
Sample records for chain reaction assay

  1. Identification of Erwinia stewartii by a ligase chain reaction assay.


    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A


    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...

  2. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.


    Dewit, D.; Wootton, M.; Allan, B; Steyn, L


    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not c...

  3. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti


    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.


    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  4. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain


    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  5. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.


    Patou, G.; Pillay, D.; Myint, S; Pattison, J.


    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  6. A Novel Nested Polymerase Chain Reaction (n-PCR) Assay for Identifying Sorghum nitidum


    Wei, Shasha; Zhirui DENG; Liping YIN; Yi, Jianping; Renqi WU; Qin CHEN


    This work developed a novel nested polymerase chain reaction (n-PCR) assay to identify Sorghum nitidum (S. nitidum). It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band ...

  7. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto


    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  8. Development and validation of a Myxoma virus real-time polymerase chain reaction assay


    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A


    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  9. Development and validation of a Myxoma virus real-time polymerase chain reaction assay. (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea


    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  10. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying


    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  11. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Directory of Open Access Journals (Sweden)

    Mari Tuyama


    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  12. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp (United States)

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  13. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses. (United States)

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola


    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  14. An allele-specific polymerase chain reaction assay for the differentiation of members of the Anopheles culicifacies complex

    Indian Academy of Sciences (India)

    O P Singh; Geeta Goswami; N Nanda; K Raghavendra; D Chandra; S K Subbarao


    Anopheles culicifacies, the principal vector of malaria in India, is a complex of five cryptic species which are morphologically indistinguishable at any stage of life. In view of the practical difficulties associated with classical cytotaxonomic method for the identification of members of the complex, an allele-specific polymerase chain reaction (ASPCR) assay targeted to the D3 domain of 28S ribosomal DNA was developed. The assay discriminates An. culicifacies species A and D from species B, C and E. The assay was validated using chromosomally-identified specimens of An. culicifacies from different geographical regions of India representing different sympatric associations. The assay correctly differentiates species A and D from species B, C and E. The possible use of this diagnostic assay in disease vector control programmes is discussed.

  15. Chain reaction

    International Nuclear Information System (INIS)

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  16. Alteration in sample preparation to increase the yield of multiplex Polymerase Chain Reaction assay for diagnosis of genital ulcer disease


    Rao, G.; A Das; Prabhakar, P.; V Nema; Risbud, A. R.


    Purpose: Genital Ulcer Disease (GUD) is common sexually transmitted infection (STI). Multiple studies have shown that GUDs are strongly associated with the transmission and the acquisition of HIV infection. An accurate diagnosis of common etiology of GUD namely Herpes, syphilis and Chancroid is possible using Multiplex PCR (M-PCR). However, frequent presence of Polymerase Chain Reaction inhibitors in the ulcer swab specimen limits the performance of the assay. In order to overcome this proble...

  17. Rapid Detection/pathotyping of Newcastle disease virus isolates in clinical samples using real time polymerase chain reaction assay




    Authors: Abdul Wajid, Muhammad Wasim, Tahir Yaqub, Shafqat F Rehmani, Tasra Bibi, Nadia Mukhtar, Javed Muhammad, Umar Bacha, Suliman Qadir Afridi, Muhammad Nauman Zahid, Zia u ddin, Muhammad Zubair Shabbir, Kamran Abbas & Muneer Ahmad ### Abstract In the present protocol we describe the real time reverse transcription polymerase chain reaction (rRT-PCR) assay for the rapid detection/pathotyping of Newcastle disease virus (NDV) isoaltes in clinical samples. Fusion gene and matrix ...

  18. Development and validation of a Pneumocystis jirovecii real-time polymerase chain reaction assay for diagnosis of Pneumocystis pneumonia


    Church, Deirdre L; Ambasta, Anshula; Wilmer, Amanda; Williscroft, Holly; Ritchie, Gordon; Pillai, Dylan R.; Champagne, Sylvie; Daniel G Gregson


    Pneumocystis pneumonia is caused by Pneumocystis jirovecii, an opportunistic fungal pathogen. Presently, many clinical microbiology laboratories rely on direct microscopic detection of P jirovecii. The validation, and clinical and laboratory development of a qualitative P jirovecii real-time polymerase chain reaction assay for the rapid detection of Pneumocystis pneumonia is discussed by the authors. In addition, this new technique is compared with the existing gold-standard immunofluorescenc...

  19. Rapid and inexpensive species differentiation using a multiplex real-time polymerase chain reaction high-resolution melt assay. (United States)

    Elkins, Kelly M; Perez, Anjelica C U; Sweetin, Katherine C


    We demonstrate a method for developing real-time polymerase chain reaction (PCR) high-resolution melt (HRM) assays to identify multiple species present in a mixture simultaneously using LCGreen Plus and melt temperatures. Highly specific PCR primers are designed to yield amplicons with different melt temperatures for simple routine species identification compared with differentiating melt curve kinetics traces or difference plots. This method is robust and automatable, and it leads to savings in time and reagent costs, is easily modified to probe any species of interest, eliminates the need for post-PCR gel or capillary electrophoresis in routine assays, and requires no expensive dye-labeled primers. PMID:26836486

  20. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen. (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E


    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  1. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  2. Comparison of a TaqMan real-time polymerase chain reaction assay with a loop-mediated isothermal amplification assay for detection of Gallid herpesvirus 1. (United States)

    Ou, Shan-Chia; Giambrone, Joseph J; Macklin, Kenneth S


    A TaqMan real-time polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) assay were developed to detect Gallid herpesvirus 1 (GaHV-1, formerly Infectious laryngotracheitis virus). The standard curve of real-time PCR was established, and the sensitivity reached 10 copies/μl. In the current study, the conversion between viral titer and GaHV-1 genomic copy number was constructed. Six primers for LAMP assay amplified target gene at 65°C within 45 min, and the detection limit was 60 copies/μl. The 6 primers were highly specific, sensitive, and reproducible for detection of GaHV-1. Although the sensitivity of LAMP was lower than that of real-time PCR, LAMP was faster, less expensive, and did not require a thermocycler. The LAMP assay would be a viable alternative assay in diagnostic laboratories that do not employ real-time PCR technology. PMID:22362944

  3. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products. (United States)

    Infante, Carlos; Manchado, Manuel


    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  4. A clinical comparative study of polymerase chain reaction assay for diagnosis of pneumocystis pneumonia in non-AIDS patients

    Institute of Scientific and Technical Information of China (English)

    MU Xiang-dong; WANG Guang-fa; SU Li


    Background Pneurnocystis jirovecii pneumonia (PCP) is one of the most common and fatal infections in non-AIDS immunocompromised patients,which is difficult to diagnose by traditional morphologic methods.This study evaluated polymerase chain reaction (PCR) assays of Pneumocystis jirovecii mitochondrial large subunits ribosomal RNA in sputum and bronchioalveolar lavage fluid (BALF) for diagnosing PCP.Methods Sputum and BALF specimens from two groups were collected:one group (PCP group) included 20 patients definitely diagnosed of PCP by Gomori methenamine silver (GMS) stains of BALF;the other group (non-PCP group) included 40 patients.Each specimen was examined by GMS stains and PCR assays.Results GMS stains of BALF in PCP group were 100% positive (20/20),GMS stains of sputum in PCP group were 35% positive (7/20);GMS stains of BALF in non-PCP group were 100% negative (40/40),GMS stains of sputum in non-PCP group were 100% negative (40/40).PCR assays of BALF in PCP group were 100% positive (20/20),PCR assays of sputum in PCP group were 100% positive (20/20);PCR assays of BALF in non-PCP group were 100% negative (40/40),PCR assays of sputum in non-PCP group were 100% negative (40/40).Sensitivity and specificity of PCR assays of sputum and BALF were both 100%;positive and negative predictive values were also both 100%.Conclusion The diagnostic value of PCR assays of Pneumocystisjirovecii mitochondrial large subunits ribosomal RNA on sputum and BALF for pneumocystis pneumonia are both high and equivalent.

  5. Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus. (United States)

    Mahmoudian, Alireza; Kirkpatrick, Naomi C; Coppo, Mauricio; Lee, Sang-Won; Devlin, Joanne M; Markham, Philip F; Browning, Glenn F; Noormohammadi, Amir H


    Infectious laryngotracheitis is an acute viral respiratory disease of chickens with a worldwide distribution. Sensitive detection of the causative herpesvirus is particularly important because it can persist in the host at a very low copy number and be transmitted to other birds. Quantification of viral genome copy number is also useful for clinical investigations and experimental studies. In the study presented here, a quantitative polymerase chain reaction (qPCR) assay was developed using SYBR Green chemistry and the viral gene UL15a to detect and quantify infectious laryngotracheitis virus (ILTV) in ILTV-inoculated chicken embryos or naturally infected birds. The specificity of the assay was confirmed using a panel of viral and bacterial pathogens of poultry. The sensitivity of the assay was compared with two conventional PCR assays, virus titration and an antigen-detecting enzyme-linked immunosorbent assay. The qPCR developed in this study was highly sensitive and specific, and has potential for quantification of ILTV in tissues from naturally and experimentally infected birds and embryos. PMID:21711182

  6. Avian haemosporidian parasites (Haemosporida): A comparative analysis of different polymerase chain reaction assays in detection of mixed infections. (United States)

    Bernotienė, Rasa; Palinauskas, Vaidas; Iezhova, Tatjana; Murauskaitė, Dovilė; Valkiūnas, Gediminas


    Mixed infections of different species and genetic lineages of haemosporidian parasites (Haemosporida) predominate in wildlife, and such infections are particularly virulent. However, currently used polymerase chain reaction (PCR)-based detection methods often do not read mixed infections. Sensitivity of different PCR assays in detection of mixed infections has been insufficiently tested, but this knowledge is essential in studies addressing parasite diversity in wildlife. Here, we applied five different PCR assays, which are broadly used in wildlife avian haemosporidian research, and compared their sensitivity in detection of experimentally designed mixed infections of Haemoproteus and Plasmodium parasites. Three of these PCR assays use primer sets that amplify fragments of cytochrome b gene (cyt b), one of cytochrome oxidase subunit I (COI) gene, and one target apicoplast genome. We collected blood from wild-caught birds and, using microscopic and PCR-based methods applied in parallel, identified single infections of ten haemosporidian species with similar parasitemia. Then, we prepared 15 experimental mixes of different haemosporidian parasites, which often are present simultaneously in wild birds. Similar concentration of total DNA was used in each parasite lineage during preparation of mixes. Positive amplifications were sequenced, and the presence of mixed infections was reported by visualising double-base calling in sequence electropherograms. This study shows that the use of each single PCR assay markedly underestimates biodiversity of haemosporidian parasites. The application of at least 3 PCR assays in parallel detected the majority, but still not all lineages present in mixed infections. We determined preferences of different primers in detection of parasites belonging to different genera of haemosporidians during mixed infections. PMID:26821298

  7. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization. (United States)

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J


    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  8. Development of a specific polymerase chain reaction assay for the detection of Basidiobolus. (United States)

    Gómez-Muñoz, María Teresa; Fernández-Barredo, Salceda; Martínez-Díaz, Rafael Alberto; Pérez-Gracia, María Teresa; Ponce-Gordo, Francisco


    The etiology of chronic diarrhea is complex in humans and animals. It is always necessary to evaluate a list of differential diagnosis, including bacteria, protozoa and fungi. Basidiobolomycosis is a fungal disease reported sporadically worldwide, mainly caused by B. ranarum, a frequent organism found in soil or in the intestine and skin of lizards and frogs. It is an opportunistic pathogen that causes infections characterized by granulomatous lesions in the subcutaneous tissues as well as in the intestinal wall in humans and animals. In this work we have developed a PCR technique to differentiate Basidiobolus from other causes of intestinal disease in dogs and humans. To test the specificity of the PCR assay we included closely related organisms, common intestinal microbiota and pathogenic organisms, such as Aspergillus, Candida, Cryptosporidium, Escherichia, Giardia, Mucor, Proteus, Rhizopus and Salmonella. Pythium insidiosum, which cause clinically similar disease in dogs but require a different treatment. Only Basidiobolus was positive to the PCR assay. PMID:22075784

  9. Polymerase chain reaction assay for the detection of Bacillus cereus group cells

    DEFF Research Database (Denmark)

    Hansen, Bjarne Munk; Leser, Thomas D.; Hendriksen, Niels Bohse


    Recent investigations have shown that members of the Bacillus cereus group carry genes which have the potential to cause gastrointestinal and somatic diseases. Although most cases of diseases caused by the B. cereus group bacteria are relatively mild, it is desirable to be able to detect members of...... the B. cereus group in food and in the environment. Using 16S rDNA as target, a PCR assay for the detection of B. cereus group cells has been developed. Primers specific for the 16S rDNA of the B. cereus group bacteria were selected and used in combination with consensus primers for 165 rDNA as...... internal PCR procedure control. The PCR procedure was optimized with respect to annealing temperature. When DNA from the B. cereus group bacteria was present, the PCR assay yielded a B. cereus specific fragment, while when non-B. cereus prokaryotic DNA was present, the consensus 165 rDNA primers directed...

  10. Rapid Detection of Filoviruses by Real-time TaqMan Polymerase Chain Reaction Assays

    Institute of Scientific and Technical Information of China (English)

    Yi Huang; Hongping Wei; Yunpeng Wang; Zhengli Shi; Herve Raoul; Zhiming Yuan


    Ebola virus (EBOV) and Marburg virus (MARV) are causative agents of severe hemorrhagic fever with high mortality rates in humans and non-human primates and there is currently no licensed vaccine or therapeutics.To date,there is no specific laboratory diagnostic test in China,while there is a national need to provide differential diagnosis during outbreaks and for instituting acceptable quarantine procedures.In this study,the TaqMan RT-PCR assays targeting the nucleoprotein genes of the Zaire Ebolavirus (ZEBOV) and MARV were developed and their sensitivities and specificities were investigated.Our results indicated that the assays were able to make reliable diagnosis over a wide range of virus copies from 103 to 109,corresponding to the threshold of a standard RNA transcript.The results showed that there were about 1010 RNA copies per milliliter of virus culture supernatant,equivalent to 10,000 RNA molecules per infectious virion,suggesting the presence of many non-infectious particles.These data indicated that the TaqMan RT-PCR assays developed in this study will be suitable for future surveillance and specific diagnosis of ZEBOV and MARV in China.

  11. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection (United States)

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve


    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  12. Identification of Cystic Fibrosis Variants by Polymerase Chain Reaction/Oligonucleotide Ligation Assay


    Schwartz, Karen M.; Pike-Buchanan, Lisa L.; Muralidharan, Kasinathan; Redman, Joy B.; Wilson, Jean Amos; Jarvis, Michael; Cura, M. Grace; Pratt, Victoria M.


    The purpose of this work is to define rare variants of cystic fibrosis (CF) that are potential sources of error and can confound molecular genetic testing methods. We performed routine, clinical CF mutation screening using a laboratory-developed test and the oligonucleotide ligation assay reagents from Abbott/Celera. In this report, we describe 11 unique allele drop outs [3849 + 10kb C>T (NM_000492.2:c.3718-2477C>T), V520F (c.1558G>T), 1078delT (c.948delT), A455E (c.1364C>A), R347P (c.1040G>C...

  13. Efficacy of a commercial polymerase chain reaction-based assay for detection of Salmonella spp. in animal feeds. (United States)

    Maciorowski, K G; Pillai, S D; Ricke, S C


    Salmonellosis is a cyclic problem in the food industry, to which animal feed has been contributory. Current conventional methods of Salmonella spp. detection require 96 h for detection and confirmation. With modern and just-in-time production schedules, a 96-h hold represents a significant expense in storage and decontamination. The commercially available assay, 'BAX for Screening/Salmonella' (BAX), is based on the principle of the polymerase chain reaction and may represent a significant decrease in assay time. Seven fresh feed formulations, two fresh feed ingredients, seven stored feeds and two stored feed ingredients were artificially contaminated with a primary poultry isolate of Salmonella typhimurium and analysed by conventional and BAX methodology. The results of BAX agreed with conventional plating results for 16 of 18 samples spiked with 1200 cfu 10 g(-1) of feed and 13 of 18 samples spiked with 40 cfu 10 g(-1) of feed. Indigenous Salmonella spp. were detected in five of eight samples of poultry diets by conventional methods. With BAX, Salmonella spp. could not be detected in any of the samples after only 7 h of enrichment but could be detected in two dietary samples after 13 h of enrichment and four dietary samples after 24 h of enrichment. Specific sequences of salmonella DNA that were extracted from poultry diets could be detected with BAX. PMID:11054177

  14. Development of real-time quantitative polymerase chain reaction assays to track treatment response in retinoid resistant acute promyelocytic leukemia

    Directory of Open Access Journals (Sweden)

    Jelena V Jovanovic


    Full Text Available Molecular detection of minimal residual disease (MRD has become established to assess remission status and guide therapy in patients with PML-RARA+ acute promyelocytic leukemia (APL. However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF-RARA and STAT5b-RARA. Despite their relative rarity (<1% of APL we identified 6 cases (PLZF-RARA, n=5; STAT5b-RARA, n=1, established the respective breakpoint junction regions and designed real-time quantitative polymerase chain reaction (RQ-PCR assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17-associated APL, affording assay sensitivities of ~1 in 104-105. Serial samples were available from 2 PLZF-RARA APL patients. One showed persistent PCR positivity, predicting subsequent relapse, and remains in CR2, ~11 years post-autograft. The other, achieved molecular remission (CRm with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b-RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RQ-PCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly-defined subsets of acute leukemia.

  15. PCR (Polymerase Chain Reaction) Assay On Antibiotics Resistant Clinical Isolates Of Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    To detect to DNA of 9 drug-resistant isolates of m. tuberculosis such as isoniazid, streptomycin, isoniazid + streptomycin and isoniazid + rifampisin- resistant isolates, the DNA amplification by using PCR assay was carried out after lysing the bacterial cells. Two primer pairs for amplification used were Pt8 and Pt9 and Pt3 and Pt6. The amplified DNA taeget of 8 drug-resistant isolates and 1 drug-resistant isolate by means Pt8 8 Pt9 primer, gave the positive and negative result, respectively. Presence of amplified DNA target fragmens/bands on agarose gel, showed the positive result and vice verse. PCR process by using Pt3 and Pt6 primer revealed the positive results on 2 drug-resistant islates, whereas there was no amplified DNA bands from the other 7 isolates. DNA amplification by using either Pt8 and Pt9 or Pt3 and Pt6 primers occurred on H sub.37Rv strain DNA. Size of the amplified DNA products with Pt8 and Pt9 and Pt3 and Pt6 primers were 541 bp and 188 bp, respectively

  16. A species-specific polymerase chain reaction assay for rapid and sensitive detection of Colletotrichum capsici. (United States)

    Torres-Calzada, C; Tapia-Tussell, R; Quijano-Ramayo, A; Martin-Mex, R; Rojas-Herrera, R; Higuera-Ciapara, I; Perez-Brito, D


    Colletotrichum capsici is an important fungal species that causes anthracnose in many genera of plants causing severe economic losses worldwide. A primer set was designed based on the sequences of the ribosomal internal transcribed spacer (ITS1 and ITS2) regions for use in a conventional PCR assay. The primer set (CcapF/CcapR) amplified a single product of 394 bp with DNA extracted from 20 Mexican isolates of C. capsici. The specificity of primers was confirmed by the absence of amplified product with DNA of four other Colletotrichum species and eleven different fungal genera. This primer set is capable of amplifying only C. capsici from different contaminated tissues or fungal structures, thereby facilitating rapid diagnoses as there is no need to isolate and cultivate the fungus in order to identify it. The sensitivity of detection with this PCR method was 10 pg of genomic DNA from the pathogen. This is the first report of a C. capsici-specific primer set. It allows rapid pathogen detection and provides growers with a powerful tool for a rational selection of fungicides to control anthracnose in different crops and in the post-harvest stage. PMID:21253896

  17. Use of Polymerase Chain Reaction Enzyme Linked Oligonucleotide Sorbent Assay (Pcr-Elosa for Detection of Disease Agents

    Directory of Open Access Journals (Sweden)

    Simson Tarigan


    Full Text Available Diagnostic tool comprises one of the vital components in the control of infectious diseases. One of the most common techniques in the diagnosis of infectious disease currently available is the polymerase chain reaction (PCR because this technique is very sensitive, specific, and rapid. This technique requires an adjunct technique to indicate the formation of the right reaction product. Agarose gel electrophoresis has been the most common technique to visualise the PCR product or amplicon. Enzyme linked oligonucleotide sorbent assay (ELOSA is an alternative technique which is more sensitive and gives more important identity of the amplicon. This technique can be more than 100 times as sensitive as a gel agarose electrophoresis, and very specific since confirmation of the amplicon is carried out by DNA hibridisation. The capacity of the ELOSA can also be extended to the detection of disease-causal agent at subtype level, or detection of mutation at particular location in a gene. Since the equipment used for ELOSA is similar to that for ELISA (enzyme linked immunosorbent assay, a large number of samples can be accomplished rapidly. As in ELISA, a number of variation can be made in ELOSA depend on the requirement. Nucleotide can be immobilised on the microwell plate either by passive adsorbtion, by first conjugation of nucleotide with biotin then immobilisation on streptavidin-coated microwell plate, or immobilisaion by covalent bonding. The PCR and ELOSA can be performed at separate or in a single tube by first immobilising the PCR primers on the surface of microwell plates.

  18. Alteration in sample preparation to increase the yield of multiplex Polymerase Chain Reaction assay for diagnosis of genital ulcer disease

    Directory of Open Access Journals (Sweden)

    G Rao


    Full Text Available Purpose: Genital Ulcer Disease (GUD is common sexually transmitted infection (STI. Multiple studies have shown that GUDs are strongly associated with the transmission and the acquisition of HIV infection. An accurate diagnosis of common etiology of GUD namely Herpes, syphilis and Chancroid is possible using Multiplex PCR (M-PCR. However, frequent presence of Polymerase Chain Reaction inhibitors in the ulcer swab specimen limits the performance of the assay. In order to overcome this problem, alternative specimen preparation method was used. Materials and Methods: To determine the common etiology, GUD specimens obtained under an STI operations research study were tested with M-PCR after the samples were prepared using Roche Amplicor specimen preparation kit. PCR inhibiting samples were identified from that, which showed negative results. These samples were subjected to phenol-chloroform extraction and ethanol precipitation before the conduct of M-PCR on them. Results: Of the 237 GUD specimens tested, in 145 etiologies could be detected, whereas 92 samples were found negative. Further spiking with one of the target DNA, 128 of the negative samples were found to contain the inhibitors. These 126 samples were then subjected to phenol chloroform extraction and ethanol precipitation followed by M-PCR. Using this method for sample preparation, etiology could be determined in 46 (23% additional samples. This success rate of altered sample preparation method has been lower than that has reported. Conclusion: The results indicate that sample preparation using phenol chloroform extraction and ethanol precipitation, prior to M-PCR helps to eliminate the inhibitors and increase the yield of the assay. However, being a laborious procedure, it may be used for samples giving negative results after the screening by Roche Amplicor specimen preparation kit.

  19. Quantitative polymerase chain reaction (PCR) assays for a bacterial thiaminase I gene and the thiaminase-producing bacterium Paenibacillus thiaminolyticus. (United States)

    Richter, C.A.; Wright-Osment, Maureen K.; Zajicek, J.L.; Honeyfield, D.C.; Tillitt, D.E.


    The thiaminase I enzyme produced by the gram-positive bacterium Paenibacillus thiaminolyticus isolated from the viscera of Lake Michigan alewives Alosa pseudoharengus is currently the only defined source of the thiaminase activity linked to thiamine (vitamin B1) deficiency in early mortality syndrome (EMS) in the larvae of Great Lakes salmonines. Diets of alewife or isolated strains of P. thiaminolyticus mixed in a semipurified diet and fed to lake trout Salvelinus namaycush have been shown to produce EMS in fry. We utilized quantitative polymerase chain reaction (Q-PCR) to aid in studies of the sources of P. thiaminolyticus and thiaminase I. Quantitative PCR assays were established to detect the thiaminase I gene of P. thiaminolyticus, the 16S rRNA gene from most species of bacteria, and the 16S rRNA gene specifically from P. thiaminolyticus and a few closely related taxa. The Q-PCR assays are linear over at least six orders of magnitude and can detect the thiaminase I gene of P. thiaminolyticus from as few as 1,000 P. thiaminolyticus cells/g of sample or the Paenibacillus 16S rRNA gene from as few as 100 P. thiaminolyticus cells/g of sample. The initial results from alewife viscera samples with high thiaminase activity yielded unexpectedly low densities of P. thiaminolyticus cells; Paenibacillus thiaminolyticus was detectable in 2 of 6 alewife viscera tested at densities on the order of 100 cells/g out of 100,000,000 total bacterial cells/g. The low numbers of P. thiaminolyticus detected suggest that alewives contain additional non-P. thiaminolyticus sources of thiaminase activity.

  20. Typing of Plasmodium falciparum DNA from 2 years old Giemsa-stained dried blood spots using nested polymerase chain reaction assay. (United States)

    Kumar, D; Dhiman, S; Rabha, B; Goswami, D; Yadav, K; Deka, M; Veer, V; Baruah, I


    A panel of 129 Giemsa-stained thick blood spots (TBS) confirmed for Plasmodium falciparum infection having different levels of parasite density were collected from a malaria endemic area. DNA was extracted and nested polymerase chain reaction (PCR) assay was performed to amplify P. falciparum DNA. Nested PCR assay successfully amplified P. falciparum DNA at a very low parasitaemia of ~10 parasites/μl of blood. Current PCR assay is very simple and can be used retrospectively to monitor the invasion and prevalence of different Plasmodium species in endemic areas. PMID:27080775

  1. Overcoming RNA inhibition in the fluorescent polymerase chain reaction assay to enhance detection of bovine DNA in cattle feeds. (United States)

    Sawyer, Mary; Rensen, Gabriel; Smith, Wayne; Yee, Melanie; Wong, Alice; Osburn, Bennie; Cullor, James


    The practice of incorporating mammalian protein in ruminant feeds was banned in the United States in 1997 as a measure to avoid transmission of bovine spongiform encephalopathy (BSE). A sensitive means of identifying the banned additives in feeds would be by detection of species-specific DNA using the polymerase chain reaction (PCR). However, problems may arise in the PCR due to the presence of inhibitory substances. Using human DNA as an internal PCR control, inhibitory substances were evident in the DNA extraction products of cattle feeds. The results of heating experiments excluded enzymes as a cause of inhibition, and spectrophotometric calculations suggested the possibility of RNA contamination. Co-electrophoresis of untreated and RNAse digested extracts confirmed the presence of RNA in the undigested product. Seven cattle feeds were spiked with predetermined amounts of bovine meat and bone meal (BMBM). The DNA extracted products were treated with RNAse and the bovine specific mitochondrial DNA (B-mtDNA) was amplified by PCR. The minimum level of detection of B-mtDNA was influenced by RNAse treatment and feed composition. RNAse treatment decreased false-negative results overall by 75%. False-negative results were decreased 100% in the higher BMBM concentrations and 50% in the lower BMBM concentrations. Also, each cattle feed was spiked to attain a 2% wt/wt concentration with each swine, fish, sheep, or poultry product, or cattle dried blood. Amplification of B-mtDNA occurred only with the cattle dried blood and only in three feeds in which B-mtDNA was detected at the only level tested (2%). A commercial immunochromotographic assay (Neogen) detected the spiked BMBM in only one of the seven feeds and only at the upper concentration (1%). PMID:15992269

  2. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species. (United States)

    Nadal, Anna; Esteve, Teresa; Pla, Maria


    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary. PMID:19610365

  3. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp


    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Díez Baños, Pablo; Píriz, Ana; Fickel, Joerns; Sánchez, Antonio


    The present study aimed to establish a fluorescence- based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus- specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were an...

  4. Chain Reaction Polymerization. (United States)

    McGrath, James E.


    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  5. Access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: a randomised, controlled trial

    Directory of Open Access Journals (Sweden)

    Lindh Magnus


    Full Text Available Abstract Background Viral respiratory infections are common worldwide and range from completely benign disease to life-threatening illness. Symptoms can be unspecific, and an etiologic diagnosis is rarely established because of a lack of suitable diagnostic tools. Improper use of antibiotics is common in this setting, which is detrimental in light of the development of bacterial resistance. It has been suggested that the use of diagnostic tests could reduce antibiotic prescription rates. The objective of this study was to evaluate whether access to a multiplex polymerase chain reaction (PCR assay panel for etiologic diagnosis of acute respiratory tract infections (ARTIs would have an impact on antibiotic prescription rate in primary care clinical settings. Methods Adult patients with symptoms of ARTI were prospectively included. Nasopharyngeal and throat swabs were analysed by using a multiplex real-time PCR method targeting thirteen viruses and two bacteria. Patients were recruited at 12 outpatient units from October 2006 through April 2009, and samples were collected on the day of inclusion (initial visit and after 10 days (follow-up visit. Patients were randomised in an open-label treatment protocol to receive a rapid or delayed result (on the following day or after eight to twelve days. The primary outcome measure was the antibiotic prescription rate at the initial visit, and the secondary outcome was the total antibiotic prescription rate during the study period. Results A total sample of 447 patients was randomised. Forty-one were excluded, leaving 406 patients for analysis. In the group of patients randomised for a rapid result, 4.5% (9 of 202 of patients received antibiotics at the initial visit, compared to 12.3% (25 of 204 (P = 0.005 of patients in the delayed result group. At follow-up, there was no significant difference between the groups: 13.9% (28 of 202 in the rapid result group and 17.2% (35 of 204 in the delayed result group (P

  6. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer



    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have d...

