WorldWideScience

Sample records for chain reaction assay

  1. Identification of Erwinia stewartii by a ligase chain reaction assay.

    OpenAIRE

    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A

    1994-01-01

    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...

  2. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti

    OpenAIRE

    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.

    1996-01-01

    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  3. A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Ali, A; Reynolds, D L

    1999-01-01

    A reverse transcription-polymerase chain reaction assay was developed for the detection of avian pneumovirus (Colorado strain) (APV-Col). The specific primers were designed from the published sequence of the matrix protein gene of APV-Col. The primers amplified a product of 631 nucleotides from APV-Col. The assay identified only APV-Col and did not react with Newcastle disease virus and infectious bronchitis virus.

  4. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain

    2010-02-01

    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  5. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.

    OpenAIRE

    Patou, G.; Pillay, D.; Myint, S; Pattison, J.

    1993-01-01

    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  6. A Novel Nested Polymerase Chain Reaction (n-PCR) Assay for Identifying Sorghum nitidum

    OpenAIRE

    Wei, Shasha; Zhirui DENG; Liping YIN; Yi, Jianping; Renqi WU; Qin CHEN

    2011-01-01

    This work developed a novel nested polymerase chain reaction (n-PCR) assay to identify Sorghum nitidum (S. nitidum). It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band ...

  7. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  8. A Novel Nested Polymerase Chain Reaction (n-PCR Assay for Identifying Sorghum nitidum

    Directory of Open Access Journals (Sweden)

    Shasha WEI

    2011-11-01

    Full Text Available This work developed a novel nested polymerase chain reaction (n-PCR assay to identify Sorghum nitidum (S. nitidum. It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band at ~873 bp in gel spectra, while other relatives, including Sorghum halepense, Sorghum almum, Sorghum bicolor, Sorghum propinum and Sorghum sudanse exhibited negative amplifications. This assay was able to specifically identify S. nitidum fast and effectively, which could be applied widely in field inspection, agriculture production and plant protection.

  9. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus.

    Science.gov (United States)

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A

    2011-01-01

    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  10. Development and validation of a Myxoma virus real-time polymerase chain reaction assay

    OpenAIRE

    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  11. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    Science.gov (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  12. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying

    2007-01-01

    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  13. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Directory of Open Access Journals (Sweden)

    Mari Tuyama

    2008-03-01

    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  14. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    Science.gov (United States)

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures.

  15. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    Science.gov (United States)

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  16. A polymerase chain reaction assay for ascosporic inoculum of Sclerotinia species

    Science.gov (United States)

    A PCR assay was developed which amplified a 170-bp fragment of the intergenic spacer region of Sclerotinia sclerotiorum, the cause of white mould. Sensitivity was 10 S. sclerotiorum ascospores per DNA extraction (0.2 ascospores per PCR reaction). The presence of soil did not affect sensitivity a...

  17. Chain reaction

    International Nuclear Information System (INIS)

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  18. An allele-specific polymerase chain reaction assay for the differentiation of members of the Anopheles culicifacies complex

    Indian Academy of Sciences (India)

    O P Singh; Geeta Goswami; N Nanda; K Raghavendra; D Chandra; S K Subbarao

    2004-09-01

    Anopheles culicifacies, the principal vector of malaria in India, is a complex of five cryptic species which are morphologically indistinguishable at any stage of life. In view of the practical difficulties associated with classical cytotaxonomic method for the identification of members of the complex, an allele-specific polymerase chain reaction (ASPCR) assay targeted to the D3 domain of 28S ribosomal DNA was developed. The assay discriminates An. culicifacies species A and D from species B, C and E. The assay was validated using chromosomally-identified specimens of An. culicifacies from different geographical regions of India representing different sympatric associations. The assay correctly differentiates species A and D from species B, C and E. The possible use of this diagnostic assay in disease vector control programmes is discussed.

  19. Novel assay of competitively differentiated polymerase chain reaction for screening point mutation of hepatitis B virus

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Xue-Juan Chen; Jian-Guo Li; Lin Gu; Yang-Su Huang; Zhi-Liang Gao

    2003-01-01

    AIM: Point mutation, one of the commonest gene mutations,is the most important molecular pathogenesis of cancer and chronic infection. The commonest methods for detection of point mutation are based on polymerase chain reaction (PCR). These techniques, however, cannot be used in large scale screening since they are neither accurate nor simple.For this reason, this study established a novel method of competitively differentiated PCR (CD-PCR) for screening point mutation in clinical practice.METHODS: Two competitively differentiated primers for mutant-type and wild-type templates respectively with an identically complemented region in 3′ end except for last 2base pairs and a different non-complemented region in 5′end were designed. Thus, competitive amplification might be carried out at a lower annealing temperature at first, and then differentiated amplification at a higher annealing temperature when primers could not combine with initial templates. The amplification was performed in one-tube.The products of CD-PCR were detected using microplate hybridization assay. CD-PCR was evaluated by detecting G1896A variant of hepatitis B virus (HBV) in form of recombinant plasmids and in sera from patients with hepatitis B, and compared with allele-specific PCR (AS-PCR) and competitive AS-PCR.RESULTS: CD-PCR was successfully established. It could clearly distinguish wild-type and mutant-type plasmid DNA of G1896A variant when the amount of plasmid DNA was between 102-108copies/reaction, while for AS-PCR and competitive AS-PCR, the DNA amount was between 102-104copies/reaction. CD-PCR could detect one copy of G1896A variant among 10-100 copies of wild-type plasmid DNA. The specificity of CD-PCR was higher than those of AS-PCR and competitive AS-PCR in the detection of HBV G1896A variant in sera from patients with hepatitis B. CD-PCR was independent of the amount of HBV DNA in serum. HBV G1896A variant was more often found in HBeAg (-) patients with a lower level of

  20. Rapid Detection/pathotyping of Newcastle disease virus isolates in clinical samples using real time polymerase chain reaction assay

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Abdul Wajid, Muhammad Wasim, Tahir Yaqub, Shafqat F Rehmani, Tasra Bibi, Nadia Mukhtar, Javed Muhammad, Umar Bacha, Suliman Qadir Afridi, Muhammad Nauman Zahid, Zia u ddin, Muhammad Zubair Shabbir, Kamran Abbas & Muneer Ahmad ### Abstract In the present protocol we describe the real time reverse transcription polymerase chain reaction (rRT-PCR) assay for the rapid detection/pathotyping of Newcastle disease virus (NDV) isoaltes in clinical samples. Fusion gene and matrix ...

  1. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    Science.gov (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola.

  2. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    Science.gov (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  3. The sensitivity and specificity of a reverse transcription-polymerase chain reaction assay for the avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Pedersen, J C; Reynolds, D L; Ali, A

    2000-01-01

    A reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of avian pneumovirus (APV), Colorado strain (US/CO), was evaluated for sensitivity and specificity. The single-tube RT-PCR assay utilized primers developed from the matrix (M) gene sequence of the US/CO APV. The RT-PCR amplified the US/CO APV but did not amplify other pneumoviruses, including the avian pneumoviruses subgroups A and B. The RT-PCR was capable of detecting between 10(0.25) mean tissue culture infective dose (TCID50) and 10(-0.44) TCID50 of the US/CO APV. These results have demonstrated that the single-tube RT-PCR assay is a specific and sensitive assay for the detection of US/CO APV.

  4. A multiplex reverse transcription-polymerase chain reaction assay for Newcastle disease virus and avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Ali, A; Reynolds, D L

    2000-01-01

    Newcastle disease virus (NDV) and avian pneumovirus (APV) cause Newcastle disease and rhinotracheitis respectively, in turkeys. Both of these viruses infect the respiratory system. A one-tube, multiplex, reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of both NDV and Colorado strain of APV (APV-Col) was developed and evaluated. The primers, specific for each virus, were designed from the matrix protein gene of APV-Col and the fusion protein gene of NDV to amplify products of 631 and 309 nucleotides, respectively. The multiplex RT-PCR assay, for detecting both viruses simultaneously, was compared with the single-virus RT-PCR assays for its sensitivity and specificity. The specific primers amplified products of predicted size from each virus in the multiplex as well as the single-virus RT-PCR assays. The multiplex RT-PCR assay was determined to be equivalent to the single-virus RT-PCR assays for detecting both NDV and APV-Col. This multiplex RT-PCR assay proved to be a sensitive method for the simultaneous and rapid detection of NDV and APV-Col. This assay has the potential for clinical diagnostic applications.

  5. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    Science.gov (United States)

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  6. Development of a Polymerase Chain Reaction Assay for Detection of Burkholderia mallei, a Potent Biological Warfare Agent

    Directory of Open Access Journals (Sweden)

    Vijai Pal

    2016-09-01

    Full Text Available Burkholderia mallei is the etiological agent of glanders, primarily a disease of equines. B. mallei is closely related to B. pseudomallei, the causative agent of melioidosis. Therefore, detection of B. mallei and its differentiation from B. pseudomallei, has always been troublesome. In present investigation, a B. mallei specific DNA sequence was identified by performing BLASTn search using ~3000 ORFs of B. mallei NCTC 10229. A polymerase chain reaction (PCR assay with internal amplification control (IAC was developed for detection of B. mallei and its differentiation from B. pseudomallei. The PCR assay could amplify a specific 224-bp fragment from all the six B. mallei strains used in the study, whereas other closely related organisms were tested negative. The detection limit of the assay was found to be 10 pg of purified DNA of B. mallei. Incorporation of IAC in the assay makes the results reliable as false negative results which may arise due to presence of PCR inhibitors, can be avoided. For validation, the assay was tested on tap water, Bengal gram and grass artificially spiked with B. mallei. The developed assay can be used as a simple and rapid tool for detection of B. mallei.

  7. Rapid detection of avian influenza virus in chicken fecal samples by immunomagnetic capture reverse transcriptase–polymerase chain reaction assay

    DEFF Research Database (Denmark)

    Dhumpa, Raghuram; Handberg, Kurt; Jørgensen, Poul Henrik;

    2011-01-01

    chain reaction (RT-PCR) without RNA extraction because of effective removal of RT-PCR inhibitors. The developed bead-based assay showed a similar detection limit comparable to the RNA extraction and the classic virus isolation method. Using ready-to-use antibody-conjugated bead, the method requires less....... In this study, magnetic beads were applied for immunoseparation and purification of AIV from spiked chicken fecal sample. The beads were conjugated with monoclonal antibodies against the AIV nucleoprotein, which is conserved in all the AIV. The bead-captured virus was detected by reverse transcriptase–polymerase...

  8. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    Science.gov (United States)

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  9. A clinical comparative study of polymerase chain reaction assay for diagnosis of pneumocystis pneumonia in non-AIDS patients

    Institute of Scientific and Technical Information of China (English)

    MU Xiang-dong; WANG Guang-fa; SU Li

    2011-01-01

    Background Pneurnocystis jirovecii pneumonia (PCP) is one of the most common and fatal infections in non-AIDS immunocompromised patients,which is difficult to diagnose by traditional morphologic methods.This study evaluated polymerase chain reaction (PCR) assays of Pneumocystis jirovecii mitochondrial large subunits ribosomal RNA in sputum and bronchioalveolar lavage fluid (BALF) for diagnosing PCP.Methods Sputum and BALF specimens from two groups were collected:one group (PCP group) included 20 patients definitely diagnosed of PCP by Gomori methenamine silver (GMS) stains of BALF;the other group (non-PCP group) included 40 patients.Each specimen was examined by GMS stains and PCR assays.Results GMS stains of BALF in PCP group were 100% positive (20/20),GMS stains of sputum in PCP group were 35% positive (7/20);GMS stains of BALF in non-PCP group were 100% negative (40/40),GMS stains of sputum in non-PCP group were 100% negative (40/40).PCR assays of BALF in PCP group were 100% positive (20/20),PCR assays of sputum in PCP group were 100% positive (20/20);PCR assays of BALF in non-PCP group were 100% negative (40/40),PCR assays of sputum in non-PCP group were 100% negative (40/40).Sensitivity and specificity of PCR assays of sputum and BALF were both 100%;positive and negative predictive values were also both 100%.Conclusion The diagnostic value of PCR assays of Pneumocystisjirovecii mitochondrial large subunits ribosomal RNA on sputum and BALF for pneumocystis pneumonia are both high and equivalent.

  10. Evaluation of a commercial real-time polymerase chain reaction assay for detection of environmental contamination with Clostridium difficile.

    Science.gov (United States)

    Deshpande, A; Kundrapu, S; Sunkesula, V C K; Cadnum, J L; Fertelli, D; Donskey, C J

    2013-09-01

    Contaminated environmental surfaces are an important source for transmission of Clostridium difficile. However, there are no efficient and easy methods to assess contamination. The performance of a commercial real-time polymerase chain reaction (PCR) assay was evaluated for detection of environmental toxigenic C. difficile in comparison with anaerobic culture followed by toxin testing of isolates. For 66 sites sampled, PCR had a sensitivity of 17.39%, specificity 100%, positive predictive value 100% and negative predictive value 69.35%. Increasing the PCR cycle threshold (CT) value to 45 increased sensitivity to 52% without decreasing specificity. The commercial PCR assay is not sufficiently sensitive for environmental monitoring, but improved sensitivity might be possible through CT value modification.

  11. Development and use of a real-time polymerase chain reaction assay for the detection of Ophidiomyces ophiodiicola in snakes.

    Science.gov (United States)

    Allender, Matthew C; Bunick, David; Dzhaman, Elena; Burrus, Lucienne; Maddox, Carol

    2015-03-01

    Fungal pathogens threatening the conservation of wildlife are becoming increasingly common. Since 2008, free-ranging snakes across North America have been experiencing a marked increase in the prevalence of snake fungal disease associated with Ophidiomyces ophiodiicola. Diagnosis has historically relied on histology, microbiology, and conventional polymerase chain reaction (PCR). More sensitive methods are needed to adequately characterize the epidemiology. The current study describes the development of a real-time PCR (qPCR) assay for detecting a segment of the internal transcribed spacer 1 region between the 18S and 5.8S ribosomal RNA gene. The assay was able to detect as few as 1.05 × 10(1) gene copies per reaction. An additional 4 positive cases were detected when comparing a conventional PCR (n = 3) and the qPCR (n = 7) when used on swab samples from 47 eastern massasauga rattlesnakes. The newly developed assay is a sensitive and specific tool for surveillance and monitoring in the conservation of free-ranging snakes.

  12. Sensitive electrochemical determination of miRNAs based on a sandwich assay onto magnetic microcarriers and hybridization chain reaction amplification.

    Science.gov (United States)

    Torrente-Rodríguez, R M; Campuzano, S; Montiel, V Ruiz-Valdepeñas; Montoya, J J; Pingarrón, J M

    2016-12-15

    A novel electrochemical approach for determination of miRNAs involving a sandwich hybridization assay onto streptavidin-magnetic beads (Strep-MBs), hybridization chain reaction (HCR) amplification and amperometric detection at disposable screen-printed carbon electrodes is reported. Using miRNA-21 as the target analyte, a dynamic linear range from 0.2 to 5.0nM with a 60pM (1.5fmol in 25μL) detection limit was obtained. The achieved sensitivity is 24-fold higher than a non-HCR amplification approach involving conventional sandwich type assay onto MBs. Moreover, the whole assay time lasted 1h 45min which is remarkably shorter than other reported methodologies. The methodology exhibited full selectivity against other non-complementary miRNAs as well as an acceptable discrimination between homologous miRNA family members. The applicability of this novel approach was demonstrated by determining mature miRNA-21 in total RNA (RNAt) extracted from tumor cells and human tissues.

  13. Avian haemosporidian parasites (Haemosporida): A comparative analysis of different polymerase chain reaction assays in detection of mixed infections.

    Science.gov (United States)

    Bernotienė, Rasa; Palinauskas, Vaidas; Iezhova, Tatjana; Murauskaitė, Dovilė; Valkiūnas, Gediminas

    2016-04-01

    Mixed infections of different species and genetic lineages of haemosporidian parasites (Haemosporida) predominate in wildlife, and such infections are particularly virulent. However, currently used polymerase chain reaction (PCR)-based detection methods often do not read mixed infections. Sensitivity of different PCR assays in detection of mixed infections has been insufficiently tested, but this knowledge is essential in studies addressing parasite diversity in wildlife. Here, we applied five different PCR assays, which are broadly used in wildlife avian haemosporidian research, and compared their sensitivity in detection of experimentally designed mixed infections of Haemoproteus and Plasmodium parasites. Three of these PCR assays use primer sets that amplify fragments of cytochrome b gene (cyt b), one of cytochrome oxidase subunit I (COI) gene, and one target apicoplast genome. We collected blood from wild-caught birds and, using microscopic and PCR-based methods applied in parallel, identified single infections of ten haemosporidian species with similar parasitemia. Then, we prepared 15 experimental mixes of different haemosporidian parasites, which often are present simultaneously in wild birds. Similar concentration of total DNA was used in each parasite lineage during preparation of mixes. Positive amplifications were sequenced, and the presence of mixed infections was reported by visualising double-base calling in sequence electropherograms. This study shows that the use of each single PCR assay markedly underestimates biodiversity of haemosporidian parasites. The application of at least 3 PCR assays in parallel detected the majority, but still not all lineages present in mixed infections. We determined preferences of different primers in detection of parasites belonging to different genera of haemosporidians during mixed infections.

  14. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    Science.gov (United States)

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  15. Rapid Detection of Filoviruses by Real-time TaqMan Polymerase Chain Reaction Assays

    Institute of Scientific and Technical Information of China (English)

    Yi Huang; Hongping Wei; Yunpeng Wang; Zhengli Shi; Herve Raoul; Zhiming Yuan

    2012-01-01

    Ebola virus (EBOV) and Marburg virus (MARV) are causative agents of severe hemorrhagic fever with high mortality rates in humans and non-human primates and there is currently no licensed vaccine or therapeutics.To date,there is no specific laboratory diagnostic test in China,while there is a national need to provide differential diagnosis during outbreaks and for instituting acceptable quarantine procedures.In this study,the TaqMan RT-PCR assays targeting the nucleoprotein genes of the Zaire Ebolavirus (ZEBOV) and MARV were developed and their sensitivities and specificities were investigated.Our results indicated that the assays were able to make reliable diagnosis over a wide range of virus copies from 103 to 109,corresponding to the threshold of a standard RNA transcript.The results showed that there were about 1010 RNA copies per milliliter of virus culture supernatant,equivalent to 10,000 RNA molecules per infectious virion,suggesting the presence of many non-infectious particles.These data indicated that the TaqMan RT-PCR assays developed in this study will be suitable for future surveillance and specific diagnosis of ZEBOV and MARV in China.

  16. Multiplex time-reducing quantitative polymerase chain reaction assay for determination of telomere length in blood and tissue DNA.

    Science.gov (United States)

    Jiao, Jingjing; Kang, Jing X; Tan, Rui; Wang, Jingdong; Zhang, Yu

    2012-04-01

    In this paper we describe a multiplex time-reducing quantitative polymerase chain reaction (qPCR) method for determination of telomere length. This multiplex qPCR assay enables two pairs of primers to simultaneously amplify telomere and single copy gene (albumin) templates, thus reducing analysis time and labor compared with the previously established singleplex assay. The chemical composition of the master mix and primers for the telomere and albumin were systematically optimized. The thermal cycling program was designed to ensure complete separation of the melting processes of the telomere and albumin. Semi-log standard curves of DNA concentration versus cycle threshold (C (t)) were established, with a linear relationship over an 81-fold DNA concentration range. The well-performed intra-assay (RSD range 2.4-4.7%) and inter-assay (RSD range: 3.1-5.0%) reproducibility were demonstrated to ensure measurement stability. Using wild-type, Lewis lung carcinoma and H22 liver carcinoma C57BL/6 mouse models, significantly different telomere lengths among different DNA samples were not observed in wild-type mice. However, the relative telomere lengths of the tumor DNA in the two strains of tumor-bearing mice were significantly shorter than the lengths in the surrounding non-tumor DNA of tumor-bearing mice and the tissue DNA of wild-type mice. These results suggest that the shortening of telomere lengths may be regarded as an important indicator for cancer control and prevention. Quantification of telomere lengths was further confirmed by the traditional Southern blotting method. This method could be successfully used to reduce the time needed for rapid, precise measurement of telomere lengths in biological samples.

  17. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    Science.gov (United States)

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  18. Identification of Cystic Fibrosis Variants by Polymerase Chain Reaction/Oligonucleotide Ligation Assay

    OpenAIRE

    Schwartz, Karen M.; Pike-Buchanan, Lisa L.; Muralidharan, Kasinathan; Redman, Joy B.; Wilson, Jean Amos; Jarvis, Michael; Cura, M. Grace; Pratt, Victoria M.

    2009-01-01

    The purpose of this work is to define rare variants of cystic fibrosis (CF) that are potential sources of error and can confound molecular genetic testing methods. We performed routine, clinical CF mutation screening using a laboratory-developed test and the oligonucleotide ligation assay reagents from Abbott/Celera. In this report, we describe 11 unique allele drop outs [3849 + 10kb C>T (NM_000492.2:c.3718-2477C>T), V520F (c.1558G>T), 1078delT (c.948delT), A455E (c.1364C>A), R347P (c.1040G>C...

  19. Development of a new duplex real-time polymerase chain reaction assay for detection of dicer in G. gallus.

    Science.gov (United States)

    Ji, Xiaolin; Wang, Qi; Gao, Yulong; Wang, Yongqiang; Qin, Liting; Qi, Xiaole; Gao, Honglei; Wang, Xiaomei

    2013-05-01

    Recently, there has been a growing body of evidence showing that cellular microRNAs (miRNAs) are involved in virus-host interactions. Numerous studies have focused on analyses of the expression profiles of cellular miRNAs, but the expression patterns of Dicer, which is responsible for the generation of miRNAs, have only rarely been explored in Gallus gallus. We developed a duplex realtime reverse transcriptase polymerase chain reaction (RTPCR) assay for the relative quantification of the mRNAs of Dicer and beta-actin in G. gallus. To apply this method, the expression of Dicer in avian cells after infection with avian leukosis virus subgroup J (ALV-J) was detected using our established duplex real-time RT-PCR. The duplex realtime RT-PCR assay is sufficiently sensitive, specific, accurate, reproducible, and cost-effective for the detection of Dicer in G. gallus. Furthermore, this study, for the first time, demonstrated that ALV-J can induce differential expression of Dicer mRNA in the ALV-J-infected cells.

  20. Development of real-time quantitative polymerase chain reaction assays to track treatment response in retinoid resistant acute promyelocytic leukemia

    Directory of Open Access Journals (Sweden)

    Jelena V Jovanovic

    2011-10-01

    Full Text Available Molecular detection of minimal residual disease (MRD has become established to assess remission status and guide therapy in patients with PML-RARA+ acute promyelocytic leukemia (APL. However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF-RARA and STAT5b-RARA. Despite their relative rarity (<1% of APL we identified 6 cases (PLZF-RARA, n=5; STAT5b-RARA, n=1, established the respective breakpoint junction regions and designed real-time quantitative polymerase chain reaction (RQ-PCR assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17-associated APL, affording assay sensitivities of ~1 in 104-105. Serial samples were available from 2 PLZF-RARA APL patients. One showed persistent PCR positivity, predicting subsequent relapse, and remains in CR2, ~11 years post-autograft. The other, achieved molecular remission (CRm with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b-RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RQ-PCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly-defined subsets of acute leukemia.

  1. Quantitative polymerase chain reaction (PCR) assays for a bacterial thiaminase I gene and the thiaminase-producing bacterium Paenibacillus thiaminolyticus.

    Science.gov (United States)

    Richter, C.A.; Wright-Osment, Maureen K.; Zajicek, J.L.; Honeyfield, D.C.; Tillitt, D.E.

    2009-01-01

    The thiaminase I enzyme produced by the gram-positive bacterium Paenibacillus thiaminolyticus isolated from the viscera of Lake Michigan alewives Alosa pseudoharengus is currently the only defined source of the thiaminase activity linked to thiamine (vitamin B1) deficiency in early mortality syndrome (EMS) in the larvae of Great Lakes salmonines. Diets of alewife or isolated strains of P. thiaminolyticus mixed in a semipurified diet and fed to lake trout Salvelinus namaycush have been shown to produce EMS in fry. We utilized quantitative polymerase chain reaction (Q-PCR) to aid in studies of the sources of P. thiaminolyticus and thiaminase I. Quantitative PCR assays were established to detect the thiaminase I gene of P. thiaminolyticus, the 16S rRNA gene from most species of bacteria, and the 16S rRNA gene specifically from P. thiaminolyticus and a few closely related taxa. The Q-PCR assays are linear over at least six orders of magnitude and can detect the thiaminase I gene of P. thiaminolyticus from as few as 1,000 P. thiaminolyticus cells/g of sample or the Paenibacillus 16S rRNA gene from as few as 100 P. thiaminolyticus cells/g of sample. The initial results from alewife viscera samples with high thiaminase activity yielded unexpectedly low densities of P. thiaminolyticus cells; Paenibacillus thiaminolyticus was detectable in 2 of 6 alewife viscera tested at densities on the order of 100 cells/g out of 100,000,000 total bacterial cells/g. The low numbers of P. thiaminolyticus detected suggest that alewives contain additional non-P. thiaminolyticus sources of thiaminase activity.

  2. Utility of a single nasal polymerase chain reaction assay in predicting absence of skin and environmental contamination in hospitalized patients with past methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Guerrero, Dubert M; Wagner, Matthew; Carson, Grace; Hanish, Christine; Thompson, Jody; Orr, Megan; Roth, Felix; Carson, Paul J

    2016-06-01

    We evaluated hospitalized patients with a history of methicillin-resistant Staphylococcus aureus (MRSA) for persistent colonization and need for contact precautions. Up to 3 daily cultures of nares, skin, and any present wounds were compared with a single nasal polymerase chain reaction (PCR) assay. Most patients (76.2%) were no longer colonized with MRSA. A single PCR assay was sufficient to exclude persistent colonization and environmental contamination and remove the contact precautions.

  3. Diagnosis of enzootic pneumonia in Danish cattle: reverse transcription-polymerase chain reaction assay for detection of bovine respiratory syncytial virus in naturally and experimentally infected cattle

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.;

    1999-01-01

    A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved...... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal....... (7%), and Pasteurella haemolytica (7%) were the most common bacterial agents found in the lungs. BRSV was identified using a conventional antigen enzyme-linked immunosorbent assay (ELISA) in 23 (17%) animals. The established BRSV-specific RT-PCR assay yielded positive results for the same 23 animals...

  4. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    Science.gov (United States)

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  5. Typing of Plasmodium falciparum DNA from 2 years old Giemsa-stained dried blood spots using nested polymerase chain reaction assay.

    Science.gov (United States)

    Kumar, D; Dhiman, S; Rabha, B; Goswami, D; Yadav, K; Deka, M; Veer, V; Baruah, I

    2016-01-01

    A panel of 129 Giemsa-stained thick blood spots (TBS) confirmed for Plasmodium falciparum infection having different levels of parasite density were collected from a malaria endemic area. DNA was extracted and nested polymerase chain reaction (PCR) assay was performed to amplify P. falciparum DNA. Nested PCR assay successfully amplified P. falciparum DNA at a very low parasitaemia of ~10 parasites/μl of blood. Current PCR assay is very simple and can be used retrospectively to monitor the invasion and prevalence of different Plasmodium species in endemic areas. PMID:27080775

  6. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  7. Droplet digital polymerase chain reaction assay for screening of ESR1 mutations in 325 breast cancer specimens.

    Science.gov (United States)

    Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Inao, Toko; Sueta, Aiko; Fujiwara, Saori; Omoto, Yoko; Iwase, Hirotaka

    2015-12-01

    Droplet digital polymerase chain reaction (ddPCR), which could perform thousands of PCRs on a nanoliter scale simultaneously, would be an attractive method to massive parallel sequencing for identifying and studying the significance of low-frequency rare mutations. Recent evidence has shown that the key potential mechanisms of the failure of aromatase inhibitors-based therapy involve identifying activating mutations affecting the ligand-binding domain of the ESR1 gene. Therefore, the detection of ESR1 mutations may be useful as a biomarker predicting an effect of the treatment. We aimed to develop a ddPCR-based method for the sensitive detection of ESR1 mutations in 325 breast cancer specimens, in which 270 primary and 55 estrogen receptor-positive (ER+) metastatic breast cancer (MBC) specimens. Our ddPCR assay could detect the ESR1 mutant molecules with low concentration of 0.25 copies/μL. According to the selected cutoff, ESR1 mutations occurred in 7 (2.5%) of 270 primary breast cancer specimens and in 11 (20%) of 55 ER+ MBC specimens. Among the 11 MBC specimens, 5 specimens (45.5%) had the most common ESR1 mutation, Y537S, 4 specimens (36.3%) each had D538G, Y537N, and Y537C. Interestingly, 2 patients had 2 ESR1 mutations, Y537N/D538G and Y537S/Y537C, and 2 patients had 3 ESR1 mutations, Y537S/Y537N/D538G. Biopsy was performed in heterochrony in 8 women twice. In 8 women, 4 women had primary breast cancer and MBC specimens and 4 women had 2 specimens when treatment was failure. Four of these 8 women acquired ESR1 mutation, whereas no ESR1 mutation could be identified at first biopsy. ddPCR technique could be a promising tool for the next-generation sequencing-free precise detection of ESR1 mutations in endocrine therapy resistant cases and may assist in determining the treatment strategy.

  8. Access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: a randomised, controlled trial

    Directory of Open Access Journals (Sweden)

    Lindh Magnus

    2011-04-01

    Full Text Available Abstract Background Viral respiratory infections are common worldwide and range from completely benign disease to life-threatening illness. Symptoms can be unspecific, and an etiologic diagnosis is rarely established because of a lack of suitable diagnostic tools. Improper use of antibiotics is common in this setting, which is detrimental in light of the development of bacterial resistance. It has been suggested that the use of diagnostic tests could reduce antibiotic prescription rates. The objective of this study was to evaluate whether access to a multiplex polymerase chain reaction (PCR assay panel for etiologic diagnosis of acute respiratory tract infections (ARTIs would have an impact on antibiotic prescription rate in primary care clinical settings. Methods Adult patients with symptoms of ARTI were prospectively included. Nasopharyngeal and throat swabs were analysed by using a multiplex real-time PCR method targeting thirteen viruses and two bacteria. Patients were recruited at 12 outpatient units from October 2006 through April 2009, and samples were collected on the day of inclusion (initial visit and after 10 days (follow-up visit. Patients were randomised in an open-label treatment protocol to receive a rapid or delayed result (on the following day or after eight to twelve days. The primary outcome measure was the antibiotic prescription rate at the initial visit, and the secondary outcome was the total antibiotic prescription rate during the study period. Results A total sample of 447 patients was randomised. Forty-one were excluded, leaving 406 patients for analysis. In the group of patients randomised for a rapid result, 4.5% (9 of 202 of patients received antibiotics at the initial visit, compared to 12.3% (25 of 204 (P = 0.005 of patients in the delayed result group. At follow-up, there was no significant difference between the groups: 13.9% (28 of 202 in the rapid result group and 17.2% (35 of 204 in the delayed result group (P

  9. Establishment and Application of a TaqMan Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Rubella Virus RNA

    Institute of Scientific and Technical Information of China (English)

    Li-Hong ZHAO; Yu-Yan MA; Hong WANG; Shu-Ping ZHAO; Wei-Ming ZHAO; Hua LI; Lei-Yi WANG

    2006-01-01

    The aim of this study was to establish and apply a real-time quantitative reverse transcription polymerase chain reaction (RT-PCR) for rubella virus (RV) RNA. First, the primer and TaqMan probe concentrations, as well as reaction temperatures were optimized to establish an efficient real-time quantitative RT-PCR assay for RV RNA. Next, an RV-specific PCR amplicon was made as an external standard to estimate the linearity, amplification efficiency, analytical sensitivity and reproducibility of the real time quantitative assay. Finally, the assay was applied to quantify RVRNA in clinical samples for rubella diagnosis.The RV-specific PCR amplicon was prepared for evaluation of the assay at 503 bp, and its original concentration was 2.75×109 copies/μl. The real time quantitative assay was shown to have good linearity (R2=0.9920), high amplification efficiency (E=1.91), high sensitivity (275 copies/ml), and high reproducibility (variation coefficient range, from 1.25% to 3.58%). Compared with the gold standard, the specificity and sensitivity of the assay in clinical samples was 96.4% and 86.4%, respectively. Therefore, the established quantitative RT-PCR method is a simple, rapid, less-labored, quantitative, highly specific and sensitive assay for RV RNA.

  10. Evaluation of two real-time polymerase chain reaction assays for Porcine epidemic diarrhea virus (PEDV) to assess PEDV transmission in growing pigs.

    Science.gov (United States)

    Miller, Laura C; Crawford, Kimberly K; Lager, Kelly M; Kellner, Steven G; Brockmeier, Susan L

    2016-01-01

    In April 2013, a Porcine epidemic diarrhea virus (PEDV) epidemic began in the United States. As part of the response, real-time reverse transcription polymerase chain reaction (RT-PCR) assays to detect PEDV were developed by several veterinary diagnostic laboratories. Our study evaluated RT-PCR PEDV assays that detect the N gene (gN) and S gene (gS) for their ability to detect PEDV infection and the transmission potential of pigs experimentally exposed to PEDV. Detection limits and quantification cycle (Cq) values of real-time RT-PCR were assayed for PEDV samples and positive controls for both gN and gS. The limit of detection for the gN assay was 10(-6) (mean Cq: 39.82 ± 0.30) and 10(-5) (mean Cq: 39.39 ± 0.72) for the gS assay with PEDV strain USA/Colorado/2013. Following recommended guidelines, rectal swabs (n = 1,064) were tested; 354 samples were positive by gN assay and 349 samples were positive by gS assay (Cq ≤ 34.99), 710 samples were negative by gN assay and 715 were negative by gS assay (Cq > 34.99) of which 355 and 344 were "undetermined" (i.e., undetected within a threshold of 40 RT-PCR cycles, by gN and gS assays, respectively). The coefficient of variation (intra-assay variation) ranged from 0.00% to 2.65% and interassay variation had an average of 2.75%. PEDV could be detected in rectal swabs from all pigs for ~2 weeks postinfection at which time the prevalence began to decrease until all pigs were RT-PCR negative by 5 weeks postinfection. Our study demonstrated that RT-PCR assays functioned well to detect PEDV and that the gN assay was slightly better.

  11. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products.

    Science.gov (United States)

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M

    2016-08-17

    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials. PMID:27501408

  12. Comparison of the direct fluorescence assay and real-time polymerase chain reaction for the detection of influenza virus A and B in immunocompromised patients

    Directory of Open Access Journals (Sweden)

    Ana Helena Perosa

    2013-09-01

    Full Text Available OBJECTIVE: This study evaluated the diagnostic performance of two methods for the detection of influenza virus in immunocompromised transplant patients. METHODS: A total of 475 respiratory samples, 236 from patients in a hematopoietic stem cell transplantation program and 239 from kidney transplant patients, were analyzed by a direct fluorescence assay and the Centers for Disease Control real-time polymerase chain reaction protocol for influenza A and B detection. RESULTS: Influenza detection using either method was 7.6% in the hematopoietic stem cell transplant group and 30.5% in the kidney transplant patient group. Influenza detection by real-time polymerase chain reaction yielded a higher positive rate compared with fluorescence than that reported by other studies, and this difference was more pronounced for influenza A. The fluorescence assay sensitivity, specificity, positive and negative predictive values, and kappa coefficient were 17.6%, 100%, 1, 0.83, and 0.256, respectively, and lower detection rates occurred in the kidney transplant patients. CONCLUSIONS: The real-time polymerase chain reaction performance and the associated turnaround time for a large number of samples support the choice of this method for use in different routine diagnostic settings and influenza surveillance in high-risk patients.

  13. TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

    Science.gov (United States)

    Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

    2016-01-01

    This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated. PMID:26458055

  14. Loop mediated isothermal amplification assay using hydroxy naphthol blue, conventional polymerase chain reaction and real-time PCR in the diagnosis of intraocular tuberculosis

    Directory of Open Access Journals (Sweden)

    P K Balne

    2015-01-01

    Full Text Available This study is a comparative evaluation (Chi-square test of a closed tube loop mediated isothermal amplification assay using hydroxy naphthol blue dye (HNB-LAMP, real-time polymerase chain reaction (PCR and conventional PCR in the diagnosis of intraocular tuberculosis. Considering clinical presentation as the gold standard in 33 patients, the sensitivity of HNB-LAMP assay (75.8% was higher (not significant, P value 0.2 than conventional PCR (57.6% and lower than real-time PCR (90.9%. Specificity was 100% by all three methods. No amplification was observed in negative controls (n = 20 by all three methods. The cost of the HNB-LAMP assay was Rs. 500.00 and it does not require thermocycler, therefore, it can be used as an alternative to conventional PCR in resource-poor settings.

  15. A novel polymerase chain reaction (PCR based assay for authentication of cell lines or tissues from human, pig and chicken origin

    Directory of Open Access Journals (Sweden)

    MARIO GORENJAK

    2012-01-01

    Full Text Available A polymerase chain reaction based assay was developed for authentication of cell lines or tissues from human, pig and chicken origin. Specificity was achieved by species specific primer design targeting the mitochondrial D-loop sequence. Amplicon sizes were 114 bp, 169 bp and 645-648 bp for chicken, human and pig derived cell lines, respectively. Primers were tested for species specificity and non-specificity between haplogroups of the same organisms using BLAST tool and subsequently for cross amplification DNA extracted from human, chicken and pig venous blood as a positive control. Primers were also amplifying specific products in DNA extracted from individual cell line in both functional cell models and intentionally mixed cell lines consisting functional cell models. The PCR assay developed in this study represents a low-cost species specific end-point PCR based assay of the mitochondrial D-loop for the authentication of the cell line origin.

  16. Loop mediated isothermal amplification assay using hydroxy naphthol blue, conventional polymerase chain reaction and real-time PCR in the diagnosis of intraocular tuberculosis.

    Science.gov (United States)

    Balne, P K; Basu, S; Rath, S; Barik, M R; Sharma, S

    2015-01-01

    This study is a comparative evaluation (Chi-square test) of a closed tube loop mediated isothermal amplification assay using hydroxy naphthol blue dye (HNB-LAMP), real-time polymerase chain reaction (PCR) and conventional PCR in the diagnosis of intraocular tuberculosis. Considering clinical presentation as the gold standard in 33 patients, the sensitivity of HNB-LAMP assay (75.8%) was higher (not significant, P value 0.2) than conventional PCR (57.6%) and lower than real-time PCR (90.9%). Specificity was 100% by all three methods. No amplification was observed in negative controls (n = 20) by all three methods. The cost of the HNB-LAMP assay was Rs. 500.00 and it does not require thermocycler, therefore, it can be used as an alternative to conventional PCR in resource-poor settings.

