocular specimens with clinically suspected fungal etiology during 2003-2005. Results and Conclusions: PCR was specific and sensitive to detect 1fg of fungal DNA with ITS primers. PCR detected fungal genome in 90 (53.57% in comparison with the conventional technique, positive in 34 (20.23% by smear examination and in 42 (25% by culture. The increase in clinical sensitivity by 28.57% using PCR was found to be statistically significant { P < 0.001 using Z test for two proportion}. The accuracy of the test was found to be 70.85%. PCR proved to be a rapid diagnostic technique for detection of panfungal genome directly from clinical specimens

  20. Development of TaqMan real-time reverse transcription-polymerase chain reaction for the detection and quantitation of porcine kobuvirus.

    Science.gov (United States)

    Zhu, Xiangdong; Wang, Yufei; Chen, Jianfei; Zhang, Xin; Shi, Hongyan; Shi, Da; Gao, Jing; Feng, Li

    2016-08-01

    Porcine kobuvirus (PKV) is a newly emerging virus that has been detected in diarrheic pigs. Presently, reverse transcription-polymerase chain reaction (RT-PCR) and RT-loop-mediated amplification are the only methods that can be used to detect PKV. To develop a TaqMan real-time RT-PCR for the rapid detection and quantitation of PKV nucleic acid in fecal samples, a pair of primers and a probe were designed to amplify the conserved 3D region of the PKV genome. After optimization, the TaqMan real-time RT-PCR was highly specific and ∼1000 times more sensitive than conventional RT-PCR, and the detection limit was as low as 30 DNA copies. Among the 148 intestinal samples from piglets with diarrhea, 136 and 118 were positive based on the TaqMan and conventional RT-PCR methods, respectively, indicating that the TaqMan RT-PCR was more sensitive than conventional RT-PCR, and the total concordance of the two methods was approximately 87.84%. Thus, the TaqMan real-time RT-PCR should be a useful tool for the early detection and quantitation of PKV. PMID:26912233

  1. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    LENUS (Irish Health Repository)

    Meyler, Kenneth L

    2012-12-01

    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies\\/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and\\/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF.

  2. Combined Detection of Breast Cancer Micrometastases in the Lymph Nodes and Bone Marrow Using Reverse-transcriptase chain Reaction and Southern Hybridization

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The presence of lymph nodes and bone marrow micrometastases of patients with breast carcinoma by immunohistochemistry (IHC) methods has been strongly correlated to early recurrence and shorter overall survival. The aim of this study was to detect micrometastases in matched sample pairs of lymph nodes and the bone marrow of primary breast cancer patients using a more sensitive method, and compare with other clinical parameters. Methods: Cytokeratin 19 (CK-19) gene mRNA expression was detected by reverse transcriptase-polymerase chain reaction (RT-PCR) and Southern blot hybridization. Human breast cancer cell line T47D was mixed with bone marrow cells at different proportions. The positive detection rate was compared among RT-PCR, Southern blotting and IHC methods. Results: Cytokeratin 19 gene was expressed in all 6 positive control samples, while the expression wasn't seen in 18 negative control samples. CK-19 IHC positive cells were detected at a dilution of one T47D cell in 5×105 bone marrow cells, while the sensitivity detected by PCR and Southern blot hybridization was at 1:5′ 104 and 1:106, respectively. In the samples from the 35 patients, we found CK-19 positive cells in 2 cases (5.7%) by IHC. CK-19 gene expression signal was detected in 14/35 (40%) by RT-PCR,and 17/35 (48.6%) by southern blotting. Four cases were micrometastases positive both in lymph node and bone marrow (11.4%). There was no correlation between CK-1 9 detection and other clinical parameters. Conclusion: combined detection of micrometastases in lymph node and bone marrow by RT-PCR and Southern blotting, using CK-19 as a biological marker, is a highly sensitive method for breast cancer.

  3. The use of serotype 1-and serotype 3-specific polymerase chain reaction for the detection of Marek's disease virus in chickens

    DEFF Research Database (Denmark)

    Handberg, Kurt; Nielsen, Ole L.; Jørgensen, Poul Henrik

    2001-01-01

    to develop and evaluate a reliable and easy-to-handle method for surveillance of the occurrence of MDV in chicken flocks. We emphasize the development of a method, which can be applied to types of samples conveniently collected in the field, e.g. feather tips and blood samples. In addition, the PCR...... albumen pretreatment. The PCR proved to be a convenient tool for the monitoring of MDV in the poultry population, and feather tips were the most convenient and sensitive samples.......A serotype 1- and serotype 3-specific detection of Marek's disease virus (MDV) by polymerase chain reaction (PCR) was developed. The sensitivity of the method when applied to cell culture grown virus was comparable with that of cultivation. The method was applied to various tissue samples from...

  4. Detection and quantitative characterization of artificial extra peaks following polymerase chain reaction amplification of 14 short tandem repeat systems used in forensic investigations

    DEFF Research Database (Denmark)

    Meldgaard, Michael; Morling, N

    1997-01-01

    one repeat unit shorter than the true allele peak. The existence of such artificial peaks is of special importance when the methods are used for forensic investigations because the artificial extra peaks may simulate true alleles when samples containing mixtures of DNA from different individuals are......Detection on automated DNA sequencers of polymerase chain reaction (PCR) products of tetra- and penta-nucleotide short tandem repeat (STR) loci frequently reveals one or more extra peaks along with the true, major allele peak. The most frequent extra peak pattern is a single smaller peak which is......, while Hum-TH01, HumCD4, and D12S391 were virtually unaffected by low-stringency conditions. Replacement of the Taq DNA polymerase with DNA polymerases with lower processivity resulted in higher levels of extra peaks. Our results support the hypothesis that extra peaks are produced due to slipped...

  5. Detection of infectious bursal disease virus in various lymphoid tissues of experimentally infected specific pathogen free chickens by different reverse transcription polymerase chain reaction assays

    DEFF Research Database (Denmark)

    Kabell, Susanne; Handberg, Kurt; Kusk, Mette;

    2005-01-01

    transcription polymerase chain reaction (RT-PCR) assays, including two recently developed strain-specific assays, were employed for detection of ribonucleic acid (RNA) from three different IBDV strains in bursa tissue samples from experimentally infected specific pathogen free chickens. The virus strains......Infectious bursal disease (IBD) is a worldwide distributed immunosuppressive viral disease in young chickens, controlled by vaccination. Emergence of several strains of IBD virus (IBDV) has created a demand for strain-specific diagnostic tools. In the present experiment, five different reverse...... included vaccine strain D78, classical strain Faragher 52/70, and the very virulent Danish strain DK01 The presence of the virus infection was confirmed by histopathologic evaluation of bursa lesions. The largest number of positive samples was obtained with a strain-specific two-step multiplex (MPX) RT...

  6. Detection of the Pandemic H1N1/2009 Influenza A Virus by a Highly Sensitive Quantitative Real-time Reverse-transcription Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    Zhu Yang; Guoliang Mao; Yujun Liu; Yuan-Chuan Chen; Chengjing Liu; Jun Luo; Xihan Li

    2013-01-01

    A quantitative real time reverse-transcription polymerase chain reaction (qRT-PCR) assay with specific primers recommended by the World Health Organization (WHO) has been widely used successfully for detection and monitoring of the pandemic H1N 1/2009 influenza A virus.In this study,we report the design and characterization of a novel set of primers to be used in a qRT-PCR assay for detecting the pandemic H1N1/2009 virus.The newly designed primers target three regions that are highly conserved among the hemagglutinin (HA) genes of the pandemic H1N1/2009 viruses and are different from those targeted by the WHO-recommended primers.The qRT-PCR assays with the newly designed primers are highly specific,and as specific as the WHO-recommended primers for detecting pandemic H1N1/2009 viruses and other influenza viruses including influenza B viruses and influenza A viruses of human,swine,and raccoon dog origin.Furthermore,the qRT-PCR assays with the newly designed primers appeared to be at least 10-fold more sensitive than those with the WHO-recommended primers as the detection limits of the assays with our primers and the WHO-recommended primers were 2.5 and 25 copies of target RNA per reaction,respectively.When tested with 83 clinical samples,32 were detected to be positive using the qRT-PCR assays with our designed primers,while only 25 were positive by the assays with the WHO-recommended primers.These results suggest that the qRT-PCR system with the newly designed primers represent a highly sensitive assay for diagnosis of the pandemic H1N1/2009 virus infection.

  7. Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Silvia Cristina Osaki

    2013-06-01

    Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

  8. TPR-MET oncogenic rearrangement: Detection by polymerase chain reaction amplification of the transcript and expression in human tumor cells lines

    International Nuclear Information System (INIS)

    Activation of the MET protooncogene by a rearrangement involving the fusion of TPR and MET specific gene sequences has been observed in a human osteosarcoma cell line (HOS) treated in vitro with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). No information has been available about the possible occurrence of this rearrangement in human tumors. To facilitate rapid screening of human cell lines and tumor samples for this specific gene rearrangement; the authors developed a sensitive detection method based on polymerase chain reaction (PCR) amplification of TPR-MET mRNA. cDNA was generated from cellular transcripts by using one of the PCR primers, which was then used as a template for PCR amplification of a 205-base-pair region carrying the breakpoint. An end-labeled internal probe was hybridized in solution to an aliquot of the PCR product for detecting amplification. Cells could be directly screened by the assay without prior isolation of RNA. A 205-base-pair DNA fragment characteristic of the TRP-MET rearrangement was detected in cell lines previously known to contain this altered sequence. The rearrangement was also detected at very low levels in the parental (nontransformed) cell line, HOS TE-85. A preliminary survey of cell lines derived from a variety of human tumors indicates that TPR-MET rearrangement occurred and was expressed at very low frequencies by cells from 7 of 14 tumors of nonhematopoietic origin

  9. Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmon ovarian fluid

    Science.gov (United States)

    Pascho, R.J.; Chase, D.; McKibben, C.L.

    1998-01-01

    Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 3 109 cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 3 104 cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods.

  10. Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmonid ovarian fluid.

    Science.gov (United States)

    Pascho, R J; Chase, D; McKibben, C L

    1998-01-01

    Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 x 10(9) cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 x 10(4) cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods. PMID:9526862

  11. Comparison of Four Polymerase Chain Reaction Methods for the Rapid Detection of Human Fecal Pollution in Marine and Inland Waters

    Directory of Open Access Journals (Sweden)

    Dave S. Bachoon

    2010-01-01

    Full Text Available We compared the effectiveness of three PCR protocols for the detection of Bifidobacterium adolescentis and one PCR protocol for detecting Bacteroidales as indicators of human fecal pollution in environmental samples. Quantitative PCR indicated that a higher concentration of B. adolescentis DNA was recovered from sewage samples on the 0.2 μm filters compared to the 0.45 μm filters, and there was no evidence of qPCR inhibitors in the DNA extracts. With the Matsuki method (1999, B. adolescentis was detected only in undiluted sewage samples. The King method (2007 performed well and detected B. adolescentis in all of the sewage dilutions (from undiluted to 10−4. In contrast, the Bonjoch approach (2004 was effective at detecting B. adolescentis at lower dilutions (10−3 of sewage samples and it gave false positive results with some (3/8 pig fecal samples. Human-specific Bacteroidales (HuBacs were detected in the lower diluents of sewage samples but was positive in pig (6/8 and cattle fecal samples. PCR detection of B. adolescentis in marine samples from Puerto Rico and freshwater samples from Georgia indicated that the PCR method of King et al. (2007 and the modified Layton method for HuBac were in agreement in detecting human fecal pollution in most sites.

  12. A simple extraction procedure for efficient routine detection of pathogenic bacteria in plant material by polymerase chain reaction.

    Science.gov (United States)

    Llop, P; Caruso, P; Cubero, J; Morente, C; López, M M

    1999-07-01

    A simple and rapid method for extracting DNA from plants based on the use of an extraction buffer and precipitation with isopropanol was assayed to see its usefulness in detecting pathogenic bacteria in plant material. The method was compared with a phenol-chloroform standard procedure obtaining higher sensitivity levels of detection. The protocol developed was efficient for detecting a Gram-positive bacterium, Clavibacter michiganensis subsp. sepedonicus and several Gram-negative pathogenic bacteria (Ralstonia solanacearum, Erwinia amylovora, Xanthomonas axonopodis pv. citri) with a sensitivity of 10(2)-10(3) cfu/ml in spiked samples. It was also efficient to specifically identify such bacteria in naturally infected plant material. This procedure is proposed as a routine tool for detection of plant pathogenic bacteria, as well as in environmental microbiology and biotechnology studies. PMID:10395461

  13. Diagnostic multiplex polymerase chain reaction assay for the identification of Pseudomonas aeruginosa from the skin biopsy specimens in burn wound infections and detection of antibiotic susceptibility

    International Nuclear Information System (INIS)

    Objective was to identify Pseudomonas aeruginosa (P. aeruginosa) from the skin biopsy specimens in burn wound infections by multiplex polymerase chain reaction (M-PCR) and detection of antimicrobial susceptibility of isolates from culture. We conducted the cross-sectional study in 140 patients with wound infections who admitted to referral burn center of Motahari, Tehran, Iran, during a 12-month period from 2005-2006. Skin biopsy specimens were aseptically taken from each patient, one for PCR and one for bacterial culture. A M-PCR test based on simultaneous amplification of 2 lipoprotein genes: oprI and oprL, was used to directly detect fluorescent pseudomonades and P. aeruginosa in skin biopsy specimens. The susceptibility of P. aeruginosa isolates to 16 antibiotics was determined using the disc diffusion method. Out of 140 biopsy specimens, M-PCR detected 66 (47.2%) isolates, while culture detected 57 (40.7%) isolates as P. aeruginosa. Positive results for both genes which observed only for P. aeruginosa, while only one gene, oprI, was amplified from other fluorescent pseudomonades (n=12) and all other bacterial tested (n=62) were negative by the amplification test. The most effective antibiotics against isolate of P. aeruginosa were cefepime (79%), azetreonam (76%), ticarcillin-clavulanic acid (68%), tobramycin (62%) and amikacin (61%). Multiplex PCR assay appears promising for the rapid and sensitive detection of P. aeruginosa from the burned skin biopsy specimens. Simultaneous amplification of 2 lipoprotein genes: oprI and oprL could detect P. aeruginosa and oprI gene only for other fluorescent pseudomonades. (author)

  14. Application of real time polymerase chain reaction targeting kex 1 gene & its comparison with the conventional methods for rapid detection of Pneumocystis jirovecii in clinical specimens

    Directory of Open Access Journals (Sweden)

    Mani Revathy

    2014-01-01

    Full Text Available Background & objectives: As there are no standard laboratory techniques for the rapid detection of Pneumocystis jirovecii in India, this study was undertaken to evaluate and establish an optimal and rapid technique for the detection of P. jirovecii by comparing three different techniques - staining technique, application of a real time polymerase chain reaction (RT-PCR targeting kex 1 gene and application of nested PCR targeting mitochondrial large subunit (mtLSU gene for rapid detection of P. jirovecii in HIV positive patients. Methods: One hundred and fifty sputum specimens from HIV positive (n = 75 and HIV negative (n = 75 patients were subjected to three different techniques -KOH/Calcoflour and Grocott methanamine silver staining (GMS, RT-PCR targeting kex1 gene, PCR targeting mtLSU region followed by DNA sequencing and BLAST analysis. Results: Among the 75 HIV positive patients, P. jirovecii was detected in 19 (25.33% patients by the staining techniques, and in 23 (30.65% patients each by PCR targeting mtLSU region and by RT- PCR targeting kex1 gene of P. jirovecii. PCR based DNA sequencing targeting mtLSU region revealed 97-100 per cent sequence homology with P. jirovecii sequences in GenBank. Interpretation & conclusions: Of the three techniques for detection of P. jirovecii evaluated in this study, false negativity was found to be more in staining technique and it also required high technical expertise to interpret the result. Both nested PCR and RT-PCR were reliable and equally sensitive, in rapid detection of P. jirovecii, but RT-PCR technique also generated the copy numbers for knowing the severity of infection.

  15. Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization and real-time polymerase chain reaction.

    Science.gov (United States)

    Ha, Y; Fessehaie, A; Ling, K S; Wechter, W P; Keinath, A P; Walcott, R R

    2009-06-01

    To improve the simultaneous detection of two pathogens in cucurbit seed, a combination of magnetic capture hybridization (MCH) and multiplex real-time polymerase chain reaction (PCR) was developed. Single-stranded DNA hybridization capture probes targeting DNA of Acidovorax avenae subsp. citrulli, causal agent of bacterial fruit blotch, and Didymella bryoniae, causal agent of gummy stem blight, were covalently attached to magnetic particles and used to selectively concentrate template DNA from cucurbit seed samples. Sequestered template DNAs were subsequently amplified by multiplex real-time PCR using pathogen-specific TaqMan PCR assays. The MCH multiplex real-time PCR assay displayed a detection threshold of A. avenae subsp. citrulli at 10 CFU/ml and D. bryoniae at 10(5) conidia/ml in mixtures of pure cultures of the two pathogens, which was 10-fold more sensitive than the direct real-time PCR assays for the two pathogens separately. Although the direct real-time PCR assay displayed a detection threshold for A. avenae subsp. citrulli DNA of 100 fg/microl in 25% (1/4 samples) of the samples assayed, MCH real-time PCR demonstrated 100% detection frequency (4/4 samples) at the same DNA concentration. MCH did not improve detection sensitivity for D. bryoniae relative to direct real-time PCR using conidial suspensions or seed washes from D. bryoniae-infested cucurbit seed. However, MCH real-time PCR facilitated detection of both target pathogens in watermelon and melon seed samples (n = 5,000 seeds/sample) in which 0.02% of the seed were infested with A. avenae subsp. citrulli and 0.02% were infested with D. bryoniae. PMID:19453225

  16. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time reverse-transcription polymerase chain reaction and virus isolation.

    Science.gov (United States)

    Goodell, Christa K; Zhang, Jianqiang; Strait, Erin; Harmon, Karen; Patnayak, Devi; Otterson, Tracy; Culhane, Marie; Christopher-Hennings, Jane; Clement, Travis; Leslie-Steen, Pamela; Hesse, Richard; Anderson, Joe; Skarbek, Kevin; Vincent, Amy; Kitikoon, Pravina; Swenson, Sabrina; Jenkins-Moore, Melinda; McGill, Jodi; Rauh, Rolf; Nelson, William; O'Connell, Catherine; Shah, Rohan; Wang, Chong; Main, Rodger; Zimmerman, Jeffrey J

    2016-01-01

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 assays based on real-time reverse-transcription polymerase chain reaction (rRT-PCR) and 7 assays based on virus isolation (VI). The OF specimens were inoculated with H1N1 or H3N2 IAV and serially diluted 10-fold (10(-1) to 10(-8)). Eight participating laboratories received 180 randomized OF samples (10 replicates × 8 dilutions × 2 IAV subtypes plus 20 IAV-negative samples) and performed the rRT-PCR and VI procedure(s) of their choice. Analysis of the results with a mixed-effect logistic-regression model identified dilution and assay as variables significant (P < 0.0001) for IAV detection in OF by rRT-PCR or VI. Virus subtype was not significant for IAV detection by either rRT-PCR (P = 0.457) or VI (P = 0.101). For rRT-PCR the cycle threshold (Ct) values increased consistently with dilution but varied widely. Therefore, it was not possible to predict VI success on the basis of Ct values. The success of VI was inversely related to the dilution of the sample; the assay was generally unsuccessful at lower virus concentrations. Successful swine health monitoring and disease surveillance require assays with consistent performance, but significant differences in reproducibility were observed among the assays evaluated. PMID:26733728

  17. Development and inter-laboratory transfer of a decaplex polymerase chain reaction assay combined with capillary electrophoresis for the simultaneous detection of ten food allergens.

    Science.gov (United States)

    Cheng, Fang; Wu, Jiajie; Zhang, Jin; Pan, Aihu; Quan, Sheng; Zhang, Dabing; Kim, HaeYeong; Li, Xiang; Zhou, Shan; Yang, Litao

    2016-05-15

    Food allergies cause health risks to susceptible consumers and regulations on labeling of food allergen contents have been implemented in many countries and regions. To achieve timely and accurate food allergen labeling, the development of fast and effective allergen detection methods is very important. Herein, a decaplex polymerase chain reaction (PCR) assay combined with capillary electrophoresis was developed to detect simultaneously 10 common food allergens from hazelnut, pistachio, oat, sesame, peanut, cashew, barley, wheat, soybean and pecan. The absolute limit of detection (LODa) of this system is between 2 and 20 copies of haploid genome, and the relative LOD (LODr) is as low as 0.005% (w/w) in simulated food mixtures. The developed assay was subsequently applied to 20 commercial food products and verified the allergen ingredients stated on the labels. Furthermore, results using this decaplex PCR assay was successfully replicated in three other laboratories, demonstrating the repeatability and applicability of this assay in routine analysis of the 10 food allergens. PMID:26776037

  18. Ultrasensitive electrochemical detection of avian influenza A (H7N9) virus DNA based on isothermal exponential amplification coupled with hybridization chain reaction of DNAzyme nanowires.

    Science.gov (United States)

    Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun

    2015-02-15

    In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. PMID:25310490

  19. Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

    Science.gov (United States)

    Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

    2016-04-15

    In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. PMID:26853743

  20. Detection of high-risk subtypes of human papillomavirus in cervical swabs: routine use of the Digene Hybrid Capture assay and polymerase chain reaction analysis.

    LENUS (Irish Health Repository)

    Brennan, M M

    2012-02-03

    Human papillomaviruses (HPVs) are major causative agents in the pathogenesis of cervical cancer, and more than twenty types are associated with its development. With the introduction of liquid-based preparation systems, it is envisaged that large-scale HPV testing will be established in the near future. Preliminary studies demonstrate the accessibility of these samples for DNA testing using both the Digene Hybrid Capture assay (DHCA) and polymerase chain reaction (PCR) techniques. This study aims to assess the validity and sensitivity of the DHCA system to detect high-risk HPV DNA, using two sets of HPV consensus primers (Gp5+\\/Gp6+ and MY09\\/MY11) in tandem with routine assessment of cervical smear and biopsy samples. Results indicate that the combination of DHCA and PCR detects more high-grade lesions than does the DHCA alone. DHCA-negative cases were categorised by subsequent PCR amplification into low-grade HPV-negative (12\\/16) cervical lesions and high-grade HPV-positive (7\\/9) cervical lesions. Gp5+\\/Gp6+ primers were less sensitive in detecting HPV-positive samples than was the MY09\\/MY11 primer set. These results support the use of high-risk HPV testing by DHCA, with subsequent analysis of DHCA-negative samples by PCR using the MY09\\/MY11 primers.

  1. Detection and differentiation of Cryptosporidium by real-time polymerase chain reaction in stool samples from patients in Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Flávia Ribeiro Rolando

    2012-06-01

    Full Text Available This study reports the first genetic characterisation of Cryptosporidium isolates in Brazil using real-time polymerase chain reaction (RT-PCR. A total of 1,197 faecal specimens from children and 10 specimens from human immunodeficiency virus-infected patients were collected between 1999-2010 and screened using microscopy. Forty-eight Cryptosporidium oocyst-positive isolates were identified and analysed using a generic TaqMan assay targeting the 18S rRNA to detect Cryptosporidium species and two other TaqMan assays to identify Cryptosporidium hominis and Cryptosporidium parvum. The 18S rRNA assay detected Cryptosporidium species in all 48 of the stool specimens. The C. parvum TaqMan assay correctly identified five/48 stool samples, while 37/48 stool specimens were correctly amplified in the C. hominis TaqMan assay. The results obtained in this study support previous findings showing that C. hominis infections are more prevalent than C. parvum infections in Brazil and they demonstrate that the TaqMan RT-PCR procedure is a simple, fast and valuable tool for the detection and differentiation of Cryptosporidium species.

  2. A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3).

    Science.gov (United States)

    Glenney, Gavin W; Barbash, Patricia A; Coll, John A

    2016-03-01

    Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015. PMID:26980561

  3. Comparison of Four Polymerase Chain Reaction Methods for the Rapid Detection of Human Fecal Pollution in Marine and Inland Waters

    OpenAIRE

    Bachoon, Dave S.; Cortney M. Miller; Green, Christen P.; Ernesto Otero

    2010-01-01

    We compared the effectiveness of three PCR protocols for the detection of Bifidobacterium adolescentis and one PCR protocol for detecting Bacteroidales as indicators of human fecal pollution in environmental samples. Quantitative PCR indicated that a higher concentration of B. adolescentis DNA was recovered from sewage samples on the 0.2 μm filters compared to the 0.45 μm filters, and there was no evidence of qPCR inhibitors in the DNA extracts. With the Matsuki method (1999), ...

  4. A novel strategy for human papillomavirus detection and genotyping with SybrGreen and molecular beacon polymerase chain reaction

    NARCIS (Netherlands)

    Szuhai, K; Sandhaus, E; Kolkman-Uljee, SM; Lemaitre, M; Truffert, JC; Dirks, RW; Tanke, HJ; Fleuren, GJ; Schuuring, E; Raap, AK

    2001-01-01

    Human papillomaviruses (HPVs) play an important role in the pathogenesis of cervical cancer. For identification of the large number of different HPV types found in (pre)malignant lesions, a robust methodology is needed that combines general HPV detection with HPV genotyping. We have developed for fo

  5. Rapid detection of avian influenza virus in chicken fecal samples by immunomagnetic capture reverse transcriptase–polymerase chain reaction assay

    DEFF Research Database (Denmark)

    Dhumpa, Raghuram; Handberg, Kurt; Jørgensen, Poul Henrik;

    2011-01-01

    this study, magnetic beads were applied for immunoseparation and purification of AIV from spiked chicken fecal sample. The beads were conjugated with monoclonal antibodies against the AIV nucleoprotein, which is conserved in all the AIV. The bead-captured virus was detected by reverse transcriptase...