  7. Establishment and Application of a TaqMan Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Rubella Virus RNA

    Institute of Scientific and Technical Information of China (English)

    Li-Hong ZHAO; Yu-Yan MA; Hong WANG; Shu-Ping ZHAO; Wei-Ming ZHAO; Hua LI; Lei-Yi WANG


    The aim of this study was to establish and apply a real-time quantitative reverse transcription polymerase chain reaction (RT-PCR) for rubella virus (RV) RNA. First, the primer and TaqMan probe concentrations, as well as reaction temperatures were optimized to establish an efficient real-time quantitative RT-PCR assay for RV RNA. Next, an RV-specific PCR amplicon was made as an external standard to estimate the linearity, amplification efficiency, analytical sensitivity and reproducibility of the real time quantitative assay. Finally, the assay was applied to quantify RVRNA in clinical samples for rubella diagnosis.The RV-specific PCR amplicon was prepared for evaluation of the assay at 503 bp, and its original concentration was 2.75×109 copies/μl. The real time quantitative assay was shown to have good linearity (R2=0.9920), high amplification efficiency (E=1.91), high sensitivity (275 copies/ml), and high reproducibility (variation coefficient range, from 1.25% to 3.58%). Compared with the gold standard, the specificity and sensitivity of the assay in clinical samples was 96.4% and 86.4%, respectively. Therefore, the established quantitative RT-PCR method is a simple, rapid, less-labored, quantitative, highly specific and sensitive assay for RV RNA.

  8. Evaluation of two real-time polymerase chain reaction assays for Porcine epidemic diarrhea virus (PEDV) to assess PEDV transmission in growing pigs. (United States)

    Miller, Laura C; Crawford, Kimberly K; Lager, Kelly M; Kellner, Steven G; Brockmeier, Susan L


    In April 2013, a Porcine epidemic diarrhea virus (PEDV) epidemic began in the United States. As part of the response, real-time reverse transcription polymerase chain reaction (RT-PCR) assays to detect PEDV were developed by several veterinary diagnostic laboratories. Our study evaluated RT-PCR PEDV assays that detect the N gene (gN) and S gene (gS) for their ability to detect PEDV infection and the transmission potential of pigs experimentally exposed to PEDV. Detection limits and quantification cycle (Cq) values of real-time RT-PCR were assayed for PEDV samples and positive controls for both gN and gS. The limit of detection for the gN assay was 10(-6) (mean Cq: 39.82 ± 0.30) and 10(-5) (mean Cq: 39.39 ± 0.72) for the gS assay with PEDV strain USA/Colorado/2013. Following recommended guidelines, rectal swabs (n = 1,064) were tested; 354 samples were positive by gN assay and 349 samples were positive by gS assay (Cq ≤ 34.99), 710 samples were negative by gN assay and 715 were negative by gS assay (Cq > 34.99) of which 355 and 344 were "undetermined" (i.e., undetected within a threshold of 40 RT-PCR cycles, by gN and gS assays, respectively). The coefficient of variation (intra-assay variation) ranged from 0.00% to 2.65% and interassay variation had an average of 2.75%. PEDV could be detected in rectal swabs from all pigs for ~2 weeks postinfection at which time the prevalence began to decrease until all pigs were RT-PCR negative by 5 weeks postinfection. Our study demonstrated that RT-PCR assays functioned well to detect PEDV and that the gN assay was slightly better. PMID:26699519

  9. Comparison of the direct fluorescence assay and real-time polymerase chain reaction for the detection of influenza virus A and B in immunocompromised patients

    Directory of Open Access Journals (Sweden)

    Ana Helena Perosa


    Full Text Available OBJECTIVE: This study evaluated the diagnostic performance of two methods for the detection of influenza virus in immunocompromised transplant patients. METHODS: A total of 475 respiratory samples, 236 from patients in a hematopoietic stem cell transplantation program and 239 from kidney transplant patients, were analyzed by a direct fluorescence assay and the Centers for Disease Control real-time polymerase chain reaction protocol for influenza A and B detection. RESULTS: Influenza detection using either method was 7.6% in the hematopoietic stem cell transplant group and 30.5% in the kidney transplant patient group. Influenza detection by real-time polymerase chain reaction yielded a higher positive rate compared with fluorescence than that reported by other studies, and this difference was more pronounced for influenza A. The fluorescence assay sensitivity, specificity, positive and negative predictive values, and kappa coefficient were 17.6%, 100%, 1, 0.83, and 0.256, respectively, and lower detection rates occurred in the kidney transplant patients. CONCLUSIONS: The real-time polymerase chain reaction performance and the associated turnaround time for a large number of samples support the choice of this method for use in different routine diagnostic settings and influenza surveillance in high-risk patients.

  10. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products. (United States)

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M


    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials. PMID:27501408

  11. TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget. (United States)

    Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub


    This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated. PMID:26458055

  12. Loop mediated isothermal amplification assay using hydroxy naphthol blue, conventional polymerase chain reaction and real-time PCR in the diagnosis of intraocular tuberculosis

    Directory of Open Access Journals (Sweden)

    P K Balne


    Full Text Available This study is a comparative evaluation (Chi-square test of a closed tube loop mediated isothermal amplification assay using hydroxy naphthol blue dye (HNB-LAMP, real-time polymerase chain reaction (PCR and conventional PCR in the diagnosis of intraocular tuberculosis. Considering clinical presentation as the gold standard in 33 patients, the sensitivity of HNB-LAMP assay (75.8% was higher (not significant, P value 0.2 than conventional PCR (57.6% and lower than real-time PCR (90.9%. Specificity was 100% by all three methods. No amplification was observed in negative controls (n = 20 by all three methods. The cost of the HNB-LAMP assay was Rs. 500.00 and it does not require thermocycler, therefore, it can be used as an alternative to conventional PCR in resource-poor settings.

  13. Detection of the Pandemic H1N1/2009 Influenza A Virus by a Highly Sensitive Quantitative Real-time Reverse-transcription Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    Zhu Yang; Guoliang Mao; Yujun Liu; Yuan-Chuan Chen; Chengjing Liu; Jun Luo; Xihan Li


    A quantitative real time reverse-transcription polymerase chain reaction (qRT-PCR) assay with specific primers recommended by the World Health Organization (WHO) has been widely used successfully for detection and monitoring of the pandemic H1N 1/2009 influenza A virus.In this study,we report the design and characterization of a novel set of primers to be used in a qRT-PCR assay for detecting the pandemic H1N1/2009 virus.The newly designed primers target three regions that are highly conserved among the hemagglutinin (HA) genes of the pandemic H1N1/2009 viruses and are different from those targeted by the WHO-recommended primers.The qRT-PCR assays with the newly designed primers are highly specific,and as specific as the WHO-recommended primers for detecting pandemic H1N1/2009 viruses and other influenza viruses including influenza B viruses and influenza A viruses of human,swine,and raccoon dog origin.Furthermore,the qRT-PCR assays with the newly designed primers appeared to be at least 10-fold more sensitive than those with the WHO-recommended primers as the detection limits of the assays with our primers and the WHO-recommended primers were 2.5 and 25 copies of target RNA per reaction,respectively.When tested with 83 clinical samples,32 were detected to be positive using the qRT-PCR assays with our designed primers,while only 25 were positive by the assays with the WHO-recommended primers.These results suggest that the qRT-PCR system with the newly designed primers represent a highly sensitive assay for diagnosis of the pandemic H1N1/2009 virus infection.

  14. Development of a set of multiplex standard polymerase chain reaction assays for the identification of infectious agents from aborted bovine clinical samples. (United States)

    Tramuta, Clara; Lacerenza, Daniela; Zoppi, Simona; Goria, Mariella; Dondo, Alessandro; Ferroglio, Ezio; Nebbia, Patrizia; Rosati, Sergio


    The current study describes the development of a set of 5 multiplex polymerase chain reaction (mPCR) assays for the simultaneous detection of abortive infection agents in bovine fetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mPCR1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mPCR2); Coxiella burnetii and Chlamydophila psittaci (mPCR3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mPCR4); and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mPCR5). The protocol was tested on different tissue samples collected from 50 aborted bovine fetuses, and it showed that out of the 50 fetuses, 7 (14%, mPCR2) were PCR-positive for N. caninum, 4 (8%, mPCR5) were PCR-positive for BVDV, and 2 (4%, mPCR4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. Moreover, all multiplex PCR assays on clinical samples were compared with reference methods, obtaining a perfect accordance in all samples and confirming the validity of the set of multiplex PCR assays. The proposed set of multiplex PCR assays is, therefore, suitable for the simultaneous detection of the main infectious agents responsible for bovine abortion. PMID:21908306

  15. A rapid, 2-well, multiplex real-time polymerase chain reaction assay for the detection of SCCmec types I to V in methicillin-resistant Staphylococcus aureus. (United States)

    Valvatne, Håvard; Rijnders, Michelle I A; Budimir, Ana; Boumans, Marie-Louise; de Neeling, Albert J; Beisser, Patrick S; Stobberingh, Ellen E; Deurenberg, Ruud H


    For us to assess the spread of methicillin-resistant Staphylococcus aureus (MRSA), typing of the staphylococcal cassette chromosome mec (SCCmec) is a valuable addition to existing typing methods, such as multilocus sequence typing (MLST). Traditional SCCmec typing assays, that is, that of Oliveira et al. and Ito et al., are polymerase chain reaction (PCR) based, requiring electrophoresis. We introduce a rapid, 2-well, multiplex real-time PCR assay that can be used directly on bacterial suspensions and is able to characterize SCCmec type I to V based on the detection of the ccr genes and the mec complex. The assay was evaluated on 212 clinical MRSA isolates from various countries, associated with MLST clonal complexes (CC) 1, 5, 8, 22, 30, and 45, as well as pig-associated CC398. When comparing the real-time PCR assay with traditional methods, the correct SCCmec element was identified in 209 (99%) of the 212 MRSA isolates. The new assay enables high-throughput analyses for SCCmec on large strain collections. PMID:19781888

  16. Polymerase chain reaction


    Gaurav Solanki


    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  17. Detection of infectious bursal disease virus in various lymphoid tissues of experimentally infected specific pathogen free chickens by different reverse transcription polymerase chain reaction assays

    DEFF Research Database (Denmark)

    Kabell, Susanne; Handberg, Kurt; Kusk, Mette;


    transcription polymerase chain reaction (RT-PCR) assays, including two recently developed strain-specific assays, were employed for detection of ribonucleic acid (RNA) from three different IBDV strains in bursa tissue samples from experimentally infected specific pathogen free chickens. The virus strains......Infectious bursal disease (IBD) is a worldwide distributed immunosuppressive viral disease in young chickens, controlled by vaccination. Emergence of several strains of IBD virus (IBDV) has created a demand for strain-specific diagnostic tools. In the present experiment, five different reverse...... included vaccine strain D78, classical strain Faragher 52/70, and the very virulent Danish strain DK01 The presence of the virus infection was confirmed by histopathologic evaluation of bursa lesions. The largest number of positive samples was obtained with a strain-specific two-step multiplex (MPX) RT...

  18. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP). (United States)

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis


    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. PMID:26880717

  19. A quantitative polymerase chain reaction assay for the enumeration of brown tide algae Aureococcusanophagefferens in coastal waters of Qinhuangdao

    Institute of Scientific and Technical Information of China (English)

    GUO Hao; LIU Yongjian; ZHANG Qi; YUAN Xiutang; ZHANG Weiwei; ZHANG Zhifeng


    Aureococcus anophagefferens, a small pelagophyte algae, has caused brown tide blooms in coastal waters of Qinhua-ngdao in recent years, presenting significant negative impacts on the shellfish mariculture industry. Under standard light microscopy, it is visually indistinguishable from other small algae in field samples due to its extremely small size. In this study, quantitative polymerase chain reaction (qPCR) based on 18S rDNA sequences was developed and used to detect and enumerate A. anophagefferens. A linear regression (R2=0.91) was generated based on cycle thr-esholds value (Ct) versus known concentrations of A. anophagefferens. Twenty-two field samples collected in coastal waters of Qinhuangdao were subjected to DNA extraction and then analyzed using qPCR. Results showed that A. anophagefferens had a wide distribution in coastal waters along Qinhuangdao. Elevated A. anophagefferens abun-dance, category 3 brown tide blooms (>200 000 cells/mL) occurred at Dongshan Beach and Tiger-stone Beach in August in 2013. In shellfish mariculture areas along coastal waters of Qinhuangdao, 4 stations had category 3 blooms, and 6 stations had category 2 blooms (35 000–200 000 cells/mL) in August and all stations had category 1 blooms (>0 to ≤35 000 cells/mL) in October. Quantitative PCR allows for detection of A. anophagefferens cells at low levels in filed samples, which is essential to effective management and prediction of brown tide blooms.

  20. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    International Nuclear Information System (INIS)

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  1. Development of an assay for rapid identification of meat from yak and cattle using polymerase chain reaction technique. (United States)

    Yin, R H; Bai, W L; Wang, J M; Wu, C D; Dou, Q L; Yin, R L; He, J B; Luo, G B


    Yak meat is of good quality with fine texture, high protein and low fat content, and rich in amino acids compared with that of cattle, and it lacks anabolic steroids or other drugs. In general terms, however, the meat yield of yak is relatively low compared with that of the cattle. In order to prevent possible adulteration of yak meat with cattle meat, based on the sequence of mitochondrial 12S rRNA gene, a multiplex PCR-based approach was proposed for rapid identification of the meat from yak and cattle using three primers designed in this work. Through the combinatorial usage of three primers with a single reaction set, two fragments of 290 and 159bp were amplified from the cattle meat DNA, whereas only a fragment of 290bp was obtained from the yak meat DNA. Using the assay described, satisfactory amplification was accomplished in the analysis of raw and heat-treated binary meat mixtures of yak/cattle with a detection limit of 0.1% for cattle meat. The technique is fast and straightforward. It might be a useful tool in the quality control of yak meat and meat products. PMID:20416705

  2. Development and inter-laboratory transfer of a decaplex polymerase chain reaction assay combined with capillary electrophoresis for the simultaneous detection of ten food allergens. (United States)

    Cheng, Fang; Wu, Jiajie; Zhang, Jin; Pan, Aihu; Quan, Sheng; Zhang, Dabing; Kim, HaeYeong; Li, Xiang; Zhou, Shan; Yang, Litao


    Food allergies cause health risks to susceptible consumers and regulations on labeling of food allergen contents have been implemented in many countries and regions. To achieve timely and accurate food allergen labeling, the development of fast and effective allergen detection methods is very important. Herein, a decaplex polymerase chain reaction (PCR) assay combined with capillary electrophoresis was developed to detect simultaneously 10 common food allergens from hazelnut, pistachio, oat, sesame, peanut, cashew, barley, wheat, soybean and pecan. The absolute limit of detection (LODa) of this system is between 2 and 20 copies of haploid genome, and the relative LOD (LODr) is as low as 0.005% (w/w) in simulated food mixtures. The developed assay was subsequently applied to 20 commercial food products and verified the allergen ingredients stated on the labels. Furthermore, results using this decaplex PCR assay was successfully replicated in three other laboratories, demonstrating the repeatability and applicability of this assay in routine analysis of the 10 food allergens. PMID:26776037

  3. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris). (United States)

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M


    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1. PMID:25437743

  4. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples. (United States)

    Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary


    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. PMID:23017260

  5. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    LENUS (Irish Health Repository)

    Meyler, Kenneth L


    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies\\/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and\\/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF.

  6. Development of real-time reverse transcription polymerase chain reaction assays to quantify insulin-like growth factor receptor and insulin receptor expression in equine tissue

    Directory of Open Access Journals (Sweden)

    Stephen B. Hughes


    Full Text Available The insulin-like growth factor system (insulin-like growth factor 1, insulin-like growth factor 2, insulin-like growth factor 1 receptor, insulin-like growth factor 2 receptor and six insulin-like growth factor-binding proteins and insulin are essential to muscle metabolism and most aspects of male and female reproduction. Insulin-like growth factor and insulin play important roles in the regulation of cell growth, differentiation and the maintenance of cell differentiation in mammals. In order to better understand the local factors that regulate equine physiology, such as muscle metabolism and reproduction (e.g., germ cell development and fertilisation, real-time reverse transcription polymerase chain reaction assays for quantification of equine insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were developed. The assays were sensitive: 192 copies/µLand 891 copies/µL for insulin-like growth factor 1 receptor, messenger ribonucleic acid and insulin receptor respectively (95%limit of detection, and efficient: 1.01 for the insulin-like growth factor 1 receptor assay and 0.95 for the insulin receptor assay. The assays had a broad linear range of detection (seven logs for insulin-like growth factor 1 receptor and six logs for insulin receptor. This allowed for analysis of very small amounts of messenger ribonucleic acid. Low concentrations of both insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were detected in endometrium, lung and spleen samples, whilst high concentrations were detected in heart, muscle and kidney samples, this was most likely due to the high level of glucose metabolism and glucose utilisation by these tissues. The assays developed for insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid expression have been shown to work on equine tissue and will contribute to the understanding of insulin and insulin-like growth factor 1

  7. Identification of Human Adenovirus in Respiratory Samples with Luminex Respiratory Virus Panel Fast V2 Assay and Real-Time Polymerase Chain Reaction. (United States)

    Esposito, Susanna; Scala, Alessia; Bianchini, Sonia; Zampiero, Alberto; Fossali, Emilio; Principi, Nicola


    In order to compare the last version of the Respiratory Virus Panel (RVP) Fast assay for human Adenovirus (hAdv) detection with a specific real-time polymerase chain reaction (qPCR), which is considered the gold standard for hAdv detection, nasopharyngeal samples collected from 309 children (age range, four months to eight years) with respiratory tract infection were tested using the RVP Fast v2 assay (Luminex Molecular Diagnostics, Inc., Toronto, ON, Canada) and a specific TaqMan qPCR to identify hAdv DNA. The RVP Fast v2 assay detected 30/61 (49.2%) hAdv infections that had been identified by real-time qPCR, demonstrating a significantly lower detection rate (p < 0.001). The sensitivity of the RVP Fast v2 assay in comparison to qPCR was lower in younger children (42.9% vs. 57.7%; Cohen's kappa coefficient, 0.53); in samples with co-infections (40.0% vs. 56.7%; Cohen's kappa coefficient, 0.52); and in samples with hAdv type C (45.9% vs. 57.1%; Cohen's kappa coefficient, 0.60). Samples with lower viral loads were associated with a significantly lower sensitivity of the RVP Fast v2 assay (35.1% vs. 68.2%, p = 0.01; Cohen's kappa coefficients, 0.49). The RVP Fast v2 assay has important limitations for the detection of hAdv and cannot be used to evaluate whether hAdvs are the main etiologic agent responsible for an outbreak or when epidemiological studies are performed. PMID:26927078

  8. Evaluation of a polymerase chain reaction assay for the diagnosis of bovine Trypanosomosis and epidemiological surveillance in Bolivia

    International Nuclear Information System (INIS)

    Sporadic outbreaks of bovine Trypanosomiasis have been reported in Bolivia since 1996 when T.vivax and T.evansi were identified for the first time by parasitological means. However, comprehensive epidemiological information concerning T.vivax and T.evansi in the country is lacking. Current parasitological and serological diagnostic methods for Trypanosomiasis have important limitations either in their sensitivity or specificity, which can result in unreliable data when applied in epidemiological studies. PCR assays are a recently developed procedure that might help to overcome the constraints of parasitological and serological assays. Therefore, the objective of this study was to evaluate PCR assays as a diagnostic tool for epidemiological studies in Bolivia. PCR assays for diagnosis of Trypanosome infection in cattle were evaluated for their ability to detect Trypanosome DNA in blood spots samples collected from cattle in four different provinces from the Bolivian lowlands and the results compared with those obtained with standard parasitological (Micro Haematocrit Centrifugation Technique (HCT) and stained smears) and serological methods (Card Agglutination Test for T.evansi (CATT), and Antibody ELISAs for T.vivax and T. congolense). Kappa agreement analysis showed a significant agreement between PCR assays and results from parasitological methods but there was no agreement when PCR was compared with serological assays. Some samples from T.vivax smear positive animals were negative by PCR, therefore modifications to the PCR assay conditions were undertaken to try to improve agreement between PCR and parasitological assays. Changes in the template DNA concentration or the use of an alternative primer sets resulted in improvements in the PCR detection rate, but not all the parasitologically positive samples were detected by PCR. Results from PCR assays for T.vivax and T.evansi were combined with results from parasitological and serological assays to provide

  9. Relative efficiency of polymerase chain reaction and enzyme-linked immunosorbant assay in determination of viral etiology in congenital cataract in infants

    Directory of Open Access Journals (Sweden)

    Shyamala G


    Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.

  10. Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms. (United States)

    Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa


    Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed. PMID:16001857

  11. A Quantitative Polymerase Chain Reaction Assay for the Detection and Quantification of Epizootic Epitheliotropic Disease Virus (EEDV; Salmonid Herpesvirus 3). (United States)

    Glenney, Gavin W; Barbash, Patricia A; Coll, John A


    Epizootic epitheliotropic disease virus (EEDV; salmonid herpesvirus [SalHV3]; family Alloherpesviridae) causes a systemic disease of juvenile and yearling Lake Trout Salvelinus namaycush. No cell lines are currently available for the culture and propagation of EEDV, so primary diagnosis is limited to PCR and electron microscopy. To better understand the pervasiveness of EEDV (carrier or latent state of infection) in domesticated and wild Lake Trout populations, we developed a sensitive TaqMan quantitative PCR (qPCR) assay to detect the presence of the EEDV terminase gene in Lake Trout tissues. This assay was able to detect a linear standard curve over nine logs of plasmid dilution and was sensitive enough to detect single-digit copies of EEDV. The efficiency of the PCR assay was 99.4 ± 0.06% (mean ± SD), with a 95% confidence limit of 0.0296 (R(2) = 0.994). Methods were successfully applied to collect preliminary data from a number of species and water bodies in the states of Pennsylvania, New York, and Vermont, indicating that EEDV is more common in wild fish than previously known. In addition, through the development of this qPCR assay, we detected EEDV in a new salmonid species, the Cisco Coregonus artedi. The qPCR assay was unexpectedly able to detect two additional herpesviruses, the Atlantic Salmon papillomatosis virus (ASPV; SalHV4) and the Namaycush herpesvirus (NamHV; SalHV5), which both share high sequence identity with the EEDV terminase gene. With these unexpected findings, we subsequently designed three primer sets to confirm initial TaqMan qPCR assay positives and to differentiate among EEDV, ASPV, and NamHV by detecting the glycoprotein genes via SYBR Green qPCR. Received April 20, 2015; accepted November 10, 2015. PMID:26980561

  12. Spirochetemia due to Treponema pallidum using polymerase-chain-reaction assays in patients with early syphilis: prevalence, associated factors and treatment response. (United States)

    Wu, B-R; Tsai, M-S; Yang, C-J; Sun, H-Y; Liu, W-C; Yang, S-P; Wu, P-Y; Su, Y-C; Chang, S-Y; Hung, C-C


    Between 2009 and 2013, polymerase-chain-reaction assay was used to detect Treponema pallidum in the blood samples collected from 296 patients with early syphilis (241 being HIV infected) and 102 patients (34.5%) had spirochetemia. The presence of spirochetemia was associated with lower CD4 counts (per 10-cell/mm(3) decrease, adjusted odds ratio (AOR), 1.020; 95% CI, 1.006-1.036) and secondary syphilis (AOR, 4.967; 95% CI, 2.016-12.238). Patients with early latent syphilis were less likely to achieve serological response compared with those with primary or secondary syphilis (AOR, 0.317; 95% CI, 0.142-0.708). However, serological response was not affected by presence of spirochetemia or antibiotic regimens. PMID:24350785

  13. Comparison of Parasite Burden Using Real-Time Polymerase Chain Reaction Assay and Limiting Dilution Assay in Leishma-nia major Infected Mouse

    Directory of Open Access Journals (Sweden)

    Somayeh GHOTLOO


    Full Text Available Background:Limiting dilution assay is considered as the gold standard method for quantifying the number of parasites in the animal model of Leishmania infection. Nowadays, real-time PCR is being increasingly applied to quantify infectious agents. In the present study, a real-time PCR assay was developed to estimate para­site burdens in lymph nodes of Leishmania major infected BALB/C mice. Enumera­tion of parasites was also performed by limiting dilution assay and compared with the results of real-time PCR based quantification.Methods:The SYBR Green based real- time PCR assay was performed to amplify a 75 bp fragment of superoxide dismutase B1 gene in the lymph nodes of L. major infected BALB/C mice 8 weeks post infection. Mice were infected subcutaneously at the base of their tail with 2 × 105L. major promastigotes in the stationary phase of growth. To compare parasite burdens obtained by real-time PCR assay with those of limiting dilution assay, twelve 8-fold serial dilutions of the lymph node homoge­nates were prepared in the Schneider medium and incubated at 26°C.After 7 days, wells containing motile parasites were identified by direct observation under an inverted light microscope and the total number of parasites was estimated using the ELIDA software.Results:Spearman's correlation coefficient of the parasite burdens between real-time PCR and limiting dilution assay was 0.72 (Pvalue = 0.008.Conclusion:Real-time PCR assay is an appropriate replacement to existing limit­ing dilution assay in quantifying parasite burden in the experimental model of Leishma­nia infection.


    We present a simple assay to determine the SLA haplotypes of animals within two experimental herds of MHC defined miniature pigs. The Yucatan Miniature Pigs have four founder haplotypes (w, x, y, z) and one recombinant haplotype (q). The NIH Miniature Pigs have three founder haplotypes (a, c, d) an...

  15. Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Gaurav Solanki


    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  16. Development and validation of a real-time Taqman polymerase chain reaction assay for the detection of Mycoplasma gallisepticum in naturally infected birds (United States)

    In this study, we report the development and validation of a real-time PCR assay using a Taqman labeled probe (MGLP assay) for the detection of Mycoplasma gallisepticum (M. gallisepticum). The MGLP assay was highly specific with a detection limit of 25 template copies/reaction and a quantification l...

  17. Longitudinal study of the detection of Bluetongue virus in bull semen and comparison of real-time polymerase chain reaction assays. (United States)

    Gu, Xingnian; Davis, Rodney J; Walsh, Susan J; Melville, Lorna F; Kirkland, Peter D


    Infection with Bluetongue virus (BTV) is a significant impediment to the global movement of bovine semen. Repeat testing of blood from donor animals is specified in the World Organization for Animal Health (OIE) Manual for the export of semen from regions where BTV may be present. Screening of blood or semen samples has usually been carried out by virus isolation (VI) either by inoculation of chicken embryos followed by passage onto insect and mammalian cell cultures or in vivo inoculation of sheep followed by serology to detect seroconversion. Direct testing of semen for BTV would enable earlier release of semen samples and avoid repeat testing of the donor, as well as provide an option for releasing batches of semen that were collected without certification of the donor. Quantitative (real-time) reverse transcription polymerase chain reaction (qRT-PCR) assays overcome most of the limitations of other methods and have the potential to provide higher sensitivity. The present study compared 5 qRT-PCR assays, including 2 commercially available kits, for the detection of BTV in semen serially collected from 8 bulls over a period of 90 days after experimental infection. The results of the study show that at least one of the qRT-PCR assays is extremely reproducible and has both very high sensitivity and specificity to reliably detect all available serotypes. The preferred qRT-PCR gave consistently superior results to VI, sheep inoculation, and conventional RT-PCR. Therefore, the assay can be recommended for the screening of bovine semen for freedom from BTV. PMID:24532692

  18. Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide

    Directory of Open Access Journals (Sweden)

    Yuexia Wang


    Full Text Available Real-time polymerase chain reaction (PCR allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at −18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 103 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 100 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach.

  19. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4. (United States)

    Lin, Ying-Hong; Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda


    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  20. Assessment of litter prevalence of Mycoplasma hyopneumoniae in preweaned piglets utilizing an antemortem tracheobronchial mucus collection technique and a real-time polymerase chain reaction assay. (United States)

    Vangroenweghe, Frédéric; Karriker, Locke; Main, Rodger; Christianson, Eric; Marsteller, Thomas; Hammen, Kristin; Bates, Jessica; Thomas, Paul; Ellingson, Josh; Harmon, Karen; Abate, Sarah; Crawford, Kimberly


    The swine industry currently lacks validated antemortem methods of detecting baseline herd prevalence of Mycoplasma hyopneumoniae. The focus of our study was to evaluate alternative antemortem detection techniques and to determine baseline litter prevalence in preweaned pig populations utilizing the selected technique and a real-time polymerase chain reaction (qPCR) assay. Preliminary data was analyzed on weaned piglets with evidence of respiratory disease (n = 32). Five sample types (antemortem nasal swab, tracheobronchial mucus, postmortem deep airway swab, bronchoalveolar lavage, and lung tissue) were collected from each pig. Individual samples were tested for M. hyopneumoniae using qPCR. Compared to nasal swabs, tracheobronchial mucus demonstrated higher test sensitivity (P hyopneumoniae. Two out of 180 litters revealed a positive result (1.1%). Individual qPCR assays were run on the samples collected from sow farm 4. Five out of 30 samples revealed a positive result (16.7%). Tracheobronchial mucus collection in combination with qPCR is a sensitive antemortem sampling technique that can be used to estimate the prevalence of M. hyopneumoniae in preweaned pigs, thus providing insight into the infection dynamics across the entire farrow-to-finish process. PMID:26179099

  1. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4 (United States)

    Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda


    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  2. Detection of Klebsiella pneumoniae in Emulsifiable Dust by Polymerase Chain Reaction Assay%PCR检测乳粉中肺炎克雷伯氏菌

    Institute of Scientific and Technical Information of China (English)

    秦丽; 周正; 穆燕魁; 吴涛; 周巍


    A uniplex polymerase chain reaction(PCR) assay was developed for direct detection Klebsiella pneumoniae without enrichment in emulsifiable dust. A solvent extraction procedure was successfully modified for extraction of Klebsiella pneumoniae DNA from artifically by contaminated whole milk, skim milk and cheese. Primer targeting the thermostable nuclease gene(ITS) was used in the uniplex PCR. A DNA fragment of 158 bp was amplified. PCR product was confirmed by DNA sequencing. The sensitivity of the uniplex PCR is 10 CFU/mL.The developed methodology allows detection of Klebsiella pneumoniae in emulsifiable dust in less than 6 h, the time of this developed PCR assay is 12~24 h less than the time of general PCR assay with enrichment method.%利用PCR技术直接检测乳粉中的肺炎克雷伯氏菌,无需增菌.通过滤膜法成功地从人工污染肺炎克雷伯氏菌的乳粉中提取了肺炎克雷伯氏菌的DNA.以肺炎克雷伯氏菌的间区序列(ITS)为靶基因,经过PCR扩增得到158 bp的产物,经过DNA测序证实该产物为目的扩增产物.该方法灵敏度高,乳粉中检测的灵敏度为10CFU/mL,可在6 h内完成对乳品中肺炎克雷伯氏菌的检测,比目前普遍采用的先增菌再进行PCR检测的方法缩短了12-24 h.