  17. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    Science.gov (United States)

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

  18. Detection of the Pandemic H1N1/2009 Influenza A Virus by a Highly Sensitive Quantitative Real-time Reverse-transcription Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    Zhu Yang; Guoliang Mao; Yujun Liu; Yuan-Chuan Chen; Chengjing Liu; Jun Luo; Xihan Li

    2013-01-01

    A quantitative real time reverse-transcription polymerase chain reaction (qRT-PCR) assay with specific primers recommended by the World Health Organization (WHO) has been widely used successfully for detection and monitoring of the pandemic H1N 1/2009 influenza A virus.In this study,we report the design and characterization of a novel set of primers to be used in a qRT-PCR assay for detecting the pandemic H1N1/2009 virus.The newly designed primers target three regions that are highly conserved among the hemagglutinin (HA) genes of the pandemic H1N1/2009 viruses and are different from those targeted by the WHO-recommended primers.The qRT-PCR assays with the newly designed primers are highly specific,and as specific as the WHO-recommended primers for detecting pandemic H1N1/2009 viruses and other influenza viruses including influenza B viruses and influenza A viruses of human,swine,and raccoon dog origin.Furthermore,the qRT-PCR assays with the newly designed primers appeared to be at least 10-fold more sensitive than those with the WHO-recommended primers as the detection limits of the assays with our primers and the WHO-recommended primers were 2.5 and 25 copies of target RNA per reaction,respectively.When tested with 83 clinical samples,32 were detected to be positive using the qRT-PCR assays with our designed primers,while only 25 were positive by the assays with the WHO-recommended primers.These results suggest that the qRT-PCR system with the newly designed primers represent a highly sensitive assay for diagnosis of the pandemic H1N1/2009 virus infection.

  19. Development of a polymerase chain reaction assay for species identification of goose and mule duck in foie gras products.

    Science.gov (United States)

    Rodrı X0301 Guez, Miguel A; Garcı X0301 A, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martı X0301 N, Rosario

    2003-12-01

    Polymerase chain reaction amplification of a conserved region of the α-actin gene has been used for the specific identification of goose (Anser anser) and mule duck (Anas platyrhynchos×Cairina moschata) foie gras. Universal primers were used for the amplification of a DNA fragment containing three introns and four exons of the α-actin gene in goose and mule duck. Sequence analysis of the amplified fragments was necessary for the design of forward species-specific primers in the goose and mule duck α-actin genes. The use of species-specific forward primers, together with a reverse universal primer, produced amplicons of different length, allowing clear identification of goose and mule duck foie gras samples. Analysis of experimental mixtures demonstrated that 1% of duck can be easily detected in goose foie gras using the PCR method developed here. This genetic marker can be very useful for the accurate identification of these two species in foie gras products.

  20. Screening of Riboflavin-Producing Lactobacilli by a Polymerase-Chain-Reaction-Based Approach and Microbiological Assay.

    Science.gov (United States)

    Thakur, Kiran; Tomar, Sudhir Kumar; Brahma, Biswajit; De, Sachinandan

    2016-03-01

    Riboflavin has an important role in various cellular metabolic activities through its participation in oxidation-reduction reactions. In this study, as many as 60 lactobacilli were screened for the presence or absence of riboflavin biosynthesis genes and riboflavin production. Of these, only 14 strains were able to grow in a commercial riboflavin-free medium. We observed that the presence of riboflavin biosynthesis genes is strain-specific across different species of lactobacilli. The microbiological assay was found to be appreciably reproducible, sensitive, rapid, and inexpensive and, hence, can be employed for screening the riboflavin-producing strains. The study thus represents a convenient and efficient method for selection of novel riboflavin producers. These riboflavin(+) strains thus identified and characterized could be explored as potent candidates for the development of a wide range of dairy- and cereal-based foods for the delivery of in situ riboflavin to consumers.

  1. An investigation of genital ulcers in Jackson, Mississippi, with use of a multiplex polymerase chain reaction assay: high prevalence of chancroid and human immunodeficiency virus infection.

    Science.gov (United States)

    Mertz, K J; Weiss, J B; Webb, R M; Levine, W C; Lewis, J S; Orle, K A; Totten, P A; Overbaugh, J; Morse, S A; Currier, M M; Fishbein, M; St Louis, M E

    1998-10-01

    In 1994, an apparent outbreak of atypical genital ulcers was noted by clinicians at the sexually transmitted disease clinic in Jackson, Mississippi. Of 143 patients with ulcers tested with a multiplex polymerase chain reaction (PCR) assay, 56 (39%) were positive for Haemophilus ducreyi, 44 (31%) for herpes simplex virus, and 27 (19%) for Treponema pallidum; 12 (8%) were positive for > 1 organism. Of 136 patients tested for human immunodeficiency virus (HIV) by serology, 14 (10%) were HIV-seropositive, compared with none of 200 patients without ulcers (P genital ulcers and HIV infection in this population highlights the urgency of preventing genital ulcers in the southern United States.

  2. Detection of Morganella morganii, a prolific histamine former, by the polymerase chain reaction assay with 16S rDNA-targeted primers.

    Science.gov (United States)

    Kim, Shin-Hee; An, Haejung; Field, Katharine G; Wei, Cheng-I; Velazquez, Jorge Barros; Ben-Gigirey, Begoña; Morrissey, Michael T; Price, Robert J; Pitta, Thomas P

    2003-08-01

    A polymerase chain reaction (PCR) assay for the rapid and sensitive detection of the most prolific histamine former, Morganella morganii, was developed. 16S rDNA targeted PCR primers were designed, and the primer specificity and sensitivity of the PCR assay were evaluated. The 16S rDNA sequence (1,503 bp) for M. morganii showed 95% identity to those for enteric bacteria, i.e., Enterobacter spp., Klebsiella spp., Citrobacter spp., Hafnia alvei, Proteus spp., and Providencia spp. The unique primers for M. morganii were designed on the basis of the variable regions in the 16S rDNA sequence. The primers showed positive reactions with all M. morganii strains tested. However, PCR amplification was not detected when the primers were tested with other enteric or marine bacteria. When the sensitivity of the assay was evaluated, M. morganii was detected at levels ranging from 10(6) to 10(8) CFU/ml in albacore homogenate after the PCR amplification. The sensitivity of the assay was greatly improved with the enrichment of samples, and 9 CFU of M. morganii per ml of albacore homogenate was detected after 6 h of enrichment at 37 degrees C.

  3. Polymerase chain reaction

    OpenAIRE

    Gaurav Solanki

    2015-01-01

    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  4. Development of a set of multiplex standard polymerase chain reaction assays for the identification of infectious agents from aborted bovine clinical samples.

    Science.gov (United States)

    Tramuta, Clara; Lacerenza, Daniela; Zoppi, Simona; Goria, Mariella; Dondo, Alessandro; Ferroglio, Ezio; Nebbia, Patrizia; Rosati, Sergio

    2011-07-01

    The current study describes the development of a set of 5 multiplex polymerase chain reaction (mPCR) assays for the simultaneous detection of abortive infection agents in bovine fetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mPCR1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mPCR2); Coxiella burnetii and Chlamydophila psittaci (mPCR3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mPCR4); and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mPCR5). The protocol was tested on different tissue samples collected from 50 aborted bovine fetuses, and it showed that out of the 50 fetuses, 7 (14%, mPCR2) were PCR-positive for N. caninum, 4 (8%, mPCR5) were PCR-positive for BVDV, and 2 (4%, mPCR4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. Moreover, all multiplex PCR assays on clinical samples were compared with reference methods, obtaining a perfect accordance in all samples and confirming the validity of the set of multiplex PCR assays. The proposed set of multiplex PCR assays is, therefore, suitable for the simultaneous detection of the main infectious agents responsible for bovine abortion.

  5. Economic evaluation of 21-gene reverse transcriptase-polymerase chain reaction assay in lymph-node-negative, estrogen-receptor-positive, early-stage breast cancer in Japan.

    Science.gov (United States)

    Kondo, Masahide; Hoshi, Shu Ling; Ishiguro, Hiroshi; Yoshibayashi, Hiroshi; Toi, Masakazu

    2008-11-01

    The 21-gene reverse transcriptase-polymerase chain reaction assay with a patented algorithm is validated as a good predictor of prognosis and potential benefit from adjuvant chemotherapy for lymph-node-negative, estrogen-receptor-positive, early-stage breast cancer, while its high cost raises concern about how to finance it. Cost-effectiveness analysis comparing prevalent National Comprehensive Cancer Network (NCCN) guideline/St Gallen recommendation-guided treatment with the assay-guided treatment is carried out with budget impact estimation in the context of Japan's health care system. Incremental cost-effectiveness ratios are estimated as 2,997,495 yen/QALY (26,065 US$/QALY) in the comparison between NCCN guided-treatment vs. the assay-guided treatment, and as 1,239,055 yen/QALY (10,774 US$/QALY) in the comparison between St Gallen guided-treatment vs. the assay-guided treatment. Budget impact is estimated as yen2,638 million (US$23 million) to yen3,225 million (US$28 million) per year. The routine use of the assay is indicated as cost-effective. And the budget impact could be judged as within fundable level. PMID:18075786

  6. A rapid, 2-well, multiplex real-time polymerase chain reaction assay for the detection of SCCmec types I to V in methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Valvatne, Håvard; Rijnders, Michelle I A; Budimir, Ana; Boumans, Marie-Louise; de Neeling, Albert J; Beisser, Patrick S; Stobberingh, Ellen E; Deurenberg, Ruud H

    2009-12-01

    For us to assess the spread of methicillin-resistant Staphylococcus aureus (MRSA), typing of the staphylococcal cassette chromosome mec (SCCmec) is a valuable addition to existing typing methods, such as multilocus sequence typing (MLST). Traditional SCCmec typing assays, that is, that of Oliveira et al. and Ito et al., are polymerase chain reaction (PCR) based, requiring electrophoresis. We introduce a rapid, 2-well, multiplex real-time PCR assay that can be used directly on bacterial suspensions and is able to characterize SCCmec type I to V based on the detection of the ccr genes and the mec complex. The assay was evaluated on 212 clinical MRSA isolates from various countries, associated with MLST clonal complexes (CC) 1, 5, 8, 22, 30, and 45, as well as pig-associated CC398. When comparing the real-time PCR assay with traditional methods, the correct SCCmec element was identified in 209 (99%) of the 212 MRSA isolates. The new assay enables high-throughput analyses for SCCmec on large strain collections. PMID:19781888

  7. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    Science.gov (United States)

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters.

  8. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

    Science.gov (United States)

    Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2010-06-01

    Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

  9. Development of a locked nucleic acid real-time polymerase chain reaction assay for the detection of Pinus armandii in mixed species pine nut samples associated with dysgeusia.

    Science.gov (United States)

    Handy, Sara M; Timme, Ruth E; Jacob, Salena M; Deeds, Jonathan R

    2013-02-01

    Recent work has shown that the presence of the species Pinus armandii , even when occurring as species mixtures of pine nuts, is correlated with taste disturbance (dysgeusia), also referred to as "pine mouth". Because of this known possibility of pine nut mixtures, a need was identified for a rapid streamlined assay to detect the presence of this species in the presence of other types of pine nuts. A locked nucleic acid probe was employed in a real-time polymerase chain reaction (RT-PCR) format to detect a single nucleotide polymorphism (SNP) unique to this species. This assay was able to detect P. armandii in homogenates down to ∼1% concentration (the lowest level tested) in the presence of several commonly co-occurring and closely related species of pine and should prove to be a useful tool for the detection of this species in food products.

  10. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    International Nuclear Information System (INIS)

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  11. A quantitative polymerase chain reaction assay for the enumeration of brown tide algae Aureococcusanophagefferens in coastal waters of Qinhuangdao

    Institute of Scientific and Technical Information of China (English)

    GUO Hao; LIU Yongjian; ZHANG Qi; YUAN Xiutang; ZHANG Weiwei; ZHANG Zhifeng

    2015-01-01

    Aureococcus anophagefferens, a small pelagophyte algae, has caused brown tide blooms in coastal waters of Qinhua-ngdao in recent years, presenting significant negative impacts on the shellfish mariculture industry. Under standard light microscopy, it is visually indistinguishable from other small algae in field samples due to its extremely small size. In this study, quantitative polymerase chain reaction (qPCR) based on 18S rDNA sequences was developed and used to detect and enumerate A. anophagefferens. A linear regression (R2=0.91) was generated based on cycle thr-esholds value (Ct) versus known concentrations of A. anophagefferens. Twenty-two field samples collected in coastal waters of Qinhuangdao were subjected to DNA extraction and then analyzed using qPCR. Results showed that A. anophagefferens had a wide distribution in coastal waters along Qinhuangdao. Elevated A. anophagefferens abun-dance, category 3 brown tide blooms (>200 000 cells/mL) occurred at Dongshan Beach and Tiger-stone Beach in August in 2013. In shellfish mariculture areas along coastal waters of Qinhuangdao, 4 stations had category 3 blooms, and 6 stations had category 2 blooms (35 000–200 000 cells/mL) in August and all stations had category 1 blooms (>0 to ≤35 000 cells/mL) in October. Quantitative PCR allows for detection of A. anophagefferens cells at low levels in filed samples, which is essential to effective management and prediction of brown tide blooms.

  12. Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

    Science.gov (United States)

    Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

    2015-11-01

    Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence.

  13. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    Science.gov (United States)

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

  14. Development and inter-laboratory transfer of a decaplex polymerase chain reaction assay combined with capillary electrophoresis for the simultaneous detection of ten food allergens.

    Science.gov (United States)

    Cheng, Fang; Wu, Jiajie; Zhang, Jin; Pan, Aihu; Quan, Sheng; Zhang, Dabing; Kim, HaeYeong; Li, Xiang; Zhou, Shan; Yang, Litao

    2016-05-15

    Food allergies cause health risks to susceptible consumers and regulations on labeling of food allergen contents have been implemented in many countries and regions. To achieve timely and accurate food allergen labeling, the development of fast and effective allergen detection methods is very important. Herein, a decaplex polymerase chain reaction (PCR) assay combined with capillary electrophoresis was developed to detect simultaneously 10 common food allergens from hazelnut, pistachio, oat, sesame, peanut, cashew, barley, wheat, soybean and pecan. The absolute limit of detection (LODa) of this system is between 2 and 20 copies of haploid genome, and the relative LOD (LODr) is as low as 0.005% (w/w) in simulated food mixtures. The developed assay was subsequently applied to 20 commercial food products and verified the allergen ingredients stated on the labels. Furthermore, results using this decaplex PCR assay was successfully replicated in three other laboratories, demonstrating the repeatability and applicability of this assay in routine analysis of the 10 food allergens.

  15. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    Science.gov (United States)

    Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

    2012-12-01

    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. PMID:23017260

  16. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    LENUS (Irish Health Repository)

    Meyler, Kenneth L

    2012-12-01

    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies\\/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and\\/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF.

  17. Comparative evaluation of polymerase chain reaction assay with microscopy for detection of asymptomatic carrier state of theileriosis in a herd of crossbred cattle

    Directory of Open Access Journals (Sweden)

    Gaurav Charaya

    2016-09-01

    Full Text Available Aim: This study aims to develop and to standardize a polymerase chain reaction (PCR assay that will diagnose clinical as well as carrier state of the disease and to compare the results with conventional microscopy technique. Materials and Methods: A herd of crossbred cattle with the previous history of theileriosis in village Lahli, district Rohtak, Haryana, was selected for this study. A total of 29 blood samples were collected randomly from cows including five clinically ill cattle. Blood smears from all animals and lymph node biopsy smears from animal with swollen lymph nodes were examined microscopically after conventional Giemsa staining. Phenol chloroform isoamyl alcohol method was used for extracting DNA from blood. Previously published primers targeting cytochrome b gene sequence of Theileria annulata were used in the PCR assay that was standardized to use in the laboratory. Results: Out of 29 samples tested,18 (62.06% were found positive for theileriosis by PCR assay, whereas only 10 (34.48% samples were detected positive by conventional microscopic technique using Giemsa staining method. Conclusions: On the basis results of comparative studies, it can be concluded that PCR assay is a more sensitive than microscopic examination for detection of theileriosis. This can be attributed to the ability of PCR assay to detect small amounts of genomic DNA of T. annulata or low parasitemia in cows. Therefore, PCR assay can serve as a more sensitive tool to detect Theileria for detection of theileriosis even in asymptomatic carrier cattle which is important for the implementation of successful control programs.

  18. Comparative evaluation of polymerase chain reaction assay with microscopy for detection of asymptomatic carrier state of theileriosis in a herd of crossbred cattle

    Science.gov (United States)

    Charaya, Gaurav; Rakha, N. K.; Maan, Sushila; Kumar, Aman; Kumar, Tarun; Jhambh, Ricky

    2016-01-01

    Aim: This study aims to develop and to standardize a polymerase chain reaction (PCR) assay that will diagnose clinical as well as carrier state of the disease and to compare the results with conventional microscopy technique. Materials and Methods: A herd of crossbred cattle with the previous history of theileriosis in village Lahli, district Rohtak, Haryana, was selected for this study. A total of 29 blood samples were collected randomly from cows including five clinically ill cattle. Blood smears from all animals and lymph node biopsy smears from animal with swollen lymph nodes were examined microscopically after conventional Giemsa staining. Phenol chloroform isoamyl alcohol method was used for extracting DNA from blood. Previously published primers targeting cytochrome b gene sequence of Theileria annulata were used in the PCR assay that was standardized to use in the laboratory. Results: Out of 29 samples tested,18 (62.06%) were found positive for theileriosis by PCR assay, whereas only 10 (34.48%) samples were detected positive by conventional microscopic technique using Giemsa staining method. Conclusions: On the basis results of comparative studies, it can be concluded that PCR assay is a more sensitive than microscopic examination for detection of theileriosis. This can be attributed to the ability of PCR assay to detect small amounts of genomic DNA of T. annulata or low parasitemia in cows. Therefore, PCR assay can serve as a more sensitive tool to detect Theileria for detection of theileriosis even in asymptomatic carrier cattle which is important for the implementation of successful control programs. PMID:27733810

  19. Identification of Human Adenovirus in Respiratory Samples with Luminex Respiratory Virus Panel Fast V2 Assay and Real-Time Polymerase Chain Reaction.

    Science.gov (United States)

    Esposito, Susanna; Scala, Alessia; Bianchini, Sonia; Zampiero, Alberto; Fossali, Emilio; Principi, Nicola

    2016-01-01

    In order to compare the last version of the Respiratory Virus Panel (RVP) Fast assay for human Adenovirus (hAdv) detection with a specific real-time polymerase chain reaction (qPCR), which is considered the gold standard for hAdv detection, nasopharyngeal samples collected from 309 children (age range, four months to eight years) with respiratory tract infection were tested using the RVP Fast v2 assay (Luminex Molecular Diagnostics, Inc., Toronto, ON, Canada) and a specific TaqMan qPCR to identify hAdv DNA. The RVP Fast v2 assay detected 30/61 (49.2%) hAdv infections that had been identified by real-time qPCR, demonstrating a significantly lower detection rate (p < 0.001). The sensitivity of the RVP Fast v2 assay in comparison to qPCR was lower in younger children (42.9% vs. 57.7%; Cohen's kappa coefficient, 0.53); in samples with co-infections (40.0% vs. 56.7%; Cohen's kappa coefficient, 0.52); and in samples with hAdv type C (45.9% vs. 57.1%; Cohen's kappa coefficient, 0.60). Samples with lower viral loads were associated with a significantly lower sensitivity of the RVP Fast v2 assay (35.1% vs. 68.2%, p = 0.01; Cohen's kappa coefficients, 0.49). The RVP Fast v2 assay has important limitations for the detection of hAdv and cannot be used to evaluate whether hAdvs are the main etiologic agent responsible for an outbreak or when epidemiological studies are performed. PMID:26927078

  20. QUANTITATION OF DNA TOPOISOMERASE-II-ALPHA MESSENGER-RIBONUCLEIC-ACID LEVELS IN A SMALL-CELL LUNG-CANCER CELL-LINE AND 2 DRUG-RESISTANT SUBLINES USING A POLYMERASE CHAIN REACTION-AIDED TRANSCRIPT TITRATION ASSAY

    NARCIS (Netherlands)

    WITHOFF, S; SMIT, EF; MEERSMA, GJ; van den Berg, Anke; TIMMERBOSSCHA, H; KOK, K; POSTMUS, PE; MULDER, NH; DEVRIES, EGE; BUYS, CHCM

    1994-01-01

    BACKGROUND: We have modified a polymerase chain reaction (PCR)-aided transcript titration assay (1) in order to allow quantitation of low amounts of DNA topoisomerase II alpha mRNA in small RNA samples. EXPERIMENTAL DESIGN: The titration assay was used to quantitate the amount of DNA topoisomerase I

  1. Evaluation of a polymerase chain reaction assay for the diagnosis of bovine Trypanosomosis and epidemiological surveillance in Bolivia

    International Nuclear Information System (INIS)

    Sporadic outbreaks of bovine Trypanosomiasis have been reported in Bolivia since 1996 when T.vivax and T.evansi were identified for the first time by parasitological means. However, comprehensive epidemiological information concerning T.vivax and T.evansi in the country is lacking. Current parasitological and serological diagnostic methods for Trypanosomiasis have important limitations either in their sensitivity or specificity, which can result in unreliable data when applied in epidemiological studies. PCR assays are a recently developed procedure that might help to overcome the constraints of parasitological and serological assays. Therefore, the objective of this study was to evaluate PCR assays as a diagnostic tool for epidemiological studies in Bolivia. PCR assays for diagnosis of Trypanosome infection in cattle were evaluated for their ability to detect Trypanosome DNA in blood spots samples collected from cattle in four different provinces from the Bolivian lowlands and the results compared with those obtained with standard parasitological (Micro Haematocrit Centrifugation Technique (HCT) and stained smears) and serological methods (Card Agglutination Test for T.evansi (CATT), and Antibody ELISAs for T.vivax and T. congolense). Kappa agreement analysis showed a significant agreement between PCR assays and results from parasitological methods but there was no agreement when PCR was compared with serological assays. Some samples from T.vivax smear positive animals were negative by PCR, therefore modifications to the PCR assay conditions were undertaken to try to improve agreement between PCR and parasitological assays. Changes in the template DNA concentration or the use of an alternative primer sets resulted in improvements in the PCR detection rate, but not all the parasitologically positive samples were detected by PCR. Results from PCR assays for T.vivax and T.evansi were combined with results from parasitological and serological assays to provide

  2. Relative efficiency of polymerase chain reaction and enzyme-linked immunosorbant assay in determination of viral etiology in congenital cataract in infants

    Directory of Open Access Journals (Sweden)

    Shyamala G

    2008-01-01

    Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.

  3. Screening for JH1 genetic defect carriers in Jersey cattle by a polymerase chain reaction and restriction fragment length polymorphism assay.

    Science.gov (United States)

    Zhang, Yi; Guo, Gang; Huang, Hetian; Lu, Lu; Wang, Lijie; Fang, Lingzhao; Liu, Lin; Wang, Yachun; Zhang, Shengli

    2015-09-01

    An autosomal recessive genetic defect termed JH1 has been associated with early embryonic loss in the Jersey cattle breed. The genetic basis has been identified as a cytosine to thymine mutation in the CWC15 gene that changes an amino acid from arginine to a stop code. To screen for JH1 carriers in an imported Jersey population in China, a method based on a polymerase chain reaction amplification followed by a restriction fragment length polymorphism assay (PCR-RFLP) was developed for the accurate diagnosis of the JH1 allele. A total of 449 randomly chosen cows were examined with the PCR-RFLP assay, and 31 were identified as JH1 carriers, corresponding to a carrier frequency of 6.9%. The PCR-RFLP method was validated by DNA sequencing of 8 positive and 13 negative samples, with all 21 samples giving the expected DNA sequence. In addition, 3 negative and 3 positive samples were confirmed by a commercial microarray-based single nucleotide polymorphism assay. Finally, samples from 9 bulls in the United States of known status were correctly identified as carriers (5 bulls) or noncarriers (4 bulls). As the JH1 defect has most likely spread worldwide, implementing routine screening is necessary to avoid the risk of carrier-to-carrier matings and to gradually eradicate the deleterious gene.

  4. Interlaboratory comparison of three microbial source tracking quantitative polymerase chain reaction (qPCR) assays from fecal-source and environmental samples

    Science.gov (United States)

    Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.

    2012-01-01

    During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.

  5. A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3).

    Science.gov (United States)

    Glenney, Gavin W; Barbash, Patricia A; Coll, John A

    2016-03-01

    Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015.

  6. A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3).

    Science.gov (United States)

    Glenney, Gavin W; Barbash, Patricia A; Coll, John A

    2016-03-01

    Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015. PMID:26980561

  7. Validation of high-throughput real time polymerase chain reaction assays for simultaneous detection of invasive citrus pathogens.

    Science.gov (United States)

    Saponari, Maria; Loconsole, Giuliana; Liao, Hui-Hong; Jiang, Bo; Savino, Vito; Yokomi, Raymond K

    2013-11-01

    A number of important citrus pathogens are spread by graft propagation, arthropod vector transmission and inadvertent import and dissemination of infected plants. For these reasons, citrus disease management and clean stock programs require pathogen detection systems which are economical and sensitive to maintain a healthy industry. To this end, multiplex quantitative real-time PCR (qPCR) assays were developed allowing high-throughput and simultaneous detection of some major invasive citrus pathogens. Automated high-throughput extraction comparing several bead-based commercial extraction kits were tested and compared with tissue print and manual extraction to obtain nucleic acids from healthy and pathogen-infected citrus trees from greenhouse in planta collections and field. Total nucleic acids were used as templates for pathogen detection. Multiplex reverse transcription-qPCR (RT-qPCR) assays were developed for simultaneous detection of six targets including a virus, two viroids, a bacterium associated with huanglongbing and a citrus RNA internal control. Specifically, two one-step TaqMan-based multiplex RT-qPCR assays were developed and tested with target templates to determine sensitivity and detection efficiency. The first assay included primers and probes for 'Candidatus Liberibacter asiaticus' (CLas) and Citrus tristeza virus (CTV) broad spectrum detection and genotype differentiation (VT- and T3-like genotypes). The second assay contained primers and probes for Hop stunt viroid (HSVd), Citrus exocortis viroid (CEVd) and the mitochondrial NADH dehydrogenase (nad5) mRNA as an internal citrus host control. Primers and TaqMan probes for the viroids were designed in this work; whereas those for the other pathogens were from reports of others. Based on quantitation cycle values, automated high-throughput extraction of samples proved to be as suitable as manual extraction. The multiplex RT-qPCR assays detected both RNA and DNA pathogens in the same dilution series

  8. A new multiplex polymerase chain reaction assay for the identification a panel of bacteria involved in bacteremia

    Directory of Open Access Journals (Sweden)

    Hossein Fazzeli

    2013-01-01

    Conclusions: The presented multiplex PCR offers a rapid and accurate molecular diagnostic tool for simultaneous detection of some pathogenic microorganisms. The IC exists in the multiplex PCR accompanied by other primers in the system, can serve as a simple, cost- effective internal control for the multiplex PCR assay.

  9. Comparison of Parasite Burden Using Real-Time Polymerase Chain Reaction Assay and Limiting Dilution Assay in Leishma-nia major Infected Mouse

    Directory of Open Access Journals (Sweden)

    Somayeh GHOTLOO

    2015-12-01

    Full Text Available Background:Limiting dilution assay is considered as the gold standard method for quantifying the number of parasites in the animal model of Leishmania infection. Nowadays, real-time PCR is being increasingly applied to quantify infectious agents. In the present study, a real-time PCR assay was developed to estimate para­site burdens in lymph nodes of Leishmania major infected BALB/C mice. Enumera­tion of parasites was also performed by limiting dilution assay and compared with the results of real-time PCR based quantification.Methods:The SYBR Green based real- time PCR assay was performed to amplify a 75 bp fragment of superoxide dismutase B1 gene in the lymph nodes of L. major infected BALB/C mice 8 weeks post infection. Mice were infected subcutaneously at the base of their tail with 2 × 105L. major promastigotes in the stationary phase of growth. To compare parasite burdens obtained by real-time PCR assay with those of limiting dilution assay, twelve 8-fold serial dilutions of the lymph node homoge­nates were prepared in the Schneider medium and incubated at 26°C.After 7 days, wells containing motile parasites were identified by direct observation under an inverted light microscope and the total number of parasites was estimated using the ELIDA software.Results:Spearman's correlation coefficient of the parasite burdens between real-time PCR and limiting dilution assay was 0.72 (Pvalue = 0.008.Conclusion:Real-time PCR assay is an appropriate replacement to existing limit­ing dilution assay in quantifying parasite burden in the experimental model of Leishma­nia infection.

  10. Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Gaurav Solanki

    2012-10-01

    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  11. Label-Free and Enzyme-Free Homogeneous Electrochemical Biosensing Strategy Based on Hybridization Chain Reaction: A Facile, Sensitive, and Highly Specific MicroRNA Assay.

    Science.gov (United States)

    Hou, Ting; Li, Wei; Liu, Xiaojuan; Li, Feng

    2015-11-17

    Homogenous electrochemical biosensing strategies have attracted substantial attention, because of their advantages of being immobilization-free and having rapid response and improved recognition efficiency, compared to heterogeneous biosensors; however, the high cost of labeling and the strict reaction conditions of tool enzymes associated with current homogeneous electrochemical methods limit their potential applications. To address these issues, herein we reported, for the first time, a simple label-free and enzyme-free homogeneous electrochemical strategy based on hybridization chain reaction (HCR) for sensitive and highly specific detection of microRNA (miRNA). The target miRNA triggers the HCR of two species of metastable DNA hairpin probes, resulting in the formation of multiple G-quadruplex-incorporated long duplex DNA chains. Thus, with the electrochemical indicator Methylene Blue (MB) selectively intercalated into the duplex DNA chain and the multiple G-quadruplexes, a significant electrochemical signal drop is observed, which is dependent on the concentration of the target miRNA. Thus, using this "signal-off" mode, a simple, label-free and enzyme-free homogeneous electrochemical strategy for sensitive miRNA assay is readily realized. This strategy also exhibits excellent selectivity to distinguish even single-base mismatched miRNA. Furthermore, this method also exhibits additional advantages of simplicity and low cost, since both expensive labeling and sophisticated probe immobilization processes are avoided. Therefore, the as-proposed label-free and enzyme-free homogeneous electrochemical strategy may become an alternative method for simple, sensitive, and selective miRNA detection, and it has great potential to be applied in miRNA-related clinical diagnostics and biochemical research.

  12. Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide

    Directory of Open Access Journals (Sweden)

    Yuexia Wang

    2015-09-01

    Full Text Available Real-time polymerase chain reaction (PCR allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at −18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 103 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 100 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach.

  13. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4

    Science.gov (United States)

    Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  14. rDNA-ITS2 based species-diagnostic polymerase chain reaction assay for identification of sibling species of Anopheles fluviatilis in Iran.

    Science.gov (United States)

    Dezfouli, S R Naddaf; Oshaghi, M A; Vatandoost, H; Assmar, M

    2003-01-01

    A species-specific polymerase chain reaction (PCR) assay using primers already designed, based on differences in the nucleotides of the second internal transcribed spacer (ITS2), was used to identify the species composition of the Anopheles fluviatilis complex in Iran. All the amplified DNA samples obtained from specimens collected from different areas using different collection methods yielded to a fragment of 450 bp size, a PCR product corresponding to the species denoted as Y. Some 21 ITS2 region of Iranian specimens were sequenced and compared with the already published sequence data of species Y from India. The sequence data of the Iranian specimens were 100% identical to that of the Indian specimens, and hence confirmed the PCR assay results. Species Y is presumably species T in India, which has no role in the transmission of malaria, whereas mosquitos of An. fluviatilis are known as a secondary vector in Iran. This conflict will remain to be solved by further biological and molecular studies.

  15. Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

    Directory of Open Access Journals (Sweden)

    Nayereh Nouri

    2014-01-01

    Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

  16. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4.

    Science.gov (United States)

    Lin, Ying-Hong; Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  17. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4.

    Directory of Open Access Journals (Sweden)

    Ying-Hong Lin

    Full Text Available This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method.

  18. Discordance between MTB/RIF and Real-Time Tuberculosis-Specific Polymerase Chain Reaction Assay in Bronchial Washing Specimen and Its Clinical Implications

    Science.gov (United States)

    Jo, Yong Suk; Park, Ju-Hee; Lee, Jung Kyu; Heo, Eun Young; Chung, Hee Soon

    2016-01-01

    The prevalence and clinical implications of discordance between Xpert MTB/RIF assays and the AdvanSure TB/NTM real-time polymerase chain reaction (PCR) for bronchial washing specimens have not been studied in pulmonary TB (PTB) patients. The discordant proportion and its clinical impact were evaluated in 320 patients from the bronchoscopy registry whose bronchial washing specimens were tested simultaneously with Xpert MTB/RIF and the TB/NTM PCR assay for three years, and the accuracy of the assays, including the sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV), were studied. The clinical risk factors for discordance and false positivity of assays were also studied. Among 130 patients who were clinically diagnosed with PTB, 64 patients showed positive acid-fast bacilli culture results, 56 patients showed positive results in molecular methods and clinician diagnosed PTB without results of microbiology in 10 patients. The sensitivity, specificity, PPV, and NPV were 80.0%, 98.95%, 98.1%, and 87.9%, respectively, for Xpert MTB/RIF and 81.5%, 92.6%, 88.3%, and 88.0%, respectively, for TB/NTM PCR. The discordant proportion was 16.9% and was higher in culture-negative PTB compared to culture-confirmed PTB (24.3% vs. 9.4%, p = 0.024). However, there were no significant differences in the clinical characteristics, regardless of the discordance. The diagnostic yield increased with an additional assay (7.7% for Xpert MTB/RIF and 9.2% for TB/NTM PCR). False positivity was less common in patients tested with Xpert MTB/RIF (1.05% vs. 7.37%, p = 0.0035). No host-related risk factor for false positivity was identified. The Xpert MTB/RIF and TB/NTM PCR assay in bronchial washing specimens can improve the diagnostic yields for PTB, although there were considerable discordant results without any patient-related risk factors. PMID:27760181

  19. The impact of polymerase chain reaction assays for the detection of hepatitis C virus infection in a hemodialysis unit.

    Science.gov (United States)

    Hussein, Magdi M; Mooij, Jaap M; Hegazy, Mohamed S; Bamaga, Mohammed S

    2007-03-01

    Hepatitis C virus (HCV) infection is most often diagnosed by detection of antibodies against the virus (HCV Ab). However, it has been reported that some HCV Ab negative patients test positive for HCV-RNA. Over a study period of 30 months, all patients on hemodialysis at the Al Hada Armed Forces Hospital in Taif, Saudi Arabia were tested monthly for HCV Ab and twice per year for HCV-RNA. HCV Ab was tested by a third generation microparticle enzyme immunoassay (MEIA), and HCV-RNA by a qualitative hepatitis-RNA assay, second version (COBAS Amplicor PCR), which was recently introduced in the Molecular Pathology Laboratory of our hospital. Of the 180 patients studied, 34 (18.9%) had positive HCV Ab, and of the 146 HCV Ab negative patients, five patients tested positive for HCV-RNA (3.42%). Our study further finds that, when applying HCV Ab testing only, some patients with HCV viremia may be undetected. For better HCV infection control, routine HCV-RNA testing of dialysis patients should be considered, particularly in areas where the infection is common and in units applying isolation policies.

  20. Quantitation of viable Coxiella burnetii in milk using an integrated cell culture-polymerase chain reaction (ICC-PCR) assay.

    Science.gov (United States)

    Stewart, Diana; Shieh, Y-Carol; Tortorello, Mary; Kukreja, Ankush; Shazer, Arlette; Schlesser, Joseph

    2015-11-01

    The obligate intracellular pathogen Coxiella burnetii has long been considered the most heat resistant pathogen in raw milk, making it the reference pathogen for determining pasteurisation conditions for milk products. New milk formulations and novel non-thermal processes require validation of effectiveness which requires a more practical method for analysis than using the currently used animal model for assessing Coxiella survival. Also, there is an interest in better characterising thermal inactivation of Coxiella in various milk formulations. To avoid the use of the guinea pig model for evaluating Coxiella survival, an Integrated Cell Culture-PCR (ICC-PCR) method was developed for determining Coxiella viability in milk. Vero cell cultures were directly infected from Coxiella-contaminated milk in duplicate 24-well plates. Viability of the Coxiella in milk was shown by a ≥ 0.5 log genome equivalent (ge)/ml increase in the quantity of IS111a gene from the baseline post-infection (day 0) level after 9-11 d propagation. Coxiella in skim, 2%, and whole milk, and half and half successfully infected Vero cells and increased in number by at least 2 logs using a 48-h infection period followed by 9-d propagation time. As few as 125 Coxiella ge/ml in whole milk was shown to infect and propagate at least 2 logs in the optimised ICC-PCR assay, though variable confirmation of propagation was shown for as low as 25 Coxiella ge/ml. Applicability of the ICC-PCR method was further proven in an MPN format to quantitate the number of viable Coxiella remaining in whole milk after 60 °C thermal treatment at 0, 20, 40, 60 and 90 min.

  1. Detection of Klebsiella pneumoniae in Emulsifiable Dust by Polymerase Chain Reaction Assay%PCR检测乳粉中肺炎克雷伯氏菌

    Institute of Scientific and Technical Information of China (English)

    秦丽; 周正; 穆燕魁; 吴涛; 周巍

    2011-01-01

    A uniplex polymerase chain reaction(PCR) assay was developed for direct detection Klebsiella pneumoniae without enrichment in emulsifiable dust. A solvent extraction procedure was successfully modified for extraction of Klebsiella pneumoniae DNA from artifically by contaminated whole milk, skim milk and cheese. Primer targeting the thermostable nuclease gene(ITS) was used in the uniplex PCR. A DNA fragment of 158 bp was amplified. PCR product was confirmed by DNA sequencing. The sensitivity of the uniplex PCR is 10 CFU/mL.The developed methodology allows detection of Klebsiella pneumoniae in emulsifiable dust in less than 6 h, the time of this developed PCR assay is 12~24 h less than the time of general PCR assay with enrichment method.%利用PCR技术直接检测乳粉中的肺炎克雷伯氏菌,无需增菌.通过滤膜法成功地从人工污染肺炎克雷伯氏菌的乳粉中提取了肺炎克雷伯氏菌的DNA.以肺炎克雷伯氏菌的间区序列(ITS)为靶基因,经过PCR扩增得到158 bp的产物,经过DNA测序证实该产物为目的扩增产物.该方法灵敏度高,乳粉中检测的灵敏度为10CFU/mL,可在6 h内完成对乳品中肺炎克雷伯氏菌的检测,比目前普遍采用的先增菌再进行PCR检测的方法缩短了12-24 h.

  2. Varicella Zoster Virus Myelitis in Two Elderly Patients: Diagnostic Value of Nested Polymerase Chain Reaction Assay and Antibody Index for Cerebrospinal Fluid Specimens

    Directory of Open Access Journals (Sweden)

    Teruyuki Takahashi

    2013-04-01

    Full Text Available Background: Myelitis is one of the rarest neurological complications of the varicella zoster virus (VZV infection. Focal muscle weakness with or without sensory disturbance occurs in approximately 5% of the cases after acute VZV infection, with complete recovery in 50-70%. Case Presentation: This report describes two rare cases of elderly patients with VZV myelitis secondary to dermatomal zoster rash. Patient 1 was a 79-year-old woman who developed paraplegia, numbness and decreased sensation in the left arm and below thoracic (Th-10 after sacral zoster. Spinal cord MRI showed a high-signal-intensity lesion at the cervical spinal nerve 2 on a T2-weighted image. Patient 2 was a 73-year-old man who developed right flaccid leg weakness and urinary retention after right dorsal Th 5-8 zoster. Spinal cord MRI showed a high-signal-intensity lesion at Th 3-4 on a T2-weighted image. In both cases, although the conventional single polymerase chain reaction (PCR assays all showed negative results, the original nested PCR assay detected VZV DNA in the cerebrospinal fluid (CSF specimen collected on admission. In addition, the anti-VZV IgG antibody by enzyme immunoassay and antibody index were elevated in the CSF specimens during the clinical courses of both patients. On the basis of these findings, both patients were diagnosed with VZV myelitis and were treated with high-dose acyclovir and corticosteroid. This combined treatment was appropriate and effective for the improvement of their functional outcomes. Conclusion: The detection of VZV DNA in CSF by nested PCR assay and the evaluation of the antibody index to VZV had significant diagnostic value.