  6. Parallel detection of harmful algae using reverse transcription polymerase chain reaction labeling coupled with membrane-based DNA array.

    Science.gov (United States)

    Zhang, Chunyun; Chen, Guofu; Ma, Chaoshuai; Wang, Yuanyuan; Zhang, Baoyu; Wang, Guangce

    2014-03-01

    Harmful algal blooms (HABs) are a global problem, which can cause economic loss to aquaculture industry's and pose a potential threat to human health. More attention must be made on the development of effective detection methods for the causative microalgae. The traditional microscopic examination has many disadvantages, such as low efficiency, inaccuracy, and requires specialized skill in identification and especially is incompetent for parallel analysis of several morphologically similar microalgae to species level at one time. This study aimed at exploring the feasibility of using membrane-based DNA array for parallel detection of several microalgae by selecting five microaglae, including Heterosigma akashiwo, Chaetoceros debilis, Skeletonema costatum, Prorocentrum donghaiense, and Nitzschia closterium as test species. Five species-specific (taxonomic) probes were designed from variable regions of the large subunit ribosomal DNA (LSU rDNA) by visualizing the alignment of LSU rDNA of related species. The specificity of the probes was confirmed by dot blot hybridization. The membrane-based DNA array was prepared by spotting the tailed taxonomic probes onto positively charged nylon membrane. Digoxigenin (Dig) labeling of target molecules was performed by multiple PCR/RT-PCR using RNA/DNA mixture of five microalgae as template. The Dig-labeled amplification products were hybridized with the membrane-based DNA array to produce visible hybridization signal indicating the presence of target algae. Detection sensitivity comparison showed that RT-PCR labeling (RPL) coupled with hybridization was tenfold more sensitive than DNA-PCR-labeling-coupled with hybridization. Finally, the effectiveness of RPL coupled with membrane-based DNA array was validated by testing with simulated and natural water samples, respectively. All of these results indicated that RPL coupled with membrane-based DNA array is specific, simple, and sensitive for parallel detection of microalgae which

  7. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    OpenAIRE

    Mahmood Shishegar; Abolhasan Faramarzi; Tayyebe Kazemi; Akbar Bayat; Mohammad Motamedifar

    2011-01-01

    Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of midd...

  8. Comparision of Polymerase Chain Reaction and Agar Gel Immunodiffusion test in Detection of MarekAND#8217;s Disease Virus

    Directory of Open Access Journals (Sweden)

    A. Manicavasaka Dinakaran

    2010-10-01

    Full Text Available A study was undertaken to identify Marek’s disease virus (MDV antigen by PCR and AGID and to test the significance of PCR and AGID by McNemar’s test in detection of MDV antigen in outbreak in layer flocks. A total of twelve different MD outbreak flocks with varying flock size were selected in this study. Feather follicles were collected from 10 apparently healthy birds, 10 clinically affected birds and 10 dead birds separately in each outbreak. All the samples were subjected to PCR and AGID. In PCR, 42 (35.00%, 68 (56.67% and 106 (88.33% samples were positive to MDV in apparently healthy birds, clinically affected birds and dead birds respectively and in AGID 28 (23.33%, 56 (46.67% and 98 (81.67% samples were positive to MDV in apparently healthy birds, clinically affected birds and dead birds respectively. In testing the significance of PCR and AGID in detecting MDV, significant difference existed between the two tests in feather tips of apparently healthy birds (P < 0.05, whereas there was no significant difference between PCR and AGID in detection of MDV in feather tips of clinically affected and dead birds (P > 0.05. Hence, PCR can be used to screen MDV in apparently healthy birds and AGID can be used to screen MDV in clinically affected and dead birds keeping feasibility and economic consideration. [Vet. World 2010; 3(5.000: 212-214

  9. Multiplex polymerase chain reaction for the detection and differentiation of avian influenza viruses and other poultry respiratory pathogens.

    Science.gov (United States)

    Rashid, S; Naeem, K; Ahmed, Z; Saddique, N; Abbas, M A; Malik, S A

    2009-12-01

    A multiplex reverse transcription-PCR (mRT-PCR) was developed and standardized for the detection of type A influenza viruses, avian influenza virus (AIV) subtype H7, H9, and H5 hemagglutinin gene with simultaneous detection of 3 other poultry respiratory pathogens, Newcastle disease virus (NDV), infectious bronchitis virus (IBV), and infectious laryngotracheitis virus (ILTV). Seven sets of specific oligonucleotide primers were used in this study for the M gene of AIV and hemagglutinin gene of subtypes H7, H9, and H5 of AIV. Three sets of other specific oligonucleotide primers were used for the detection of avian respiratory pathogens other than AIV. The mRT-PCR DNA products were visualized by agarose gel electrophoresis and consisted of DNA fragments of 1,023 bp for M gene of AIV, 149 bp for IBV, 320 bp for NDV, and 647 bp for ILTV. The second set of primers used for m-RT-PCR of H7N3, H9N2, and H5N1 provided DNA products of 300 bp for H7, 456 bp for H5, and 808 bp for H9. The mRT-PCR products for the third format consisted of DNA fragments of 149 bp for IBV, 320 bp for NDV, 647 bp for ILTV, 300 bp for H7, 456 bp for H5, and 808 bp for H9. The sensitivity and specificity of mRT-PCR was determined and the test was found to be sensitive and specific for the detection of AIV and other poultry respiratory pathogens. In this present study, multiplex PCR technique has been developed to simultaneously detect and differentiate the 3 most important subtypes of AIV along with the 3 most common avian respiratory pathogens prevalent in poultry in Pakistan. Therefore, a mRT-PCR that can rapidly differentiate between these pathogens will be very important for the control of disease transmission in poultry and in humans, along with the identification of 3 of the most common respiratory pathogens often seen as mixed infections in poultry, and hence economic losses will be reduced in poultry. PMID:19903950

  10. Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide

    Directory of Open Access Journals (Sweden)

    Yuexia Wang

    2015-09-01

    Full Text Available Real-time polymerase chain reaction (PCR allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at −18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 103 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 100 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach.

  11. A new label technology for the detection of specific polymerase chain reaction products in a closed tube

    OpenAIRE

    Nurmi, Jussi; Ylikoski, Alice; Soukka, Tero; Karp, Matti; Lövgren, Timo

    2000-01-01

    A novel signal generation principle suitable for real time and end-point detection of specific PCR products in a closed tube is described. Linear DNA probes were labeled at their 5′-ends with a stable, fluorescent terbium chelate. The fluorescence intensity of this chelate is lower when it is coupled to single-stranded DNA than when the chelate is free in solution. The synthesized probes were used in the real time monitoring of PCR using a prototype instrument that consisted of a fluorometer ...

  12. Comparision of Polymerase Chain Reaction and Agar Gel Immunodiffusion test in Detection of MarekAND#8217;s Disease Virus

    OpenAIRE

    A. Manicavasaka Dinakaran; G. Selvaraju; Jayalakshmi, K.; T.R. Gopalakrishna Murthy; M. Geetha and S. Saravanan

    2010-01-01

    A study was undertaken to identify Marek’s disease virus (MDV) antigen by PCR and AGID and to test the significance of PCR and AGID by McNemar’s test in detection of MDV antigen in outbreak in layer flocks. A total of twelve different MD outbreak flocks with varying flock size were selected in this study. Feather follicles were collected from 10 apparently healthy birds, 10 clinically affected birds and 10 dead birds separately in each outbreak. All the samples were subjec...

  13. Polymerase Chain Reaction-based Detection of Cotton Leaf Curl and Other Whitefly-transmitted Geminiviruses from Sindh

    Directory of Open Access Journals (Sweden)

    S. Mansoor

    1998-01-01

    Full Text Available Samples of cotton plants showing symptoms of cotton leaf curl disease were collected from cotton fields in Sindh. Samples of some other plants including tomato, chillies, okra and Hibiscus suspected for whitefly-transmitted geminiviruses were also collected from these areas and total DNA was extracted. Degenerate primers designed to amplify DNA-A of whitefly-transmitted geminiviruses were used in PCR for the amplification of viral DNA. A product of expected (1.4 kb was obtained from all these samples which confirmed the infection of whitefly-transmitted geminiviruses. PCR primers specific for the two whitefly-transmitted geminiviruses species namely CLCuV-Pk1 and CLCuV-Pk2 found associated with cotton leaf curl disease in Punjab were also used to confirm the identity of cotton leaf curl virus in Sindh. A product specific for CLCuV-Pk1 was obtained from all four symptomatic cotton samples. The results showed that cotton samples were infected with CLCuV-Pk1 while CLCuV-Pk2 was not detected in these samples. This is the first report of detection of whitefly-transmitted geminiviruses on these crops from Sindh. Our data not only confirm the presence of a whitefly-transmitted geminivirus on cotton but also showed that the disease is caused by one of the virus species found in Punjab.

  14. A Heminested Polymerase Chain Reaction for the Detection of Brazilian Rabies Isolates from Vampire Bats and Herbivores

    Directory of Open Access Journals (Sweden)

    RM Soares

    2002-01-01

    Full Text Available A heminested-PCR (hn-PCR using primers to the nucleoprotein-coding gene in a nested set was evaluated in the detection of Brazilian strains of rabies virus (RV. A representative number of RV nucleoprotein sequences belonging to genotype 1 were aligned. Based on such alignment, primers were directed to highly conserved regions. All 42 clinical samples positive by both fluorescent antibody and mouse inoculation tests were also positive by the hn-PCR. Brain tissue that had been left to decompose, obtained from an experimentally inoculated mouse was tested by hn-PCR and yielded positive results. In conclusion, primers designed here were capable of amplifying Brazilian RV isolates obtained from a rural epidemiological cycle.

  15. Polymerase Chain Reaction for detection of Streptococcus mutans and Streptococcus sobrinus in dental plaque of children from Cartagena, Colombia

    Directory of Open Access Journals (Sweden)

    Luis Eduardo Carmona

    2011-11-01

    Full Text Available Objectives: To detect the presence of Streptococcus mutans and Streptococcus sobrinus in dental plaque of children from Cartagena and correlate it to dental caries precavity stages, applying a standardized PCR-based technique for epidemiological purposes.Methods: Descriptive study using a non-probabilistic sample of 50 children between 3 and 5 years of age, preschoolers from a Caribbean population in Colombia. Criteria for selection were that children should exhibit plaque accumulations on the surface of the cervical margins of the rearmost molars, and placed in one of two study groups: carious lesions and sound surfaces. Dental plaque samples from both groups were subjected to molecular analysis and statistical analysis was applied to determine the difference between the two groups using the frequencies of presence of S. mutans, S. sobrinus or both in thetwo groups applying Fisher’s exact test for association between the presence of microorganisms and the state of the tooth surface from where the dental plaque was taken.Results: The frequency of S. mutans in carious lesions was 76% and 24% in healthy surfaces. The frequency of S. sobrinus in carious lesions was 81.9% and 18.1% in caries-free surfaces. There was statistical significance between the presence of S. mutans and the presence of caries (p=0.001 and between the presence of S. sobrinus (p=0.02 and the presence of caries.There was no statistical significance between the presence of caries and the simultaneous presence of both microorganisms (p=0.08.Conclusions: The presence of S. mutans and S. sobrinus in dental plaque samples is highly prevalent and associated to non cavitated carious lesions, being the molecular identification of these microorganisms by PCR a sensitive, fast, and easy to use detection method for the mutans group of oral bacteria.

  16. Polymerase Chain Reaction for detection of Streptococcus mutans and Streptococcus sobrinus in dental plaque of children from Cartagena, Colombia

    Directory of Open Access Journals (Sweden)

    Farith González

    2011-11-01

    Full Text Available Objectives: To detect the presence of Streptococcus mutans and Streptococcus sobrinus in dental plaque of children fromCartagena and correlate it to dental caries precavity stages, applying a standardized PCR-based technique for epidemiologicalpurposes.Methods: Descriptive study using a non-probabilistic sample of 50 children between 3 and 5 years of age, preschoolersfrom a Caribbean population in Colombia. Criteria for selection were that children should exhibit plaque accumulations onthe surface of the cervical margins of the rearmost molars, and placed in one of two study groups: carious lesions and soundsurfaces. Dental plaque samples from both groups were subjected to molecular analysis and statistical analysis was appliedto determine the difference between the two groups using the frequencies of presence of S. mutans, S. sobrinus or both in thetwo groups applying Fisher’s exact test for association between the presence of microorganisms and the state of the toothsurface from where the dental plaque was taken.Results: The frequency of S. mutans in carious lesions was 76% and 24% in healthy surfaces. The frequency of S. sobrinusin carious lesions was 81.9% and 18.1% in caries-free surfaces. There was statistical significance between the presence ofS. mutans and the presence of caries (p=0.001 and between the presence of S. sobrinus (p=0.02 and the presence of caries.There was no statistical significance between the presence of caries and the simultaneous presence of both microorganisms(p=0.08.Conclusions: The presence of S. mutans and S. sobrinus in dental plaque samples is highly prevalent and associated tonon cavitated carious lesions, being the molecular identification of these microorganisms by PCR a sensitive, fast, and easyto use detection method for the mutans group of oral bacteria.

  17. Novel enzyme immunoassay and optimized DNA extraction for the detection of polymerase-chain-reaction-amplified viral DNA from paraffin-embedded tissue.

    Science.gov (United States)

    Merkelbach, S.; Gehlen, J.; Handt, S.; Füzesi, L.

    1997-01-01

    Four different DNA extraction methods were compared to determine their ability to provide DNA for amplification of viral sequences from paraffin-embedded human tissue samples by polymerase chain reaction (PCR). The suitability of extraction methods was assessed using parameters like DNA yield, length of recovered DNA fragments, and duration. Furthermore, the efficiency of amplifying a human single-copy gene, the beta-globin gene, from DNA samples was tested. The best preservation of DNA molecules could be achieved by binding the DNA onto a silica column before further purification. Viral DNA sequences could be amplified by PCR in DNA extracted from routinely processed paraffin blocks from cases with clinically or morphologically suspected cytomegalovirus or Epstein-Barr virus infections. The PCR products were specified by a novel liquid hybridization assay called PCR-enzyme-linked immunosorbent assay. Using this assay, the time-consuming Southern hybridization could be replaced and the time requirement for the detection of PCR products could be reduced from 1 day to 4 hours. The assay system described here represents a reliable, sensitive, and specific method for the detection of viral DNA from paraffin-embedded tissue samples. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:9137080

  18. Development of a duplex quantitative polymerase chain reaction assay for detection of bovine herpesvirus 1 and bovine viral diarrhea virus in bovine follicular fluid.

    Science.gov (United States)

    Marley, Mylissa S D; Givens, M Daniel; Galik, Patricia K; Riddell, Kay P; Stringfellow, David A

    2008-07-15

    The objective of this study was to develop a duplex quantitative polymerase chain reaction (qPCR) assay for simultaneous detection of bovine herpesvirus 1 (BoHV-1) and bovine viral diarrhea virus (BVDV) type I and type II. Follicular fluid was collected from a BoHV-1 acutely infected heifer, a BVDV I persistently infected heifer, and from 10 ovaries recovered from an abattoir. Both the BoHV-1 and BVDV contaminated follicular fluid were diluted 1:5 to 1:10(7) using the pooled, abattoir-origin follicular fluid. Each dilution sample was analyzed using the duplex qPCR, virus isolation, reverse transcription-nested PCR (RT-nPCR), and BoHV-1 qPCR. The duplex qPCR was able to simultaneously detect BoHV-1 and BVDV I in the fluid diluted to 1:100 and 1:1000, respectively. These results corresponded with the reverse transcription-nested PCR and BoHV-1 qPCR. Therefore, the duplex qPCR might be used for quality assurance testing to identify these two viruses in cells, fluids and tissues collected from donor animals and used in reproductive technologies. PMID:18452983

  19. Evaluation of nested polymerase chain reaction for the early detection of Leptospira spp. DNA in serum samples from patients with leptospirosis.

    Science.gov (United States)

    Blanco, Roberta Morozetti; Romero, Eliete Caló

    2014-04-01

    The aim of this study was to analyse the nested polymerase chain reaction (nested PCR) in human serum samples of patients with clinical manifestations of leptospirosis. The cases of leptospirosis were defined by the microagglutination test (MAT). The samples were collected in 2010. Of 1042 serum samples collected from 521 patients, 28 (5.4%) were considered positive cases of leptospirosis, and 493 (94.6%) were negative. Twenty-three confirmed cases had no MAT-detectable antibodies in the acute sample (mean of 5.6 days after onset). Nested PCR was positive in 22/23 (95.7%) patients during the acute phase of the disease, with negative results by MAT. Nested PCR was negative in all convalescent serum samples with positive results by MAT. All negative cases of leptospirosis were negative by nested PCR. The nested PCR is an alternative diagnostic tool for early detection of leptospires in sera during the first 7 days of the disease. PMID:24445157

  20. Detection of Onchocerca volvulus in Skin Snips by Microscopy and Real-Time Polymerase Chain Reaction: Implications for Monitoring and Evaluation Activities.

    Science.gov (United States)

    Thiele, Elizabeth A; Cama, Vitaliano A; Lakwo, Thomson; Mekasha, Sindeaw; Abanyie, Francisca; Sleshi, Markos; Kebede, Amha; Cantey, Paul T

    2016-04-01

    Microscopic evaluation of skin biopsies is the monitoring and evaluation (M and E) method currently used by multiple onchocerciasis elimination programs in Africa. However, as repeated mass drug administration suppresses microfilarial loads, the sensitivity and programmatic utility of skin snip microscopy is expected to decrease. Using a pan-filarial real-time polymerase chain reaction with melt curve analysis (qPCR-MCA), we evaluated 1) the use of a single-step molecular assay for detecting and identifying Onchocerca volvulus microfilariae in residual skin snips and 2) the sensitivity of skin snip microscopy relative to qPCR-MCA. Skin snips were collected and examined with routine microscopy in hyperendemic regions of Uganda and Ethiopia (N= 500 each) and "residual" skin snips (tissue remaining after induced microfilarial emergence) were tested with qPCR-MCA. qPCR-MCA detected Onchocerca DNA in 223 residual snips: 139 of 147 microscopy(+) and 84 among microscopy(-) snips, suggesting overall sensitivity of microscopy was 62.3% (139/223) relative to qPCR-MCA (75.6% in Uganda and 28.6% in Ethiopia). These findings demonstrate the insufficient sensitivity of skin snip microscopy for reliable programmatic monitoring. Molecular tools such as qPCR-MCA can augment sensitivity and provide diagnostic confirmation of skin biopsies and will be useful for evaluation or validation of new onchocerciasis M and E tools. PMID:26880774

  1. Evaluation of the efficacy of real-time polymerase chain reaction for the routine early detection of Pseudomonas aeruginosa in cystic fibrosis sputum and throat swab specimens.

    LENUS (Irish Health Repository)

    Logan, Catriona

    2012-02-01

    A longitudinal study of 2099 sputa and throat swabs received from 183 pediatric cystic fibrosis patients over a 29-month period was used to evaluate the efficacy of real-time polymerase chain reaction (PCR) for the early detection of Pseudomonas aeruginosa as compared to microbiologic culture. Real-time PCR resulted in an increased number of specimens identified as P. aeruginosa positive. The sensitivity of culture was 82% (373\\/453) and of PCR was 93% (420\\/453) when considering both positive culture and PCR results as true positives. Of the 80 specimens identified as PCR positive\\/culture negative for P. aeruginosa, the subsequent patient sample in 32.5% (26\\/80) of specimens concerned was identified as P. aeruginosa culture positive, suggesting that PCR has the potential to detect P. aeruginosa earlier than the microbiologic culture. Real-time PCR analysis found no evidence of the Liverpool and Manchester epidemic P. aeruginosa strains in the cohort examined. The findings of this study highlight the importance of specimen collection protocols to ensure that adequate samples are received at the laboratory for testing, thereby minimizing the potential for reporting of false-negative P. aeruginosa culture results.

  2. Real-time polymerase chain reaction (PCR) quantitative detection of Brassica napus using a locked nucleic acid TaqMan probe.

    Science.gov (United States)

    Schmidt, Anna-Mary; Rott, Michael E

    2006-02-22

    Several countries have introduced mandatory labeling requirements on foods derived from genetically modified organisms. Real-time quantitative Polymerase Chain Reaction (PCR) has quickly become the method of choice in support of these regulations and requires the development of separate PCR assays targeting the transgenic sequence as well as a specific endogenous gene sequence. To develop a Brassica napus-specific PCR assay, partial sequences of the acetyl-CoA carboxylase BnACCg8 gene from B. napus and the closely related Brassica rapa were determined and compared, and a region of unique nucleotide sequence was identified. Universal amplification primers were designed to either side of this region, and a locked nucleic acid TaqMan probe was designed to the B. napus-specific sequence. Evaluation of this primer/probe combination indicated a high level of specificity to B. napus: no amplification signal was observed with any other species tested, including five closely related Brassica species. The method was assayed with 14 different B. napus cultivars, and comparable amplification curves were consistently obtained for all. The assay was highly sensitive, with a limit of detection between 1 and 10 haploid copies. Practically, the method was demonstrated to be effective for the detection of processed food samples and for the quantification of Roundup Ready canola content in mixed samples. PMID:16478231

  3. Influence of storage time on DNA of Chlamydia trachomatis, Ureaplasma urealyticum, and Neisseria gonorrhoeae for accurate detection by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Lu, Y; Rong, C Z; Zhao, J Y; Lao, X J; Xie, L; Li, S; Qin, X

    2016-01-01

    The shipment and storage conditions of clinical samples pose a major challenge to the detection accuracy of Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), and Ureaplasma urealyticum (UU) when using quantitative real-time polymerase chain reaction (qRT-PCR). The aim of the present study was to explore the influence of storage time at 4°C on the DNA of these pathogens and its effect on their detection by qRT-PCR. CT, NG, and UU positive genital swabs from 70 patients were collected, and DNA of all samples were extracted and divided into eight aliquots. One aliquot was immediately analyzed with qRT-PCR to assess the initial pathogen load, whereas the remaining samples were stored at 4°C and analyzed after 1, 2, 3, 7, 14, 21, and 28 days. No significant differences in CT, NG, and UU DNA loads were observed between baseline (day 0) and the subsequent time points (days 1, 2, 3, 7, 14, 21, and 28) in any of the 70 samples. Although a slight increase in DNA levels was observed at day 28 compared to day 0, paired sample t-test results revealed no significant differences between the mean DNA levels at different time points following storage at 4°C (all P>0.05). Overall, the CT, UU, and NG DNA loads from all genital swab samples were stable at 4°C over a 28-day period. PMID:27580005

  4. Detection of dengue viral RNA in Aedes aegypti (Diptera: Culicidae) exposed to sticky lures using reverse-transcriptase polymerase chain reaction.

    Science.gov (United States)

    Bangs, M J; Tan, R; Listiyaningsih, E; Kay, B H; Porter, K R

    2001-09-01

    Active surveillance for dengue (DEN) virus infected mosquitoes can be an effective way to predict the risk of dengue infection in a given area. However, doing so may pose logistical problems if mosquitoes must be kept alive or frozen fresh to detect DEN virus. In an attempt to simplify mosquito processing, we evaluated the usefulness of a sticky lure and a seminested reverse-transcriptase polymerase chain reaction assay (RT-PCR) for detecting DEN virus RNA under laboratory conditions using experimentally infected Aedes aegypti (L.) mosquitoes. In the first experiment, 40 male mosquitoes were inoculated with 0.13 microl of a 10(4) pfu/ml DEN-2 stock solution. After a 7-d incubation period, the mosquitoes were applied to the sticky lure and kept at room temperatures of 23-30 degrees C. Following 7, 10, 14, and 28 d application, 10 mosquitoes each were removed from the lure, pooled, and assayed for virus. DEN virus nucleic acid was clearly detectable in all pools up to 28 d after death. A second study evaluated sensitivity and specificity using one, two, and five DEN-infected mosquitoes removed after 7,10, 14, 21, and 30 d application and tested by RT-PCR. All four DEN serotypes were individually inoculated in mosquitoes and evaluated using the same procedures as experiment 1. The four serotypes were detectable in as few as one mosquito 30 d after applications to the lure with no evidence of cross-reactivity. The combination of sticky lures and RT-PCR show promise for mosquito and dengue virus surveillance and warrant further evaluation. PMID:11580045

  5. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Directory of Open Access Journals (Sweden)

    Cui Shang-jin

    2010-05-01

    Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  6. Label-free and enzyme-free colorimetric detection of microRNA by catalyzed hairpin assembly coupled with hybridization chain reaction.