  3. Absence of Bacteria on Coronary Angioplasty Balloons from Unselected Patients: Results with Use of a High Sensitivity Polymerase Chain Reaction Assay (United States)

    Hansen, Gorm Mørk; Nilsson, Martin; Nielsen, Claus Henrik; Holmstrup, Palle; Helqvist, Steffen; Tolker-Nielsen, Tim; Givskov, Michael; Hansen, Peter Riis


    Periodontitis is a chronic, bacterially-induced inflammatory disease of the tooth-supporting tissues, which may result in transient bacteremia and a systemic inflammatory response. Periodontitis is associated with coronary artery disease independently of established cardiovascular risk factors, and translocation of bacteria from the oral cavity to the coronary arteries may play a role in the development of coronary artery disease. Very few studies have used angioplasty balloons for in vivo sampling from diseased coronary arteries, and with varying results. Therefore, the aim of this study was to assess if bacterial DNA from primarily oral bacteria could be detected on coronary angioplasty balloons by use of an optimized sampling process combined with an internally validated sensitive polymerase chain reaction (PCR) assay. Coronary angioplasty balloons and control samples from a total of 45 unselected patients with stable angina, unstable angina/non-ST elevation myocardial infarction, and ST-elevation myocardial infarction (n = 15 in each group) were collected and analyzed using a PCR assay with high sensitivity and specificity for 16S rRNA genes of the oral microbiome. Despite elimination of extraction and purification steps, and demonstration of sensitivity levels of 25–125 colony forming units (CFU), we did not detect bacterial DNA from any of the coronary angioplasty balloons. A subsequent questionnaire indicated that the prevalence of periodontitis in the study cohort was at least 39.5%. Although coronary angioplasty balloons are unlikely to be useful for detection of bacteria with current PCR techniques in unselected patients with coronary artery disease, more studies are warranted to determine the extent to which bacteria contribute to atherosclerosis and its clinical manifestations and whether the presence of bacteria in the arteries is a transient phenomenon. PMID:26695491

  4. Detection of Pseudomonas aeruginosa by a triplex polymerase chain reaction assay based on lasI/R and gyrB genes. (United States)

    Aghamollaei, Hosseine; Moghaddam, Mehrdad M; Kooshki, Hamid; Heiat, Mohammad; Mirnejad, Reza; Barzi, Nastaran S


    Pseudomonas aeruginosa is a nosocomial pathogen, which, due to its inherent and acquired resistance to a wide range of antibiotics, causes high mortality rates. Therefore, rapid detection of the bacterium with high specificity and sensitivity plays a critical role in the control of the pathogenic bacterium. The aim of this study was to evaluate the accuracy and specificity of a prompt detection of the bacterium based on a triplex polymerase chain reaction that amplifies the lasI, lasR and gyrB genes. For this purpose, 30 clinical isolates of P. aeruginosa and 30 wound biopsy samples were retrieved from clinical diagnostic laboratories. After the extraction of the chromosomal DNA, the desired genes were amplified using uniplex and triplex PCR with appropriate primers. The specificity of the primers was evaluated by a comparison of the PCR results for P. aeruginosa clinical samples and non-Pseudomonas species control samples. The sensitivity of the primers was determined using a serial dilution of the genomic DNA template (100 ng to 100 fg) and by a comparison of the PCR and bacterial culture results. The results showed that the triplex PCR assay was positive for all of the samples (100%), while the PCR identifications were negative for non-Pseudomonas species. Additionally, at 10(-4) and 10(-5) diluted genomic DNA from P. aeruginosa (10 pg and 1 pg), the triplex PCR test was positive for the Las and gyrB genes in all of the samples, respectively. Based on these results, the designed primers can be used for the rapid, specific and sensitive diagnosis of P. aeruginosa in a triplex PCR assay. PMID:25863575

  5. Parvovirus B19 infections in state of Rio de Janeiro, Brasil: 526 sera analyzed by IgM-enzyme-linked immunosorbent assay and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    MCL Mendonça


    Full Text Available In this study were analyzed 526 sera; the patients aged from two days to 65 years old presenting exanthema, which was the most frequent symptom observed, besides fever, adenomegaly, and arthralgia. These sera were negative by enzyme-linked immunosorbent assay (IgM-ELISA for either rubella (495, toxoplasma (41, cytomegalovirus (12, measles (40, dengue (56, and they were submitted to nested polymerase chain reaction (PCR for B19 DNA and commercial IgM-ELISA for B19. In 39 abortion cases, IgM or DNA were not detected, therefore they were not took into account for analysis. Specific DNA and IgM were detected respectively in 71 (14.5% and IgM in 62 (12.7% sera from 487 sera analyzed. IgM and DNA were simultaneously detected in 43 (8.8%, while agreement among the results by PCR and IgM-ELISA was observed in 440 (90.4%. The sera were collected from January 1999 to December 2000, most of them in 1999 (325, during winter and spring. The major number of clinical cases was observed in the age group from one to ten years old. IgM or DNA were detected in 23 from 51 municipal districts of the state of Rio de Janeiro, where the samples were collected.

  6. Development of a duplex quantitative polymerase chain reaction assay for detection of bovine herpesvirus 1 and bovine viral diarrhea virus in bovine follicular fluid. (United States)

    Marley, Mylissa S D; Givens, M Daniel; Galik, Patricia K; Riddell, Kay P; Stringfellow, David A


    The objective of this study was to develop a duplex quantitative polymerase chain reaction (qPCR) assay for simultaneous detection of bovine herpesvirus 1 (BoHV-1) and bovine viral diarrhea virus (BVDV) type I and type II. Follicular fluid was collected from a BoHV-1 acutely infected heifer, a BVDV I persistently infected heifer, and from 10 ovaries recovered from an abattoir. Both the BoHV-1 and BVDV contaminated follicular fluid were diluted 1:5 to 1:10(7) using the pooled, abattoir-origin follicular fluid. Each dilution sample was analyzed using the duplex qPCR, virus isolation, reverse transcription-nested PCR (RT-nPCR), and BoHV-1 qPCR. The duplex qPCR was able to simultaneously detect BoHV-1 and BVDV I in the fluid diluted to 1:100 and 1:1000, respectively. These results corresponded with the reverse transcription-nested PCR and BoHV-1 qPCR. Therefore, the duplex qPCR might be used for quality assurance testing to identify these two viruses in cells, fluids and tissues collected from donor animals and used in reproductive technologies. PMID:18452983

  7. Diagnostic accuracy of an IgM enzyme-linked immunosorbent assay and comparison with 2 polymerase chain reactions for early diagnosis of human leptospirosis. (United States)

    Vanasco, N B; Jacob, P; Landolt, N; Chiani, Y; Schmeling, M F; Cudos, C; Tarabla, H; Lottersberger, J


    Enzyme-linked immunosorbent assay (ELISA) tests and polymerase chain reaction (PCR) may play a key role for early detection and treatment of human leptospirosis in developing countries. The aims of this study were to develop and validate an IgM ELISA under field conditions and to compare the diagnostic accuracy among IgG, IgM ELISAs, conventional PCR (cPCR), and real-time PCR (rtPCR) for early detection of human leptospirosis. Overall accuracy of IgM ELISA was sensitivity of 87.9%, specificity of 97.0%, and area under the curve of 0.940. When the 4 methods were compared, IgM ELISA showed the greatest diagnostic accuracy (J=0.6) followed by rtPCR (J=0.4), cPCR (J=0.2) and IgG ELISA (J=0.1). Our results support the use of IgM ELISA and rtPCR for early diagnosis of the disease. Moreover, due to their high specificity, they could be also useful to replace or supplement microscopic agglutination test as a confirmatory test, allowing more confirmations. PMID:26867967

  8. Detection of high-risk subtypes of human papillomavirus in cervical swabs: routine use of the Digene Hybrid Capture assay and polymerase chain reaction analysis.

    LENUS (Irish Health Repository)

    Brennan, M M


    Human papillomaviruses (HPVs) are major causative agents in the pathogenesis of cervical cancer, and more than twenty types are associated with its development. With the introduction of liquid-based preparation systems, it is envisaged that large-scale HPV testing will be established in the near future. Preliminary studies demonstrate the accessibility of these samples for DNA testing using both the Digene Hybrid Capture assay (DHCA) and polymerase chain reaction (PCR) techniques. This study aims to assess the validity and sensitivity of the DHCA system to detect high-risk HPV DNA, using two sets of HPV consensus primers (Gp5+\\/Gp6+ and MY09\\/MY11) in tandem with routine assessment of cervical smear and biopsy samples. Results indicate that the combination of DHCA and PCR detects more high-grade lesions than does the DHCA alone. DHCA-negative cases were categorised by subsequent PCR amplification into low-grade HPV-negative (12\\/16) cervical lesions and high-grade HPV-positive (7\\/9) cervical lesions. Gp5+\\/Gp6+ primers were less sensitive in detecting HPV-positive samples than was the MY09\\/MY11 primer set. These results support the use of high-risk HPV testing by DHCA, with subsequent analysis of DHCA-negative samples by PCR using the MY09\\/MY11 primers.

  9. A simple real-time polymerase chain reaction (PCR)-based assay for authentication of the Chinese Panax ginseng cultivar Damaya from a local ginseng population. (United States)

    Wang, H; Wang, J; Li, G


    Panax ginseng is one of the most important medicinal plants in the Orient. Owing to its increasing demand in the world market, cultivated ginseng has become the main source of medicinal material. Among the Chinese ginseng cultivars, Damaya commands higher prices and is grown in significant proportions among the local ginseng population. Due to the lack of rapid and accurate authentication methods, Damaya is distributed among different cultivars in the local ginseng population in China. Here, we identified a unique, Damaya-specific single nucleotide polymorphism (SNP) site present in the second intron of mitochondrial cytochrome c oxidase subunit 2 (cox2). Based on this SNP, a Damaya cultivar-specific primer was designed and an allele-specific polymerase chain reaction (PCR) was optimized for the effective molecular authentication of Damaya. We designed a method by combining a simple DNA isolation method with real-time allele-specific PCR using SYBR Green I fluorescent dye, and proved its efficacy in clearly discriminated Damaya cultivar from other Chinese ginseng cultivars according to the allelic discrimination analysis. Hence, this study provides a simple and rapid assay for the differentiation and conservation of Damaya from the local Chinese ginseng population. PMID:27420983

  10. Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmon ovarian fluid (United States)

    Pascho, R.J.; Chase, D.; McKibben, C.L.


    Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 3 109 cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 3 104 cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods.

  11. Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmonid ovarian fluid. (United States)

    Pascho, R J; Chase, D; McKibben, C L


    Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 x 10(9) cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 x 10(4) cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods. PMID:9526862

  12. Detection of Phakopsora pachyrhizi by polymerase chain reaction (PCR) and use of germination test and DNA comet assay after e-beam processing in soybean

    International Nuclear Information System (INIS)

    Soybean harvest is the main agribusiness in Brazil, which is the second largest exporter in the world and has a revenue of billions of dollars. Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is difficult to control, since it occurs through wind dispersion. Actually P. pachyrhizi is found in different parts of the world. Electron beam treatment could be an alternative process to minimize these losses, especially for the grains exportation industry. Besides the possibility of being disconnected when not in use, this source does not need to be reloaded, is easily available and, streamlines the process and reduces logistics costs. The present work aims to identify, by the polymerase chain reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soybeans and the possibility to use radiation treatment as a sanitary alternative. Doses 0, 1.0, 2.0, 5.0, 6.0, 7.0, 8.0, 9.0 and 10.0 kGy (IPEN-CNEN/SP Electron Accelerator) were applied and two fast-screening methods were performed: DNA comet assay (for the detection of DNA damage) and germination test (for the measurement of roots inhibition). These tests are very easy to carry out and measure damage response depending on radiation dose

  13. Two novel nonradioactive polymerase chain reaction-based assays of dried blood spots, genomic DNA, or whole cells for fast, reliable detection of Z and S mutations in the alpha 1-antitrypsin gene

    DEFF Research Database (Denmark)

    Andresen, B S; Knudsen, I; Jensen, P K;


    Two new nonradioactive polymerase chain reaction (PCR)-based assays for the Z and S mutations in the alpha 1-antitrypsin gene are presented. The assays take advantage of PCR-mediated mutagenesis, creating new diagnostic restriction enzyme sites for unambiguous discrimination between test samples...... from individuals who are normal, heterozygous, or homozygous for the mutations. We show that the two assays can be performed with purified genomic DNA as well as with boiled blood spots. The new assays were validated by parallel testing with a technique in which PCR is combined with allele......-specific oligonucleotide (ASO) probes. In all cases tested the results obtained by the different techniques were in accordance. The new assays can be used for prenatal diagnostics and can be performed directly with boiled tissue samples. Because the new assays are easy to perform and reliable, we conclude that they are...

  14. Diagnostic multiplex polymerase chain reaction assay for the identification of Pseudomonas aeruginosa from the skin biopsy specimens in burn wound infections and detection of antibiotic susceptibility

    International Nuclear Information System (INIS)

    Objective was to identify Pseudomonas aeruginosa (P. aeruginosa) from the skin biopsy specimens in burn wound infections by multiplex polymerase chain reaction (M-PCR) and detection of antimicrobial susceptibility of isolates from culture. We conducted the cross-sectional study in 140 patients with wound infections who admitted to referral burn center of Motahari, Tehran, Iran, during a 12-month period from 2005-2006. Skin biopsy specimens were aseptically taken from each patient, one for PCR and one for bacterial culture. A M-PCR test based on simultaneous amplification of 2 lipoprotein genes: oprI and oprL, was used to directly detect fluorescent pseudomonades and P. aeruginosa in skin biopsy specimens. The susceptibility of P. aeruginosa isolates to 16 antibiotics was determined using the disc diffusion method. Out of 140 biopsy specimens, M-PCR detected 66 (47.2%) isolates, while culture detected 57 (40.7%) isolates as P. aeruginosa. Positive results for both genes which observed only for P. aeruginosa, while only one gene, oprI, was amplified from other fluorescent pseudomonades (n=12) and all other bacterial tested (n=62) were negative by the amplification test. The most effective antibiotics against isolate of P. aeruginosa were cefepime (79%), azetreonam (76%), ticarcillin-clavulanic acid (68%), tobramycin (62%) and amikacin (61%). Multiplex PCR assay appears promising for the rapid and sensitive detection of P. aeruginosa from the burned skin biopsy specimens. Simultaneous amplification of 2 lipoprotein genes: oprI and oprL could detect P. aeruginosa and oprI gene only for other fluorescent pseudomonades. (author)

  15. Detection of Francisella tularensis in blood by polymerase chain reaction.


    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.


    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.

  16. Supply chain reaction

    International Nuclear Information System (INIS)

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  17. Detection of hemoplasma infection of goats by use of a quantitative polymerase chain reaction assay and risk factor analysis for infection. (United States)

    Johnson, Kathy A; do Nascimento, Naíla C; Bauer, Amy E; Weng, Hsin-Yi; Hammac, G Kenitra; Messick, Joanne B


    OBJECTIVE To develop and validate a real-time quantitative PCR (qPCR) assay for the detection and quantification of Mycoplasma ovis in goats and investigate the prevalence and risk factors for hemoplasma infection of goats located in Indiana. ANIMALS 362 adult female goats on 61 farms. PROCEDURES Primers were designed for amplification of a fragment of the dnaK gene of M ovis by use of a qPCR assay. Blood samples were collected into EDTA-containing tubes for use in total DNA extraction, blood film evaluation, and determination of PCV. Limit of detection, intra-assay variability, interassay variability, and specificity of the assay were determined. RESULTS Reaction efficiency of the qPCR assay was 94.45% (R(2), 0.99; slope, -3.4623), and the assay consistently detected as few as 10 copies of plasmid/reaction. Prevalence of infection in goats on the basis of results for the qPCR assay was 18.0% (95% confidence interval, 14% to 22%), with infected goats ranging from 1 to 14 years old, whereby 61% (95% confidence interval, 47% to 73%) of the farms had at least 1 infected goat. Bacterial load in goats infected with M ovis ranged from 1.05 × 10(3) target copies/mL of blood to 1.85 × 10(5) target copies/mL of blood; however, no bacteria were observed on blood films. Production use of a goat was the only risk factor significantly associated with hemoplasma infection. CONCLUSIONS AND CLINICAL RELEVANCE The qPCR assay was more sensitive for detecting hemoplasma infection than was evaluation of a blood film, and production use of a goat was a risk factor for infection. PMID:27463552

  18. Detection and quantification of MBR/JH2 t(14;18) BCL-2 gene rearrangement in follicular lymphoma using a combined real-time polymerase chain reaction assay. (United States)

    Csernák, Erzsébet; Tóth, Erika; Melegh, Zsombor; Schneider, Tamás; Rosta, András; Szentirmay, Zoltán


    We report our experience with a new real-time polymerase chain reaction (PCR) assay applicable for simultaneous quantification and characterization of MBR/JH translocation in follicular lymphomas. This technique, which combines amplification with the FRET probe with SYBR Green I melting curve analysis, allows efficient detection of tumor cells in bone marrow or peripheral blood and their comparison with the original neoplastic clone. PMID:16704964



    Imoukhuede, Egeruan B; Andrews, Laura; Milligan, Paul; Berthoud, Tamara; Bojang, Kalifa; Nwakanma, Davis; Ismaili, Jamila; Buckee, Caroline; Njie, Fanta; KEITA, SAIKOU; Sowe, Maimuna; Lang, Trudie; Gilbert, Sarah C.; Greenwood, Brian M.; Hill, Adrian V. S.


    The feasibility of using a sensitive polymerase chain reaction (PCR) to evaluate malaria vaccines in small group sizes was tested in 102 adult Gambian volunteers who received either the malaria vaccine regimen FP9 ME-TRAP/MVA ME-TRAP or rabies vaccine. All volunteers received the antimalarial drugs primaquine and Lapdap plus artesunate to eliminate malaria parasites. Volunteers in a further group received an additional single treatment with sulfadoxine-pyrimethamine (SP) to prevent new infect...

  20. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection


    Vasuki Venkatesan; Sugeerappa Laxmanappa Hoti; Nagalakshmi Kamaraj; Somnath Ghosh; Kaushik Rajaram


    Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence ...

  1. Detection of MDR1 single nucleotide polymorphisms C3435T and G2677T using real-time polymerase chain reaction: MDR1 single nucleotide polymorphism genotyping assay


    Song, Pengfei; Li, Shen; Meibohm, Bernd; Gaber, A. Osama; Honaker, Marsha R.; Kotb, Malak; Yates, Charles R.


    The objective of this study was to develop a real-time polymerase chain reaction (PCR) method to detect MDR1 (human multidrug resistance gene) single nucleotide polymorphisms (SNPs) C3435T and G2677T. C3435T and G2677T are linked to MDR1*2, which is associated with enhanced efflux activity in vitro. Using the Smart Cycler, an allele-specific real-time PCR-based genotyping method was developed to detect C3435T and G2677T. The MDR1 genotype of human genomic DNA templates was determined by direc...

  2. One-step triplex-polymerase chain reaction assay for the authentication of yellowfin (Thunnus albacares), bigeye (Thunnus obesus), and skipjack (Katsuwonus pelamis) tuna DNA from fresh, frozen, and canned tuna samples. (United States)

    Michelini, Elisa; Cevenini, Luca; Mezzanotte, Laura; Simoni, Patrizia; Baraldini, Mario; De Laude, Luca; Roda, Aldo


    A one-step triplex-polymerase chain reaction (PCR)-based assay was developed to discriminate between three tuna species, Thunnus albacares, Thunnus obesus, and Katsuwonus pelamis, even in highly processed food samples such as canned or cooked tuna. Diagnostic nucleotides were identified by direct sequencing and alignment of part of the mitochondrial cytochrome b gene of 30 authenticated exemplars, which allowed us to evaluate intraspecific variation and the genetic distance between three tuna species. The assay relies on a one-step triplex-PCR reaction in which in a single tube species-specific amplification products are generated only in the presence of the correct template nucleic acid and the species of origin of the DNA is indicated by the distinctive size of the PCR product. The identification of tuna species can be performed with a good accuracy, low cost, and with potential automation for large-scale high-throughput screenings in small in-house laboratories. PMID:17711337

  3. Analysis of phosphate-accumulating organisms cultivated under different carbon sources with polymerase chain reaction-denaturing gradient gel electrophoresis assay

    Institute of Scientific and Technical Information of China (English)

    YU Shui-li; LIU Ya-nan; JING Guo-lin; ZHAO Bing-jie; GUO Si-yuan


    To investigate the microbial communities of microorganisms cultivated under different carbon sources, three sequencing batch reactors were operated. They were supplied with sewage, glucose and sodium acetate as carbon sources respectively and showed high phosphorus removal performance. The results of denaturing gradient gel electrophoresis(DGGE) of polymerase chain reaction-amplified (PCR) 16S rDNA fragments demonstrated that β-protebacteria, Actinomyces sp. and γ-protebacteria only exited in 1 # reactor. The microbiological diversity of 1 # reactor exceeded the other two reactors. Flavobacterium, Bacillales, Actinomyces, Actinobacteridae and uncultured bacteria(AF527584, AF502204, AY592749, AB076862, AJ619051, AF495454 and AY133070) could be detected in the biological phosphorus removal reactors.

  4. Development of a polymerase chain reaction (PCR assay targeted to the dnaJ gene of Vibrio harveyi, a bacterial pathogen in Asian seabass, Lates calcarifer

    Directory of Open Access Journals (Sweden)

    Norwell B. Bautista


    Full Text Available Partial sequence of the dnaJ gene of Vibrio harveyi, which was isolated from diseased juvenileAsian seabass, Lates calcarifer was identified. The partial sequence of dnaJ gene of V. harveyi was 447 bp and shared at least 77% identity at the nucleotide level with the dnaJ gene of other Vibrios. It was distinct from the dnaJ gene of other Vibrios but was closely related with the dnaJ gene of V. rotiferianus and V. campbellii having at least 90% nucleotide identity. PCR primers targeting this gene were designed to detect the pathogen in Asian seabass. The assay was specific to V. harveyi and the limit of detection was 100 pg of genomic DNA ml-1 or 100 fg of bacterial genomic DNA in a PCR reaction. Thiscorresponded to a sensitivity of approximately 20 genome equivalents (GE of V. harveyi. These resultsindicate that the dnaJ gene is a good candidate to develop primers for the PCR assay in detecting V.harveyi in fish.

  5. Comparative study of sensitivity, linearity, and resistance to inhibition of digital and nondigital polymerase chain reaction and loop mediated isothermal amplification assays for quantification of human cytomegalovirus. (United States)

    Nixon, Gavin; Garson, Jeremy A; Grant, Paul; Nastouli, Eleni; Foy, Carole A; Huggett, Jim F


    Performing nucleic acid amplification techniques (NAATs) in digital format using limiting dilution provides potential advantages that have recently been demonstrated with digital polymerase chain reaction (dPCR). Key benefits that have been claimed are the ability to quantify nucleic acids without the need of an external calibrator and a greater resistance to inhibitors than real-time quantitative PCR (qPCR). In this study, we evaluated the performance of four NAATs, qPCR, dPCR, real-time quantitative loop mediated isothermal amplification (qLAMP), and digital LAMP (dLAMP), for the detection and quantification of human cytomegalovirus (hCMV). We used various DNA templates and inhibitors to compare the performance of these methods using a conventional real-time thermocycler platform (Bio-Rad CFX96) and a chip based digital platform (Fluidigm Biomark 12.765 Digital Array). dPCR performed well and demonstrated greater resistance to inhibitors than the other methods although this resistance did not apply equally to all inhibitors tested. dLAMP was found to be less sensitive than dPCR, but its quantitative performance was better than qLAMP, the latter being unable to quantify below 1000 copies. dLAMP was also more resistant to inhibitors than qLAMP. Unlike qPCR, both digital methods were able to quantify viral genomes without requiring a calibrator; however, neither can currently compete with the large reaction volumes, and thus the greater absolute sensitivity, of qPCR. With the introduction of digital instrumentation that will enable larger reaction volumes, digital amplification methods such as those evaluated in this study could potentially offer a robust alternative to qPCR for nucleic acid quantification. PMID:24684191

  6. Novel polymerase chain reaction-restriction fragment length polymorphism assay to determine internal transcribed spacer-2 group in the Chagas disease vector, Triatoma dimidiata (Latreille, 1811

    Directory of Open Access Journals (Sweden)

    Bethany Richards


    Full Text Available Triatoma dimidiata is the most important Chagas disease insect vector in Central America as this species is primarily responsible for Trypanosoma cruzi transmission to humans, the protozoan parasite that causes Chagas disease. T. dimidiata sensu lato is a genetically diverse assemblage of taxa and effective vector control requires a clear understanding of the geographic distribution and epidemiological importance of its taxa. The nuclear ribosomal internal transcribed spacer 2 (ITS-2 is frequently used to infer the systematics of triatomines. However, oftentimes amplification and sequencing of ITS-2 fails, likely due to both the large polymerase chain reaction (PCR product and polymerase slippage near the 5' end. To overcome these challenges we have designed new primers that amplify only the 3'-most 200 base pairs of ITS-2. This region distinguishes the ITS-2 group for 100% of known T. dimidiata haplotypes. Furthermore, we have developed a PCR-restriction fragment length polymorphism (RFLP approach to determine the ITS-2 group, greatly reducing, but not eliminating, the number of amplified products that need to be sequenced. Although there are limitations with this new PCR-RFLP approach, its use will help with understanding the geographic distribution of T. dimidiata taxa and can facilitate other studies characterising the taxa, e.g. their ecology, evolution and epidemiological importance, thus improving vector control.

  7. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection

    Directory of Open Access Journals (Sweden)

    Vasuki Venkatesan


    Full Text Available Single-stranded DNA (ssDNA is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring.

  8. Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection. (United States)

    Venkatesan, Vasuki; Hoti, Sugeerappa Laxmanappa; Kamaraj, Nagalakshmi; Ghosh, Somnath; Rajaram, Kaushik


    Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring. PMID:24037206

  9. Development and evaluation of a reverse transcription-insulated isothermal polymerase chain reaction (RT-iiPCR) assay for detection of equine arteritis virus in equine semen and tissue samples using the POCKIT™ system. (United States)

    Carossino, Mariano; Lee, Pei-Yu A; Nam, Bora; Skillman, Ashley; Shuck, Kathleen M; Timoney, Peter J; Tsai, Yun-Long; Ma, Li-Juan; Chang, Hsiao-Fen G; Wang, Hwa-Tang T; Balasuriya, Udeni B R


    Equine arteritis virus (EAV) is the causative agent of equine viral arteritis (EVA), a respiratory and reproductive disease of horses. Most importantly, EAV induces abortion in pregnant mares and can establish persistent infection in up to 10-70% of the infected stallions, which will continue to shed the virus in their semen. The objective of this study was to develop and evaluate a reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) for the detection of EAV in semen and tissue samples. The newly developed assay had a limit of detection of 10 RNA copies and a 10-fold higher sensitivity than a previously described real-time RT-PCR (RT-qPCR). Evaluation of 125 semen samples revealed a sensitivity and specificity of 98.46% and 100.00%, respectively for the RT-qPCR assay, and 100.00% and 98.33%, respectively for the RT-iiPCR assay. Both assays had the same accuracy (99.2%, k=0.98) compared to virus isolation. Corresponding values derived from testing various tissue samples (n=122) collected from aborted fetuses, foals, and EAV carrier stallions are as follows: relative sensitivity, specificity, and accuracy of 88.14%, 96.83%, and 92.62% (k=0.85), respectively for the RT-qPCR assay, and 98.31%, 92.06%, and 95.08% (k=0.90), respectively for the RT-iiPCR assay. These results indicate that RT-iiPCR is a sensitive, specific, and a robust test enabling detection of EAV in semen and tissue samples with very considerable accuracy. Even though the RT-qPCR assay showed a sensitivity and specificity equal to virus isolation for semen samples, its diagnostic performance was somewhat limited for tissue samples. Thus, this new RT-iiPCR could be considered as an alternative tool in the implementation of EAV control and prevention strategies. PMID:27036504

  10. Polymerization as a Model Chain Reaction (United States)

    Morton, Maurice


    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  11. Utility of a multiplex reverse transcriptasepolymerase chain reaction assay (HemaVision in the evaluation of genetic abnormalities in Korean children with acute leukemia: a single institution study

    Directory of Open Access Journals (Sweden)

    Hye-Jin kim


    Full Text Available &lt;b&gt;Purpose:&lt;/b&gt; In children with acute leukemia, bone marrow genetic abnormalities (GA have prognostic significance, and may be the basis for minimal residual disease monitoring. Since April 2007, we have used a multiplex reverse transcriptase-polymerase chain reaction tool (HemaVision to detect of GA. &lt;b&gt;Methods:&lt;/b&gt; In this study, we reviewed the results of HemaVision screening in 270 children with acute leukemia, newly diagnosed at The Catholic University of Korea from April 2007 to December 2011, and compared the results with those of fluorescence in situ hybridization (FISH, and G-band karyotyping. &lt;b&gt;Results:&lt;/b&gt; Among the 270 children (153 males, 117 females, 187 acute lymphoblastic leukemia and 74 acute myeloid leukemia patients were identified. Overall, GA was detected in 230 patients (85.2%. HemaVision, FISH, and G-band karyotyping identified GA in 125 (46.3%, 126 (46.7%, and 215 patients (79.6%, respectively. TEL-AML1 (20.9%, 39/187 and AML1-ETO (27%, 20/74 were the most common GA in ALL and AML, respectively. Overall sensitivity of HemaVision was 98.4%, with false-negative results in 2 instances: 1 each for TEL-AML1 and MLL-AF4 . An aggregate of diseasesspecific FISH showed 100% sensitivity in detection of GA covered by HemaVision for actual probes utilized. G-band karyotype revealed GA other than those covered by HemaVison screening in 133 patients (49.3%. Except for hyperdiplody and hypodiploidy, recurrent GA as defined by the World Health Organizationthat were not screened by HemaVision, were absent in the karyotype. &lt;b&gt;Conclusion:&lt;/b&gt; HemaVision, supported by an aggregate of FISH tests for important translocations, may allow for accurate diagnosis of GA in Korean children with acute leukemia.