  3. Two novel nonradioactive polymerase chain reaction-based assays of dried blood spots, genomic DNA, or whole cells for fast, reliable detection of Z and S mutations in the alpha 1-antitrypsin gene

    DEFF Research Database (Denmark)

    Andresen, B S; Knudsen, I; Jensen, P K;

    1992-01-01

    Two new nonradioactive polymerase chain reaction (PCR)-based assays for the Z and S mutations in the alpha 1-antitrypsin gene are presented. The assays take advantage of PCR-mediated mutagenesis, creating new diagnostic restriction enzyme sites for unambiguous discrimination between test samples...... from individuals who are normal, heterozygous, or homozygous for the mutations. We show that the two assays can be performed with purified genomic DNA as well as with boiled blood spots. The new assays were validated by parallel testing with a technique in which PCR is combined with allele...

  4. Absence of Bacteria on Coronary Angioplasty Balloons from Unselected Patients: Results with Use of a High Sensitivity Polymerase Chain Reaction Assay.

    Science.gov (United States)

    Hansen, Gorm Mørk; Nilsson, Martin; Nielsen, Claus Henrik; Holmstrup, Palle; Helqvist, Steffen; Tolker-Nielsen, Tim; Givskov, Michael; Hansen, Peter Riis

    2015-01-01

    Periodontitis is a chronic, bacterially-induced inflammatory disease of the tooth-supporting tissues, which may result in transient bacteremia and a systemic inflammatory response. Periodontitis is associated with coronary artery disease independently of established cardiovascular risk factors, and translocation of bacteria from the oral cavity to the coronary arteries may play a role in the development of coronary artery disease. Very few studies have used angioplasty balloons for in vivo sampling from diseased coronary arteries, and with varying results. Therefore, the aim of this study was to assess if bacterial DNA from primarily oral bacteria could be detected on coronary angioplasty balloons by use of an optimized sampling process combined with an internally validated sensitive polymerase chain reaction (PCR) assay. Coronary angioplasty balloons and control samples from a total of 45 unselected patients with stable angina, unstable angina/non-ST elevation myocardial infarction, and ST-elevation myocardial infarction (n = 15 in each group) were collected and analyzed using a PCR assay with high sensitivity and specificity for 16S rRNA genes of the oral microbiome. Despite elimination of extraction and purification steps, and demonstration of sensitivity levels of 25-125 colony forming units (CFU), we did not detect bacterial DNA from any of the coronary angioplasty balloons. A subsequent questionnaire indicated that the prevalence of periodontitis in the study cohort was at least 39.5%. Although coronary angioplasty balloons are unlikely to be useful for detection of bacteria with current PCR techniques in unselected patients with coronary artery disease, more studies are warranted to determine the extent to which bacteria contribute to atherosclerosis and its clinical manifestations and whether the presence of bacteria in the arteries is a transient phenomenon.

  5. Detection of Pseudomonas aeruginosa by a triplex polymerase chain reaction assay based on lasI/R and gyrB genes.

    Science.gov (United States)

    Aghamollaei, Hosseine; Moghaddam, Mehrdad M; Kooshki, Hamid; Heiat, Mohammad; Mirnejad, Reza; Barzi, Nastaran S

    2015-01-01

    Pseudomonas aeruginosa is a nosocomial pathogen, which, due to its inherent and acquired resistance to a wide range of antibiotics, causes high mortality rates. Therefore, rapid detection of the bacterium with high specificity and sensitivity plays a critical role in the control of the pathogenic bacterium. The aim of this study was to evaluate the accuracy and specificity of a prompt detection of the bacterium based on a triplex polymerase chain reaction that amplifies the lasI, lasR and gyrB genes. For this purpose, 30 clinical isolates of P. aeruginosa and 30 wound biopsy samples were retrieved from clinical diagnostic laboratories. After the extraction of the chromosomal DNA, the desired genes were amplified using uniplex and triplex PCR with appropriate primers. The specificity of the primers was evaluated by a comparison of the PCR results for P. aeruginosa clinical samples and non-Pseudomonas species control samples. The sensitivity of the primers was determined using a serial dilution of the genomic DNA template (100 ng to 100 fg) and by a comparison of the PCR and bacterial culture results. The results showed that the triplex PCR assay was positive for all of the samples (100%), while the PCR identifications were negative for non-Pseudomonas species. Additionally, at 10(-4) and 10(-5) diluted genomic DNA from P. aeruginosa (10 pg and 1 pg), the triplex PCR test was positive for the Las and gyrB genes in all of the samples, respectively. Based on these results, the designed primers can be used for the rapid, specific and sensitive diagnosis of P. aeruginosa in a triplex PCR assay. PMID:25863575

  6. Parvovirus B19 infections in state of Rio de Janeiro, Brasil: 526 sera analyzed by IgM-enzyme-linked immunosorbent assay and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    MCL Mendonça

    2005-12-01

    Full Text Available In this study were analyzed 526 sera; the patients aged from two days to 65 years old presenting exanthema, which was the most frequent symptom observed, besides fever, adenomegaly, and arthralgia. These sera were negative by enzyme-linked immunosorbent assay (IgM-ELISA for either rubella (495, toxoplasma (41, cytomegalovirus (12, measles (40, dengue (56, and they were submitted to nested polymerase chain reaction (PCR for B19 DNA and commercial IgM-ELISA for B19. In 39 abortion cases, IgM or DNA were not detected, therefore they were not took into account for analysis. Specific DNA and IgM were detected respectively in 71 (14.5% and IgM in 62 (12.7% sera from 487 sera analyzed. IgM and DNA were simultaneously detected in 43 (8.8%, while agreement among the results by PCR and IgM-ELISA was observed in 440 (90.4%. The sera were collected from January 1999 to December 2000, most of them in 1999 (325, during winter and spring. The major number of clinical cases was observed in the age group from one to ten years old. IgM or DNA were detected in 23 from 51 municipal districts of the state of Rio de Janeiro, where the samples were collected.

  7. A simple real-time polymerase chain reaction (PCR)-based assay for authentication of the Chinese Panax ginseng cultivar Damaya from a local ginseng population.

    Science.gov (United States)

    Wang, H; Wang, J; Li, G

    2016-01-01

    Panax ginseng is one of the most important medicinal plants in the Orient. Owing to its increasing demand in the world market, cultivated ginseng has become the main source of medicinal material. Among the Chinese ginseng cultivars, Damaya commands higher prices and is grown in significant proportions among the local ginseng population. Due to the lack of rapid and accurate authentication methods, Damaya is distributed among different cultivars in the local ginseng population in China. Here, we identified a unique, Damaya-specific single nucleotide polymorphism (SNP) site present in the second intron of mitochondrial cytochrome c oxidase subunit 2 (cox2). Based on this SNP, a Damaya cultivar-specific primer was designed and an allele-specific polymerase chain reaction (PCR) was optimized for the effective molecular authentication of Damaya. We designed a method by combining a simple DNA isolation method with real-time allele-specific PCR using SYBR Green I fluorescent dye, and proved its efficacy in clearly discriminated Damaya cultivar from other Chinese ginseng cultivars according to the allelic discrimination analysis. Hence, this study provides a simple and rapid assay for the differentiation and conservation of Damaya from the local Chinese ginseng population. PMID:27420983

  8. Use of the polymerase chain reaction assay for the detection of Babesia odocoilei 18S ribosomal RNA in formalin-fixed tissues.

    Science.gov (United States)

    Lockerbie, Betty P; Bollinger, Trent K; Burgess, Hilary J

    2014-06-10

    The effect of fixation and storage conditions on the performance of polymerase chain reaction (PCR) assays for Babesia odocoilei were examined using 3 different primer sets targeting the eukaryotic 18S ribosomal RNA gene, with variably sized products of 1,723 base pairs (bp), 483 bp, and 306 bp. All primer sets performed well on fresh-frozen tissue, and storage for 1 year at -20°C did not affect PCR performance. Formalin fixation markedly affected the amplicon length that could be amplified. However, DNA was successfully amplified after storage in formalin for 2 months using the primer set with a 483-bp product, and up to 6 months using the primer set with a 306-bp product. The latter primer set successfully differentiated B. odocoilei and Babesia microti DNA; however, further evaluation is required to confirm its specificity. Treatment of tissues with formic acid, at concentrations typically used to denature prions, degraded the DNA and made it unsuitable for PCR testing.

  9. Detection of Phakopsora pachyrhizi by polymerase chain reaction (PCR) and use of germination test and DNA comet assay after e-beam processing in soybean

    International Nuclear Information System (INIS)

    Soybean harvest is the main agribusiness in Brazil, which is the second largest exporter in the world and has a revenue of billions of dollars. Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is difficult to control, since it occurs through wind dispersion. Actually P. pachyrhizi is found in different parts of the world. Electron beam treatment could be an alternative process to minimize these losses, especially for the grains exportation industry. Besides the possibility of being disconnected when not in use, this source does not need to be reloaded, is easily available and, streamlines the process and reduces logistics costs. The present work aims to identify, by the polymerase chain reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soybeans and the possibility to use radiation treatment as a sanitary alternative. Doses 0, 1.0, 2.0, 5.0, 6.0, 7.0, 8.0, 9.0 and 10.0 kGy (IPEN-CNEN/SP Electron Accelerator) were applied and two fast-screening methods were performed: DNA comet assay (for the detection of DNA damage) and germination test (for the measurement of roots inhibition). These tests are very easy to carry out and measure damage response depending on radiation dose

  10. Commercial enzyme-linked immunosorbent assay versuspolymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis.

    Science.gov (United States)

    Brasil, Pedro Emmanuel Alvarenga Americano do; Castro, Rodolfo; Castro, Liane de

    2016-01-01

    Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects.

  11. Diagnostic accuracy of an IgM enzyme-linked immunosorbent assay and comparison with 2 polymerase chain reactions for early diagnosis of human leptospirosis.

    Science.gov (United States)

    Vanasco, N B; Jacob, P; Landolt, N; Chiani, Y; Schmeling, M F; Cudos, C; Tarabla, H; Lottersberger, J

    2016-04-01

    Enzyme-linked immunosorbent assay (ELISA) tests and polymerase chain reaction (PCR) may play a key role for early detection and treatment of human leptospirosis in developing countries. The aims of this study were to develop and validate an IgM ELISA under field conditions and to compare the diagnostic accuracy among IgG, IgM ELISAs, conventional PCR (cPCR), and real-time PCR (rtPCR) for early detection of human leptospirosis. Overall accuracy of IgM ELISA was sensitivity of 87.9%, specificity of 97.0%, and area under the curve of 0.940. When the 4 methods were compared, IgM ELISA showed the greatest diagnostic accuracy (J=0.6) followed by rtPCR (J=0.4), cPCR (J=0.2) and IgG ELISA (J=0.1). Our results support the use of IgM ELISA and rtPCR for early diagnosis of the disease. Moreover, due to their high specificity, they could be also useful to replace or supplement microscopic agglutination test as a confirmatory test, allowing more confirmations.

  12. A simple real-time polymerase chain reaction (PCR)-based assay for authentication of the Chinese Panax ginseng cultivar Damaya from a local ginseng population.

    Science.gov (United States)

    Wang, H; Wang, J; Li, G

    2016-06-27

    Panax ginseng is one of the most important medicinal plants in the Orient. Owing to its increasing demand in the world market, cultivated ginseng has become the main source of medicinal material. Among the Chinese ginseng cultivars, Damaya commands higher prices and is grown in significant proportions among the local ginseng population. Due to the lack of rapid and accurate authentication methods, Damaya is distributed among different cultivars in the local ginseng population in China. Here, we identified a unique, Damaya-specific single nucleotide polymorphism (SNP) site present in the second intron of mitochondrial cytochrome c oxidase subunit 2 (cox2). Based on this SNP, a Damaya cultivar-specific primer was designed and an allele-specific polymerase chain reaction (PCR) was optimized for the effective molecular authentication of Damaya. We designed a method by combining a simple DNA isolation method with real-time allele-specific PCR using SYBR Green I fluorescent dye, and proved its efficacy in clearly discriminated Damaya cultivar from other Chinese ginseng cultivars according to the allelic discrimination analysis. Hence, this study provides a simple and rapid assay for the differentiation and conservation of Damaya from the local Chinese ginseng population.

  13. A polymerase chain reaction and enzyme linked immunosorbent assay based approach for diagnosis and differentiation between vaccinated and infected cattle with Mycobacterium bovis

    Directory of Open Access Journals (Sweden)

    Mohamed Sabry

    2014-01-01

    Full Text Available Background: In most African and Arabic countries tuberculosis (TB causes great economic losses in bovine species and constitutes serious zoonotic problem. As the traditional diagnostic method delay the research because of low sensitivity and specificity, a rapid method of diagnosis is of outmost importance. Aim: The study was designed to evaluate the two rapid diagnostic methods of TB in cattle, further to differentiate between infected and bacillus Calmette-Guerin (BCG vaccinated animals. Materials and Methods: Intradermal tuberculin test was applied to 300 cattle. Of these cattle, 15 cattle were vaccinated from cattle negative to tuberculin test with BCG. Blood samples were taken for lymphocyte separation to apply polymerase chain reaction (PCR upon and for serum preparation for the enzyme-linked immunosorbent assay (ELISA application, this blood collected from 65 cattle classified into three groups, viz. positive tuberculin test (35 animals, negative tuberculin test (15 animals, and vaccinated cow with BCG (15 animals. From blood samples lymphocytes were separated and the isolated lymphocytes were subjected to PCR and serum for ELISA application. Blood samples, specimens from lymph nodes and specific tissues were taken for PCR and for cultivation and isolation of Mycobacterium bovis. Results and Conclusions: The results of this study revealed that PCR can be used as rapid efficient and accurate diagnostic test in detection of ruminant TB. Moreover, cattle′s ELISA reading showed higher sensitivity in positive tuberculin animals. However, the differentiations between vaccinated and infected animals not clear by using a single antigen only.

  14. Detection of high-risk subtypes of human papillomavirus in cervical swabs: routine use of the Digene Hybrid Capture assay and polymerase chain reaction analysis.

    LENUS (Irish Health Repository)

    Brennan, M M

    2012-02-03

    Human papillomaviruses (HPVs) are major causative agents in the pathogenesis of cervical cancer, and more than twenty types are associated with its development. With the introduction of liquid-based preparation systems, it is envisaged that large-scale HPV testing will be established in the near future. Preliminary studies demonstrate the accessibility of these samples for DNA testing using both the Digene Hybrid Capture assay (DHCA) and polymerase chain reaction (PCR) techniques. This study aims to assess the validity and sensitivity of the DHCA system to detect high-risk HPV DNA, using two sets of HPV consensus primers (Gp5+\\/Gp6+ and MY09\\/MY11) in tandem with routine assessment of cervical smear and biopsy samples. Results indicate that the combination of DHCA and PCR detects more high-grade lesions than does the DHCA alone. DHCA-negative cases were categorised by subsequent PCR amplification into low-grade HPV-negative (12\\/16) cervical lesions and high-grade HPV-positive (7\\/9) cervical lesions. Gp5+\\/Gp6+ primers were less sensitive in detecting HPV-positive samples than was the MY09\\/MY11 primer set. These results support the use of high-risk HPV testing by DHCA, with subsequent analysis of DHCA-negative samples by PCR using the MY09\\/MY11 primers.

  15. Development of plasmids for quantitative detection of integrated lentiviral vectors and evaluation of culture time to perform vector titer by real-time quantitative polymerase chain reaction assay

    Directory of Open Access Journals (Sweden)

    Elena Baiamonte

    2014-09-01

    Full Text Available The accurate assessment of provirus copy number per cell (VCN/cell is a fundamental issue in transgenesis as well as in gene therapy studies based on stably integrated vectors. To this end, real-time quantitative polymerase chain reaction (qPCR is a powerful method but it is sensible to differences in quality or concentration of the two-plasmid preparations used for the construction of the standard curves. In order to minimize technical errors we included genome specific sequences (mouse or human and vector specific sequences in the same plasmid. We evaluated the specificity and sensitivity of these bivalent plasmids by qPCR analysis on mouse and human genomic DNA containing a known number of a reporter lentiviral vector and we found that the system is reliable to measure up to 0.1 VCN/cell. Here we have applied this assay to measure vector titer of virus stock preparations and to determine the optimal cell passages at which viral titration effectively reflects the number of integrated vectors.

  16. Commercial enzyme-linked immunosorbent assay versus polymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis

    Science.gov (United States)

    do Brasil, Pedro Emmanuel Alvarenga Americano; Castro, Rodolfo; de Castro, Liane

    2016-01-01

    Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects. PMID:26814640

  17. A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

    Science.gov (United States)

    Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

    2013-01-01

    Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations.

  18. Diagnostic multiplex polymerase chain reaction assay for the identification of Pseudomonas aeruginosa from the skin biopsy specimens in burn wound infections and detection of antibiotic susceptibility

    International Nuclear Information System (INIS)

    Objective was to identify Pseudomonas aeruginosa (P. aeruginosa) from the skin biopsy specimens in burn wound infections by multiplex polymerase chain reaction (M-PCR) and detection of antimicrobial susceptibility of isolates from culture. We conducted the cross-sectional study in 140 patients with wound infections who admitted to referral burn center of Motahari, Tehran, Iran, during a 12-month period from 2005-2006. Skin biopsy specimens were aseptically taken from each patient, one for PCR and one for bacterial culture. A M-PCR test based on simultaneous amplification of 2 lipoprotein genes: oprI and oprL, was used to directly detect fluorescent pseudomonades and P. aeruginosa in skin biopsy specimens. The susceptibility of P. aeruginosa isolates to 16 antibiotics was determined using the disc diffusion method. Out of 140 biopsy specimens, M-PCR detected 66 (47.2%) isolates, while culture detected 57 (40.7%) isolates as P. aeruginosa. Positive results for both genes which observed only for P. aeruginosa, while only one gene, oprI, was amplified from other fluorescent pseudomonades (n=12) and all other bacterial tested (n=62) were negative by the amplification test. The most effective antibiotics against isolate of P. aeruginosa were cefepime (79%), azetreonam (76%), ticarcillin-clavulanic acid (68%), tobramycin (62%) and amikacin (61%). Multiplex PCR assay appears promising for the rapid and sensitive detection of P. aeruginosa from the burned skin biopsy specimens. Simultaneous amplification of 2 lipoprotein genes: oprI and oprL could detect P. aeruginosa and oprI gene only for other fluorescent pseudomonades. (author)

  19. Supply chain reaction

    International Nuclear Information System (INIS)

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  20. Detection of Francisella tularensis in blood by polymerase chain reaction.

    OpenAIRE

    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.

    1993-01-01

    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.

  1. Detection of hemoplasma infection of goats by use of a quantitative polymerase chain reaction assay and risk factor analysis for infection.

    Science.gov (United States)

    Johnson, Kathy A; do Nascimento, Naíla C; Bauer, Amy E; Weng, Hsin-Yi; Hammac, G Kenitra; Messick, Joanne B

    2016-08-01

    OBJECTIVE To develop and validate a real-time quantitative PCR (qPCR) assay for the detection and quantification of Mycoplasma ovis in goats and investigate the prevalence and risk factors for hemoplasma infection of goats located in Indiana. ANIMALS 362 adult female goats on 61 farms. PROCEDURES Primers were designed for amplification of a fragment of the dnaK gene of M ovis by use of a qPCR assay. Blood samples were collected into EDTA-containing tubes for use in total DNA extraction, blood film evaluation, and determination of PCV. Limit of detection, intra-assay variability, interassay variability, and specificity of the assay were determined. RESULTS Reaction efficiency of the qPCR assay was 94.45% (R(2), 0.99; slope, -3.4623), and the assay consistently detected as few as 10 copies of plasmid/reaction. Prevalence of infection in goats on the basis of results for the qPCR assay was 18.0% (95% confidence interval, 14% to 22%), with infected goats ranging from 1 to 14 years old, whereby 61% (95% confidence interval, 47% to 73%) of the farms had at least 1 infected goat. Bacterial load in goats infected with M ovis ranged from 1.05 × 10(3) target copies/mL of blood to 1.85 × 10(5) target copies/mL of blood; however, no bacteria were observed on blood films. Production use of a goat was the only risk factor significantly associated with hemoplasma infection. CONCLUSIONS AND CLINICAL RELEVANCE The qPCR assay was more sensitive for detecting hemoplasma infection than was evaluation of a blood film, and production use of a goat was a risk factor for infection. PMID:27463552

  2. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection

    OpenAIRE

    Vasuki Venkatesan; Sugeerappa Laxmanappa Hoti; Nagalakshmi Kamaraj; Somnath Ghosh; Kaushik Rajaram

    2013-01-01

    Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence ...

  3. Study of a viral-dual infection in rainbow trout (Oncorhynchus mykiss) by seroneutralization, western blot and polymerase chain reaction assays.

    Science.gov (United States)

    Rodríguez, S; Vilas, M P; Alonso, M; Pérez, S I

    1995-12-01

    Viral-dual infections in fish are of interest to aquaculture practices but they are rarely described and studied. Several methods were applied in this work to demonstrate a case of coinfection in a reared rainbow trout (Oncorhynchus mykiss) population. Inoculation in cell cultures and cross-neutralization tests were the standard procedures that made it possible to isolate and identify a birnavirus, the infectious pancreatic necrosis virus (IPNV), and suspect of a second virus. Western blotting with both polyclonal and monoclonal antibodies, and reverse transcriptional-polymerase chain reaction (RT-PCR) demonstrate coexistence of both, IPNV and a rhabdovirus.

  4. Detection of the reemerging agent Burkholderia mallei in a recent outbreak of glanders in the United Arab Emirates by a newly developed fliP-based polymerase chain reaction assay.

    Science.gov (United States)

    Scholz, Holger C; Joseph, Marina; Tomaso, Herbert; Al Dahouk, Sascha; Witte, Angela; Kinne, Joerg; Hagen, Ralph M; Wernery, Renate; Wernery, Ulrich; Neubauer, Heinrich

    2006-04-01

    A polymerase chain reaction (PCR) assay targeting the flagellin P (fliP)-I S407A genomic region of Burkholderia mallei was developed for the specific detection of this organism in pure cultures and clinical samples from a recent outbreak of equine glanders. Primers deduced from the known fliP-IS407A sequence of B. mallei American Type Culture Collection (ATCC) 23344(T) allowed the specific amplification of a 989-bp fragment from each of the 20 B. mallei strains investigated, whereas other closely related organisms tested negative. The detection limit of the assay was 10 fg for purified DNA of B. mallei ATCC 23344(T). B. mallei DNA was also amplified from various tissues of horses with a generalized B. mallei infection. The developed PCR assay can be used as a simple and rapid tool for the specific and sensitive detection of B. mallei in clinical samples.

  5. A comparison of two real-time polymerase chain reaction assays using hybridization probes targeting either 16S ribosomal RNA or a subsurface lipoprotein gene for detecting leptospires in canine urine.

    Science.gov (United States)

    Gentilini, Fabio; Zanoni, Renato Giulio; Zambon, Elisa; Turba, Maria Elena

    2015-11-01

    Leptospires are excreted in the urine of infected animals, and the prompt detection of leptospiral DNA using polymerase chain reaction (PCR) is increasingly being used. However, contradictory data has emerged concerning the diagnostic accuracy of the most popular PCR assays that target either the 16S ribosomal RNA (rrs) or the subsurface lipoprotein (LipL32) genes. In order to clarify the effect of the gene target, a novel hydrolysis probe-based, quantitative real-time PCR (qPCR) assay targeting the LipL32 gene was developed, validated, and then compared directly to the previously described rrs hydrolysis probe-based qPCR using a convenience collection of canine urine samples. The novel LipL32 qPCR assay was linear from 5.9 × 10(6) to 59 genome equivalents per reaction. Both the LipL32 and the rrs qPCR assays showed a limit of detection of 10 target copies per reaction indicating an approximately equivalent analytical sensitivity. Both assays amplified all 20 pathogenic leptospiral strains tested but did not amplify a representative collection of bacteria commonly found in voided canine urine. When the field samples were assayed, 1 and 5 out of 184 samples yielded an amplification signal in the LipL32 and rrs assays, respectively. Nevertheless, when the limit of detection was considered as the cutoff for interpreting findings, the 4 discordant cases were judged as negative. In conclusion, our study confirmed that both LipL32 and rrs are suitable targets for qPCR for the detection of leptospiral DNA in canine urine. However, the rrs target requires the mandatory use of a cutoff value in order to correctly interpret spurious amplifications.

  6. Analysis of phosphate-accumulating organisms cultivated under different carbon sources with polymerase chain reaction-denaturing gradient gel electrophoresis assay

    Institute of Scientific and Technical Information of China (English)

    YU Shui-li; LIU Ya-nan; JING Guo-lin; ZHAO Bing-jie; GUO Si-yuan

    2005-01-01

    To investigate the microbial communities of microorganisms cultivated under different carbon sources, three sequencing batch reactors were operated. They were supplied with sewage, glucose and sodium acetate as carbon sources respectively and showed high phosphorus removal performance. The results of denaturing gradient gel electrophoresis(DGGE) of polymerase chain reaction-amplified (PCR) 16S rDNA fragments demonstrated that β-protebacteria, Actinomyces sp. and γ-protebacteria only exited in 1 # reactor. The microbiological diversity of 1 # reactor exceeded the other two reactors. Flavobacterium, Bacillales, Actinomyces, Actinobacteridae and uncultured bacteria(AF527584, AF502204, AY592749, AB076862, AJ619051, AF495454 and AY133070) could be detected in the biological phosphorus removal reactors.

  7. In planta and soil quantification of Fusarium oxysporum f. sp. ciceris and evaluation of Fusarium wilt resistance in chickpea with a newly developed quantitative polymerase chain reaction assay.

    Science.gov (United States)

    Jiménez-Fernández, Daniel; Montes-Borrego, Miguel; Jiménez-Díaz, Rafael M; Navas-Cortés, Juan A; Landa, Blanca B

    2011-02-01

    Fusarium wilt of chickpea caused by Fusarium oxysporum f. sp. ciceris can be managed by risk assessment and use of resistant cultivars. A reliable method for the detection and quantification of F. oxysporum f. sp. ciceris in soil and chickpea tissues would contribute much to implementation of those disease management strategies. In this study, we developed a real-time quantitative polymerase chain reaction (q-PCR) protocol that allows quantifying F. oxysporum f. sp. ciceris DNA down to 1 pg in soil, as well as in the plant root and stem. Use of the q-PCR protocol allowed quantifying as low as 45 colony forming units of F. oxysporum f. sp. ciceris per gram of dry soil from a field plot infested with several races of the pathogen. Moreover, the q-PCR protocol clearly differentiated susceptible from resistant chickpea reactions to the pathogen at 15 days after sowing in artificially infested soil, as well as the degree of virulence between two F. oxysporum f. sp. ciceris races. Also, the protocol detected early asymptomatic root infections and distinguished significant differences in the level of resistance of 12 chickpea cultivars that grew in that same field plot infested with several races of the pathogen. Use of this protocol for fast, reliable, and cost-effective quantification of F. oxysporum f. sp. ciceris in asymptomatic chickpea tissues at early stages of the infection process can be of great value for chickpea breeders and for epidemiological studies in growth chambers, greenhouses and field-scale plots.

  8. Comparative study of sensitivity, linearity, and resistance to inhibition of digital and nondigital polymerase chain reaction and loop mediated isothermal amplification assays for quantification of human cytomegalovirus.

    Science.gov (United States)

    Nixon, Gavin; Garson, Jeremy A; Grant, Paul; Nastouli, Eleni; Foy, Carole A; Huggett, Jim F

    2014-05-01

    Performing nucleic acid amplification techniques (NAATs) in digital format using limiting dilution provides potential advantages that have recently been demonstrated with digital polymerase chain reaction (dPCR). Key benefits that have been claimed are the ability to quantify nucleic acids without the need of an external calibrator and a greater resistance to inhibitors than real-time quantitative PCR (qPCR). In this study, we evaluated the performance of four NAATs, qPCR, dPCR, real-time quantitative loop mediated isothermal amplification (qLAMP), and digital LAMP (dLAMP), for the detection and quantification of human cytomegalovirus (hCMV). We used various DNA templates and inhibitors to compare the performance of these methods using a conventional real-time thermocycler platform (Bio-Rad CFX96) and a chip based digital platform (Fluidigm Biomark 12.765 Digital Array). dPCR performed well and demonstrated greater resistance to inhibitors than the other methods although this resistance did not apply equally to all inhibitors tested. dLAMP was found to be less sensitive than dPCR, but its quantitative performance was better than qLAMP, the latter being unable to quantify below 1000 copies. dLAMP was also more resistant to inhibitors than qLAMP. Unlike qPCR, both digital methods were able to quantify viral genomes without requiring a calibrator; however, neither can currently compete with the large reaction volumes, and thus the greater absolute sensitivity, of qPCR. With the introduction of digital instrumentation that will enable larger reaction volumes, digital amplification methods such as those evaluated in this study could potentially offer a robust alternative to qPCR for nucleic acid quantification. PMID:24684191

  9. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection

    Directory of Open Access Journals (Sweden)

    Vasuki Venkatesan

    2013-09-01

    Full Text Available Single-stranded DNA (ssDNA is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring.

  10. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection.

    Science.gov (United States)

    Venkatesan, Vasuki; Hoti, Sugeerappa Laxmanappa; Kamaraj, Nagalakshmi; Ghosh, Somnath; Rajaram, Kaushik

    2013-09-01

    Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring. PMID:24037206

  11. Novel polymerase chain reaction-restriction fragment length polymorphism assay to determine internal transcribed spacer-2 group in the Chagas disease vector, Triatoma dimidiata (Latreille, 1811

    Directory of Open Access Journals (Sweden)

    Bethany Richards

    2013-06-01

    Full Text Available Triatoma dimidiata is the most important Chagas disease insect vector in Central America as this species is primarily responsible for Trypanosoma cruzi transmission to humans, the protozoan parasite that causes Chagas disease. T. dimidiata sensu lato is a genetically diverse assemblage of taxa and effective vector control requires a clear understanding of the geographic distribution and epidemiological importance of its taxa. The nuclear ribosomal internal transcribed spacer 2 (ITS-2 is frequently used to infer the systematics of triatomines. However, oftentimes amplification and sequencing of ITS-2 fails, likely due to both the large polymerase chain reaction (PCR product and polymerase slippage near the 5' end. To overcome these challenges we have designed new primers that amplify only the 3'-most 200 base pairs of ITS-2. This region distinguishes the ITS-2 group for 100% of known T. dimidiata haplotypes. Furthermore, we have developed a PCR-restriction fragment length polymorphism (RFLP approach to determine the ITS-2 group, greatly reducing, but not eliminating, the number of amplified products that need to be sequenced. Although there are limitations with this new PCR-RFLP approach, its use will help with understanding the geographic distribution of T. dimidiata taxa and can facilitate other studies characterising the taxa, e.g. their ecology, evolution and epidemiological importance, thus improving vector control.

  12. Development and evaluation of a reverse transcription-insulated isothermal polymerase chain reaction (RT-iiPCR) assay for detection of equine arteritis virus in equine semen and tissue samples using the POCKIT™ system.

    Science.gov (United States)

    Carossino, Mariano; Lee, Pei-Yu A; Nam, Bora; Skillman, Ashley; Shuck, Kathleen M; Timoney, Peter J; Tsai, Yun-Long; Ma, Li-Juan; Chang, Hsiao-Fen G; Wang, Hwa-Tang T; Balasuriya, Udeni B R

    2016-08-01

    Equine arteritis virus (EAV) is the causative agent of equine viral arteritis (EVA), a respiratory and reproductive disease of horses. Most importantly, EAV induces abortion in pregnant mares and can establish persistent infection in up to 10-70% of the infected stallions, which will continue to shed the virus in their semen. The objective of this study was to develop and evaluate a reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) for the detection of EAV in semen and tissue samples. The newly developed assay had a limit of detection of 10 RNA copies and a 10-fold higher sensitivity than a previously described real-time RT-PCR (RT-qPCR). Evaluation of 125 semen samples revealed a sensitivity and specificity of 98.46% and 100.00%, respectively for the RT-qPCR assay, and 100.00% and 98.33%, respectively for the RT-iiPCR assay. Both assays had the same accuracy (99.2%, k=0.98) compared to virus isolation. Corresponding values derived from testing various tissue samples (n=122) collected from aborted fetuses, foals, and EAV carrier stallions are as follows: relative sensitivity, specificity, and accuracy of 88.14%, 96.83%, and 92.62% (k=0.85), respectively for the RT-qPCR assay, and 98.31%, 92.06%, and 95.08% (k=0.90), respectively for the RT-iiPCR assay. These results indicate that RT-iiPCR is a sensitive, specific, and a robust test enabling detection of EAV in semen and tissue samples with very considerable accuracy. Even though the RT-qPCR assay showed a sensitivity and specificity equal to virus isolation for semen samples, its diagnostic performance was somewhat limited for tissue samples. Thus, this new RT-iiPCR could be considered as an alternative tool in the implementation of EAV control and prevention strategies. PMID:27036504

  13. Evaluation of two real-time polymerase chain reaction assays for porcine epidemic diarrhea virus (PEDV) to assess PEDV transmission in growing pigs

    Science.gov (United States)

    In April 2013 a porcine epidemic diarrhea virus (PEDV) epidemic began in the United States. As part of the response, real-time RT-PCR assays to detect PEDV were developed by several Veterinary Diagnostic Laboratories. This study evaluated RT-PCR PEDV assays that detect the N gene (gN) and S gene (gS...

  14. Clinical Utility Of Blood E2F3 MRNA Assay In The Early Diagnosis Of Prostatic Cancer By Real-Time Polymerase Chain Reaction

    International Nuclear Information System (INIS)

    Background: Based on the fact that prostate cancer development and progression is the result of the interaction between different molecular mechanisms, many efforts have been devoted to the identification of new circulating genes that could serve as non invasive, reliable early diagnostic and prognostic markers and where their specific functions allow potential therapeutic targets. E2F3 is a member of E2F family of transcription factors involved in cell cycle regulatory functions. It was found that E2F3 is over-expressed in some tumors including bladder and prostate cancer. Aim: The aim of the study was to evaluate the clinical significance of peripheral blood E2F3 mRNA assay in the early diagnosis of patients with localized prostate cancer and to compare its expression in the blood of age-matched prostate cancer, benign prostatic hypertrophy and healthy males. Methods: This study was conducted on 25 patients with cancer prostate, 15 patients with benign prostatic hyperplasia (serving as a pathological control group) in addition to 10 healthy men (serving as a healthy control group). Blood samples were collected and tested for the detection of E2F3 mRNA gene by real time RT-PCR and prostate specific antigen (PSA) by electro chemiluminescence immunoassay. E2F3 mRNA results were reported in relative quantification, where the target and housekeeping gene (GAPDH) were amplified from the same sample in two separate reaction plates. Results were then compared between different samples relying on direct comparison of threshold cycle (CT) values. Finally, the normalized level of target gene expression was calculated by using the formula: 2δδCT Results: Total PSA at the cutoff 4 ng/mL had a diagnostic sensitivity of 88%, specificity of 84%, positive predictive value of 88%, negative predictive value of 84% and diagnostic efficacy of 86%. E2F3 mRNA was statistically higher in cancer prostate group than in benign prostatic hyperplasia and healthy control groups. At the cut

  15. Triplex polymerase chain reaction assay for detection of major soil-transmitted helminths, Ascaris lumbricoides, Trichuris trichiura, Necator americanus, in fecal samples.

    Science.gov (United States)

    Phuphisut, Orawan; Yoonuan, Tippayarat; Sanguankiat, Surapol; Chaisiri, Kittipong; Maipanich, Wanna; Pubampen, Somchit; Komalamisra, Chalit; Adisakwattana, Poom

    2014-03-01

    Ascaris lumbricoides, Trichuris trichiura, and Necator americanus are medically important soil-transmitted helminths (STHs) occurring frequently worldwide including Thailand. Fecal examination using a microscope has been recommended as the gold standard for diagnosis of STH infections, but suffers from low sensitivity. Recently, highly sensitive and specific assays, such as multiplex quantitative PCR, has been established, but the high cost and need for special instruments are still barriers limiting their applications in routine diagnosis. Therefore, a conventional multiplex PCR assay, with its lower cost and greater simplicity, was developed, for the simultaneous detection of STHs in fecal samples. The multiplex PCR assay was species-specific to the three STHs, and could detect one copy of DNA target. Compared with microscopic examination of fecal samples, sensitivity and specificity of the multiplex PCR was 87% and 83%, respectively. This multiplex PCR assay provides an alternative method for routine diagnosis of STHs infection, and might be applied for epidemiological studies of STHs in endemic areas.

  16. Development and validation of a real time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assay for investigation of wild poliovirus type 1-South Asian (SOAS) strain reintroduced into Israel, 2013 to 2014.

    Science.gov (United States)

    Hindiyeh, M Y; Moran-Gilad, J; Manor, Y; Ram, D; Shulman, L M; Sofer, D; Mendelson, E

    2014-02-20

    In February 2013, wild poliovirus type 1 (WPV1) was reintroduced into southern Israel and resulted in continuous silent circulation in the highly immune population. As a part of the public health emergency response, a novel real time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed, to allow for the sensitive and specific detection of the circulatingWPV1-South Asian (SOAS) strain. Specific primers and probes derived from the VP-1 region were designed, based on sequenced sewage isolates, and used to simultaneously amplify this WPV1-SOAS sequence together with bacteriophage MS-2 as internal control. High titre WPV1-SOAS stock virus was used for assay optimisation and 50 processed sewage samples collected from southern Israel and tested by reference culture based methods were used for analytical validation of the assay’s performance. The limit of detection of the multiplex qRT-PCR (SOAS/MS-2) assay was 0.1 plaque-forming unit (pfu)/reaction (20 pfu/mL) for WPV1-SOAS RNA with 100% sensitivity, specificity, positive and negative predictive values when compared to the culture based method. The turnaround time was rapid, providing results for environmental samples within 24 to 48 hours from completion of sewage processing, instead of five to seven days by culture-based analysis. Direct sewage testing by qRT-PCR assay proved to be a useful tool for rapid detection and environmental surveillance of WPV1-SOAS circulating strain during emergency response. Application of the approach for detection of WPV1-SOAS in stool samples obtained during acute flaccid paralysis (AFP) surveillance or field surveys should be further evaluated.

  17. Development of a Polymerase Chain Reaction (PCR Assay for the Detection of Philippine Isolates of the Penaeus monodon-type Baculovirus (MBV

    Directory of Open Access Journals (Sweden)

    Christopher Marlowe A. Caipang

    2011-07-01

    Full Text Available Penaeus monodon-type baculovirus (MBV is a DNA virus that infects postlarvae and early juveniles of shrimp, Penaeus monodon. Several variants of this virus occur through nucleotide analysis of its genomic DNA. In the present study, a one-step PCR method was developed for the detection of the Philippine isolates of MBV by designing PCR primers on the least conserved region of the Philippine MBV. Using genomic DNA of MBV-infected shrimp postlarvae, the PCR assay amplified a 193-bp PCR product. Its sensitivity was comparable to the published PCR assays. The strain-specific primers did not cross-react with other DNA viruses including White Spot Syndrome Virus (WSSV, Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV and hepatopancreatic parvovirus (HPV. This PCR assay could be used for regular monitoring and surveillance of MBV in shrimp as well as tracing the movement of the Philippine MBV in shrimp farms in different geographic regions.