    Science.gov (United States)

    Wu, Hao; Liu, Yaling; Wang, Hongyong; Wu, Jun; Zhu, Feifan; Zou, Pei

    2016-07-15

    In this study, a simple, label-free, and enzyme-free colorimetric biosensor has been developed for amplified detection of let-7a microRNA (miRNA) on the basis of dual signal amplification strategy. The sensing system mainly consists of four unlabeled hairpin probes termed H1, H2, H3, and H4. Upon sensing of the target miRNA, hairpin H1 is opened. Then hairpin H2 hybridizes with H1 forming H1-H2 duplex and frees the target miRNA that can be recycled to trigger another reaction cycle. In addition, the newly formed H1-H2 duplex hybridizes with hairpin H3, and this triggers the autonomous cross-opening of the two hairpins H3 and H4 through hybridization chain reaction. During this process, numerous split G-quadruplex structures are generated and further associate with cofactor hemin to form massive peroxidase-mimicking DNAzymes. The resulting DNAzymes catalyze the H2O2-mediated oxidation of colorless 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS(2-)) to the green-colored ABTS(•-), inducing a remarkably amplified colorimetric signal. This newly developed sensing system exhibits high sensitivity toward miRNA with a detection limit of 7.4fM and a large dynamic range of 6 orders of magnitude from 10fM to 10nM. Furthermore, it exhibits a good performance to discriminate single-base difference among the miRNA family members and holds a great potential for early diagnosis in gene-related diseases. PMID:26985582

  7. Detection of Hepatitis B Virus (HBV) in Blood Serum By Means of PCR (Polymerase Chain Reaction) Technique

    International Nuclear Information System (INIS)

    Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer

  8. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction%连接酶链反应检测尿液中的淋病双球菌

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维

    2003-01-01

    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was performed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted diseases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR.Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively.Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.%目的 评价连接酶链反应(LCR)技术对尿液中淋病双球菌诊断的意义.方法 对在STD门诊就诊的276例尿道/宫颈炎患者进行分泌物细菌培养及尿液淋球菌LCR检测,对两项结果不符合的标本进行聚合酶链反应(PCR)检测,确定细菌培养、LCR法检测尿液中淋球菌的敏感性、特异性.结果 276例患者中24例LCR检测阳性(8.7%),21例培养阳性(7.6%).5例两项结果不符合者进行聚合酶链反应检测.结果表明LCR的敏感性及特异性分别为92.3%,100%.结论 LCR分析法检测尿液中的淋球菌具有较高的敏感性及特异性.

  9. Longitudinal study of the detection of Bluetongue virus in bull semen and comparison of real-time polymerase chain reaction assays.

    Science.gov (United States)

    Gu, Xingnian; Davis, Rodney J; Walsh, Susan J; Melville, Lorna F; Kirkland, Peter D

    2014-01-01

    Infection with Bluetongue virus (BTV) is a significant impediment to the global movement of bovine semen. Repeat testing of blood from donor animals is specified in the World Organization for Animal Health (OIE) Manual for the export of semen from regions where BTV may be present. Screening of blood or semen samples has usually been carried out by virus isolation (VI) either by inoculation of chicken embryos followed by passage onto insect and mammalian cell cultures or in vivo inoculation of sheep followed by serology to detect seroconversion. Direct testing of semen for BTV would enable earlier release of semen samples and avoid repeat testing of the donor, as well as provide an option for releasing batches of semen that were collected without certification of the donor. Quantitative (real-time) reverse transcription polymerase chain reaction (qRT-PCR) assays overcome most of the limitations of other methods and have the potential to provide higher sensitivity. The present study compared 5 qRT-PCR assays, including 2 commercially available kits, for the detection of BTV in semen serially collected from 8 bulls over a period of 90 days after experimental infection. The results of the study show that at least one of the qRT-PCR assays is extremely reproducible and has both very high sensitivity and specificity to reliably detect all available serotypes. The preferred qRT-PCR gave consistently superior results to VI, sheep inoculation, and conventional RT-PCR. Therefore, the assay can be recommended for the screening of bovine semen for freedom from BTV. PMID:24532692

  10. Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms.

    Science.gov (United States)

    Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa

    2005-01-01

    Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed. PMID:16001857

  11. 套式PCR检测蚊体内间日疟原虫子孢子%Nested polymerase chain reaction in detection of Plasmodium vivax sporozoites in mosquitoes

    Institute of Scientific and Technical Information of China (English)

    李凤舞; 牛春; 叶炳辉

    2001-01-01

    Objective To detect malaria DNA in mosquitoes. Methods A nested polymerase chain reaction (nested PCR) procedure which amplifies a 121 bp DNA of a SSUrRNA gene specific to Plasmodium vivax was used. Results In laboratory-infected mosquitoes, nested PCR could detect as few as 3 sporozoites or 1 infected mosquito mixed in a group of 99 normal ones. Furthermore, no specific 121?bp band was seen with DNA templates from other malaria parasites or negative mosquitoes. Conclusion Sensitivity and specificity obtained indicated an advantage of the nested PCR over DNA probes or direct PCR for the detection of Plasmodium vivax sporozoites in mosquitoes with low-grade parasitic infections.%目的检测蚊体内间日疟原虫DNA。 方法以疟原虫SSurRNA为模板,采用套式PCR扩增间日疟原虫特异性121bp片段。 结果在实验感染蚊中,套式PCR可检测到低至3个间日疟原虫子孢子的DNA或100只蚊中的一只阳性蚊,而其它3种人疟原虫或正常蚊DNA未扩增出条带。 结论套式PCR的敏感性及特异性表明,该方法在检测蚊体内少量疟原虫感染时,比DNA探针或直接PCR具有更大优越性。

  12. Validity of bioconjugated silica nanoparticles in comparison with direct smear, culture, and polymerase chain reaction for detection of Mycobacterium tuberculosis in sputum specimens

    Directory of Open Access Journals (Sweden)

    Ekrami A

    2011-11-01

    Full Text Available Alireza Ekrami1, Ali Reza Samarbaf-Zadeh2, Azar Khosravi1, Behrooz Zargar3, Mohamad Alavi1, Mansor Amin2, Alireza Kiasat3 1Infectious and Tropical Diseases Research Center, Ahvaz Jundishapur University of Medical Sciences, 2Department of Microbiology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, 3Department of Chemistry, School of Science, Shahid Chamran University, Ahvaz, Iran Background: Tuberculosis is a public health problem worldwide, and new easy to perform diagnostic methods with high accuracy are necessary for optimal control of the disease. Recently, fluorescent silica nanoparticles (FSNP has attracted immense interest for the detection of pathogenic microorganisms. The aim of this study was to detect Mycobacterium tuberculosis in clinical samples using bioconjugated FSNP compared with microscopic examination, polymerase chain reaction (PCR, nested PCR, and culture as the gold standard. Methods: In total, 152 sputum specimens were obtained from patients who were suspected to have pulmonary tuberculosis. All samples were examined by the four techniques described. Results: The assay showed 97.1% sensitivity (95% confidence interval [CI] 91–99.2 and 91.35% specificity (CI 78.3–97.1. Furthermore, assays using variable bacterial concentrations indicated that 100 colony forming units/mL of M. tuberculosis could be detected. There were no differences between the results obtained from two types of mouse monoclonal antibody against Hsp-65 and 16 KDa antigens. Conclusion: We performed this assay in a large number of clinical samples to confirm the diagnostic specificity and sensitivity of the test and can recommend its application for diagnosis of M. tuberculosis. We believe that this method is more convenient for routine diagnosis of M. tuberculosis in sputum and will be more easily applicable in the field, and with sufficient sensitivity. Keywords: Mycobacterium tuberculosis, fluorescent silica nanoparticles

  13. Development and use of a real-time polymerase chain reaction for the detection of group II invertebrate iridoviruses in pet lizards and prey insects.

    Science.gov (United States)

    Papp, Tibor; Spann, Dirk; Marschang, Rachel E

    2014-06-01

    Members of the genus Iridovirus (invertebrate iridoviruses [IIVs]) of the Iridoviridae family infect a wide range of invertebrates, mainly arthropods, but there have also been a few reports from other taxa. The cricket iridovirus described recently has been shown to infect a wide host range among insect orders and has also been described in several diseased reptiles. This virus together with the type species Chilo iridescent virus form a distinct "group II" in the genus. The aim of this study was to develop a fast and easy real-time polymerase chain reaction [quantitative (q)PCR] for the detection of these group II iridoviruses. In silico and in vitro assays demonstrated that the designed TaqMan primer-probe combination targeting a portion of the major capsid protein is specific for this group of IIVs. A sensitivity assay showed that it is able to detect as little as one copy of viral DNA. Direct comparison of cell culture isolation, nested (n)PCR, and qPCR methods has shown that PCR methods are 10(2)-10(3) more sensitive compared with the isolation method. In testing the three methods on routine diagnostic samples from lizards (n = 22) and crickets (n = 11), the nPCR and qPCR results were consistent with 19 positive lizards and 10 positive crickets, respectively, whereas isolation on cell culture detected only seven and six positives, respectively. QPCR is a fast, sensitive, and specific diagnostic method. Furthermore, it requires fewer handling steps than were previously required. It also allows the quantitation and comparison of the amounts of IIV DNA in samples. PMID:25000681

  14. Real-time polymerase chain reaction optimised for hepatitis C virus detection in dried blood spots from HIV-exposed infants, KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Anneta Naidoo

    2016-02-01

    Full Text Available Background: There is a paucity of data on the prevalence of hepatitis C virus (HCV in children, particularly in sub-Saharan Africa. A major obstacle in resource-limited settings for polymerase chain reaction (PCR testing is the necessity for specimen transportation and storage at low temperatures. There are numerous recent studies of using real-time HCV PCR for diagnosis and screening of plasma and serum, but few have looked at using dried blood spot (DBS specimens.Objectives: The aim of this study was to optimise a real-time HCV PCR method to detect HCV RNA from infant DBS specimens for use as a tool for HCV surveillance in KwaZulu-Natal, South Africa.Method: The LightCycler® 2.0 instrument was used for the HCV PCR using the LightCycler® RNA Master SYBR Green I kit. Template volume, primer concentration and primer annealing temperatures were optimised and the method was used on 179 DBS specimens from HIV-exposed infants in KwaZulu-Natal.Results: Primer concentrations adjusted to 0.25 µM and a template volume of 10 µL improved the PCR amplification. Primer annealing temperatures lowered from 65 °C to 58 °C resulted in higher quantities of amplified PCR product. The limit of detection of the optimised HCV PCR assay was between 1200 IU/mL and 3580 IU/mL of HCV RNA. HCV was not detected in any of the 179 DBS specimens.Conclusion: The optimised real-time HCV PCR on infant DBS specimens performed well, but HCV was not found in this surveillance study. HIV infection may have little impact on the vertical transmission of HCV in this region.

  15. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    Science.gov (United States)

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis. PMID:24712177

  16. Detection and strain differentiation of infectious bronchitis virus in tracheal tissues from experimentally infected chickens by reverse transcription-polymerase chain reaction. Comparison with an immunohistochemical technique

    DEFF Research Database (Denmark)

    Handberg, Kurt; Nielsen, O.L.; Pedersen, M.W.; Jørgensen, Poul Henrik

    1999-01-01

    Oligonucleotide pairs were constructed for priming the amplification of fragments of nucleocapsid (N) protein and spike glycoprotein (S) genes of avian infectious bronchitis virus (IBV) by reverse transcription-polymerase chain reaction (RT-PCR). One oligonucleotide pair amplified a common segment...

  17. Utility of nested polymerase chain reaction over the microscopy and immuno-chromatographic test in the detection of Plasmodium species and their clinical spectrum.

    Science.gov (United States)

    Ranjan, P; Ghoshal, U

    2016-09-01

    Though demonstration of Plasmodium parasite in peripheral blood on microscopy remains gold standard, it may miss some patients resulting in delay in instituting life-saving therapy. Studies on polymerase chain reaction (PCR), a highly sensitive and specific technique that also discriminates among different species of malaria parasite, are scanty. Hence, we aimed to evaluate the role of PCR in diagnosis and species identification of Plasmodium. Of 2186 febrile patients with clinical suspicion of malaria screened between July 2013 to February 2015, 561 patients fulfilled inclusion criteria. Microscopy, rapid diagnostic test (RDT) and PCR were performed to identify the parasite. Plasmodium was detected in 64/561 (11.40 %), 92/561 (16.40 %) and 78/561 (13.90 %) cases using microscopy, RDT and PCR, respectively. Of 78 positive cases by PCR, 47 (60.25 %) were confirmed as Plasmodium falciparum (P. falciparum), 28 (35.89 %) were Plasmodium vivax (P. vivax) and 3 (3.84 %) had mixed infections. Sensitivity and specificity of microscopy and RDT were 82.10 %, 100 % and 98.70 %, 96.90 %, respectively (p = 0.139). Of total 93 patients, 67 (72.04 %) were classified as complicated and 26 (27.96 %) were as uncomplicated. Creatinine (p = Plasmodium species. PMID:27147091

  18. Plasmid-based controls to detect rpoB mutations in Mycobacterium tuberculosis by quantitative polymerase chain reaction-high-resolution melting

    Directory of Open Access Journals (Sweden)

    Joas Lucas da Silva

    2013-02-01

    Full Text Available Quantitative polymerase chain reaction-high-resolution melting (qPCR-HRM analysis was used to screen for mutations related to drug resistance in Mycobacterium tuberculosis. We detected the C526T and C531T mutations in the rifampicin resistance-determining region (RRDR of the rpoB gene with qPCR-HRM using plasmid-based controls. A segment of the RRDR region from M. tuberculosis H37Rv and from strains carrying C531T or C526T mutations in the rpoB were cloned into pGEM-T vector and these vectors were used as controls in the qPCR-HRM analysis of 54 M. tuberculosis strains. The results were confirmed by DNA sequencing and showed that recombinant plasmids can replace genomic DNA as controls in the qPCR-HRM assay. Plasmids can be handled outside of biosafety level 3 facilities, reducing the risk of contamination and the cost of the assay. Plasmids have a high stability, are normally maintained in Escherichia coli and can be extracted in large amounts.

  19. Detection and quantification of Wuchereria bancrofti and Brugia malayi DNA in blood samples and mosquitoes using duplex droplet digital polymerase chain reaction.

    Science.gov (United States)

    Jongthawin, Jurairat; Intapan, Pewpan M; Lulitanond, Viraphong; Sanpool, Oranuch; Thanchomnang, Tongjit; Sadaow, Lakkhana; Maleewong, Wanchai

    2016-08-01

    Lymphatic filariasis, a mosquito-borne disease, is still a major public health problem in tropical and sub-tropical countries. Effective diagnostic tools are required for identification of infected individuals, for epidemiological assessment, and for monitoring of control programs. A duplex droplet digital polymerase chain reaction (ddPCR) was conducted to differentiate and quantify Wuchereria bancrofti DNA by targeting the long DNA repeat (LDR) element and Brugia malayi DNA by targeting the HhaI element in blood samples and mosquito vectors. The analytical sensitivity and specificity were evaluated. Our results indicated that the duplex ddPCR assay could differentiate and quantify W. bancrofti and B. malayi DNA from blood samples and mosquitoes. DNA from a single larva in 50 μl of a blood sample, or in one mosquito vector, could be detected. The analytical sensitivity and specificity for W. bancrofti are both 100 %. Corresponding values for B. malayi are 100 and 98.3 %, respectively. Therefore, duplex ddPCR is a potential tool for simultaneous diagnosis and monitoring of bancroftian and brugian filariasis in endemic areas. PMID:27085707

  20. Detection of herpes simplex virus DNA by polymerase chain reaction in the cerebrospinal fluid of patients with vial meningoencephalitis using primers for the glycoprotein D gene

    International Nuclear Information System (INIS)

    A novel set of primers for polymerase chain reaction (PCR) which amplified the portion of US6 sequence coding for the main type-common neutralizing epitope of glycoprotein D was used for detection of herpes simplex virus (HSV) DNA in 44 cerebrospinal fluid (CSF) samples from 29 patients with clinical symptoms of viral meningitis or meningoencephalitis. The primers in question amplified the DNA of 9 out of 10 low-passage HSV-1 isolates and of 5 out of 10 HSV-2 low passage isolates as well as the DNA of ail laboratory strains examined when tested in the supernatant fluid of infected cells cultures. The PCR was positive in 5 CSF samples (taken on days 2, 4, 8, 10 and 56 after the onset of symptoms, but not later than day 8 after starting acyclovir (ACV) therapy) obtained from 4 patients with intrathecal antibody response. The PCR was repeatedly negative in CSF of 15 patients who had antibodies to HSV in serum and CSF, but did not show intrathecal antibody production. It was also negative in 10 patients who had no HSV antibodies in CSF. Our results confirmed that positive PCR for HSV DNA in the CSF is an indication for starting and/or continuing ACV therapy even in the absence of classical symptoms of HSV encephalitis. (author)

  1. Detection of Phakopsora pachyrhizi by polymerase chain reaction (PCR) and use of germination test and DNA comet assay after e-beam processing in soybean

    International Nuclear Information System (INIS)

    Soybean harvest is the main agribusiness in Brazil, which is the second largest exporter in the world and has a revenue of billions of dollars. Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is difficult to control, since it occurs through wind dispersion. Actually P. pachyrhizi is found in different parts of the world. Electron beam treatment could be an alternative process to minimize these losses, especially for the grains exportation industry. Besides the possibility of being disconnected when not in use, this source does not need to be reloaded, is easily available and, streamlines the process and reduces logistics costs. The present work aims to identify, by the polymerase chain reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soybeans and the possibility to use radiation treatment as a sanitary alternative. Doses 0, 1.0, 2.0, 5.0, 6.0, 7.0, 8.0, 9.0 and 10.0 kGy (IPEN-CNEN/SP Electron Accelerator) were applied and two fast-screening methods were performed: DNA comet assay (for the detection of DNA damage) and germination test (for the measurement of roots inhibition). These tests are very easy to carry out and measure damage response depending on radiation dose

  2. A rapid, 2-well, multiplex real-time polymerase chain reaction assay for the detection of SCCmec types I to V in methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Valvatne, Håvard; Rijnders, Michelle I A; Budimir, Ana; Boumans, Marie-Louise; de Neeling, Albert J; Beisser, Patrick S; Stobberingh, Ellen E; Deurenberg, Ruud H

    2009-12-01

    For us to assess the spread of methicillin-resistant Staphylococcus aureus (MRSA), typing of the staphylococcal cassette chromosome mec (SCCmec) is a valuable addition to existing typing methods, such as multilocus sequence typing (MLST). Traditional SCCmec typing assays, that is, that of Oliveira et al. and Ito et al., are polymerase chain reaction (PCR) based, requiring electrophoresis. We introduce a rapid, 2-well, multiplex real-time PCR assay that can be used directly on bacterial suspensions and is able to characterize SCCmec type I to V based on the detection of the ccr genes and the mec complex. The assay was evaluated on 212 clinical MRSA isolates from various countries, associated with MLST clonal complexes (CC) 1, 5, 8, 22, 30, and 45, as well as pig-associated CC398. When comparing the real-time PCR assay with traditional methods, the correct SCCmec element was identified in 209 (99%) of the 212 MRSA isolates. The new assay enables high-throughput analyses for SCCmec on large strain collections. PMID:19781888

  3. Detection of very low level Plasmodium falciparum infections using the nested polymerase chain reaction and a reassessment of the epidemiology of unstable malaria in Sudan

    DEFF Research Database (Denmark)

    Roper, C; Elhassan, I M; Hviid, L;

    1996-01-01

    We have used the nested polymerase chain reaction (PCR) to assay for low level Plasmodium falciparum infections that were below the threshold of detection of blood film examination. This revealed a substantial group of asymptomatic, submicroscopically patent infections within the population of a...

  4. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity of...

  5. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  6. Detection of Klebsiella pneumoniae in Emulsifiable Dust by Polymerase Chain Reaction Assay%PCR检测乳粉中肺炎克雷伯氏菌

    Institute of Scientific and Technical Information of China (English)

    秦丽; 周正; 穆燕魁; 吴涛; 周巍

    2011-01-01

    A uniplex polymerase chain reaction(PCR) assay was developed for direct detection Klebsiella pneumoniae without enrichment in emulsifiable dust. A solvent extraction procedure was successfully modified for extraction of Klebsiella pneumoniae DNA from artifically by contaminated whole milk, skim milk and cheese. Primer targeting the thermostable nuclease gene(ITS) was used in the uniplex PCR. A DNA fragment of 158 bp was amplified. PCR product was confirmed by DNA sequencing. The sensitivity of the uniplex PCR is 10 CFU/mL.The developed methodology allows detection of Klebsiella pneumoniae in emulsifiable dust in less than 6 h, the time of this developed PCR assay is 12~24 h less than the time of general PCR assay with enrichment method.%利用PCR技术直接检测乳粉中的肺炎克雷伯氏菌,无需增菌.通过滤膜法成功地从人工污染肺炎克雷伯氏菌的乳粉中提取了肺炎克雷伯氏菌的DNA.以肺炎克雷伯氏菌的间区序列(ITS)为靶基因,经过PCR扩增得到158 bp的产物,经过DNA测序证实该产物为目的扩增产物.该方法灵敏度高,乳粉中检测的灵敏度为10CFU/mL,可在6 h内完成对乳品中肺炎克雷伯氏菌的检测,比目前普遍采用的先增菌再进行PCR检测的方法缩短了12-24 h.

  7. Detection of Human Metapneumovirus and Respiratory Syncytial Virus by Real-Time Polymerase Chain Reaction Among Hospitalized Young Children in Iran

    Science.gov (United States)

    Parsania, Masoud; Poopak, Behzad; Pouriayevali, Mohammad Hassan; Haghighi, Sama; Amirkhani, Aref; Nateghian, Alireza

    2016-01-01

    Background Acute respiratory infection plays an important role in hospitalization of children in developing countries; detection of viral causes in such infections is very important. The respiratory syncytial virus (RSV) is the most common etiological agent of viral lower respiratory tract infection in children, and human metapneumovirus (hMPV) is associated with both upper and lower respiratory tract infections among infants and children. Objectives This study evaluated the frequency and seasonal prevalence of hMPV and RSV in hospitalized children under the age of five, who were admitted to Aliasghar children’s hospital of Iran University of Medical Sciences from March 2010 until March 2013. Patients and Methods Nasopharyngeal or throat swabs from 158 hospitalized children with fever and respiratory distress were evaluated for RSV and hMPV RNA by the real-time polymerase chain reaction (PCR) method. Results Among the 158 children evaluated in this study, 49 individuals (31.1%) had RSV infection while nine individuals (5.7%) had hMPV infection. Five (55.5%) of the hMPV-infected children were male while four (44.5%) were female and 27 (55.2%) of the RSV-infected patients were females and 22 (44.8%) were males. The RSV infections were detected in mainly one year old children. Both RSV and hMPV infections had occurred mainly during winter and spring seasons. Conclusions Respiratory syncytial virus was the major cause of acute respiratory infection in children under one-year of age while human metapneumovirus had a low prevalence in this group. The seasonal occurrence of both viruses was the same.

  8. Comparison of disc and MIC reduction methods with polymerase chain reaction for the detection of metallo-β-lactamase in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    S Buchunde

    2012-01-01

    Full Text Available Purpose: The present study was undertaken to evaluate the screening antibiotic, confirmatory phenotypic test and agent against PCR as gold standard and to detect the prevalent MBL gene. Materials and Methods: Three hundred and twenty-six Pseudomonas aeruginosa isolates were screened for resistance to Imipenem (IPM, Meropemem (MEM and Ceftazidime (CAZ by disc diffusion. Isolates resistant to any of these were considered screen test-positive for MBL and were subjected to Double disc synergy test (DDST and Disc potentiation test (DPT: Using IPM, MEM and CAZ alone and with EDTA, Minimum inhibitory concentration (MIC reduction [four-fold or more reduction in MIC of IPM and MEM in presence of chelators: EDTA and 1,10-phenanthroline (EPI/EPM: EDTA-phenanthroline- Imipenem/Meropenem Broth Microdilution method] and polymerase chain reaction (PCR for blaIMP and blaVIM . Results: Screen test-positives by MEM and CAZ were 19.3% as against 17.8% by IPM. MEMDDST, DPT and EPM confirmed 100% screen-test positives as against 93.7% by CAZ DDST and DPT-2, 76.2% by CAZ DPT-1, 88.9% by IPM DDST, 85.7% by IPM DPT-1 and 92.1% by EPI. IPMand CAZ DDST together confirmed 100% while IPM and CAZ DPT-2 confirmed 96.8%. All 63 screen-test positives showed the presence of blaVIM . Conclusions: MEM was found to be the best screening and confirmatory agent for MBL detection and blaVIM was found to be the prevalent MBL gene in this part of the country.