  12. Clinical Utility Of Blood E2F3 MRNA Assay In The Early Diagnosis Of Prostatic Cancer By Real-Time Polymerase Chain Reaction

    International Nuclear Information System (INIS)

    Background: Based on the fact that prostate cancer development and progression is the result of the interaction between different molecular mechanisms, many efforts have been devoted to the identification of new circulating genes that could serve as non invasive, reliable early diagnostic and prognostic markers and where their specific functions allow potential therapeutic targets. E2F3 is a member of E2F family of transcription factors involved in cell cycle regulatory functions. It was found that E2F3 is over-expressed in some tumors including bladder and prostate cancer. Aim: The aim of the study was to evaluate the clinical significance of peripheral blood E2F3 mRNA assay in the early diagnosis of patients with localized prostate cancer and to compare its expression in the blood of age-matched prostate cancer, benign prostatic hypertrophy and healthy males. Methods: This study was conducted on 25 patients with cancer prostate, 15 patients with benign prostatic hyperplasia (serving as a pathological control group) in addition to 10 healthy men (serving as a healthy control group). Blood samples were collected and tested for the detection of E2F3 mRNA gene by real time RT-PCR and prostate specific antigen (PSA) by electro chemiluminescence immunoassay. E2F3 mRNA results were reported in relative quantification, where the target and housekeeping gene (GAPDH) were amplified from the same sample in two separate reaction plates. Results were then compared between different samples relying on direct comparison of threshold cycle (CT) values. Finally, the normalized level of target gene expression was calculated by using the formula: 2δδCT Results: Total PSA at the cutoff 4 ng/mL had a diagnostic sensitivity of 88%, specificity of 84%, positive predictive value of 88%, negative predictive value of 84% and diagnostic efficacy of 86%. E2F3 mRNA was statistically higher in cancer prostate group than in benign prostatic hyperplasia and healthy control groups. At the cut

  13. cobas 4800 HPV Test, a real-time polymerase chain reaction assay for the detection of human papillomavirus in cervical specimens. (United States)

    Isidean, Sandra D; Coutlée, François; Franco, Eduardo L


    Cervical cancer screening incorporating high-risk human papillomavirus (HPV) detection has become the preferred screening strategy in some countries and is increasingly more widespread in other countries with organized or opportunistic screening programs. Given knowledge that high-risk HPV genotypes differ in their oncogenic potential, commercial HPV assays with genotyping capabilities have been developed and have garnered attention in the recent literature. The cobas 4800 HPV Test is a qualitative multiplex assay that provides specific genotyping information for HPV types 16 and 18, while concurrently detecting 12 other high-risk HPV genotypes as a pooled result. It is currently the only clinically validated, US FDA-approved assay with this capability. Since HPV types 16 and 18 have been designated as conferring the greatest risk for cervical disease, their detection may prove useful in guiding patient management. PMID:24308341

  14. Development of a Polymerase Chain Reaction (PCR Assay for the Detection of Philippine Isolates of the Penaeus monodon-type Baculovirus (MBV

    Directory of Open Access Journals (Sweden)

    Christopher Marlowe A. Caipang


    Full Text Available Penaeus monodon-type baculovirus (MBV is a DNA virus that infects postlarvae and early juveniles of shrimp, Penaeus monodon. Several variants of this virus occur through nucleotide analysis of its genomic DNA. In the present study, a one-step PCR method was developed for the detection of the Philippine isolates of MBV by designing PCR primers on the least conserved region of the Philippine MBV. Using genomic DNA of MBV-infected shrimp postlarvae, the PCR assay amplified a 193-bp PCR product. Its sensitivity was comparable to the published PCR assays. The strain-specific primers did not cross-react with other DNA viruses including White Spot Syndrome Virus (WSSV, Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV and hepatopancreatic parvovirus (HPV. This PCR assay could be used for regular monitoring and surveillance of MBV in shrimp as well as tracing the movement of the Philippine MBV in shrimp farms in different geographic regions.


    A PCR assay using a set of specific primers and probe (TaqMan) was developed to quantify the amount of Aphanomyces euteiches DNA in alfalfa plants exhibiting varying levels of disease severity. The study included two isolates each of race 1 and of race 2 of A. euteiches. Analysis of individual plant...

  16. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna


    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  17. The chain re-action

    CERN Multimedia


    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  18. Detection and quantification of parapoxvirus DNA by use of a quantitative real-time polymerase chain reaction assay in calves without clinical signs of parapoxvirus infection. (United States)

    Yaegashi, Gakuji; Fukunari, Kazuhiro; Oyama, Takayuki; Murakami, Ryu-Koh; Inoshima, Yasuo


    OBJECTIVE To investigate the presence of parapoxvirus (PPV) in cattle without clinical signs of infection and in farm environments of PPV-infected cattle. ANIMALS 28 calves without clinical signs of PPV infection on 2 farms and 11 clinically affected calves on 6 farms. PROCEDURES 164 oral swab samples were collected at regular intervals from 28 calves without clinical signs of PPV infection, and 11 swab samples were collected from 11 clinically affected calves. Viral DNA load was quantified by use of a PPV-specific quantitative real-time PCR (qRT-PCR) assay. RESULTS Of 28 calves without clinical signs of PPV infection, 12 had positive results for PPV DNA by use of the qRT-PCR assay. Viral DNA was detected continuously over a period of 2 to 5 months from 9 of these 12 calves, particularly from calves with dermatomycosis or respiratory tract disease. The PPV DNA loads in 32 oral swab samples from these 12 calves were significantly lower (median, 3.2 copies/mg) than those in samples collected from the 11 clinically affected calves (median, 3.2 × 10(4) copies/mg). Moreover, PPV DNA was detected in the residual feed and drinking water on both farms that housed the calves without clinical signs of PPV infection. CONCLUSIONS AND CLINICAL RELEVANCE PPV in cattle without clinical signs of infection and in the environments of these cattle may represent sources of PPV transmission to susceptible cattle. IMPACT FOR HUMAN MEDICINE Humans should wear gloves to prevent zoonotic disease transmission when handling cattle with or without clinical signs of PPV infection. PMID:27027837

  19. "Use of Random Amplified Polymorphic DNA Polymerase Chain Reaction (RAPD-PCR and ITS2 PCR assays for differentiation of populations and putative sibling species of Anopheles fluviatilis (Diptera: Culicidae in Iran"

    Directory of Open Access Journals (Sweden)

    SR Naddaf Dezfouli


    Full Text Available Anopheles fluviatilis complex is known to be a vector of malaria in Iran. Since mosquitoes of this species cover a wide geographical range in Iran, they might have evolved into different separated populations. Random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR assay was used to differentiate geographic populations of this species. DNA was extracted from individual mosquitoes from 8 localities in 4 south and southeast provinces and amplified in PCR reactions using 18 single primers of arbitrary nucleotide sequence. Results of RAPD-PCR showed that Kazeroun populations could simply be differentiated from other populations using a diagnostic fragment amplified with primer UBC-306. But other populations could not be differentiated either visually or by means of statistical analysis. Moreover ITS2 fragments of some selected specimens were amplified using a pair of universal primer and sequenced as a key standard for detection of putative sibling species. Sequence analysis of the ITS2 fragments revealed a very high (100% homology among the populations. These findings are crucial in epidemiological studies concerning relatedness of geographic populations and vector movement in the region. Results of RAPD-PCR and ITS2 analysis suggest that this taxon in Iran comprises of only one species with a low genetic variation among geographic populations.

  20. Effect of sample pooling and transport conditions on the clinical sensitivity of a real-time polymerase chain reaction assay for Campylobacter fetus subsp. venerealis in preputial samples from bulls. (United States)

    García-Guerra, Alvaro; Waldner, Cheryl L; Pellegrino, Andrea; Macdonald, Nicole; Chaban, Bonnie; Hill, Janet E; Hendrick, Steven H


    The diagnosis of bovine genital campylobacteriosis (BGC) presents significant challenges, as traditional methods lack sensitivity when prolonged transport of samples is required. Assays of preputial samples by means of real-time polymerase chain reaction (PCR) provide good sensitivity and high throughput capabilities. However, there is limited information on the acceptable duration of transport and temperature during transport of samples. In addition, the use of pooled samples has proven to be a valuable strategy for the diagnosis of other venereal diseases in cattle. The objectives of the present study were to determine the effect of sample pooling and of transport time and temperature on the clinical sensitivity of a real-time quantitative PCR (qPCR) assay for Campylobacter fetus subsp. venerealis in preputial samples from beef bulls. Eight infected bulls and 176 virgin yearling bulls were used as the source of samples. The qPCR sensitivity was comparable for unpooled samples and pools of 5 samples, whereas sensitivity was decreased for pools of 10 samples. Sensitivity for the various pool sizes improved with repeated sampling. For shorter-term transport (2 and 48 h), sensitivity was greatest when the samples were stored at 4°C and 30°C, whereas for longer-term transport (96 h) sensitivity was greatest when the samples were stored at -20°C. The creation of pools of 5 samples is therefore a good option to decrease costs when screening bulls for BGC with the qPCR assay of direct preputial samples. Ideally the samples should be stored at 4°C and arrive at the laboratory within 48 h of collection, but when that is not possible freezing at -20°C could minimize the loss of sensitivity. PMID:26733730

  1. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease. (United States)

    Khalil, S H; Siegrist, K; Akhtar, M


    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  2. Efficacy of an in-house polymerase chain reaction assay for rapid diagnosis of Mycobacterium tuberculosis in patients with tubercular lymphadenitis: Comparison with fine needle aspiration cytology and conventional techniques

    Directory of Open Access Journals (Sweden)

    Sharma Meera


    Full Text Available Introduction: Tubercular lymphadenitis (TB-L is the most common manifestation of extrapulmonary tuberculosis. Excisional biopsy with histopathological examination, Ziehl-Neelsen staining (ZNS and culture and fine needle aspiration (FNA cytology, although useful in the diagnosis of TB-L, cannot diagnose a substantial proportion of cases. We investigated the role of an in-house polymerase chain reaction (PCR assay targeting the IS6110 gene from the FNA material in the diagnosis of the disease. Materials and Methods: The clinical profile of 150 patients with lymphadenopathy was noted and the fine needle aspirate was collected. After cytological processing, ZNS and culture on Lowenstein-Jensen media, mycobacterial DNA was isolated from the residual aspirate material and IS6110 gene PCR was performed. Results of cytology, ZNS, culture and IS6110 gene PCR were compared. Results: There were 49 confirmed patients of TB-L based on laboratory parameters (either culture isolation of Mycobacterium tuberculosis or any two of cytology, ZNS, PCR positive and clinical response to therapy. Sensitivity and specificity of FNA was 89.8% and 96%, of ZNS was 40.8% and 99%, of culture was 40.8% and 100% and of IS6110 gene PCR test was 100% and 92.1%. Conclusion: IS6110 PCR can be considered a valuable adjunct to cytology, ZNS and culture techniques in the diagnosis of TB-L.

  3. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K


    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity of...

  4. Determining Annealing Temperatures for Polymerase Chain Reaction (United States)

    Porta, Angela R.; Enners, Edward


    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  5. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M


    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  6. Transformational leadership: a cascading chain reaction. (United States)

    Murphy, Lorraine


    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  7. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.



    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  8. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  9. Comet assay as a cold chain control tool

    International Nuclear Information System (INIS)

    Bearing in mind an ever more demanding market regarding the quality of food, it has been necessary to develop processes that meet the demands of consumers. Within the existing processes the cold chain and irradiation stand out. The cold chain comprises all the stages of conserving food from production, cooling, freezing, storing and transportation to the final consumer. Irradiation, as a means of conserving food, prolongs the shelf life, inhibits budding and reduces pathogenic contamination among other benefits. Is very important the identification of food degradation in function of failure on the processes which they were subjected. The comet assay is a screening test widely studied, considerate fast and with low cost. By the fact of the test identify breaks on the DNA, may be possible use the comet test on the control of cold chain failures that degrade de food. The labels and stamp, do not consider the previous food situation and indicate failures from the moment where they be placed in contact with the product. With the comet assay is possible to check the degradation that has occurred in liver chicken samples until the moment of comet's test realization. (author)

  10. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo


    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  11. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy


    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  12. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed


    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  13. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G


    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  14. 食品中化脓链球菌的PCR检测方法的建立%Establishment of Polymerase Chain Reaction Assay for Detection of Streptococcus Pyogenes in Food Products

    Institute of Scientific and Technical Information of China (English)

    杨学明; 巢强国; 葛宇; 熊薇; 曲勤凤


    化脓链球菌是一种常见的食源性致病菌,从19世纪80年代起,化脓链球菌引起的感染在全球范围内呈逐步上升之势并发展成为人类重要致病茵之一.通过已公布的13株化脓链球菌的基因组序列找出具有种特异性的基因序列.运用BLAST(Basic Local Alignment Search Tool,基本局部比对工具)在GenBank中进行序列对库的比对结果表明:化脓链球菌的某些基因(SmeZ,emm,spyM51755)具有种特异性.以这些基因为目的基因,共设计七对引物.经PCR(Polymerase Chain Reaction,聚合酶链式反应)检测发现spvM引物对(spyM51755F,spyM51755R)具有很高的特异性.利用该引物对,建立可快速且灵敏地检测食品中化脓链球菌的PCR方法,其灵敏度达到10 cfu/g样品.

  15. Detection of Mycoplasma pneumoniae by polymerase chain reaction and nonradioactive hybridization in microtiter plates.


    Lüneberg, E; Jensen, J S; M. Frosch


    In order to improve the diagnosis of a Mycoplasma pneumoniae infection, we developed a polymerase chain reaction (PCR)-based assay. The gene encoding elongation factor Tu (tuf) was selected as the target sequence. Oligonucleotides derived from variable stretches of the tuf gene were able to prime the amplification of a 950-bp fragment exclusively when M. pneumoniae DNA was used as the template. The sensitivity of the assay was increased 10-fold when the amplification products were hybridized ...

  16. A chain reaction approach to modelling gene pathways. (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen


    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  17. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction. (United States)

    Uphoff, Cord C; Drexler, Hans G


    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  18. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients.

    Directory of Open Access Journals (Sweden)

    Sirirat Seekhuntod

    Full Text Available Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC. The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR assay to detect KRAS mutations.We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D. We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay.Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%, G12D (25.83% and G12V (12.50% in codon 12.The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues.

  19. Development and Validation of TaqMan Real-Time Polymerase Chain Reaction Assays for the Quantitative and Differential Detection of Wild-Type Infectious Laryngotracheitis Viruses from a Glycoprotein G-Deficient Candidate Vaccine Strain. (United States)

    Shil, Niraj K; Legione, Alistair R; Markham, Philip F; Noormohammadi, Amir H; Devlin, Joanne M


    Infectious laryngotracheitis (ILT) is a significant upper respiratory tract disease of chickens with a worldwide distribution. Differentiating between wild-type and vaccine strains of ILT virus (ILTV) would be useful for enhancing disease control, and in the early stages of a disease outbreak molecular diagnostic tools for the detection and differentiation of the circulating virus could be applied. This study developed TaqMan real-time PCR (qPCR) assays to detect and differentiate the glycoprotein G (gG)-deficient (ΔgG) ILTV candidate vaccine strain of ILTV from ILTV strains that contain the gG gene. The gG+ve and gG-ve ILTV TaqMan assays were used in individual and multiplex format to detect, differentiate, and quantitate ILTV DNA in laboratory and clinical samples. The assays were highly sensitive and highly specific, with a detection limit of 10 viral template copies for each assay. Low interassay coefficients of variation were recorded (0.021-0.042 and 0.013-0.039) for gG+ve and gG-ve TaqMan assays, respectively. The multiplex assay was successfully used to examine the replication kinetics of wild-type and ΔgG strains of ILTV in cultured leghorn male hepatoma cells and embryonated hen eggs under coinfection conditions. The results showed that the TaqMan qPCR assay, along with the ΔgG ILTV vaccine, has the potential to be used in a "Differentiating Infected from Vaccinated Animals" strategy for the control and eradication of ILT. PMID:26292527



    Kouritzin, Michael A.; Hongwei Long


    In the context of simulating the transport of a chemical or bacterial contaminant through a moving sheet of water, we extend a well-established method of approximating reaction-diffusion equations with Markov chains by allowing convection, certain Poisson measure driving sources and a larger class of reaction functions. Our alterations also feature dramatically slower Markov chain state change rates often yielding a ten to one-hundred-fold simulation speed increase over the previous version o...

  1. Detection of pathogenic elephant endotheliotropic herpesvirus in routine trunk washes from healthy adult Asian elephants (Elephas maximus) by use of a real-time quantitative polymerase chain reaction assay (United States)

    Stanton, Jeffrey J.; Zong, Jian-Chao; Latimer, Erin; Tan, Jie; Herron, Alan; Hayward, Gary S.; Ling, Paul D.


    Objective To investigate the pathogenesis and transmission of elephant endotheliotropic herpesvirus (EEHV1) by analyzing various elephant fluid samples with a novel EEHV1-specific real-time PCR assay. Animals 5 apparently healthy captive Asian elephants (Elephas maximus) from the same herd. Procedures A real-time PCR assay was developed that specifically detects EEHV1. The assay was used to evaluate paired whole blood and trunk-wash samples obtained from the 5 elephants during a 15-week period. Deoxyribonucleic acid sequencing and viral gene subtyping analysis were performed on trunk-wash DNA preparations that had positive results for EEHV1. Viral gene subtypes were compared with those associated with past fatal cases of herpesvirus-associated disease within the herd. Results The PCR assay detected viral DNA to a level of 1,200 copies/mL of whole blood. It was used to detect EEHV1 in trunk secretions of 3 of the 5 elephants surveyed during the 15-week period. Viral gene subtyping analysis identified 2 distinct elephant herpesviruses, 1 of which was identical to the virus associated with a previous fatal case of herpesvirus-associated disease within the herd. Conclusions and Clinical Relevance EEHV1 was shed in the trunk secretions of healthy Asian elephants. Trunk secretions may provide a mode of transmission for this virus. Results of this study may be useful for the diagnosis, treatment, and management of EEHV1-associated disease and the overall management of captive elephant populations. PMID:20673092

  2. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.; Schonenbrucher, H.; Cook, N.; Heuvelink, A.E.; Hoorfar, Jeffrey


    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  3. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.;


    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The...... selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  4. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle


    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  5. Microdissection and polymerase chain reaction amplification of genomic DNA from histological tissue sections.


    Moskaluk, C A; Kern, S.E.


    Polymerase chain reaction (PCR)-based assays are being used increasingly to study the molecular genetic changes that occur in minute cellular lesions that are identified in histological sections. It is often desirable to microdissect the cells of interest in a lesion, isolating them from surrounding normal tissue to obtain the purest representation of genomic DNA possible. We present here an optimized microdissection and DNA extraction protocol that reliably produces PCR-amplifiable DNA from ...

  6. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay

    International Nuclear Information System (INIS)

    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg-1 almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg-1. We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg-1 almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg-1. Further, between 100 and 100,000 mg kg-1 spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n = 5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and potentially

  7. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay

    Energy Technology Data Exchange (ETDEWEB)

    Roeder, Martin; Vieths, Stefan [Division of Allergology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, 63225 Langen (Germany); Holzhauser, Thomas, E-mail: [Division of Allergology, Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, 63225 Langen (Germany)


    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg{sup -1} almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg{sup -1}. We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg{sup -1} almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg{sup -1}. Further, between 100 and 100,000 mg kg{sup -1} spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n = 5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a

  8. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe


    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  9. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction. (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M


    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples. PMID:25197027

  10. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.


    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D


    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions ...

  11. The generalised self-sustaining chain reaction theory about ADS

    International Nuclear Information System (INIS)

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  12. Detection of Listeria monocytogenes by using the polymerase chain reaction

    International Nuclear Information System (INIS)

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  13. Characteristics of a chain thermal explosion as a function of the kinetic properties of reaction chains (United States)

    Azatyan, V. V.; Piloyan, A. A.; Saikova, G. R.; Smirnov, N. N.


    Study of the combustion and explosion of hydrogen‒carbon oxide‒air mixtures shows that the sharpness of a chain thermal explosion depends on the frequency of branching in a given branch of a reaction chain. It is established that varying the CO: H2 concentration allows us to observe and eliminate the degeneration of an explosion while maintaining the regimes of ignition and deflagration.

  14. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.


    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E


    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  15. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  16. Real-time polymerase chain reaction for diagnosis and quantitation of negative strand of chikungunya virus. (United States)

    Chiam, Chun Wei; Chan, Yoke Fun; Loong, Shih Keng; Yong, Sara Su Jin; Hooi, Poh Sim; Sam, I-Ching


    Quantitative real-time polymerase chain reaction (qRT-PCR) is useful for diagnosis and studying virus replication. We developed positive- and negative-strand qRT-PCR assays to detect nsP3 of chikungunya virus (CHIKV), a positive-strand RNA alphavirus that causes epidemic fever, rash, and arthritis. The positive- and negative-strand qRT-PCR assays had limits of quantification of 1 and 3 log10 RNA copies/reaction, respectively. Compared to a published E1 diagnostic assay using 30 laboratory-confirmed clinical samples, the positive-strand nsP3 qRT-PCR assay had higher R(2) and efficiency and detected more positive samples. Peak viral load of 12.9 log(10) RNA copies/mL was reached on day 2 of illness, and RNA was detectable up to day 9, even in the presence of anti-CHIKV IgM. There was no correlation between viral load and persistent arthralgia. The positive-strand nsP3 assay is suitable for diagnosis, while the negative-strand nsP3 assay, which uses tagged primers to increase specificity, is useful for study of active viral replication kinetics. PMID:23886793

  17. Detecting ricin: sensitive luminescent assay for ricin A-chain ribosome depurination kinetics. (United States)

    Sturm, Matthew B; Schramm, Vern L


    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic rRNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of the elongation factor binding site resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small stem-loop RNAs by RTA catalysis. Adenine phosphoribosyl transferase (APRTase) and pyruvate orthophosphate dikinase (PPDK) convert adenine to ATP for quantitation by firefly luciferase. The resulting AMP is cycled to ATP to give sustained luminescence proportional to adenine concentration. Subpicomole adenine quantitation permits the action of RTA on eukaryotic ribosomes to be followed in continuous, high-throughput assays. Facile analysis of RIP catalytic activity will have applications in plant toxin detection, inhibitor screens, mechanistic analysis of depurinating agents on oligonucleotides and intact ribosomes, and in cancer immunochemotherapy. Kinetic analysis of the catalytic action of RTA on rabbit reticulocyte 80S ribosomes establishes a catalytic efficiency of 2.6 x 10(8) M(-1) s(-1), a diffusion limited reaction indicating catalytic perfection even with large reactants. PMID:19364139

  18. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维


    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  19. The chain gas phase reactions. The present problems

    International Nuclear Information System (INIS)

    The results of investigations of chain gas phase reactions which are directed for solving practically important problems have been carried out. The problem of increasing methanol formation selectivity in the direct natural gas oxidation process is discussed. The peculiarities of cool flame of cyclic hydrocarbons, particularly cyclohexane which are containing in the different kinds of fuel. The influence of cool flame on intensity and full consumption of fuels burning is examined. Conjugated processes of SO2 conversion to SO3 and sulfur under effect of hydrocarbon and hydrogen oxidation chain gas phase reactions are considered. The results of discussed investigations can be served as a basis for the developing of industrial processes for conversion natural hydrocarbon row materials and also the ecological problems of utilization of SO2 gas ejected from thermoelectric power stations and metallurgical plants

  20. Identification of related DNA sequences in Borrelia burgdorferi and two strains of Leptospira interrogans by using polymerase chain reaction.


    Kron, M A; Gupta, A; Mackenzie, C. D.


    The suitability of a polymerase chain reaction assay for Borrelia burgdorferi in epidemiological studies of infected tick populations was evaluated by using 28 strains of Leptospira interrogans and lysates of fixed adult Ixodes tick tissues. Two false positives representing leptospires were differentiated from B. burgdorferi by using an oligonucleotide probe.

  1. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan


    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  2. Polymerase chain reaction: A molecular diagnostic tool in periodontology


    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology w...

  3. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.


    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S


    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  4. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.


    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  5. Reaction chain modeling of denitrification reactions during a push-pull test (United States)

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.


    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  6. Radioinitiation of Chain Branched Reactions and its Sensitization

    International Nuclear Information System (INIS)

    This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author)

  7. Convective polymerase chain reaction around micro immersion heater (United States)

    Hennig, Martin; Braun, Dieter


    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  8. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. (Univ. of Illinois, Chicago (USA)); Wunder, J.S.; Andrulis, I.L. (Mount Sinai Hospital, Toronto, Ontario (Canada)); Gazdar, A.F. (National Cancer Inst., Bethesda, MD (USA)); Willman, C.L.; Griffith, B. (Univ. of New Mexico, Albuquerque (USA)); Von Hoff, D.D. (Univ. of Texas, San Antonio (USA))


    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  9. Direct detection of Mycobacterium tuberculosis in sputum by polymerase chain reaction and DNA hybridization.


    Nolte, F S; Metchock, B; McGowan, J. E.; Edwards, A; Okwumabua, O; Thurmond, C; Mitchell, P S; Plikaytis, B; Shinnick, T


    A polymerase chain reaction (PCR) assay for the rapid diagnosis of pulmonary tuberculosis was developed by using oligonucleotide primers to amplify a fragment of IS6110, an insertion sequence repeated multiple times in the chromosome of Mycobacterium tuberculosis. Sediment obtained from sputa processed by the N-acetyl-L-cysteine-NaOH method was suspended in a simple lysis buffer and was heated at 100 degrees C for 30 min prior to amplification. A dUTP-uracil N-glycosylase PCR protocol was use...

  10. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.


    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J


    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...

  11. Robust quantification of polymerase chain reactions using global fitting.

    Directory of Open Access Journals (Sweden)

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  12. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    International Nuclear Information System (INIS)

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  13. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique


    İLHAK, O. İrfan; Arslan, Ali


    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...


    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏


    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  15. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  16. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    Energy Technology Data Exchange (ETDEWEB)

    Liu Jinfeng [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail:; Shen Xingyan [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Zhu Debin [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)


    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency.

  17. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman


    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  18. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.


    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  19. A multisubstrate assay for lipases/esterases: assessing acyl chain length selectivity by reverse-phase high-performance liquid chromatography. (United States)

    Divakar, K; Gautam, Pennathur


    Lipases and esterases are hydrolytic enzymes and are known to hydrolyze esters with unique substrate specificity and acyl chain length selectivity. We have developed a simple competitive multiple substrate assay for determination of acyl chain length selectivity of lipases/esterases using RP-HPLC with UV detection. A method for separation and quantification of 4-nitrophenyl fatty acid esters (C4-C18) was developed and validated. The chain length selectivity of five lipases and two esterases was determined in a multisubstrate reaction system containing equimolar concentrations of 4-nitrophenyl esters (C4-C18). This assay is simple, reproducible, and a useful tool for determining chain length selectivity of lipases/esterases. PMID:24316114

  20. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  1. International Ring Trial for the Validation of an Event-Specific Golden Rice 2 Quantitative Real-Time Polymerase Chain Reaction Method




    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3′ junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in...

  2. Detection of Vibrio Cholerae in Turtles by Real Time Polymerase Chain Reaction, Colloidal Gold Immunochromatographic Assay and Conventional Bacterial Culture%实时荧光PCR法、胶体金法和培养法检测甲鱼中霍乱弧菌

    Institute of Scientific and Technical Information of China (English)

    颜淑妩; 李哲婷; 邓婵


    目的 优化水产品甲鱼中霍乱弧菌的检测程序,提高甲鱼中霍乱弧菌检出率.方法 用实时荧光PCR、常规细菌培养、胶体金法同时对甲鱼中霍乱弧菌进行检测,并用实时荧光PCR法检测标本中霍乱弧菌ctx基因.结果 共检测185份甲鱼样品,其中实时荧光PCR法检出28份霍乱弧菌核酸阳性,阳性率为15.14%;6份ctx基因核酸阳性,阳性率21.43% (6/28).常规细菌培养法分离出2株菌株,一株为O139群霍乱弧菌,一株为小川型霍乱弧菌,用实时荧光PCR检测这两株纯培养菌株或原始标本,霍乱弧菌ctx基因均为阴性;胶体金法未检出阳性标本.结论 对于水产品标本,可先用实时荧光PCR法筛检霍乱弧菌,阳性标本再进行传统细菌分离培养,以提高霍乱弧菌菌株的检出率;同时阳性标本进行霍乱弧菌ctx基因核酸检测,如也为阳性,需提高警惕,加强流行病学上的预防控制措施,及时防范霍乱疫情的发生.%Objective To optimize the detection procedure of Vibrio Cholerae (v. cholerae) and increase its detection rate in turtles. Methods The v. cholerae in turtles was detected by real time polymerase chain reaction (real time PCR), conventional bacterial culture and colloidal gold immunochrornatographic assay, and the ctx gene of the virus was detected by real time PCR. Results Real time PCR revealed that among 185 turtle samples, 28 ones were positive with v. cholerae nucleic acid, with a positive rate of 15.14% (28/185), and six samples were positive with ctx gene, with a positive rate of 21.43% (6/ 28). Two strains of v.cholerae were isolated by conventional bacterial culture, Vibrio cholerae O139, and Vibrio cholerae Ol serotype Ogawa. Neither the pure cultures nor the original samples of both stains were positive with ctx gene. No v. cholerae was detected by colloidal gold immunochromatugraphic assay. Conclusions For V. cholerae detection in seafood samples, real time PCR can be first used for

  3. Polymerase chain reaction: A molecular diagnostic tool in periodontology (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  4. Early detection of typhoid by polymerase chain reaction

    International Nuclear Information System (INIS)

    Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

  5. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang


    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  6. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes

    International Nuclear Information System (INIS)

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement. (paper)

  7. Nested methylation-specific polymerase chain reaction cancer detection method (United States)

    Belinsky, Steven A.; Palmisano, William A.


    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  8. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed


    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  9. Polymerase chain reaction: A molecular diagnostic tool in periodontology. (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  10. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Directory of Open Access Journals (Sweden)

    Rajendran Maheaswari


    Full Text Available This review discusses the principles of polymerase chain reaction (PCR and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  11. Controlling Hybridization Chain Reactions with pH. (United States)

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco


    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  12. Circulating polymerase chain reaction chips utilizing multiple-membrane activation (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin


    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  13. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture



    Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR) assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by...