  18. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  19. The chain re-action

    CERN Multimedia

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  20. Study and application of polymerase chain reaction assay on Brucella identification%布鲁氏菌PCR鉴定方法的研究与应用

    Institute of Scientific and Technical Information of China (English)

    钟旗; 易新萍; 李博; 吴冬玲; 刘丽娅; 叶锋; 闫晶华; 李金平; 王力俭

    2011-01-01

    The purpose of this study was to apply PCR and PCR-SSCP assay method to identify Brucella and specific type of Brucella. In order to analyze a great number of partition Brucella of types sequence which have been issued as specific genotype and search for the distributing role of genotype-specific nucleotides, the specific primers were designed and PCR method was applied to identify specific type of Brucella. PCR-SSCP method was established to distinguish vaccine strain Al9 from other specific types of Brucella. Results indicated that the established PCR method could be used to conduct the diagnosis of Brucellosis and identify specific type of Brucella. And PCR-SSCP assay could detect vaccine strain Al9, It's suggested that PCR and PCR-SSCP assay is a reliable and convenient method to identify specific type of Brucella and vaccine strain Al9.%目的 采用PCR、PCR-SSCP方法对布鲁氏菌进行快速鉴定,并对其种、型鉴别.方法 分析已发表布鲁氏菌属、种、型基因序列,寻找出不同布鲁氏菌的种、型特异性碱基分布规律,设计特异性引物,用于布鲁氏菌属、种、型的鉴定;根据聚合酶链反应-单链构象多态性(PCR-SSCP)分析原理,建立PCR-SSCP方法,用于区分牛种A19疫苗株与其他型布鲁氏菌.结果 所建立的PCR方法能高效、准确鉴定出布鲁氏菌,并能对其种、型进行区分;PCR-SSCP方法可将A19疫苗株从其他型布鲁氏菌中区分出来.结论 利用PCR、PCR-SSCP方法能快速、准确地进行布鲁氏菌属、种、型以及疫苗株A19的鉴别,且简便、可靠,便于临床应用.

  1. Description of Haemoproteus ciconiae sp. nov. (Haemoproteidae, Haemosporida) from the white stork Ciconia ciconia, with remarks on insensitivity of established polymerase chain reaction assays to detect this infection.

    Science.gov (United States)

    Valkiūnas, Gediminas; Ilgūnas, Mikas; Bukauskaitė, Dovilė; Iezhova, Tatjana A

    2016-07-01

    Haemoproteus ciconiae sp. nov. (Haemosporida, Haemoproteidae) was found in the white stork Ciconia ciconia (Ciconiiformes, Ciconiidae) after spring migration in Lithuania. This organism is illustrated and described based on the morphology of its blood stages. The new species can be readily distinguished from all other haemoproteids parasitizing ciconiiform birds due to the presence of large number (approximately 20 on average) small (parasites. The white stork cyt b sequence was readily detectable, indicating the well-optimised PCR protocols and the good quality of total DNA in the sample containing the new species. The failure to amplify this parasite DNA indicates insufficient sensitivity of the currently used PCR-based assays in diagnostics of avian haemosporidian infections. We suggest possible explanations of this observation. To minimize number of the false negative PCR reports, we call for the continued use of optical microscopy in parallel with molecular diagnostics in studies of haemosporidian parasites, particularly in wildlife. PMID:27000089

  2. Application of a real-time fluorescence resonance energy transfer polymerase chain reaction assay with melting curve analysis for the detection of Paragonimus heterotremus eggs in the feces of experimentally infected cats.

    Science.gov (United States)

    Tantrawatpan, Chairat; Intapan, Pewpan M; Thanchomnang, Tongjit; Sanpool, Oranuch; Janwan, Penchom; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai

    2013-09-01

    Paragonimus heterotremus is a medically important lung fluke that causes human and animal paragonimiasis in Southeast Asia, including Thailand. In the current study, a real-time fluorescence resonance energy transfer polymerase chain reaction (real-time FRET PCR) with melting curve analysis was developed and evaluated to detect P. heterotremus eggs in the feces of experimentally infected cats. The detection limit of this method for the P. heterotremus DNA sequence was 3 × 10(2) copies of the positive control plasmid and 10(-3) ng of P. heterotremus genomic DNA. The assay system could detect 10 eggs of P. heterotremus per gram of cat feces. No fluorescence signal was observed when DNA purified from 16 other organisms or genomic DNA from cats and human beings were tested. Real-time FRET PCR yielded positive results for all fecal samples from 17 P. heterotremus-infected cats and showed a negative relationship (r = -0.852, P Paragonimus species examined were divided into 4 groups by melting peak analysis. This assay can be useful for the detection of, and epidemiological studies on, P. heterotremus infection in endemic areas.

  3. Evaluation of a broad range real-time polymerase chain reaction (RT-PCR) assay for the diagnosis of septic synovitis in horses.

    Science.gov (United States)

    Elmas, Colette R; Koenig, Judith B; Bienzle, Dorothee; Cribb, Nicola C; Cernicchiaro, Natalia; Coté, Nathalie M; Weese, J Scott

    2013-07-01

    Septic synovitis is a potentially debilitating and life-threatening disorder in horses. We hypothesized that a universal bacterial real-time PCR (RT-PCR) assay would have improved sensitivity and decreased turn-around time for detection of bacteria in synovial fluid (SF) samples. Forty-eight SF samples were collected from 36 horses that presented to two referral institutions with suspected septic synovitis. Universal RT-PCR, bacterial culture and SF analysis were performed on all samples, and an interpretation on the sample being septic or not was derived by three board certified specialists from the history, clinical assessment and SF characteristics. RT-PCR results were compared to a composite standard comprised of positive culture and interpretation by all three specialists of samples as "septic". For 41 of 48 samples (85%), culture and RT-PCR results were concordant. Compared to the composite standard, 83% of samples were correctly classified by RT-PCR (turn-around time of approximately 4 hours). Relative sensitivity and specificity of RT-PCR were 87% and 72% respectively, and 56% and 86% for culture. Hence, universal RT-PCR was a rapid and highly sensitive test, which may accelerate diagnosis and improve outcome for horses with septic synovitis.

  4. "Use of Random Amplified Polymorphic DNA Polymerase Chain Reaction (RAPD-PCR and ITS2 PCR assays for differentiation of populations and putative sibling species of Anopheles fluviatilis (Diptera: Culicidae in Iran"

    Directory of Open Access Journals (Sweden)

    SR Naddaf Dezfouli

    2002-09-01

    Full Text Available Anopheles fluviatilis complex is known to be a vector of malaria in Iran. Since mosquitoes of this species cover a wide geographical range in Iran, they might have evolved into different separated populations. Random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR assay was used to differentiate geographic populations of this species. DNA was extracted from individual mosquitoes from 8 localities in 4 south and southeast provinces and amplified in PCR reactions using 18 single primers of arbitrary nucleotide sequence. Results of RAPD-PCR showed that Kazeroun populations could simply be differentiated from other populations using a diagnostic fragment amplified with primer UBC-306. But other populations could not be differentiated either visually or by means of statistical analysis. Moreover ITS2 fragments of some selected specimens were amplified using a pair of universal primer and sequenced as a key standard for detection of putative sibling species. Sequence analysis of the ITS2 fragments revealed a very high (100% homology among the populations. These findings are crucial in epidemiological studies concerning relatedness of geographic populations and vector movement in the region. Results of RAPD-PCR and ITS2 analysis suggest that this taxon in Iran comprises of only one species with a low genetic variation among geographic populations.

  5. Efficacy of an in-house polymerase chain reaction assay for rapid diagnosis of Mycobacterium tuberculosis in patients with tubercular lymphadenitis: Comparison with fine needle aspiration cytology and conventional techniques

    Directory of Open Access Journals (Sweden)

    Sharma Meera

    2010-10-01

    Full Text Available Introduction: Tubercular lymphadenitis (TB-L is the most common manifestation of extrapulmonary tuberculosis. Excisional biopsy with histopathological examination, Ziehl-Neelsen staining (ZNS and culture and fine needle aspiration (FNA cytology, although useful in the diagnosis of TB-L, cannot diagnose a substantial proportion of cases. We investigated the role of an in-house polymerase chain reaction (PCR assay targeting the IS6110 gene from the FNA material in the diagnosis of the disease. Materials and Methods: The clinical profile of 150 patients with lymphadenopathy was noted and the fine needle aspirate was collected. After cytological processing, ZNS and culture on Lowenstein-Jensen media, mycobacterial DNA was isolated from the residual aspirate material and IS6110 gene PCR was performed. Results of cytology, ZNS, culture and IS6110 gene PCR were compared. Results: There were 49 confirmed patients of TB-L based on laboratory parameters (either culture isolation of Mycobacterium tuberculosis or any two of cytology, ZNS, PCR positive and clinical response to therapy. Sensitivity and specificity of FNA was 89.8% and 96%, of ZNS was 40.8% and 99%, of culture was 40.8% and 100% and of IS6110 gene PCR test was 100% and 92.1%. Conclusion: IS6110 PCR can be considered a valuable adjunct to cytology, ZNS and culture techniques in the diagnosis of TB-L.

  6. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...

  7. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  8. Polymerase Chain Reaction for Educational Settings.

    Science.gov (United States)

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  9. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  10. The polymerase chain reaction (PCR): general methods.

    Science.gov (United States)

    Waters, Daniel L E; Shapter, Frances M

    2014-01-01

    The polymerase chain reaction (PCR) converts very low quantities of DNA into very high quantities and is the foundation of many specialized techniques of molecular biology. PCR utilizes components of the cellular machinery of mitotic cell division in vitro which respond predictably to user inputs. This chapter introduces the principles of PCR and discusses practical considerations from target sequence definition through to optimization and application.

  11. Evaluation of IgG anti-toxoplasma avidity and polymerase chain reaction in the postnatal diagnosis of congenital toxoplasmosis.

    Science.gov (United States)

    Torres, Elizabeth; Rivera, Raul; Cardona, Nestor; Sanchez, Victor; Lora, Fabiana; Gómez-Marín, Jorge Enrique

    2013-06-01

    Confirmatory tests for congenital toxoplasmosis were evaluated in 23 infected and 31 uninfected newborns. Conventional polymerase chain reaction was better than real-time polymerase chain reaction, but did not identify additional cases. Avidity tests added 2 new cases that were not identified by other criteria. Overall sensitivity was 82.6%. Avidity assay, but not polymerase chain reaction, increased the sensitivity of confirmatory assays in congenital toxoplasmosis.

  12. Transformational leadership: a cascading chain reaction.

    Science.gov (United States)

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  13. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  14. Polymerase Chain Reaction on a Viral Nanoparticle.

    Science.gov (United States)

    Carr-Smith, James; Pacheco-Gómez, Raúl; Little, Haydn A; Hicks, Matthew R; Sandhu, Sandeep; Steinke, Nadja; Smith, David J; Rodger, Alison; Goodchild, Sarah A; Lukaszewski, Roman A; Tucker, James H R; Dafforn, Timothy R

    2015-12-18

    The field of synthetic biology includes studies that aim to develop new materials and devices from biomolecules. In recent years, much work has been carried out using a range of biomolecular chassis including α-helical coiled coils, β-sheet amyloids and even viral particles. In this work, we show how hybrid bionanoparticles can be produced from a viral M13 bacteriophage scaffold through conjugation with DNA primers that can template a polymerase chain reaction (PCR). This unprecedented example of a PCR on a virus particle has been studied by flow aligned linear dichroism spectroscopy, which gives information on the structure of the product as well as a new protototype methodology for DNA detection. We propose that this demonstration of PCR on the surface of a bionanoparticle is a useful addition to ways in which hybrid assemblies may be constructed using synthetic biology.

  15. [Polymerase chain reaction and its application].

    Science.gov (United States)

    Sárosi, I; Gerald, E; Girish, V N

    1992-07-01

    The polymerase chain reaction (PCR) is one of the most important new methods in molecular biology. It is widely used in genetic and anthropologic basic research, in oncology and virology, in all those fields, where molecular biologic methods can give answers to the questions raised. The procedure enables one to multiply with extreme precision targeted pieces of amounts as little as one target molecule of DNA or RNA by five to six logs, making them easy to be handled and examined by routine molecular biological methods. The method is presented through one possible application field, that is of great importance in the study of hepatocarcinogenesis. Sensitivity of PCR in detection of hepatitis B virus DNA is greater by four logs than animal inoculation, the last most sensitive method known.

  16. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.

    OpenAIRE

    1991-01-01

    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  17. Investigation on detection of Haemophilus ducreyi by Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xibao(张锡宝); FEI Shi(费实); DENG Wenguo(邓文国); CAO wenlig(曹文苓); ZHU huilan(朱慧兰); MENG jinxiu(孟锦秀); YAN jinglan(颜景兰)

    2002-01-01

    Objective:To investigate the application of polymerase chain reaction (PCR) detection of Haemophilus ducreyi in clinical diagnosis of chancroid.Methods: Nucleotide sequences of 16srRNA gene specific for H. Dureyi were used to develop primer sets for amplification of two strains. The amplified products were tested via PCR and sequenced by electrophoresis in a 1.5 % gel.These products were compared with those of heterogeneous species or related bacteria to test the specificity of the PCR assay. PCR amplification with different concentrations of H.ducreyi was performed to test its sensitivity.Results: PCR amplification of two strains of H. Ducreyi produced a single band of expected 438bp length. The sequence was identified with genomic DNA. None of the other 19 reference species amplified under the same conditions gave this result. The highest sensitivity of PCR assay in the present test was 10ng/L.Conclusions: PCR assay for detection of H. Ducreyi is a rapid, specific, and sensitive detection method. If laboratory conditions are strictly controlled, PCR assay is a potentially useful laboratory test for H. Ducreyi infection diagnosis.

  18. Comet assay as a cold chain control tool

    International Nuclear Information System (INIS)

    Bearing in mind an ever more demanding market regarding the quality of food, it has been necessary to develop processes that meet the demands of consumers. Within the existing processes the cold chain and irradiation stand out. The cold chain comprises all the stages of conserving food from production, cooling, freezing, storing and transportation to the final consumer. Irradiation, as a means of conserving food, prolongs the shelf life, inhibits budding and reduces pathogenic contamination among other benefits. Is very important the identification of food degradation in function of failure on the processes which they were subjected. The comet assay is a screening test widely studied, considerate fast and with low cost. By the fact of the test identify breaks on the DNA, may be possible use the comet test on the control of cold chain failures that degrade de food. The labels and stamp, do not consider the previous food situation and indicate failures from the moment where they be placed in contact with the product. With the comet assay is possible to check the degradation that has occurred in liver chicken samples until the moment of comet's test realization. (author)

  19. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  20. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  1. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  2. 食品中化脓链球菌的PCR检测方法的建立%Establishment of Polymerase Chain Reaction Assay for Detection of Streptococcus Pyogenes in Food Products

    Institute of Scientific and Technical Information of China (English)

    杨学明; 巢强国; 葛宇; 熊薇; 曲勤凤

    2008-01-01

    化脓链球菌是一种常见的食源性致病菌,从19世纪80年代起,化脓链球菌引起的感染在全球范围内呈逐步上升之势并发展成为人类重要致病茵之一.通过已公布的13株化脓链球菌的基因组序列找出具有种特异性的基因序列.运用BLAST(Basic Local Alignment Search Tool,基本局部比对工具)在GenBank中进行序列对库的比对结果表明:化脓链球菌的某些基因(SmeZ,emm,spyM51755)具有种特异性.以这些基因为目的基因,共设计七对引物.经PCR(Polymerase Chain Reaction,聚合酶链式反应)检测发现spvM引物对(spyM51755F,spyM51755R)具有很高的特异性.利用该引物对,建立可快速且灵敏地检测食品中化脓链球菌的PCR方法,其灵敏度达到10 cfu/g样品.

  3. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    1993-01-01

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  4. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    Science.gov (United States)

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  5. Immunoglobulin heavy chain/light chain pairs (HLC, Hevylite™) assays for diagnosing and monitoring monoclonal gammopathies.

    Science.gov (United States)

    Kraj, Maria

    2014-01-01

    Immunofixation (IFE) is a standard method for detecting monoclonal immunoglobulins and characterizing its isotype. Recently clonality can also be determined by using immunoglobulin (Ig) heavy chain/light chain immunoassays - HLC, HevyliteTM. HLC separately measures in pairs light chain types of each intact Ig class generating ratios of monoclonal Ig/uninvolved polyclonal Ig concentrations. Studies have shown that HLC and IFE are complementary methods. HLC assays quantify monoclonal proteins and identify monoclonality. It is possible to predict prognosis in multiple myeloma and to monitor response to treatment using HLC ratio. HLC ratio may serve as a parameter for myeloma induced immunoparesis and serve as a new marker for validating remission depth and relapse probabilities.

  6. A chain reaction approach to modelling gene pathways.

    Science.gov (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  7. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients.

    Directory of Open Access Journals (Sweden)

    Sirirat Seekhuntod

    Full Text Available Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC. The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR assay to detect KRAS mutations.We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D. We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay.Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%, G12D (25.83% and G12V (12.50% in codon 12.The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues.

  8. A noncontact temperature measurement method in polymerase chain reaction reactors

    Science.gov (United States)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  9. Comparison of Polymerase Chain Reaction, Culture and Serologic Assays for Diagnosis of Pertussis%聚合酶链反应和细菌培养及血清学方法诊断百日咳的比较研究

    Institute of Scientific and Technical Information of China (English)

    袁林; 俞桑洁; 姚开虎; 欧金玲; 王丽; 张庶民; 徐颖华; 沈叙庄; 杨永弘

    2012-01-01

    目的 应用聚合酶链反应(Polymerase Chain Reaction,PCR)、细菌培养和血清学方法诊断百日咳,比较阳性率的差异.方法 分别应用细菌培养、血清学和PCR方法,检测86例疑似百日咳患者鼻咽拭子和血清标本中百日咳杆菌或其特异抗体、基因.结果 在86例疑似百日咳患者鼻咽拭子标本中,分离培养出百日咳杆菌5例,阳性率5.8%;8份血清抗体增高,阳性率为9.3%;15例PCR检测阳性,阳性率为17.4%,PCR方法与细菌培养、血清学方法阳性率的差异有统计学意义(P<0.001).PCR方法与细菌培养的符合率为88.37%,与血清学方法的符合率为91.86%.经细菌培养和血清学方法判定为阳性患者的标本,PCR方法均为阳性.结论 与细菌培养、血清学方法相比,PCR方法可提高百日咳感染的检出率,缩短检测时间.%Objective To compare polymerase chain reaction, culture and serologic assays for diagnosis of pertussis. Methods Nasopharyngeal swabs from 86 patients were taken for bacterial culture and polymerase chain reaction (PCR) analysis, while the titres of anti-pertussis toxin (PT) immunoglobulin (Ig) G in the serum samples were determined. The positive rates of three methods were analyzed statistically. Results 5 Bordetella pertussis was isolated from 86 swab specimens by culture, while 8 case of sero-positive in the sera sample from patients were found. Of the 86 swab samples, 15 were PCR positive. The positive rate of PCR was 17.4%, which is higher than that of culture and serologic assays (P<0.001). The compliance of PCR and culture was 88.37%, that of PCR and serologic assays was 91.86%. All samples from culture-or sero-positive patients were PCR positive. Conclusion Compared with culture and serologic assays, PCR assay is quick and sensitive for diagnosis of pertussis, which will improve the way of quick diagnosis and treatment of pertussis.

  10. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Science.gov (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents.

  11. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.;

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The...... selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  12. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  13. Polymerase chain reaction-based molecular diagnosis of cutaneous infections in dermatopathology.

    Science.gov (United States)

    Swick, Brian L

    2012-12-01

    Conventional methods, including microscopy, culture, and serologic studies, are a mainstay in the diagnosis of cutaneous infection. However, owing to limitations associated with these techniques, such as low sensitivity for standard microscopy and in the case of culture delay in diagnosis, polymerase chain-reaction based molecular techniques have taken on an expanding role in the diagnosis of infectious processes in dermatopathology. In particular, these assays are a useful adjunct in the diagnosis of cutaneous tuberculosis, atypical mycobacterial infection, leprosy, Lyme disease, syphilis, rickettsioses, leishmaniasis, and some fungal and viral infections. Already in the case of tuberculosis and atypical mycobacterial infection, standardized polymerase chain-reaction assays are commonly used for diagnostic purposes. With time, additional molecular-based techniques will decrease in cost and gain increased standardization, thus delivering rapid diagnostic confirmation for many difficult-to-diagnose cutaneous infections from standard formalin-fixed paraffin-embedded tissue specimens.

  14. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay

    Energy Technology Data Exchange (ETDEWEB)

    Roeder, Martin; Vieths, Stefan [Division of Allergology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, 63225 Langen (Germany); Holzhauser, Thomas, E-mail: holth@pei.de [Division of Allergology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, 63225 Langen (Germany)

    2011-01-24

    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg{sup -1} almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg{sup -1}. We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg{sup -1} almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg{sup -1}. Further, between 100 and 100,000 mg kg{sup -1} spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n = 5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a

  15. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  16. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.

    Science.gov (United States)

    Matsuda, Kazuyuki; Honda, Takayuki

    2015-01-01

    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  17. In Vitro Ubiquitination: Self-Ubiquitination, Chain Formation, and Substrate Ubiquitination Assays.

    Science.gov (United States)

    Maspero, Elena; Polo, Simona

    2016-01-01

    Ubiquitination of proteins in vitro has evolved as an indispensable tool for the functional analysis of this posttranslational modification. In vitro ubiquitination is particularly helpful to study conjugation mechanisms. The efficiency of the ubiquitination reaction depends in part on the quality of the enzymes utilized. Here we introduce the assay developed in our lab to study HECT E3 ligases. It involves bacterially expressed E1, His-tagged Ube2D3 (also called UbcH5c, the best E2 for Nedd4), untagged Nedd4, and untagged ubiquitin (Ub). As tags may impair specific activity of the enzymes or even interfere with the enzymatic reaction, they should be avoided, removed, or kept to a minimal size whenever possible, unless proven to be without consequence. The protocol described here is suitable for other E3 ligases capable of forming Ub chains as pseudo-product of the enzyme reaction. It is also adapted to include substrates. In this case, substrates should be tagged and purified after the reaction is completed to allow the detection of the ubiquitinated products. PMID:27613033

  18. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    Science.gov (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  19. Specific detection of the toxic shock syndrome toxin-1 gene using the polymerase chain reaction.

    Science.gov (United States)

    Jaulhac, B; Prevost, G; Piemont, Y

    1991-08-01

    A rapid and specific assay for toxic shock syndrome toxin-1 gene (tst gene) detection in Staphylococcus aureus was developed using the polymerase chain reaction. A two-primer set and an oligonucleotide detection probe were synthesized. After 40 cycles of amplification, detection of a 160-bp amplified DNA fragment was carried out by agarose gel electrophoresis and Southern blot hybridization. This assay was sensitive since it was able to detect 1-10 bacteria. It was also specific since no amplification was documented with DNAs from enterotoxigenic S. aureus or Gram-negative bacteria devoid of the tst gene.

  20. The generalised self-sustaining chain reaction theory about ADS

    International Nuclear Information System (INIS)

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  1. Detection of Listeria monocytogenes by using the polymerase chain reaction

    International Nuclear Information System (INIS)

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  2. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  3. [The contamination under polymerase chain reaction studies: problems and solutions].

    Science.gov (United States)

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  4. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    Science.gov (United States)

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  5. Mathematics analysis of polymerase chain reaction kinetic curves.

    Science.gov (United States)

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V

    2016-01-01

    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  6. 痰标本甲氧西林耐药金黄色葡萄球菌培养与聚合酶链反应快速检测方法的比较%Detection of methicillin-resistant S . aureus from respiratory specimens of ICU patients by conventional sputum culture compared with rapid polymerase chain reaction assay

    Institute of Scientific and Technical Information of China (English)

    沈蕾; 骆俊; 施宏; 祝禾辰

    2015-01-01

    Objective To evaluate the performance of polymerase chain reaction (PCR)‐based rapid detection of methicillin‐resistant S .aureus (MRSA) from the respiratory specimens of ICU patients in comparison with conventional sputum culture . Methods We collected 3 respiratory specimens from each patient simultaneously for bacterial culture ,fungal culture and PCR‐based detection of MRSA .The performance of the established PCR method was compared with the results of sputum culture in terms of sensitivity ,specificity ,positive predictive value (PPV) and negative predictive value (NPV) .Results The sensitivity , specificity ,PPV and NPV of PCR assay were 88 .9% ,73 .6% ,36 .4% ,and 97 .5% ,respectively ,which were lower than the reported results of PCR assay with nasal swabs .Conclusions The utility of PCR assay for active screening of MRSA from respiratory specimens still needs further supportive data .However ,PCR assay is somewhat informative in excluding MRSA infection or colonization because of its high NPV .%目的:评价聚合酶链反应(PCR)快速检测耐甲氧西林金黄色葡萄球菌(MRSA)方法在痰标本中的应用。方法同时采集痰标本送细菌培养、真菌培养和 PCR快速检测,以细菌培养方法为金标准,评价 PCR方法的灵敏度和特异度。结果PCR方法检测痰标本M RSA的灵敏度为88.9%,特异度为73.6%,阳性预测值为36.4%,阴性预测值为97.5%,均较文献报道的鼻拭子PCR的灵敏度和特异度低。结论将痰标本 PCR检测 M RSA用于临床动态监测 M RSA的流行尚缺乏进一步的数据支持,但 PCR结果不受其他细菌生长的影响,而且阴性预测值高达97.5%,在排除 M RSA感染或定植方面有一定价值。

  7. Detecting ricin: sensitive luminescent assay for ricin A-chain ribosome depurination kinetics.

    Science.gov (United States)

    Sturm, Matthew B; Schramm, Vern L

    2009-04-15

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic rRNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of the elongation factor binding site resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small stem-loop RNAs by RTA catalysis. Adenine phosphoribosyl transferase (APRTase) and pyruvate orthophosphate dikinase (PPDK) convert adenine to ATP for quantitation by firefly luciferase. The resulting AMP is cycled to ATP to give sustained luminescence proportional to adenine concentration. Subpicomole adenine quantitation permits the action of RTA on eukaryotic ribosomes to be followed in continuous, high-throughput assays. Facile analysis of RIP catalytic activity will have applications in plant toxin detection, inhibitor screens, mechanistic analysis of depurinating agents on oligonucleotides and intact ribosomes, and in cancer immunochemotherapy. Kinetic analysis of the catalytic action of RTA on rabbit reticulocyte 80S ribosomes establishes a catalytic efficiency of 2.6 x 10(8) M(-1) s(-1), a diffusion limited reaction indicating catalytic perfection even with large reactants. PMID:19364139

  8. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维

    2003-01-01

    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  9. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.

    OpenAIRE

    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S

    1996-01-01

    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  10. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  11. Identification of related DNA sequences in Borrelia burgdorferi and two strains of Leptospira interrogans by using polymerase chain reaction.

    OpenAIRE

    Kron, M A; Gupta, A; Mackenzie, C. D.

    1991-01-01

    The suitability of a polymerase chain reaction assay for Borrelia burgdorferi in epidemiological studies of infected tick populations was evaluated by using 28 strains of Leptospira interrogans and lysates of fixed adult Ixodes tick tissues. Two false positives representing leptospires were differentiated from B. burgdorferi by using an oligonucleotide probe.

  12. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  13. Reaction chain modeling of denitrification reactions during a push-pull test

    Science.gov (United States)

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.

    2013-05-01

    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  14. Identification of duck plague virus by polymerase chain reaction

    Science.gov (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  15. Convective polymerase chain reaction around micro immersion heater

    Science.gov (United States)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  16. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. (Univ. of Illinois, Chicago (USA)); Wunder, J.S.; Andrulis, I.L. (Mount Sinai Hospital, Toronto, Ontario (Canada)); Gazdar, A.F. (National Cancer Inst., Bethesda, MD (USA)); Willman, C.L.; Griffith, B. (Univ. of New Mexico, Albuquerque (USA)); Von Hoff, D.D. (Univ. of Texas, San Antonio (USA))

    1990-09-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  17. Robust quantification of polymerase chain reactions using global fitting.

    Directory of Open Access Journals (Sweden)

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  18. Single-species reactions on a random catalytic chain

    Energy Technology Data Exchange (ETDEWEB)

    Oshanin, G [Laboratoire de Physique Theorique des Liquides, Universite Paris 6, 4 Place Jussieu, 75252 Paris (France); Burlatsky, S F [United Technologies Research Center, United Technologies Corporation, 411 Silver Lane, 129-21 East Hartford, CT (United States)

    2002-11-29

    We present an exact solution for a catalytically activated annihilation A+A {yields} 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P{sup (quen)} per site of such a chain is given by P{sup (quen)} P{sup (Lan)} + {beta}{sup -1}F, where P{sup (Lan)}={beta}{sup -1} ln(1+z) is the Langmuir adsorption pressure, (z being the activity and {beta}{sup -1} the temperature), while {beta}{sup -1}F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2x2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented. (letter to the editor)

  19. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    International Nuclear Information System (INIS)

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  20. A polymerase chain reaction protocol for the detection of various geographical isolates of white spot virus.

    Science.gov (United States)

    Tapay, L M; Nadala, E C; Loh, P C

    1999-09-01

    Polymerase chain reaction (PCR) primers were designed based on the sequence of a cloned fragment of the white spot virus (WSV) genome and were used to detect at least four geographic isolates of WSV from both experimentally- and naturally-infected shrimp. In addition to high specificity, the one-step and two-step PCR protocols were determined to have sensitivities of 10-100 pg and 100 femtograms respectively. The two-step PCR protocol is recommended as a very sensitive and specific alternative protocol to Western blot assay for the detection of WSV.

  1. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.

    OpenAIRE

    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J

    1992-01-01

    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...

  2. Automated polymerase chain reaction in capillary tubes with hot air.

    Science.gov (United States)

    Wittwer, C T; Fillmore, G C; Hillyard, D R

    1989-06-12

    We describe a simple, compact, inexpensive thermal cycler that can be used for the polymerase chain reaction. Based on heat transfer with air to samples in sealed capillary tubes, the apparatus resembles a recirculating hair dryer. The temperature is regulated via thermocouple input to a programmable set-point process controller that provides proportional output to a solid state relay controlling a heating coil. For efficient cooling after the denaturation step, the controller activates a solenoid that opens a door to vent hot air and allows cool air to enter. Temperature-time profiles and amplification results approximate those obtained using water baths and microfuge tubes.

  3. Simultaneous Removal of Multiple DNA Segments by Polymerase Chain Reactions.

    Science.gov (United States)

    Krishnamurthy, Vishnu; Zhang, Kai

    2017-01-01

    Precise DNA manipulation is a key enabling technology for synthetic biology. Approaches based on restriction digestion are often limited by the presence of certain restriction enzyme recognition sites. Recent development of restriction-free cloning approaches has greatly enhanced the flexibility and speed of molecular cloning. Most restriction-free cloning methods focus on DNA assembly. Much less work has been dedicated towards DNA removal. Here we introduce a protocol that allows simultaneous removal of multiple DNA segments from a plasmid using polymerase chain reactions (PCR). Our approach will be beneficial to applications in multiple sites mutagenesis, DNA library construction, genetic and protein engineering, and synthetic biology. PMID:27671942

  4. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  5. APPLICATION OF POLYMERASE CHAIN REACTION FOR DIAGNOSING AMEBIC LIVER ABSCESS

    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏

    1996-01-01

    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  6. 肉制品中牛源性成分荧光定量聚合酶链式反应方法的建立与应用%Establish and Application of a Real-Time Fluorescence-Based Polymerase Chain Reaction Assay for Detection of Bovine-Derived Materials in Meat Products

    Institute of Scientific and Technical Information of China (English)

    苗丽; 李志娟; 王珊; 张秀平; 陈静

    2015-01-01

    A real-time fluorescence-based polymerase chain reaction (PCR) assay that enables rapid and accurate identification of adulterated beef products was developed usingTaqMan probe for the rapid and effective detection of bovine-derived materials in meat products. A pair of specific primers andTaqMan probe was designed according to the conserved sequence of the bovine β-actingene. PCR reaction conditions were optimized using pMD-18T-96-beef plasmid as standard. The results showed that the pMD-18T-96-beef plasmid was confirmed to be valid by PCR, sequencing and enzyme digestion and the developed standard curve produced a good linear relationship betweenCt value and initial amounts of total DNA with correlation coefficient and slope of 0.98 and−3.345, respectively. The sensitivity was 46.1 copies/µL. No cross-reactions were found in specimens containing pork, mutton, chicken, duck and goose. The intra- and inter-assay variable coefficients were less than 0.98% and 0.33%, respectively, suggesting good repeatability. A total of 40 beef product samples from the market were measured by this method and the routine real-time PCR method from the industry standard SN/T 2051—2008. Of the 40 samples, 3 were detected as positive as consistently indicated by the two assays. This real-time PCR method with strong specificity and high sensitivity could provide a useful approach for the identification of meat adulteration.%为了能够快速准确检测出市场中掺假牛肉制品,采用TaqMan探针法,建立一种用于快速有效检测牛肉制品中牛源性成分的荧光定量聚合酶链式反应(polymerase chain reaction,PCR)方法。选择GenBank中牛β-actin基因的保守序列,设计并合成特异性引物及TaqMan探针,以构建的pMD-18T-96-beef质粒为标准品,优化反应条件。结果表明:重组质粒标准品经PCR、测序和酶切鉴定正确,建立的标准曲线Ct值与模板拷贝数对数值之间呈良好的线

  7. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  8. DETECTION OF PATHOGENS CAUSING GENITAL ULCER DISEASE BY MULTIPLEX POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    Ai-ying Liu; Ming-jun Jiang; Yue-ping Yin; Jiang-fang Sun

    2005-01-01

    Objective To establish a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of pathogens causing genital ulcer disease (GUD).Methods Based on the gene-specific region of the following pathogens: Chlamydia trachomatis ompl/ompb, herpes simplex virus (HSV) DNA polymerase, Treponema pallidum tpp47, Haemophilus ducreyi 16s rRNA, four sets of primers were designed and an M-PCR assay was developed to detect four pathogens in one test. The assay was evaluated with diagnostic result of golden standard for each pathogen.Results Of the 51 clinical samples, M-PCR showed slightly higher positive rate (47.1%) of HSV than cell culture (23.6%).Meanwhile, the positive rate of T. p allidum detected by M-PCR and dark-field microscopy was 19.6% ( 10/51) and 15.7% (8/51),respectively. Only one sample was positive for H. ducreyiand no sample was positive for C. trachomatis detected by both M-PCR assay and culture.Conclusion This primary study indicated that M-PCR assay can simultaneously and rapidly detect the four etiologic pathogens causing GUD.

  9. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  10. A multisubstrate assay for lipases/esterases: assessing acyl chain length selectivity by reverse-phase high-performance liquid chromatography.

    Science.gov (United States)

    Divakar, K; Gautam, Pennathur

    2014-03-01

    Lipases and esterases are hydrolytic enzymes and are known to hydrolyze esters with unique substrate specificity and acyl chain length selectivity. We have developed a simple competitive multiple substrate assay for determination of acyl chain length selectivity of lipases/esterases using RP-HPLC with UV detection. A method for separation and quantification of 4-nitrophenyl fatty acid esters (C4-C18) was developed and validated. The chain length selectivity of five lipases and two esterases was determined in a multisubstrate reaction system containing equimolar concentrations of 4-nitrophenyl esters (C4-C18). This assay is simple, reproducible, and a useful tool for determining chain length selectivity of lipases/esterases. PMID:24316114

  11. Nested methylation-specific polymerase chain reaction cancer detection method

    Science.gov (United States)

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  12. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  13. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  14. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed

    2012-03-01

    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  15. Detection of Vibrio Cholerae in Turtles by Real Time Polymerase Chain Reaction, Colloidal Gold Immunochromatographic Assay and Conventional Bacterial Culture%实时荧光PCR法、胶体金法和培养法检测甲鱼中霍乱弧菌

    Institute of Scientific and Technical Information of China (English)

    颜淑妩; 李哲婷; 邓婵

    2012-01-01

    目的 优化水产品甲鱼中霍乱弧菌的检测程序,提高甲鱼中霍乱弧菌检出率.方法 用实时荧光PCR、常规细菌培养、胶体金法同时对甲鱼中霍乱弧菌进行检测,并用实时荧光PCR法检测标本中霍乱弧菌ctx基因.结果 共检测185份甲鱼样品,其中实时荧光PCR法检出28份霍乱弧菌核酸阳性,阳性率为15.14%;6份ctx基因核酸阳性,阳性率21.43% (6/28).常规细菌培养法分离出2株菌株,一株为O139群霍乱弧菌,一株为小川型霍乱弧菌,用实时荧光PCR检测这两株纯培养菌株或原始标本,霍乱弧菌ctx基因均为阴性;胶体金法未检出阳性标本.结论 对于水产品标本,可先用实时荧光PCR法筛检霍乱弧菌,阳性标本再进行传统细菌分离培养,以提高霍乱弧菌菌株的检出率;同时阳性标本进行霍乱弧菌ctx基因核酸检测,如也为阳性,需提高警惕,加强流行病学上的预防控制措施,及时防范霍乱疫情的发生.%Objective To optimize the detection procedure of Vibrio Cholerae (v. cholerae) and increase its detection rate in turtles. Methods The v. cholerae in turtles was detected by real time polymerase chain reaction (real time PCR), conventional bacterial culture and colloidal gold immunochrornatographic assay, and the ctx gene of the virus was detected by real time PCR. Results Real time PCR revealed that among 185 turtle samples, 28 ones were positive with v. cholerae nucleic acid, with a positive rate of 15.14% (28/185), and six samples were positive with ctx gene, with a positive rate of 21.43% (6/ 28). Two strains of v.cholerae were isolated by conventional bacterial culture, Vibrio cholerae O139, and Vibrio cholerae Ol serotype Ogawa. Neither the pure cultures nor the original samples of both stains were positive with ctx gene. No v. cholerae was detected by colloidal gold immunochromatugraphic assay. Conclusions For V. cholerae detection in seafood samples, real time PCR can be first used for

  16. International Ring Trial for the Validation of an Event-Specific Golden Rice 2 Quantitative Real-Time Polymerase Chain Reaction Method

    OpenAIRE

    JACCHIA SARA; NARDINI ELENA; BASSANI NICCOLO; SAVINI Cristian; SHIM Jung-Hyun; TRIJATMIKO Kurniawan; KREYSA JOACHIM; Mazzara, Marco

    2014-01-01

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3′ junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in...