  9. Detection of Pseudomonas aeruginosa by a triplex polymerase chain reaction assay based on lasI/R and gyrB genes.

    Science.gov (United States)

    Aghamollaei, Hosseine; Moghaddam, Mehrdad M; Kooshki, Hamid; Heiat, Mohammad; Mirnejad, Reza; Barzi, Nastaran S

    2015-01-01

    Pseudomonas aeruginosa is a nosocomial pathogen, which, due to its inherent and acquired resistance to a wide range of antibiotics, causes high mortality rates. Therefore, rapid detection of the bacterium with high specificity and sensitivity plays a critical role in the control of the pathogenic bacterium. The aim of this study was to evaluate the accuracy and specificity of a prompt detection of the bacterium based on a triplex polymerase chain reaction that amplifies the lasI, lasR and gyrB genes. For this purpose, 30 clinical isolates of P. aeruginosa and 30 wound biopsy samples were retrieved from clinical diagnostic laboratories. After the extraction of the chromosomal DNA, the desired genes were amplified using uniplex and triplex PCR with appropriate primers. The specificity of the primers was evaluated by a comparison of the PCR results for P. aeruginosa clinical samples and non-Pseudomonas species control samples. The sensitivity of the primers was determined using a serial dilution of the genomic DNA template (100 ng to 100 fg) and by a comparison of the PCR and bacterial culture results. The results showed that the triplex PCR assay was positive for all of the samples (100%), while the PCR identifications were negative for non-Pseudomonas species. Additionally, at 10(-4) and 10(-5) diluted genomic DNA from P. aeruginosa (10 pg and 1 pg), the triplex PCR test was positive for the Las and gyrB genes in all of the samples, respectively. Based on these results, the designed primers can be used for the rapid, specific and sensitive diagnosis of P. aeruginosa in a triplex PCR assay. PMID:25863575

  10. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  11. PCR技术检测空肠弯曲菌的研究进展%Advances in detection of Campylobacter jejuni by polymerase chain reaction technology

    Institute of Scientific and Technical Information of China (English)

    陈金; 毕水莲

    2015-01-01

    空肠弯曲菌(Campylobacter jejuni)是一种人畜共患病病原菌,可以使人和动物引发多种疾病。目前,检测C. jejuni采用的国标方法是传统的培养法,但C. jejuni培养条件苛刻,且培养法存在操作繁琐、特异性不强、费时等缺点。聚合酶链式反应(polymerase chain reaction, PCR)以其快速、准确、灵敏度高、特异性强的特点,现已广泛应用于C. jejuni的检测,并成为目前快速检测临床与食品中C. jejuni最常用的的方法。本文综述了近年来利用RCR技术,包括常规PCR、多重PCR、巢式PCR、实时荧光定量PCR、PCR-酶联免疫吸附法、最大几率数-PCR、PCR-限制性片段长度多态性、PCR-变性高效液相色谱、PCR-变性梯度凝胶电泳和磁捕获-荧光PCR方法检测C. jejuni的研究进展,并针对这些PCR技术的原理、检测效果、优点和缺点等方面进行了分析比较,为有效控制和预防该菌引起的疾病提供重要信息。%ABSTRACT:As a zoonotic pathogen, Campylobacter jejuni could cause lots of diseases of human and animal. At present, plate-culture method is used to detect C. jejuni as the national standard. But the cultivation conditions of C. jejuni are very strict, and the plate-culture method has the disadvantages such as complicated operation, specificity, and time consuming. Polymerase chain reaction, which is excellent for the rapid, accurate, high sensitivity and specificity, has been widely used in the detection of C. jejuni, and become the most common method for the rapid detection of C. jejuni in clinical and food samples. The recent research progress was summarized in this paper and the principle, effect and characteristics among conventional PCR, multiplex PCR, nested PCR, real-time PCR, PCR-ELISA, MPN (most probable number)-PCR, PCR-RFLP (restriction fragment length polymorphism), PCR-DHPLC (denaturing high performance liquid chromatography), PCR-DGGE (denaturing gradient gel electrophoresis) and IMC

  12. LOW-LEVEL MALARIA INFECTIONS DETECTED BY A SENSITIVE POLYMERASE CHAIN REACTION ASSAY AND USE OF THIS TECHNIQUE IN THE EVALUATION OF MALARIA VACCINES IN AN ENDEMIC AREA

    OpenAIRE

    Imoukhuede, Egeruan B; Andrews, Laura; Milligan, Paul; Berthoud, Tamara; Bojang, Kalifa; Nwakanma, Davis; Ismaili, Jamila; Buckee, Caroline; Njie, Fanta; KEITA, SAIKOU; Sowe, Maimuna; Lang, Trudie; Gilbert, Sarah C.; Greenwood, Brian M.; Hill, Adrian V. S.

    2007-01-01

    The feasibility of using a sensitive polymerase chain reaction (PCR) to evaluate malaria vaccines in small group sizes was tested in 102 adult Gambian volunteers who received either the malaria vaccine regimen FP9 ME-TRAP/MVA ME-TRAP or rabies vaccine. All volunteers received the antimalarial drugs primaquine and Lapdap plus artesunate to eliminate malaria parasites. Volunteers in a further group received an additional single treatment with sulfadoxine-pyrimethamine (SP) to prevent new infect...

  13. Novel enzyme immunoassay and optimized DNA extraction for the detection of polymerase-chain-reaction-amplified viral DNA from paraffin-embedded tissue.

    OpenAIRE

    Merkelbach, S.; Gehlen, J.; Handt, S.; Füzesi, L

    1997-01-01

    Four different DNA extraction methods were compared to determine their ability to provide DNA for amplification of viral sequences from paraffin-embedded human tissue samples by polymerase chain reaction (PCR). The suitability of extraction methods was assessed using parameters like DNA yield, length of recovered DNA fragments, and duration. Furthermore, the efficiency of amplifying a human single-copy gene, the beta-globin gene, from DNA samples was tested. The best preservation of DNA molec...

  14. Detection of varicella-zoster virus DNA using the polymerase chain reaction in an immunocompromised patient with transverse myelitis secondary to herpes zoster.

    OpenAIRE

    Grant, A. D.; Fox, J D; Brink, N. S.; Miller, R F

    1993-01-01

    A case of herpes zoster transverse myelitis is described in which the clinical diagnosis was confirmed by demonstrating the presence of varicella-zoster virus (VZV) DNA in the cerebrospinal fluid (CSF) by amplification using the polymerase chain reaction. This case illustrates the potential role of the selective amplification of VZV DNA from CSF in contributing to the diagnosis of neurological complications associated with VZV infection.

  15. Comparison of the accuracy of Hybrid Capture II and polymerase chain reaction in detecting clinically important cervical dysplasia: a systematic review and meta-analysis

    Science.gov (United States)

    Luu, Hung N; Dahlstrom, Kristina R; Mullen, Patricia Dolan; VonVille, Helena M; Scheurer, Michael E

    2013-01-01

    The effectiveness of screening programs for cervical cancer has benefited from the inclusion of Human papillomavirus (HPV) DNA assays; which assay to choose, however, is not clear based on previous reviews. Our review addressed test accuracy of Hybrid Capture II (HCII) and polymerase chain reaction (PCR) assays based on studies with stronger designs and with more clinically relevant outcomes. We searched OvidMedline, PubMed, and the Cochrane Library for English language studies comparing both tests, published 1985–2012, with cervical dysplasia defined by the Bethesda classification. Meta-analysis provided pooled sensitivity, specificity, and 95% confidence intervals (CIs); meta-regression identified sources of heterogeneity. From 29 reports, we found that the pooled sensitivity and specificity to detect high-grade squamous intraepithelial lesion (HSIL) was higher for HCII than PCR (0.89 [CI: 0.89–0.90] and 0.85 [CI: 0.84–0.86] vs. 0.73 [CI: 0.73–0.74] and 0.62 [CI: 0.62–0.64]). Both assays had higher accuracy to detect cervical dysplasia in Europe than in Asia-Pacific or North America (diagnostic odd ratio – dOR = 4.08 [CI: 1.39–11.91] and 4.56 [CI: 1.86–11.17] for HCII vs. 2.66 [CI: 1.16–6.53] and 3.78 [CI: 1.50–9.51] for PCR) and accuracy to detect HSIL than atypical squamous cells of undetermined significance (ASCUS)/ low-grade squamous intraepithelial lesion (LSIL) (HCII-dOR = 9.04 [CI: 4.12–19.86] and PCR-dOR = 5.60 [CI: 2.87–10.94]). For HCII, using histology as a gold standard results in higher accuracy than using cytology (dOR = 2.87 [CI: 1.31–6.29]). Based on higher test accuracy, our results support the use of HCII in cervical cancer screening programs. The role of HPV type distribution should be explored to determine the worldwide comparability of HPV test accuracy. PMID:23930214

  16. Comparison of the accuracy of Hybrid Capture II and polymerase chain reaction in detecting clinically important cervical dysplasia: a systematic review and meta-analysis

    International Nuclear Information System (INIS)

    The effectiveness of screening programs for cervical cancer has benefited from the inclusion of Human papillomavirus (HPV) DNA assays; which assay to choose, however, is not clear based on previous reviews. Our review addressed test accuracy of Hybrid Capture II (HCII) and polymerase chain reaction (PCR) assays based on studies with stronger designs and with more clinically relevant outcomes. We searched OvidMedline, PubMed, and the Cochrane Library for English language studies comparing both tests, published 1985–2012, with cervical dysplasia defined by the Bethesda classification. Meta-analysis provided pooled sensitivity, specificity, and 95% confidence intervals (CIs); meta-regression identified sources of heterogeneity. From 29 reports, we found that the pooled sensitivity and specificity to detect high-grade squamous intraepithelial lesion (HSIL) was higher for HCII than PCR (0.89 [CI: 0.89–0.90] and 0.85 [CI: 0.84–0.86] vs. 0.73 [CI: 0.73–0.74] and 0.62 [CI: 0.62–0.64]). Both assays had higher accuracy to detect cervical dysplasia in Europe than in Asia-Pacific or North America (diagnostic odd ratio – dOR = 4.08 [CI: 1.39–11.91] and 4.56 [CI: 1.86–11.17] for HCII vs. 2.66 [CI: 1.16–6.53] and 3.78 [CI: 1.50–9.51] for PCR) and accuracy to detect HSIL than atypical squamous cells of undetermined significance (ASCUS)/ low-grade squamous intraepithelial lesion (LSIL) (HCII-dOR = 9.04 [CI: 4.12–19.86] and PCR-dOR = 5.60 [CI: 2.87–10.94]). For HCII, using histology as a gold standard results in higher accuracy than using cytology (dOR = 2.87 [CI: 1.31–6.29]). Based on higher test accuracy, our results support the use of HCII in cervical cancer screening programs. The role of HPV type distribution should be explored to determine the worldwide comparability of HPV test accuracy

  17. Development and validation of a real-time Taqman polymerase chain reaction assay for the detection of Mycoplasma gallisepticum in naturally infected birds

    Science.gov (United States)

    In this study, we report the development and validation of a real-time PCR assay using a Taqman labeled probe (MGLP assay) for the detection of Mycoplasma gallisepticum (M. gallisepticum). The MGLP assay was highly specific with a detection limit of 25 template copies/reaction and a quantification l...

  18. Detection of hepatocyte growth factor/scatter factor receptor (c-Met) in axillary drainage after operations for breast cancer using reverse transcriptase–polymerase chain reaction

    International Nuclear Information System (INIS)

    The diverse biological effects of hepatocyte growth factor/scatter factor (HGF/SF) are mediated by c-Met, which is preferentially expressed on epithelial cells. Met signaling has a role in normal cellular activities, and may be associated with the development and progression of malignant processes. In this study we examined whether Met can be detected in the axillary drainage from patients who underwent conservative operations for breast cancer, and its prognostic significance. Thirty-one consecutive patients with invasive ductal carcinoma of the breast suitable for breast-conserving treatment were studied. The output of the drain that had been placed in the axilla during the operation was collected, and the presence of Met and β-actin were assessed by reverse transcriptase–polymerase chain reaction (RT–PCR) assays. The data were compared with the pathological features of the tumor and the axillary lymph nodes, and with the estrogen receptor and progesterone receptor status. RT–PCR of the axillary lymphatic drainage was positive for Met in 23 (74.2%) of the patients. Positive assays were correlated with increasing tumor size and grade, with capillary and lymphatic invasion, and with lymph node metastasis (P < 0.02, for all comparisons). All 12 patients with axillary lymph node metastases had positive assays for Met, compared with 57.9% of patients without lymph node metastases. All five patients with tumor involvement in the margins of the resection had positive assays for Met in their lymphatic fluid, compared with 18 of 26 positive assays (69.2%) for patients without involved margins (P < 0.04). Finally, Met showed negative correlations with positivity for estrogen receptor and progesterone receptor (P < 0.02). Met can be detected in the axillary fluids of patients with breast cancer and its expression in the axillary drainage may have potential as a prognostic factor. This finding might be relevant to therapeutic considerations, because a positive assay

  19. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    Science.gov (United States)

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M

  20. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte;

    2012-01-01

    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... commercial kits used in the ring trial could identify all different PRRSV strains with an optimal analytical and diagnostic sensitivity. The genetic variability of the PRRSV strains, which is supposed to hinder the diagnostic of the RT-PCR because of mutations at the primer binding sites, was also confirmed...

  1. Streptococcus mutans and Streptococcus sobrinus detection by Polymerase Chain Reaction and their relation to dental caries in 12 and 15 year-old schoolchildren in Valencia (Spain)

    OpenAIRE

    Sánchez Acedo, Mateo; Montiel Company, José María; Dasí Fernández, Francisco; Almerich Silla, José Manuel

    2013-01-01

    A cross-sectional study was carried out to determine the prevalence of Streptococcus mutans and Streptococcus sobrinus and the association of the two in a random sample (n=614) of the child population of the region of Valencia (Spain). Saliva samples were analyzed by the quantitative polymerase chain reaction (PCR) method to study the relation of these bacteria to caries prevalence and the DMFT index. The prevalence of S. mutans was 35.4% at age 12 and 22.9% at age 15, that of S. sobrinus 18....

  2. Detection and quantification of MBR/JH2 t(14;18) BCL-2 gene rearrangement in follicular lymphoma using a combined real-time polymerase chain reaction assay.

    Science.gov (United States)

    Csernák, Erzsébet; Tóth, Erika; Melegh, Zsombor; Schneider, Tamás; Rosta, András; Szentirmay, Zoltán

    2006-06-01

    We report our experience with a new real-time polymerase chain reaction (PCR) assay applicable for simultaneous quantification and characterization of MBR/JH translocation in follicular lymphomas. This technique, which combines amplification with the FRET probe with SYBR Green I melting curve analysis, allows efficient detection of tumor cells in bone marrow or peripheral blood and their comparison with the original neoplastic clone. PMID:16704964

  3. Transformational leadership: a cascading chain reaction.

    Science.gov (United States)

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  4. Detection of genomic mutations in katG, inhA and rpoB genes of Mycobacterium tuberculosis isolates using polymerase chain reaction and multiplex allele-specific polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Azar Dokht Khosravi

    2012-02-01

    Full Text Available OBJECTIVE: Isoniazid (INH and rifampin (RIF are the most effective first line antibiotics against Mycobacterium tuberculosis. Mutations in several genes determine resistance of M. tuberculosis to INH, with the most common gene target of katG, and resistance to RIF is due to mutation in rpoB gene. The aim of present study was to assess the mutations in the regions related to RIF and INH resistance. METHODS: We characterized 80 clinical isolates of confirmed M. tuberculosis to analyze the most commonly observed INH and RIF mutations. PCR analysis and sequencing were used to detect mutations related to RIF and INH resistance. The multiplex allele-specific-PCR (MAS-PCR was performed as a comparative assay and for evaluation of this method. RESULTS: The sequencing of the 250-bp region of katG codon 315, revealed point mutations at 5 different codons in 13.7% of the M. tuberculosis isolates. The sequencing of the 270-bp central region of the rpoB gene revealed point mutations at 7 different codons in 12 (15% of the M. tuberculosis isolates. The results obtained with MAS-PCR are in accordance with PCR-sequencing with high sensitivity and specificity for katG315, inhA15, and rpoB (531, 516, 526. CONCLUSION: The results of this study suggested that molecular techniques can be used as a rapid tool for the identification of drug resistance in clinical isolates of M. tuberculosis. Both DNA sequencing and MAS-PCR yielded high sensitivity for the detection of RIF and INH mutations and detecting multi-drug resistant tuberculosis cases.

  5. [Detection of the eggs of Echinococcus multilocularis Leuckart, 1863, in the feces of the fox (Vulpes vulpes Linnaeus, 1758) by the polymerase chain reaction].

    Science.gov (United States)

    Bretagne, S; Guillou, J P; Morand, M; Houin, R

    1992-12-01

    The polymerase chain reaction (PCR) was applied to the identification of eggs of Echinococcus multilocularis in faeces from foxes. The test was positive in three of six faeces samples from foxes which were harbouring adult worms, and in one of four samples from foxes in which no adult E. multilocularis was found in the intestines. These initial results show that it is possible to use PCR to identify E. multilocularis eggs in faeces. PCR can be used to complement examination of intestinal contents, showing that the distribution of eggs in faeces is uneven. The sensitivity of the test was estimated to be 50 eggs in 5 g of faeces. Further work is needed to confirm these initial results before the test can be used more widely. PMID:1305852

  6. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  7. Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney.

    Science.gov (United States)

    Chase, D M; Pascho, R J

    1998-11-30

    Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. Development of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively. PMID:9925428

  8. Detection of hemoplasma infection of goats by use of a quantitative polymerase chain reaction assay and risk factor analysis for infection.

    Science.gov (United States)

    Johnson, Kathy A; do Nascimento, Naíla C; Bauer, Amy E; Weng, Hsin-Yi; Hammac, G Kenitra; Messick, Joanne B

    2016-08-01

    OBJECTIVE To develop and validate a real-time quantitative PCR (qPCR) assay for the detection and quantification of Mycoplasma ovis in goats and investigate the prevalence and risk factors for hemoplasma infection of goats located in Indiana. ANIMALS 362 adult female goats on 61 farms. PROCEDURES Primers were designed for amplification of a fragment of the dnaK gene of M ovis by use of a qPCR assay. Blood samples were collected into EDTA-containing tubes for use in total DNA extraction, blood film evaluation, and determination of PCV. Limit of detection, intra-assay variability, interassay variability, and specificity of the assay were determined. RESULTS Reaction efficiency of the qPCR assay was 94.45% (R(2), 0.99; slope, -3.4623), and the assay consistently detected as few as 10 copies of plasmid/reaction. Prevalence of infection in goats on the basis of results for the qPCR assay was 18.0% (95% confidence interval, 14% to 22%), with infected goats ranging from 1 to 14 years old, whereby 61% (95% confidence interval, 47% to 73%) of the farms had at least 1 infected goat. Bacterial load in goats infected with M ovis ranged from 1.05 × 10(3) target copies/mL of blood to 1.85 × 10(5) target copies/mL of blood; however, no bacteria were observed on blood films. Production use of a goat was the only risk factor significantly associated with hemoplasma infection. CONCLUSIONS AND CLINICAL RELEVANCE The qPCR assay was more sensitive for detecting hemoplasma infection than was evaluation of a blood film, and production use of a goat was a risk factor for infection. PMID:27463552

  9. Comparison of the performance of polymerase chain reaction and pp65 antigenemia for the detection of human cytomegalovirus in immunosuppressed patients

    Directory of Open Access Journals (Sweden)

    Patrícia Borba Martiny

    2011-06-01

    Full Text Available INTRODUCTION: Human cytomegalovirus (HCMV is often reactive in latently infected immunosuppressed patients. Accordingly, HCMV remains one of the most common infections following solid organ and hemopoietic stem cell transplantations, resulting in significant morbidity, graft loss and occasional mortality. The early diagnosis of HCMV disease is important in immunosuppressed patients, since in these individuals, preemptive treatment is useful. The objective of this study was to compare the performance of the in-house qualitative polymerase chain reaction (PCR and pp65 antigenemia to HCMV infection in immunosuppressed patients in the Hospital de Clínicas of Porto Alegre (HCPA. METHODS: A total of 216 blood samples collected between August 2006 and January 2007 were investigated. RESULTS: Among the samples analyzed, 81 (37.5% were HCMV-positive by PCR, while 48 (22.2% were positive for antigenemia. Considering antigenemia as the gold standard, sensitivity, specificity, positive predictive values and negative predictive values for PCR were 87.5%, 76.8%, 51.8% and 95.5% respectively. CONCLUSIONS: These results demonstrated that qualitative PCR has high sensitivity and negative predictive value (NPV. Consequently PCR is especially indicated for the initial diagnosis of HCMV infection. In the case of preemptive treatment strategy, identification of patients at high-risk for HCMV disease is fundamental and PCR can be useful tool.

  10. Detection of replication-defective hepatitis A virus based on the correlation between real-time polymerase chain reaction and ELISA in situ results

    Directory of Open Access Journals (Sweden)

    Alyne Moraes Costa

    2013-02-01

    Full Text Available ELISA in situ can be used to titrate hepatitis A virus (HAV particles and real-time polymerase chain reaction (RT-PCR has been shown to be a fast method to quantify the HAV genome. Precise quantification of viral concentration is necessary to distinguish between infectious and non-infectious particles. The purpose of this study was to compare cell culture and RT-PCR quantification results and determine whether HAV genome quantification can be correlated with infectivity. For this purpose, three stocks of undiluted, five-fold diluted and 10-fold diluted HAV were prepared to inoculate cells in a 96-well plate. Monolayers were then incubated for seven, 10 and 14 days and the correlation between the ELISA in situ and RT-PCR results was evaluated. At 10 days post-incubation, the highest viral load was observed in all stocks of HAV via RT-PCR (10(5 copies/mL (p = 0.0002, while ELISA revealed the highest quantity of particles after 14 days (optical density = 0.24, p < 0.001. At seven days post-infection, there was a significant statistical correlation between the results of the two methods, indicating equivalents titres of particles and HAV genome during this period of infection. The results reported here indicate that the duration of growth of HAV in cell culture must be taken into account to correlate genome quantification with infectivity.

  11. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  12. Polymerase chain reaction for the diagnosis of viral hepatitis B and C.

    OpenAIRE

    Bréchot, C

    1993-01-01

    Polymerase chain reaction is a highly sensitive technique for the detection of hepatitis B virus-DNA and hepatitis C virus-RNA in serum, liver tissue, and peripheral mononuclear blood cells. In chronic hepatitis B, it is particularly useful for identification of infectious subjects who are hepatitis B surface antigen positive and anti-hepatitis B e antigen antibody-positive, and for follow up of hepatitis B virus infections in liver transplantation programmes. Polymerase chain reaction detect...

  13. Evaluation of a conjunctival swab polymerase chain reaction for the detection of Leishmania infantum in dogs in a non-endemic area.

    Science.gov (United States)

    Geisweid, K; Weber, K; Sauter-Louis, C; Hartmann, K

    2013-10-01

    Due to the increasing numbers of dogs imported from or visiting Mediterranean countries, canine leishmaniasis has become an important infectious disease in countries where natural transmission typically does not occur. Although conjunctival swabs have recently been described as a useful diagnostic tool in endemic areas, their usefulness in non-endemic areas is unknown. The aim of this study was to evaluate the sensitivity and specificity of a conjunctival swab polymerase chain reaction (PCR) in dogs in a non-endemic area. Dogs (n=74) that were presented for suspected canine leishmaniasis or for screening purposes after a history of travelling were prospectively included. PCR results from conjunctival swabs were compared to those from bone marrow, lymph nodes and blood and also to antibody results determined by an indirect immunofluorescence antibody test or enzyme-linked immunosorbent assay. Dogs were considered infected if bone marrow, lymph node, or blood PCR was positive and were defined as not infected if bone marrow PCR, the gold standard of testing, was negative. The sensitivity and specificity of the conjunctival swab PCR were 78.4% (confidence interval [CI] 95%, 62.8-88.6) and 93.8% (CI 95%, 79.8-98.3), respectively. There was substantial agreement between PCR results from conjunctival swabs and lymph nodes (κ=0.642), fair to moderate agreement between conjunctival swabs and bone marrow (κ=0.483), and almost no agreement between conjunctival swabs and blood (κ=0.070). Dogs with high antibody titres were more likely to be positive on conjunctival swab PCR than dogs with negative or doubtful antibody titres (P<0.001). Thus, conjunctival swab PCR is a good non-invasive test to diagnose Leishmania infection in dogs in non-endemic countries. PMID:23993391

  14. Detection of Polymorphism at the Insulin Like Growth Factor-I Gene in Mazandaran Native Chicken using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Method

    Directory of Open Access Journals (Sweden)

    Hossein A. Abbasi

    2011-01-01

    Full Text Available Problem statement: Molecular genetics selection on individual genes is a promising method to genetically improve economically important traits in chickens. The Insulin like Growth Factor-I (IGF1 gene may play important roles in growth of multiple tissues, including muscle cells, cartilage and bone. Approach: In the present study polymorphism of the promoter and 5' untranslated region of IGF-1 gene of Mazandaran native fowls was investigated. In order to evaluate the IGF-1 gene polymorphism we have used a Restriction Fragment Length Polymorphism (RFLP method. Blood samples were collected from randomly chosen 100 Mazandaran native fowls. Genomic DNA was extracted using modified salting-out method and used amplified polymerase chain reaction technique. The promoter and 5' untranslated region of the fowl IGF-1 gene was amplified to produce a 621 bp fragment. The PCR products were electrophoresed on 2.5% agarose gel and stained by etidium bromide. Results: Then, they were digested of amplicon with PstI and revealed two alleles A and B. Data were analyzed using Pop Gene 32 package. In this population, AA, AB, BB genotype have been identified with the 25.88, 50.23, 23.89% frequencies. A and B alleles frequencies were 0.51, 0.49, respectively. The Chi-square (÷2 test was significant and the population was in Hardy-Weinberg equilibrium (pConclusion: The PCR technique amplified a DNA fragment of IGF-1 with 621 bp. The results of the RFLP analysis showed two fragment 257 and 354bp after restriction with enzyme with PstI that identify changes in 5' untranslated region. In according to action modes and importance of IGF-1, its polymorphisms can be related to economical traits such as body weight, muscle cells and bone.