  14. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment


    Krøjgaard Louise H; Krogfelt Karen A; Albrechtsen Hans-Jørgen; Uldum Søren A


    Abstract Background Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the useful...

  15. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction


    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.


    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  16. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome


    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo


    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  17. Use of the Polymerase Chain Reaction to Detect Helicobacter pylori in the Dental Plaque of Healthy and Symptomatic Individuals


    Banatvala, N.; Lopez, C. Romero; Owen, R J; Hurtado, A; Abdi, Y; Davies, G. R.; Hardie, J. M.; Feldman, R A


    A polymerase chain reaction (PCR) assay, based on the amplification of a species specific ureA (urease) gene internal sequence, was used to detect Helicobacter pylori. Total DNA extracts were obtained from dental plaque in patients attending an endoscopy clinic and from apparently healthy schoolchildren of Bangladeshi origin. Of the 54 samples of dental plaque from endoscopy patients examined, 39 were positive (72 per cent). There was 63 per cent correlation (34/54) between H. pylori in the s...

  18. Detecting Ricin: A Sensitive Luminescent Assay for Ricin A-chain Ribosome Depurination Kinetics+


    Sturm, Matthew B.; Schramm, Vern L.


    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic ribosomal RNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of elongation factor binding resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small ...

  19. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail:


    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  20. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections



    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  1. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  2. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes


    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  3. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes


    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  4. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays. (United States)

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua


    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. PMID:26922047

  5. Use of the polymerase chain reaction in epizootiological studies of viral diseases

    International Nuclear Information System (INIS)

    The polymerase chain reaction (PCR) has become a powerful diagnostic tool in veterinary virology. The research team at the Department of Virology of the National Veterinary Institute, Uppsala, Sweden, was among the first groups to develop and apply routine diagnostic PCR assays in veterinary virology, to develop PCR diagnostic kits and to introduce assays of molecular epizootiology, based on comparative nucleotide sequence analysis of the PCR products. In the paper the experiences of 10 years of application of these techniques are summarized, with special regard to technical developments, i.e. simplified methods of sample preparation, precautions to avoid false positive or negative results, comparison of standard and nested PCR and simple assays of visualization. The viruses involved in the routine PCR diagnostic work are listed in two tables. Examples are given concerning the problems of routine PCR diagnosis in veterinary virology. The use of the PCR as a basic method of 'molecular epizootiology' is discussed and illustrated with several examples. The approaches of molecular epizootiology are based on direct sequence analysis of the PCR products, comparative analysis of the sequences and construction of phylogenetic trees. By this approach the phylogenetic relations are determined and the viruses are rapidly identified and grouped. The accurate genetic identification of virus variants provides novel means to the epizootiologists to trace the geographic distribution of the viruses and to determine the origin of a given outbreak. (author)

  6. Identifying of meat species using polymerase chain reaction (PCR) (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  7. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  8. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi


    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  9. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  10. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  11. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou


    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  12. Fluorescent assay for oxytetracycline based on a long-chain aptamer assembled onto reduced graphene oxide

    International Nuclear Information System (INIS)

    We report on a fluorescent assay for oxytetracycline (OTC) using a fluorescein-labeled long-chain aptamer assembled onto reduced graphene oxide (rGO). The π-π stacking interaction between aptamer and rGO causes the fluorescence of the label to be almost completely quenched via energy transfer so that the system has very low background fluorescence. The addition of OTC leads to the formation of G-quadruplex OTC complexes and prevents the adsorption of labeled aptamer on the surface of rGO. As a result, fluorescence is restored, and this effect allows for a quantitative assay of OTC over the 0.1–2 μM concentration range and with a detection limit of 10 nM. This method is simple, rapid, selective and sensitive. It may be applied to other small molecule analytes by applying appropriate aptamers. (author)

  13. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E


    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  14. Gadolinium-neutron capture reactions: A radiobiological assay

    International Nuclear Information System (INIS)

    Gadolinium neutron capture(GNC) takes advantage of its extraordinarily large cross section to thermal neutrons. In GNC reactions, prompt high energy gamma rays, x-rays and electrons are released. Because of the photons and electrons, the intracellular presence of gadolinium is not considered critical. This is an advantage over boron-neutron capture therapy where the intracellular presence of boron is required because of the short flight tracks of 2.4 MeV alpha particles. In this study, the radiation effect of GNC reactions was measured using Chinese hamster cells in an attempt to evaluate the contributions of neutrons, gamma rays and electrons on cell inactivation

  15. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .


    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  16. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana


    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  17. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Directory of Open Access Journals (Sweden)

    Mohammad Soleimani


    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  18. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S


    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  19. Proteome-wide selected reaction monitoring assays for the human pathogen Streptococcus pyogenes.


    Karlsson, Christofer; Malmström, Lars; Aebersold, Ruedi; Malmström, Johan


    Selected reaction monitoring mass spectrometry (SRM-MS) is a targeted proteomics technology used to identify and quantify proteins with high sensitivity, specificity and high reproducibility. Execution of SRM-MS relies on protein-specific SRM assays, a set of experimental parameters that requires considerable effort to develop. Here we present a proteome-wide SRM assay repository for the gram-positive human pathogen group A Streptococcus. Using a multi-layered approach we generated SRM assays...

  20. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q


    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  1. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)


    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  2. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    International Nuclear Information System (INIS)

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

  3. An assay for the detection of grapevine leafroll-associated virus 3 using a single-chain fragment variable antibody. (United States)

    Cogotzi, Laura; Giampetruzzi, Annalisa; Nölke, Greta; Orecchia, Martin; Elicio, Vito; Castellano, Maria Antonietta; Martelli, Giovanni P; Fischer, Rainer; Schillberg, Stefan; Saldarelli, Pasquale


    Grapevine leafroll-associated virus 3 (GLRaV-3) is a major pathogen of grapevine. A previously described single-chain fragment variable (scFv) antibody (scFvLR3), directed against the coat protein (CP) of GLRaV-3, was expressed in Escherichia coli and used to develop a diagnostic ELISA kit. The antibody was fused to the light chain constant domain of human immunoglobulin to create the bivalent reagent C(L)-LR3, which was purified from the periplasmic fraction, giving a yield of ~5 mg/l. The sensitivity of the reagent against recombinant GLRaV-3 CP was 0.1 ng. The sensitivity, specificity and durability of the reagent was similar to a commercial kit. The C(L)-LR3 showed a weak cross-reaction in immune electron microscopy assays to GLRaV-1 and -7, but not with the phylogenetically more distant GLRaV-2. A fully recombinant kit was developed with the inclusion of a recombinant GLRaV-3 CP expressed in bacteria, thus avoiding problems associated with virus propagation and purification. This system represents a rapid, simple, sensitive and standardized diagnostic protocol for GLRaV-3 detection. PMID:19082687

  4. Redox-Reaction Based Spectrophotometric Assay of Isoniazid in Pharmaceuticals


    N Swamy; K. N. Prashanth; K. Basavaiah


    Two spectrophotometric methods are described for the determination of isoniazid (INH) in pharmaceuticals. In the first method (FCR method), INH is reacted with Folin-Ciocalteu reagent in Na2CO3 medium and the resulting blue colored chromogen measured at 760 nm. Iron(II), formed as a result of reaction between INH and iron(III), is made to react with ferricyanide, and the resulting Prussian blue is measured at 760 nm, basing the second method (FFC method). The conditions for better performance...

  5. Three sample preparation protocols for polymerase chain reaction based detection of Cryptosporidium parvum in environmental samples. (United States)

    Kostrzynska, M; Sankey, M; Haack, E; Power, C; Aldom, J E; Chagla, A H; Unger, S; Palmateer, G; Lee, H; Trevors, J T; De Grandis, S A


    Cryptosporidium parvum is a protozoan parasite responsible for an increasing number of outbreaks of gastrointestinal illness worldwide. In this report, we describe development of sample preparation protocols for polymerase chain reaction (PCR)-based detection of C. parvum in fecal material and environmental water samples. Two of these methods were found adequate for isolation of Cryptosporidium DNA from filtered water pellet suspensions. The first involved several filtration steps, immunomagnetic separation and freeze-thaw cycles. The second method involved filtration, addition of EnviroAmp lysis reagent, freeze-thaw cycles and precipitation of the DNA with isopropanol. Using nested PCR, we detected 100 oocysts/ml of filtered water pellet suspension, with either of the above sample preparation procedures. Nested PCR increased sensitivity of the assay by two to three orders of magnitude as compared to the primary PCR. The detection limit for seeded fecal samples was 10-fold higher than for filtered environmental water pellet suspension. Nested PCR results showed 62.4 and 91.1% correlation with immunofluorescence assay (IFA) for fecal samples and filtered environmental water pellet suspensions, respectively. This correlation decreased to 47.2% and 44.4%, respectively, when only IFA positive samples were analyzed. However, in fecal samples contaminated with a high number (> 10(5)/g) of C. parvum oocysts, this correlation was 100%. PMID:10076632

  6. Detection of Toxoplasma gondii in venous blood from AIDS patients by polymerase chain reaction. (United States)

    Dupouy-Camet, J; de Souza, S L; Maslo, C; Paugam, A; Saimot, A G; Benarous, R; Tourte-Schaefer, C; Derouin, F


    Detection of Toxoplasma gondii in blood by means of the polymerase chain reaction (PCR) may facilitate the diagnosis and follow-up of cerebral toxoplasmosis in patients with AIDS. We evaluated this approach with seven patients with tissue culture-proven parasitemia, 14 patients with presumptive cerebral toxoplasmosis, and 17 healthy human immunodeficiency virus-positive controls. Each sample of blood was assayed on three different occasions by a PCR assay based on detection of the gene encoding the P30 surface protein. A positive PCR diagnosis required positivity in at least two of the three PCR tests. None of the controls had a positive PCR diagnosis, but six of the seven patients with parasitemia did. Cerebral toxoplasmosis was confirmed in 13 of the 14 patients with a presumptive diagnosis; diagnosis by PCR was positive before treatment for 9 of these 13 patients, whereas tissue culture was positive for only 1 patient. During treatment, blood samples were taken from 14 patients at regular intervals until day 12. PCR diagnosis became negative on ethidium-stained gels, but persistent signals were observed after hybridization, in some cases, for up to 12 days after initiation of therapy. PCR on venous blood could thus be a sensitive and noninvasive method for the diagnosis of cerebral and disseminated toxoplasmosis in AIDS patients and could be a potential tool for monitoring the effects of treatment. PMID:8349765

  7. The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

    International Nuclear Information System (INIS)

    Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

  8. Rapid Diagnosis of Extrapulmonary Tuberculosis by Ligase Chain Reaction Amplification


    Gamboa, Fredy; Dominguez, José; Padilla, Eduardo; Manterola, José M.; Gazapo, Elena; Lonca, Joan; Matas, Lurdes; Hernandez, Agueda; Cardona, Pere Joan; Ausina, Vicente


    A rapid amplification-based test for the diagnosis of extrapulmonary tuberculosis, the LCx Mycobacterium tuberculosis Assay from Abbott Laboratories, was evaluated. Results from the LCx M. tuberculosis Assay were compared with those from culture and the final clinical diagnosis for each patient. A total of 526 nonrespiratory specimens from 492 patients were tested. The specimens included urine; feces; lymph node exudates; pleural, cerebrospinal, articular, and ascitic fluids; tissue biopsies;...

  9. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang


    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  10. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction. (United States)

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S


    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  11. Polymerase chain reaction for the diagnosis of viral hepatitis B and C.


    Bréchot, C


    Polymerase chain reaction is a highly sensitive technique for the detection of hepatitis B virus-DNA and hepatitis C virus-RNA in serum, liver tissue, and peripheral mononuclear blood cells. In chronic hepatitis B, it is particularly useful for identification of infectious subjects who are hepatitis B surface antigen positive and anti-hepatitis B e antigen antibody-positive, and for follow up of hepatitis B virus infections in liver transplantation programmes. Polymerase chain reaction detect...

  12. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis. (United States)

    Chase, Dorothy M; Elliott, Diane G; Pascho, Ronald J


    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids. PMID:16921877

  13. Analytical issues of serum free light chain assays and the relative performance of polyclonal and monoclonal based reagents. (United States)

    Carr-Smith, Hugh D; Jenner, Ellen L; Evans, Josie A R; Harding, Stephen J


    Serum free light chain (FLC) assays have been incorporated into routine clinical practice and their use is recommended in international guidelines for the management of monoclonal gammopathies. Given that FLCs are not simple analytes, laboratories should be aware of potential analytical issues when using FLC assays, including antigen excess, lot-to-lot variation and non-linearity. Whilst manufacturers of monoclonal antibody-based assays claim that they overcome such issues, the evidence available to date does not support this. Here we review and compare the technical performance of both polyclonal and monoclonal antibody-based assays. The evidence suggests that the Freelite assay, based on polyclonal antisera, gives a broader recognition of monoclonal FLCs than the N Latex assay, based on monoclonal antisera, and despite being cited as a technical concern, we show that lot-to-lot variation of the Freelite assay is good. Both non-linearity and antigen excess are characteristic of FLC analysis and laboratories should be aware of these phenomena regardless of the assay system they use. Comparisons of the absolute values of sFLCs determined using monoclonal and polyclonal antibody-based assays show poor quantitative agreement and, because current guidelines have been established using the polyclonal antibody-based Freelite assay, it should not be assumed that assays utilizing monoclonal antibodies will give compliance with these guidelines. PMID:26943608

  14. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction. (United States)

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su


    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time. PMID:22079620

  15. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini


    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.


    Directory of Open Access Journals (Sweden)

    Yu. Rud


    Full Text Available Purpose. To analyse the nucleotide sequences of salmonids Y chromosome and to determine the fragment for specific primers selection and also to develop the PCR based method for sex determination in huchen H. hucho. Methodology. Using the ClustalW algorithm in MEGA 5.2, the nucleotide sequences of salmonids Y chromosome were analysed. For developing of method for rapid diagnostic of huchen sex the polymerase chain reaction (PCR assay was used. Tne nucleotide sequences of amplified products were investigated by sequencing. Findings. Using PCR assay the method of sex determination in huchen H. hucho was developed. It was shown that specific PCR products in size of 450 nucleotides were visible in huchen males only. In addition we showed that selected primers can be used in sex determination of rainbow trout Oncorhynchus mykiss and this fact is proved the high rate of sdY locus similarity and its wide destribution in salmonids. Originality. The nucleotide sequences of salmonids Y chromosome were analysed and highly conservative region of sdY locus for specific primers selection, which covers sex-linked marker, was identified. Practical Value. Rapid sex determination in huchen by the developed method will allow to identify reversal males in process of gormonal sex reversion. At the stage of reversal males screening, this method will allow to identify the genotypic males (XY in experimental group and discard them because only phenotypic males with XX genotype (reversal males must be used in the crosses with native femelas for getting of 100 % all-females stock.

  17. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G


    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  18. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction. (United States)

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T


    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244


    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈


    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  20. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction. (United States)

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham


    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  1. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection. (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao


    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. PMID:26879193

  2. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis. (United States)

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui


    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. J. Med. Virol. 88:871-876, 2016. © 2015 Wiley Periodicals, Inc. PMID:26455510

  3. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan


    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  4. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method. (United States)

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco


    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method. PMID:25946377

  5. High-Speed Microdialysis-Capillary Electrophoresis Assays for Measuring Branched Chain Amino Acid Uptake in 3T3-L1 cells. (United States)

    Harstad, Rachel K; Bowser, Michael T


    We have developed a high-throughput microdialysis-capillary electrophoresis (MD-CE) assay for monitoring branched chain amino acid (BCAA) uptake/release dynamics in 3T3-L1 cells. BCAAs (i.e., isoleucine, leucine, and valine) and their downstream metabolites (i.e., alanine, glutamine, and glutamate) are important indicators of adipocyte lipogenesis. To perform an analysis, amino acids were sampled using microdialysis, fluorescently labeled in an online reaction, separated using CE, and detected using laser-induced fluorescence (LIF) in a sheath flow cuvette. Separation conditions were optimized for the resolution of the BCAAs isoleucine, leucine, and valine, as well as 13 other amino acids, including ornithine, alanine, glutamine, and glutamate. CE separations were performed in <30 s, and the temporal resolution of the online MD-CE assay was <60 s. Limits of detection (LOD) were 400, 200, and 100 nM for isoleucine, leucine, and valine, respectively. MD-CE dramatically improved throughput in comparison to traditional offline CE methods, allowing 8 replicates of 15 samples (i.e., 120 analyses) to be assayed in <120 min. The MD-CE assay was used to assess the metabolism dynamics of 3T3-L1 cells over time, confirming the utility of the assay. PMID:27398773

  6. Development of a high-throughput assay for the HIV-1 integrase disintegration reaction

    Institute of Scientific and Technical Information of China (English)


    Both HIV-1 integrase (IN) and the central catalytic domain of IN (IN-CCD) catalyze the disintegration reaction in vitro.In this study,IN and IN-CCD proteins were expressed and purified,and a high-throughput format enzyme-linked immunosorbent assay (ELISA) was developed for the disintegration reaction.IN exhibited a marked preference for Mn2+ over Mg2+ as the divalent cation cofactor in disintegration.Baicalein,a known IN inhibitor,was found to be an IN-CCD inhibitor.The assay is sensitive and specific for the study of disintegration reaction as well as for the in vitro identification of antiviral drugs targeting IN,especially targeting IN-CCD.

  7. Simultaneous detection of pyrethroid, organophosphate, and cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex polymerase chain reaction. (United States)

    Domingues, Luísa N; Guerrero, Felix D; Foil, Lane D


    The horn fly, Haematobia irritans irritans (L., 1758) (Diptera: Muscidae), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex polymerase chain reaction (PCR) assay to simultaneously detect target site resistance to pyrethroids (kdr mutation), organophosphates (G262A acetylcholinesterase mutation), and cyclodienes (Rdl mutation) and used the new procedure to follow the progression of these three mutations after exposure to different insecticide pressure. We assayed flies collected at the Macon Ridge research station, Winnsboro, LA, from 2008 to 2012. The multiplex PCR showed robust results in all our assays. The kdr mutation remained at high frequencies during all years, even after 4 yr with no use of pyrethroids. The G262A acetylcholinesterase mutation fluctuated from 7.5 to 23.8% during the studied years, while the Rdl mutation was rare in 2008, 2009, and June 2010, and then significantly increased after the first use of endosulfan. The possibility of screening for all the known target site resistance mutations in a single PCR reaction makes the multiplex PCR a useful and affordable tool that can be used to help diagnose insecticide resistance. PMID:25276924

  8. Diagnosis of foot-and mouth disease by real time reverse transcription polymerase chain reaction under field conditions in Brazil

    Directory of Open Access Journals (Sweden)

    Clarke Neville P


    Full Text Available Abstract Background Foot-and-mouth disease (FMD is an economically important and highly contagious viral disease that affects cloven-hoofed domestic and wild animals. Virus isolation and enzyme-linked immunosorbent assay (ELISA are the gold standard tests for diagnosis of FMD. As these methods are time consuming, assays based on viral nucleic acid amplification have been developed. Results A previously described real-time reverse transcriptase polymerase chain reaction (RT-PCR assay with high sensitivity and specificity under laboratorial and experimental conditions was used in the current study. To verify the applicability of this assay under field conditions in Brazil, 460 oral swabs from cattle were collected in areas free of FMD (n = 200 and from areas with outbreaks of FMD (n = 260. Three samples from areas with outbreaks of FMD were positive by real-time RT-PCR, and 2 of those samples were positive by virus isolation and ELISA. Four other samples were considered inconclusive by real-time RT-PCR (threshold cycle [Ct] > 40; whereas all 200 samples from an area free of FMD were real-time RT-PCR negative. Conclusion real-time RT-PCR is a powerful technique for reliable detection of FMDV in a fraction of the time required for virus isolation and ELISA. However, it is noteworthy that lack of infrastructure in certain areas with high risk of FMD may be a limiting factor for using real-time RT-PCR as a routine diagnostic tool.

  9. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction. (United States)

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga


    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  10. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    International Nuclear Information System (INIS)

    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

  11. Method of carbon chain extension using novel aldol reaction

    Energy Technology Data Exchange (ETDEWEB)

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek


    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  12. Limitations of clonality analysis of B cell proliferations using CDR3 polymerase chain reaction


    Hoeve, M A; Krol, A D G; Philippo, K; Derksen, P W B; Veenendaal, R. A.; Schuuring, E; Kluin, Ph M; Krieken, J.H.J.M. van


    Background/Aims—Detection of clonal immunoglobulin heavy chain (IgH) rearrangements by the polymerase chain reaction (PCR) is an attractive alternative to Southern blotting in lymphoma diagnostics. However, the advantages and limitations of PCR in clonality analysis are still not fully appreciated. In this study, clonality was analysed by means of PCR, focusing in particular on the sample size requirements when studying extremely small samples of polyclonal and monoclonal lesions.

  13. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections


    Luciene de Fátima Costa Torres; Dayana Ribeiro; Raphael Hirata Jr; Luis Gustavo Carvalho Pacheco; Monica Cristina de Souza; Louisy Sanches dos Santos; Cíntia Silva dos Santos; Mohammad Salah; Mateus Matiuzzi da Costa; Marcio Garcia Ribeiro; Selim, Salah A; Vasco Ariston de Carvalho Azevedo; Ana Luiza Mattos-Guaraldi


    Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR) assay that can simultan...

  14. Development of Multiplex Real-Time Polymerase Chain Reaction for Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in Clinical Specimens


    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip


    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolyt...

  15. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction. (United States)

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana


    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain. PMID:26169291

  16. RAPID DETECTION OF Salmonella IN SHRIMP BY POLYMERASE CHAIN REACTION [Deteksi Cepat Salmonella pada Udang dengan Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ulfah Amalia


    Full Text Available Shrimp is an important non-oil commodity for foreign trade in Indonesia. However, rejection of shrimp exports by the importing countries is still commonly encountered. In 2011, the USFDA recorded two cases of Salmonella spp. contamination in shrimp products from two shrimp processing companies in Indonesia. Analysis of Salmonella spp. in seafood is generally performed using a conventional method which takes at least 5 days. The objective of the study is to get a Salmonellae rapid detection method in shrimp by PCR. In this study, optimization of PCR protocol method to detect Salmonella invA gene was conducted using six different annealing temperatures (59, 59.5, 60.8, 62, 64 and 64.5°C. The results showed that 64°C was the optimum annealing temperature to detect the 284 bp fragment of Salmonella invA gene. The PCR based detection method has a DNA detection limit of 27.81ug/mL and 10°CFU/mL of viable salmonellae with 100% specificity. The PCR protocol is capable of detecting six different Salmonella serovars (S. Enteritidis, S. Hadar, S. Heidelberg, S. Kentucky, S. Paratyphi and S. Typhimurium but none of the non salmonellae isolates. Application of the PCR assay on Salmonella in shrimp after the selective enrichment step suggested that all 16 samples were positive for Salmonella. At the same time, the conventional method could only detected 3 samples for Salmonella positive.

  17. Detection of Human Parvovirus B19 Nonstrutural Protein DNA by Nested-Polymerase Chain Reaction in Gravida Serum and Pregnant Tissues

    Institute of Scientific and Technical Information of China (English)


    A new nested-polymerase chain reaction (nested-PCR) assay was developed to detect human parvovirus B19 DNA corresponding to the nonstructural protein in clinical specimens in a routine diagnostic laboratory. The sensitivity of this highly specific assay was up to 0. 005 fg of B19 DNA. Parvovirus B19 was identified in sera of 20 pregnant women with abnormal pregnant outcome. Among these 20 cases, intrauterine parvovirus infection did exist in 7 pregnant women because parvovirus B19 DNA was detected in the pregnant tissues of them such as placenta tissues,chorionic villi, amniotic fluid, fetal spleen, liver and abdominal fluids.

  18. Reverse transcription genome exponential amplification reaction assay for rapid and universal detection of human rhinoviruses. (United States)

    Guan, Li; Zhao, Lin-Qing; Zhou, Hang-Yu; Nie, Kai; Li, Xin-Na; Zhang, Dan; Song, Juan; Qian, Yuan; Ma, Xue-Jun


    Human rhinoviruses (HRVs) have long been recognized as the cause of more than one-half of acute viral upper respiratory illnesses, and they are associated with more-serious diseases in children, such as asthma, acute otitis media and pneumonia. A rapid and universal test for of HRV infection is in high demand. In this study, a reverse transcription genome exponential amplification reaction (RT-GEAR) assay targeting the HRV 5' untranslated region (UTR) was developed for pan-HRV detection. The reaction was performed in a single tube in one step at 65 °C for 60 min using a real-time fluorometer (Genie(®)II; Optigene). The RT-GEAR assay showed no cross-reactivity with common human enteroviruses, including HEV71, CVA16, CVA6, CVA10, CVA24, CVB5, Echo30, and PV1-3 or with other common respiratory viruses including FluA H3, FluB, PIV1-4, ADV3, RSVA, RSVB and HMPV. With in vitro-transcribed RNA containing the amplified regions of HRV-A60, HRV-B06 and HRV-C07 as templates, the sensitivity of the RT-GEAR assay was 5, 50 and 5 copies/reaction, respectively. Experiments to evaluate the clinical performance of the RT-GEAR assay were also carried out with a panel of 143 previously verified samples, and the results were compared with those obtained using a published semi-nested PCR assay followed by sequencing. The tested panel comprised 91 HRV-negative samples and 52 HRV-positive samples (18 HRV-A-positive samples, 3 HRV-B-positive samples and 31 HRV-C-positive samples). The sensitivity and specificity of the pan-HRVs RT-GEAR assay was 98.08 % and 100 %, respectively. The kappa correlation between the two methods was 0.985. The RT-GEAR assay based on a portable Genie(®)II fluorometer is a sensitive, specific and rapid assay for the universal detection of HRV infection. PMID:27132014

  19. High-Throughput Electrophoretic Mobility Shift Assays for Quantitative Analysis of Molecular Binding Reactions


    Pan, Yuchen; Duncombe, Todd A.; Kellenberger, Colleen A.; Hammond, Ming C.; Herr, Amy E.


    We describe a platform for high-throughput electrophoretic mobility shift assays (EMSAs) for identification and characterization of molecular binding reactions. A photopatterned free-standing polyacrylamide gel array comprised of 8 mm-scale polyacrylamide gel strips acts as a chassis for 96 concurrent EMSAs. The high-throughput EMSAs was employed to assess binding of the Vc2 cyclic-di-GMP riboswitch to its ligand. In optimizing the riboswitch EMSAs on the free-standing polyacrylamide gel arra...

  20. Selected reaction monitoring assays in mesenchymal stem cells from osteoarthritis patients


    Camafeita, Emilio; Lamas, José-Ramón; Calvo, Enrique; Tornero-Esteban, Pilar; López, Juan-Antonio; Fernández-Gutiérrez, Benjamín


    Osteoarthritis (OA) is considered the most prevalent form of arthritis. The aim of this study was to verify potential protein OA biomarkers by applying Selected Reaction Monitoring (SRM) assays to protein extracts obtained from Bone Marrow-Mesenchymal Stem Cells (BM-MSCs) isolated from OA patients. BM aspirates were obtained from the femoral channel of OA patients at the time of surgery and from the femoral channel of hip fracture subjects without OA during hip joint replacement surgery for t...

  1. Immunomagnetic Separation Combined with Polymerase Chain Reaction for the Detection of Alicyclobacillus acidoterrestris in Apple Juice


    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen


    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agar...

  2. Detection of Listeria monocytogenes in salmon using the Probelia polymerase chain reaction system. (United States)

    Wan, Jason; King, Kerryn; Forsyth, Santina; Coventry, M John


    A validation was conducted on the performance of a commercially available polymerase chain reaction (PCR) kit (Probelia) in comparison with International Organization for Standardization (ISO) method 11290-1 (adopted as an Australian New Zealand Standard Method, AS/NZS 1766.2.16.1:1998) for the detection of Listeria monocytogenes in salmon samples. The validation was conducted following the guidelines of an Australian New Zealand Standard (Guide to Determining the Equivalence of Food Microbiology Test Methods, Part 1, Qualitative Tests, AS/NZS 4659.1:1999), which adopts an approach similar to that recommended by the Association of Analytical Communities Microbiology Method Validation Program for Performance Tested and Peer Verified Methods. The validation study involved the use of five cultures of L. monocytogenes, each challenged at a single level of inoculation into five different types of salmon samples. A total of 60 salmon samples (30 unchallenged and 30 challenged) were tested using both the PCR method and the ISO method. Results from this study indicated that the Probelia PCR method is equivalent to the ISO method. In addition, the detection sensitivity of the Probelia PCR system was determined as approximately 0.5 CFU per PCR assay (equivalent to 20 CFU/ml broth culture) for a pure culture of L. monocytogenes. The Probelia PCR method offers the advantage of detecting L. monocytogenes to genetic specificity within 48 to 50 h, whereas the ISO method requires 5 days for negative results with additional days for confirmed positive results by the use of other biochemical and cultural tests. PMID:12636297

  3. Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Conventional methods for the diagnosis of tubercolosis based on microscopic examination and in vitro culture is both time consuming and tedious. Molecular methods of diagnosis have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determined the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. An aliquot of each specimen were kept for analysis by in vitro amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. All specimens were analysed in quintriplicate, with 2 samples unspiked and 3 sampled spiked with M. tuberculosis. Appropriate positive and negative controls were included in all essays. Following amplification, the specimens were analysed by agarose gel electrophoresis (AGE). All specimens were further subject to hybridization studies using a specific radiolabelled probe. The sensitivity of the amplification assay coupled with visualization of the amplified targets using eithidium bromide staining was found to be about 1 fg of DNA. A total of 40 smear positive specimens were analyzed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive by PCR/hybridization analysis. (author). 13 refs, 1 tab

  4. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    V Makeshkumar


    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  5. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.


    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam


    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  7. Polyvinylpyrrolidone-Agarose Gel Electrophoresis Purification of Polymerase Chain Reaction-Amplifiable DNA from Soils


    Young, Charles C.; Burghoff, Robert L.; Keim, Lois G.; Minak-Bernero, Vera; Lute, James R.; Hinton, Stephen M.