  17. Detection of hepatitis C virus sequences in sera with controversial serology by nested polymerase chain reaction.

    Science.gov (United States)

    Lazizi, Y; Elfassi, E; Pillot, J

    1992-04-01

    The specificity of first-generation enzyme-linked immunosorbent assays (ELIAs) for antibody detection in individuals with hepatitis C virus (HCV) infection has been questioned in some pathological situations. We observed a surprisingly high prevalence of anti-HCV antibodies in alcoholic patients, and thus, false-positive reactions in anti-HCV tests were strongly suspected. The introduction of new epitopes, particularly a core protein, C22 (second-generation tests), seems to increase the sensitivity of anti-HCV detection. In order to study the specificity of the second-generation tests, 60 serum samples from alcoholic patients found to be positive by the first-generation anti-HCV ELISA (Ortho) were reexamined by a second-generation anti-HCV enzyme immunoassay (Abbott) and a recombinant immunoblot assay (RIBA II; Chiron). Fifteen serum samples gave contradictory results when they were tested by the two assays. We performed nested polymerase chain reactions (PCRs) to confirm that the discrepancies that we observed could be due to the presence of low levels of anti-HCV antibodies, which were detected by a more sensitive test, or to unspecific positive reactions. Nested PCR revealed the presence of HCV RNA sequences in all anti-HCV-positive sera or sera that were weakly positive by ELISA. Anti-HCV positive by RIBA II was always correlated with the presence of viral RNA in serum, but HCV RNA was detected in RIBA II-negative sera. These results indicate that the specificity of the second-generation tests is an important improvement but that an HCV infection can still persist without detectable antibodies. PCR remains the reference assay to clear up controversial serology results and to detect HCV infection in patients with no anti-HCV-detectable immune response. PMID:1315339

  18. 沙门氏致病菌标准阳性模板的构建及实时荧光定量聚合酶链式反应检测%Construction of Standard Positive Template and Development of a Real-Time Fluorescence Quantitative Polymerase Chain Reaction (FQ-PCR) Assay for PathogenicSalmonella spp.

    Institute of Scientific and Technical Information of China (English)

    陈晨; 邵彪; 陈刚; 黄伟东

    2014-01-01

    Objective: To construct recombinant plasmids for use as standard positive template and establish a real-time fluorescent quantitative polymerase chain reaction (FQ-PCR) assay for determining pathogenicSalmonellaspp. in foods. Methods: Primers and Taqman probe were designed and synthesized with the specific fragment of InvA gene as the target sequence. Recombinant plasmids were constructed by inserting the target gene into PGM-T carriers. Real-time fluorescent quantitative PCR method was established and its sensitivity, specificity, repeatability and accuracy were investigated. Results: The recombinant plasmids constructed using the specific sequence of pathogenicSalmonella spp. could be used as a standard positive template for fluorescent quantitative PCR. The standard curve wasY=-3.151 lgX+42.86 (R2=0.999), and the sensitivity of the method was 80 copies per reaction. It was specific to detect Salmonellaspp. with good repeatability (the inter-batch and intra-batch coefficients of variation were both less than 5%). Conclusion: The FQ-PCR method allows qualitative and quantitative detection of pathogenicSalmonellaspp.%目的:构建重组质粒作为标准阳性模板,建立食品中沙门氏致病菌实时荧光定量聚合酶链式反应检测方法。方法:以致病性沙门氏菌invA基因上特异性片段为目标,设计并合成引物和TaqMan探针,将目标片段连接到PGM-T载体上构建重组质粒,建立实时荧光定量检测体系,并考察方法的灵敏性、特异性、重复性和准确性。结果:构建出致病性沙门氏菌特异性基因片段的重组质粒,能够作为实时荧光定量聚合酶链式反应检测方法的标准阳性模板,标准曲线方程为Y=-3.151 lgX+42.86(R2=0.999),灵敏度80拷贝反应体系,能特异区分沙门氏菌与类型的细菌,同时,批内和批间的变异系数均小于5%,具有良好的重复性。结论:本方法能够实现对食品

  19. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    Science.gov (United States)

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  20. Controlling Hybridization Chain Reactions with pH.

    Science.gov (United States)

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco

    2015-08-12

    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  1. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    Science.gov (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  2. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction

    OpenAIRE

    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.

    2009-01-01

    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  3. Detecting Ricin: A Sensitive Luminescent Assay for Ricin A-chain Ribosome Depurination Kinetics+

    OpenAIRE

    Sturm, Matthew B.; Schramm, Vern L.

    2009-01-01

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic ribosomal RNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of elongation factor binding resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small ...

  4. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail: dianping.tang@fzu.edu.cn

    2013-06-14

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  5. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    OpenAIRE

    2012-01-01

    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  6. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  7. Clinical Application and Evaluation of Polymerase Chain Reaction-Mic rowell Plate Hybridization Assay in the Detection of Mycobacterium tuberculosis%聚合酶链反应-微孔板杂交法检测结核杆菌的临床应用及其评价

    Institute of Scientific and Technical Information of China (English)

    杨正林; 傅明德; 杜琼; 杨明清; 乔国蓉; 唐蓉

    2001-01-01

    目的 对聚合酶链反应(PCR)-微孔板杂交法检测结核杆菌的临床适用性和可行性进行评价。方法 收集1130份临床标本,分别用抗酸染色、培养、PCR电泳及PCR微孔板杂交法进行结核杆菌检测,并结合临床诊断和疗效观察对实验结果进行分析。结果 100份临床证实无结核病的体液标本经抗酸染色和PCR电泳,分别有1例和2例假阳性,但经培养和PCR微孔板杂交法未查出阳性;其余1030份高度怀疑含有结核杆菌的体液标本的检测结果,以PCR微孔板杂交阳性检出例数最高(481/1030),其次为PCR电泳(406/1030)、培养(365/1030)以及抗酸染色(256/1030);χ2检验结果显示,PCR微孔板杂交的结核杆菌阳性检出例数与其它三种方法比较均呈显著或极显著性差异(P<0.0083及P<0.0017)。结论 PCR-微孔板杂交方法是特异、灵敏、准确、快速的结核杆菌检测方法,具有推广应用价值。%Objective To evaluate the clinical application an d feasibilityof polymerase chain reaction-microwell plate hybridization assay in the detection of M ycobacterium tuberculosis. Methods 1130 specimens with strong s uspicion for myc obacterium tuberculosis were collected from the hospitals and were detected by fast bacilli stain,culture,PCR-electrophoresis and PCR-microwell plate hybridi za tion respectively. The laboratory results were analyzed in combination with the symptoms and signs of patients and the observations on treatment.Also detected were 100 samples from the clinically evidenced non-tuberculosis patients. Results In the 100 samples collected from the patients without tuber culosis, the PCR- h ybridization method and culture method did not detect Mycobacterium tuberculosis , but the fast bacilli stain method and PCR-electrophoresis method brought out o ne and two false-positive results respectively. The results of testing the 1030 clinical samples which probably contained

  8. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  9. Fluorescence-based temperature control for polymerase chain reaction.

    Science.gov (United States)

    Sanford, Lindsay N; Wittwer, Carl T

    2014-03-01

    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  10. Monitoring infection: from blood culture to polymerase chain reaction (PCR).

    Science.gov (United States)

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank

    2013-06-01

    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  11. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  12. Analysis of human cytomegalovirus using the polymerase chain reaction.

    Science.gov (United States)

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  13. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  14. Identifying of meat species using polymerase chain reaction (PCR)

    Science.gov (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  15. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Science.gov (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  16. Laboratory reporting accuracy of polymerase chain reaction testing for avian polyomavirus.

    Science.gov (United States)

    Fitzgerald, Brenna; Olsen, Geoff; Speer, Brian

    2013-03-01

    Polymerase chain reaction (PCR) assays are available for detection of birds infected with avian polyomavirus (APV). Several laboratories offer this diagnostic assay in the United States, but little information is available regarding assay sensitivity, specificity, and accuracy. In this study, known APV-positive and APV-negative samples (each n = 10, 5 undiluted and 5 diluted) were sent to 5 commercial laboratories. A significant difference in reporting accuracy was found among laboratories, most notably for dilute APV-positive samples. Two out of 5 laboratories provided 100% accurate results, 1 had an accuracy of 90%, and 2 reported 80% and 75% accuracy, respectively. The accuracies of the last 2 laboratories were negatively affected by test sensitivities of 60% and 50%, respectively. These findings show that although accurate results were reported by most laboratories, both false-positive and false-negative results were reported by at least 3 laboratories, and false-negative results reported for dilute APV-positive samples predominated. These study findings illustrate a need for veterinary diagnostic laboratories to institute improved voluntary quality control measures.

  17. Diagnosis of Streptococcus pneumoniae meningitis by polymerase chain reaction amplification of the gene for pneumolysin

    Directory of Open Access Journals (Sweden)

    Juliana de A Matos

    2006-08-01

    Full Text Available Diagnosis of bacterial meningitis has long been based on classical methods of Gram stain, serological tests, and culture of cerebrospinal fluid (CSF. The performance of these methods, especially culture and direct smear, is thwarted by failure to detect bacteria following administration of antimicrobial agents and reluctance to performance lumbar punctures at admission. Indeed, patients with meningitis frequently receive antibiotics orally or by injection before the diagnosis is suspected or established. Thus an alternative method has become necessary to help clinicians and epidemiologists to management and control of bacterial meningitis. We evaluate the application of a polymerase chain reaction-based (PCR assay for amplification of pneumolysin gene (ply to diagnosis of Streptococcus pneumoniae meningitis. The PCR assay sensitivity for CSF was 96% (95% confidence interval, CI, 90-99% compared to a sensitivity of 59% for culture (95% CI 49-69%, 66% for Gram stain (95% CI 56-74%, and 78% for latex agglutination test (95% CI 69-86%; PCR specificity was 100% (95% CI 83-100%. PCR results were available within 4 h of the start of the assay. This molecular approach proved to be reliable and useful to identify this bacterium compared with other classical laboratory methods for identification of bacterial meningitis pathogens.

  18. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  19. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou

    2008-01-01

    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  20. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  1. Treponema pallidum and Haemophilus ducreyi DNA detection by A Multi-Nested Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    郑和平; SylviaBruisten; 何玉山; 黄进梅; 吴兴中

    2004-01-01

    Objectives: To develop a multi-nested polymerase chain reaction in an assay to detect early Treponema pallidum and Haemophilus ducreyi DNA in the swabs of genital ulcers. Methods: Four pairs of outer and inner primers, specific to the basic membrane protein gene of Treponema pallidum and to the 16s rRNA gene of H ducreyi were synthesized. The multi-nested PCR was developed and applied to detect Treponema pallidum and Haemophilus dicreyi in clinical swabs. Result: The two samples of standard strains of Haemophilus ducreyi and one Treponema pallidum were amplified and showed 309-bp rRNA gene of Haemophilus ducreyi and 506-bp DNA of Treponema palidum, respectively. Out of 51 samples of genital ulcer detected, 29 showed Treponemapallidum positive product and noHaemophilus ducreyi DNA was found. Conclusion: The multi-nested PCR for Treponema pallidum and Haemophilus ducreyi could be useful for early detection and distinguishing diagnosis between syphilis and chancroid.

  2. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  3. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  4. Gadolinium-neutron capture reactions: A radiobiological assay

    International Nuclear Information System (INIS)

    Gadolinium neutron capture(GNC) takes advantage of its extraordinarily large cross section to thermal neutrons. In GNC reactions, prompt high energy gamma rays, x-rays and electrons are released. Because of the photons and electrons, the intracellular presence of gadolinium is not considered critical. This is an advantage over boron-neutron capture therapy where the intracellular presence of boron is required because of the short flight tracks of 2.4 MeV alpha particles. In this study, the radiation effect of GNC reactions was measured using Chinese hamster cells in an attempt to evaluate the contributions of neutrons, gamma rays and electrons on cell inactivation

  5. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  6. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  7. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  8. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Directory of Open Access Journals (Sweden)

    Mohammad Soleimani

    2010-01-01

    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  9. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S

    2015-09-01

    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  10. Redox-Reaction Based Spectrophotometric Assay of Isoniazid in Pharmaceuticals

    OpenAIRE

    N Swamy; K. N. Prashanth; K. Basavaiah

    2014-01-01

    Two spectrophotometric methods are described for the determination of isoniazid (INH) in pharmaceuticals. In the first method (FCR method), INH is reacted with Folin-Ciocalteu reagent in Na2CO3 medium and the resulting blue colored chromogen measured at 760 nm. Iron(II), formed as a result of reaction between INH and iron(III), is made to react with ferricyanide, and the resulting Prussian blue is measured at 760 nm, basing the second method (FFC method). The conditions for better performance...

  11. Rapid detection of mecA and nuc genes in staphylococci by real-time multiplex polymerase chain reaction.

    Science.gov (United States)

    Costa, Anna-Maria; Kay, Ian; Palladino, Silvano

    2005-01-01

    A multiplex real-time polymerase chain reaction (RT-PCR) targeting the mecA and nuc genes was developed for the detection of methicillin resistance and identification of Staphylococcus aureus. Novel mecA and nuc primers and fluorescence resonance energy transfer hybridization probes specific for the mecA and nuc genes were evaluated. The assay was performed using the LightCycler system (Roche Molecular Biochemicals, Mannheim, Germany) and evaluated against the traditional gel-based multiplex PCR (PCR-gel) method currently used at Royal Perth Hospital. Clinical isolates (n = 222) and isolates from a culture collection library (n = 206) were tested by both assays in parallel. The RT-PCR assay was 100% sensitive and specific for the detection of methicillin resistance and for the identification of S. aureus when compared with the PCR-gel assay. Results from the RT-PCR assay showed 5 isolates with lower efficiency fluorescence curves for the nuc gene PCR fragment. DNA sequencing showed mutations within the region of the probe-binding sites compared with the reference strain. The results of the RT-PCR assay were available within 2 h. This rapid mecA/nuc RT-PCR assay is a suitable and practical tool for the routine detection of methicillin resistance and identification of S. aureus, which can be easily incorporated into the diagnostic molecular microbiology laboratory work flow.

  12. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: ruark@126.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: zhouximi@yahoo.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)

    2012-03-09

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  13. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie;

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  14. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte;

    2012-01-01

    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...

  15. Quantification of Staphylococcus aureus and Staphylococcus epidermidis on the hands of health-care workers using a real-time polymerase chain reaction method

    DEFF Research Database (Denmark)

    Horn, P; Schouenborg, P Øland; Brandslund, I

    2007-01-01

    OBJECTIVE: The objective of this study was to test a polymerase chain reaction (PCR) assay intended as a tool for monitoring hand hygiene in hospital wards. METHODS: The hands of 20 health-care workers were sampled for 10 days using real-time PCR for quantification of Staphylococcus aureus and S...

  16. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  17. 多重荧光定量PCR方法的建立及其在快速产前诊断中的应用%Establishment of multiple quantitative fluorescent polymerase chain reaction assay and its application in rapid prenatal diagnosis of common chromosome aneuploidies

    Institute of Scientific and Technical Information of China (English)

    徐爱群; 边旭明; 刘俊涛; 姚凤霞; 张为民; 郝娜; 周京

    2010-01-01

    术能成功用于常见非整倍体异常的快速产前诊断,检测结果准确,适合于规模较大的产前诊断中心进行大样本检测.%Objective To establish the multiple quantitative fluorescent polymerase chain reaction (QF-PCR)assay and evaluate its clinical application in prenatal diagnosis.Methods Totally 170 samples Were collected between May 2008 and July 2009 in prenatal center of Peking Union Medical College Hospital:123 of them were amniotic fluid,9 were chofionic villous samples,20 were fetal blood and 18 were villi from aborted fetuses.All samples were from women of Han nationality,with mean age of (34.1±4.6) years old,and with mean gestational age of(19.6±1.0)weeks.Cytogenetic cultures and karyotyping were made to every sample.Genomic DNA wag extracted from the samples.The sequences of twenty short tandem repeat (STR) markers were designed according to the GenBank and references,including 6 STR markers in chromosome 21.4 in chromosome 18.4 in chromosome 13,4 in chromosome X,1 in chromosome Y and 1 universal marker in both X and Y chromosome.Each sample was amplified by two sets of multiple QF-PCR,which included 4 STR markers in each of 21,18,13 and sex chromosomes. If the result was uninformative,the third set of anotherd 4 STR markers was added. Results ( 1 ) Karyotyping. Cytogenetic analysis were made for all the 170 samples, 151 (89%) of which were normal, and 19 (11% ) were abnormal (2)QF-PCR assay. 167(98% ) samples were detected by QF-PCR. The results were obtained within 2 -3 days after sampling. 134 samples were proved normal by QF-PCR, which was consistent with karyotyping. Among the 19 abnormal karyotype samples, 18 were detected as abnormal( eight were 21-trisomy, three were 18-trisomy)by QF-PCR. Among the 167 samples, 150(90% ) were detected using the first and second set of STR mixtures, and 3(2% ) were detected when the third set of STR was added. The remain 14(8% ) were uninformative. (3) The diagnostic efficiency of QF

  18. 实时荧光聚合酶链式反应偶联高特异性核酸侵入反应检测单核苷酸多态性%Detection of Single Nucleotide Polymorphism by Real-time Polymerase Chain Reaction Coupled with High Specific Invader Assay in Single Tube

    Institute of Scientific and Technical Information of China (English)

    郑梦琳; 齐谢敏; 童欢; 刘云龙; 邹秉杰; 宋沁馨; 周国华

    2015-01-01

    建立了实时荧光聚合酶链式反应( PCR)偶联高特性核酸侵入反应检测单核苷酸多态性( SNP)的方法。优化了体系中flap核酸内切酶1(FEN1酶)和野生型检测探针等用量,确定了最佳反应条件,即FEN1酶用量为1.5 U,野生型检测探针用量为0.125μmol/L,0.5μmol/L Invader突变型检测探针,各0.25μmol/L通用野生型( VIC)和突变型( FAM)荧光共振转移发卡探针,显著降低了野生型样本和突变型样本背景信号,避免了背景信号对检测结果分型的干扰。采用本方法对编码乙醛脱氢酶2( ALDH2)基因ALDH2*2位点21例样本、细胞色素P4502C19基因CYP2C19*2和CYP2C19*3位点各19例样本进行分型检测,结果表明, AL-DH2*2位点GG纯合10例,GA杂合8例,AA纯合3例;CYP2C19*2位点GG纯合9例,GA杂合8例,AA纯合2例;CYP2C19*3位点GG纯合18例,GA杂合1例。使用焦磷酸测序进行验证,两种方法检测结果一致。本方法特异性好、操作简便、耗时短、成本低,可实现对SNP单管闭管无污染的分型检测。%A method for the real-time polymerase chain reaction ( PCR ) coupled with high specific invader assay to detect single nucleotide polymorphism ( SNP) was established. To reduce the background signal, the amount of flap endonuclease 1 ( FEN1 enzyme ) and wild-type detection probe was optimized. Under the optimum conditions including 0. 05 μmo/L invasive oligonucleotide probe, 0. 125 μmol/L wild-type detection probe, 0. 5 μmol/L mutation detection probe, 0. 25 μmol/L each fluorescence resonance energy transfer (FRET) probe and 1. 5 U FEN1, the background signal of wild-type sample and mutation sample was dramatically decreased and the background interference to the detecting results was thus eliminated. A total of 21 cases of aldehyde dehydrogenase-2*2 ( ALDH2*2 ) , 19 cases of cytochrome p450 2 C19*2 ( CYP2 C19*2 ) and 19 cases of CYP2C19*3 were analyzed with the established method, and the genotypes of ALDH2*2 were 10

  19. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2014-10-01

    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  20. Rapid Diagnosis of Extrapulmonary Tuberculosis by Ligase Chain Reaction Amplification

    OpenAIRE

    Gamboa, Fredy; Dominguez, José; Padilla, Eduardo; Manterola, José M.; Gazapo, Elena; Lonca, Joan; Matas, Lurdes; Hernandez, Agueda; Cardona, Pere Joan; Ausina, Vicente

    1998-01-01

    A rapid amplification-based test for the diagnosis of extrapulmonary tuberculosis, the LCx Mycobacterium tuberculosis Assay from Abbott Laboratories, was evaluated. Results from the LCx M. tuberculosis Assay were compared with those from culture and the final clinical diagnosis for each patient. A total of 526 nonrespiratory specimens from 492 patients were tested. The specimens included urine; feces; lymph node exudates; pleural, cerebrospinal, articular, and ascitic fluids; tissue biopsies;...

  1. An assay for the detection of grapevine leafroll-associated virus 3 using a single-chain fragment variable antibody.

    Science.gov (United States)

    Cogotzi, Laura; Giampetruzzi, Annalisa; Nölke, Greta; Orecchia, Martin; Elicio, Vito; Castellano, Maria Antonietta; Martelli, Giovanni P; Fischer, Rainer; Schillberg, Stefan; Saldarelli, Pasquale

    2009-01-01

    Grapevine leafroll-associated virus 3 (GLRaV-3) is a major pathogen of grapevine. A previously described single-chain fragment variable (scFv) antibody (scFvLR3), directed against the coat protein (CP) of GLRaV-3, was expressed in Escherichia coli and used to develop a diagnostic ELISA kit. The antibody was fused to the light chain constant domain of human immunoglobulin to create the bivalent reagent C(L)-LR3, which was purified from the periplasmic fraction, giving a yield of ~5 mg/l. The sensitivity of the reagent against recombinant GLRaV-3 CP was 0.1 ng. The sensitivity, specificity and durability of the reagent was similar to a commercial kit. The C(L)-LR3 showed a weak cross-reaction in immune electron microscopy assays to GLRaV-1 and -7, but not with the phylogenetically more distant GLRaV-2. A fully recombinant kit was developed with the inclusion of a recombinant GLRaV-3 CP expressed in bacteria, thus avoiding problems associated with virus propagation and purification. This system represents a rapid, simple, sensitive and standardized diagnostic protocol for GLRaV-3 detection. PMID:19082687

  2. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  3. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang

    2006-01-01

    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  4. Identification of co-occurring Branchinecta fairy shrimp species from encysted embryos using multiplex polymerase chain reaction

    Science.gov (United States)

    Vandergast, A.G.; Wood, D.A.; Simovich, M.; Bohonak, A.J.

    2009-01-01

    Morphological identification of many fairy shrimp species is difficult because distinguishing characters are restricted to adults. We developed two multiplex polymerase chain reaction assays that differentiate among three Branchinecta fairy shrimp with distributional overlap in southern California vernal pools. Two of the species are federally listed as threatened. Molecular identification of Branchinecta from cysts allows for species surveys to be conducted during the dry season, expanding the timeframe for population assessment and providing a less intrusive method of sampling sensitive vernal pool habitats. ?? Published 2009. This article is a US Government work and is in the public domain in the USA.

  5. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  6. Improved diagnosis of mycobacterial infections in formalin-fixed and paraffin-embedded sections with nested polymerase chain reaction.

    Science.gov (United States)

    Azov, Andrey G; Koch, Jørn; Hamilton-Dutoit, Stephen J

    2005-09-01

    Traditional histological diagnosis of mycobacterial infection in formalin-fixed and paraffin-embedded (FFPE) tissues is insensitive and poorly specific. To improve this, we developed nested polymerase chain reaction (PCR) protocols for detecting a Mycobacterium genus-specific 65-kDa heat shock protein (HSP65) sequence and the M. tuberculosis complex-specific insertion sequence IS6110 in FFPE sections. Protocols were optimized on tissues from 20 patients with a final clinical diagnosis of mycobacterial infection. Amplicons were controlled by sequencing and restriction endonuclease digestion. PCR could detect as few as three mycobacterial genomes per reaction. Assays showed 100% sensitivity and specificity for both M. tuberculosis complex and M. avium complex infection. Paraffin blocks from a second group of 26 patients with histological evidence of necrotizing granulomas of unknown etiology were then analyzed as a surrogate group to test the assay under conditions similar to those applying during routine diagnosis. Twenty-three of these blocks contained amplifiable DNA; nine were positive for M. tuberculosis complex DNA and four for other types of mycobacterial DNA. Furthermore, digestion of HSP65 amplicons with NarI could distinguish M. tuberculosis from M. avium complex. In conclusion, our nested PCR assays can be used as reliable tools for the detection of mycobacterial infections in FFPE tissues. The assays are simple and rapid to perform and show improved sensitivity and specificity compared to previously reported protocols.

  7. Coamplification at lower denaturation temperature polymerase chain reaction enables selective identification of K-Ras mutations in formalin-fixed, paraffin-embedded tumor tissues without tumor-cell enrichment.

    Science.gov (United States)

    Yu, Shaorong; Xie, Li; Hou, Zhibo; Qian, Xiaoping; Yu, Lixia; Wei, Jia; Ding, Yitao; Liu, Baorui

    2011-09-01

    Conventional polymerase chain reaction-based Sanger sequencing is the standard assay for the detection of K-Ras mutations. However, this method is deficient in identifying small numbers of mutation-bearing cells, and tumor-cell enrichment methods such as microdissection or macrodissection are labor intensive and not always achievable. We applied the recently described coamplification at lower denaturation temperature polymerase chain reaction, which amplifies minority alleles selectively, to detect K-Ras mutations directly in 29 formalin-fixed, paraffin-embedded pancreatic specimens and compared the results with those of conventional polymerase chain reaction. To avoid a false-negative result from the coamplification at lower denaturation temperature polymerase chain reaction assay, we applied a more sensitive peptide nucleic acid polymerase chain reaction method as the gold standard. Dilution experiments indicated an approximately 5-fold improvement in sensitivity with coamplification at lower denaturation temperature polymerase chain reaction-based Sanger sequencing. Conventional polymerase chain reaction detected K-Ras mutations in 11 formalin-fixed, paraffin-embedded pancreatic specimens (37.9%), whereas coamplification at lower denaturation temperature polymerase chain reaction could identify all of those mutations as well as mutations in 10 additional samples, for a total of 21 (72.4%, P = .002) of 29. Unlike peptide nucleic acid polymerase chain reaction, coamplification at lower denaturation temperature polymerase chain reaction identified all K-Ras mutations in specimens in which tumor cells accounted for at least 20% of the total. Adoption of coamplification at lower denaturation temperature polymerase chain reaction is straightforward and requires no additional reagents or instruments. The technique is a good strategy to detect K-Ras mutations selectively in formalin-fixed, paraffin-embedded tissues without tumor-cell enrichment.

  8. Multiple reaction monitoring and multiple reaction monitoring cubed based assays for the quantitation of apolipoprotein F.

    Science.gov (United States)

    Kumar, Abhinav; Gangadharan, Bevin; Zitzmann, Nicole

    2016-10-15

    Apolipoprotein F (APO-F) is a novel low abundance liver fibrosis biomarker and its concentration decreases in human serum and plasma across liver fibrosis stages. Current antibody based assays for APO-F suffer from limitations such as unspecific binding, antibody availability and undetectable target if the protein is degraded; and so an antibody-free assay has the potential to be a valuable diagnostic tool. We report an antibody-free, rapid, sensitive, selective and robust LC-MS/MS (MRM and MRM(3)) method for the detection and quantitation of APO-F in healthy human plasma. With further analysis of clinical samples, this LC-MS based method could be established as the first ever antibody-free biomarker assay for liver fibrosis. We explain the use of Skyline software for peptide selection and the creation of a reference library to aid in true peak identification of endogenous APO-F peptides in digests of human plasma without protein or peptide enrichment. Detection of a glycopeptide using MRM-EPI mode and reduction of interferences using MRM3 are explained. The amount of APO-F in human plasma from a healthy volunteer was determined to be 445.2ng/mL, the coefficient of variation (CV) of precision for 20 injections was <12% and the percentage error of each point along the calibration curve was calculated to be <8%, which is in line with the assay requirements for clinical samples. PMID:27592286

  9. Multiple reaction monitoring and multiple reaction monitoring cubed based assays for the quantitation of apolipoprotein F.

    Science.gov (United States)

    Kumar, Abhinav; Gangadharan, Bevin; Zitzmann, Nicole

    2016-10-15

    Apolipoprotein F (APO-F) is a novel low abundance liver fibrosis biomarker and its concentration decreases in human serum and plasma across liver fibrosis stages. Current antibody based assays for APO-F suffer from limitations such as unspecific binding, antibody availability and undetectable target if the protein is degraded; and so an antibody-free assay has the potential to be a valuable diagnostic tool. We report an antibody-free, rapid, sensitive, selective and robust LC-MS/MS (MRM and MRM(3)) method for the detection and quantitation of APO-F in healthy human plasma. With further analysis of clinical samples, this LC-MS based method could be established as the first ever antibody-free biomarker assay for liver fibrosis. We explain the use of Skyline software for peptide selection and the creation of a reference library to aid in true peak identification of endogenous APO-F peptides in digests of human plasma without protein or peptide enrichment. Detection of a glycopeptide using MRM-EPI mode and reduction of interferences using MRM3 are explained. The amount of APO-F in human plasma from a healthy volunteer was determined to be 445.2ng/mL, the coefficient of variation (CV) of precision for 20 injections was <12% and the percentage error of each point along the calibration curve was calculated to be <8%, which is in line with the assay requirements for clinical samples.

  10. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction.

    Science.gov (United States)

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su

    2012-01-01

    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time. PMID:22079620

  11. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    Science.gov (United States)

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis.

  12. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  13. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Science.gov (United States)

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  14. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Laure F Pittet

    Full Text Available Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR. In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old, formerly diagnosed as Bordetella pertussis (IS481+. No B. holmesii (IS481+, IS1001-, hIS1001+ was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  15. Design, construction, and validation of a modular library of sequence diversity standards for polymerase chain reaction.

    Science.gov (United States)

    Baum, Paul D; Young, Jennifer J; Zhang, Qianjun; Kasakow, Zeljka; McCune, Joseph M

    2011-04-01

    Methods to measure the sequence diversity of polymerase chain reaction (PCR)-amplified DNA lack standards for use as assay calibrators and controls. Here we present a general and economical method for developing customizable DNA standards of known sequence diversity. Standards ranging from 1 to 25,000 sequences were generated by directional ligation of oligonucleotide "words" of standard length and GC content and then amplified by PCR. The sequence accuracy and diversity of the library were validated using AmpliCot analysis (DNA hybridization kinetics) and Illumina sequencing. The library has the following features: (i) pools containing tens of thousands of sequences can be generated from the ligation of relatively few commercially synthesized short oligonucleotides; (ii) each sequence differs from all others in the library at a minimum of three nucleotide positions, permitting discrimination between different sequences by either sequencing or hybridization; (iii) all sequences have identical length, GC content, and melting temperature; (iv) the identity of each standard can be verified by restriction digestion; and (v) once made, the ends of the library may be cleaved and replaced with sequences to match any PCR primer pair. These standards should greatly improve the accuracy and reproducibility of sequence diversity measurements.

  16. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

    Science.gov (United States)

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

    2010-03-01

    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  17. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction.

    Science.gov (United States)

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham

    2002-08-01

    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  18. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction.

    Science.gov (United States)

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T

    1997-01-01

    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  19. A novel technique for measuring variations in DNA copy-number: competitive genomic polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Nakagawara Akira

    2007-07-01

    Full Text Available Background Changes in genomic copy number occur in many human diseases including cancer. Characterization of these changes is important for both basic understanding and diagnosis of these diseases. Microarrays have recently become the standard technique and are commercially available. However, it is useful to have an affordable technique to complement them. Results We describe a novel polymerase chain reaction (PCR-based technique, termed competitive genomic PCR (CGP. The main characteristic of CGP is that different adaptors are added to the sample and control genomic DNAs after appropriate restriction enzyme digestion. These adaptor-supplemented DNAs are subjected to competitive PCR using an adaptor-primer and a locus-specific primer. The amplified products are then separated according to size differences between the adaptors. CGP eliminates the tedious steps inherent in quantitative PCR and achieves moderate throughput. Assays with different X chromosome numbers showed that it can provide accurate quantification. High-resolution analysis of neuroblastoma cell lines around the MYCN locus revealed novel junctions for amplification, which were not detected by a commercial array. Conclusion CGP is a moderate throughput technique for analyzing changes in genomic copy numbers. Because CGP can measure any genomic locus using PCR primers, it is especially useful for detailed analysis of a genomic region of interest.

  20. BORRELIA BURGDORFERI DNA IN BIOLOGICAL SAMPLES FROM PATIENTS WITH SARCOIDOSIS USING THE POLYMERASE CHAIN REACTION TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈

    1995-01-01

    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  1. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    Science.gov (United States)

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  2. Polymerase chain reaction-based screening for the ceftriaxone-resistant Neisseria gonorrhoeae F89 strain.

    Science.gov (United States)

    Goire, N; Lahra, M M; Ohnishi, M; Hogan, T; Liminios, A E; Nissen, M D; Sloots, T P; Whiley, D M

    2013-04-04

    Emergence and spread of Neisseria gonorrhoeae resistant to extended spectrum cephalosporins is a major problem threatening treatment of gonorrhoea and is further highlighted by the recent report of a second ceftriaxone-resistant N. gonorrhoeae strain (F89) in Europe, initially observed in France and subsequently identified in Spain. N. gonorrhoeae antimicrobial resistance (AMR) surveillance has acquired new importance and molecular tools have the potential to enhance bacterial culture-based methods. In this study, we established a polymerase chain reaction (PCR) protocol for direct detection of the F89 strain. A key component of this screening protocol was the development of a hybridisation probe-based melting curve analysis assay (mosaic501-hybPCR) to detect the presence of an A501P substitution on the N. gonorrhoeae mosaic penicillin binding protein 2 (PBP2) sequence, an important characteristic of the F89 strain. The mosaic501-hybPCR was evaluated using plasmid-derived positive controls (n=3) and characterised gonococcal (n=33) and non-gonococcal (n=58) isolates. The protocol was then applied to 159 clinical specimens from Sydney, Australia, collected during the first half of the year 2012 that were N. gonorrhoeae PCR-positive. Overall, the results indicate that the PCR-based protocol is suitable for direct detection of the N. gonorrhoeae F89 strain in non-cultured clinical samples. It therefore provides an additional tool to aid investigations into the potential spread of F89 strain throughout Europe and elsewhere.

  3. Development of a high-throughput assay for the HIV-1 integrase disintegration reaction

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Both HIV-1 integrase (IN) and the central catalytic domain of IN (IN-CCD) catalyze the disintegration reaction in vitro.In this study,IN and IN-CCD proteins were expressed and purified,and a high-throughput format enzyme-linked immunosorbent assay (ELISA) was developed for the disintegration reaction.IN exhibited a marked preference for Mn2+ over Mg2+ as the divalent cation cofactor in disintegration.Baicalein,a known IN inhibitor,was found to be an IN-CCD inhibitor.The assay is sensitive and specific for the study of disintegration reaction as well as for the in vitro identification of antiviral drugs targeting IN,especially targeting IN-CCD.

  4. Thermal reactions of polymer chains with coal structures

    Energy Technology Data Exchange (ETDEWEB)

    P. Straka; J. Nahunkova [Academy of Sciences of the Czech Republic, Prague (Czech Republic). Institute of Rock Structure and Mechanics

    2003-07-01

    The thermal decompositions of polyethylene, polystyrene and polyamide 6 in the presence of coal was studied by DSC and TGA methods and reactions of these polymers with coal were described. Tars and cokes obtained were characterized and mass balance of the process expressed. Polyethylene decomposes by a free radical mechanism and the major products are 1-alkenes, {alpha},{omega}-alkadienes and n-alkanes. In the presence of coal, formed unsaturated products are adsorbed on the inner surface of coal and semicoke. Maximum weight losses of the coal-polyethylene mixture occur at higher temperature in comparison with that from the decomposition of polyethylene alone. Further, thermal reactions of coal with polystyrene were studied. In the range of 410 490{sup o}C a thermal degradation of coal proceeded, simultaneously, with decomposition of polystyrene. Because coal is a strong H-donor, unsaturated products of polystyrene decomposition (mainly styrene) was hydrogenated by coal. Some aromatic products of polystyrene decomposition reacted with the coal tar structures and new aromatics were formed. That is why the conversion time of polystyrene decomposition was much higher in the presence of coal. The yields of tar from copyrolysis with styrene polymers are higher in comparison with pyrolysis of coal alone. Also composition of tar is changed. Finally, reactions of coal with polyamide 6 were investigated. During the thermal degradation of coal the decomposition of polyamide 6 occurs and {epsilon}-caprolactam and the cyclic dimer are formed. The {epsilon}-caprolactam formation is promoted by water and hydrogen from coal degradation as due to high content of hydrogen coal acts as a strong H- and water donor. Under high-temperature conditions of copyrolysis beside a-caprolactam mainly carbon oxides, methane, aliphatic hydrocarbons, simple aromatics and stable oil are formed. 8 refs., 3 figs., 7 tabs.

  5. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

    Science.gov (United States)

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-05-27

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method. PMID:25946377

  6. High-Speed Microdialysis-Capillary Electrophoresis Assays for Measuring Branched Chain Amino Acid Uptake in 3T3-L1 cells.

    Science.gov (United States)

    Harstad, Rachel K; Bowser, Michael T

    2016-08-16

    We have developed a high-throughput microdialysis-capillary electrophoresis (MD-CE) assay for monitoring branched chain amino acid (BCAA) uptake/release dynamics in 3T3-L1 cells. BCAAs (i.e., isoleucine, leucine, and valine) and their downstream metabolites (i.e., alanine, glutamine, and glutamate) are important indicators of adipocyte lipogenesis. To perform an analysis, amino acids were sampled using microdialysis, fluorescently labeled in an online reaction, separated using CE, and detected using laser-induced fluorescence (LIF) in a sheath flow cuvette. Separation conditions were optimized for the resolution of the BCAAs isoleucine, leucine, and valine, as well as 13 other amino acids, including ornithine, alanine, glutamine, and glutamate. CE separations were performed in <30 s, and the temporal resolution of the online MD-CE assay was <60 s. Limits of detection (LOD) were 400, 200, and 100 nM for isoleucine, leucine, and valine, respectively. MD-CE dramatically improved throughput in comparison to traditional offline CE methods, allowing 8 replicates of 15 samples (i.e., 120 analyses) to be assayed in <120 min. The MD-CE assay was used to assess the metabolism dynamics of 3T3-L1 cells over time, confirming the utility of the assay. PMID:27398773

  7. Diagnosis of foot-and mouth disease by real time reverse transcription polymerase chain reaction under field conditions in Brazil

    Directory of Open Access Journals (Sweden)

    Clarke Neville P

    2008-12-01

    Full Text Available Abstract Background Foot-and-mouth disease (FMD is an economically important and highly contagious viral disease that affects cloven-hoofed domestic and wild animals. Virus isolation and enzyme-linked immunosorbent assay (ELISA are the gold standard tests for diagnosis of FMD. As these methods are time consuming, assays based on viral nucleic acid amplification have been developed. Results A previously described real-time reverse transcriptase polymerase chain reaction (RT-PCR assay with high sensitivity and specificity under laboratorial and experimental conditions was used in the current study. To verify the applicability of this assay under field conditions in Brazil, 460 oral swabs from cattle were collected in areas free of FMD (n = 200 and from areas with outbreaks of FMD (n = 260. Three samples from areas with outbreaks of FMD were positive by real-time RT-PCR, and 2 of those samples were positive by virus isolation and ELISA. Four other samples were considered inconclusive by real-time RT-PCR (threshold cycle [Ct] > 40; whereas all 200 samples from an area free of FMD were real-time RT-PCR negative. Conclusion real-time RT-PCR is a powerful technique for reliable detection of FMDV in a fraction of the time required for virus isolation and ELISA. However, it is noteworthy that lack of infrastructure in certain areas with high risk of FMD may be a limiting factor for using real-time RT-PCR as a routine diagnostic tool.

  8. Primer-introduced restriction analysis polymerase chain reaction method for non-invasive prenatal testing of β-thalassemia.