  15. Detection of Salmonella Spp., Shigella (Flexneri and Sonnei) and Vibrio Cholerae O1 by Polymerase Chain Reaction (PCR) in Exported Shrimp from the Mexican Northeast Coast

    International Nuclear Information System (INIS)

    The objective of the present work was to use the PCR technique for the simultaneous detection of Salmonella spp and Vibrio cholerae O1 in frozen shrimp for export. The DNA segments located in the gene A [284 pairs of bases (pb)] from Salmonella spp. locus ial (217 and 320 pb) from Shigella flexneri and Shigella sonnei and the gene ctxA and ctxB (777 pb) from Vibrio cholerae O1 were amplified. The different primers that amplify these segments were assayed in a PCR reaction for the simultaneous detection of DNA from the microorganisms. It was not possible to amplify the gene of Shigella sonnei and Shigella flexneri under the assay’s conditions, whilst those of Salmonella spp. and Vibrio cholerae O1 were successfully amplified. The amplification conditions for the PCR were: 94° C, 58° C and 72° C during 30 cycles, allowing a reduction from 15 days test time with the official microbiological methods to 28 hours (24 for the pre-enrichment and four for the PCR). Samples of raw-frozen-headless shrimps were taken from production plants located in the State of Sinaloa, Mexico. A random sampling procedure was used, according to the guidelines described by the International Commission of Microbiological Specifications for Foods (ICMSF, 1999). Five packages per lot per production plant were obtained. From each individual package (5 pounds 80 OZ ≈ 2.27 kg) three samples were taken for the bacteriological assays to search for Salmonella spp. and Vibrio cholerae O1, respectively. The samples were also analyzed by PCR. Results showed that none of the samples were positive by PCR to any of the studied bacteria. Salmonella spp. and Vibrio cholerae O1 were not detected in these samples by the official methods. However, the latter were able to identify other Vibrio species and enterobacteria like Proteus and Acromobacter. These results confirmed PCR’s rapidity, sensitivity and specificity. (author)

  16. Classical swine fever virus detection: results of a real-time reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control

    DEFF Research Database (Denmark)

    Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo;

    2011-01-01

    The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT......-PCR protocols and a standardized protocol commonly used by the Friedrich-Loeffler-Institute (FLI) on a panel of well-characterized samples. In general, all participants produced results within the acceptable range. The FLI assay, several in-house assays, and the commercial kits had high analytical sensitivity...... and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without...

  17. APPLICATION OF POLYMERASE CHAIN REACTION FOR DIAGNOSING AMEBIC LIVER ABSCESS

    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏

    1996-01-01

    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  18. Label-free cascade amplification strategy for sensitive visual detection of thrombin based on target-triggered hybridization chain reaction-mediated in situ generation of DNAzymes and Pt nanochains.

    Science.gov (United States)

    Zhang, Ying; Ren, Wang; Luo, Hong Qun; Li, Nian Bing

    2016-06-15

    A new magnetic bead-based cascade amplification strategy for highly sensitive visual detection of proteins (thrombin as a model analyte) was developed by coupling target-triggered hybridization chain reaction (HCR) with the synergistic catalysis of DNA concatemer-mediated hemin/G-quadruplex DNAzymes and Pt nanozymes. Initially, the biotinylated primer DNA (P-DNA) was complementary with aptamer to form dsDNA which was further linked to streptavidin-coated magnetic bead (MB), thereby fabricating the expected MB-based aptasensor. In the presence of target TB, the aptamer was taken away from the aptasensor, and the free P-DNA immediately triggered HCR to spontaneously form DNA concatemer-directed nanochains with numerous DNAzymes and Pt nanoclusters (PtNCs) to achieve cascades signal amplification. The dual peroxidase mimetics catalyzed the H2O2-mediated oxidation of colorless 3,3',5,5'-tetramethylbenzidine (TMB) into the colored TMB oxides (oxTMB), causing intensified color change of the chromogenic solution for the highly sensitive naked-eye detection of as low as 100.0 pM TB. In this strategy, the employment of magnetic separation and exonuclease III (Exo III)-assisted digestion of residual dsDNA minimized the background noise and avoided the false positive results, greatly improving the detection accuracy and sensitivity with a low limit of detection (LOD=15.0 pM). The proposed visual platform has promise for detecting various types of proteins with careful DNA sequence designs. PMID:26878483

  19. POLYMERASE CHAIN REACTION FOR THE DETECTION OF TOXIN A ( TCD A AND TOXIN B ( TCD B GENES OF CLOSTRIDIUM DIFFICILE ISOLATED FROM DIARRHOEAL CASES AND ANALYSIS OF THE CLINICAL SPECTRUM

    Directory of Open Access Journals (Sweden)

    Sherin

    2015-04-01

    Full Text Available BACKGROUND: Molecular methods for detection of toxigenic Clostridium difficile have been established in the developed countries though not very common in our country. AIMS: The study was intended to determine the presence of toxin A and toxin B genes of Clostridium difficile isolates by means of polymerase chain reaction (PCR and a nalysis of clinical picture of the patients. MATERIALS AND METHODS: The prospective study was conducted in a tertiary care teaching hospital, South India from January 2012 to December 2014. Stool samples were collected consecutively from 563 in patients with diarrhoea from various wards. Clostridium difficile was isolated and identified by semi quantitative culture, latex agglutination and biochemical reactions. These isolates were then subjected to PCR for the detection of toxin A and toxin B genes. In addition, enzyme immunoassay was performed on stool samples for the detection of toxins A and B. The clinical spectrum of PCR positive patients was also analyzed. RESULTS: From 563 stool specimens, 113 (20. 07% Clostridium difficile isolates wer e grown by culture and identified by latex agglutination and biochemical reactions. Out of 113 isolates, 94 were subjected to PCR. 50 (53. 19% isolates out of 94 were found to be positive. Three toxigenic types obtained were A + B + , A - B + and A + B - which accou nted for 6. 38%, 42.55% and 4. 26% respectively. A - B - isolates were 46. 81%. 30 (26.55% out of 113 stool samples (which were culture positive was also enzyme immunoassay positive. 32 (64% out of 50 PCR positive patients e xhibited antibiotic usage (p<0. 05 and 39 (78% revealed the presence of underl ying illnesses/conditions (p<0. 01. CONCLUSION: The study highlights the usefulness of PCR for detection of toxigenic Clostridium difficile and for determination of its molecular epidemiology.

  20. Leptospira spp detection by Polymerase Chain Reaction (PCR) in clinical samples of captive black-capped Capuchin monkey (Cebus apella) Detecção de Leptospira spp pela técnica da reação da polimerase em cadeia (PCR) em amostras clínicas de macaco prego (Cebus apella) criado em cativeiro

    OpenAIRE

    Eliana Scarcelli; Rosa Maria Piatti; José Daniel Luzes Fedullo; Faiçal Simon; Maristela Vasconcellos Cardoso; Vanessa Castro; Simone Miyashiro; Margareth Élide Genovez

    2003-01-01

    Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR), in clinical samples from one captive black...

  1. CONVERGENCE OF MARKOV CHAIN APPROXIMATIONS TO STOCHASTIC REACTION DIFFUSION EQUATIONS

    OpenAIRE

    Kouritzin, Michael A.; Hongwei Long

    2001-01-01

    In the context of simulating the transport of a chemical or bacterial contaminant through a moving sheet of water, we extend a well-established method of approximating reaction-diffusion equations with Markov chains by allowing convection, certain Poisson measure driving sources and a larger class of reaction functions. Our alterations also feature dramatically slower Markov chain state change rates often yielding a ten to one-hundred-fold simulation speed increase over the previous version o...

  2. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  3. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  4. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  5. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Directory of Open Access Journals (Sweden)

    Rajendran Maheaswari

    2016-01-01

    Full Text Available This review discusses the principles of polymerase chain reaction (PCR and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  6. Boronic acid disk diffusion for the phenotypic detection of polymerase chain reaction-confirmed, carbapenem-resistant, gram-negative bacilli isolates

    OpenAIRE

    Elsherif, Rasha; Ismail, Dalia; Elawady, Sanaa; Jastaniah, Samyah; Al-Masaudi, Saad; Harakeh, Steve; Karrouf, Gamal

    2016-01-01

    Background The Middle East is regarded as a secondary reservoir for OXA-48 and New Delhi metallo-β-lactamase (NDM) carbapenemases. One of the main challenges in clinical microbiology diagnostics is the detection of carbapenemases. For this reason simple screening methods have been sought to detect carbapenemase producers to determine appropriate therapeutic measures and implement infection control interventions. The present study aimed to evaluate the efficacy of the modified Hodge test (MHT)...

  7. Detection of subgenomic mRNA of feline coronavirus by real-time polymerase chain reaction based on primer-probe energy transfer (P-sg-QPCR)

    DEFF Research Database (Denmark)

    Hornyák, Ákos; Bálint, Ádám; Farsang, Attila;

    2012-01-01

    manifestation of feline infectious peritonitis is of paramount importance. In the present work, a novel real-time RT-PCR method is described which is able to detect FCoV and to determine simultaneously the quantity of the viral RNA. The new assay combines the M gene subgenomic messenger RNA (sg-mRNA) detection...... leukocytes from uncertain clinical cases were also subjected to the assay. The sensitivity of the P-sg-QPCR method was high, since as few as 10 genome copies of FCoV were detected. The quantitative sg-mRNA detection method revealed more than 10–50,000 times increase of the M gene sg-mRNA in organ materials...... of feline infectious peritonitis cases, compared to those of the enteric FCoV variants present in the faeces of normal, healthy cats. These results indicate the applicability of the new P-sg-QPCR test as a powerful novel tool for the better detection and quantitation of FCoV and for the improved...

  8. Standardization of real-time quantitative polymerase chain reaction for detection of the JAK2V617F mutation in BCR-ABL1 negative myeloproliferative neoplasms: A tertiary care centre experience

    Directory of Open Access Journals (Sweden)

    Tathagat Chatterjee

    2015-01-01

    Full Text Available Background: Identification of JAK2V617F mutations has led to a significant development in our understanding of the pathogenesis and therapy of BCR-ABL1 negative myeloproliferative neoplasms (MPNs. However, not all cases of BCR-ABL1 negative MPNs carry JAK2V617F mutations. The present study was undertaken with an aim to standardize the real-time quantitative polymerase chain reaction (PCR for the detection of JAK2V617F mutations and to find the prevalence of Janus kinase 2 (JAK2 mutations in MPNs in the Indian scenario. Materials and Methods: Real-time quantitative PCR was used to detect the JAK2V617F mutation. Standardization of the detection procedure was carried out using recommended guidelines to ensure the accuracy and reproducibility of results. Forty-nine patients of BCR-ABL1 negative MPNs were included in the study. Results: The JAK2V617F mutation was detected in 63.3% patients of BCR-ABL1 negative MPNs. On classification of these BCR-ABL1 negative MPNs, JAK2V617F mutation was detected in 78.3% patients with polycythemia vera (PV, 62.5% patients with essential thrombocythemia (ET, and 44.4% patients with Primary myelofibrosis (PMF. Conclusion: Role of detection of JAK2 mutations in BCR-ABL1 negative MPN has begun to be described and can be used in the diagnosis of PV, ET, and PMF along with other criterias. In future, it may be suitable for treatment monitoring and prognostication.

  9. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    Science.gov (United States)

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates. PMID:19860467

  10. cobas 4800 HPV Test, a real-time polymerase chain reaction assay for the detection of human papillomavirus in cervical specimens.

    Science.gov (United States)

    Isidean, Sandra D; Coutlée, François; Franco, Eduardo L

    2014-01-01

    Cervical cancer screening incorporating high-risk human papillomavirus (HPV) detection has become the preferred screening strategy in some countries and is increasingly more widespread in other countries with organized or opportunistic screening programs. Given knowledge that high-risk HPV genotypes differ in their oncogenic potential, commercial HPV assays with genotyping capabilities have been developed and have garnered attention in the recent literature. The cobas 4800 HPV Test is a qualitative multiplex assay that provides specific genotyping information for HPV types 16 and 18, while concurrently detecting 12 other high-risk HPV genotypes as a pooled result. It is currently the only clinically validated, US FDA-approved assay with this capability. Since HPV types 16 and 18 have been designated as conferring the greatest risk for cervical disease, their detection may prove useful in guiding patient management. PMID:24308341

  11. Evaluation of exotoxin A gene and frequency of polymerase chain reaction sensitivity in detection of pseudomonas aeruginosa isolated from burn patients

    Directory of Open Access Journals (Sweden)

    Rasoul Yousefi Mashouf

    2014-06-01

    Conclusion: Our results showed that sensitivity of PCR mediated ETA gene in detection of pseudomonas aeruginosa strains is considerable and this factor can be used as a good factor identifying of pseudomonas aeruginosa. It seems more studies with larger sample size is necessary in this area.

  12. Development of a polymerase chain reaction to differentiate avian leukosis virus (ALV) subgroups: detection of an ALV contaminate in a commercial Marek's disease vaccine

    Science.gov (United States)

    Avian leukosis viruses (ALVs) are common in many poultry flocks and can be detected by using an ELISA assay or any other test designed to identify the viral antigen p27. However, endogenous retroviruses, expressing p27, are often present and can be confused with exogenous ALVs. A more specific and i...

  13. O Serogroup-Specific Touchdown-Multiplex Polymerase Chain Reaction for Detection and Identification of Vibrio cholerae O1, O139, and Non-O1/Non-O139

    Directory of Open Access Journals (Sweden)

    Adisak Bhumiratana

    2014-01-01

    Full Text Available A novel, sensitive locus-specific touchdown-multiplex polymerase chain reaction (TMPCR, which is based on two-stage amplification pertaining to multiplex PCR and conditional touchdown strategy, was used in detecting and differentiating Vibrio cholerae serogroups. A panel of molecular marker-based TMPCR method generates reproducible profiles of V. cholerae-specific (588 bp amplicons derived from ompW gene encoding the outer membrane protein and serogroup-specific amplicons, 364 bp for the O1 and 256 bp for the O139, authentically copied from rfb genes responsible for the lipopolysaccharide biosynthesis. The TMPCR amplification efficiency yields either equally or unequally detectable duplex DNA bands of the O1 (588 and 364 bp and O139 (588 and 256 bp or a DNA fragment of non-O1/non-O139 (588 bp while providing no false positive identifications using the genomic DNA templates of the other vibrios and Enterobacteriaceae. The reciprocal analysis of two-template combinations demonstrated that, using V. cholerae O1, O139, or equally mixed O1 and O139, the TMPCR had a detection limit of as low as 100 pg of the O1, O139, or non-O1/non-O139 in reactions containing unequally or equally mixed gDNAs. In addition, the O serogroup-specific TMPCR method had 100% agreement with the serotyping method when examined for the serotyped V. cholerae reference strains and those recovered from clinical samples. The potential benefit of using this TMPCR tool would augment the serotyping method used in epidemiological surveillance and monitoring of V. cholerae serogroups, O1, O139, and non-O1/non-O139 present in clinical and environmental samples.

  14. Specific Detection and Identification of American Mulberry-Infecting and Italian Olive-Associated Strains of Xylella fastidiosa by Polymerase Chain Reaction.

    Science.gov (United States)

    Guan, Wei; Shao, Jonathan; Elbeaino, Toufic; Davis, Robert E; Zhao, Tingchang; Huang, Qi

    2015-01-01

    Xylella fastidiosa causes bacterial leaf scorch in many landscape trees including elm, oak, sycamore and mulberry, but methods for specific identification of a particular tree host species-limited strain or differentiation of tree-specific strains are lacking. It is also unknown whether a particular landscape tree-infecting X. fastidiosa strain is capable of infecting multiple landscape tree species in an urban environment. We developed two PCR primers specific for mulberry-infecting strains of X. fastidiosa based on the nucleotide sequence of a unique open reading frame identified only in mulberry-infecting strains among all the North and South American strains of X. fastidiosa sequenced to date. PCR using the primers allowed for detection and identification of mulberry-infecting X. fastidiosa strains in cultures and in samples collected from naturally infected mulberry trees. In addition, no mixed infections with or non-specific detections of the mulberry-infecting strains of X. fastidiosa were found in naturally X. fastidiosa-infected oak, elm and sycamore trees growing in the same region where naturally infected mulberry trees were grown. This genotype-specific PCR assay will be valuable for disease diagnosis, studies of strain-specific infections in insects and plant hosts, and management of diseases caused by X. fastidiosa. Unexpectedly but interestingly, the unique open reading frame conserved in the mulberry-infecting strains in the U. S. was also identified in the recently sequenced olive-associated strain CoDiRO isolated in Italy. When the primer set was tested against naturally infected olive plant samples collected in Italy, it allowed for detection of olive-associated strains of X. fastidiosa in Italy. This PCR assay, therefore, will also be useful for detection and identification of the Italian group of X. fastidiosa strains to aid understanding of the occurrence, evolution and biology of this new group of X. fastidiosa strains. PMID:26061051

  15. Use of polymerase chain reactions for the detection of M. gallisepticum, M. imitans, M. iowae, M. meleagridis and M. synoviae in birds of prey

    OpenAIRE

    Lierz, Michael; Hagen, Nils; Lüschow, Dörte; Hafez, Hafez Mohamed

    2008-01-01

    Abstract Mycoplasmas are pathogens of different avian species, but the role of Mycoplasma in raptors is not yet completely determined. In the past Mycoplasma species known to be pathogenic for poultry were described in raptors but do not seem to occur regular. Therefore species-specific PCRs for the detection of M. gallisepticum, M. imitans, M. iowae, M. meleagridis and M. synoviae were evaluated for the use in non- poultry species. The specificities of the PCR-methods were investi...

  16. TPR-MET oncogenic rearrangement: detection by polymerase chain reaction amplification of the transcript and expression in human tumor cell lines.

    OpenAIRE

    Soman, N R; Wogan, G N; Rhim, J S

    1990-01-01

    Activation of the MET protooncogene by a rearrangement involving the fusion of TPR and MET specific gene sequences has been observed in a human osteosarcoma cell line (HOS) treated in vitro with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). No information has been available about the possible occurrence of this rearrangement in human tumors. To facilitate rapid screening of human cell lines and tumor samples for this specific gene rearrangement, we developed a sensitive detection method based ...

  17. Specific Detection and Identification of American Mulberry-Infecting and Italian Olive-Associated Strains of Xylella fastidiosa by Polymerase Chain Reaction.

    Directory of Open Access Journals (Sweden)

    Wei Guan

    Full Text Available Xylella fastidiosa causes bacterial leaf scorch in many landscape trees including elm, oak, sycamore and mulberry, but methods for specific identification of a particular tree host species-limited strain or differentiation of tree-specific strains are lacking. It is also unknown whether a particular landscape tree-infecting X. fastidiosa strain is capable of infecting multiple landscape tree species in an urban environment. We developed two PCR primers specific for mulberry-infecting strains of X. fastidiosa based on the nucleotide sequence of a unique open reading frame identified only in mulberry-infecting strains among all the North and South American strains of X. fastidiosa sequenced to date. PCR using the primers allowed for detection and identification of mulberry-infecting X. fastidiosa strains in cultures and in samples collected from naturally infected mulberry trees. In addition, no mixed infections with or non-specific detections of the mulberry-infecting strains of X. fastidiosa were found in naturally X. fastidiosa-infected oak, elm and sycamore trees growing in the same region where naturally infected mulberry trees were grown. This genotype-specific PCR assay will be valuable for disease diagnosis, studies of strain-specific infections in insects and plant hosts, and management of diseases caused by X. fastidiosa. Unexpectedly but interestingly, the unique open reading frame conserved in the mulberry-infecting strains in the U. S. was also identified in the recently sequenced olive-associated strain CoDiRO isolated in Italy. When the primer set was tested against naturally infected olive plant samples collected in Italy, it allowed for detection of olive-associated strains of X. fastidiosa in Italy. This PCR assay, therefore, will also be useful for detection and identification of the Italian group of X. fastidiosa strains to aid understanding of the occurrence, evolution and biology of this new group of X. fastidiosa strains.

  18. Detection of virulence genes (yrp1 and yrpE in the Yersinia ruckeri by polymerase chain reaction test in Chaharmahal-Va-Bakhtiary province, Iran

    Directory of Open Access Journals (Sweden)

    Firooz fadaeifard

    2014-04-01

    Full Text Available Introduction: Yersinia ruckeri is the etiological agent of enteric redmouth (ERM disease, one of the important bacterial diseases in the cultured salmonids. The aim of present study was detection of virulence genes (yrpE and yrp1 in the Y.ruckeri bacterium Materials and methods In this study fish were evaluated in average size 10-12 Cm from six rainbow trout farms in Chaharmahal-Va-Bakhtiary province. In each farm 10 fish (totally 60 suspected to ERM were randomly selected, sampling was done from lower part of intestine and cultured on general (trypticase soy agar and specific (Waltman-Shots mediums. Finally, colonies that were isolated on these mediums tested by PCR method for Y.ruckeri detection. Then, in the identified strains of Y.ruckeri virulenc genes (yrp1and yrpE were detected by PCR test. Results: In the all strains of Y.ruckeri two virulence genes (yrp1and yrpE were identified by molecular test. 24 strains out of total isolates were identified as Y.ruckeri, and among them 12 cases (50% and 11 cases (45.83% had yrp1 andyrpE genes, respectively. Also, 6 samples (25% had both genes simultaneously. Discussion and conclusion: The study revealed that virulence factor yrp1 is as extracellular protease presence in Y.ruckeri strains. This factor plays an important role in the bacterial virulence and pathogenesis of ERM disease. Data obtained in this study help to control disease especially in development of current vaccines.

  19. P53 GENE MUTATIONS IN NON-SMALL CELL LUNG CANCER DETECTED BY POLYMERASE CHAIN REACTION SINGLE-STRAND CONFORMATION POLYMORPHISM ANALYSIS

    Institute of Scientific and Technical Information of China (English)

    赵永良; 吴德昌; 项晓琼; 张宝仁; 周乃康; 胡迎春

    1999-01-01

    Mutations of the p53 tumor suppressor gone are the most frequent genetic akerations detected in human lung cancer. To assess the pathogenic significance of p53 gone alterations in Chlnege non-small cell lung cancer (NSCLC), 74 paired samples of primary lung cancer and normal lung tissue far away from the cancer were analyzed for mutations of the p53 gene(exons 5-8) using exon-specific PCR, single-gtrand conformation polymorphimax (PCR-SSCP). p53 mutations were observed in 55.4% (41/74) of the samples.No linkaiges were detected between the incidence of p53 mutations and histological type, lymph node metastasis, age or sex. Significant association between p53 mutations and degree of differentiation in edenotmremmnas, not in squamous cell carcinomas, was observed, The frequency of p53 mutations in(65. 3%) was higher than in nonsmokers (33. 3%) and reached stafisrical significance. We also found p53 mutations in 6/7 samples which had tissue invasion and distant metastasis. These results suggest that smcking could be an important factor in lung carcinogenesis, p53 mutation is a worse prognosis indicator in ade and nocarcinomas and related to high aggressive behavior of human lung cancer.

  20. P53 GENE MUTATIONS IN NON-SMALL CELL LUNG CANCER DETECTED BY POLYMERASE CHAIN REACTION SINGLE-STRAND CONFORMATION POLYMORPHISM ANALYSIS

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    @@ Mutations of the p53 tumor suppressor gene are the most frequent genetic alterations detected in human lung cancer. To assess the pathogenic significance of p53 gene alterations in Chinese non-small cell lung cancer(NSCLC),74 paired samples of primary lung cancer and normal lung tissue far away from the cancer were analyzed for mutations of the p53 gene(exons 5-8) using exon-specific PCR, single-strand conformation polymorphism (PCR-SSCP). p53 mutations were observed in 55.4%(41/74) of the samples. No linkages were detected between the incidence of p53 mutations and histological type, lymph node metastasis,age or sex. Significant association between p53 mutations and degree of differentiation in adenocarcinomas, not in squamous cell carcinomas, was observed. The frequency of p53 mutations in smokers(65.3%) was higher than in nonsmokers(33.3%) and reached statistical significance.We also found p53 mutations in 6/7 samples which had tissue invasion and distant metastasis.These results suggest that smoking could be an important factor in lung carcinogenesis,p53 mutation is a worse prognosis indicator in adenocarcinomas and related to high aggressive behavior of human lung cancer.

  1. Detection of foot-and-mouth disease by reverse transcription polymerase chain reaction and virus isolation in contact sheep without clinical signs of foot-and-mouth disease.

    Science.gov (United States)

    Callens, M; De Clercq, K; Gruia, M; Danes, M

    1998-05-01

    Summary Two non-vaccinated sheep were experimentally, infected with FMDV and one day later 4 other sheep were brought in contact. Although the contact sheep showed no clinical signs, serology indicated that all sheep became infected. Various secretion samples, taken over a period of at least one month, and various tissue samples were examined for the presence of FMDV by RT-PCR and by virus isolation. FMDV was most often found in saliva (mouth swabs), followed by nasal secretion and sera. Faecal material, wool and milk were less suitable. The period of detection with the highest frequency of positive isolations was between 2 to 4 days pi for the infected sheep and between 5 to 10 days pc for the contact animals. It was established that in subclinically infected sheep, with a very low amount of virus present, FMD viral RNA could be detected by a sensitive RT-PCR-ELISA although virus isolation and standard RT-PCR remained negative. Moreover there was some evidence of active spreading of FMDV from the contact sheep to two sentinel pigs. This indicates that serologically positive contact sheep without clinical signs may be considered as a danger for the transmission of FMDV. PMID:22077296

  2. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    Science.gov (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  3. In vitro Detection of Yeast-Like and Mycelial Colonies of Ustilago scitaminea in Tissue-Cultured Plantlets of Sugarcane Using Polymerase Chain Reaction

    Science.gov (United States)

    Moosawi-Jorf, S. Ali; Izadi, Mahin B.

    Plantlets of sugarcane cultivars NCO-310 (susceptible) and CP73-21 (resistant) were generated using in vitro apical meristem tissue culture method of leaf and culturing of the callous. Yeast-like and dikaryotic mycelial colonies were isolated and purified. The plantlets were inoculated with two types of yeast-like and dikaryotic mycelial colonies. Results of the PCR assay in plantlets inoculated with the two types of colonies indicated the detection of bE mating-type gene of sugarcane smut in all treated plantlets at all different times after inoculation. Whereas, the disease symptoms were seen in cuttings inoculated only with dikaryotic mycelia or mixed mating types of sporidia, 6 month after transplanting in pots.