    This communication describes a modification of agarose gel electrophoresis to provide a rapid and simple method for the purification of polymerase chain reaction-amplifiable DNA from soil. This modification is to add polyvinylpyrrolidone to the agarose gel. The polyvinylpyrrolidone addition retards the electrophoretic mobility of denaturing phenolic compounds so that they do not comigrate with nucleic acids.

  8. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints." (United States)

    Phelps, Tara L.; And Others


    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  9. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory (United States)

    Elkins, Kelly M.


    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  10. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.; Ahlford, A.; Syvänen, A.-C; Kutter, Jörg Peter; Wolff, Anders

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple and...

  11. Development and application of reverse transcriptase nested polymerase chain reaction test for the detection of exogenous avian leukosis virus. (United States)

    García, Maricarmen; El-Attrache, John; Riblet, Sylva M; Lunge, Vagner R; Fonseca, André S K; Villegas, Pedro; Ikuta, Nilo


    A polymerase chain reaction (PCR) assay that utilizes nested primers to amplify a fragment of the long terminal repeat of exogenous avian leukosis virus (ALV) was developed and evaluated for detection of ALV subgroup J directly from clinical samples. Compilation of sequence data from different endogenous and exogenous ALVs allowed the selection of a conserved set of nested primers specific for the amplification of exogenous ALV subgroups A, B, C, D, and J and excluded amplification of endogenous viruses or endogenous viral sequences within the chicken genome. The nested primers were successfully used in both PCR and reverse transcriptase (RT)-PCR assays to detect genetically diverse ALV-J field isolates. Detection limits of ALV-J isolate ADOL-Hc1 DNA by nested PCR and RNA by RT-nested PCR were superior to detection of group-specific antigen by enzyme-linked immunosorbent assay (ELISA) in cell culture. Detection of ALV-J in cloacal swabs by RT-nested PCR was compared with direct detection by antigen-capture (ac)-ELISA; RT-nested PCR detected fewer positive samples than ac-ELISA, suggesting that RT-nested PCR excluded detection of endogenous virus in clinical samples. Detection of ALV-J in plasma samples by RT-nested PCR was compared with virus isolation in C/E chicken embryo fibroblasts; the level of agreement between both assays as applied to plasma samples ranged from low to moderate. The main disagreement between both assays was observed for a group of plasma samples found positive by RT-nested PCR and negative by virus isolation, suggesting that RT-nested PCR detected ALV-J genome in plasma samples of transiently or intermittently infected birds. ALV-J transient and intermittent infection profiles are characterized by inconsistent virus isolation responses throughout the life of a naturally infected flock. PMID:12713157

  12. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction (United States)

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.


    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  13. Validation and Identification of Invasive Salmonella Serotypes in Sub-Saharan Africa by Multiplex Polymerase Chain Reaction. (United States)

    Al-Emran, Hassan M; Krumkamp, Ralf; Dekker, Denise Myriam; Eibach, Daniel; Aaby, Peter; Adu-Sarkodie, Yaw; Ali, Mohammad; Rubach, Mathew P; Bjerregaard-Andersen, Morten; Crump, John A; Cruz Espinoza, Ligia Maria; Løfberg, Sandra Valborg; Gassama Sow, Amy; Hertz, Julian T; Im, Justin; Jaeger, Anna; Kabore, Leon Parfait; Konings, Frank; Meyer, Christian G; Niang, Aissatou; Pak, Gi Deok; Panzner, Ursula; Park, Se Eun; Rabezanahary, Henintsoa; Rakotozandrindrainy, Raphaël; Raminosoa, Tiana Mirana; Razafindrabe, Tsiriniaina Jean Luco; Sampo, Emmanuel; Schütt-Gerowitt, Heidi; Sarpong, Nimako; Soura, Abdramane Bassiahi; Tall, Adama; von Kalckreuth, Vera; Wierzba, Thomas F; May, Jürgen; Marks, Florian


    Salmonella enterica serovar Typhi and nontyphoidal Salmonella (NTS) cause the majority of bloodstream infections in sub-Saharan Africa; however, serotyping is rarely performed. We validated a multiplex polymerase chain reaction (PCR) assay with the White-Kauffmann-Le Minor (WKLM) scheme of serotyping using 110 Salmonella isolates from blood cultures of febrile children in Ghana and applied the method in other Typhoid Fever Surveillance in Africa Program study sites. In Ghana, 47 (43%) S. Typhi, 36 (33%) Salmonella enterica serovar Typhimurium, 14 (13%) Salmonella enterica serovar Dublin, and 13 (12%) Salmonella enterica serovar Enteritidis were identified by both multiplex PCR and the WKLM scheme separately. Using the validated multiplex PCR assay, we identified 42 (66%) S. Typhi, 14 (22%) S. Typhimurium, 2 (3%) S. Dublin, 2 (3%) S. Enteritidis, and 4 (6%) other Salmonella species from the febrile patients in Burkina Faso, Guinea-Bissau, Madagascar, Senegal, and Tanzania. Application of this multiplex PCR assay in sub-Saharan Africa could advance the knowledge of serotype distribution of Salmonella. PMID:26933026

  14. Comparison of a conventional polymerase chain reaction with real-time polymerase chain reaction for the detection of neurotropic viruses in cerebrospinal fluid samples


    M Ramamurthy; Alexander, M; Aaron, S; Kannangai, R.; Ravi, V.; Sridharan, G.; A.M. Abraham


    Purpose : To compare a conventional polymerase chain reaction (PCR) and real-time PCR for the detection of neurotropic DNA viruses. Materials and Methods : A total of 147 cerebrospinal fluid (CSF) samples was collected from patients attending a tertiary care hospital in South India for a period from 2005 to 2008. All these samples were tested using a conventional multiplex/uniplex PCR and a real-time multiplex/uniplex PCR. This technique was used to detect a large number of herpes viruses res...

  15. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou


    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  16. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio


    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  17. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen; Uldum, Søren A.


    samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the......Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...


    Institute of Scientific and Technical Information of China (English)

    徐作军; 马东来; 罗慰慈; 朱元珏


    To investigate the correlation between sarcoidosis and Borrelia burgdorferi (Bb) infection,flagella DNA of Bb were detected in 23 granulomatous tissue specimens from patients with confirmed sarcoidosis usingpolymerase chain reaction in situ technique (in situ PCR) and the antibodies to Bb were examined in 55 serum samples obtained from the patients by indirect immunoflurescence assays. Our data presented that =(1) None of granulomatous tissues was found to have Bb DNA in 23 tissue samples. (2) Thirty of 55(54.6%) patients with sarcoidosis were found antibodies to Bh positive,in contrast,six of 60 (10%) norreal subjects had antibodies against Bb,the positive rate was remarkably higher in patient group than thatin healthy group (P(0. 005). The results suggest that Bb might not be the causative agent of sarcoidosis,the elevated titres of serum antibodies against Bb in patients with sarcoidosis is a nonspecific response.

  19. Development of a multiplex polymerase chain reaction to detect five common Gram-negative bacteria of aquatic animals. (United States)

    Tsai, M-A; Ho, P-Y; Wang, P-C; E, Y-J; Liaw, L-L; Chen, S-C


    A multiplex polymerase chain reaction (m-PCR) technique was developed as a rapid and accurate diagnostic tool for identifying five major Gram-negative bacilli -Vibrio vulnificus, V. parahaemolyticus, Aeromonas hydrophila, Chryseobacterium meningosepticum and Edwardsiella tarda- that cause major diseases in cultured aquatic animals in Taiwan. The expected amplicons for V. vulnificus, V. parahaemolyticus, A. hydrophila, C. meningosepticum and E. tarda were 410, 368, 685, 180 and 230bp, respectively. The assay was shown to be specific for the target pathogens. The sensitivities of detection were estimated to be 20.5fg∼200pg of genomic DNA or 10(2) ∼10(4) colony-forming units (cfu) of bacterial isolates when adopted as PCR templates. The m-PCR was capable of simultaneously amplifying target fragments from bacterial genome DNA mixed with the DNA extracted from viscera and tissues taken from fish without affecting the performance of the method. PMID:22571515

  20. A new measurement approach of ionizing radiation in irradiated trout (Oncorhynchus mykiss) by Randomly Polymorphic DNA-Polymerase Chain Reaction. (United States)

    Şakalar, Ergün; Mol, Sühendan


    Trout (Oncorhynchus mykiss) were irradiated at doses of 0.250, 0.500, 1, 3, 5, 7 and 9 kGy in gamma cell. DNAs were extracted from the irradiated samples before and after storage. 1ERP primers were designed, and RAPD-PCR (Randomly Polymorphic DNA-Polymerase Chain Reaction) was applied to make randomly amplifications on the DNA of the irradiated samples. Agarose gel profiles of irradiated fish were obtained to determine change of band profiles. In addition, DNA fragmentation occurring in each dose was determined by comet assay for the verification of methodology developed in this study. The molecular methodology was developed to estimate ionizing radiation (IR) level in irradiated fish. This methodology allows the analysis of the trout irradiated up to the dose limit of around 0.5 kGy and stored for a period of three months. PMID:27407216

  1. Detection of Nesopora caninum-specific DNA from cerebrospinal fluid by polymerase chain reaction in a dog with confirmed neosporosis. (United States)

    Ishigaki, Kyohei; Noya, Masahiko; Kagawa, Yumiko; Ike, Kazunori; Orima, Hiromitsu; Imai, Soichi


    A one-month male Greyhound dog presented with a swinging gait of the hindlimbs, and later developed muscular atrophy of the femoral region and hyperextension of hindlimbs. The dog had positive serum IFAT titers to Neospora caninum, but a negative titer in the cerebrospinal fluid (CSF). N. caninum-specific DNA was amplified from the CSF using a semi-nested polymerase chain reaction assay. Clusters of protozoa in biopsied muscle fibers were subsequently confirmed as N. caninum tachyzoites by immunohistochemical examination. Early recognition and treatment are necessary for effective recovery of clinical canine neosporosis, but antemortem diagnosis is difficult. We suggest that the detection of parasite deoxyribonucleic acid in the CSF is a useful antemortem diagnostic method in facilitating treatment of this disease. PMID:22446406

  2. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma... (United States)


    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... sample (100 to 2000 ng/5 μl) with one of the following 45 μl PCR cocktails: (i) 5 μl 10x PCR buffer, 1...

  3. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study


    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana


    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  4. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.;


    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  5. Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Dominique Rainteau

    Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

  6. Detection and characterization of cry1Ac transgene construct in Bt cotton: multiple polymerase chain reaction approach. (United States)

    Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N


    To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach

  7. Comparison of RNA isolation and associated methods for extracellular RNA detection by high-throughput quantitative polymerase chain reaction. (United States)

    Tanriverdi, Kahraman; Kucukural, Alper; Mikhalev, Ekaterina; Tanriverdi, Selim E; Lee, Rosalind; Ambros, Victor R; Freedman, Jane E


    MicroRNAs (miRNAs) are small noncoding RNA molecules that function in RNA silencing and posttranscriptional regulation of gene expression. miRNAs in biofluids are being used for clinical diagnosis as well as disease prediction. Efficient and reproducible isolation methods are crucial for extracellular RNA detection. To determine the best methodologies for miRNA detection from plasma, the performance of four RNA extraction kits, including an in-house kit, were determined with miScript miRNA assay technology; all were measured using a high-throughput quantitative polymerase chain reaction (qPCR) platform (BioMark System) with 90 human miRNA assays. In addition, the performances of complementary DNA (cDNA) and preamplification kits for TaqMan miRNA assays and miScript miRNA assays were compared using the same 90 miRNAs on the BioMark System. There were significant quantification cycle (Cq) value differences for the detection of miRNA targets between isolation kits. cDNA, preamplification, and qPCR performances were also varied. In summary, this study demonstrates differences among RNA isolation methods as measured by reverse transcription (RT)-qPCR. Importantly, differences were also noted in cDNA and preamplification performance using TaqMan and miScript. The in-house kit performed better than the other three kits. These findings demonstrate significant variability between isolation and detection methods for low-abundant miRNA detection from biofluids. PMID:26969789

  8. Comet assay as a cold chain control tool;Teste do cometa como ferramenta de controle da cadeia do frio

    Energy Technology Data Exchange (ETDEWEB)

    Duarte, Renato Cesar


    Bearing in mind an ever more demanding market regarding the quality of food, it has been necessary to develop processes that meet the demands of consumers. Within the existing processes the cold chain and irradiation stand out. The cold chain comprises all the stages of conserving food from production, cooling, freezing, storing and transportation to the final consumer. Irradiation, as a means of conserving food, prolongs the shelf life, inhibits budding and reduces pathogenic contamination among other benefits. Is very important the identification of food degradation in function of failure on the processes which they were subjected. The comet assay is a screening test widely studied, considerate fast and with low cost. By the fact of the test identify breaks on the DNA, may be possible use the comet test on the control of cold chain failures that degrade de food. The labels and stamp, do not consider the previous food situation and indicate failures from the moment where they be placed in contact with the product. With the comet assay is possible to check the degradation that has occurred in liver chicken samples until the moment of comet's test realization. (author)

  9. Assessing HER2 amplification by IHC, FISH, and real-time polymerase chain reaction analysis (real-time PCR) following LCM in formalin-fixed paraffin embedded tissue from 40 women with ovarian cancer


    Hillig, Thore; Thode, Jørgen; Breinholt, Marie F; Franzmann, Maria-Benedicte; Pedersen, Carsten; Lund, Flemming; Mygind, Henrik; Sölétormos, György; Rudnicki, Martin


    We compare HER2 receptor amplification analysis by immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), and real-time polymerase chain reaction (real-time PCR) DNA copy-number assay following laser capture microdissection (LCM) in formalin-fixed paraffin embedded tissue from 40 women with verified ovarian cancer. We speculate that LCM should result in a more accurate assessment of HER2 amplification in our real-time PCR assay compared with IHC and FISH. HER2 overexpression m...

  10. Optimization of asymmetric polymerase chain reaction for rapid fluorescent DNA sequencing. (United States)

    Wilson, R K; Chen, C; Hood, L


    A high-throughput method for the preparation of single-stranded template DNA, which is suitable for sequence analysis using fluorescent labeling chemistry, is described here. In this procedure, the asymmetric polymerase chain reaction is employed to amplify recombinant plasmid or bacteriophage DNA directly from colonies or plaques. The use of amplification primers located at least 200 base pairs 5' to the site of sequencing primer annealing removes the need for extensive purification of the asymmetric polymerase chain reaction product. Instead, the single-stranded product DNA is purified by a simple isopropanol precipitation step and then directly sequenced using fluorescent dye-labeled oligonucleotides. This method significantly reduces the time and labor required for template preparation and improves fluorescent DNA sequencing strategies by providing a much more uniform yield of single-stranded DNA. PMID:2317375

  11. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples. (United States)

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal


    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  12. Light chain editing generates polyreactive antibodies in chronic graft-versus-host reaction


    Witsch, Esther J.; Cao, Hong; Fukuyama, Hidehiro; Weigert, Martin


    The chronic graft-versus-host (cGvH) reaction is a model of induced lupus caused by alloreactive CD4+ T cells from a Bm-12 mouse in a C57BL/6 recipient. We used this cGvH reaction in C57BL/6 anti-DNA H chain transgenic mice, 56R/B6, to understand the structure, specificity, and origin of the induced autoantibodies (auto-Abs). We found anti-DNA Abs that reacted to several different antigens, such as phosphatidylserine, myelin basic protein, thyroglobulin, histone, insulin, cytochrome C, and β-...

  13. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin


    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  14. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei


    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  15. Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Eustaquio T


    Full Text Available Trisha Eustaquio, James F LearyWeldon School of Biomedical Engineering, Purdue University, West Lafayette, IN, USABackground: Determination of the fate of nanoparticles (NPs in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR, coined “nanobarcoding,” is demonstrated.Methods: Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV.Results: Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs, while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas.Conclusion: Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further

  16. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive (United States)

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  17. Human parvovirus B19, varicella zoster virus, and human herpes virus 6 in temporal artery biopsy specimens of patients with giant cell arteritis: analysis with quantitative real time polymerase chain reaction


    Alvarez-Lafuente, R.; Fernandez-Gutierr..., B; Jover, J; Judez, E; Loza, E; Clemente, D; Garcia-Asenjo, J; Lamas, J


    Methods: Temporal artery biopsy specimens from 57 patients with GCA and 56 controls were investigated. DNA was obtained by biopsy, and quantitative real time polymerase chain reaction assay performed to establish the prevalence and viral load of B19, VZV, and HHV-6. Amplification of the human ß-globin gene was used as internal positive control.

  18. Assessing HER2 amplification by IHC, FISH, and real-time polymerase chain reaction analysis (real-time PCR) following LCM in formalin-fixed paraffin embedded tissue from 40 women with ovarian cancer

    DEFF Research Database (Denmark)

    Hillig, Thore; Thode, Jørgen; Breinholt, Ellen Marie;


    We compare HER2 receptor amplification analysis by immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), and real-time polymerase chain reaction (real-time PCR) DNA copy-number assay following laser capture microdissection (LCM) in formalin-fixed paraffin embedded tissue from 40...

  19. Detection of very low level Plasmodium falciparum infections using the nested polymerase chain reaction and a reassessment of the epidemiology of unstable malaria in Sudan

    DEFF Research Database (Denmark)

    Roper, C; Elhassan, I M; Hviid, L;


    We have used the nested polymerase chain reaction (PCR) to assay for low level Plasmodium falciparum infections that were below the threshold of detection of blood film examination. This revealed a substantial group of asymptomatic, submicroscopically patent infections within the population of a...

  20. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools. (United States)

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma


    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. PMID:23000800

  1. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng


    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  2. DNA amplification by polymerase chain reaction from brain tissues embedded in paraffin.


    Gall, K; Pavelić, J.; Jadro-Santel, D.; Poljak, M; Pavelić, K.


    A method which enables analysis of DNA from archival paraffin embedded normal and malignant brain tissue is described. The demonstration of a 317-bp long beta-actin DNA sequence by the polymerase chain reaction (PCR) was used to identify which fixation procedure, deparaffinization time and DNA extraction procedure would give the best results. Tissue specimens 1-39 years old were included in the experiments. Specimens fixed in either 10% formalin, Carnoy's or AMeX fixative were found to be bes...

  3. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.


    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P


    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate p...

  4. Uji Diagnostik Polymerase Chain Reaction –Restriction Fragment Length Polymorphism Dalam Menegakkan Diagnosis Onikomikosis.


    Lubis, Nova Zairina


    Background: Onychomycosis is a fungal infection of one or more units of the nail caused by dermatophytes, or mold and nondermatophytes yeast. Investigations are needed to establish the diagnosis of onychomycosis before starting treatment. Several investigations methods for diagnosing onychomycosis such as microscopic examination with 20% KOH, fungal culture, histopathology examination with PAS staining (Periodic acid Schiff) and PCR (Polymerase Chain Reaction), for culture methods require a l...

  5. Amplification of human minisatellites by the polymerase chain reaction: towards DNA fingerprinting of single cells.


    Jeffreys, A J; Wilson, V.; Neumann, R.; Keyte, J


    Hypervariable minisatellites can be amplified from human DNA by the polymerase chain reaction, using primers from DNA flanking the minisatellite to amplify the entire block of tandem repeat units. Minisatellite alleles up to 5-10 kb long can be faithfully amplified. At least six minisatellite loci can be co-amplified from the same DNA sample and simultaneously detected to provide a reproducible and highly variable DNA fingerprint which can be obtained from nanogram quantities of human DNA. Th...

  6. Genomic fingerprints of Staphylococcus aureus of bovine origin by polymerase chain reaction-based DNA fingerprinting.


    Matthews, K R; Kumar, S. J.; O'Conner, S. A.; Harmon, R J; Pankey, J W; Fox, L. K.; Oliver, S P


    Staphylococcus aureus (n = 75) isolated from mammary secretions of cows with subclinical and clinical mastitis from several geographic locations in the USA were examined using polymerase chain reaction-based DNA fingerprinting. DNA fingerprints were produced using a synthetic oligonucleotide primer (5'GTAACGCC3') to produce a distinct spectrum of amplified DNA fragments facilitating a high degree of resolution for differentiating S. aureus strains. PCR-based DNA fingerprinting grouped the 75 ...

  7. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction


    Harmey, Judith H.; Harmey, Matthew A.


    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  8. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J


    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  9. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics


    Li Jiang; Matthew Mancuso; Zhengda Lu; Gunkut Akar; Ethel Cesarman; David Erickson


    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics ...

  10. Compact-like kink in a real electrical reaction-diffusion chain

    International Nuclear Information System (INIS)

    We demonstrate experimentally the compact-like kinks existence in a real electrical reaction-diffusion chain. Our measures show that such entities are strictly localized and consequently present a finite spatial extent. We show equally that the kink velocity is threshold-dependent. A theoretical quantification of the critical coupling under which propagation fails is also achieved and reveals that nonlinear coupling leads to a propagation failure reduction

  11. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis


    Padmavathy L; Rao L; Veliath A


    Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR) is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patien...

  12. Detection of Durum Wheat Pasta Adulteration in the Jordanian Market by Polymerase Chain Reaction Technology


    H. Al-Rousan; N.D. Al-Hmoud; Ibrahim, M. A.; B.O. Hayek


    Taking into account the impact of monitoring food adulteration on the quality of food products, the aim of this study was to use polymerase chain reaction technology to detect possible adulteration of durum wheat pasta products in the Jordanian market. Cetyltrimethyl ammonium bromide method was applied for extracting genomic DNA from twenty six randomly collected pasta products, the results suggested the suitability of this method for DNA extraction from pasta products. Specific primers were ...

  13. The design and construction of an electronic model of the chain reaction process

    International Nuclear Information System (INIS)

    The design and construction of an electronic model simulating the nuclear chain reaction process up to three successive neutron generations is briefly described. This model is equipped with a special sound effect. However, a tape recorder can be attached and replayed in synchronism with the display with minimum hardware modifications. In this manner, it can function as a useful educational aid. The circuit is built around easily available ttl integrated circuits. (author)

  14. Effect of fungal and plant secondary metabolites on polimerase chain reaction (PCR)


    Thaler, Nejc; Bajc, Marko


    Secondary metabolites are organic compounds that can be found in both fungi and plants, where they play an important role as defensive and signal molecules, or provide other kinds of advantage in natural selection, but are not directly involved in normal growth, development and reproduction of an organism. When working with DNA techniques, it is the secondary metabolites that most often affect the efficiency of polymerase chain reaction (PCR), either by hindering cell lysis, causing ...

  15. Preliminary evaluation of the ligase chain reaction for specific detection of Neisseria gonorrhoeae.


    Birkenmeyer, L; Armstrong, A S


    Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the ...

  16. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.


    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W; Atlas, R M


    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can di...

  17. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.


    Alexander, H S; Key, D.W.; Nagy, E.


    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb Ba...

  18. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.


    Tzianabos, T; Anderson, B E; McDade, J E


    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinica...

  19. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  20. Prenatal diagnosis of Down syndrome using cell-free fetal DNA in amniotic fluid by quantitative fluorescent polymersase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wu Dan; Chi Hongbin; Shao Minjie; Wu Yao; Jin Hongyan; Wu Baiyan; Qiao Jie


    Backgroud Amniotic fluid (AF) supernatant contains cell-free fetal DNA (cffDNA) fragments.This study attempted to take advantage of cffDNA as a new material for prenatal diagnosis,which could be combined with simple quantitative fluorescent polymerase chain reaction (QF-PCR) to provide an ancillary method for the prenatal diagnosis of trisomy 21 syndrome.Methods AF supernatant samples were obtained from 27 women carrying euploid fetuses and 28 women carrying aneuploid fetuses with known cytogenetic karyotypes.Peripheral blood samples of the parents were collected at the same time.Short tandem repeat (STR) fragments on chromosome 21 were amplified by QF-PCR.Fetal condition and the parental source of the extra chromosome could be determined by the STR peaks.Results The sensitivity of the assay for the aneuploid was 93% (26/28; confidence interval,CI:77%-98%) and the specificity was 100% (26/26; CI:88%-100%).The determination rate of the origin of the extra chromosome was 69%.The sensitivity and the specificity of the assay in the euploid were 100% (27/27).Conclusions Trisomy 21 can be prenatally diagnosed by the QF-PCR method in AF supernatant.This karyotype analysis method greatly reduces the requirement for the specimen size.It will be a benefit for early amniocentesis and could avoid pregnancy complications.The method may become an ancillary method for prenatal diagnosis of trisomy 21.

  1. Comparison of serology, antigenemia assay and the polymerase chain reaction for monitoring active cytomegalovirus infections in hematopoietic stem cell transplantation patients Estudo comparativo entre sorologia, antigenemia e reação em cadeia da polimerase para o monitoramento da infecção por citomegalovírus em pacientes receptores de transplantes de células progenitoras hematopoéticas

    Directory of Open Access Journals (Sweden)

    Sandra Helena Alves Bonon


    Full Text Available Forty-six allogeneic hematopoietic stem cell transplantation (HSCT patients were monitored for the presence of CMV antibodies, CMV-DNA and CMV antigens after transplantation. Immunoenzymatic serological tests were used to detect IgM and the increase in CMV IgG antibodies (increase IgG, a nested polymerase chain reaction (N-PCR was used to detect CMV-DNA, and an antigenemia assay (AGM was used to detect CMV antigens. The presence of CMV-IgM and/or CMV-increase IgG antibodies was detected in 12/46 (26.1% patients, with a median time between HSCT and the detection of positive serology of 81.5 days. A positive AGM was detected in 24/46 (52.2% patients, with a median time between HSCT and antigen detection of 62 days. Two or more consecutive positive N-PCR results were detected in 32/46 (69.5% patients, with a median time between HSCT and the first positive PCR of 50.5 days. These results confirmed that AGM and mainly PCR are superior to serology for the early diagnosis of CMV infection. Six patients had CMV-IgM and/or CMV-increase IgG with a negative AGM (five cases or N-PCR assay (one case. In five of these cases the serological markers were detected during the first 100 days after HSCT, the period of highest risk. These findings support the idea that serology may be useful for monitoring CMV infections in HSCT patients, especially when PCR is unavailable.Quarenta e seis pacientes receptores de transplantes de células progenitoras hematopoéticas (TCPH foram monitorados em relação à infecção ativa por citomegalovírus (CMV. Testes sorológicos imunoenzimáticos foram utilizados para a detecção de anticorpos IgM e elevação significativa das concentrações de anticorpos IgG (aumento IgG, nested-PCR (N-PCR foi utilizada para a detecção de CMV-DNA e antigenemia (AGM para a detecção de antígenos virais. A presença de CMV-IgM e/ou CMV-aumento IgG foi detectada em 12/46 (26,1% pacientes, sendo o tempo mediano entre o transplante e a detec

  2. Rapid detection of Candida albicans by polymerase spiral reaction assay in clinical blood samples

    Directory of Open Access Journals (Sweden)

    Xiaoqun eJiang


    Full Text Available Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2, a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non- C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional PCR to compare their sensitivities. The detection limit of PSR was 6.9 pg/µl within 1 h, 10-fold higher than that of PCR (69.0 pg/µl. Blood samples (n=122 were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing.

  3. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms. (United States)

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven


    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The

  4. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C2H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH3; and ammonia, which produces NH2. In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  5. A string reaction coordinate for the folding of a polymer chain (United States)

    Leitold, Christian; Lechner, Wolfgang; Dellago, Christoph


    We investigate the crystallization mechanism of a single, flexible homopolymer chain with short range attractions. For a sufficiently narrow attractive well, the system undergoes a first-order like freezing transition from an expanded disordered coil to a compact crystalline state. Based on a maximum likelihood analysis of committor values computed for configurations obtained by Wang-Landau sampling, we construct a non-linear string reaction coordinate for the coil-to-crystal transition. In contrast to a linear reaction coordinate, the string reaction coordinate captures the effect of different degrees of freedom controlling different stages of the transition. Our analysis indicates that a combination of the energy and the global crystallinity parameter Q6 provide the most accurate measure for the progress of the transition. While the crystallinity paramter Q6 is most relevant in the initial stages of the crystallization, the later stages are dominated by a decrease in the potential energy.

  6. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)


    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  7. Differential detection of turkey coronavirus, infectious bronchitis virus, and bovine coronavirus by a multiplex polymerase chain reaction. (United States)

    Loa, C C; Lin, T L; Wu, C C; Bryan, T A; Hooper, T A; Schrader, D L


    The objective of the present study was to develop a multiplex polymerase chain reaction (PCR) method for differential detection of turkey coronavirus (TCoV), infectious bronchitis coronavirus (IBV), and bovine coronavirus (BCoV). Primers were designed from conserved or variable regions of nucleocapsid (N) or spike (S) protein gene among TCoV, IBV, and BCoV and used in the same PCR reaction. Reverse transcription followed by the PCR reaction was used to amplify a portion of N or S gene of the corresponding coronaviruses. The PCR products were detected on agarose gel stained with ethidium bromide. Two PCR products, a 356-bp band corresponding to N gene and a 727-bp band corresponding to S gene, were obtained for TCoV isolates. In contrast, one PCR product of 356 bp corresponding to a fragment of N gene was obtained for IBV strains and one PCR product of 568 bp corresponding to a fragment of S gene was obtained for BCoV. There were no PCR products with the same primers for Newcastle disease virus, Marek's disease virus, turkey pox virus, pigeon pox virus, fowl pox virus, reovirus, infectious bursal disease virus, enterovirus, astrovirus, Salmonella enterica, Escherichia coli, and Mycoplasma gallisepticum. Performance of the assay with serially diluted RNA demonstrated that the multiplex PCR could detect 4.8x10(-3) microg of TCoV RNA, 4.6x10(-4) microg of IBV RNA, and 8.0x10(-2) microg of BCoV RNA. These results indicated that the multiplex PCR as established in the present study is a rapid, sensitive, and specific method for differential detection of TCoV, IBV, and BCoV in a single PCR reaction. PMID:16137773

  8. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture

    Directory of Open Access Journals (Sweden)

    Monica Visnieski Alcantara


    Full Text Available Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by PCR directly from liquid culture - without prior DNA extraction. This simple approach enabled us to generate PCR amplifications from different cultures varying from 106-108 cells/mL. We also show that it is possible to combine different primer pairs in a multiplex detection reaction and even to achieve knockout confirmation with an extremely simple interpretation of a real-time PCR result. Using the “culture PCR” approach, we show for the first time that we can assess different DNA sequence combinations by PCR directly from liquid culture, saving time in several tasks for T. cruzi genotype interrogation.