    Science.gov (United States)

    Liu, Saijun; Chen, Liyuan; Zhang, Xiandong; Li, Jian; Lin, Haiying; Liu, Louhui; Xie, Jiansheng; Ge, Huijuan; Ye, Minglan; Chen, Caifen; Ji, Xingwen; Zhang, Caifen; Xu, Fengping; Jiang, Hui; Zhen, Hefu; Chen, Shiping; Wang, Wei

    2015-01-01

    We have developed a new method for non-invasive prenatal testing (NIPT) of paternally inherited fetal mutants for β-thalassemia (β-thal). Specially designed primer-introduced restriction analysis-polymerase chain reaction (PIRA-PCR) were used to detect four major mutations [IVS-II-654, HBB: c.316-197C > T; codon 17 (A > T), HBB: c.52A > T; -28 (A > G), HBB: c.-78A > G and codons 41/42 (-TTCT), HBB: c.126_129delCTTT] causing β-thal in China. The PIRA-PCR assay was first tested in a series of mixed DNA with different concentrations and mixed proportions. Subsequently, this assay was further tested in 10 plasma DNA samples collected from pregnant women. In the DNA mixture simulation test, the PIRA-PCR assay was able to detect 3.0% target genomic DNA (gDNA) mixed in 97.0% wild-type gDNA isolated from whole blood. For plasma DNA testing, the results detected by PIRA-PCR assay achieved 100.0% consistency with those obtained from the amniocentesis analysis. This new method could potentially be used for NIPT of paternally inherited fetal mutants for β-thal.

  9. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction.

    Science.gov (United States)

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga

    2015-09-01

    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  10. Method of carbon chain extension using novel aldol reaction

    Energy Technology Data Exchange (ETDEWEB)

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  11. Preparation of End Grafted Polyacrylonitrile Brushes through Surface Confined Radical Chain Transfer Reaction

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    End grafted polyacrylonitrile (PAN) brush was prepared through surface initiated polymerization via the chain transfer process. The thiol-terminated monolayer and PAN brushes were characterized by FTIR, X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), ellipsometry and contact angle measurements ete. It is demonstrated that radical chain transfer reaction and surface initiated precipitate polymerization can be used to prepare end-grafted polymer brushes.

  12. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary

    2012-08-01

    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  13. RAPID DETECTION OF Salmonella IN SHRIMP BY POLYMERASE CHAIN REACTION [Deteksi Cepat Salmonella pada Udang dengan Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ulfah Amalia

    2014-06-01

    Full Text Available Shrimp is an important non-oil commodity for foreign trade in Indonesia. However, rejection of shrimp exports by the importing countries is still commonly encountered. In 2011, the USFDA recorded two cases of Salmonella spp. contamination in shrimp products from two shrimp processing companies in Indonesia. Analysis of Salmonella spp. in seafood is generally performed using a conventional method which takes at least 5 days. The objective of the study is to get a Salmonellae rapid detection method in shrimp by PCR. In this study, optimization of PCR protocol method to detect Salmonella invA gene was conducted using six different annealing temperatures (59, 59.5, 60.8, 62, 64 and 64.5°C. The results showed that 64°C was the optimum annealing temperature to detect the 284 bp fragment of Salmonella invA gene. The PCR based detection method has a DNA detection limit of 27.81ug/mL and 10°CFU/mL of viable salmonellae with 100% specificity. The PCR protocol is capable of detecting six different Salmonella serovars (S. Enteritidis, S. Hadar, S. Heidelberg, S. Kentucky, S. Paratyphi and S. Typhimurium but none of the non salmonellae isolates. Application of the PCR assay on Salmonella in shrimp after the selective enrichment step suggested that all 16 samples were positive for Salmonella. At the same time, the conventional method could only detected 3 samples for Salmonella positive.

  14. Reverse transcription genome exponential amplification reaction assay for rapid and universal detection of human rhinoviruses.

    Science.gov (United States)

    Guan, Li; Zhao, Lin-Qing; Zhou, Hang-Yu; Nie, Kai; Li, Xin-Na; Zhang, Dan; Song, Juan; Qian, Yuan; Ma, Xue-Jun

    2016-07-01

    Human rhinoviruses (HRVs) have long been recognized as the cause of more than one-half of acute viral upper respiratory illnesses, and they are associated with more-serious diseases in children, such as asthma, acute otitis media and pneumonia. A rapid and universal test for of HRV infection is in high demand. In this study, a reverse transcription genome exponential amplification reaction (RT-GEAR) assay targeting the HRV 5' untranslated region (UTR) was developed for pan-HRV detection. The reaction was performed in a single tube in one step at 65 °C for 60 min using a real-time fluorometer (Genie(®)II; Optigene). The RT-GEAR assay showed no cross-reactivity with common human enteroviruses, including HEV71, CVA16, CVA6, CVA10, CVA24, CVB5, Echo30, and PV1-3 or with other common respiratory viruses including FluA H3, FluB, PIV1-4, ADV3, RSVA, RSVB and HMPV. With in vitro-transcribed RNA containing the amplified regions of HRV-A60, HRV-B06 and HRV-C07 as templates, the sensitivity of the RT-GEAR assay was 5, 50 and 5 copies/reaction, respectively. Experiments to evaluate the clinical performance of the RT-GEAR assay were also carried out with a panel of 143 previously verified samples, and the results were compared with those obtained using a published semi-nested PCR assay followed by sequencing. The tested panel comprised 91 HRV-negative samples and 52 HRV-positive samples (18 HRV-A-positive samples, 3 HRV-B-positive samples and 31 HRV-C-positive samples). The sensitivity and specificity of the pan-HRVs RT-GEAR assay was 98.08 % and 100 %, respectively. The kappa correlation between the two methods was 0.985. The RT-GEAR assay based on a portable Genie(®)II fluorometer is a sensitive, specific and rapid assay for the universal detection of HRV infection.

  15. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    Science.gov (United States)

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  16. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections

    OpenAIRE

    Luciene de Fátima Costa Torres; Dayana Ribeiro; Raphael Hirata Jr; Luis Gustavo Carvalho Pacheco; Monica Cristina de Souza; Louisy Sanches dos Santos; Cíntia Silva dos Santos; Mohammad Salah; Mateus Matiuzzi da Costa; Marcio Garcia Ribeiro; Selim, Salah A; Vasco Ariston de Carvalho Azevedo; Ana Luiza Mattos-Guaraldi

    2013-01-01

    Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR) assay that can simultan...

  17. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    Science.gov (United States)

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain.

  18. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    Science.gov (United States)

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain. PMID:26169291

  19. Lab-on-a-Chip-Based PCR-RFLP Assay for the Detection of Malayan Box Turtle (Cuora amboinensis) in the Food Chain and Traditional Chinese Medicines

    Science.gov (United States)

    Asing; Ali, Md. Eaqub; Abd Hamid, Sharifah Bee; Hossain, M. A. Motalib; Mustafa, Shuhaimi; Kader, Md. Abdul; Zaidul, I. S. M.

    2016-01-01

    The Malayan box turtle (Cuora amboinensis) (MBT) is a vulnerable and protected turtle species, but it is a lucrative item in the illegal wildlife trade because of its great appeal as an exotic food item and in traditional medicine. Although several polymerase chain reaction (PCR) assays to identify MBT by various routes have been documented, their applicability for forensic authentication remains inconclusive due to the long length of the amplicon targets, which are easily broken down by natural decomposition, environmental stresses or physiochemical treatments during food processing. To address this research gap, we developed, for the first time, a species-specific PCR-restriction fragment length polymorphism (RFLP) assay with a very short target length (120 bp) to detect MBT in the food chain; this authentication ensured better security and reliability through molecular fingerprints. The PCR-amplified product was digested with Bfa1 endonuclease, and distinctive restriction fingerprints (72, 43 and 5 bp) for MBT were found upon separation in a microfluidic chip-based automated electrophoresis system, which enhances the resolution of short oligos. The chances of any false negative identifications were eliminated through the use of a universal endogenous control for eukaryotes, and the limit of detection was 0.0001 ng DNA or 0.01% of the meat under admixed states. Finally, the optimized PCR-RFLP assay was validated for the screening of raw and processed commercial meatballs, burgers and frankfurters, which are very popular in most countries. The optimized PCR-RFLP assay was further used to screen MBT materials in 153 traditional Chinese medicines of 17 different brands and 62 of them were found MBT positive; wherein the ingredients were not declared in product labels. Overall, the novel assay demonstrated sufficient merit for use in any forensic and/or archaeological authentication of MBT, even under a state of decomposition. PMID:27716792

  20. Detection of Human Parvovirus B19 Nonstrutural Protein DNA by Nested-Polymerase Chain Reaction in Gravida Serum and Pregnant Tissues

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    A new nested-polymerase chain reaction (nested-PCR) assay was developed to detect human parvovirus B19 DNA corresponding to the nonstructural protein in clinical specimens in a routine diagnostic laboratory. The sensitivity of this highly specific assay was up to 0. 005 fg of B19 DNA. Parvovirus B19 was identified in sera of 20 pregnant women with abnormal pregnant outcome. Among these 20 cases, intrauterine parvovirus infection did exist in 7 pregnant women because parvovirus B19 DNA was detected in the pregnant tissues of them such as placenta tissues,chorionic villi, amniotic fluid, fetal spleen, liver and abdominal fluids.

  1. Use of pooled samples for the detection of Salmonella in feces by polymerase chain reaction.

    Science.gov (United States)

    Singer, Randall S; Cooke, Cara L; Maddox, Carol W; Isaacson, Richard E; Wallace, Richard L

    2006-07-01

    Many epidemiological studies of Salmonella rely on conventional bacteriological culture methods to detect Salmonella in fecal samples. These culture-based methods are inefficient for epidemiological studies in populations with a low prevalence of Salmonella. The objective of this study was to optimize a protocol that uses pooled Salmonella enrichment broth cultures of bovine feces and polymerase chain reaction (PCR) for the detection of the invA gene of Salmonella in feces. In one field trial, 196 animals were sampled, and all samples were tested by culture, invA PCR on individual samples, invA PCR on pools of 5 samples, and BAX PCR on individual samples. All assays showed a high agreement on individual samples (kappa > or = 0.75). The invA PCR was run on each of 40 pools and detected 19 of 22 culture-positive pools. In another field trial, 152 samples were taken from 4 dairies, and the invA PCR was performed on pools of 5 samples in addition to bacteriological culture of individual samples. Salmonella was detected in 5 of the 32 pools (7 total positive samples) by both PCR and culture. One pool was PCR-positive but culture-negative. Pooling did not dramatically affect the performance of the invA PCR; most of the culture-positive samples were detected, including all of the samples when there were 4 or more Salmonella colonies on the agar plate. Based on these field trials, invA PCR on pooled samples appears to be an efficient method of Salmonella detection as long as Salmonella loads are not extremely low.

  2. Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Conventional methods for the diagnosis of tubercolosis based on microscopic examination and in vitro culture is both time consuming and tedious. Molecular methods of diagnosis have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determined the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. An aliquot of each specimen were kept for analysis by in vitro amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. All specimens were analysed in quintriplicate, with 2 samples unspiked and 3 sampled spiked with M. tuberculosis. Appropriate positive and negative controls were included in all essays. Following amplification, the specimens were analysed by agarose gel electrophoresis (AGE). All specimens were further subject to hybridization studies using a specific radiolabelled probe. The sensitivity of the amplification assay coupled with visualization of the amplified targets using eithidium bromide staining was found to be about 1 fg of DNA. A total of 40 smear positive specimens were analyzed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive by PCR/hybridization analysis. (author). 13 refs, 1 tab

  3. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis].

    Science.gov (United States)

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P

    2013-06-01

    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; P3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients.

  4. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    V Makeshkumar

    2014-01-01

    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  5. Early detection of Brucella canis via quantitative polymerase chain reaction analysis.

    Science.gov (United States)

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A

    2014-02-01

    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  6. Detection and analysis of polymerase chain reaction products by mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  7. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    Science.gov (United States)

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  8. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    A total of 280 persons were HLA-DQA1 typed by two different polymerase chain reaction (PCR) based methods; (i) a reverse dot-blot (RDB) method, which can differentiate between six alleles, and (ii) a combined PCR-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification...

  9. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    Science.gov (United States)

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  10. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...

  11. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.;

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...

  12. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  13. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)

    1993-01-01

    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The resul

  14. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  15. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction

    Science.gov (United States)

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.

    2016-01-01

    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  16. Detection of Paragonimus heterotremus eggs in experimentally infected cats by a polymerase chain reaction-based method.

    Science.gov (United States)

    Intapan, Pewpan M; Wongkham, Chaisiri; Imtawil, Kanokwan J; Pumidonming, Wilawan; Prasongdee, Thidarat K; Miwa, Masanao; Maleewong, Wanchai

    2005-02-01

    A polymerase chain reaction (PCR) procedure for the detection of Paragonimus heterotremus eggs in stool samples was developed and compared with Stoll's egg count method. The primers were designed on the basis of a previously constructed pPH-13-specific DNA probe, which produced an approximate 0.5-kb amplified product. This PCR method could detect as few as 5 eggs in 0.6 g of artificially inoculated feces of a healthy control cat or as little as 1 x 10(-4) ng of P. heterotremus genomic DNA. The assay had 100% sensitivity in all infected cats. The method did not yield an approximate 0.5-kb product with DNA from other parasites such as Gnathostoma spinigerum, Trichinella spiralis, Fasciola gigantica, Echinostoma malayanum, Opisthorchis viverrini, Dirofilaria immitis, and Taenia saginata; exceptions were Paragonimus siamensis and Paragonimus westermani. In addition, no genomic DNA from Escherichia coli, Burkholderia pseudomallei, Acinetobacter anitratus, Mycobacterium tuberculosis, Staphylococcus aureus, beta-Streptococcus grA, and Proteus mirabilis or from the vertebrate and invertebrate hosts of P. heterotremus was amplified in the PCR assay. This assay has great potential for application in clinical epidemiological studies.

  17. Bluetongue virus detection: a safer reverse-transcriptase polymerase chain reaction for prediction of viremia in sheep.

    Science.gov (United States)

    Shad, G; Wilson, W C; Mecham, J O; Evermann, J F

    1997-04-01

    A reversible target capture viral RNA extraction procedure was combined with a reverse-transcriptase nested polymerase chain reaction (PCR) to develop a capture PCR assay providing a rapid and safe prediction method for circulating bluetongue virus in infected ruminants. This new assay was compared with virus isolation and a recently developed antigen-capture enzyme-linked immunosorbent assay (ELISA) for the detection of bluetongue virus. Eight Warhill crossbred sheep were inoculated subcutaneously with bluetongue virus serotype 10, and blood samples were taken sequentially over a period of 28 days. The capture PCR detected the peak of viremia, as determined by virus isolation and antigen-capture ELISA, from day 5 to day 14 after challenge. The results indicate that the rapid-capture bluetongue virus PCR provides a rapid indicator of samples in which virus can be isolated. In addition, this capture bluetongue virus PCR procedure does not require a lengthy phenol extraction or the use of the highly toxic methyl mercury hydroxide denaturant.

  18. Development and application of reverse transcriptase nested polymerase chain reaction test for the detection of exogenous avian leukosis virus.

    Science.gov (United States)

    García, Maricarmen; El-Attrache, John; Riblet, Sylva M; Lunge, Vagner R; Fonseca, André S K; Villegas, Pedro; Ikuta, Nilo

    2003-01-01

    A polymerase chain reaction (PCR) assay that utilizes nested primers to amplify a fragment of the long terminal repeat of exogenous avian leukosis virus (ALV) was developed and evaluated for detection of ALV subgroup J directly from clinical samples. Compilation of sequence data from different endogenous and exogenous ALVs allowed the selection of a conserved set of nested primers specific for the amplification of exogenous ALV subgroups A, B, C, D, and J and excluded amplification of endogenous viruses or endogenous viral sequences within the chicken genome. The nested primers were successfully used in both PCR and reverse transcriptase (RT)-PCR assays to detect genetically diverse ALV-J field isolates. Detection limits of ALV-J isolate ADOL-Hc1 DNA by nested PCR and RNA by RT-nested PCR were superior to detection of group-specific antigen by enzyme-linked immunosorbent assay (ELISA) in cell culture. Detection of ALV-J in cloacal swabs by RT-nested PCR was compared with direct detection by antigen-capture (ac)-ELISA; RT-nested PCR detected fewer positive samples than ac-ELISA, suggesting that RT-nested PCR excluded detection of endogenous virus in clinical samples. Detection of ALV-J in plasma samples by RT-nested PCR was compared with virus isolation in C/E chicken embryo fibroblasts; the level of agreement between both assays as applied to plasma samples ranged from low to moderate. The main disagreement between both assays was observed for a group of plasma samples found positive by RT-nested PCR and negative by virus isolation, suggesting that RT-nested PCR detected ALV-J genome in plasma samples of transiently or intermittently infected birds. ALV-J transient and intermittent infection profiles are characterized by inconsistent virus isolation responses throughout the life of a naturally infected flock. PMID:12713157

  19. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou

    2005-01-01

    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  20. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio

    2010-11-01

    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  1. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Science.gov (United States)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  2. Identification of goose, mule duck, chicken, turkey, and swine in foie gras by species-specific polymerase chain reaction.

    Science.gov (United States)

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martín, Rosario

    2003-03-12

    A specific Polymerase Chain Reaction (PCR) has been developed for the identification of goose (Anser anser), mule duck (Anas platyrhynchos x Cairina moschata), chicken (Gallus gallus), turkey (Meleagris gallopavo), and swine (Sus scrofa domesticus) in foie gras. A forward common primer was designed on a conserved DNA sequence in the mitochondrial 12S ribosomal RNA gene (rRNA), and reverse primers were designed to hybridize on species-specific DNA sequences of each species considered. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose, mule duck, chicken, turkey, and swine in foie gras. Analysis of experimental mixtures demonstrated that the detection limit of the assay was approximately 1% for each species analyzed. This genetic marker can be very useful for the accurate identification of these species, avoiding mislabeling or fraudulent species substitution in foie gras.

  3. DETECTION OF BORRELIA BURGDOFERI DNA IN GRANULOMATOUS TISSUES FROM PATIENTSWITH SARCOIDOSIS USING POLYMERASE CHAIN REACTION IN SITU TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    徐作军; 马东来; 罗慰慈; 朱元珏

    1996-01-01

    To investigate the correlation between sarcoidosis and Borrelia burgdorferi (Bb) infection,flagella DNA of Bb were detected in 23 granulomatous tissue specimens from patients with confirmed sarcoidosis usingpolymerase chain reaction in situ technique (in situ PCR) and the antibodies to Bb were examined in 55 serum samples obtained from the patients by indirect immunoflurescence assays. Our data presented that =(1) None of granulomatous tissues was found to have Bb DNA in 23 tissue samples. (2) Thirty of 55(54.6%) patients with sarcoidosis were found antibodies to Bh positive,in contrast,six of 60 (10%) norreal subjects had antibodies against Bb,the positive rate was remarkably higher in patient group than thatin healthy group (P(0. 005). The results suggest that Bb might not be the causative agent of sarcoidosis,the elevated titres of serum antibodies against Bb in patients with sarcoidosis is a nonspecific response.

  4. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen;

    2011-01-01

    Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...... for risk assessment. Results: In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6* 10(5)GU/L while L. pneumophila were detected in a range from LOQ to 6.8*10(5) GU/L. By culturing, the legionellae were detected in the range from below...

  5. Detection of Nesopora caninum-specific DNA from cerebrospinal fluid by polymerase chain reaction in a dog with confirmed neosporosis.

    Science.gov (United States)

    Ishigaki, Kyohei; Noya, Masahiko; Kagawa, Yumiko; Ike, Kazunori; Orima, Hiromitsu; Imai, Soichi

    2012-08-01

    A one-month male Greyhound dog presented with a swinging gait of the hindlimbs, and later developed muscular atrophy of the femoral region and hyperextension of hindlimbs. The dog had positive serum IFAT titers to Neospora caninum, but a negative titer in the cerebrospinal fluid (CSF). N. caninum-specific DNA was amplified from the CSF using a semi-nested polymerase chain reaction assay. Clusters of protozoa in biopsied muscle fibers were subsequently confirmed as N. caninum tachyzoites by immunohistochemical examination. Early recognition and treatment are necessary for effective recovery of clinical canine neosporosis, but antemortem diagnosis is difficult. We suggest that the detection of parasite deoxyribonucleic acid in the CSF is a useful antemortem diagnostic method in facilitating treatment of this disease. PMID:22446406

  6. A new measurement approach of ionizing radiation in irradiated trout (Oncorhynchus mykiss) by Randomly Polymorphic DNA-Polymerase Chain Reaction.

    Science.gov (United States)

    Şakalar, Ergün; Mol, Sühendan

    2016-05-01

    Trout (Oncorhynchus mykiss) were irradiated at doses of 0.250, 0.500, 1, 3, 5, 7 and 9 kGy in gamma cell. DNAs were extracted from the irradiated samples before and after storage. 1ERP primers were designed, and RAPD-PCR (Randomly Polymorphic DNA-Polymerase Chain Reaction) was applied to make randomly amplifications on the DNA of the irradiated samples. Agarose gel profiles of irradiated fish were obtained to determine change of band profiles. In addition, DNA fragmentation occurring in each dose was determined by comet assay for the verification of methodology developed in this study. The molecular methodology was developed to estimate ionizing radiation (IR) level in irradiated fish. This methodology allows the analysis of the trout irradiated up to the dose limit of around 0.5 kGy and stored for a period of three months. PMID:27407216

  7. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms.

    Science.gov (United States)

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

    2016-03-01

    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The

  8. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    OpenAIRE

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  9. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.;

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  10. Comparison of different polymerase chain reaction-based approaches for clonality assessment of immunoglobulin heavy-chain gene rearrangements in B-cell neoplasia

    NARCIS (Netherlands)

    Derksen, P W; Langerak, A W; Kerkhof, E; Wolvers-Tettero, I L; Boor, P P; Mulder, A H; Vrints, L W; Coebergh, J W; van Krieken, J H; Schuuring, E; Kluin, P M; van Dongen, J J

    1999-01-01

    Several frequently applied polymerase chain reaction strategies for analysis of immunoglobulin heavy-chain gene rearrangements were compared by analyzing 70 B-cell lymphoproliferative disorders and 24 reactive lymphoid lesions. Southern blot analysis was used as the "gold standard" for clonality ass

  11. Cyanidin-horseradish peroxidase-hydroperoxide reaction system and its application in enzyme linked immunosensing assays

    Institute of Scientific and Technical Information of China (English)

    GONG FuChun; LI DingZhong; YANG Rong; WEI JianKe; CAO Zhong; TAN ShuZhen; TAN YaFei

    2009-01-01

    A cyanidin-based horseradish peroxidase(HRP)-catalyzed reaction system was established in this work.In B-R buffer solutions(pH 6.8),a UV-visible ebsorbance peak of cyanidin(CAG)at 540 nm(Ap1)appeared.After the oxidation reaction of CAG catalyzed by HRP in the presence of H2O2,a significant absorbance peak at 482 nm(Ap2)occurred.The ratio R(Ap2/Ap1)was proportional to the HRP concentration.The application of CAG in the enzyme-linked immunosensing assays was investigated using food and mouth disease virus antigen(FMDVAg)as e model analyte.in sandwich immunoreaction,the analyte FMDVAg and food and mouth disease virus antibody(FMDVAb)-modified magnetic nanoparticles bound the supported conconvalina(Con A)bound with HRP-FMDVAb.After de-absorbing and separating,the HRP-FMDVAb-FMDVAg-FMDVAb-magnetic nanoparticles complexes were subject to enzymatic reaction and UV-visible absorbance measurements.The HRP moiety of the immunoreaction complexes can catalyze the oxidation reaction of CAG by H2O2,and the substrate CAG is converted to products.Based on this principle,a sandwich assay model has been employed to determine FMDVAg in rabbit serum samples with the aid of FMDVAb-Fe3O4 magnetic nanoparticles.The linear range of the FMDVAg determination is 1.5×10-8-2.7×10-6 g/mL with the relatively standard deviation of 3.7%(n=11).The detection limit is 3.1×10 g/mL.Additional advantages of the typical substrate such as OPD,OAP and TMB are good water-solubility and stability.

  12. Detection of deoxyribonucleic acid (DNA) targets using polymerase chain reaction (PCR) and paper surface-enhanced Raman spectroscopy (SERS) chromatography.

    Science.gov (United States)

    Hoppmann, Eric P; Yu, Wei W; White, Ian M

    2014-01-01

    Surface-enhanced Raman spectroscopy (SERS) enables multiplex detection of analytes using simple, portable equipment consisting of a single excitation source and detector. Thus, in theory, SERS is ideally suited to replace fluorescence in assays that screen for numerous deoxyribonucleic acid (DNA) targets, but in practice, SERS-based assays have suffered from complexity and elaborate processing steps. Here, we report an assay in which a simple inkjet-fabricated plasmonic paper device enables SERS-based detection of multiple DNA targets within a single polymerase chain reaction (PCR). In prior work, we demonstrated the principles of chromatographic separation and SERS-based detection on inkjet-fabricated plasmonic paper. The present work extends that capability for post-PCR gene sequence detection. In this design, hydrolysis DNA probes with 5' Raman labels are utilized; if the target is present, the probe is hydrolyzed during PCR, freeing the reporter. After applying the PCR sample to a paper SERS device, an on-device chromatographic separation and concentration is conducted to discriminate between hydrolyzed and intact probes. SERS is then used to detect the reporter released by the hydrolyzed probes. This simple separation and detection on paper eliminates the need for complex sample processing steps. In this work, we simultaneously detect the methicillin-resistant Staphylococcus aureus genes mecA and femB to illustrate the concept. We envision that this approach could contribute to the development of multiplex DNA diagnostic tests enabling screening for several target sequences within a single reaction, which is necessary for cases in which sample volume and resources are limited.

  13. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend;

    1991-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...... was minimized. The polymerase chain reaction detected a higher number of Chlamydia trachomatis infections among both symptomatic and asymptomatic females and males, and it also detected Chlamydia trachomatis at an earlier stage of infection when compared to cell culture. The polymerase chain reaction did...

  14. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend;

    1993-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...... was minimized. The polymerase chain reaction detected a higher number of Chlamydia trachomatis infections among both symptomatic and asymptomatic females and males, and it also detected Chlamydia trachomatis at an earlier stage of infection when compared to cell culture. The polymerase chain reaction did...

  15. Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Dominique Rainteau

    Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

  16. Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections.

    Science.gov (United States)

    Coates, P J; d'Ardenne, A J; Khan, G; Kangro, H O; Slavin, G

    1991-02-01

    The polymerase chain reaction was applied to the analysis of DNA contained in archival paraffin wax embedded material. DNA suitable for the reaction was obtained from these tissues by simple extraction methods, without previous dewaxing of tissue sections. When compared with unfixed material, the reaction efficiency was compromised, so that an increased number of amplification cycles were required to produce equivalent amounts of amplified product. This in turn led to an increase in amplification artefacts, which can be minimised by a simple modification of the standard reaction. Amplification of relatively large DNA fragments was not always successful, and it seems prudent to bear this in mind when designing oligonucleotide primers which are to be used for the amplification of archival material. The efficiency of the procedure can be improved by dividing the amplification cycles into two parts: this reduces the amount of reagent needed, is relatively simple and inexpensive, and can be performed in one working day.

  17. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples.

    Science.gov (United States)

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal

    2008-07-01

    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  18. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei

    2011-01-01

    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  19. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin

    2011-01-01

    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  20. Cyclic polyesters prepared by poly(oxypropylene oxymaloyl ring-chain reactions

    Directory of Open Access Journals (Sweden)

    2007-01-01

    Full Text Available The synthesis of cyclic polyesters of poly(oxypropylene oxymaloyl from a ring-chain reaction was carried out at 40°C with 'Maghnite' an acid exchanged montmorillonite as acid solid ecocatalyst (Mag–H+. 'Maghnite' is already used as catalyst for polymerization of many vinylic and heterocyclic monomers [1]. The effect of amount of catalyst on yield and molecular weight of polymer was studied.A typical reaction product was analyzed by gel permeation chromatography (GPC as well as by nuclear magnetic resonance spectroscopy (1H-NMR and the existence of cyclic species was proven.

  1. Digital polymerase chain reaction in an array of femtoliter polydimethylsiloxane microreactors.

    Science.gov (United States)

    Men, Yongfan; Fu, Yusi; Chen, Zitian; Sims, Peter A; Greenleaf, William J; Huang, Yanyi

    2012-05-15

    We developed a simple, compact microfluidic device to perform high dynamic-range digital polymerase chain reaction (dPCR) in an array of isolated 36-femtoliter microreactors. The density of the microreactors exceeded 20000/mm(2). This device, made from polydimethylsiloxane (PDMS), allows the samples to be loaded into all microreactors simultaneously. The microreactors are completely sealed through the deformation of a PDMS membrane. The small volume of the microreactors ensures a compact device with high reaction efficiency and low reagent and sample consumption. Future potential applications of this platform include multicolor dPCR and massively parallel dPCR for next generation sequencing library preparation. PMID:22482776

  2. 肝细胞生长因子mRNA实时荧光定量PCR检测体系的建立及其在淋巴瘤诊断中的价值%Establishment of real-time fluorescence quantitative polymerase chain reaction analysis assay quantification for hepatocyte growth flactor mRNA expression and its clinical relevance in lymphoma

    Institute of Scientific and Technical Information of China (English)

    岑东; 吕建新; 裴仁治; 涂植光; 余晓林; 文阳安

    2008-01-01

    Objective To construct quantitative standard for quantification of hepatocyte growth factor (HGF) mRNA and establish its real-time fluorescence quantitative(FQ)-PCR assay to estimate its clinical relevance in lymphoma.Methods Recombinant plasmid Was constructed with target cDNA obtained from isolated total RNA by RT-PCR After PCR products were identified and purified,recombined plasmids were quantitated and then acted as quantitative standard.A new real time FQ-PCR analysis system Was established with the second pair of primers and the probe after amplification condition and the concentrations of components were optimized.HGF mRNA expressions in 47 lymohoma cases[11 Hodgkin disease(HD) cases,36 non-Hodgkin lyphoma(NHL)cases.among these patients,36 patients in remission while 11 patients without remission ] were analyzed quantitatively,and its specificity and sensitivity for lymphoma diagnosis were evaluated by receiptor operation character(ROC)curve method.Results HGF mRNA quantitative standard was constructed successfully.and its real time FO.PCR analysis system Was established combined with hot.start PCR and down.touch PCR technique. According to slope of standard curve (-3.513)and correlation cofficient(0.999),amplification efficiency of the system was 92.6%.Coefficient variation of intra-assay,intra-day and inter-day-assay were 2.1%,4.0% and 6.8%,respectively.Sensitivity of FQ-PCR Was 2 eopies/μl.Expressions of HGF mRNA in lymphoma group Was higher than that in control group(6.425±2.172 and 0.317±0.192,respectively,t=15.883,P0.05).According to ROC analysis,its sensitivity and specificity were 93.6% and 100% when cutoff value for lymphoma clinical diagnosis Was 3.136.Conclusion HGF mRNA'8 quantitative standard and its real time F9-PCR analysis system have been successfully constructed,and it can be used for quantitative detection of its mRNA expression in lymphoma.%目的 构建肝细胞生长因子(HGF)mRNA定量标准,建立实时荧光定量(FQ)-PCR检测

  3. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  4. STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Honcharova S.Y.

    2015-08-01

    Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

  5. Exploiting the tetrazine-norbornene reaction for single polymer chain collapse.

    Science.gov (United States)

    Hansell, Claire F; Lu, Annhelen; Patterson, Joseph P; O'Reilly, Rachel K

    2014-04-21

    Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and (1)H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated.

  6. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;

    2015-01-01

    Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  7. Preliminary evaluation of the ligase chain reaction for specific detection of Neisseria gonorrhoeae.

    OpenAIRE

    Birkenmeyer, L; Armstrong, A S

    1992-01-01

    Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the ...

  8. [Comparison of direct microscopy, culture and polymerase chain reaction methods for the diagnosis of cutaneous leishmaniasis].

    Science.gov (United States)

    Ertabaklar, Hatice; Özlem Çalışkan, Serçin; Boduç, Erengül; Ertuğ, Sema

    2015-01-01

    Cutaneous leishmaniasis (CL) is an endemic disease especially in Southeastern Anatolia of Turkey and recently shows a trend for spread to other regions of the country including the Aegean region. The diagnosis of CL is based on combined evaluation of epidemiological data with the clinical symptoms and laboratory findings. Direct microscopic examination and culture methods are mainly used in the routine diagnosis of CL, while molecular methods are mainly used for research. The aim of this study was to detect the presence of Leishmania spp. in samples obtained from CL-suspected patients by using direct microscopy, culture and polymerase chain reaction (PCR) methods and to compare the results. A total of 55 patients who were admitted to Parasitology Laboratory of Adnan Menderes University Hospital, Aydin (located at Aegean region in Turkey), between 2012-2014 were included in the study. Smear preparations from the skin lesions of cases were fixed and stained with Giemsa, and the presence of amastigote forms were evaluated by direct microscopy. NNN medium was used for the cultivation of samples. Total genomic DNA of Leishmania from the samples were extracted with a commercial kit (NucleoSpin Tissue(®) Kit, Macherey-Nagel, Germany) and PCR was performed by using 13A and 13B primers to amplify the 116 base pair fragment of Leishmania spp. specific kinetoplast DNA. Amastigotes were observed in 29 (53%) of the 55 samples by direct microscopy, promastigotes were detected among 34 (62%) samples in culture, and parasite-specific amplicons were revealed in 30 (55%) samples by PCR. All assays were positive in 24 patients while in 18 patients all of the tests yielded negative results. Thirty-seven (67%) out of 55 cases were diagnosed as CL when reactivity in at least one of these three methods were considered as positive. Accordingly the positivity rates of the methods were 78.4% (29/37) for direct microscopy, 92% (34/37) for culture and 81.1% (30/37) for PCR in CL

  9. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng

    2015-05-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  10. Rapid detection of Candida albicans by polymerase spiral reaction assay in clinical blood samples

    Directory of Open Access Journals (Sweden)

    Xiaoqun eJiang

    2016-06-01

    Full Text Available Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2, a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non- C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional PCR to compare their sensitivities. The detection limit of PSR was 6.9 pg/µl within 1 h, 10-fold higher than that of PCR (69.0 pg/µl. Blood samples (n=122 were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing.

  11. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  12. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

    Science.gov (United States)

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

    2015-03-01

    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. PMID:23000800

  13. A novel high-throughput format assay for HIV-1 integrase strand transfer reaction using magnetic beads

    Institute of Scientific and Technical Information of China (English)

    Hong-qiu HE; Xiao-hui MA; Bin LIU; Wei-zu CHEN; Cun-xin WANG; Shao-hui CHENG

    2008-01-01

    Aim:To develop a novel high-throughput format assay to monitor the integrase (IN) strand transfer (ST) reaction in vitro and apply it to a reaction character study and the identification of antiviral drugs.Methods:The donor DNA duplex,with a sequence identical to the U5 end of HIV-1 long terminal repeats,is labeled at its 5' end with biotin (BIO).The target DNA duplex is labeled at its 3' end with digoxin (DIG).IN mediates the integration of donor DNA into target DNA and results in a 5' BIO and 3' DIG-labeled duplex DNA product.Streptavidin-coated magnetic beads were used to capture the product,and the amount of DIG was measured as the ST reaction product.The assay was optimized in 96-well microplate format for high-throughput screening purpose.Moreover,the assay was applied in a ST reaction character study,and the efficiency of the assay in the identification of antiviral compounds was tested.Results:The end-point values,measured as absorbance at 405 nm was approximately 1.5 for the IN-mediated ST reaction as compared with no more than 0.05 of background readings.The ST reaction char-acter and the half maximal inhibitory concentration (IC50) values of 2 known IN inhibitors obtained in our assay were similar to previously reported results using other assays.The evaluation parameter Z' factor for this assay ranged from 0.6 to 0.9.Conclusion:The assay presented here has been proven to be rapid,sensitive,and specific for the detection of IN ST activity,the reaction character study,as well as for the identification of antiviral drugs targeting IN.

  14. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    Science.gov (United States)

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  15. Prenatal diagnosis of Down syndrome using cell-free fetal DNA in amniotic fluid by quantitative fluorescent polymersase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wu Dan; Chi Hongbin; Shao Minjie; Wu Yao; Jin Hongyan; Wu Baiyan; Qiao Jie

    2014-01-01

    Backgroud Amniotic fluid (AF) supernatant contains cell-free fetal DNA (cffDNA) fragments.This study attempted to take advantage of cffDNA as a new material for prenatal diagnosis,which could be combined with simple quantitative fluorescent polymerase chain reaction (QF-PCR) to provide an ancillary method for the prenatal diagnosis of trisomy 21 syndrome.Methods AF supernatant samples were obtained from 27 women carrying euploid fetuses and 28 women carrying aneuploid fetuses with known cytogenetic karyotypes.Peripheral blood samples of the parents were collected at the same time.Short tandem repeat (STR) fragments on chromosome 21 were amplified by QF-PCR.Fetal condition and the parental source of the extra chromosome could be determined by the STR peaks.Results The sensitivity of the assay for the aneuploid was 93% (26/28; confidence interval,CI:77%-98%) and the specificity was 100% (26/26; CI:88%-100%).The determination rate of the origin of the extra chromosome was 69%.The sensitivity and the specificity of the assay in the euploid were 100% (27/27).Conclusions Trisomy 21 can be prenatally diagnosed by the QF-PCR method in AF supernatant.This karyotype analysis method greatly reduces the requirement for the specimen size.It will be a benefit for early amniocentesis and could avoid pregnancy complications.The method may become an ancillary method for prenatal diagnosis of trisomy 21.

  16. Potential of polymerase chain reaction and galactomannan for the diagnosis of invasive aspergillosis in patients with febrile neutropenia.

    Science.gov (United States)

    Aslan, Muge; Oz, Yasemin; Aksit, Filiz; Akay, Olga M

    2015-06-01

    The incidence of invasive aspergillosis (IA) has increased over the last years, especially in immuncompromised patients with high mortality rates. Because of difficulties about the diagnosis; serological methods [galactomannan (GM) antigen test] and polymerase chain reaction (PCR) developed in recent years. MycAssay Aspergillus PCR performance in the diagnosis of IA was evaluated and compared with the GM and in-house PCR. This study was conducted with 358 serum samples obtained from 99 patient with febrile neutropenic episodes who were followed in haematology and bone marrow transplantation units. Patients were classified by the European Organization for the Research and Treatment of Cancer/Mycoses Study Group criteria, 18 of them is proven and probable IA. GM antigen test and two different real-time PCR; one of them is fist commercial PCR for IA; Mycassay Aspergillus and the other one is in-house real-time PCR performed. Sensitivity values were Mycassay Aspergillus PCR, in-house PCR, and GM 65.38%, 11.53% and 23.07%, respectively. The high sensitivity obtained from Mycassay Aspergillus PCR and sensitivity is increased by using a combination of diagnostic methods. GM antigen test and real-time PCR could be beneficial for early diagnosis and treatment of IA. For routine usage of PCR as diagnostic assay more studies needed in future.