  4. Development of a Polymerase Chain Reaction (PCR Assay for the Detection of Philippine Isolates of the Penaeus monodon-type Baculovirus (MBV

    Directory of Open Access Journals (Sweden)

    Christopher Marlowe A. Caipang

    2011-07-01

    Full Text Available Penaeus monodon-type baculovirus (MBV is a DNA virus that infects postlarvae and early juveniles of shrimp, Penaeus monodon. Several variants of this virus occur through nucleotide analysis of its genomic DNA. In the present study, a one-step PCR method was developed for the detection of the Philippine isolates of MBV by designing PCR primers on the least conserved region of the Philippine MBV. Using genomic DNA of MBV-infected shrimp postlarvae, the PCR assay amplified a 193-bp PCR product. Its sensitivity was comparable to the published PCR assays. The strain-specific primers did not cross-react with other DNA viruses including White Spot Syndrome Virus (WSSV, Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV and hepatopancreatic parvovirus (HPV. This PCR assay could be used for regular monitoring and surveillance of MBV in shrimp as well as tracing the movement of the Philippine MBV in shrimp farms in different geographic regions.

  5. Detection and quantification of parapoxvirus DNA by use of a quantitative real-time polymerase chain reaction assay in calves without clinical signs of parapoxvirus infection.

    Science.gov (United States)

    Yaegashi, Gakuji; Fukunari, Kazuhiro; Oyama, Takayuki; Murakami, Ryu-Koh; Inoshima, Yasuo

    2016-04-01

    OBJECTIVE To investigate the presence of parapoxvirus (PPV) in cattle without clinical signs of infection and in farm environments of PPV-infected cattle. ANIMALS 28 calves without clinical signs of PPV infection on 2 farms and 11 clinically affected calves on 6 farms. PROCEDURES 164 oral swab samples were collected at regular intervals from 28 calves without clinical signs of PPV infection, and 11 swab samples were collected from 11 clinically affected calves. Viral DNA load was quantified by use of a PPV-specific quantitative real-time PCR (qRT-PCR) assay. RESULTS Of 28 calves without clinical signs of PPV infection, 12 had positive results for PPV DNA by use of the qRT-PCR assay. Viral DNA was detected continuously over a period of 2 to 5 months from 9 of these 12 calves, particularly from calves with dermatomycosis or respiratory tract disease. The PPV DNA loads in 32 oral swab samples from these 12 calves were significantly lower (median, 3.2 copies/mg) than those in samples collected from the 11 clinically affected calves (median, 3.2 × 10(4) copies/mg). Moreover, PPV DNA was detected in the residual feed and drinking water on both farms that housed the calves without clinical signs of PPV infection. CONCLUSIONS AND CLINICAL RELEVANCE PPV in cattle without clinical signs of infection and in the environments of these cattle may represent sources of PPV transmission to susceptible cattle. IMPACT FOR HUMAN MEDICINE Humans should wear gloves to prevent zoonotic disease transmission when handling cattle with or without clinical signs of PPV infection. PMID:27027837

  6. Detection of carcinoembryonic antigen messenger RNA in blood using quantitative real-time reverse transcriptase-polymerase chain reaction to predict recurrence of gastric adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Wang Zhi-qiang

    2010-10-01

    Full Text Available Abstract Background The existence of circulating tumor cells (CTCs in peripheral blood as an indicator of tumor recurrence has not been clearly established, particularly for gastric cancer patients. We conducted a retrospective analysis of the relationship between CTCs in peripheral blood at initial diagnosis and clinicopathologic findings in patients with gastric carcinoma. Methods Blood samples were obtained from 123 gastric carcinoma patients at initial diagnosis. mRNA was extracted and amplified for carcinoembryonic antigen (CEA mRNA detection using real-time RT-PCR. Periodic 3-month follow-up examinations included serum CEA measurements and imaging. Results The minimum threshold for corrected CEA mRNA score [(CEA mRNA/GAPDH mRNA × 106] was set at 100. Forty-five of 123 patients (36.6% were positive for CEA mRNA expression. CEA mRNA expression significantly correlated with T stage and postoperative recurrence status (P = 0.001. Recurrent disease was found in 44 of 123 cases (35.8%, and 25 of these (56.8% were positive for CEA mRNA. Of these patients, CEA mRNA was more sensitive than serum CEA in indicating recurrence. Three-year disease-free survival of patients positive for CEA mRNA was significantly poorer than of patients negative for CEA mRNA (P Conclusions CEA mRNA copy number in peripheral blood at initial diagnosis was significantly associated with disease recurrence in gastric adenocarcinoma patients. Real-time RT-PCR detection of CEA mRNA levels at initial diagnosis appears to be a promising predictor for disease recurrence in gastric adenocarcinoma patients.

  7. A novel nested multiplex polymerase chain reaction (PCR assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    Directory of Open Access Journals (Sweden)

    Parija Subhash C

    2007-05-01

    Full Text Available Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific. The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens.

  8. Use of Blood Smears and Dried Blood Spots for Polymerase Chain Reaction-Based Detection and Quantification of Bacterial Infection and Plasmodium falciparum in Severely Ill Febrile African Children.

    Science.gov (United States)

    Wihokhoen, Benchawan; Dondorp, Arjen M; Turner, Paul; Woodrow, Charles J; Imwong, Mallika

    2016-02-01

    Molecular approaches offer a means of testing archived samples stored as dried blood spots in settings where standard blood cultures are not possible. Peripheral blood films are one suggested source of material, although the sensitivity of this approach has not been well defined. Thin blood smears and dried blood spots from a severe pediatric malaria study were assessed using specific polymerase chain reaction (PCR) primers to detect non-typhoidal Salmonella (NTS; MisL gene), Streptococcus pneumoniae (lytA), and Plasmodium falciparum (18S rRNA). Of 16 cases of NTS and S. pneumoniae confirmed on blood culture, none were positive by PCR using DNA extracts from blood films or dried blood spots. In contrast, four of 36 dried blood spots and two of 178 plasma samples were PCR positive for S. pneumoniae, despite negative bacterial blood cultures, suggesting false positives. Quantitative assessment revealed that the effective concentration of P. falciparum DNA in blood films was three log orders of magnitude lower than for dried blood spots. The P. falciparum kelch13 gene could not be amplified from blood films. These findings question the value of blood PCR-based approaches for detection of NTS and S. pneumoniae, and show that stored blood films are an inefficient method of studying P. falciparum. PMID:26711525

  9. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  10. Establishment of a Flexible Real-Time Polymerase Chain Reaction-Based Platform for Detecting Prevalent Deafness Mutations Associated with Variable Degree of Sensorineural Hearing Loss in Koreans.

    Science.gov (United States)

    Han, Kyu-Hee; Kim, Ah Reum; Kim, Min Young; Ahn, Soyeon; Oh, Seung-Ha; Song, Ju Hun; Choi, Byung Yoon

    2016-01-01

    Many cutting-edge technologies based on next-generation sequencing (NGS) have been employed to identify candidate variants responsible for sensorineural hearing loss (SNHL). However, these methods have limitations preventing their wide clinical use for primary screening, in that they remain costly and it is not always suitable to analyze massive amounts of data. Several different DNA chips have been developed for screening prevalent mutations at a lower cost. However, most of these platforms do not offer the flexibility to add or remove target mutations, thereby limiting their wider use in a field that requires frequent updates. Therefore, we aimed to establish a simpler and more flexible molecular diagnostic platform based on ethnicity-specific mutation spectrums of SNHL, which would enable bypassing unnecessary filtering steps in a substantial portion of cases. In addition, we expanded the screening platform to cover varying degrees of SNHL. With this aim, we selected 11 variants of 5 genes (GJB2, SLC26A4, MTRNR1, TMPRSS3, and CDH23) showing high prevalence with varying degrees in Koreans and developed the U-TOP™ HL Genotyping Kit, a real-time PCR-based method using the MeltingArray technique and peptide nucleic acid probes. The results of 271 DNA samples with wild type sequences or mutations in homo- or heterozygote form were compared between the U-TOP™ HL Genotyping Kit and Sanger sequencing. The positive and negative predictive values were 100%, and this method showed perfect agreement with Sanger sequencing, with a Kappa value of 1.00. The U-TOP™ HL Genotyping Kit showed excellent performance in detecting varying degrees and phenotypes of SNHL mutations in both homozygote and heterozygote forms, which are highly prevalent in the Korean population. This platform will serve as a useful and cost-effective first-line screening tool for varying degrees of genetic SNHL and facilitate genome-based personalized hearing rehabilitation for the Korean population

  11. Molecular identification of dermatophytosis by polymerase chain reaction (PCR and detection of source of infection by restricted fragment length polymorphism (RFLP

    Directory of Open Access Journals (Sweden)

    BK Jha

    2013-09-01

    Full Text Available Introduction Dermatophytes are responsible for most superficial fungal infections and the estimated lifetime risk of acquiring a dermatophyte infection is between 10-20%. These fungi are mainly classified in three major genera Microsporum, Trichophyton and Epidermophyton. Materials and Methods Clinically suspected 200 cases of dermatophyte infected patients from K. R. Hospital Mysore and Mission Hospital Mysore were included in this descriptive study from January 2011 to June 2012. All the culture positive smear- 10% Potassium Hydroxide (KOH and culture in different dermatophytic medium patients were confirmed by PCR and source of infection was detected (n=10 from PCR positive patients and (n=10 from their domestic animals by PCR-RFLP methods targeting 18S rDNA regions of fungi. Results Out of 200 clinically suspected cases KOH mount was positive in 143 (71.5% cases and culture was positive in 132(66% cases. The isolates belonged to three genera and eight species as T.mentagrophytes 52(39.4%, T.rubrum 30(22.7%, T.violacium 18(13.6%, T.verrucosum 11(8.3%, E.floccosum 10(7.6%, M.canis 6(4.5%, T.tonsurans 03(2.3% and T.schollenii 2(1.5%. To identify the source of infection 10 animals ,one each from the houses of 10 patients who were PCR positive were also subjected to PCR and RFLP. The animals and the patients were found to be infected by same organisms T.verrucosum .This indicates that T.verrucosum infection is from animal source. Conclusion Dermatophytic infections are more common infectious disease. Preliminary diagnosis of dermatophytosis can be done by KOH mount and culture, which takes longer time to report and cannot differentiate at the genus and species level. Results indicate that PCR-RFLP may be considered as gold standard for the diagnosis and confirmation of source of infection of dermatophytosis and can aid the clinician in initiating prompt and appropriate antifungal therapy. Journal of College of Medical Sciences-Nepal, 2012, Vol-8

  12. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  13. Limitations of clonality analysis of B cell proliferations using CDR3 polymerase chain reaction

    OpenAIRE

    Hoeve, M A; Krol, A D G; Philippo, K; Derksen, P W B; Veenendaal, R. A.; Schuuring, E; Kluin, Ph M; Krieken, J.H.J.M. van

    2000-01-01

    Background/Aims—Detection of clonal immunoglobulin heavy chain (IgH) rearrangements by the polymerase chain reaction (PCR) is an attractive alternative to Southern blotting in lymphoma diagnostics. However, the advantages and limitations of PCR in clonality analysis are still not fully appreciated. In this study, clonality was analysed by means of PCR, focusing in particular on the sample size requirements when studying extremely small samples of polyclonal and monoclonal lesions.

  14. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  15. Correlation of p53 over-expression and alteration in p53 gene detected by polymerase chain reaction-single strand conformation polymorphism in adenocarcinoma of gastric cancer patients from India

    Institute of Scientific and Technical Information of China (English)

    Sajjad Karim; Arif Ali

    2009-01-01

    AIM: To study the alterations in p53 gene among Indian gastric cancer patients and to correlate them with the various clinicopathological parameters.METHODS: A total of 103 gastric cancer patients were included in this study. The p53 alterations were studied by both immunohistochemical method as well as polymerase chain reaction (PCR)-single strand conformation polymorphism (SSCP) analysis. We only studied four (exon 5, 6, 7, and 8) of the 11 p53 exons. The alterations in p53 were also correlated with respect to various clinicopathological parameters.RESULTS: Among 103 cases, p53 over-expression and alteration were detected in 37 (35.92%) and 19 (18.44%) cases, respectively. Most of the p53 alterations were found at exon 5 (31.54%), followed by exon 6 (26.31%), exon 7 (21.04%) and exon 8 (21.04%). A significant correlation of p53 overexpression was found with p53 alteration ( P = 0.000).Concordance between p53 alteration (as detected by SSCP) and over-expression [as detected by immunohistochemistry (IHC)] was found in 75% cases.We found that IHC-positive/SSCP-negative cases accounted for 21% of cases and IHC-negative/SSCPpositive cases accounted for remaining 4% cases.CONCLUSION: Our results show that p53 gene mutations are significantly correlated with p53 protein over-expression, with 75% concordance in overexpression and alteration in the p53 gene, but 25% disconcordance also cautions against the assumption that p53 over-expression is always associated with a gene mutation. There may be other mechanisms responsible for stabilization and accumulation of p53 protein with no evidence of gene mutation that reflect an accumulation of a non-mutated protein, or a false negative SSCP result.

  16. Development and evaluation of a reverse transcription-insulated isothermal polymerase chain reaction (RT-iiPCR) assay for detection of equine arteritis virus in equine semen and tissue samples using the POCKIT™ system.

    Science.gov (United States)

    Carossino, Mariano; Lee, Pei-Yu A; Nam, Bora; Skillman, Ashley; Shuck, Kathleen M; Timoney, Peter J; Tsai, Yun-Long; Ma, Li-Juan; Chang, Hsiao-Fen G; Wang, Hwa-Tang T; Balasuriya, Udeni B R

    2016-08-01

    Equine arteritis virus (EAV) is the causative agent of equine viral arteritis (EVA), a respiratory and reproductive disease of horses. Most importantly, EAV induces abortion in pregnant mares and can establish persistent infection in up to 10-70% of the infected stallions, which will continue to shed the virus in their semen. The objective of this study was to develop and evaluate a reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) for the detection of EAV in semen and tissue samples. The newly developed assay had a limit of detection of 10 RNA copies and a 10-fold higher sensitivity than a previously described real-time RT-PCR (RT-qPCR). Evaluation of 125 semen samples revealed a sensitivity and specificity of 98.46% and 100.00%, respectively for the RT-qPCR assay, and 100.00% and 98.33%, respectively for the RT-iiPCR assay. Both assays had the same accuracy (99.2%, k=0.98) compared to virus isolation. Corresponding values derived from testing various tissue samples (n=122) collected from aborted fetuses, foals, and EAV carrier stallions are as follows: relative sensitivity, specificity, and accuracy of 88.14%, 96.83%, and 92.62% (k=0.85), respectively for the RT-qPCR assay, and 98.31%, 92.06%, and 95.08% (k=0.90), respectively for the RT-iiPCR assay. These results indicate that RT-iiPCR is a sensitive, specific, and a robust test enabling detection of EAV in semen and tissue samples with very considerable accuracy. Even though the RT-qPCR assay showed a sensitivity and specificity equal to virus isolation for semen samples, its diagnostic performance was somewhat limited for tissue samples. Thus, this new RT-iiPCR could be considered as an alternative tool in the implementation of EAV control and prevention strategies. PMID:27036504

  17. Rapid detection of cytomegalovirus in bronchoalveolar lavage fluid and serum samples by polymerase chain reaction: correlation of virus isolation and clinical outcome for patients with human immunodeficiency virus infection

    DEFF Research Database (Denmark)

    Hansen, K K; Vestbo, Jørgen; Benfield, T;

    1997-01-01

    Bronchoalveolar lavage (BAL) fluids and serum samples from 153 patients with pulmonary symptoms who were infected with human immunodeficiency virus (HIV) and underwent BAL were examined for the presence of cytomegalovirus (CMV) by conventional culture and by polymerase chain reaction (PCR) for...

  18. The generalised self-sustaining chain reaction theory about ADS

    International Nuclear Information System (INIS)

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  19. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard;

    2005-01-01

    . However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

  20. Characteristics of a chain thermal explosion as a function of the kinetic properties of reaction chains

    Science.gov (United States)

    Azatyan, V. V.; Piloyan, A. A.; Saikova, G. R.; Smirnov, N. N.

    2016-03-01

    Study of the combustion and explosion of hydrogen‒carbon oxide‒air mixtures shows that the sharpness of a chain thermal explosion depends on the frequency of branching in a given branch of a reaction chain. It is established that varying the CO: H2 concentration allows us to observe and eliminate the degeneration of an explosion while maintaining the regimes of ignition and deflagration.

  1. Identifying of meat species using polymerase chain reaction (PCR)

    Science.gov (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  2. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  3. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  4. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  5. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti

    OpenAIRE

    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.

    1996-01-01

    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  6. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.

    OpenAIRE

    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W; Atlas, R M

    1992-01-01

    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can di...

  7. Presence of chelonid fibropapilloma-associated herpesvirus in tumored and non-tumored green turtles, as detected by polymerase chain reaction, in endemic and non-endemic aggregations, Puerto Rico.

    Science.gov (United States)

    Page-Karjian, Annie; Torres, Fernando; Zhang, Jian; Rivera, Samuel; Diez, Carlos; Moore, Phillip A; Moore, Debra; Brown, Corrie

    2012-01-01

    Fibropapillomatosis (FP), a transmissible neoplastic disease of marine turtles characterized by a likely herpesviral primary etiology, has emerged as an important disease in green sea turtles (Chelonia mydas) over the past three decades. The objectives of this study were to determine the suitability of three different chelonid fibropapilloma-associated herpesvirus (CFPHV) gene targets in polymerase chain reaction (PCR) assays of affected tissues; to explore the presence of CFPHV in non-affected skin from turtles with and without tumors; and to better understand tissue localization of the CFPHV genome in a tumor-free turtle by evaluating CFPHV presence in microanatomic tissue sites. Two aggregations of green sea turtles (Chelonia mydas) in Puerto Rico were evaluated, with six sampling intervals over the three-year period 2004-2007. Primary and nested PCR for three different herpesviral gene targets- DNA polymerase, capsid maturation protease, and membrane glycoprotein B- were performed on 201 skin biopsies taken from 126 turtles with and without external tumors. Laser capture microdissection and nested PCR were used to identify tissue localizations of CFPHV in skin from a normal turtle. Of the turtles sampled in Manglar Bay, 30.5% had tumors; at the relatively more pristine Culebrita, 5.3% of turtles sampled had tumors. All three PCR primer combinations successfully amplified CFPHV from tumors, and from normal skin of both tumored and tumor-free turtles. Via nested PCR, the polymerase gene target proved superior to the other two gene targets in the positive detection of CFPHV DNA. CFPHV infection may be common relative to disease incidence, supporting the idea that extrinsic and/or host factors could play a transforming role in tumor expression. Laser capture microdissection revealed CFPHV in skin from a tumor-free turtle, harbored in both epidermal and dermal tissues. Identification of CFPHV harbored in a non-epidermal site (dermis) of a tumor-free turtle indicates

  8. The chain gas phase reactions. The present problems

    International Nuclear Information System (INIS)

    The results of investigations of chain gas phase reactions which are directed for solving practically important problems have been carried out. The problem of increasing methanol formation selectivity in the direct natural gas oxidation process is discussed. The peculiarities of cool flame of cyclic hydrocarbons, particularly cyclohexane which are containing in the different kinds of fuel. The influence of cool flame on intensity and full consumption of fuels burning is examined. Conjugated processes of SO2 conversion to SO3 and sulfur under effect of hydrocarbon and hydrogen oxidation chain gas phase reactions are considered. The results of discussed investigations can be served as a basis for the developing of industrial processes for conversion natural hydrocarbon row materials and also the ecological problems of utilization of SO2 gas ejected from thermoelectric power stations and metallurgical plants

  9. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    OpenAIRE

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology w...

  10. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.

    OpenAIRE

    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S

    1996-01-01

    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  11. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  12. Development and validation of a Myxoma virus real-time polymerase chain reaction assay

    OpenAIRE

    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  13. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    Science.gov (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  14. Reaction chain modeling of denitrification reactions during a push-pull test

    Science.gov (United States)

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.

    2013-05-01

    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  15. Radioinitiation of Chain Branched Reactions and its Sensitization

    International Nuclear Information System (INIS)

    This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author)

  16. Convective polymerase chain reaction around micro immersion heater

    Science.gov (United States)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  17. Development of the nested polymerase chain reaction (PCR) for detection of hepatitis C virus RNA in blood derivatives. Final report for the period 15 December 1994 - 15 December 1995

    International Nuclear Information System (INIS)

    Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab

  18. Robust quantification of polymerase chain reactions using global fitting.

    Directory of Open Access Journals (Sweden)

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  19. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    International Nuclear Information System (INIS)

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  20. Relative microvessel area of the primary tumour, and not lymph node status, predicts the presence of bone marrow micrometastases detected by reverse transcriptase polymerase chain reaction in patients with clinically non-metastatic breast cancer

    International Nuclear Information System (INIS)

    About 50% of patients with breast cancer have no involvement of axillary lymph nodes at diagnosis and can be considered cured after primary locoregional treatment. However, about 20–30% will experience distant relapse. The group of patients at risk is not well characterised: recurrence is probably due to the establishment of micrometastases before treatment. Given the early steps of metastasis in which tumour cells interact with endothelial cells of blood vessels, and, given the independent prognostic value in breast cancer of both the quantification of tumour vascularisation and the detection of micrometastases in the bone marrow, the aim of this study was to determine the relationship between vascularisation, measured by Chalkley morphometry, and the bone marrow content of cytokeratin-19 (CK-19) mRNA, quantified by real-time reverse transcriptase polymerase chain reaction, in a series of 68 patients with localised untreated breast cancer. The blood concentration of factors involved in angiogenesis (interleukin-6 and vascular endothelial growth factor) and of factors involved in coagulation (D-dimer, fibrinogen, platelets) was also measured. When bone marrow CK-19 relative gene expression (RGE) was categorised according to the cut-off value of 0.77 (95th centile of control patients), 53% of the patients had an elevated CK-19 RGE. Patients with bone marrow micrometastases, on the basis of an elevated CK-19 RGE, had a mean Chalkley count of 7.5 ± 1.7 (median 7, standard error [SE] 0.30) compared with a mean Chalkley count of 6.5 ± 1.7 in other patients (median 6, SE 0.3) (Mann–Whitney U-test; P = 0.04). Multiple regression analysis revealed that Chalkley count, not lymph node status, independently predicted CK-19 RGE status (P = 0.04; odds ratio 1.38; 95% confidence interval 1.009–1.882). Blood parameters reflecting angiogenesis and coagulation were positively correlated with Chalkley count and/or CK-19 RGE. Our data are in support of an association between

  1. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

    OpenAIRE

    İLHAK, O. İrfan; Arslan, Ali

    2007-01-01

    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  2. Identification of Erwinia stewartii by a ligase chain reaction assay.

    OpenAIRE

    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A

    1994-01-01

    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...

  3. A chain reaction approach to modelling gene pathways.

    Science.gov (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  4. A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae Polymerase chain reaction used to detect Streptococcus pneumoniae resistance to penicillin

    Directory of Open Access Journals (Sweden)

    Eduardo Walker Zettler

    2004-12-01

    Full Text Available INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM. A reação em cadeia da polimerase (PCR detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca de 8 horas. OBJETIVO: Comparar a PCR com o método da CIM no diagnóstico da resistência da Streptococcus pneumoniae a penicilina. MÉTODO: Foram estudadas 153 amostras de Streptococcus pneumoniae, isoladas de diferentes sítios anatômicos, usando-se para detecção de mutações nos genes que codificam as proteínas ligadoras de penicilina 1a, 2b e 2x, responsáveis pela resistência à penicilina. A ocorrência das mutações foi correlacionada com a CIM de penicilina, determinada pelo teste de difusão em ágar. RESULTADOS: A resistência global à penicilina do Streptococcus pneumoniae foi de 22,8% (16,3% de resistência intermediária e 6,5% de resistência alta. Em proporções estatisticamente significativas, as amostras sensíveis à penicilina não tinham mutações, as intermediárias apenas uma, geralmente na proteína ligadora de penicilina 2x, e as altamente resistentes tinham mutações nas três proteínas investigadas. CONCLUSÃO: A PCR é um método rápido para a detecção da resistência à penicilina do Streptococcus pneumoniae, que poderá vir a ser utilizado na prática clínica.BACKGROUND: Streptococcus pneumoniae is the most common etiologic agent of community-acquired respiratory infections. In recent years, S. pneumoniae resistance to antimicrobial agents has increased. Minimum inhibitory concentration (MIC is routinely used to determine resistance. Polymerase chain reaction (PCR detects the genes

  5. Amplification of human minisatellites by the polymerase chain reaction: towards DNA fingerprinting of single cells.

    OpenAIRE

    Jeffreys, A J; Wilson, V.; Neumann, R.; Keyte, J

    1988-01-01

    Hypervariable minisatellites can be amplified from human DNA by the polymerase chain reaction, using primers from DNA flanking the minisatellite to amplify the entire block of tandem repeat units. Minisatellite alleles up to 5-10 kb long can be faithfully amplified. At least six minisatellite loci can be co-amplified from the same DNA sample and simultaneously detected to provide a reproducible and highly variable DNA fingerprint which can be obtained from nanogram quantities of human DNA. Th...