  9. [Development of a real-time polymerase chain reaction method for the identification of Candida species]. (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza


    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  10. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time reverse-transcription polymerase chain reaction and virus isolation. (United States)

    Goodell, Christa K; Zhang, Jianqiang; Strait, Erin; Harmon, Karen; Patnayak, Devi; Otterson, Tracy; Culhane, Marie; Christopher-Hennings, Jane; Clement, Travis; Leslie-Steen, Pamela; Hesse, Richard; Anderson, Joe; Skarbek, Kevin; Vincent, Amy; Kitikoon, Pravina; Swenson, Sabrina; Jenkins-Moore, Melinda; McGill, Jodi; Rauh, Rolf; Nelson, William; O'Connell, Catherine; Shah, Rohan; Wang, Chong; Main, Rodger; Zimmerman, Jeffrey J


    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 assays based on real-time reverse-transcription polymerase chain reaction (rRT-PCR) and 7 assays based on virus isolation (VI). The OF specimens were inoculated with H1N1 or H3N2 IAV and serially diluted 10-fold (10(-1) to 10(-8)). Eight participating laboratories received 180 randomized OF samples (10 replicates × 8 dilutions × 2 IAV subtypes plus 20 IAV-negative samples) and performed the rRT-PCR and VI procedure(s) of their choice. Analysis of the results with a mixed-effect logistic-regression model identified dilution and assay as variables significant (P < 0.0001) for IAV detection in OF by rRT-PCR or VI. Virus subtype was not significant for IAV detection by either rRT-PCR (P = 0.457) or VI (P = 0.101). For rRT-PCR the cycle threshold (Ct) values increased consistently with dilution but varied widely. Therefore, it was not possible to predict VI success on the basis of Ct values. The success of VI was inversely related to the dilution of the sample; the assay was generally unsuccessful at lower virus concentrations. Successful swine health monitoring and disease surveillance require assays with consistent performance, but significant differences in reproducibility were observed among the assays evaluated. PMID:26733728

  11. Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps). (United States)

    Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X


    Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. PMID:25776549

  12. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte;


    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... commercial kits used in the ring trial could identify all different PRRSV strains with an optimal analytical and diagnostic sensitivity. The genetic variability of the PRRSV strains, which is supposed to hinder the diagnostic of the RT-PCR because of mutations at the primer binding sites, was also confirmed...

  13. Updating the Nuclear Reaction Rate Library (REACLIB) I. Experimental Reaction Rates of the Proton-Proton Chain

    International Nuclear Information System (INIS)

    REACLIB is one of the most comprehensive and popular astrophysical reaction rate libraries. However, its experimentally obtained rates for light isotopes still rely mainly on the Caughlan and Fowler (1988) compilation and have never been updated despite the progress in many relevant nuclear astrophysics experiments. Moreover, due to fitting errors REACLIB is not reliable at temperatures lower than 107K. In this work we establish the formalism for updating the obsolete Caughlan-Fowler experimental rates of REACLIB. Then we use the NACRE compilation and results from the LUNA experiments to update some important charged-particle induced rates of REACLIB focusing on the proton-proton chain. The updated rates (available also in digital form) can now be used in the low temperature regime (below 107K) which was forbidden to the old version of REACLIB. (authors)

  14. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk


    Jain, V K; Kumar, S.; Sharma, A.; N. Sindhu


    In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in...

  15. Herpes simplex encephalitis: MRI findings in two cases confirmed by polymerase chain reaction assay

    International Nuclear Information System (INIS)

    Herpes simplex virus (HSV) type I causes a fulminant necrotising meningoencephalitis distinguished from other encephalitides by its focal and often haemorrhagic nature. Specific antiviral therapy with acyclovir can significantly improve the prognosis. We present MRI findings of two cases of herpes simplex encephalitis (HSE) confirmed by PCR analysis, focusing on the serial changes after acyclovir therapy: gyral swelling, high signal intensity on T2-weighted images in the subfrontal region, temporal lobe and insula in the initial stage, then regional extension with enhancement and haemorrhage despite appropriate acyclovir therapy, and finally encephalomalacia and brain atrophy. (orig.)

  16. Genome editing. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations. (United States)

    Gantz, Valentino M; Bier, Ethan


    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype, whereas individuals homozygous for two copies of the allele will display a mutant phenotype. We have developed a method called the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome-editing system for generating autocatalytic mutations, to produce homozygous loss-of-function mutations. In Drosophila, we found that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome, thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  17. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan


    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  18. Zoster ... "a lmost" ... sine herpete: diagnostic utility of real time-polymerase chain reaction. (United States)

    Vena, Gino A; Apruzzi, Doriana; Vestita, Michelangelo; Calvario, Agata; Foti, Caterina; Cassano, Nicoletta


    Zoster sine herpete is a particular form of varicella zoster virus (VZV) infection characterized by segmental pain and dysesthesia, without any cutaneous lesions ever becoming perceptible. This report describes the case of a female patient, presenting with intercostal pain associated with a single papulo-vesicular lesion localized within the same area. Thanks to such a lesion, real time-polymerase chain reaction (PCR) analysis on vesicle fluid swab was possible, thus revealing a significant number of VZV genome copies. This innovative tool has proven essential to diagnose this abortive form of herpes zoster, which would otherwise have remained unidentified. PMID:21213602



    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini


    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  20. A highly sensitive aptasensor for OTA detection based on hybridization chain reaction and fluorescent perylene probe. (United States)

    Wang, Bin; Wu, Yuanya; Chen, Yanfen; Weng, Bo; Xu, Liqun; Li, Changming


    An optical aptasensor was developed for ultrasensitive detection of ochratoxin A (OTA) based on hybridization chain reaction (HCR) amplification strategy and fluorescent perylene probe (PAPDI)/DNA composites. Dendritic DNA concatamers were synthesized by HCR strategy and modified on magnetic nanoparticles through aptamer as medium. A large amount of PAPDI probe aggregated under the induction of DNA concatamers and caused fluorescence quenching. In the presence of OTA, the PAPDI/DNA composites were released from magnetic nanoparticles due to the strong affinity between aptamer and OTA. In ethanol, PAPDI monomers disaggregated and produced strong fluorescence. The present method displays excellent sensitivity and selectivity towards OTA. PMID:26938491

  1. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction.


    Tsai, Y L; Olson, B H


    The polymerase chain reaction (PCR) was used to amplify an Escherichia coli 16S ribosomal gene fragment from sediments with high contents of humic substances. Total DNA was extracted from 1 g of E. coli seeded or unseeded samples by a rapid freeze-and-thaw method. Several approaches (use of Bio-Gel P-6 and P-30 and Sephadex G-50 and G-200 columns, as well as use of the Stoffel fragment) were used to reduce interference with the PCR. The best results were obtained when crude DNA extracts conta...

  2. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots


    Liang Gaofeng; Ma Chao; Zhu Yanliang; Li Shuchun; Shao Youhua; Wang Yong; Xiao Zhongdang


    Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase ...

  3. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Miagostovich Marize Pereira


    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  4. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA


    Ana Lisa do Vale Gomes; Fábio L Melo; Roberto P Werkhauser; Frederico GC Abath


    This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR) protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA). Th...

  5. Real-Time Polymerase Chain Reaction for Detection of Strongyloides stercoralis in Stool


    Sultana, Yasmin; Jeoffreys, Neisha; Watts, Matthew R.; Gilbert, Gwendolyn L.; Lee, Rogan


    The use of real-time polymerase chain reaction (PCR) for detection of Strongyloides stercoralis in stool has recently been described. We compared five DNA extraction methods by using normal human stool spiked with Strongyloides ratti and tested by using a real-time PCR. The PowerSoil kit was found to be the best technique in terms of sensitivity and ease of use. The PCR detected DNA extracted from one spiked S. ratti larva diluted 10−2. The PowerSoil kit was then used to extract DNA from 160 ...

  6. Ultra sensitive detection of Listeria monocytogenes in milk by the polymerase chain reaction (PCR). (United States)

    Starbuck, M A; Hill, P J; Stewart, G S


    The polymerase chain reaction (PCR) has been used to detect Listeria monocytogenes in whole milk at a level of 0.1 cfu per 30 ml. This high degree of sensitivity has been achieved following enzymatic digestion, polysulphonone membrane filtration and amplification of a nucleotide sequence within the promoter region of hlyA. Key elements of the procedure are the absence of enrichment culture and a complete solubilization of the membrane filter, ensuring total nucleic acid recovery. The simplicity of the protocol coupled with high sample volumes and exquisite sensitivity extends the relevance of PCR within food and environmental microbiology. PMID:1368996

  7. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.


    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W


    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  8. Use of the Polymerase Chain Reaction in the Detection of Bovine Leukosis


    Kelly, Emma Jane


    A diagnostic test for bovine leukosis was developed using the polymerase chain reaction (PCR) to amplify a 375 base pair region in the gag gene of the proviral genome. Blood samples were collected from 3 adult Holstein cows shown to be infected with bovine leukosis virus (BLV) by the agar-gel immunodiffusion (AGID) technique. The 3 samples were mixed and the composite blood was used to inoculate 10 cows. Five of the cows were inoculated with 0.1 ml of blood, and the other cows were inocula...

  9. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction


    Alexandrakis, G.; JALALI, S; Gloor, P


    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In o...

  10. Synthesis and Intramolecular [4+2] Cycloaddition Reactions of 4-Pyridazinecarbonitriles with Alkyne Side Chains


    Norbert Haider; Günther Fülep


    The preparation of a series of new 3-(alkynyl-X)-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH) is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2]...

  11. Detection and differentiation of Cryptosporidium by real-time polymerase chain reaction in stool samples from patients in Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Flávia Ribeiro Rolando


    Full Text Available This study reports the first genetic characterisation of Cryptosporidium isolates in Brazil using real-time polymerase chain reaction (RT-PCR. A total of 1,197 faecal specimens from children and 10 specimens from human immunodeficiency virus-infected patients were collected between 1999-2010 and screened using microscopy. Forty-eight Cryptosporidium oocyst-positive isolates were identified and analysed using a generic TaqMan assay targeting the 18S rRNA to detect Cryptosporidium species and two other TaqMan assays to identify Cryptosporidium hominis and Cryptosporidium parvum. The 18S rRNA assay detected Cryptosporidium species in all 48 of the stool specimens. The C. parvum TaqMan assay correctly identified five/48 stool samples, while 37/48 stool specimens were correctly amplified in the C. hominis TaqMan assay. The results obtained in this study support previous findings showing that C. hominis infections are more prevalent than C. parvum infections in Brazil and they demonstrate that the TaqMan RT-PCR procedure is a simple, fast and valuable tool for the detection and differentiation of Cryptosporidium species.

  12. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.


    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  13. Vibrational nonequilibrium in chain branching reactions of hydrogen combustion using quasi-classical trajectory analysis (United States)

    Voelkel, Stephen; Raman, Venkat; Varghese, Philip


    In high-speed reactive flows in scramjets, thermal nonequilibrium is introduced in the flow via shock waves. Though rotational and translational energy modes relax back to equilibrium quickly, vibrational relaxation is comparable to the bulk mixing and reaction timescales. The discrepancy between vibration and rotation/translation energy distributions can dramatically alter on the initiation of the fuel oxidation process. For continuum-scale applications, thermal nonequilibrium effects are derived from the rovibrational state-specific reaction and scattering rates associated with the chemical mechanism. In this work, the state-specific reaction rates are calculated for the chain branching reactions in the hydrogen combustion mechanism using a quasi-classical trajectory (QCT) framework. The state-specific rates are incorporated into a multiple temperature continuum-scale model whereby each species is characterized by a Boltzmann distribution parametrized by its own vibrational temperature. The flame ignition rates are implemented in a CFD code to simulate a reactive coflow. Funded by AFOSR FA9550-12-1-0460.

  14. Detection of Legionella by quantitative-polymerase chain reaction (qPCR for monitoring and risk assessment

    Directory of Open Access Journals (Sweden)

    Krøjgaard Louise H


    Full Text Available Abstract Background Culture and quantitative polymerase chain reaction (qPCR assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a circulation water b water from empty apartments c water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool for risk assessment. Results In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6*105GU/L while L. pneumophila were detected in a range from LOQ to 6.8*105 GU/L. By culturing, the legionellae were detected in the range from below detection limit (> 10 CFU/L to 1.6*106 CFU/L. In circulating water and in first flush water from shower hoses, culture and qPCR showed the same tendencies. The overall correlation between the bacteria number detected by culture and the two developed qPCR assays (L. spp and L. pneumophila was relatively poor (r2 = 0.31 for culture and Legionella spp. assay, r2 = 0.20 for culture and L. pneumophila assay. Conclusion Detection by qPCR was suitable for monitoring changes in the concentration of Legionella but the precise determination of bacteria is difficult. Risk assessment by qPCR only on samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the other hand, the detection of a low number of bacteria by qPCR is a strong indication for the absence of risk.

  15. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.


    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  16. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction. (United States)

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin


    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems. PMID:17904730

  17. Polymerase chain reaction detection of candidatus liberibacter asiatic associated with citrus huanglonbing

    Directory of Open Access Journals (Sweden)

    G.P. Jagtap


    Full Text Available Polymerase chain reaction diagnosis of Candidatus liberibacter asiatic associated with citrus Huanglonbing disease is molecular technique which is used for detection of disease when pathogen present is very low concentration in disease sample. Among these three DNA isolation methods viz., commercial kit method, sodium sulphite method and membrane bard nucleic acid technique, sodium sulphite method is cost effective for commercial use. In nucleic acid membrane method for DNA extraction isolation there is no use of liquid nitrogen. Polymerase chain reaction detection of disease is based on principal of thermal cycling in which PCR instrument allow to run generally 60-65 thermal cycle, during PCR operation it allow different stages of cycle at different temperatures for different period of time i.e. initiation (940C, denaturation (940C, primer annealing (600C, extension/elongation step (720C, final elongation (720C and holding temperature (40C. PCR based diagnosis system is developed for detection of greening bacteria. The comparative cost of detection by various combinations of reagent and sampling time was determined and cost effective technology was standardized and validated.

  18. Use of sodC versus ctrA for real-time polymerase chain reaction-based detection of Neisseria meningitidis in sterile body fluids

    Directory of Open Access Journals (Sweden)

    Fábio Takenori Higa


    Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.

  19. Quantification of Staphylococcus aureus and Staphylococcus epidermidis on the hands of health-care workers using a real-time polymerase chain reaction method

    DEFF Research Database (Denmark)

    Horn, P; Schouenborg, P Øland; Brandslund, I


    OBJECTIVE: The objective of this study was to test a polymerase chain reaction (PCR) assay intended as a tool for monitoring hand hygiene in hospital wards. METHODS: The hands of 20 health-care workers were sampled for 10 days using real-time PCR for quantification of Staphylococcus aureus and S....... aureus and 211% for S. epidermidis. In an intervention study aimed at better hand hygiene in a ward with n participants, the difference before and after intervention is significant at CDI/sqrt[n] per cent. CONCLUSIONS: The PCR assay can be used to detect change in a group mean of S. aureus and S....... epidermidis in a hospital ward, i.e. before and after an intervention to improve hand hygiene. For the individual, the change in bacteria levels needed for significance is compromised by high intra-individual variation....

  20. Sensitive detection of Renibacterium salmoninarum in whole fry, blood, and other tissues of pacific salmon by reverse transcription-polymerase chain reaction. (United States)

    Rhodes, L D; Nilsson, W B; Strom, M S


    A sensitive, reproducible assay for detecting Renibacterium salmoninarum in a variety of tissues, including blood, has been developed. This assay, based on reverse transcription-polymerase chain reaction (RT-PCR) of 16S ribosomal RNA, exhibited sensitivity to

  1. Classical swine fever virus detection: results of a real-time reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control

    DEFF Research Database (Denmark)

    Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo;


    The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT......-PCR protocols and a standardized protocol commonly used by the Friedrich-Loeffler-Institute (FLI) on a panel of well-characterized samples. In general, all participants produced results within the acceptable range. The FLI assay, several in-house assays, and the commercial kits had high analytical sensitivity...... and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without...

  2. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  3. Identification of HIV-1 Genotypic Resistance in Patients on First-line Antiretroviral Therapy Using Polymerase Chain Reaction and Sequencing

    Institute of Scientific and Technical Information of China (English)

    Jiang Xiao; Gui-ju Gao; Hong-xin Zhao; Yan-mei Li; Ying-xiu Huang; Wen Zhang; Wen-jing Su; Wei Zhang; Ning Han; Di Yang; Xin Li


    Objective The aim of the study was to evaluate the characteristics of HIV drug-genotypic resistance among patients taking ifrst-line ARV regimens using polymerase chain reaction and sequencing, and guide to design optimal ARV regimens for these patients. Methods HIV reverse transcriptase-encoded gene was ampliifed with RT-PCR and ampliifed PCR products were aligned and comparatively analyzed with HIV resistance database to ifnd drug-resistance mutations. Results Twenty-eight PCR products were amplified and sequenced successfully in 30 serum samples of recruited HIV-infected patients with virologic failure. The resistance rate was 96%, mutations in NRT region were found in 26 patients (93%), while mutations in NNRT region were found in 27 patients (96%). M184V was the most common mutation (86%), K65R was selected in 14%of recruited individuals and TAMs occurred in 50%of patients, which resulted in resistance to NRTIs. Y181C and V179D were the most common mutations in NNRTIs and prevalence was 43%(12/28) and 36%(10/28), respectively, which resulted in cross-resistance to NNRTIs due to low-genetic barrier. Conclusions Virologic failure may occur in long-term administration of ifrst-line ARV regimens, and drug-resistance mutations can be found in these patients, which resulted in resistance to ifrst-line ARV regimens. We emphasized that HIV viral load assay and resistance assay were important tools to guide healthcare workers to design an optimal second-line ARV regimens for HAART-experienced individuals with virologic failure.

  4. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from sheep of Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.


    Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.

  5. A chimera of green fluorescent protein with single chain variable fragment antibody against ginsenosides for fluorescence-linked immunosorbent assay. (United States)

    Sakamoto, Seiichi; Tanizaki, Yusuke; Pongkitwitoon, Benyakan; Tanaka, Hiroyuki; Morimoto, Satoshi


    A chimera of green fluorescent protein extracted from Aequorea coerulescens (AcGFP), a mutant that has been codon optimized for mammalian expression, with single-chain variable fragment (scFv) antibody against ginsenoside Re (GRe-scFv), named fluobody, has been successfully expressed in Escherichia coli (E. coli) to develop simple, speedy, and sensitive fluorescence-linked immunosorbent assay (FLISA). Two chimera proteins were constructed to contain GRe-scFv at the C-terminus of AcGFP (C-fluobody) and at the N-terminus of AcGFP (N-fluobody). These fluobodies were then purified by ion metal affinity chromatography and refolded by stepwise dialysis. The characterization of both fluobodies revealed that C-fluobody was found to be appropriate probe for FLISA as compare with N-fluobody. Furthermore, improvement of limit of detection (LOD) was observed in FLISA using C-fluobody (10 ng/mL) due to its strong fluorescence intensity of AcGFP compared with conventional enzyme-linked immunosorbent assay (ELISA) using parental monoclonal antibody against ginsenoside Re (G-Re), MAb-4G10 (100 ng/mL). Since some steps required in ELISA can be avoided in this present FLISA, speedy and sensitive immunoassay also could be performed using fluobody instead of monoclonal antibody and scFv. PMID:21277981

  6. Detection and characterization of human pathogenic viruses circulating in community wastewater using multi target microarrays and polymerase chain reaction. (United States)

    Wong, Mark V M; Hashsham, Syed A; Gulari, Erdogan; Rouillard, Jean-Marie; Aw, Tiong Gim; Rose, Joan B


    Sewage pollution remains the most significant source of human waterborne pathogens. This study describes the detection and characterization of human enteric viruses in community wastewaters using cell culture coupled with multiple target microarrays (with a total of 780 unique probes targeting 27 different groups of both DNA and RNA viruses) and polymerase chain reaction (PCR) assays. Over a 13-month sampling period, RNA viruses (astroviruses and enteroviruses) were more frequently detected compared to DNA viruses (adenoviruses, particularly type 41 and BK polyomavirus). Overall, many more viruses were shed during the winter months (December-February) compared to the summer months. Exploration of the multiple types of enteric viruses particularly in winter months identified much more significant prevalence of key viral pathogens associated with sewage pollution of the water environment than previously realized and seasonal disinfection used in some parts of the world may lead to a seeding of ambient waters. Molecular characterization of pathogenic viruses in community wastewater will improve the understanding of the potential risk of waterborne disease transmission of viral pathogens. PMID:24334840

  7. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    International Nuclear Information System (INIS)

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  8. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions (United States)

    Shen, Cenchao; Yang, Wenjuan; Ji, Qiaoli; Maki, Hisaji; Dong, Anjie; Zhang, Zhizhou


    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  9. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes


    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  10. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam


    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  11. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction. (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn


    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  12. Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sundaran S. Tinky


    Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

  13. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    Directory of Open Access Journals (Sweden)

    R.S. Diaz


    Full Text Available For certain applications of the polymerase chain reaction (PCR, it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We used the forward mutation assay to compare the fidelity of Taq polymerase and Thermotoga maritima (ULTMA™ DNA polymerase, an enzyme that does have proofreading activity. We did not find significant differences in the fidelity of either enzyme, even when using optimal buffer conditions, thermal cycling parameters, and number of cycles (0.2% and 0.13% error rates for ULTMA™ and Taq, respectively, after reading about 3,000 bases each. We conclude that for sequencing purposes there is no difference in using a DNA polymerase that contains an inherent 3' to 5' exonuclease activity for DNA amplification. Perhaps the specificity and fidelity of PCR are complex issues influenced by the nature of the target sequence, as well as by each PCR component.

  14. Diagnosis of human herpesvirus 6B primary infection by polymerase chain reaction in young children with exanthematic disease

    Directory of Open Access Journals (Sweden)

    Ivna de Melo Magalhães


    Full Text Available INTRODUCTION: Exanthem subitum is a classical rash disease of early childhood caused by human herpesvirus 6B (HHV-6B. However, the rash is frequently misdiagnosed as that of either measles or rubella. METHODS: In this study, a nested multiplex polymerase chain reaction (PCR was used to diagnose HHV-6B primary infection, differentiate it from infections caused by HHV-6A and compare it to antibody avidity tests. The samples were separated into case group and control group according to the results of the indirect immunofluorescence assay (IFA technique. RESULTS: From the saliva samples analyzed, HHV-6A DNA was detected in 3.2% of the case group and in 2.6% of the control group. Regarding HHV-6B, PCR detected viral DNA in 4.8% of the case group and in 1.3% of the control group. Among the serum samples studied, a frequency of 1.7% was determined for HHV-6A in the case group and 1.2% in the control group. PCR did not detect HHV-6B DNA in serum samples. The sensitivity and specificity of the PCR technique ranged from 0% to 4.8% and 97.5% to 100%, respectively, compared to IFA. CONCLUSIONS: The PCR technique was not suitable for diagnosing primary infection by HHV-6B in children with exanthematic disease and should not substitute the IFA.

  15. High-throughput real-time assay based on molecular beacons for HIV-1 integrase 3'-processing reaction

    Institute of Scientific and Technical Information of China (English)

    Hong-qiu HE; Xiao-hui MA; Bin LIU; Xiao-yi ZHANG; Wei-zu CHEN; Cun-xin WANG; Shao-hui CHENG


    Aim: To develop a high-throughput real-time assay based on molecular beacons to monitor the integrase 3'-processing reaction in vitro and apply it to inhibitor screening.Methods: The recombinant human immunodeficiency virus (HIV)-1 integrase (IN) is incubated with a 38 mer oligonucleotide substrate, a sequence identical to the U5 end of HIV-1 long terminal repeats (LTR). Based on the fluores-cence properties of molecular beacons, the substrate is designed to form a stem-loop structure labeled with a fluorophore at the 5' end and a quencher at the 3'end.IN cleaves the terminal 3'-dinucleotide containing the quencher, resulting in an increase in fluorescence which can be monitored on a spectrofluorometer. To optimize this assay, tests were performed to investigate the effects of substrates, enzyme and the metal ion concentrations on the IN activity and optimal param-eters were obtained. Moreover, 2 IN inhibitors were employed to test the perfor-mance of this assay in antiviral compound screening.Results: The fluorescent intensity of the reaction mixture varies linearly with time and is proportional to the velocity of the 3'-processing reaction. Tests were performed and the results showed that the optimal rate was obtained for a reaction mixture containing 50 mg/L recom-binant HIV-1 IN, 400 nmol/L substrate, and 10 mmol/L Mn2+. The IN 3'-processing reaction under the optimal conditions showed a more than 18-fold increase in the fluorescence intensity compared to the enzyme-free control. The IC50 values of the IN inhibitors obtained in our assay were similar to the values obtained from a radiolabeled substrate assay.Conclusion: Our results demonstrated that this is a fast, reliable, and sensitive method to monitor HIV IN 3'-processing reaction and that it can be used for inhibitor screening.

  16. A chemiluminescence assay for L-histidine based on controlled DNAzyme catalytic reactions on magnetic microparticles

    International Nuclear Information System (INIS)

    We describe a chemiluminescence (CL) assay for L-histidine that is based on the use of DNAzyme covalently immobilized on 1.5-μm sized magnetic beads. On addition of a substrate labeled with a CL reagent, the DNAzyme and substrate form a stable duplex by allosteric synergetic stabilization of each duplex. If L-histidine is added to this system, self-cleavage of the substrate occurs through catalytic reaction and results in the formation of two fragments which dissociate from the beads. After removal of the magnetic beads, the labeled fragments can be detected by CL whose intensity is linearly related to the concentration of L-histidine in the 1.0 to 1,000 nM range. The detection limit is 0.3 nM, and the RSD is 3.4 % at a 50 nM level (n = 9). The method has been successfully applied to the determination of L-histidine in spiked human serum samples and holds promise as a widely applicable general platform for DNAzyme-based CL detection of small organic molecules and of metal ions. (author)

  17. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria


    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  18. A fluorescence turn on assay for alkaline phosphatase based on the Cu(2+) catalyzed Fenton-like reaction. (United States)

    Zhang, Qingfeng; Zhang, Cuiyun; Shahzad, Sohail Anjum; Yu, Cong


    A fluorescence turn-on assay was established for ALP (alkaline phosphatase) based on Cu(2+) catalyzed Fenton-like reaction and Graphene Oxide (GO). GO was utilized to quench the fluorescence of fluorescein (FAM) labeled single strand DNA (F-DNA). ALP can remove the phosphate group in sodium ascorbyl phosphate (SAP), and convert it into reducing ascorbate. Highly reactive hydroxyl radicals (·OH) were generated in the presence of ascorbate and Cu(2+) through the Fenton-like reaction. The reactive radicals generated in situ caused the cleavage of F-DNA into small fragments. When GO was added, the fluorescence emission of the sample without ALP was quenched and fluorescence emission recovered in the presence of ALP. The intensity of the recovered fluorescence was directly related to the concentration of ALP in the assay solution, and a sensitive and selective facile ALP assay is therefore established. PMID:27343614

  19. Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis.

    Directory of Open Access Journals (Sweden)

    Melissa K Gregory

    Full Text Available BACKGROUND: Δ6-Desaturase (Fads2 is widely regarded as rate-limiting in the conversion of dietary α-linolenic acid (18:3n-3; ALA to the long-chain omega-3 polyunsaturated fatty acid docosahexaenoic acid (22:6n-3; DHA. However, increasing dietary ALA or the direct Fads2 product, stearidonic acid (18:4n-3; SDA, increases tissue levels of eicosapentaenoic acid (20:5n-3; EPA and docosapentaenoic acid (22:5n-3; DPA, but not DHA. These observations suggest that one or more control points must exist beyond ALA metabolism by Fads2. One possible control point is a second reaction involving Fads2 itself, since this enzyme catalyses desaturation of 24:5n-3 to 24:6n-3, as well as ALA to SDA. However, metabolism of EPA and DPA both require elongation reactions. This study examined the activities of two elongase enzymes as well as the second reaction of Fads2 in order to concentrate on the metabolism of EPA to DHA. METHODOLOGY/PRINCIPAL FINDINGS: The substrate selectivities, competitive substrate interactions and dose response curves of the rat elongases, Elovl2 and Elovl5 were determined after expression of the enzymes in yeast. The competitive substrate interactions for rat Fads2 were also examined. Rat Elovl2 was active with C(20 and C(22 polyunsaturated fatty acids and this single enzyme catalysed the sequential elongation reactions of EPA→DPA→24:5n-3. The second reaction DPA→24:5n-3 appeared to be saturated at substrate concentrations not saturating for the first reaction EPA→DPA. ALA dose-dependently inhibited Fads2 conversion of 24:5n-3 to 24:6n-3. CONCLUSIONS: The competition between ALA and 24:5n-3 for Fads2 may explain the decrease in DHA levels observed after certain intakes of dietary ALA have been exceeded. In addition, the apparent saturation of the second Elovl2 reaction, DPA→24:5n-3, provides further explanations for the accumulation of DPA when ALA, SDA or EPA is provided in the diet. This study suggests that Elovl2 will be

  20. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations (United States)

    Gantz, Valentino M.; Bier, Ethan


    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype while individuals homozygous for two copies of the allele will display a mutant phenotype. Here, we develop a method that we refer to as the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome editing system for generating autocatalytic mutations to generate homozygous loss-of-function mutations. We demonstrate in Drosophila that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  1. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction. (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P


    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted. Images PMID:1696290

  2. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina


    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  3. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan


    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  4. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications. (United States)

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav


    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  5. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi


    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  6. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Directory of Open Access Journals (Sweden)

    Liang Gaofeng


    Full Text Available Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR. Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA. The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  7. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane


    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  8. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))


    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  9. Detection of hepatopancreatic parvovirus (HPV) in wild shrimp from India by nested polymerase chain reaction (PCR). (United States)

    Manjanaik, B; Umesha, K R; Karunasagar, Indrani; Karunasagar, Iddya


    The prevalence of hepatopancreatic parvovirus (HPV) in wild penaeid shrimp samples from India was studied by nested polymerase chain reaction (PCR) using primers designed in our laboratory. The virus could be detected in 9 out of 119 samples by non-nested PCR. However, by nested PCR 69 out of 119 samples were positive. The PCR results were confirmed by hybridization with digoxigenin-labelled DNA probe. Shrimp species positive by non-nested PCR included Penaeus monodon, Penaeus indicus and Penaeus semisulcatus and by nested PCR Parapenaeopsis stylifera, Penaeus japonicus, Metapenaeus monoceros, M. affinis, M. elegans, M. dobsoni, M. ensis and Solenocera choprai. This is the first report on the prevalence of HPV in captured wild shrimp from India. PMID:15819441

  10. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis

    Directory of Open Access Journals (Sweden)

    Padmavathy L


    Full Text Available Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patients with various types of cutaneous tuberculosis were subjected to PCR. Results: An overall positivity of 64% was observed, which is comparable to other series. Seventy five percent of lupus vulgaris cases, 62.2% of tuberculosis verrucosa cutis and 50% of scrofuloderma cases showed PCR positivity. Conclusion: Though useful, the cost and the technique involved limit the use of PCR in developing countries like ours.