  17. Comparison of serology, antigenemia assay and the polymerase chain reaction for monitoring active cytomegalovirus infections in hematopoietic stem cell transplantation patients Estudo comparativo entre sorologia, antigenemia e reação em cadeia da polimerase para o monitoramento da infecção por citomegalovírus em pacientes receptores de transplantes de células progenitoras hematopoéticas

    Directory of Open Access Journals (Sweden)

    Sandra Helena Alves Bonon

    2006-10-01

    Full Text Available Forty-six allogeneic hematopoietic stem cell transplantation (HSCT patients were monitored for the presence of CMV antibodies, CMV-DNA and CMV antigens after transplantation. Immunoenzymatic serological tests were used to detect IgM and the increase in CMV IgG antibodies (increase IgG, a nested polymerase chain reaction (N-PCR was used to detect CMV-DNA, and an antigenemia assay (AGM was used to detect CMV antigens. The presence of CMV-IgM and/or CMV-increase IgG antibodies was detected in 12/46 (26.1% patients, with a median time between HSCT and the detection of positive serology of 81.5 days. A positive AGM was detected in 24/46 (52.2% patients, with a median time between HSCT and antigen detection of 62 days. Two or more consecutive positive N-PCR results were detected in 32/46 (69.5% patients, with a median time between HSCT and the first positive PCR of 50.5 days. These results confirmed that AGM and mainly PCR are superior to serology for the early diagnosis of CMV infection. Six patients had CMV-IgM and/or CMV-increase IgG with a negative AGM (five cases or N-PCR assay (one case. In five of these cases the serological markers were detected during the first 100 days after HSCT, the period of highest risk. These findings support the idea that serology may be useful for monitoring CMV infections in HSCT patients, especially when PCR is unavailable.Quarenta e seis pacientes receptores de transplantes de células progenitoras hematopoéticas (TCPH foram monitorados em relação à infecção ativa por citomegalovírus (CMV. Testes sorológicos imunoenzimáticos foram utilizados para a detecção de anticorpos IgM e elevação significativa das concentrações de anticorpos IgG (aumento IgG, nested-PCR (N-PCR foi utilizada para a detecção de CMV-DNA e antigenemia (AGM para a detecção de antígenos virais. A presença de CMV-IgM e/ou CMV-aumento IgG foi detectada em 12/46 (26,1% pacientes, sendo o tempo mediano entre o transplante e a detec

  18. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C2H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH3; and ammonia, which produces NH2. In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  19. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  20. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms.

    Science.gov (United States)

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

    2016-03-01

    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The

  1. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    Science.gov (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  2. Enzyme catalysis-electrophoresis titration for multiplex enzymatic assay via moving reaction boundary chip.

    Science.gov (United States)

    Zhong, Ran; Xie, Haiyang; Kong, Fanzhi; Zhang, Qiang; Jahan, Sharmin; Xiao, Hua; Fan, Liuyin; Cao, Chengxi

    2016-09-21

    In this work, we developed the concept of enzyme catalysis-electrophoresis titration (EC-ET) under ideal conditions, the theory of EC-ET for multiplex enzymatic assay (MEA), and a related method based on a moving reaction boundary (MRB) chip with a collateral channel and cell phone imaging. As a proof of principle, the model enzymes horseradish peroxidase (HRP), laccase and myeloperoxidase (MPO) were chosen for the tests of the EC-ET model. The experiments revealed that the EC-ET model could be achieved via coupling EC with ET within a MRB chip; particularly the MEA analyses of catalysis rate, maximum rate, activity, Km and Kcat could be conducted via a single run of the EC-ET chip, systemically demonstrating the validity of the EC-ET theory. Moreover, the developed method had these merits: (i) two orders of magnitude higher sensitivity than a fluorescence microplate reader, (ii) simplicity and low cost, and (iii) fairly rapid (30 min incubation, 20 s imaging) analysis, fair stability (<5.0% RSD) and accuracy, thus validating the EC-ET method. Finally, the developed EC-ET method was used for the clinical assay of MPO activity in blood samples; the values of MPO activity detected via the EC-ET chip were in agreement with those obtained by a traditional fluorescence microplate reader, indicating the applicability of the EC-ET method. The work opens a window for the development of enzymatic research, enzyme assay, immunoassay, and point-of-care testing as well as titration, one of the oldest methods of analysis, based on a simple chip.

  3. Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

    Science.gov (United States)

    Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

    2015-03-01

    Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. PMID:25776549

  4. Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

    Science.gov (United States)

    Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

    2015-03-01

    Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons.

  5. Polymerase chain reaction detection of Leishmania DNA in skin biopsy samples in Sri Lanka where the causative agent of cutaneous leishmaniasis is Leishmania donovani.

    Science.gov (United States)

    Ranasinghe, Shalindra; Wickremasinghe, Renu; Hulangamuwa, Sanjeeva; Sirimanna, Ganga; Opathella, Nandimithra; Maingon, Rhaiza D C; Chandrasekharan, Vishvanath

    2015-12-01

    Leishmania donovani is the known causative agent of both cutaneous (CL) and visceral leishmaniasis in Sri Lanka. CL is considered to be under-reported partly due to relatively poor sensitivity and specificity of microscopic diagnosis. We compared robustness of three previously described polymerase chain reaction (PCR) based methods to detect Leishmania DNA in 38 punch biopsy samples from patients presented with suspected lesions in 2010. Both, Leishmania genus-specific JW11/JW12 KDNA and LITSR/L5.8S internal transcribed spacer (ITS)1 PCR assays detected 92% (35/38) of the samples whereas a KDNA assay specific forL. donovani (LdF/LdR) detected only 71% (27/38) of samples. All positive samples showed a L. donovani banding pattern upon HaeIII ITS1 PCR-restriction fragment length polymorphism analysis. PCR assay specificity was evaluated in samples containing Mycobacterium tuberculosis, Mycobacterium leprae, and human DNA, and there was no cross-amplification in JW11/JW12 and LITSR/L5.8S PCR assays. The LdF/LdR PCR assay did not amplify M. leprae or human DNA although 500 bp and 700 bp bands were observed in M. tuberculosis samples. In conclusion, it was successfully shown in this study that it is possible to diagnose Sri Lankan CL with high accuracy, to genus and species identification, using Leishmania DNA PCR assays.

  6. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time reverse-transcription polymerase chain reaction and virus isolation.

    Science.gov (United States)

    Goodell, Christa K; Zhang, Jianqiang; Strait, Erin; Harmon, Karen; Patnayak, Devi; Otterson, Tracy; Culhane, Marie; Christopher-Hennings, Jane; Clement, Travis; Leslie-Steen, Pamela; Hesse, Richard; Anderson, Joe; Skarbek, Kevin; Vincent, Amy; Kitikoon, Pravina; Swenson, Sabrina; Jenkins-Moore, Melinda; McGill, Jodi; Rauh, Rolf; Nelson, William; O'Connell, Catherine; Shah, Rohan; Wang, Chong; Main, Rodger; Zimmerman, Jeffrey J

    2016-01-01

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 assays based on real-time reverse-transcription polymerase chain reaction (rRT-PCR) and 7 assays based on virus isolation (VI). The OF specimens were inoculated with H1N1 or H3N2 IAV and serially diluted 10-fold (10(-1) to 10(-8)). Eight participating laboratories received 180 randomized OF samples (10 replicates × 8 dilutions × 2 IAV subtypes plus 20 IAV-negative samples) and performed the rRT-PCR and VI procedure(s) of their choice. Analysis of the results with a mixed-effect logistic-regression model identified dilution and assay as variables significant (P PCR or VI. Virus subtype was not significant for IAV detection by either rRT-PCR (P = 0.457) or VI (P = 0.101). For rRT-PCR the cycle threshold (Ct) values increased consistently with dilution but varied widely. Therefore, it was not possible to predict VI success on the basis of Ct values. The success of VI was inversely related to the dilution of the sample; the assay was generally unsuccessful at lower virus concentrations. Successful swine health monitoring and disease surveillance require assays with consistent performance, but significant differences in reproducibility were observed among the assays evaluated.

  7. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wei-Ping Qian; Li-Ka Shing; Yue-Qiu Tan; Ying Chen; Ying Peng; Zhi Li; Guang-Xiu Lu; Marie C. Lin; Hsiang-Fu Kung; Ming-Ling He

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen.METHODS: Hepatitis B viral DNA was isolated from HBV carriers' semen and sera using phenol extraction method and QTAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction.RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5×107 and 1.67×107 copies of HBV DNA per mL in two HBV infected patients' sera, while 2.L4×105 and 3.02×105 copies of HBV DNA per mL in the semen.CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen.

  8. Application of the ligase chain reaction to the detection of nisinA and nisinZ genes in Lactococcus lactis ssp. lactis.

    Science.gov (United States)

    Ward, L J; Brown, J C; Davey, G P

    1994-03-15

    This paper reports on the application of the ligase chain reaction (LCR) to the specific detection of variants of the nisin structural gene (nisinA and nisinZ) in nisin producing strains of Lactococcus lactis ssp lactis. The LCR assay was used to screen nisin producing strains to determine which form of the nisin structural gene they contained. This method of differentiating the nisin structural gene variants provides a useful alternative to the only other available genetic differentiation, that of sequencing the gene.

  9. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    OpenAIRE

    Jain, V K; Kumar, S.; Sharma, A.; N. Sindhu

    2010-01-01

    In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in...

  10. Polymerase chain reaction assay for the detection of Bacillus cereus group cells

    DEFF Research Database (Denmark)

    Hansen, Bjarne Munk; Leser, Thomas D.; Hendriksen, Niels Bohse

    2001-01-01

    Recent investigations have shown that members of the Bacillus cereus group carry genes which have the potential to cause gastrointestinal and somatic diseases. Although most cases of diseases caused by the B. cereus group bacteria are relatively mild, it is desirable to be able to detect members ...

  11. Development of a species-specific polymerase chain reaction assay for Gardnerella vaginalis

    NARCIS (Netherlands)

    A.F. van Belkum (Alex); A. Koeken (A.); A.M. Vandamme (Anne Mieke); M. van Esbroeck (M.); H. Goossens; J. Koopmans (J.); J.C. Kuijpers (Johan); E. Falsen (E.); W.G.V. Quint (Wim)

    1995-01-01

    textabstractThe nucleotide sequence of the region between the 16S and 23S rRNA genes of the facultative anaerobic bacteriumGardnerella vaginalishas been determined, together with the 5′ proximal 500 nucleotides of the 23S rRNA gene. Regions suited for the development of specific, probe-confirmable p

  12. ACUTE ENTERIC INFECTIONS POLYMERASE CHAIN REACTION ASSAY IN PEDIATRIC PRACTICE: OPPORTUNITIES AND CHALLENGES

    Directory of Open Access Journals (Sweden)

    E. D. Sokolova

    2016-01-01

    Full Text Available The aim of the study is estimate the opportunities of local multi-prime PCR reagents kits in children enteric infections etiological diagnostics amongst the patients with diarrhoea vs traditional bacteriological methods. We used 4 kits of reagents that provide multiple pathogens simultaneous indication in one sample: 1 Rotavirus, Norovirus, Astrovirus; 2 Shigella spp./EIEC, Salmonella spp., Campylobacter spp.; 3 Yersinia enterocolitica and Yersinia pseudotuberculosis; 4 E. coli: EIEC (enteroinvasive, EPEC (enteropathogenic, ETEC (enterotoxigenic, EHEC (enterohaemorrhagic, EAgEC (enteroaggregative. It has been shown that the viral intestinal infections is increased by 14%, bacterial — in 2,5 times. PCR diagnostics identified in 62% of patients the viral gastroenteritis: Rotavirus (52%, Norovirus (9%, Astrovirus (1%. Detected bacterial pathogens PCR markers number proved up to 2.5 times high than according to bacteriological examination. The spectrum of bacterial agents increased due to E. coli and Y. enterocolitica. PCR diagnostics increased detection of Campylobacter up to 2 times. Detected E. coli DNA prevalence: EPEC — 66%, EAgEC, ETEC and EHEC were 31%, 9% and 4%, respectively. DNA Campylobacter spp. and E. coli constituted 2/3 of all findings: Campylobacter spp. (41%, E. coli (24%, Salmonella spp. (19%, Yersinia spp. (11%, Shigella spp./EIEC (5%. The positive results of bacteriological and serological methods duplicate the positive results of PCR diagnostics. In general, the positive results of PCR diagnosis of bacterial pathogens were detected in 46.35% of the examined patients. In 48.4% of patients identified PCR markers viral — bacterial infection, in 5.25% — of bacterial associations, in 11% of them were found the DNA 2–3 bacterial pathogens. The study was shown in children in St. Petersburg in 2012–2014 dominated rotavirus infection, campylobacteriosis and escherichiosis. The prevalence of viral-bacterial confections is more than 50% of all diagnosed cases.

  13. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline;

    2015-01-01

    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma...

  14. Genome editing. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations.

    Science.gov (United States)

    Gantz, Valentino M; Bier, Ethan

    2015-04-24

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype, whereas individuals homozygous for two copies of the allele will display a mutant phenotype. We have developed a method called the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome-editing system for generating autocatalytic mutations, to produce homozygous loss-of-function mutations. In Drosophila, we found that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome, thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  15. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Miagostovich Marize Pereira

    1997-01-01

    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  16. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    OpenAIRE

    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini

    2008-01-01

    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  17. [Detection of leptospirosis reservoirs in Madagascar using the polymerase chain reaction technique].

    Science.gov (United States)

    Ralaiarijaona, R L; Bellenger, E; Chanteau, S; Roger, F; Pérolat, P; Rasolofo Razanamparany, V

    2001-01-01

    A polymerase chain reaction (PCR) technique was used for detection of the Leptospira interrogans rrs gene in kidney tissue from 115 rats, 50 zebu cattles and 13 pigs in an attempt to identify a possible animal reservoir of leptospirosis in Madagascar. In addition, serological testing of 105 individuals in close contact with animals was carried out. The PCR analysis was negative for all the samples tested and only one person was found seropositive at a low titer. The findings suggest that leptospirosis, if prevalent in Madagascar, is likely rare.

  18. [Identification of the causative agents of glanders and melioidosis by polymerase chain reaction].

    Science.gov (United States)

    Tkachenko, G A; Antonov, V A; Zamaraev, V S; Iliukhin, V I

    2003-01-01

    Burkholderia mallei and B. pseudomallei are causative agents of glanders and melioidosis, respectively, i.e. severe and fatal infection diseases of man and animal. The computer-based analysis of the 23S rRNA gene sites was used for selecting the primers. Two pairs of primers were chosen for the identification of B. mallei and Bpseudomallei. DNAs from 48 B. pseudomallei and 15 strains of B. mallei, unlike from other geterological bacteria, were positively amplified. Therefore, the method of polymerase chain reaction can be used in laboratory diagnosis of glanders and melioidosis.

  19. Preparative isolation of polymerase chain reaction products using mixed-mode chromatography.

    Science.gov (United States)

    Matos, T; Silva, G; Queiroz, J A; Bülow, L

    2015-11-15

    The polymerase chain reaction (PCR) has become one of the most useful techniques in molecular biology laboratories around the world. The purification of the target DNA product is often challenging, however, and most users are restricted to employing available commercial kits. The recent developments in mixed-mode chromatography have shown higher selectivity for a variety of nucleic acid-containing samples. Capto Adhere is a mixed-mode chromatography resin that offers a high-selectivity ligand and is here applied for the purification of amplified DNAs from PCR mixtures in a 10-min single step, with yields above 95%, high linearity, and high precision for different concentrations.

  20. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  1. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan

    2004-01-01

    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  2. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.

    OpenAIRE

    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W

    1992-01-01

    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  3. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    OpenAIRE

    Liang Gaofeng; Ma Chao; Zhu Yanliang; Li Shuchun; Shao Youhua; Wang Yong; Xiao Zhongdang

    2010-01-01

    Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase ...

  4. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction

    OpenAIRE

    Alexandrakis, G.; JALALI, S; Gloor, P

    1998-01-01

    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In o...

  5. Identifiability of parameters and behaviour of MCMC chains: a case study using the reaction norm model.

    Science.gov (United States)

    Shariati, M M; Korsgaard, I R; Sorensen, D

    2009-04-01

    Markov chain Monte Carlo (MCMC) enables fitting complex hierarchical models that may adequately reflect the process of data generation. Some of these models may contain more parameters than can be uniquely inferred from the distribution of the data, causing non-identifiability. The reaction norm model with unknown covariates (RNUC) is a model in which unknown environmental effects can be inferred jointly with the remaining parameters. The problem of identifiability of parameters at the level of the likelihood and the associated behaviour of MCMC chains were discussed using the RNUC as an example. It was shown theoretically that when environmental effects (covariates) are considered as random effects, estimable functions of the fixed effects, (co)variance components and genetic effects are identifiable as well as the environmental effects. When the environmental effects are treated as fixed and there are other fixed factors in the model, the contrasts involving environmental effects, the variance of environmental sensitivities (genetic slopes) and the residual variance are the only identifiable parameters. These different identifiability scenarios were generated by changing the formulation of the model and the structure of the data and the models were then implemented via MCMC. The output of MCMC sampling schemes was interpreted in the light of the theoretical findings. The erratic behaviour of the MCMC chains was shown to be associated with identifiability problems in the likelihood, despite propriety of posterior distributions, achieved by arbitrarily chosen uniform (bounded) priors. In some cases, very long chains were needed before the pattern of behaviour of the chain may signal the existence of problems. The paper serves as a warning concerning the implementation of complex models where identifiability problems can be difficult to detect a priori. We conclude that it would be good practice to experiment with a proposed model and to understand its features

  6. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain...

  7. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO;

    1993-01-01

    CP-specific B lymphocytes were isolated by antigen-coated immunomagnetic beads. After the purification, at least 98% of the immunoglobulin-secreting recovered cells were HibCP specific. The RNA was isolated and amplified by cDNA synthesis using a kappa constant region primer followed by polymerase chain...... reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...

  8. Evaluation of the mitochondrial respiratory chain and oxidative phosphorylation system using polarography and spectrophotometric enzyme assays.

    Science.gov (United States)

    Barrientos, Antoni; Fontanesi, Flavia; Díaz, Francisca

    2009-10-01

    The oxidative phosphorylation (OXPHOS) system consists of five multimeric complexes embedded in the mitochondrial inner membrane. They work in concert to drive the aerobic synthesis of ATP. Mitochondrial and nuclear DNA mutations affecting the accumulation and function of these enzymes are the most common cause of mitochondrial diseases and have also been associated with neurodegeneration and aging. For this reason, several approaches for the assessment of the OXPHOS system enzymes have been developed. Based on the methods described elsewhere, the assays describe methods that form a biochemical characterization of the OXPHOS system in cells and mitochondria isolated from cultured cells or tissues.

  9. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  10. Amplification refractory mutation system polymerase chain reaction versus optimized polymerase chain reaction restriction-fragment length polymorphism for apolipoprotein E genotyping of majorly depressed patients.

    Science.gov (United States)

    You, Hongmin; Chen, Jin; Zhou, Jingjing; Huang, Hua; Pan, Junxi; Wang, Ziye; Lv, Lin; Zhang, Lujun; Li, Juan; Qin, Bin; Yang, Yongtao; Xie, Peng

    2015-11-01

    Major depressive disorder (MDD) is a prevalent, debilitating mood disorder that has been associated with several genetic polymorphisms. One such polymorphism, namely that of apolipoprotein E (APOE), has three allelic forms (ε2, ε3 and ε4) that encode for six unique isoforms of the APOE protein. A growing number of techniques have been developed for APOE genotyping; however, not all polymerase chain reaction (PCR)‑based genotyping techniques are equally accurate or cost‑effective. In order to find a more accurate and cost‑effective APOE genotyping method for MDD screening in large populations, the present study comparatively evaluated two genotyping methods, amplification refractory mutation system PCR (ARMS‑PCR) and optimized PCR restriction‑fragment length polymorphism (PCR‑RFLP), in blood samples taken from a population of 708 MDD patients. Although either of the two methods were able to detect all six unique APOE genotypes, comparisons of the two methods with Sanger sequencing demonstrated that ARMS‑PCR (94%) was significantly more accurate than optimized PCR‑RFLP (82%). ARMS‑PCR should prove useful in quickly verifying ambiguous results obtained by other APOE genotyping methods and can be cost-effectively performed in the setting of a small laboratory or a population-based screening program.

  11. Comparison of DNA extraction protocols for Mycobacterium Tuberculosis in diagnosis of tuberculous meningitis by real-time polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Rajeev Thakur

    2011-01-01

    Full Text Available Background: Several nucleic acid amplification techniques are available for detection of Mycobacterium tuberculosis (MTB in pulmonary and extrapulmonary samples, but insufficient data are available on the diagnostic utility of these techniques in tubercular meningitis where bacilli load is less. The success of final amplification and detection of nucleic acid depends on successful extraction of DNA from the organism. Aims: We performed this study to compare four methods of extraction of MTB DNA from cerebrospinal fluid (CSF samples so as to select one method of DNA extraction for amplification of nucleic acid from clinical samples. Materials and Methods: Four methods of extracting MTB DNA from CSF samples for testing by real-time polymerase chain reaction (PCR were compared: QIAGEN R protocol for DNA purification using QIAamp spin procedure (manual, AMPLICOR R respiratory specimen preparation kit, MagNA Pure R kit extraction, combined manual DNA extraction with automated extraction by MagNA Pure R . Real-time PCR was performed on COBAS TaqMan 48 Analyzer R with known positive and negative controls. Results: The detection limit for the combined manual and MagNA Pure R extraction protocol was found to be 100 copies of MTB DNA per reaction as against 1,000 copies of MTB DNA per reaction by the QIAGEN R , AMPLICOR R , and the MagNA Pure R extraction protocol. Conclusion: The real-time PCR assay employing the combination of manual extraction steps with MagNA Pure R extraction protocol for extraction of MTB DNA proved to be better than other extraction methods in analytical sensitivity, but could not detect less than 10 2 bacilli /ml.

  12. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......) x s(-1)) > backbone amides (10-10(-3) M(-1) x s(-1)) > Gln(0.03 M(-1) x s(-1)) approximately Asn (0.03 M(-1) x s(-1)). The rate constants for reaction of HOCl with backbone amides (peptide bonds) vary by 4 orders of magnitude with uncharged peptide bonds reacting more readily with HOCl than those...

  13. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.

    2009-01-01

    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  14. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.

    2001-03-08

    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  15. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction.

    Science.gov (United States)

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin

    2008-01-01

    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems. PMID:17904730

  16. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  17. Detection and differentiation of Cryptosporidium by real-time polymerase chain reaction in stool samples from patients in Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Flávia Ribeiro Rolando

    2012-06-01

    Full Text Available This study reports the first genetic characterisation of Cryptosporidium isolates in Brazil using real-time polymerase chain reaction (RT-PCR. A total of 1,197 faecal specimens from children and 10 specimens from human immunodeficiency virus-infected patients were collected between 1999-2010 and screened using microscopy. Forty-eight Cryptosporidium oocyst-positive isolates were identified and analysed using a generic TaqMan assay targeting the 18S rRNA to detect Cryptosporidium species and two other TaqMan assays to identify Cryptosporidium hominis and Cryptosporidium parvum. The 18S rRNA assay detected Cryptosporidium species in all 48 of the stool specimens. The C. parvum TaqMan assay correctly identified five/48 stool samples, while 37/48 stool specimens were correctly amplified in the C. hominis TaqMan assay. The results obtained in this study support previous findings showing that C. hominis infections are more prevalent than C. parvum infections in Brazil and they demonstrate that the TaqMan RT-PCR procedure is a simple, fast and valuable tool for the detection and differentiation of Cryptosporidium species.

  18. Performance of an in-house real-time polymerase chain reaction for identification of Mycobacterium tuberculosis isolates in laboratory routine diagnosis from a high burden setting

    Science.gov (United States)

    Gallo, Juliana Failde; Pinhata, Juliana Maira Watanabe; Chimara, Erica; Gonçalves, Maria Gisele; Fukasawa, Lucila Okuyama; de Oliveira, Rosangela Siqueira

    2016-01-01

    Abstract Brazil is one of the high burden countries for tuberculosis, and a rapid diagnosis is essential for effective control of the disease. In the present study, an in-house real-time polymerase chain reaction (PCR) assay targeting the mpt64 gene for identification of Mycobacterium tuberculosis complex isolates was evaluated under routine diagnosis conditions in a reference laboratory. From May 2011 to July 2012, 1,520 isolates of mycobacteria were prospectively submitted for phenotypic and/or PRA-hsp65 identification and to real-time PCR. The mpt64 real-time PCR showed 99.7% sensitivity and 96% specificity and detected 79.4% of the cases missed by phenotypic and PRA-hsp65 identification. The in-house real-time PCR assay showed high sensitivity and specificity and was successfully implemented in the routine diagnosis of tuberculosis in a reference laboratory from a high burden setting. PMID:27598243

  19. Use of sodC versus ctrA for real-time polymerase chain reaction-based detection of Neisseria meningitidis in sterile body fluids

    Directory of Open Access Journals (Sweden)

    Fábio Takenori Higa

    2013-04-01

    Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.

  20. Development of multiplex real-time polymerase chain reaction for detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in clinical specimens.

    Science.gov (United States)

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-10-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas.

  1. High-throughput real-time assay based on molecular beacons for HIV-1 integrase 3'-processing reaction

    Institute of Scientific and Technical Information of China (English)

    Hong-qiu HE; Xiao-hui MA; Bin LIU; Xiao-yi ZHANG; Wei-zu CHEN; Cun-xin WANG; Shao-hui CHENG

    2007-01-01

    Aim: To develop a high-throughput real-time assay based on molecular beacons to monitor the integrase 3'-processing reaction in vitro and apply it to inhibitor screening.Methods: The recombinant human immunodeficiency virus (HIV)-1 integrase (IN) is incubated with a 38 mer oligonucleotide substrate, a sequence identical to the U5 end of HIV-1 long terminal repeats (LTR). Based on the fluores-cence properties of molecular beacons, the substrate is designed to form a stem-loop structure labeled with a fluorophore at the 5' end and a quencher at the 3'end.IN cleaves the terminal 3'-dinucleotide containing the quencher, resulting in an increase in fluorescence which can be monitored on a spectrofluorometer. To optimize this assay, tests were performed to investigate the effects of substrates, enzyme and the metal ion concentrations on the IN activity and optimal param-eters were obtained. Moreover, 2 IN inhibitors were employed to test the perfor-mance of this assay in antiviral compound screening.Results: The fluorescent intensity of the reaction mixture varies linearly with time and is proportional to the velocity of the 3'-processing reaction. Tests were performed and the results showed that the optimal rate was obtained for a reaction mixture containing 50 mg/L recom-binant HIV-1 IN, 400 nmol/L substrate, and 10 mmol/L Mn2+. The IN 3'-processing reaction under the optimal conditions showed a more than 18-fold increase in the fluorescence intensity compared to the enzyme-free control. The IC50 values of the IN inhibitors obtained in our assay were similar to the values obtained from a radiolabeled substrate assay.Conclusion: Our results demonstrated that this is a fast, reliable, and sensitive method to monitor HIV IN 3'-processing reaction and that it can be used for inhibitor screening.

  2. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from sheep of Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.

    2013-05-01

    Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.

  3. Identification of HIV-1 Genotypic Resistance in Patients on First-line Antiretroviral Therapy Using Polymerase Chain Reaction and Sequencing

    Institute of Scientific and Technical Information of China (English)

    Jiang Xiao; Gui-ju Gao; Hong-xin Zhao; Yan-mei Li; Ying-xiu Huang; Wen Zhang; Wen-jing Su; Wei Zhang; Ning Han; Di Yang; Xin Li

    2013-01-01

    Objective The aim of the study was to evaluate the characteristics of HIV drug-genotypic resistance among patients taking ifrst-line ARV regimens using polymerase chain reaction and sequencing, and guide to design optimal ARV regimens for these patients. Methods HIV reverse transcriptase-encoded gene was ampliifed with RT-PCR and ampliifed PCR products were aligned and comparatively analyzed with HIV resistance database to ifnd drug-resistance mutations. Results Twenty-eight PCR products were amplified and sequenced successfully in 30 serum samples of recruited HIV-infected patients with virologic failure. The resistance rate was 96%, mutations in NRT region were found in 26 patients (93%), while mutations in NNRT region were found in 27 patients (96%). M184V was the most common mutation (86%), K65R was selected in 14%of recruited individuals and TAMs occurred in 50%of patients, which resulted in resistance to NRTIs. Y181C and V179D were the most common mutations in NNRTIs and prevalence was 43%(12/28) and 36%(10/28), respectively, which resulted in cross-resistance to NNRTIs due to low-genetic barrier. Conclusions Virologic failure may occur in long-term administration of ifrst-line ARV regimens, and drug-resistance mutations can be found in these patients, which resulted in resistance to ifrst-line ARV regimens. We emphasized that HIV viral load assay and resistance assay were important tools to guide healthcare workers to design an optimal second-line ARV regimens for HAART-experienced individuals with virologic failure.

  4. Diagnosis of human herpesvirus 6B primary infection by polymerase chain reaction in young children with exanthematic disease

    Directory of Open Access Journals (Sweden)

    Ivna de Melo Magalhães

    2011-06-01

    Full Text Available INTRODUCTION: Exanthem subitum is a classical rash disease of early childhood caused by human herpesvirus 6B (HHV-6B. However, the rash is frequently misdiagnosed as that of either measles or rubella. METHODS: In this study, a nested multiplex polymerase chain reaction (PCR was used to diagnose HHV-6B primary infection, differentiate it from infections caused by HHV-6A and compare it to antibody avidity tests. The samples were separated into case group and control group according to the results of the indirect immunofluorescence assay (IFA technique. RESULTS: From the saliva samples analyzed, HHV-6A DNA was detected in 3.2% of the case group and in 2.6% of the control group. Regarding HHV-6B, PCR detected viral DNA in 4.8% of the case group and in 1.3% of the control group. Among the serum samples studied, a frequency of 1.7% was determined for HHV-6A in the case group and 1.2% in the control group. PCR did not detect HHV-6B DNA in serum samples. The sensitivity and specificity of the PCR technique ranged from 0% to 4.8% and 97.5% to 100%, respectively, compared to IFA. CONCLUSIONS: The PCR technique was not suitable for diagnosing primary infection by HHV-6B in children with exanthematic disease and should not substitute the IFA.

  5. Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sundaran S. Tinky

    2015-04-01

    Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

  6. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  7. Quantitation of mule duck in goose foie gras using TaqMan real-time Polymerase Chain Reaction.

    Science.gov (United States)

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Hernández, Pablo E; Martín, Rosario

    2004-03-24

    A real-time quantitative Polymerase Chain Reaction (PCR) method has been developed for the quantitation of mule duck (Anas platyrhynchos x Cairina moschata) in binary duck/goose foie gras mixtures. The method combines the use of real-time PCR with duck-specific and endogenous control "duck + goose" primers to measure duck content and total foie gras content, respectively. Both PCR systems (duck-specific and duck + goose) were designed on the mitochondrial 12S ribosomal RNA gene (rRNA). The duck-specific system amplifies a 96 bp fragment from duck DNA, whereas the duck + goose system amplifies a 120 bp fragment from duck and goose DNA. The method measures PCR product accumulation through a FAM-labeled fluorogenic probe (TaqMan). The C(t) (threshold cycle) values obtained from the duck + goose system are used to normalize the ones obtained from the duck-specific system. Analysis of experimental duck/goose foie gras binary mixtures demonstrated the suitability of the assay for the detection and quantitation of duck in the range of 1-25%. This genetic marker can be very useful to avoid mislabeling or fraudulent species substitution of goose by duck in foie gras.

  8. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam

    2015-01-01

    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  9. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

    Science.gov (United States)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

    2013-11-01

    An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies.

  10. Development of a polymerase chain reaction (PCR) test for the detection of virulent forms of Vibrio parahaemolyticus.

    Science.gov (United States)

    Kadhim, H M; Miah, A; Munn, C B; Gilpin, M L

    2012-04-01

    Vibrio parahaemolyticus is a marine bacterium and some strains cause gastroenteritis in humans. Clinical isolates are thought to possess virulence factors that are absent from the majority of environmental isolates. Use of randomly amplified polymorphic DNA (RAPD)-PCR produced a unique 600 bp amplicon (band Y) in the majority of clinical isolates and rarely in environmental isolates tested. The DNA from band Y was cloned and sequenced and found to code for an outer membrane protein (OMP). Two polymerase chain reaction (PCR) primers were designed to specifically amplify a 200 bp unique sequence from presumptive virulent strains (PCR-OMP). The virulence of 23 clinical and 32 environmental isolates was assessed in cytotoxicity tests by treatment of Caco-2 cells with extracellular products (ECPs). All but two of the clinical isolates (91%) were positive for the 200 bp PCR-OMP and their ECPs produced a significantly higher (p PCR-OMP is strongly correlated with virulence, as determined by the cytotoxicity assay, and identified virulent forms better than current PCR tests for tdh, trh or T3SS2.

  11. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  12. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    International Nuclear Information System (INIS)

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  13. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    Science.gov (United States)

    Shen, Cenchao; Yang, Wenjuan; Ji, Qiaoli; Maki, Hisaji; Dong, Anjie; Zhang, Zhizhou

    2009-11-01

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  14. Detection of congenital cytomegalovirus infection by real-time polymerase chain reaction analysis of saliva or urine specimens.

    Science.gov (United States)

    Ross, Shannon A; Ahmed, Amina; Palmer, April L; Michaels, Marian G; Sánchez, Pablo J; Bernstein, David I; Tolan, Robert W; Novak, Zdenek; Chowdhury, Nazma; Fowler, Karen B; Boppana, Suresh B

    2014-11-01

    Viral culture of urine or saliva has been the gold standard technique for the diagnosis of congenital cytomegalovirus (CMV) infection. Results of rapid culture and polymerase chain reaction (PCR) analysis of urine and saliva specimens from 80 children were compared to determine the clinical utility of a real-time PCR assay for diagnosis of congenital CMV infection. Results of urine PCR were positive in 98.8% of specimens. Three PCR-positive urine samples were culture negative. Results of saliva PCR and culture were concordant in 78 specimens (97.5%). Two PCR-positive saliva samples were culture negative. These findings demonstrate that PCR performs as well as rapid culture of urine or saliva specimens for diagnosing congenital CMV infection and saliva specimens are easier to collect. Because PCR also offers more rapid turnaround, is unlikely to be affected by storage and transport conditions, has lower cost, and may be adapted to high-throughput situations, it is well suited for targeted testing and large-scale screening for CMV.

  15. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    Directory of Open Access Journals (Sweden)

    R.S. Diaz

    1998-10-01

    Full Text Available For certain applications of the polymerase chain reaction (PCR, it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We used the forward mutation assay to compare the fidelity of Taq polymerase and Thermotoga maritima (ULTMA™ DNA polymerase, an enzyme that does have proofreading activity. We did not find significant differences in the fidelity of either enzyme, even when using optimal buffer conditions, thermal cycling parameters, and number of cycles (0.2% and 0.13% error rates for ULTMA™ and Taq, respectively, after reading about 3,000 bases each. We conclude that for sequencing purposes there is no difference in using a DNA polymerase that contains an inherent 3' to 5' exonuclease activity for DNA amplification. Perhaps the specificity and fidelity of PCR are complex issues influenced by the nature of the target sequence, as well as by each PCR component.

  16. ISOLASI Campylobacter DARI KARKAS AYAM MENGGUNAKAN METODE KONVENSIONAL DAN POLYMERASE CHAIN REACTIONS [Isolation of Campylobacter from Poultry Carcasses using Conventional and Polymerase Chain Reaction Methods

    Directory of Open Access Journals (Sweden)

    Surachmi Setiyaningsih2

    2013-06-01

    Full Text Available Campylobacter jejuni and Campylobacter coli are two spesies of Campylobacter sp. frequently found as pathogenic bacteria causing human gastrointestinal infections. Contaminated chicken carcasses have been reported as the source of human campylobacteriosis. In this study, Campylobacter were isolated from chicken carcasses sold in traditional markets and supermarkets. In traditional markets, chicken carcasses are sold without proper packaging or in an open space and stored at room temperature (25-30°C for prolonged period allowing pathogenic bacteria to grow. While at supermarkets, chicken carcasses are openly displayed or enclosed in plastic wrappings and stored in a refrigerator (4-8°C. A total of 298 samples of chicken carcasses from traditional markets and supermarkets in the area of DKI Jakarta, West Java (Bogor and Sukabumi and Central Java (Kudus and Demak were collected. Isolation and identification using conventional and Polymerase Chain Reactions (PCR methods were done to determine the prevalence of C. jejuni and C. coli contamination in poultry. The results showed that chicken carcasses sold in the sampling area, both traditional markets and supermarkets, were contaminated with C. jejuni and C. coli. The contamination rate of Campylobacter sp. in chicken carcasses sold in supermarkets, were 14.1% by conventional methods and 29.5% by PCR. This was higher than those in traditional markets, i.e. 5.7 and 12.1%, respectively. It is also confirmed that the prevalence for contamination of C. jejuni was higher than C. coli in 298 samples, i.e. 16.1% and 3.7% by conventional method and 23.5% and 18.1% by PCR method respectively.

  17. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction.

    Science.gov (United States)

    Chen, Ruey-Shyang; Tsay, Jwu-Guh; Huang, Yu-Fen; Chiou, Robin Y Y

    2002-05-01

    The Aspergillus flavus group covers species of A. flavus and Aspergillus parasiticus as aflatoxin producers and Aspergillus oryzae and Aspergillus sojae as koji molds. Genetic similarity among these species is high, and aflatoxin production of a culture may be affected by cultivation conditions and substrate composition. Therefore, a polymerase chain reaction (PCR)-mediated method of detecting the aflatoxin-synthesizing genes to indicate the degree of risk a genotype has of being a phenotypic producer was demonstrated. In this study, 19 strains of the A. flavus group, including A. flavus, A. parasiticus, A. oryzae, A. sojae, and one Aspergillus niger, were subjected to PCR testing in an attempt to detect four genes, encoding for norsolorinic acid reductase (nor-1), versicolorin A dehydrogenase (ver-1), sterigmatocystin O-methyltransferase (omt-1), and a regulatory protein (apa-2), involved in aflatoxin biosynthesis. Concurrently, the strains were cultivated in yeast-malt (YM) broth for aflatoxin detection. Fifteen strains were shown to possess the four target DNA fragments. With regard to aflatoxigenicity, all seven aflatoxigenic strains possessed the four DNA fragments, and five strains bearing less than the four DNA fragments did not produce aflatoxin. When peanut kernels were artificially contaminated with A. parasiticus and A. niger for 7 days, the contaminant DNA was extractable from a piece of cotyledon (ca. 100 mg), and when subjected to multiplex PCR testing using the four pairs of primers coding for the above genes, they were successfully detected. The target DNA fragments were detected in the kernels infected with A. parasiticus, and none was detected in the sound (uninoculated) kernels or in the kernels infected with A. niger.

  18. A fluorescence turn on assay for alkaline phosphatase based on the Cu(2+) catalyzed Fenton-like reaction.

    Science.gov (United States)

    Zhang, Qingfeng; Zhang, Cuiyun; Shahzad, Sohail Anjum; Yu, Cong

    2016-09-01

    A fluorescence turn-on assay was established for ALP (alkaline phosphatase) based on Cu(2+) catalyzed Fenton-like reaction and Graphene Oxide (GO). GO was utilized to quench the fluorescence of fluorescein (FAM) labeled single strand DNA (F-DNA). ALP can remove the phosphate group in sodium ascorbyl phosphate (SAP), and convert it into reducing ascorbate. Highly reactive hydroxyl radicals (·OH) were generated in the presence of ascorbate and Cu(2+) through the Fenton-like reaction. The reactive radicals generated in situ caused the cleavage of F-DNA into small fragments. When GO was added, the fluorescence emission of the sample without ALP was quenched and fluorescence emission recovered in the presence of ALP. The intensity of the recovered fluorescence was directly related to the concentration of ALP in the assay solution, and a sensitive and selective facile ALP assay is therefore established. PMID:27343614

  19. Dynamics of interfacial reactions between O(3 P) atoms and long-chain liquid hydrocarbons

    Science.gov (United States)

    Allan, Mhairi; Bagot, Paul A. J.; Köhler, Sven P. K.; Reed, Stewart K.; Westacott, Robin E.; Costen, Matthew L.; McKendrick, Kenneth G.