  6. Detecting deception through reaction times

    NARCIS (Netherlands)

    B. Verschuere; K. Suchotzki; E. Debey

    2015-01-01

    Reaction times (RTs) are among the oldest measures in psychology, and remain popular in several psychology disciplines. However, they have been largely neglected as a cue for deception, reflecting the sceptic's view that RTs fall under voluntary control and are easily manipulated. From our review of

  7. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou

    2005-01-01

    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  8. Point Mutation Identification Using On-Chip Ligase Detection Reaction

    Institute of Scientific and Technical Information of China (English)

    李艳; 曾令文; 程京

    2004-01-01

    An efficient method was developed to detect point mutations using oligonucleotide microarrays and the ligase detection reaction (LDR).Allele-specific LDR primers were immobilized on polylysine-coated glass slides to perform LDR on a chip.The spotting concentration and detection limit were analyzed using a synthesized oligonucleotide as a template.The optimal primer spotting concentration was 20 (mol/L and the lowest detectable template concentration was 0.33 nmol/L.The method was successfully employed to identify malignant mutations of hypertrophic cardiomyopathy.Asymmetric polymerase chain reaction was employed to prepare single stranded DNA as LDR templates from cloned plasmids.The discrimination ratios for AC,TC,GT,TT,GA,and AA mismatches are 32.82,44.24,17.75,18.34,11.66,and 8.91,respectively.This method may allow construction of multiple mutation detection systems.

  9. Detecting Down syndrome with a novel dual-color competitive quantitative fluorescent polymerase chain reaction method%双色竞争性荧光定量PCR检测唐氏综合征

    Institute of Scientific and Technical Information of China (English)

    吴苹; 李启杰; 夏增亮; 张发强; 岳琳琳; 陈清英; 王泓; 范春元; 夏庆杰

    2012-01-01

    Objective To develop a rapid method for the detection of Down syndrome (DS) using dual-color competitive quantitative fluorescent polymerase chain reaction(DCC-QF-PCR),and to assess its feasibility for the prenatal diagnosis of Down syndrome.Methods DNA was extracted from peripheral blood of 30 DS patients and 60 normal men,common primers for DSCR and USC2 genes and respective TaqMan probes were designed and synthesized.The results of DCC-QF-PCR were compared with those of QF-PCR which measured the ratio between DSCR and GAPDH. Forty-six amniotic fluid samples were assayed with DCC-QF-PCR.The results were compared with that of karyotyping.Monoclone fragments for DSCR and USC2 genes were obtained from direct cloning of PCR products.DCC-QF-PCR was carried out using different DNA ratios of DSCR and USC2 as the template.The dosage ratio between DSCR and USC2 was calculated.Results The gene dosage ratio of the DS patients was 1.41-1.74,which was significantly higher than that of normal men (0.93-1.15).The dosage ratio range of DSCR and GAPDH by QF-PCR was comparatively greater than that of DSCR and USC2.Three samples were diagnosed as DS,which was in good agreement with that of karyotyping analysis.There was no significant difference between the gene dosage ratio from DCC-QF-PCR and that of predetermined(P>0.05).Conclusion DCC-QF-PCR is an accurate,rapid,and low cost method,which only requires tiny amount of sample and therefore has broad application in the genetic and prenatal diagnosis.%目的 建立一种快速检测唐氏综合征(Down syndrome,DS)的双色竞争性荧光定量聚合酶链反应(dual-color competitive quantitative fluorescent polymerase chain reaction,DCC-QF-PCR)方法,并探讨其应用于DS产前诊断的可能性.方法 提取30例DS患者和60名正常人的外周血DNA,设计DSCR和USC2两基因的特异共用引物和双色特异性TaqMan探针,同一反应管中进行两基因的DCC-QF-PCR,并与DSCR和GAPDH两基因的QF-PCR

  10. Presumptive detection of yellow head virus by reverse transcriptase-polymerase chain reaction and dot-blot hybridization in Litopenaeus vannamei and L. stylirostris cultured on the Northwest coast of Mexico.

    Science.gov (United States)

    de la Rosa-Vélez, J; Cedano-Thomas, Y; Cid-Becerra, J; Méndez-Payán, J C; Vega-Pérez, C; Zambrano-García, J; Bonami, J-R

    2006-12-01

    In order to assess the presence of yellow head virus (YHV) in shrimp farms along the Pacific coast of Mexico, 39 samples from 26 randomly chosen farms were analysed by means of reverse transcriptase-polymerase chain reaction (RT-PCR) and dot-blot hybridization. Eleven samples were positive for YHV. The disease was reproduced by means of an infectivity bioassay performed with an extract of pleopods from the positive samples. Cumulative mortality reached 50% in 14 days. Four pairs of primers which amplified several YHV genome regions were designed and used to test dead and surviving shrimp from the bioassay by RT-PCR, resulting in positive results for every expected amplicon. The results of this study provide presumptive evidence of the presence of YHV in Mexican shrimp farms at least during 1999-2000. PMID:17169104

  11. Two novel nonradioactive polymerase chain reaction-based assays of dried blood spots, genomic DNA, or whole cells for fast, reliable detection of Z and S mutations in the alpha 1-antitrypsin gene

    DEFF Research Database (Denmark)

    Andresen, B S; Knudsen, I; Jensen, P K;

    1992-01-01

    Two new nonradioactive polymerase chain reaction (PCR)-based assays for the Z and S mutations in the alpha 1-antitrypsin gene are presented. The assays take advantage of PCR-mediated mutagenesis, creating new diagnostic restriction enzyme sites for unambiguous discrimination between test samples...... from individuals who are normal, heterozygous, or homozygous for the mutations. We show that the two assays can be performed with purified genomic DNA as well as with boiled blood spots. The new assays were validated by parallel testing with a technique in which PCR is combined with allele......-specific oligonucleotide (ASO) probes. In all cases tested the results obtained by the different techniques were in accordance. The new assays can be used for prenatal diagnostics and can be performed directly with boiled tissue samples. Because the new assays are easy to perform and reliable, we conclude that they are...

  12. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    OpenAIRE

    Ana Lisa do Vale Gomes; Fábio L Melo; Roberto P Werkhauser; Frederico GC Abath

    2006-01-01

    This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR) protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA). Th...

  13. Comparison of human cytomegalovirus DNA detection in different samples by fluorescent quantitative polymerase chain reaction%人巨细胞病毒感染的核酸检测比较及对肝脏损伤的研究

    Institute of Scientific and Technical Information of China (English)

    刘春梅; 邹建文; 刘玲玲; 鞠瑛; 栾芳; 田文君; 王盛华; 刘义庆; 张炳昌

    2014-01-01

    Objective To investigate the diagnostic value of fluorescent quantitative polymerase chain re-action ( FQ-PCR) technique in detecting the human cytomegalovirus infection and its impact on hepatic function through the detection of human cytomegalovirus (HCMV) DNA in urinary epithelial cell (EC), blood of breast-feeding infants and the milk of their mothers .Methods FQ-PCR was used to analyze the HCMV DNA in urinary EC, blood of 104 breast-fed suspected infants and breast milk of their mothers .The hepatic impairment was ana-lyzed through detecting aspartate aminotransferase ( AST ) , alanine aminotransferase ( ALT ) , gamma glutamyl transpeptidase ( GGT ) and total bilirubin .Results The positive rate of urinary EC and blood was 52.9%(55/104) and 24.0% (25/104) respectively.The positive rate of urinary EC was much higher than that of blood.The differences between these groups were statistically significant (P<0.01).The positive rate of breast milk was 81.7%(85/104), and the positive rate of the paired urinary EC and/or blood in positive breast milk test was 62.4%(53/85).The difference between the two groups was statistically significant (P<0.05).The possibility of hepatic impairment was much higher with the HCMV DNA copies in infants .Conclusions Detection of HCMV DNA load in urinary EC by FQ-PCR can predict HCMV active infection in infants and monitor the treat-ment of HCMV infection .The level of AST , ALT, GGT and total bilirubin can be used for evaluating hepatic im-pairment .%目的:应用实时荧光定量聚合酶链反应( FQ-PCR)检测疑似人巨细胞病毒( HCMV)感染的患儿尿液、血液及对应母亲乳汁中HCMV DNA含量,探讨其在HCMV感染诊断中的价值及对肝脏损伤情况。方法应用FQ-PCR方法检测104例疑似HCMV感染患儿新鲜尿液上皮细胞、血液及其对应的母亲乳汁中的HCMV DNA拷贝数,并同时检测患儿血液中天冬氨酸转氨酶( AST)、丙氨酸转氨酶( ALT)、谷氨酰

  14. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  15. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  16. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes

    International Nuclear Information System (INIS)

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement. (paper)

  17. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed

    2012-03-01

    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  18. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail: dianping.tang@fzu.edu.cn

    2013-06-14

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  19. A molecule that detects the length of DNA by using chain fluctuation

    CERN Document Server

    Iwasa, Kuni H

    2015-01-01

    A class of nucleosome remodeling motors translocate nucleosomes, to which they are attached, toward the middle of DNA chain in the presence of ATP during in vitro experiments. Such a biological activity is likely be based on a physical mechanism for detecting and comparing the lengths of the flanking polymer chains. Here we propose that a pivoting mode of DNA fluctuation near the surface of the nucleosome coupled with binding reaction with a DNA binding site of the motor provides a physical basis for length detection. Since the mean frequency of fluctuation is higher for a shorter chain than a longer one due to its lower drag coefficient, a shorter chain has a higher rate of receptor binding, which triggers the ATP-dependent activity of the remodeling motor. Dimerization of such units allows the motor to compare the length of the flanking DNA chains, enabling the translocation of the nucleosome toward the center of the DNA.

  20. Controlling Hybridization Chain Reactions with pH.

    Science.gov (United States)

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco

    2015-08-12

    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  1. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay

    International Nuclear Information System (INIS)

    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg-1 almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg-1. We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg-1 almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg-1. Further, between 100 and 100,000 mg kg-1 spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n = 5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and potentially

  2. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay

    Energy Technology Data Exchange (ETDEWEB)

    Roeder, Martin; Vieths, Stefan [Division of Allergology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, 63225 Langen (Germany); Holzhauser, Thomas, E-mail: holth@pei.de [Division of Allergology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, 63225 Langen (Germany)

    2011-01-24

    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg{sup -1} almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg{sup -1}. We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg{sup -1} almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg{sup -1}. Further, between 100 and 100,000 mg kg{sup -1} spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n = 5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a

  3. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  4. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  5. 食品中化脓链球菌的PCR检测方法的建立%Establishment of Polymerase Chain Reaction Assay for Detection of Streptococcus Pyogenes in Food Products

    Institute of Scientific and Technical Information of China (English)

    杨学明; 巢强国; 葛宇; 熊薇; 曲勤凤

    2008-01-01

    化脓链球菌是一种常见的食源性致病菌,从19世纪80年代起,化脓链球菌引起的感染在全球范围内呈逐步上升之势并发展成为人类重要致病茵之一.通过已公布的13株化脓链球菌的基因组序列找出具有种特异性的基因序列.运用BLAST(Basic Local Alignment Search Tool,基本局部比对工具)在GenBank中进行序列对库的比对结果表明:化脓链球菌的某些基因(SmeZ,emm,spyM51755)具有种特异性.以这些基因为目的基因,共设计七对引物.经PCR(Polymerase Chain Reaction,聚合酶链式反应)检测发现spvM引物对(spyM51755F,spyM51755R)具有很高的特异性.利用该引物对,建立可快速且灵敏地检测食品中化脓链球菌的PCR方法,其灵敏度达到10 cfu/g样品.

  6. Androgen regulation of CYP4B1 responsible for mutagenic activation of bladder carcinogens in the rat bladder: detection of CYP4B1 mRNA by competitive reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Imaoka, S; Yoneda, Y; Sugimoto, T; Ikemoto, S; Hiroi, T; Yamamoto, K; Nakatani, T; Funae, Y

    2001-05-26

    Significant sex differences exist among cases of bladder cancer in humans as well as in experimental animals such as rats. Aromatic amines such as benzidine and 2-naphthylamine are known to induce bladder cancer. These carcinogenic amines are activated to genotoxic substances by cytochrome P 450 CYP4B1, which is present in bladder mucosa. In this study, regulation of CYP4B1 was investigated to elucidate sex difference in bladder carcinogenesis. Competitive reverse transcription-polymerase chain reaction was used to investigate the expression of rat CYP4B1 mRNA occurring in small amounts of tissue such as bladder tissue. Expression of CYP4B1 in the bladder of male rats increased with development but not in that of female rats. Moreover, mature male rats exhibited higher expression of CYP4B1 in the bladder than did mature female rats. Castration of male rats decreased CYP4B1 levels and treatment with testosterone led to a partial recovery of CYP4B1 levels. These results indicate that CYP4B1 levels in the rat bladder are partly regulated by androgens. Furthermore, the present findings suggest that the sex difference observed in bladder carcinogenesis was due to sex-different expression of CYP4B1 in bladder tissue. PMID:11311483

  7. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    OpenAIRE

    2012-01-01

    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  8. Study on Detecting Transmissible Gastroenteritis Virus by Reverse Transcription Polymerase Chain Reaction%应用RT-PCR检测猪传染性胃肠炎病毒的研究

    Institute of Scientific and Technical Information of China (English)

    朱芬花

    2012-01-01

    根据GenBank已发表的猪传染性胃肠炎病毒(porcine transmissible gastroenteritis virus,TGEV)N蛋白的基因序列,设计合成1对引物,扩增片段长度为730 bp,在优化RT-PCR反应条件的基础上,建立了检测TGEV的RT-PCR检测方法,并用该方法对疑似TGEV的猪群临床腹泻疾病进行了诊断检测和分析.本研究建立的TGEV检测方法,特异、灵敏、可靠,为该病的诊断和流行病学调查研究提供了技术保障.%According to N protein gene sequence of TGEV which was published in GenBank, designed and synthesized 1 pair of primers, which amplified fragment length of 730 bp, the detection mthods of TGEV by RT-PCR was established on the basis of the optimization of RT-PCR reaction conditions. This study established the TGEV detection meihods, specific, sensitive and reliable for the diagnosis through clinical detection of diarrheal diseases and which will provide technical support for ep-idemiological studies on transmissible gastroenteritis virus.

  9. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  10. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Miagostovich Marize Pereira

    1997-01-01

    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  11. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load

    OpenAIRE

    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY

    1998-01-01

    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  12. A nonsense mutation causing decreased levels of insulin receptor mRNA: Detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction

    International Nuclear Information System (INIS)

    Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA

  13. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction

    OpenAIRE

    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.

    2009-01-01

    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  14. Development and validation of a Pneumocystis jirovecii real-time polymerase chain reaction assay for diagnosis of Pneumocystis pneumonia

    OpenAIRE

    Church, Deirdre L; Ambasta, Anshula; Wilmer, Amanda; Williscroft, Holly; Ritchie, Gordon; Pillai, Dylan R.; Champagne, Sylvie; Daniel G Gregson

    2015-01-01

    Pneumocystis pneumonia is caused by Pneumocystis jirovecii, an opportunistic fungal pathogen. Presently, many clinical microbiology laboratories rely on direct microscopic detection of P jirovecii. The validation, and clinical and laboratory development of a qualitative P jirovecii real-time polymerase chain reaction assay for the rapid detection of Pneumocystis pneumonia is discussed by the authors. In addition, this new technique is compared with the existing gold-standard immunofluorescenc...

  15. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. (Univ. of Illinois, Chicago (USA)); Wunder, J.S.; Andrulis, I.L. (Mount Sinai Hospital, Toronto, Ontario (Canada)); Gazdar, A.F. (National Cancer Inst., Bethesda, MD (USA)); Willman, C.L.; Griffith, B. (Univ. of New Mexico, Albuquerque (USA)); Von Hoff, D.D. (Univ. of Texas, San Antonio (USA))

    1990-09-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  16. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  17. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  18. The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

    International Nuclear Information System (INIS)

    Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

  19. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.

    2001-03-08

    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  20. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  1. Real-time polymerase chain reaction for diagnosis and quantitation of negative strand of chikungunya virus.

    Science.gov (United States)

    Chiam, Chun Wei; Chan, Yoke Fun; Loong, Shih Keng; Yong, Sara Su Jin; Hooi, Poh Sim; Sam, I-Ching

    2013-10-01

    Quantitative real-time polymerase chain reaction (qRT-PCR) is useful for diagnosis and studying virus replication. We developed positive- and negative-strand qRT-PCR assays to detect nsP3 of chikungunya virus (CHIKV), a positive-strand RNA alphavirus that causes epidemic fever, rash, and arthritis. The positive- and negative-strand qRT-PCR assays had limits of quantification of 1 and 3 log10 RNA copies/reaction, respectively. Compared to a published E1 diagnostic assay using 30 laboratory-confirmed clinical samples, the positive-strand nsP3 qRT-PCR assay had higher R(2) and efficiency and detected more positive samples. Peak viral load of 12.9 log(10) RNA copies/mL was reached on day 2 of illness, and RNA was detectable up to day 9, even in the presence of anti-CHIKV IgM. There was no correlation between viral load and persistent arthralgia. The positive-strand nsP3 assay is suitable for diagnosis, while the negative-strand nsP3 assay, which uses tagged primers to increase specificity, is useful for study of active viral replication kinetics. PMID:23886793

  2. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    Science.gov (United States)

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  3. Prompt detection of influenza A and B viruses using the BD Veritor™ System Flu A+B, Quidel® Sofia® Influenza A+B FIA, and Alere BinaxNOW® Influenza A&B compared to real-time reverse transcription-polymerase chain reaction (RT-PCR).

    Science.gov (United States)

    Dunn, Jim; Obuekwe, Joy; Baun, Traci; Rogers, Justin; Patel, Twinkle; Snow, Linda

    2014-05-01

    The performance characteristics of rapid influenza diagnostic tests vary widely. This study evaluated the BD Veritor™ System Flu A+B (Veritor; BD Diagnostics, Sparks, MD, USA), Quidel® Sofia® Influenza A+B FIA (Sofia; Quidel Corp., San Diego, CA, USA), and Alere BinaxNOW® Influenza A&B (Binax; Alere Scarborough, Inc., Scarborough, ME, USA) compared to reverse transcription-polymerase chain reaction (RT-PCR) for detection of influenza viruses in nasal wash specimens from 240 pediatric patients. Positive percent agreements for influenza A and B virus detection were 93.8% and 94.2%, 95.8% and 98.1%, and 79.2% and 80.8% for Veritor, Sofia, and Binax, respectively. The Veritor and Binax tests demonstrated negative percent agreements >97.9% for detection of both influenza viruses, but the negative percent agreement of the Sofia test was 91.1% for influenza A and 70.7% for influenza B virus. Overall, the Veritor and Sofia tests were nearly as sensitive as RT-PCR and considerably more sensitive than Binax for detection of influenza viruses. However, the accuracy of the Sofia test was significantly lower than either Veritor or Binax. PMID:24582581

  4. Polymerase chain reaction as a succesful biotechnological application. Ways we use PCR in the fields of bioinformatics forensics and genetics

    OpenAIRE

    Λάζαρη, Σπυριδούλα

    2011-01-01

    Molecular genetics use molecular methods that amplify specific fragments of DNA. Today, the molecular techniques which were developed for amplification and detection of specific sequences of nucleic acids helped in a great deal to understand the structure of many diseases. Polymerase chain reaction or PCR is a technique that is used for isolation and amplification of a specific sequence of DNA. PCR is an in vitro method that exploits the in vivo procedure of replication of DNA. DNA polyme...

  5. Diagnosis of human trypanosomiasis, due to Trypanosoma brucei gambiense in central Africa, by the polymerase chain reaction

    OpenAIRE

    Penchenier, Laurent; Simo, G.; Grébaut, Pascal; Nkinin, S.; Laveissière, Claude; Herder, Stéphane

    2000-01-01

    During a mass screening of sleeping sickness conducted in 1998 and 1999, and involving 27,932 persons in Cameroon and the Central African Republic, we tested the polymerase chain reaction (PCR) on whole blood for the diagnosis of human African trypanosomiasis due to #Trypanosoma brucei gambiense$. The 1858 samples obtained were from 4 groups : 155 infected patients, 1432 serological suspects detected by the card agglutination test for trypanosomiasis (CATT), 222 negative controls living in th...

  6. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra

    2016-08-01

    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  7. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  8. An amplified electrochemical aptasensor based on hybridization chain reactions and catalysis of silver nanoclusters

    Science.gov (United States)

    Chen, Ling; Sha, Liang; Qiu, Yuwei; Wang, Guangfeng; Jiang, Hong; Zhang, Xiaojun

    2015-02-01

    In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear range of 10-10 M to 10-5 M.In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear

  9. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  10. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  11. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan

    2014-02-01

    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  12. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    Science.gov (United States)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  13. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  14. Edge Detection Using Morphological Method and Corner Detection Using Chain Code Algorithm

    OpenAIRE

    Anjan Bikash Maity; Sandip Mandal; Ranjan Podder

    2011-01-01

    In this paper we show a very good approach to detect edge and corner of any image. Edges and corners are very important part of an image .In our present days edge and corner detections is very essential for object identification. In this paper we show edge detection using morphological method and corner detection using chain code algorithm. This two method can work on any type of image.

  15. Edge Detection Using Morphological Method and Corner Detection Using Chain Code Algorithm

    Directory of Open Access Journals (Sweden)

    Anjan Bikash Maity

    2011-07-01

    Full Text Available In this paper we show a very good approach to detect edge and corner of any image. Edges and corners are very important part of an image .In our present days edge and corner detections is very essential for object identification. In this paper we show edge detection using morphological method and corner detection using chain code algorithm. This two method can work on any type of image.

  16. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  17. The use of real-time polymerase chain reaction with high resolution melting (real-time PCR-HRM) analysis for the detection and discrimination of nematodes Bursaphelenchus xylophilus and Bursaphelenchus mucronatus.

    Science.gov (United States)

    Filipiak, Anna; Hasiów-Jaroszewska, Beata

    2016-04-01

    The real-time PCR-HRM analysis was developed for the detection and discrimination of the quarantine nematode Bursaphelenchus xylophilus and Bursaphelenchus mucronatus. A set of primers was designed to target the ITS region of rDNA. The results have demonstrated that this analysis is a valuable tool for differentiation of these both species. PMID:26880540

  18. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients.

    Directory of Open Access Journals (Sweden)

    Sirirat Seekhuntod

    Full Text Available Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC. The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR assay to detect KRAS mutations.We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D. We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay.Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%, G12D (25.83% and G12V (12.50% in codon 12.The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues.

  19. DIFFERENTIATION OF PSEUDOCONDYLOMA OF VULVA AND CONDYLOMA ACUMINATA BY DOT BLOT HYBRIDIZATION AND POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿

    1996-01-01

    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  20. Multiplex polymerase chain reaction (PCR) on a SU-8 chip

    DEFF Research Database (Denmark)

    Christensen, Troels Balmer; Bang, Dang Duong; Wolff, Anders

    2008-01-01

    We present the detection of Campylobacter at species level using multiplex PCR in a micro fabricated PCR chip. The chip is based on the polymer SU-8 that allows integration with different microfluidic components, e.g., sample pre-treatment before PCR, and DNA detection simultaneously with or after...... the PCR. The chip performs very well with respect to heating and cooling rates with values up to around 40 °C/s and 20 °C/s, respectively, and has low power consumption (0.5–2.5 W depending on temperature). Multiplex DNA amplification by PCR for the detection of Campylobacter at species level...... was performed successfully on the chip with results comparable to conventional PCR methods. Microsystems often show serious PCR inhibition due to a high surface to volume ratio which causes an increased proclivity of the PCR mix ingredients to stick to the surfaces. To avoid this, a simple method of dynamic...

  1. Development and Validation of TaqMan Real-Time Polymerase Chain Reaction Assays for the Quantitative and Differential Detection of Wild-Type Infectious Laryngotracheitis Viruses from a Glycoprotein G-Deficient Candidate Vaccine Strain.

    Science.gov (United States)

    Shil, Niraj K; Legione, Alistair R; Markham, Philip F; Noormohammadi, Amir H; Devlin, Joanne M

    2015-03-01

    Infectious laryngotracheitis (ILT) is a significant upper respiratory tract disease of chickens with a worldwide distribution. Differentiating between wild-type and vaccine strains of ILT virus (ILTV) would be useful for enhancing disease control, and in the early stages of a disease outbreak molecular diagnostic tools for the detection and differentiation of the circulating virus could be applied. This study developed TaqMan real-time PCR (qPCR) assays to detect and differentiate the glycoprotein G (gG)-deficient (ΔgG) ILTV candidate vaccine strain of ILTV from ILTV strains that contain the gG gene. The gG+ve and gG-ve ILTV TaqMan assays were used in individual and multiplex format to detect, differentiate, and quantitate ILTV DNA in laboratory and clinical samples. The assays were highly sensitive and highly specific, with a detection limit of 10 viral template copies for each assay. Low interassay coefficients of variation were recorded (0.021-0.042 and 0.013-0.039) for gG+ve and gG-ve TaqMan assays, respectively. The multiplex assay was successfully used to examine the replication kinetics of wild-type and ΔgG strains of ILTV in cultured leghorn male hepatoma cells and embryonated hen eggs under coinfection conditions. The results showed that the TaqMan qPCR assay, along with the ΔgG ILTV vaccine, has the potential to be used in a "Differentiating Infected from Vaccinated Animals" strategy for the control and eradication of ILT. PMID:26292527

  2. A novel nested multiplex polymerase chain reaction (PCR) assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    OpenAIRE

    Parija Subhash C; Khairnar Krishna

    2007-01-01

    Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii a...

  3. Detection of pathogenic elephant endotheliotropic herpesvirus in routine trunk washes from healthy adult Asian elephants (Elephas maximus) by use of a real-time quantitative polymerase chain reaction assay

    Science.gov (United States)

    Stanton, Jeffrey J.; Zong, Jian-Chao; Latimer, Erin; Tan, Jie; Herron, Alan; Hayward, Gary S.; Ling, Paul D.

    2013-01-01

    Objective To investigate the pathogenesis and transmission of elephant endotheliotropic herpesvirus (EEHV1) by analyzing various elephant fluid samples with a novel EEHV1-specific real-time PCR assay. Animals 5 apparently healthy captive Asian elephants (Elephas maximus) from the same herd. Procedures A real-time PCR assay was developed that specifically detects EEHV1. The assay was used to evaluate paired whole blood and trunk-wash samples obtained from the 5 elephants during a 15-week period. Deoxyribonucleic acid sequencing and viral gene subtyping analysis were performed on trunk-wash DNA preparations that had positive results for EEHV1. Viral gene subtypes were compared with those associated with past fatal cases of herpesvirus-associated disease within the herd. Results The PCR assay detected viral DNA to a level of 1,200 copies/mL of whole blood. It was used to detect EEHV1 in trunk secretions of 3 of the 5 elephants surveyed during the 15-week period. Viral gene subtyping analysis identified 2 distinct elephant herpesviruses, 1 of which was identical to the virus associated with a previous fatal case of herpesvirus-associated disease within the herd. Conclusions and Clinical Relevance EEHV1 was shed in the trunk secretions of healthy Asian elephants. Trunk secretions may provide a mode of transmission for this virus. Results of this study may be useful for the diagnosis, treatment, and management of EEHV1-associated disease and the overall management of captive elephant populations. PMID:20673092

  4. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    Science.gov (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  5. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF

    2000-01-01

    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  6. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  7. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    Science.gov (United States)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  8. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    International Nuclear Information System (INIS)

    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

  9. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    Science.gov (United States)

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. J. Med. Virol. 88:871-876, 2016. © 2015 Wiley Periodicals, Inc. PMID:26455510

  10. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: ruark@126.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: zhouximi@yahoo.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)

    2012-03-09

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  11. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    International Nuclear Information System (INIS)

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

  12. Method of carbon chain extension using novel aldol reaction

    Energy Technology Data Exchange (ETDEWEB)

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  13. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Directory of Open Access Journals (Sweden)

    Mari Tuyama

    2008-03-01

    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  14. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction.

    Science.gov (United States)

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham

    2002-08-01

    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  15. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  16. Pesquisa de Mycobacterium leprae em biópsias de mucosa oral por meio da reação em cadeia da polimerase Molecular detection of Mycobacterium leprae by polymerase chain reaction in oral mucosa biopsy specimens

    Directory of Open Access Journals (Sweden)

    Geraldo Gomes dos Santos

    2007-06-01

    Full Text Available FUNDAMENTOS - A hanseníase é endêmica na América do Sul, sendo responsável por 3% do total dos casos mundiais e, particularmente, no Brasil, por 85% dos casos sul-americanos. Seu agente pode ser encontrado na mucosa oral sem qualquer alteração evidente, e apenas testes laboratoriais muito sensíveis podem detectar sua presença. OBJETIVOS - Determinar se o genoma do Mycobacterium leprae pode ser encontrado pelo teste da PCR em biópsias com punch da mucosa oral de pacientes com hanseníase. MATERIAL E MÉTODOS - Realizou-se biópsia da mucosa oral normal de sete pacientes com hanseníase multibacilar. Cinco estavam em tratamento durante o estudo, e apenas um, ainda sem tratamento, teve o diagnóstico confirmado pela hematoxilina-eosina e coloração de Fite-Faraco para M. leprae. As peças foram incluídas em parafina e submetidas à PCR para pesquisa de M. leprae. RESULTADOS - Seis dos sete casos foram positivos para M. leprae, e um para Mycobacterium sp., demonstrando-se alta sensibilidade e especificidade do método. CONCLUSÃO - A PCR é método rápido, fácil e confiável para a investigação de rotina da infecção por micobactéria, mesmo quando a doença ainda é assintomática. O diagnóstico pode ser obtido a partir de simples biópsia ambulatorial.BACKGROUND - Hansen's disease is endemic in South America, which accounts for 3% of total world cases, and particularly in Brazil, which accounts for 85% of all South American cases. The bacteria can be found in the oral mucosa with no evident signs of infection, and only very sensitive laboratory assays can detect its presence. OBJECTIVES - The aim of this study was to ascertain if the M. leprae genome can be detected by PCR in small punch biopsy specimens from the oral mucosa of patients with Hansen's disease. METHODS - The normal oral mucosas of seven multibacillary Hansen's disease patients were biopsied. Five of them were under treatment at the time of the study. Diagnosis of

  17. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    OpenAIRE

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M.; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; E.Lojkowska

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic culture...

  18. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    Science.gov (United States)

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  19. Polyvinylpyrrolidone-Agarose Gel Electrophoresis Purification of Polymerase Chain Reaction-Amplifiable DNA from Soils

    OpenAIRE

    Young, Charles C.; Burghoff, Robert L.; Keim, Lois G.; Minak-Bernero, Vera; Lute, James R.; Hinton, Stephen M.

    1993-01-01

    This communication describes a modification of agarose gel electrophoresis to provide a rapid and simple method for the purification of polymerase chain reaction-amplifiable DNA from soil. This modification is to add polyvinylpyrrolidone to the agarose gel. The polyvinylpyrrolidone addition retards the electrophoretic mobility of denaturing phenolic compounds so that they do not comigrate with nucleic acids.

  20. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    Science.gov (United States)

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  1. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  2. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.; Ahlford, A.; Syvänen, A.-C; Kutter, Jörg Peter; Wolff, Anders

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple and...

  3. Hybridization probes for conventional DNA fingerprinting used as single primers in the polymerase chain reaction to distinguish strains of Cryptococcus neoformans.

    OpenAIRE

    Meyer, W.; Mitchell, T G; Freedman, E Z; Vilgalys, R

    1993-01-01

    In conventional DNA fingerprinting, hypervariable and repetitive sequences (minisatellite or microsatellite DNA) are detected with hybridization probes. As demonstrated here, these probes can be used as single primers in the polymerase chain reaction (PCR) to generate individual fingerprints. Several conventional DNA fingerprinting probes were used to prime the PCR, yielding distinctive, hypervariable multifragment profiles for different strains of Cryptococcus neoformans. PCR fingerprinting ...

  4. Human papillomavirus infection and anal carcinoma. Retrospective analysis by in situ hybridization and the polymerase chain reaction.

    OpenAIRE

    Zaki, S R; Judd, R.; Coffield, L. M.; Greer, P; Rolston, F.; Evatt, B L

    1992-01-01

    To examine the association of human papillomavirus (HPV) infection with anal squamous cell carcinoma, the authors applied the highly sensitive polymerase chain reaction (PCR) and in situ hybridization (ISH) techniques to detect HPV DNA in formalin-fixed, paraffin-embedded tissues from 18 patients. The presence of HPV types 16/18 in 3 (16.7%) of 18 patients with anal carcinoma was found, using a colorimetric ISH technique for HPV types 6, 11, 16, 18, 31, 35, and 51. Results from one of these t...

  5. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    Science.gov (United States)

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  6. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction.

    Science.gov (United States)

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T

    1997-01-01

    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  7. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    Science.gov (United States)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  8. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  9. BORRELIA BURGDORFERI DNA IN BIOLOGICAL SAMPLES FROM PATIENTS WITH SARCOIDOSIS USING THE POLYMERASE CHAIN REACTION TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈

    1995-01-01

    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  10. Polymerase chain reaction amplification of a GC rich region by adding 1,2 propanediol

    Directory of Open Access Journals (Sweden)

    Zeinab Mousavian

    2014-01-01

    Full Text Available Background : Apolipoprotein E (ApoE is one of the most important carriers of lipids in mammalians. The gene for this lipoprotein (ApoE is located on chromosome 19 which is related with the pathogenesis of some nervous system disease. ApoE gene is identified as a high guanine-cytosine (GC content fragment. Detection and amplification of these templates are extensively laborious and baffling. The aim of this study was to find a practical and feasible method for the amplification of the number of GC rich genes such as ApoE. Materials and Methods: We experimented with simple polymerase chain reaction (PCR, nested PCR and PCR with 1-2 propanediol, dimethylsulfoxide (DMSO, and ethyleneglicol as additive substances to enhance the amplification ApoE gene and used the 40 samples of the human whole blood were collected in test tubes with a pre-treatment of ethylene diaminetetraacetic acid. Results: According to our observations, presence of 1-2 propanediol, DMSO, and ethyleneglicol as additive substances resulted to enhanced amplification of ApoE gene. Addition of 1-2 propanediol showed the best results, caused optimization and revealed more specific and sharp bands. Conclusion: According to our findings 1-2 propanediol are the best organic reagent for improving the amplification of ApoE gene. Optimization procedure for each GC rich sequence is recommended to be performed separately in order to identify which of the additive agent is more efficient and applicable for a particular target.

  11. Evaluation of a rapid polymerase chain reaction based identification technique for Vibrio cholerae isolates.

    Science.gov (United States)

    le Roux, W J; Masoabi, D; de Wet, C M E; Venter, S N

    2004-01-01

    Rapid and accurate identification of waterborne pathogens, such as Vibrio cholerae, in drinking-water sources is important to enable effective resource management and public health protection. Phenotypic systems currently being used for the identification of Vibrio cholerae isolates are time-consuming and the need exists for the development of suitable molecular techniques that can offer both fast and reliable identification. During this study, isolates identified as Vibrio cholerae by means of two different biochemical test systems (API 20E and VITEK 32) were analysed with the polymerase chain reaction (PCR) to compare the reliability of the various identification systems. The selected PCR technique amplified a sequence within the outer membrane protein of Vibrio cholerae, a gene specific for V. cholerae. It was found that out of 243 isolates biochemically identified as V. cholerae with either the API or VITEK system, 21 isolates did not give a positive result with the PCR detection method. Sequencing the 16S rDNA of more than half of these isolates and comparison of the sequences with Internet databases indicated that most of the isolates belonged to the genus Aeromonas. The results indicated that the rapid PCR procedure was more accurate than the API or VITEK systems currently being used for the phenotypic identification of Vibrio cholerae isolates. PMID:15318514

  12. GSH2 promoter methylation in pancreatic cancer analyzed by quantitative methylation-specific polymerase chain reaction

    Science.gov (United States)

    GAO, FEI; HUANG, HAO-JIE; GAO, JUN; LI, ZHAO-SHEN; MA, SHU-REN

    2015-01-01

    Tumor suppressor gene silencing via promoter hypermethylation is an important event in pancreatic cancer pathogenesis. Aberrant DNA hypermethylation events are highly tumor specific, and may provide a diagnostic tool for pancreatic cancer patients. The objective of the current study was to identify novel methylation-related genes that may potentially be used to establish novel therapeutic and diagnostic strategies against pancreatic cancer. The methylation status of the GS homeobox 2 (GSH2) gene was analyzed using the sodium bisulfite sequencing method. The GSH2 methylation ratio was examined in primary carcinomas and corresponding normal tissues derived from 47 patients with pancreatic cancer, using quantitative methylation-specific polymerase chain reaction. Methylation ratios were found to be associated with the patient's clinicopathological features. GSH2 gene methylation was detected in 26 (55.3%) of the 47 pancreatic cancer patients, indicating that it occurs frequently in pancreatic cancer. A significant association with methylation was observed for tumor-node-metastasis stage (P=0.031). GSH2 may be a novel methylation-sensitive tumor suppressor gene in pancreatic cancer and may be a tumor-specific biomarker of the disease. PMID:26171036

  13. Degenerate Oligonucleotide Primed-Polymerase Chain Reaction-Based Array Comparative Genomic Hybridization for Extensive Amplicon Profiling of Breast Cancers : A New Approach for the Molecular Analysis of Paraffin-Embedded Cancer Tissue

    OpenAIRE

    Daigo, Yataro; Chin, Suet-Feung; Gorringe, Kylie L.; Bobrow, Lynda G; Bruce A J Ponder; Pharoah, Paul D P; Caldas, Carlos

    2001-01-01

    We have developed a protocol for degenerate oligonucleotide-primed-polymerase chain reaction-based array comparative genomic hybridization (array CGH) that, when combined with a laser microdissection technique, allows the analysis of cancer cell populations isolated from routine, formalin-fixed, paraffin-embedded tissue samples. Comparison of copy number changes detected by degenerate oligonucleotide-primed-polymerase chain reaction-based array CGH to those detected by conventional array CGH ...

  14. Detect adverse drug reactions for drug Pioglitazone

    OpenAIRE

    Liu, Yihui; Aickelin, Uwe

    2013-01-01

    In this study we propose a novel method to successfully detect the ADRs using feature matrix and feature selection. A feature matrix, which characterizes the medical events before patients take drugs or after patients take drugs, is created from THIN database. The feature selection method of Student's t-test is used to detect the significant features from thousands of medical events. The significant ADRs, which are corresponding to significant features, are detected. Experiments are performed...

  15. Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

    Science.gov (United States)

    Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

    2002-01-01

    Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system. PMID:12083257

  16. DNAzyme-based biosensor for Cu(2+) ion by combining hybridization chain reaction with fluorescence resonance energy transfer technique.

    Science.gov (United States)

    Chen, Ying; Chen, Ling; Ou, Yidian; Wang, Zhenhua; Fu, Fengfu; Guo, Liangqia

    2016-08-01

    A novel signal amplification strategy based on Cu(2+)-dependent DNAzyme was developed for sensing Cu(2+) ion by combining hybridization chain reaction (HCR) with fluorescence resonance energy transfer (FRET) technique. In the presence of Cu(2+) ion, the substrate strands of Cu(2+)-dependent DNAzyme immobilized on magnetic beads were specifically cleaved and released. The released strands initiated the HCR process of hairpin H1 and H2 labeled with FAM as the donor and TAMRA as the acceptor, respectively. Long nicked dsDNA structures were self-assembled to bring the donor and the acceptor in close proximity, resulting in a FRET process. The relative ratio of fluorescent intensities of the acceptor and donor was used to quantitatively detect Cu(2+) ion with a limit of detection of 0.5nmolL(-1). This proposed biosensor was applied to detect Cu(2+) ion in tap water with satisfactory results. PMID:27216680

  17. The establishment of real-time fluorescent quantitation polymerase chain reaction for detection of Escherichia coli in urine%尿液中大肠埃希菌实时荧光定量聚合酶链反应检测方法的建立

    Institute of Scientific and Technical Information of China (English)

    吴蓉; 张隆; 华玲; 戴俊华; 刘丽丽; 康向东

    2011-01-01

    目的 建立实时荧光定量聚合酶链反应(RQ-PCR) 检测大肠埃希菌的方法,检测泌尿道感染患者尿液样本,评估应用RQ-PCR法在检测大肠埃希菌尿路感染的意义.方法 选择大肠埃希菌β-右旋半乳糖苷酶基因作为检测靶基因设计引物,建立SYBR GREEN I RQ-PCR检测体系.结果 引物特异性好,标准曲线相关系数在0.990 ~0.996 之间.熔解曲线显示产物特异性较强,无非目的 条带和二聚体产生.在最低检测限(102拷贝/μL)以上,能对大肠埃希菌样本进行检测,且重复性好.结论 RQ-PCR是一种快速、敏感、特异、重复性好的定量检测大肠埃希菌质粒DNA方法,可用于定量检测临床患者尿液样本中大肠埃希菌含量.%Objective To establish a method for detecting Escherichia coli in urine of patients with urinary tract infection by real-time fluorescent quantitation polymerase chain reaction (RQ-PCR) and evaluate the significance of this method. Methods Escherichia coli β-D-galactosidase gene was used to design primers for RQ-PCR. SYBR GREEN I was used in RQ-PCR. Results The specificity of primer was good, and the correlation coefficient of standard curve was 0. 990-0. 996. Melt-curve analysis showed that the primers were specific, and no nonspecific products such as nonspecific bands and primer-dimers were produced. Escherichia coli could be detected when the minimum detection limit of Escherichia coli was above 102 copies/μL. The repeatability was good. Conclusions RQ- PCR is a fast,sensitive and specific method with good repeatability to examine Escherichia coli plasmid DNA, which can be used to detect Escherichia coli level in the urine of the patients with urinary infection.

  18. Detection of Vibrio Cholerae in Turtles by Real Time Polymerase Chain Reaction, Colloidal Gold Immunochromatographic Assay and Conventional Bacterial Culture%实时荧光PCR法、胶体金法和培养法检测甲鱼中霍乱弧菌

    Institute of Scientific and Technical Information of China (English)

    颜淑妩; 李哲婷; 邓婵

    2012-01-01

    目的 优化水产品甲鱼中霍乱弧菌的检测程序,提高甲鱼中霍乱弧菌检出率.方法 用实时荧光PCR、常规细菌培养、胶体金法同时对甲鱼中霍乱弧菌进行检测,并用实时荧光PCR法检测标本中霍乱弧菌ctx基因.结果 共检测185份甲鱼样品,其中实时荧光PCR法检出28份霍乱弧菌核酸阳性,阳性率为15.14%;6份ctx基因核酸阳性,阳性率21.43% (6/28).常规细菌培养法分离出2株菌株,一株为O139群霍乱弧菌,一株为小川型霍乱弧菌,用实时荧光PCR检测这两株纯培养菌株或原始标本,霍乱弧菌ctx基因均为阴性;胶体金法未检出阳性标本.结论 对于水产品标本,可先用实时荧光PCR法筛检霍乱弧菌,阳性标本再进行传统细菌分离培养,以提高霍乱弧菌菌株的检出率;同时阳性标本进行霍乱弧菌ctx基因核酸检测,如也为阳性,需提高警惕,加强流行病学上的预防控制措施,及时防范霍乱疫情的发生.%Objective To optimize the detection procedure of Vibrio Cholerae (v. cholerae) and increase its detection rate in turtles. Methods The v. cholerae in turtles was detected by real time polymerase chain reaction (real time PCR), conventional bacterial culture and colloidal gold immunochrornatographic assay, and the ctx gene of the virus was detected by real time PCR. Results Real time PCR revealed that among 185 turtle samples, 28 ones were positive with v. cholerae nucleic acid, with a positive rate of 15.14% (28/185), and six samples were positive with ctx gene, with a positive rate of 21.43% (6/ 28). Two strains of v.cholerae were isolated by conventional bacterial culture, Vibrio cholerae O139, and Vibrio cholerae Ol serotype Ogawa. Neither the pure cultures nor the original samples of both stains were positive with ctx gene. No v. cholerae was detected by colloidal gold immunochromatugraphic assay. Conclusions For V. cholerae detection in seafood samples, real time PCR can be first used for

  19. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... sample (100 to 2000 ng/5 μl) with one of the following 45 μl PCR cocktails: (i) 5 μl 10x PCR buffer, 1...

  20. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    OpenAIRE

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  1. Optimization of asymmetric polymerase chain reaction for rapid fluorescent DNA sequencing.

    Science.gov (United States)

    Wilson, R K; Chen, C; Hood, L

    1990-02-01

    A high-throughput method for the preparation of single-stranded template DNA, which is suitable for sequence analysis using fluorescent labeling chemistry, is described here. In this procedure, the asymmetric polymerase chain reaction is employed to amplify recombinant plasmid or bacteriophage DNA directly from colonies or plaques. The use of amplification primers located at least 200 base pairs 5' to the site of sequencing primer annealing removes the need for extensive purification of the asymmetric polymerase chain reaction product. Instead, the single-stranded product DNA is purified by a simple isopropanol precipitation step and then directly sequenced using fluorescent dye-labeled oligonucleotides. This method significantly reduces the time and labor required for template preparation and improves fluorescent DNA sequencing strategies by providing a much more uniform yield of single-stranded DNA. PMID:2317375

  2. Light chain editing generates polyreactive antibodies in chronic graft-versus-host reaction

    OpenAIRE

    Witsch, Esther J.; Cao, Hong; Fukuyama, Hidehiro; Weigert, Martin

    2006-01-01

    The chronic graft-versus-host (cGvH) reaction is a model of induced lupus caused by alloreactive CD4+ T cells from a Bm-12 mouse in a C57BL/6 recipient. We used this cGvH reaction in C57BL/6 anti-DNA H chain transgenic mice, 56R/B6, to understand the structure, specificity, and origin of the induced autoantibodies (auto-Abs). We found anti-DNA Abs that reacted to several different antigens, such as phosphatidylserine, myelin basic protein, thyroglobulin, histone, insulin, cytochrome C, and β-...

  3. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin

    2011-01-01

    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  4. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei

    2011-01-01

    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  5. Nuclear reaction analysis (NRA) for trace element detection

    Energy Technology Data Exchange (ETDEWEB)

    Doebeli, M. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Noll, K. [Bern Univ. (Switzerland)

    1997-09-01

    Ion beam induced nuclear reactions can be used to analyse trace element concentrations in materials. The method is especially suited for the detection of light contaminants in heavy matrices. (author) 3 figs., 2 refs.

  6. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng

    2015-05-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  7. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    OpenAIRE

    Dewit, D.; Wootton, M.; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not c...

  8. DNA amplification by polymerase chain reaction from brain tissues embedded in paraffin.

    OpenAIRE

    Gall, K; Pavelić, J.; Jadro-Santel, D.; Poljak, M; Pavelić, K.

    1993-01-01

    A method which enables analysis of DNA from archival paraffin embedded normal and malignant brain tissue is described. The demonstration of a 317-bp long beta-actin DNA sequence by the polymerase chain reaction (PCR) was used to identify which fixation procedure, deparaffinization time and DNA extraction procedure would give the best results. Tissue specimens 1-39 years old were included in the experiments. Specimens fixed in either 10% formalin, Carnoy's or AMeX fixative were found to be bes...

  9. Microdissection and polymerase chain reaction amplification of genomic DNA from histological tissue sections.

    OpenAIRE

    Moskaluk, C A; Kern, S.E.

    1997-01-01

    Polymerase chain reaction (PCR)-based assays are being used increasingly to study the molecular genetic changes that occur in minute cellular lesions that are identified in histological sections. It is often desirable to microdissect the cells of interest in a lesion, isolating them from surrounding normal tissue to obtain the purest representation of genomic DNA possible. We present here an optimized microdissection and DNA extraction protocol that reliably produces PCR-amplifiable DNA from ...

  10. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    OpenAIRE

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-01-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate p...

  11. Uji Diagnostik Polymerase Chain Reaction –Restriction Fragment Length Polymorphism Dalam Menegakkan Diagnosis Onikomikosis.

    OpenAIRE

    Lubis, Nova Zairina

    2015-01-01

    Background: Onychomycosis is a fungal infection of one or more units of the nail caused by dermatophytes, or mold and nondermatophytes yeast. Investigations are needed to establish the diagnosis of onychomycosis before starting treatment. Several investigations methods for diagnosing onychomycosis such as microscopic examination with 20% KOH, fungal culture, histopathology examination with PAS staining (Periodic acid Schiff) and PCR (Polymerase Chain Reaction), for culture methods require a l...

  12. Genomic fingerprints of Staphylococcus aureus of bovine origin by polymerase chain reaction-based DNA fingerprinting.

    OpenAIRE

    Matthews, K R; Kumar, S. J.; O'Conner, S. A.; Harmon, R J; Pankey, J W; Fox, L. K.; Oliver, S P

    1994-01-01

    Staphylococcus aureus (n = 75) isolated from mammary secretions of cows with subclinical and clinical mastitis from several geographic locations in the USA were examined using polymerase chain reaction-based DNA fingerprinting. DNA fingerprints were produced using a synthetic oligonucleotide primer (5'GTAACGCC3') to produce a distinct spectrum of amplified DNA fragments facilitating a high degree of resolution for differentiating S. aureus strains. PCR-based DNA fingerprinting grouped the 75 ...

  13. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  14. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    OpenAIRE

    Li Jiang; Matthew Mancuso; Zhengda Lu; Gunkut Akar; Ethel Cesarman; David Erickson

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics ...

  15. Compact-like kink in a real electrical reaction-diffusion chain

    International Nuclear Information System (INIS)

    We demonstrate experimentally the compact-like kinks existence in a real electrical reaction-diffusion chain. Our measures show that such entities are strictly localized and consequently present a finite spatial extent. We show equally that the kink velocity is threshold-dependent. A theoretical quantification of the critical coupling under which propagation fails is also achieved and reveals that nonlinear coupling leads to a propagation failure reduction

  16. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis

    OpenAIRE

    Padmavathy L; Rao L; Veliath A

    2003-01-01

    Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR) is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patien...

  17. The design and construction of an electronic model of the chain reaction process

    International Nuclear Information System (INIS)

    The design and construction of an electronic model simulating the nuclear chain reaction process up to three successive neutron generations is briefly described. This model is equipped with a special sound effect. However, a tape recorder can be attached and replayed in synchronism with the display with minimum hardware modifications. In this manner, it can function as a useful educational aid. The circuit is built around easily available ttl integrated circuits. (author)

  18. Effect of fungal and plant secondary metabolites on polimerase chain reaction (PCR)

    OpenAIRE

    Thaler, Nejc; Bajc, Marko

    2013-01-01

    Secondary metabolites are organic compounds that can be found in both fungi and plants, where they play an important role as defensive and signal molecules, or provide other kinds of advantage in natural selection, but are not directly involved in normal growth, development and reproduction of an organism. When working with DNA techniques, it is the secondary metabolites that most often affect the efficiency of polymerase chain reaction (PCR), either by hindering cell lysis, causing ...

  19. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.

    OpenAIRE

    Alexander, H S; Key, D.W.; Nagy, E.

    1998-01-01

    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb Ba...

  20. Detection of weak neutral currents in inclusive neutrino reactions

    International Nuclear Information System (INIS)

    At a neutrino experiment performed at CERN both the first purely leptonic reaction νsub(μ)e- → νsub(μ)e- and the inclusive inelastic neutrino-nucleon reaction νsub(μ)N → νsub(μ) hadrons were detected for the first time. The present thesis contains more detailed analysis of the last hadronic reaction in the energy range of several GeV. (orig./HSI)