    2007-09-01

    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O(3P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  20. High-throughput Procedure for Single Pollen Grain Collection and Polymerase Chain Reaction in Plants

    Institute of Scientific and Technical Information of China (English)

    Ping-Hua Chen; Yong-Bao Pan; Ru-Kai Chen

    2008-01-01

    Single pollen grain polymersse chain reaction (PCR) has succeeded in several species, however only limited numbers of pollen grains were involved due to difficulties in pollen isolation and lysis. This has limited its application in genetic analysis and mapping studies in plants. A high-throughput (HT) procedure for collecting and detecting genetic variation in a large number of individual pollen grains by PCR is reported. The HT procedure involved the collection of Individual pollen grains by a pair of special forceps and the lysis of pollen grains in a heated alkali/detergent solution followed by neutralization with a tris-ethylenediamine tetraacetic acid (TE) buffer. These resulting template solutions yielded PCR reactions involving the 5S ribosomal RNA intergenic spacers, randomly amplified polymorphic DNA, and simple sequence repeats markers. Using this procedure, one person with experience could collect and process up to 288 single pollen grain PCR reactions per day. The method worked well on sugarcane, corn, Miscanthus spp., snap bean, sorghum, and tomato. The ability to collect and conduct PCR on individual pollen grains on a large scale offers a new approach to genetic analyses and mapping studies in an easily controllable environment with a considerable cost reduction. The method will also significantly benefit studies in species that are difficult subjects for classical genetic research.

  1. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  2. IgD multiple myeloma: Clinical, biological features and prognostic value of the serum free light chain assay.

    Science.gov (United States)

    Djidjik, R; Lounici, Y; Chergeulaïne, K; Berkouk, Y; Mouhoub, S; Chaib, S; Belhani, M; Ghaffor, M

    2015-09-01

    IgD multiple myeloma (MM) is a rare subtype of myeloma, it affects less than 2% of patients with MM. To evaluate the clinical and prognostic attributes of serum free light chains (sFLCs) analysis, we examined 17 cases of IgD MM. From 1998 to 2012, we obtained 1250 monoclonal gammapathies including 590 multiple myeloma and 17 patients had IgD MM. With preponderance of men patients with a mean age at diagnosis of: 59±12years. Patients with IgD MM have a short survival (Median survival=9months). The presenting features included: bone pain (75%), lymphadenopathy (16%), hepatomegaly (25%), splenomegaly (8%), associated AL amyloidosis (6%), renal impairment function (82%), infections (47%), hypercalcemia (37%) and anemia (93%). Serum electrophoresis showed a subtle M-spike (Mean=13.22±10g/L) in all patients associated to a hypogammaglobulinemia. There was an over-representation of Lambda light chain (65%); high serum β2-microglobulin in 91% and Bence Jones proteinuria was identified in 71%. The median rate of sFLCs κ was 19.05mg/L and 296.75mg/L for sFLCs λ. sFLCR was abnormal in 93% of patients and it showed concordance between baseline sFLCR and the survival (P=0.034). The contribution of FLC assay is crucial for the prognosis of patients with IgD MM.

  3. Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis.

    Directory of Open Access Journals (Sweden)

    Melissa K Gregory

    Full Text Available BACKGROUND: Δ6-Desaturase (Fads2 is widely regarded as rate-limiting in the conversion of dietary α-linolenic acid (18:3n-3; ALA to the long-chain omega-3 polyunsaturated fatty acid docosahexaenoic acid (22:6n-3; DHA. However, increasing dietary ALA or the direct Fads2 product, stearidonic acid (18:4n-3; SDA, increases tissue levels of eicosapentaenoic acid (20:5n-3; EPA and docosapentaenoic acid (22:5n-3; DPA, but not DHA. These observations suggest that one or more control points must exist beyond ALA metabolism by Fads2. One possible control point is a second reaction involving Fads2 itself, since this enzyme catalyses desaturation of 24:5n-3 to 24:6n-3, as well as ALA to SDA. However, metabolism of EPA and DPA both require elongation reactions. This study examined the activities of two elongase enzymes as well as the second reaction of Fads2 in order to concentrate on the metabolism of EPA to DHA. METHODOLOGY/PRINCIPAL FINDINGS: The substrate selectivities, competitive substrate interactions and dose response curves of the rat elongases, Elovl2 and Elovl5 were determined after expression of the enzymes in yeast. The competitive substrate interactions for rat Fads2 were also examined. Rat Elovl2 was active with C(20 and C(22 polyunsaturated fatty acids and this single enzyme catalysed the sequential elongation reactions of EPA→DPA→24:5n-3. The second reaction DPA→24:5n-3 appeared to be saturated at substrate concentrations not saturating for the first reaction EPA→DPA. ALA dose-dependently inhibited Fads2 conversion of 24:5n-3 to 24:6n-3. CONCLUSIONS: The competition between ALA and 24:5n-3 for Fads2 may explain the decrease in DHA levels observed after certain intakes of dietary ALA have been exceeded. In addition, the apparent saturation of the second Elovl2 reaction, DPA→24:5n-3, provides further explanations for the accumulation of DPA when ALA, SDA or EPA is provided in the diet. This study suggests that Elovl2 will be

  4. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis.

    Science.gov (United States)

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da

    2013-01-01

    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  5. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations

    Science.gov (United States)

    Gantz, Valentino M.; Bier, Ethan

    2015-01-01

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype while individuals homozygous for two copies of the allele will display a mutant phenotype. Here, we develop a method that we refer to as the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome editing system for generating autocatalytic mutations to generate homozygous loss-of-function mutations. We demonstrate in Drosophila that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  6. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  7. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Directory of Open Access Journals (Sweden)

    Seiki Kuramitsu

    2013-03-01

    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  8. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra

    2016-08-01

    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  9. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi

    2014-12-01

    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  10. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    Science.gov (United States)

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  11. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  12. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  13. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  14. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane

    2003-04-01

    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  15. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  16. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  17. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti

    2011-01-01

    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  18. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications.

    Science.gov (United States)

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav

    2004-02-01

    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  19. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  20. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-06-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted.

  1. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Directory of Open Access Journals (Sweden)

    Liang Gaofeng

    2011-01-01

    Full Text Available Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR. Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA. The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  2. DNA Polymer Brush Patterning through Photocontrollable Surface-Initiated DNA Hybridization Chain Reaction.

    Science.gov (United States)

    Huang, Fujian; Zhou, Xiang; Yao, Dongbao; Xiao, Shiyan; Liang, Haojun

    2015-11-18

    The fabrication of DNA polymer brushes with spatial resolution onto a solid surface is a crucial step for biochip research and related applications, cell-free gene expression study, and even artificial cell fabrication. Here, for the first time, a DNA polymer brush patterning method is reported based on the photoactivation of an ortho-nitrobenzyl linker-embedded DNA hairpin structure and a subsequent surface-initiated DNA hybridization chain reaction (HCR). Inert DNA hairpins are exposed to ultraviolet light irradiation to generate DNA duplexes with two active sticky ends (toeholds) in a programmable manner. These activated DNA duplexes can initiate DNA HCR to generate multifunctional patterned DNA polymer brushes with complex geometrical shapes. Different multifunctional DNA polymer brush patterns can be fabricated on certain areas of the same solid surface using this method. Moreover, the patterned DNA brush surface can be used to capture target molecules in a desired manner.

  3. Diagnosis of Progressive Spinal Muscular Atrophy by Using Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    姚娟; 丁新生; 陈克连; 程虹; 邓晓萱; 沈鸣九; 王颖

    2001-01-01

    Objective To understand the deletion in the survival motor neuron gene (SMN) of childhood-onset spinal muscular atrophy (SMA) in Chinese, and the value of diagnosis of SMA using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)method. Methods Deletions of SMN gene of exon 7 and 8 in 10 cases of presumed SMA, and 20 normal controls from 6 families and 30 unrelated controls were performed by PCR-RFLP analysis. Results Deletions of SMN gene detected in 9 of 10 (90%) cases of presumed SMA . No deletions of SMN in the telomere were found in the other members of families and controls.Conclusion PCR-RFLP is a sensitive, specific and simple method in diagnosis of SMA.

  4. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction.

    Science.gov (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-01-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  5. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  6. Variance-reduced simulation of lattice discrete-time Markov chains with applications in reaction networks

    Science.gov (United States)

    Maginnis, P. A.; West, M.; Dullerud, G. E.

    2016-10-01

    We propose an algorithm to accelerate Monte Carlo simulation for a broad class of stochastic processes. Specifically, the class of countable-state, discrete-time Markov chains driven by additive Poisson noise, or lattice discrete-time Markov chains. In particular, this class includes simulation of reaction networks via the tau-leaping algorithm. To produce the speedup, we simulate pairs of fair-draw trajectories that are negatively correlated. Thus, when averaged, these paths produce an unbiased Monte Carlo estimator that has reduced variance and, therefore, reduced error. Numerical results for three example systems included in this work demonstrate two to four orders of magnitude reduction of mean-square error. The numerical examples were chosen to illustrate different application areas and levels of system complexity. The areas are: gene expression (affine state-dependent rates), aerosol particle coagulation with emission and human immunodeficiency virus infection (both with nonlinear state-dependent rates). Our algorithm views the system dynamics as a "black-box", i.e., we only require control of pseudorandom number generator inputs. As a result, typical codes can be retrofitted with our algorithm using only minor changes. We prove several analytical results. Among these, we characterize the relationship of covariances between paths in the general nonlinear state-dependent intensity rates case, and we prove variance reduction of mean estimators in the special case of affine intensity rates.

  7. The use of polymerase chain reaction for early diagnosis of tuberculosis in Mycobacterium tuberculosis culture

    Directory of Open Access Journals (Sweden)

    M. Chagas

    2010-06-01

    Full Text Available Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7% and specificity (60% were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

  8. Quantitative Profiling of Long-Chain Bases by Mass Tagging and Parallel Reaction Monitoring

    DEFF Research Database (Denmark)

    Ejsing, Christer S; Bilgin, Mesut; Fabregat, Andreu

    2015-01-01

    sensitive and specific assays for monitoring these molecules. Here we describe a shotgun lipidomics method for quantitative profiling of LCB molecules. The method employs a "mass-tag" strategy where LCBs are chemically derivatized with deuterated methyliodide (CD3I) to produce trimethylated derivatives...... having a positively charged quaternary amine group. This chemical derivatization minimizes unwanted in-source fragmentation of LCB analytes and prompts a characteristic trimethylaminium fragment ion that enables sensitive and quantitative profiling of LCB molecules by parallel reaction monitoring...... on a hybrid quadrupole time-of-flight mass spectrometer. Notably, the strategy provides, for the first time, a routine for monitoring endogenous 3-ketosphinganine molecules and distinguishing them from more abundant isomeric sphingosine molecules. To demonstrate the efficacy of the methodology we report an in...

  9. Identification of bovine material in porcine spray-dried blood derivatives using the Polymerase Chain Reaction technique

    Directory of Open Access Journals (Sweden)

    Sánchez A.

    2004-01-01

    Full Text Available Due to the widely supported theory of bovine spongiform encephalopathy (BSE spread in cattle by contaminated animal feeds, screening of feed products has become essential. For many years, manufacturers have used blood and plasma proteins as high quality ingredients of foods for both pets and farm animals. However, in Europe, the Commission Regulation 1234/2003/EC temporally bans the use of processed animal proteins, including blood-derivative products, in feedstuffs for all farm animals which are fattened or bred for the production of food. This regulation has some exceptions, such as the use of non ruminant blood products into the feed of farm fish. Authorization of the re-introduction of these proteins into animal feed formulations, especially non ruminant proteins into the feed for non ruminant farm animals, is expected when adequate control methods to discriminate ruminant proteins exist. Currently, the number of validated methods to differentiate the species of origin for most of the animal by-products is limited. Here we report the development of a rapid and sensitive polymerase chain reaction (PCR-based assay, which allows detection of bovine or porcine specific mitochondrial DNAfrom spray-dried blood derivate products (plasma, whole blood and red cells, as a marker for bovine contamination in porcine products. Sample extracts, suitable for PCR, were easily and quickly obtained with the commercial PrepManTM Ultra reagent (Applied Biosystems. To confirm the porcine origin of the samples, primers targeting a specific region of 134 bp of the porcine cytochrome b coding sequence were designed (cytbporc1-F and cytbporc2-R. Previously published PCR primers (L8129 and H8357, specific for a 271 bp fragment of the bovine mitochondrial ATPase 8-ATPase 6 genes, were chosen to accomplish amplification of bovine DNA. The limit of detection (LOD of the bovine PCR assay was at least of 0.05% (v/v of bovine inclusion in spray-dried porcine plasma or red

  10. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  11. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections

    Directory of Open Access Journals (Sweden)

    Luciene de Fatima Costa Torres

    2013-05-01

    Full Text Available Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR assay that can simultaneously identify and determine the toxigenicity of these corynebacterial species with zoonotic potential was developed. This assay uses five primer pairs targeting the following genes: rpoB (Corynebacterium spp, 16S rRNA (C. ulcerans and C. pseudotuberculosis, pld (C. pseudotuberculosis, dtxR (C. diphtheriae and tox [diphtheria toxin (DT ]. In addition to describing this assay, we review the literature regarding the diseases caused by these pathogens. Of the 213 coryneform strains tested, the mPCR results for all toxigenic and non-toxigenic strains of C . diphtheriae, C. ulcerans and C. pseudotuberculosis were in 100% agreement with the results of standard biochemical tests and PCR-DT. As an alternative to conventional methods, due to its advantages of specificity and speed, the mPCR assay used in this study may successfully be applied for the diagnosis of human and/or animal diseases caused by potentially toxigenic corynebacterial species.

  12. Analytical validation of a real-time reverse transcription polymerase chain reaction test for Pan-American lineage H7 subtype Avian influenza viruses

    Science.gov (United States)

    Spackman, Erica; Ip, H.S.; Suarez, D.L.; Slemons, R.D.; Stallknecht, D.E.

    2008-01-01

    A real-time reverse transcription polymerase chain reaction test for the identification of the H7 subtype in North American Avian influenza viruses (AIVs) was first reported in 2002; however, recent AIV surveillance efforts in wild birds and H7 outbreaks in poultry demonstrated that the 2002 test did not detect all H7 AIVs present in North and South America. Therefore, a new test, the 2008 Pan-American H7 test, was developed by using recently available H7 nucleotide sequences. The analytical specificity of the new assay was characterized with an RNA panel composed of 19 H7 viruses from around the world and RNA from all hemagglutinin subtypes except H16. Specificity for North and South American lineage H7 viruses was observed. Assay limits of detection were determined to be between 103 and 104 gene copies per reaction with in vitro transcribed RNA, and 100.0 and 10 0.8 50% egg infectious doses per reaction. The 2008 Pan-American H7 test also was shown to perform similarly to the 2002 test with specimens from chickens experimentally exposed to A/Chicken/BritishColumbia/314514-2/04 H7N3 highly pathogenic AIV. Furthermore, the 2008 test was able to detect 100% (n = 27) of the H7 AIV isolates recovered from North American wild birds in a 2006-2007 sample set (none of which were detected by the 2002 H7 test).

  13. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    Science.gov (United States)

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis.

  14. ESTIMATION OF CHAIN REACTION BANKRUPTCY STRUCTURE BY CHANCE DISCOVERY METHOD- WITH TIME ORDER METHOD AND DIRECTED KEYGRAPH

    Institute of Scientific and Technical Information of China (English)

    Shinichi GODA; Yukio OHSAWA

    2007-01-01

    Chain reaction bankruptcy is regarded as common phenomenon and its effect is to be taken into account when credit risk portfolio is analyzed. But consideration and modeling of its effect leave much room for improvement. That is mainly because method for grasping relations among companies with limited data is underdeveloped. In this article, chance discovery method is applied to estimate industrial relations that are to include companies' relations that transmit chain reaction of bankruptcy.Time order method and directed KeyGraph are newly introduced to distinguish and express the time order among defaults that is essential information for the analysis of chain reaction bankruptcy. The steps for the data analysis are introduced and result of example analysis with default data in Kyushu,Japan, 2005 is presented. The structure estimated by the new method is compared with the structure of actual account receivable holders of bankrupted companies for evaluation.

  15. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  16. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    Science.gov (United States)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  17. Continuous reaction performances of benzene alkylation with long chain olefins catalyzed by ionic liquid

    Institute of Scientific and Technical Information of China (English)

    Congzhen QIAO; Chengyue LI

    2008-01-01

    Based on a compulsive mixing-reacting-sepa-rating-recycling small experimental setup,the continuous reaction performances of benzene alkylation with long chain olefins catalyzed by [BMIM]Cl-AlCl3 ionic liquid were investigated. Three different situations including normal continuous operation mode (reagent materials), sidetrack feeding from different axial positions along the static mixing reactor (reagent materials) and normal con-tinuous alkylation using industrial paraffin and olefins materials were examined. Even under the relatively hype-critical reaction conditions, the single pass conversion of pure 1-dodecene could reach to nearly 100.0%, and the selectivity of 2-phenyl isomer was higher than 37.7%. Although the positions along the reactor for sidetrack feeding were different, the 100.0% single pass conversion of 1-dodecene was also attained before the outlet of the reactor. The refined industrial olefins as raw material could meet with the requirements of continuous alkyla-tion. The influences of impurities such as di-olefins and non-benzene aromatics on the catalytic activity and stability should be studied further.

  18. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    Science.gov (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  19. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF

    2000-01-01

    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  20. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  1. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    Science.gov (United States)

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  2. Generic HPLC platform for automated enzyme reaction monitoring: Advancing the assay toolbox for transaminases and other PLP-dependent enzymes.

    Science.gov (United States)

    Börner, Tim; Grey, Carl; Adlercreutz, Patrick

    2016-08-01

    Methods for rapid and direct quantification of enzyme kinetics independent of the substrate stand in high demand for both fundamental research and bioprocess development. This study addresses the need for a generic method by developing an automated, standardizable HPLC platform monitoring reaction progress in near real-time. The method was applied to amine transaminase (ATA) catalyzed reactions intensifying process development for chiral amine synthesis. Autosampler-assisted pipetting facilitates integrated mixing and sampling under controlled temperature. Crude enzyme formulations in high and low substrate concentrations can be employed. Sequential, small (1 µL) sample injections and immediate detection after separation permits fast reaction monitoring with excellent sensitivity, accuracy and reproducibility. Due to its modular design, different chromatographic techniques, e.g. reverse phase and size exclusion chromatography (SEC) can be employed. A novel assay for pyridoxal 5'-phosphate-dependent enzymes is presented using SEC for direct monitoring of enzyme-bound and free reaction intermediates. Time-resolved changes of the different cofactor states, e.g. pyridoxal 5'-phosphate, pyridoxamine 5'-phosphate and the internal aldimine were traced in both half reactions. The combination of the automated HPLC platform with SEC offers a method for substrate-independent screening, which renders a missing piece in the assay and screening toolbox for ATAs and other PLP-dependent enzymes.

  3. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load

    OpenAIRE

    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY

    1998-01-01

    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  4. A Color-Reaction-Based Biochip Detection Assay for RIF and INH Resistance of Clinical Mycobacterial Specimens.

    Science.gov (United States)

    Xue, Wenfei; Peng, Jingfu; Yu, Xiaoli; Zhang, Shulin; Zhou, Boping; Jiang, Danqing; Chen, Jianbo; Ding, Bingbing; Zhu, Bin; Li, Yao

    2016-01-01

    The widespread occurrence of drug-resistant Mycobacterium tuberculosis places importance on the detection of TB (tuberculosis) drug susceptibility. Conventional drug susceptibility testing (DST) is a lengthy process. We developed a rapid enzymatic color-reaction-based biochip assay. The process included asymmetric multiplex PCR/templex PCR, biochip hybridization, and an enzymatic color reaction, with specific software for data operating. Templex PCR (tem- PCR) was applied to avoid interference between different primers in conventional multiplex- PCR. We applied this assay to 276 clinical specimens (including 27 sputum, 4 alveolar lavage fluid, 2 pleural effusion, and 243 culture isolate specimens; 40 of the 276 were non-tuberculosis mycobacteria specimens and 236 were M. tuberculosis specimens). The testing process took 4.5 h. A sensitivity of 50 copies per PCR was achieved, while the sensitivity was 500 copies per PCR when tem-PCR was used. Allele sequences could be detected in mixed samples at a proportion of 10%. Detection results showed a concordance rate of 97.46% (230/236) in rifampicin resistance detection (sensitivity 95.40%, specificity 98.66%) and 96.19% (227/236) in isoniazid (sensitivity 93.59%, specificity 97.47%) detection with those of DST assay. Concordance rates of testing results for sputum, alveolar lavage fluid, and pleural effusion specimens were 100%. The assay provides a potential choice for TB diagnosis and treatment.

  5. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki [System Instruments Co., Ltd., 776-2 Komiya-cho, Hachioji, Tokyo 192-0031 (Japan); Noda, Mamoru; Igimi, Shizunobu [Division of Biomedical Food Research, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ikebukuro, Kazunori, E-mail: ikebu@cc.tuat.ac.jp [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan)

    2013-11-01

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10{sup 6} copies.

  6. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    Directory of Open Access Journals (Sweden)

    Mahmood Shishegar

    2011-12-01

    Full Text Available Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2% of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%. Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensi-tivity profile in our geographic area.

  7. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 106 copies

  8. Clinical utility of panfungal polymerase chain reaction for the diagnosis of invasive fungal disease: a single center experience.

    Science.gov (United States)

    Trubiano, J A; Dennison, A M; Morrissey, C O; Chua, K Y; Halliday, C L; Chen, S C-A; Spelman, D

    2016-02-01

    The role of panfungal polymerase chain reaction (PCR) assays for diagnosis of invasive fungal disease (IFD) is inadequately defined. We describe the use of an internal transcribed spacer 1 (ITS-1) region-directed panfungal PCR in this context at a tertiary referral transplant center. A retrospective review of patients at Alfred Health, Melbourne, Australia (2009-2014) who had clinical samples referred for panfungal PCR testing was conducted. Baseline patient characteristics, antifungal drug history, fungal culture/histopathology, and radiology results were recorded. For bronchoalveolar lavage (BAL) fluid samples, identification of a fungus other than a Candida spp. was defined as a potential pathogen.Of 138 panfungal PCR tests (108 patients), 41 (30%) were positive for a fungal product. Ninety-seven percent (134/138) of specimens were from immunocompromised hosts. Thirteen percent (19/138) of panfungal PCR positive results were for potential pathogens and potential pathogens were detected more frequently in tissue as compared with BAL (12/13 vs. 6/26; P = .0001). No positive panfungal PCR results were obtained from CSF specimens. If histopathology examination was negative, panfungal PCR identified a potential pathogen in only 12% (11/94) of specimens. For the 20 culture negative/histopathology positive specimens, diagnosis of IFD to causative species level by panfungal PCR occurred in 35% (6/20).Sterile site specimens, in particular tissue, were more frequently panfungal PCR positive for potential pathogens than BAL. The utility of panfungal PCR appears greatest in tissue specimens, as an adjunct to histopathology to improve diagnostic sensitivity and specificity. Based on the results of this study we are now only testing tissue specimens by panfungal PCR.

  9. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    Science.gov (United States)

    Shishegar, Mahmood; Faramarzi, Abolhasan; Kazemi, Tayyebe; Bayat, Akbar; Motamedifar, Mohammad

    2011-01-01

    Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR) assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2%) of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%). Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensitivity profile in our geographic area. PMID:23115412

  10. Field expansion of DNA polymerase chain reaction for early infant diagnosis of HIV-1: The Ethiopian experience

    Directory of Open Access Journals (Sweden)

    Peter Fonjungo

    2013-03-01

    Full Text Available Background: Early diagnosis of infants infected with HIV (EID and early initiation of treatment significantly reduces the rate of disease progression and mortality. One of the challengesto identification of HIV-1-infected infants is availability and/or access to quality molecular laboratory facilities which perform molecular virologic assays suitable for accurate identificationof the HIV status of infants.Method: We conducted a joint site assessment and designed laboratories for the expansion of DNA polymerase chain reaction (PCR testing based on dried blood spot (DBS for EID insix regions of Ethiopia. Training of appropriate laboratory technologists and development of required documentation including standard operating procedures (SOPs was carried out. The impact of the expansion of EID laboratories was assessed by the number of tests performed as well as the turn-around time.Results: DNA PCR for EID was introduced in 2008 in six regions. From April 2006 to April 2008, a total of 2848 infants had been tested centrally at the Ethiopian Health and Nutrition Research Institute (EHNRI in Addis Ababa, and which was then the only laboratory with the capability to perform EID; 546 (19.2% of the samples were positive. By November 2010, EHNRI and the six laboratories had tested an additional 16 985 HIV-exposed infants, of which 1915 (11.3% were positive. The median turn-around time for test results was 14 days (range 14−21 days.Conclusion: Expansion of HIV DNA PCR testing facilities that can provide quality and reliable results is feasible in resource-limited settings. Regular supervision and monitoring for quality assurance of these laboratories is essential to maintain accuracy of testing.

  11. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-04-01

    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  12. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  13. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers.

    Science.gov (United States)

    D'Souza, Doris H; Critzer, Faith J; Golden, David A

    2009-11-01

    Recent outbreaks of Salmonella linked to fresh produce emphasize the need for rapid detection methods to help control the spread of disease. Reverse-transcriptase polymerase chain reaction (RT-PCR) can detect the presence of mRNA (shorter half-life than DNA) with greater potential for detecting viable pathogens. The chromosomally located invA gene required for host invasion by Salmonella is widely used for detection of this pathogen by PCR. Detection of Salmonella was undertaken by real-time RT-PCR (rt-RT-PCR) using newly designed invA gene primers to develop a sensitive and specific assay. Salmonella serovars Typhimurium and Enteritidis were grown (7.68 log(10) CFU/mL) in Luria-Bertani broth overnight at 37 degrees C, and RNA was extracted, followed by rt-RT-PCR with and without SYBR green I and agarose gel electrophoresis. All experiments were replicated at least thrice. Detection for both serovars using traditional RT-PCR was lower ( approximately 10(5) CFU/mL) than rt-RT-PCR (10(3) CFU/mL) by gel electrophoresis. Melt curve analysis showed melt temperatures at 87.5 degrees C with Ct values from 12 to 15 for up to 10(3) CFU/mL and improved to 10(2) CFU/mL after further optimization. Further, addition of RNA internal amplification control constructed using in vitro transcription with a T7 RNA polymerase promoter, to the RT-PCR assay also gave detection limits of 10(2) CFU/mL. Cross-reactivity was not observed against a panel of 21 non-Salmonella bacteria. Heat-inactivated (autoclaved) Salmonella showed faint or no detection by rt-RT-PCR or gel electrophoresis. This method has potential to be applied for the detection of Salmonella serovars in fresh produce and the simultaneous detection of foodborne viral (RNA viruses) and bacterial pathogens in a multiplex format.

  14. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...

  15. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    Science.gov (United States)

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  16. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR...

  17. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  18. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;

    2014-01-01

    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  19. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...

  20. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    Science.gov (United States)

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  1. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.;

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot...

  2. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Science.gov (United States)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  3. Testing vaccines in human experimental malaria: statistical analysis of parasitemia measured by a quantitative real-time polymerase chain reaction.

    NARCIS (Netherlands)

    Hermsen, C.C.; Vlas, S.J. de; Gemert, G.J.A. van; Telgt, D.S.C.; Verhage, D.F.; Sauerwein, R.W.

    2004-01-01

    Clinical trials are an essential step in evaluation of safety and efficacy of malaria vaccines, and human experimental malaria infections have been used for evaluation of protective immunity of Plasmodium falciparum malaria. In this study, a quantitative real-time polymerase chain reaction was used

  4. Optimisation of a quantitative polymerase chain reaction-based strategy for the detection and quantification of human herpesvirus 6 DNA in patients undergoing allogeneic haematopoietic stem cell transplantation

    Directory of Open Access Journals (Sweden)

    Miriam YH Ueda

    2015-06-01

    Full Text Available Human herpesvirus 6 (HHV-6 may cause severe complications after haematopoietic stem cell transplantation (HSCT. Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.

  5. Optimisation of a quantitative polymerase chain reaction-based strategy for the detection and quantification of human herpesvirus 6 DNA in patients undergoing allogeneic haematopoietic stem cell transplantation

    Science.gov (United States)

    Ueda, Miriam YH; Alvarenga, Paulo G; Real, Juliana M; Moreira, Eloisa de Sá; Watanabe, Aripuanã; Passos-Castilho, Ana Maria; Vescovi, Matheus; Novis, Yana; Rocha, Vanderson; Seber, Adriana; Oliveira, Jose SR; Rodrigues, Celso A; Granato, Celso FH

    2015-01-01

    Human herpesvirus 6 (HHV-6) may cause severe complications after haematopoietic stem cell transplantation (HSCT). Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR) has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance. PMID:26038958

  6. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota

    2012-01-01

    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  7. Modeling the Manipulation of Natural Populations by the Mutagenic Chain Reaction.

    Science.gov (United States)

    Unckless, Robert L; Messer, Philipp W; Connallon, Tim; Clark, Andrew G

    2015-10-01

    The use of recombinant genetic technologies for population manipulation has mostly remained an abstract idea due to the lack of a suitable means to drive novel gene constructs to high frequency in populations. Recently Gantz and Bier showed that the use of CRISPR/Cas9 technology could provide an artificial drive mechanism, the so-called mutagenic chain reaction (MCR), which could lead to rapid fixation of even a deleterious introduced allele. We establish the near equivalence of this system to other gene drive models and review the results of simple models showing that, when there is a fitness cost to the MCR allele, an internal equilibrium may exist that is usually unstable. In this case, introductions must be at a frequency above this critical point for the successful invasion of the MCR allele. We obtain estimates of fixation and invasion probabilities for the appropriate scenarios. Finally, we discuss how polymorphism in natural populations may introduce sources of natural resistance to MCR invasion. These modeling results have important implications for application of MCR in natural populations. PMID:26232409

  8. [The applications of thermostable ligase chain reaction in facilitating DNA recombination].

    Science.gov (United States)

    Xiangda, Zhou; Xiao, Song; Cong, Huai; Haiyan, Sun; Hongyan, Chen; Daru, Lu

    2016-02-01

    The traditional Type Ⅱ restriction enzyme-based method is restricted by the purification steps, and therefore, cannot be applied to specific DNA assembly in chaotic system. To solve this problem, Thermostable Ligase Chain Reaction (TLCR) was introduced in the process of DNA assembly and capture. This technique combines the feature of thermostable DNA ligase and sequence specific oligo ligation template, "Helper", to achieve specific assembly of target fragments and exponential increase of products in multiple thermocyclings. Two plasmid construction experiments were carried out in order to test the feasibility and practical performance of TLCR. One was that, TLCR was used to specifically capture a 1.5 kb fragment into vector from an unpurified chaotic system which contained 7 different sizes of fragments. The results showed that the capturing accuracy was around 80%, which proved the feasibility and accuracy of using TLCR to specific assembly of DNA fragments in a complicated mixed system. In the other experiment, TLCR was used to capture two fragments (total length was 27 kb) from Hind Ⅲ digestion of Lambda genome into vector by order. The results also showed an accuracy of around 80%. As demonstrated in the results, TLCR can simplify the process of DNA recombination experiments and is suitable for the assembly of multiple and large DNA fragments. This technique can provide convenience to biological experiments.

  9. Detection of herpesviral sequences in tissues of green turtles with fibropapilloma by polymerase chain reaction.

    Science.gov (United States)

    Lu, Y; Wang, Y; Yu, Q; Aguirre, A A; Balazs, G H; Nerurkar, V R; Yanagihara, R

    2000-01-01

    An alpha-herpesvirus has been associated recently with green turtle fibropapilloma (FP). To further clarify the role of this newfound green turtle herpesvirus (GTHV) in the pathogenesis of FP, various normal-appearing tissues and organs (including skin, eye, brain, heart, liver, spleen, intestine, lung, kidney, nerve, gonad, tongue, gall bladder, urinary bladder, thyroid and peripheral blood mononuclear cells (PBMC) from blood) and tumor tissues from 19 green turtles (Chelonia mydas) with FP, and tissues from three green turtles without FP, collected during 1997 to 1999 in the Hawaiian Islands, were tested for GTHV sequences by nested polymerase chain reaction (PCR), using GTHV-specific oligonuclotide primers. GTHV sequences were detected in all tumors (51/51) and most tissues (133/167) of tumored turtles. By contrast, such sequences were undetectable in tissues (0/28) of three non-tumored turtles. Analysis of GTHV sequences detected in different tissues and tumors revealed a low degree of genetic diversity (green turtles and its absence in tissues of non-tumored turtles, argues for an etiologic role in FP.

  10. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini

    2013-12-01

    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  11. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader

    Science.gov (United States)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng

    2007-11-01

    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  12. Analysis of adult otitis media: polymerase chain reaction versus culture for bacteria and viruses.

    Science.gov (United States)

    Liederman, E M; Post, J C; Aul, J J; Sirko, D A; White, G J; Buchman, C A; Ehrlich, G D

    1998-01-01

    Recent studies using the polymerase chain reaction (PCR) have identified bacterial and viral genomic sequences in culture-negative pediatric middle ear effusions. To evaluate this technique in adults, 19 effusions were analyzed to compare bacterial and viral culture and PCR detection of Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and adenovirus. Effusions from 4 subjects positive for human immunodeficiency virus (HIV) were analyzed by PCR for HIV virus. Three of 19 effusions were culture-positive for bacteria, and 0 of 19 for viruses. Fifteen of 19 effusions were PCR-positive for bacterial genomic sequences, and 0 of 19 for adenovirus. Thirteen of 15 PCR-positive specimens demonstrated S pneumoniae, 5 of 15 H influenzae, and 0 of 13 M catarrhalis. All 4 effusions from HIV-positive subjects were PCR-positive for HIV. No effusion was culture-positive and PCR-negative. These results confirm that culture-negative middle ear effusions contain genomic sequences from bacterial pathogens. Finding of HIV RNA and DNA in effusion from HIV-positives suggests replicating virus in this fluid.

  13. Improving Nuclear Safety of Fast Reactors by Slowing Down Fission Chain Reaction

    Directory of Open Access Journals (Sweden)

    G. G. Kulikov

    2014-01-01

    Full Text Available Light materials with small atomic mass (light or heavy water, graphite, and so on are usually used as a neutron reflector and moderator. The present paper proposes using a new, heavy element as neutron moderator and reflector, namely, “radiogenic lead” with dominant content of isotope 208Pb. Radiogenic lead is a stable natural lead. This isotope is characterized by extremely low micro cross-section of radiative neutron capture (~0.23 mb for thermal neutrons, which is smaller than graphite and deuterium cross-sections. The reflector-converter for a fast reactor core is the structure capable of transforming some part of prompt neutrons leaked from the core into the reflected neutrons with properties similar to those of delayed neutrons, that is, sufficiently large contribution to reactivity at the level of effective fraction of delayed neutrons and relatively long lifetime, comparable with lifetimes of radionuclides-emitters of delayed neutrons. It is evaluated that the use of radiogenic lead makes it possible to slow down the chain fission reaction on prompt neutrons in the fast reactor. This can improve the fast reactor safety and reduce some requirements to the technologies used to fabricate fuel for the fast reactor.

  14. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Directory of Open Access Journals (Sweden)

    Parvin Hassanzadeh

    2012-03-01

    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  15. Human papillomavirus infection in lung vs. oral squamous cell carcinomas: a polymerase chain reaction study.

    Science.gov (United States)

    Halimi, M; Morshedi Asl, S

    2011-06-01

    The role of Human Papillomavirus (HPV) has been suspected in pathogenesis of various malignancies; however, the available data are not conclusive. This study aimed to determine and compare the frequency of HPV infection in oral and lung Squamous Cell Carcinoma (SCC) by a sensitive method. Sixty specimens of oral and lung SCC (30 cases each one) were reevaluated in Tabriz Imam Reza Centre in a 24 month period. Following genomic DNA extract, the Polymerase Chain Reaction (PCR) amplification was performed in presence of specific MY11 and MY09 primers for HPV infection. Three cervical specimens and a combination of PCR solution lacking DNA plus healthy persons' DNA samples were employed as positive and negative controls, respectively. The oral group was significantly older than the lung group (68.90 vs. 56.67 y, p infection in the oral and lung groups were comparable (20 vs. 10%, respectively; p = 0.47). Majority of patients with HPV infection were older than 60 years (88.9%) or male (88.9%). In the oral group, all these cases were well differentiated and the majority was of lower lip origin (83.3%). In the lung group, 66.7% of these specimens were moderately differentiated and the origin was bronchus in all cases. In conclusion, the rate of HPV infection in lung and oral SCC samples is rather lower than the previous reports in the literature. This rate is apparently higher in the oral than the lung SCC specimens. PMID:22235505

  16. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Souza, M T; Carvalho-Zilse, G A

    2014-01-01

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  17. Sequencing of simple sequence repeat anchored polymerase chain reaction amplification products of Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2002-01-01

    Full Text Available Simple sequence repeat anchored polymerase chain reaction amplification (SSR-PCR is a genetic typing technique based on primers anchored at the 5' or 3' ends of microsatellites, at high primer annealing temperatures. This technique has already been used in studies of genetic variability of several organisms, using different primer designs. In order to conduct a detailed study of the SSR-PCR genomic targets, we cloned and sequenced 20 unique amplification products of two commonly used primers, CAA(CT6 and (CA8RY, using Biomphalaria glabrata genomic DNA as template. The sequences obtained were novel B. glabrata genomic sequences. It was observed that 15 clones contained microsatellites between priming sites. Out of 40 clones, seven contained complex sequence repetitions. One of the repeats that appeared in six of the amplified fragments generated a single band in Southern analysis, indicating that the sequence was not widespread in the genome. Most of the annealing sites for the CAA(CT6 primer contained only the six repeats found within the primer sequence. In conclusion, SSR-PCR is a useful genotyping technique. However, the premise of the SSR-PCR technique, verified with the CAA(CT6 primer, could not be supported since the amplification products did not result necessarily from microsatellite loci amplification.

  18. Salmonellae in fish feces analyzed by in situ hybridization and quantitative polymerase chain reaction.

    Science.gov (United States)

    Sha, Qiong; Forstner, Michael R J; Bonner, Timothy H; Hahn, Dittmar

    2013-09-01

    The potential of fish to transfer salmonellae from heterogeneous aquatic biofilms into feces was assessed in controlled aquarium studies with Suckermouth Catfish Hypostomus plecostomus and with biofilms inoculated with salmonellae. Neither the presence of catfish nor inoculation with salmonellae had detectable effects on the abundance of the microbial community. Densities of the microbial community were about 10(5) cells/mL in the water during a 1-week period, whereas densities of the microbial community increased 10-fold (10(6) to 10(7) cells/mg) in catfish feces during the same period. Salmonellae were detected by both quantitative polymerase chain reaction (qPCR) and situ hybridization in water samples immediately after inoculation, in numbers of about 10(4) cells/mL, representing up to 20% of the cells of the microbial community. Numbers decreased by three orders of magnitude within the first 3 d of the study, which represented only 0.01% of the community, and became undetectable after day 5. In catfish feces, numbers of Salmonella initially increased to up to 6% of the cells of the community but then declined. These results suggest that Salmonella are not biomagnified during gut passage, and thus, fish only provide a means for the translocation of this pathogen.

  19. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  20. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    Science.gov (United States)

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312