  11. Midtrimester fetal herpes simplex-2 diagnosis by serology, culture and quantitative polymerase chain reaction. (United States)

    Curtin, William M; Menegus, Marilyn A; Patru, Maria-Magdalena; Peterson, C Jeanne; Metlay, Leon A; Mooney, Robert A; Stanwood, Nancy L; Scheible, Amy L; Dorgan, Angela


    The acquisition of herpes simplex virus (HSV) in utero comprises a minority of neonatal herpes infections. Prenatal diagnosis is rare. We describe a midtrimester diagnosis of fetal HSV-2 infection. Ultrasound at 20 weeks for elevated maternal serum α-fetoprotein (MSAFP) showed lagging fetal growth, echogenic bowel, echogenic myocardium, and liver with a mottled pattern of echogenicity. Amniocentesis demonstrated normal karyotype, elevated AFP and positive acetylcholinesterase. Culture isolated HSV-2 with an aberrant growth pattern. Maternal serology was positive for HSV-2. Quantitative DNA polymerase chain reaction (PCR) showed 59 million copies/ml. Fetal autopsy demonstrated widespread tissue necrosis but only sparse HSV-2 inclusions. Fetal HSV-2 infection can be suspected when an elevated MSAFP accompanies ultrasound findings suggesting perinatal infection. Maternal HSV serology, amniotic fluid culture and quantitative PCR are recommended for diagnostic certainty and counseling. PMID:23075531

  12. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Directory of Open Access Journals (Sweden)

    Seiki Kuramitsu


    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  13. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction. (United States)

    Alexander, H S; Key, D W; Nagy, E


    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb BamHI fragment of the Ontario 1598 ILTV strain. Thirty-four of the Ontario isolates and all of the New Brunswick isolates were amplified successfully. This suggests that the selected primers would be useful for the majority of the isolates encountered in outbreaks of ILTV. Images Figure 1. Figure 2. PMID:9442943

  14. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing. (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo


    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  15. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra


    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  16. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S


    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.


    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha


    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  18. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction. (United States)

    Bell, D A


    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  19. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction. (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng


    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  20. Rapid isolation of DNA from fresh and preserved fish scales for polymerase chain reaction. (United States)

    Yue, G H; Orban, L


    We developed a simple and inexpensive method to extract DNA from fresh and preserved fish scales. The procedure is based on boiling the scales in 5% Chelex 100, followed by digestion with proteinase K and subsequent absorption of genomic DNA using silica. A single fresh scale from larger species (e.g., tilapia) or a few scales from smaller species (e.g., 4 scales from zebrafish) provide over 200 ng of DNA, enough for at least 40 polymerase chain reaction amplifications. The procedure is applicable for DNA isolation not only from fresh and ethanol-preserved scales, but also from dried and formaldehyde-treated samples, and thus might be useful for investigating specimens stored in museums and other collections. Since the removal of a few scales is a gentle means of sample collection, this technique will allow analysis of genetic diversity, mating systems, and parentage in populations of endangered or ornamental fish with minimal experimental influence. PMID:14961356

  1. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.


    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  2. Identification of bovine material in porcine spray-dried blood derivatives using the Polymerase Chain Reaction technique

    Directory of Open Access Journals (Sweden)

    Sánchez A.


    Full Text Available Due to the widely supported theory of bovine spongiform encephalopathy (BSE spread in cattle by contaminated animal feeds, screening of feed products has become essential. For many years, manufacturers have used blood and plasma proteins as high quality ingredients of foods for both pets and farm animals. However, in Europe, the Commission Regulation 1234/2003/EC temporally bans the use of processed animal proteins, including blood-derivative products, in feedstuffs for all farm animals which are fattened or bred for the production of food. This regulation has some exceptions, such as the use of non ruminant blood products into the feed of farm fish. Authorization of the re-introduction of these proteins into animal feed formulations, especially non ruminant proteins into the feed for non ruminant farm animals, is expected when adequate control methods to discriminate ruminant proteins exist. Currently, the number of validated methods to differentiate the species of origin for most of the animal by-products is limited. Here we report the development of a rapid and sensitive polymerase chain reaction (PCR-based assay, which allows detection of bovine or porcine specific mitochondrial DNAfrom spray-dried blood derivate products (plasma, whole blood and red cells, as a marker for bovine contamination in porcine products. Sample extracts, suitable for PCR, were easily and quickly obtained with the commercial PrepManTM Ultra reagent (Applied Biosystems. To confirm the porcine origin of the samples, primers targeting a specific region of 134 bp of the porcine cytochrome b coding sequence were designed (cytbporc1-F and cytbporc2-R. Previously published PCR primers (L8129 and H8357, specific for a 271 bp fragment of the bovine mitochondrial ATPase 8-ATPase 6 genes, were chosen to accomplish amplification of bovine DNA. The limit of detection (LOD of the bovine PCR assay was at least of 0.05% (v/v of bovine inclusion in spray-dried porcine plasma or red

  3. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)


    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  4. The use of polymerase chain reaction for early diagnosis of tuberculosis in Mycobacterium tuberculosis culture

    Directory of Open Access Journals (Sweden)

    M. Chagas


    Full Text Available Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7% and specificity (60% were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

  5. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.


    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  6. Novel enzyme immunoassay and optimized DNA extraction for the detection of polymerase-chain-reaction-amplified viral DNA from paraffin-embedded tissue. (United States)

    Merkelbach, S.; Gehlen, J.; Handt, S.; Füzesi, L.


    Four different DNA extraction methods were compared to determine their ability to provide DNA for amplification of viral sequences from paraffin-embedded human tissue samples by polymerase chain reaction (PCR). The suitability of extraction methods was assessed using parameters like DNA yield, length of recovered DNA fragments, and duration. Furthermore, the efficiency of amplifying a human single-copy gene, the beta-globin gene, from DNA samples was tested. The best preservation of DNA molecules could be achieved by binding the DNA onto a silica column before further purification. Viral DNA sequences could be amplified by PCR in DNA extracted from routinely processed paraffin blocks from cases with clinically or morphologically suspected cytomegalovirus or Epstein-Barr virus infections. The PCR products were specified by a novel liquid hybridization assay called PCR-enzyme-linked immunosorbent assay. Using this assay, the time-consuming Southern hybridization could be replaced and the time requirement for the detection of PCR products could be reduced from 1 day to 4 hours. The assay system described here represents a reliable, sensitive, and specific method for the detection of viral DNA from paraffin-embedded tissue samples. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:9137080

  7. Real-time polymerase chain reaction (PCR) quantitative detection of Brassica napus using a locked nucleic acid TaqMan probe. (United States)

    Schmidt, Anna-Mary; Rott, Michael E


    Several countries have introduced mandatory labeling requirements on foods derived from genetically modified organisms. Real-time quantitative Polymerase Chain Reaction (PCR) has quickly become the method of choice in support of these regulations and requires the development of separate PCR assays targeting the transgenic sequence as well as a specific endogenous gene sequence. To develop a Brassica napus-specific PCR assay, partial sequences of the acetyl-CoA carboxylase BnACCg8 gene from B. napus and the closely related Brassica rapa were determined and compared, and a region of unique nucleotide sequence was identified. Universal amplification primers were designed to either side of this region, and a locked nucleic acid TaqMan probe was designed to the B. napus-specific sequence. Evaluation of this primer/probe combination indicated a high level of specificity to B. napus: no amplification signal was observed with any other species tested, including five closely related Brassica species. The method was assayed with 14 different B. napus cultivars, and comparable amplification curves were consistently obtained for all. The assay was highly sensitive, with a limit of detection between 1 and 10 haploid copies. Practically, the method was demonstrated to be effective for the detection of processed food samples and for the quantification of Roundup Ready canola content in mixed samples. PMID:16478231

  8. Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation. (United States)

    Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing


    In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. PMID:26853743

  9. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections

    Directory of Open Access Journals (Sweden)

    Luciene de Fátima Costa Torres


    Full Text Available Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR assay that can simultaneously identify and determine the toxigenicity of these corynebacterial species with zoonotic potential was developed. This assay uses five primer pairs targeting the following genes: rpoB (Corynebacterium spp, 16S rRNA (C. ulcerans and C. pseudotuberculosis, pld (C. pseudotuberculosis, dtxR (C. diphtheriae and tox [diphtheria toxin (DT ]. In addition to describing this assay, we review the literature regarding the diseases caused by these pathogens. Of the 213 coryneform strains tested, the mPCR results for all toxigenic and non-toxigenic strains of C . diphtheriae, C. ulcerans and C. pseudotuberculosis were in 100% agreement with the results of standard biochemical tests and PCR-DT. As an alternative to conventional methods, due to its advantages of specificity and speed, the mPCR assay used in this study may successfully be applied for the diagnosis of human and/or animal diseases caused by potentially toxigenic corynebacterial species.

  10. Analytical validation of a real-time reverse transcription polymerase chain reaction test for Pan-American lineage H7 subtype Avian influenza viruses (United States)

    Spackman, Erica; Ip, H.S.; Suarez, D.L.; Slemons, R.D.; Stallknecht, D.E.


    A real-time reverse transcription polymerase chain reaction test for the identification of the H7 subtype in North American Avian influenza viruses (AIVs) was first reported in 2002; however, recent AIV surveillance efforts in wild birds and H7 outbreaks in poultry demonstrated that the 2002 test did not detect all H7 AIVs present in North and South America. Therefore, a new test, the 2008 Pan-American H7 test, was developed by using recently available H7 nucleotide sequences. The analytical specificity of the new assay was characterized with an RNA panel composed of 19 H7 viruses from around the world and RNA from all hemagglutinin subtypes except H16. Specificity for North and South American lineage H7 viruses was observed. Assay limits of detection were determined to be between 103 and 104 gene copies per reaction with in vitro transcribed RNA, and 100.0 and 10 0.8 50% egg infectious doses per reaction. The 2008 Pan-American H7 test also was shown to perform similarly to the 2002 test with specimens from chickens experimentally exposed to A/Chicken/BritishColumbia/314514-2/04 H7N3 highly pathogenic AIV. Furthermore, the 2008 test was able to detect 100% (n = 27) of the H7 AIV isolates recovered from North American wild birds in a 2006-2007 sample set (none of which were detected by the 2002 H7 test).

  11. Leptospira spp detection by Polymerase Chain Reaction (PCR) in clinical samples of captive black-capped Capuchin monkey (Cebus apella)


    Scarcelli Eliana; Piatti Rosa Maria; Fedullo José Daniel Luzes; Simon Faiçal; Cardoso Maristela Vasconcellos; Castro Vanessa; Miyashiro Simone; Genovez Margareth Élide


    Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR), in clinical samples from one captive black...

  12. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF


    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  13. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei


    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  14. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation. (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K


    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  15. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction (United States)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant


    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  16. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip (United States)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang


    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  17. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  18. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases. (United States)

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing


    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  19. Immersion-histo polymerase chain reaction: a practical tool for visualization of single-copy genes in tissue sections.


    L. Pan; Diss, T C; Peng, H.; Isaacson, P G


    A method, immersion-histo polymerase chain reaction (IH-PCR), was developed for visualization of single-copy DNA sequences in cells in paraffin-embedded tissue sections. Sections were mounted on coverslips, cut into small pieces, and immersed in reaction mixtures in micro-tubes for specific DNA amplification using a conventional thermal cycler. This was followed by in situ hybridization, in micro-tubes, with PCR-generated, digoxigenin-labeled probes. Epstein-Barr virus, chromosomal translocat...

  20. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load


    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY


    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  1. Development of bioreporter assays for the detection of bioavailability of long-chain alkanes based on the marine bacterium Alcanivorax borkumensis strain SK2. (United States)

    Kumari, Rekha; Tecon, Robin; Beggah, Siham; Rutler, Rebecca; Arey, J Samuel; van der Meer, Jan Roelof


    Long-chain alkanes are a major component of crude oil and therefore potentially good indicators of hydrocarbon spills. Here we present a set of new bacterial bioreporters and assays that allow to detect long-chain alkanes. These reporters are based on the regulatory protein AlkS and the alkB1 promoter from Alcanivorax borkumensis SK2, a widespread alkane degrader in marine habitats. Escherichia coli cells with the reporter construct reacted strongly to octane in short-term (6 h) aqueous suspension assays but very slightly only to tetradecane, in line with what is expected from its low water solubility. In contrast, long-term assays (up to 5 days) with A. borkumensis bioreporters showed strong induction with tetradecane and crude oil. Gel-immobilized A. borkumensis reporter cells were used to demonstrate tetradecane and crude oil bioavailability at a distance from a source. Alcanivorax borkumensis bioreporters induced fivefold more rapid and more strongly when allowed physical contact with the oil phase in standing flask assays, suggesting a major contribution of adhered cells to the overall reporter signal. Using the flask assays we further demonstrated the effect of oleophilic nutrients and biosurfactants on oil availability and degradation by A. borkumensis. The fluorescence signal from flask assays could easily be captured with a normal digital camera, making such tests feasible to be carried out on, e.g. marine oil responder vessels in case of oil accidents. PMID:21895911

  2. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki [System Instruments Co., Ltd., 776-2 Komiya-cho, Hachioji, Tokyo 192-0031 (Japan); Noda, Mamoru; Igimi, Shizunobu [Division of Biomedical Food Research, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ikebukuro, Kazunori, E-mail: [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan)


    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10{sup 6} copies.

  3. Hepatitis C Prevalence in Hemodialysis Patients in Mazandaran, Iran: A Survey by Polymerase Chain Reaction and Serological Methods

    Directory of Open Access Journals (Sweden)


    Full Text Available Patients on maintenance hemodialysis are known to have an elevated risk of acquiring Hepatitis C Virus (HCV infection. The reported prevalence among hemodialysis patients in the United States ranges from 8-10% and is considerably higher in many European and Middle Eastern countries. Therefore, a reliable diagnosis of HCV infection is essential in order to prevent the spread of the disease in dialysis units. All hemodialysis patients (n = 186 were interviewed in 2 dialysis units in Imam Khomeini and Fatemeh Zahra hospitals of Sari and Valiasr hospital of Ghaemshahr city / Iran, Between June and august 2006.. Blood samples were collected and serum samples screened for anti-HCV antibodies by Enzyme-Linked Immunosorbent Assay (ELISA. Positive samples were retested for confirmation with Polymerase Chain Reaction (PCR.Statistical analysis was done by means of SPSS (11 software. A total of 186 hemodialysis patients (mean age 58.86±16.9 years were studied. Mean duration of hemodialysis was 3.07±0.3 years. Mean of SGOT and SGPT were 30.64±6 and 32.01±8, respectively. 39 (21% patients were found to be seropositive by ELISA and 12 were confirmed positive by PCR, resulting in an anti-HCV prevalence of 6.5%. association between duration of hemodialysis andHCV seropositivity was statistically significant (p = 0.0001 but there were no significant correlation between number of transfusions and HCV seropositivity. Despite the growing demand for cost-effectiveness in the health system, tight control of HCV infection by PCR and ELISA examination must remain an essential part of the routine screening in hemodialysis patients.

  4. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 106 copies

  5. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    Directory of Open Access Journals (Sweden)

    Mahmood Shishegar


    Full Text Available Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2% of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%. Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensi-tivity profile in our geographic area.

  6. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran (United States)

    Shishegar, Mahmood; Faramarzi, Abolhasan; Kazemi, Tayyebe; Bayat, Akbar; Motamedifar, Mohammad


    Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR) assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2%) of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%). Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensitivity profile in our geographic area. PMID:23115412

  7. An amplified electrochemical aptasensor based on hybridization chain reactions and catalysis of silver nanoclusters (United States)

    Chen, Ling; Sha, Liang; Qiu, Yuwei; Wang, Guangfeng; Jiang, Hong; Zhang, Xiaojun


    In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear range of 10-10 M to 10-5 M.In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear

  8. Kinetic Analysis of Some Chalcones and Synthetic Chalcone Analogues on the Fenton-Reaction Initiated Deoxyribose Degradation Assay1


    Perjési, Pál; Rozmer, Zsuzsanna


    Investigation of in vitro hydroxyl radical scavenging (antioxidant) effect 4-methoxychalcone (1a) and its cyclic analogues (2a-4a), as well as their hydroxyl substituted counterparts (1b-4b) was performed by means of the Fenton-reaction initiated deoxyribose degradation assay in short term (10 minute) and long term (240 minute) experiments. The kinetic deoxyribose method provides possibility to investigate not only the short term antioxidant (hydroxyl radical scavenger) effect but the possibl...

  9. The new possibility of the fusion p + 11B chain reaction being induced by intense laser pulses (United States)

    Belyaev, V. S.; Krainov, V. P.; Matafonov, A. P.; Zagreev, B. V.


    We discuss the experimental and theoretical principal schemes of a thermonuclear reactor, based on the fusion reaction p + 11B: beam collisions, fusion in degenerate plasmas, ignition at the plasma, particle acceleration by nonlinear ponderomotive forces and irradiation of the solid 11B target by a proton beam at the Coulomb explosion of hydrogen microdroplets. The fusion reaction p + 11B can be initiated by ultrashort high intensity laser pulses under conditions far from thermodynamic equilibrium. This may result in fusion products containing a small amount of neutrons and other nuclear radiation effects. It was found that the fusion reaction p + 11B produces further nuclear reactions and generates high-energy protons. The latter can support the chain reaction process. Our approach allows us to also investigate nuclear reactions in the early Universe and in stars.


    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen


    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  11. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao


    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  12. Optimisation of a quantitative polymerase chain reaction-based strategy for the detection and quantification of human herpesvirus 6 DNA in patients undergoing allogeneic haematopoietic stem cell transplantation

    Directory of Open Access Journals (Sweden)

    Miriam YH Ueda


    Full Text Available Human herpesvirus 6 (HHV-6 may cause severe complications after haematopoietic stem cell transplantation (HSCT. Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.

  13. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld


    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  14. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;


    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot hybrid...... where viral replication is absent, or where genomic copies are present at such low numbers that they are otherwise undetectable....

  15. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma... (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... test for Mycoplasma gallisepticum (MGLP ReTi). (a) DNA extraction. Use Qiagen Qiamp Mini Kit for...

  16. Testing vaccines in human experimental malaria: statistical analysis of parasitemia measured by a quantitative real-time polymerase chain reaction.

    NARCIS (Netherlands)

    Hermsen, C.C.; Vlas, S.J. de; Gemert, G.J.A. van; Telgt, D.S.C.; Verhage, D.F.; Sauerwein, R.W.


    Clinical trials are an essential step in evaluation of safety and efficacy of malaria vaccines, and human experimental malaria infections have been used for evaluation of protective immunity of Plasmodium falciparum malaria. In this study, a quantitative real-time polymerase chain reaction was used

  17. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;


    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR-BM). M...

  18. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;


    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  19. Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization and real-time polymerase chain reaction. (United States)

    Ha, Y; Fessehaie, A; Ling, K S; Wechter, W P; Keinath, A P; Walcott, R R


    To improve the simultaneous detection of two pathogens in cucurbit seed, a combination of magnetic capture hybridization (MCH) and multiplex real-time polymerase chain reaction (PCR) was developed. Single-stranded DNA hybridization capture probes targeting DNA of Acidovorax avenae subsp. citrulli, causal agent of bacterial fruit blotch, and Didymella bryoniae, causal agent of gummy stem blight, were covalently attached to magnetic particles and used to selectively concentrate template DNA from cucurbit seed samples. Sequestered template DNAs were subsequently amplified by multiplex real-time PCR using pathogen-specific TaqMan PCR assays. The MCH multiplex real-time PCR assay displayed a detection threshold of A. avenae subsp. citrulli at 10 CFU/ml and D. bryoniae at 10(5) conidia/ml in mixtures of pure cultures of the two pathogens, which was 10-fold more sensitive than the direct real-time PCR assays for the two pathogens separately. Although the direct real-time PCR assay displayed a detection threshold for A. avenae subsp. citrulli DNA of 100 fg/microl in 25% (1/4 samples) of the samples assayed, MCH real-time PCR demonstrated 100% detection frequency (4/4 samples) at the same DNA concentration. MCH did not improve detection sensitivity for D. bryoniae relative to direct real-time PCR using conidial suspensions or seed washes from D. bryoniae-infested cucurbit seed. However, MCH real-time PCR facilitated detection of both target pathogens in watermelon and melon seed samples (n = 5,000 seeds/sample) in which 0.02% of the seed were infested with A. avenae subsp. citrulli and 0.02% were infested with D. bryoniae. PMID:19453225

  20. Comparison of detection platforms and post-polymerase chain reaction DNA purification methods for use in conjunction with Cleavase fragment length polymorphism analysis. (United States)

    Sander, T; Olson, S; Hall, J; Siebert, M; Grooms, K; Heisler, L; de Arruda, M; Neri, B


    The removal of impurities and contaminants from PCR-amplified fragments is important for mutation detection methods which identify mutations based on shifts in electrophoretic mobility. This is particularly critical for assays and detection methods which use target DNA that is labeled prior to analysis and electrophoretic detection. We examined several procedures for purifying DNA amplified by the polymerase chain reaction (PCR) and their use in conjunction with a novel DNA scanning method, the Cleavase fragment length polymorphism (CFLP)* assay. In this study, a 480 bp DNA fragment, fluorescently labeled on the 5'-end of one strand, was amplified and subjected to various widely used purification procedures, including several commercially available clean-up kits. We demonstrate that visualization of the fluorescent label, as opposed to simple ethidium bromide staining, reveals the presence of considerable levels of labeled, truncated, amplification products. The various procedures were evaluated on the basis of their ability to remove these unwanted DNA fragments as well as on the degree to which they inhibited or promoted the CFLP reaction. Several procedures are recommended for use with CFLP analysis, including isopropanol precipitation, gel excision, and several commercially available spin columns. Concurrently, we evaluated (compared) a number of commonly used visualization platforms, including fluorescence imaging, chemiluminescence, and post-electrophoretic staining, for the ability to detect CFLP pattern changes. The advantages and disadvantages of different methods are discussed and amounts of DNA to be used for CFLP analysis on different detection platforms are recommended. PMID:10380752

  1. Modeling the Manipulation of Natural Populations by the Mutagenic Chain Reaction. (United States)

    Unckless, Robert L; Messer, Philipp W; Connallon, Tim; Clark, Andrew G


    The use of recombinant genetic technologies for population manipulation has mostly remained an abstract idea due to the lack of a suitable means to drive novel gene constructs to high frequency in populations. Recently Gantz and Bier showed that the use of CRISPR/Cas9 technology could provide an artificial drive mechanism, the so-called mutagenic chain reaction (MCR), which could lead to rapid fixation of even a deleterious introduced allele. We establish the near equivalence of this system to other gene drive models and review the results of simple models showing that, when there is a fitness cost to the MCR allele, an internal equilibrium may exist that is usually unstable. In this case, introductions must be at a frequency above this critical point for the successful invasion of the MCR allele. We obtain estimates of fixation and invasion probabilities for the appropriate scenarios. Finally, we discuss how polymorphism in natural populations may introduce sources of natural resistance to MCR invasion. These modeling results have important implications for application of MCR in natural populations. PMID:26232409

  2. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader (United States)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng


    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  3. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Directory of Open Access Journals (Sweden)

    Parvin Hassanzadeh


    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  4. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  5. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini


    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  6. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples. (United States)

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.


    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  7. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Gleichweit, Christoph; Amende, Max; Bauer, Udo; Schernich, Stefan; Höfert, Oliver; Lorenz, Michael P. A.; Zhao, Wei; Bachmann, Philipp; Papp, Christian, E-mail: [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Müller, Michael; Koch, Marcus [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Wasserscheid, Peter [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Libuda, Jörg; Steinrück, Hans-Peter [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany)


    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H{sub 12}-NEC), dodecahydro-N-propylcarbazole (H{sub 12}-NPC), and dodecahydro-N-butylcarbazole (H{sub 12}-NBC), on Pt(111) and on Al{sub 2}O{sub 3}-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al{sub 2}O{sub 3}, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC.

  8. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. (United States)

    Ote, Isabelle; Taminiau, Bernard; Duprez, Jean-Noël; Dizier, Isabelle; Mainil, Jacques G


    Staphylococcus aureus is recognized worldwide as a pathogen causing many serious diseases in humans and animals, and is the most common aetiological agent of clinical and subclinical bovine mastitis. The importance of evaluating the combination of S. aureus virulence factors has been emphasized both in human and veterinary medicine, and knowledge about the genetic variability within different S. aureus populations would help in the design of efficient treatments. The aim of the present study was to determine the genetic profiles of S. aureus strains isolated from milk of cows suffering from clinical and subclinical mastitis in Belgium. The presence of about forty virulence-associated genes was investigated by specific polymerase chain reaction (PCR) amplification. A high number of genotypic subtypes were observed, demonstrating further the large variation in the presence of virulence genes in S. aureus isolates and the considerable diversity of strains populations that are able to cause mastitis in cows. In accordance with other studies, we showed that some genes are associated with mastitis-causing S. aureus isolates, whereas others are absent or rarely present. We also further highlighted the presence of conserved gene combinations, namely the enterotoxigenic egc-cluster and the bovine pathogenicity island SaPIbov. Importantly, the presence of isolates carrying genes coding for toxins involved in important human infections makes the milk of cows with mastitis a potential reservoir for these toxins, and therefore a potential danger in human health, which strengthens the importance to consider raw milk consumption and its processing very carefully. PMID:21708435

  9. Detection of bovine leukemia virus in cattle by the polymerase chain reaction. (United States)

    Murtaugh, M P; Lin, G F; Haggard, D L; Weber, A F; Meiske, J C


    Bovine leukemia virus (BLV) is widely distributed in U.S. cattle herds. It infects B lymphocytes and causes neoplastic disease in 5-10% of infected animals. Direct economic losses are incurred as a result of death, reduced milk production and condemnation at slaughter. Thus the identification of cattle infected with BLV is of significant concern to the U.S. cattle industry. For this reason, polymerase chain reaction (PCR) amplification was used to examine seropositive and seronegative cattle for the presence of BLV DNA in peripheral blood mononuclear cells. Using an amplification protocol able to detect 1 viral genome in 100,000 cells, BLV was not detected in 7 seronegative cattle in an infected herd. BLV sequences were detected in 13 of 18 seropositive animals with various levels of infection as determined by in vitro lymphocyte culture and electron microscopy. An active infection was demonstrated in one animal, based on the presence of viral RNA. These findings indicate that PCR is a sensitive method for the detection of BLV in cattle and provides new information regarding the dynamics of the infection. PMID:1658030

  10. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism. (United States)

    Souza, M T; Carvalho-Zilse, G A


    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  11. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction. (United States)

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E


    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  12. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics (United States)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David


    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  13. Polymerase chain reaction for detection of herpesvirus simiae (B virus) in clinical specimens. (United States)

    Slomka, M J; Brown, D W; Clewley, J P; Bennett, A M; Harrington, L; Kelly, D C


    A polymerase chain reaction (PCR) was designed which is specific to Macaca fascicularis (cynomolgus monkey) isolates of B virus. The PCR primers produced the expected 188 basepair product from the Cyno 2 strain and seven other cynomolgus monkey isolates of B virus. Oligomer hybridization with a 31-mer oligonucleotide was used to confirm the origin of this product. The PCR failed to amplify DNA of Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, and other alphaherpesviruses (herpes simplex virus types 1 and 2, four SA 8 isolates and three rhesus isolates of B virus). PCR testing of swabs obtained from four orally-infected cynomolgus monkeys confirmed the presence of B virus DNA in samples previously shown to be positive by culture. In addition, PCR detected B virus in several swabs from infected monkeys that were culture negative. Total DNA extracts from the trigeminal and sacral ganglia of these animals were tested by nested PCR and B virus DNA was detected in the trigeminal ganglia of 3 of the 4 orally-infected cynomolgus monkeys. Nested PCR did not detect B virus DNA in total DNA extracts obtained from the brains of the four monkeys. PMID:8392323

  14. Trends and advances in food analysis by real-time polymerase chain reaction. (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin


    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185


    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿


    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  16. Polymerase chain reaction amplification of a GC rich region by adding 1,2 propanediol

    Directory of Open Access Journals (Sweden)

    Zeinab Mousavian


    Full Text Available Background : Apolipoprotein E (ApoE is one of the most important carriers of lipids in mammalians. The gene for this lipoprotein (ApoE is located on chromosome 19 which is related with the pathogenesis of some nervous system disease. ApoE gene is identified as a high guanine-cytosine (GC content fragment. Detection and amplification of these templates are extensively laborious and baffling. The aim of this study was to find a practical and feasible method for the amplification of the number of GC rich genes such as ApoE. Materials and Methods: We experimented with simple polymerase chain reaction (PCR, nested PCR and PCR with 1-2 propanediol, dimethylsulfoxide (DMSO, and ethyleneglicol as additive substances to enhance the amplification ApoE gene and used the 40 samples of the human whole blood were collected in test tubes with a pre-treatment of ethylene diaminetetraacetic acid. Results: According to our observations, presence of 1-2 propanediol, DMSO, and ethyleneglicol as additive substances resulted to enhanced amplification of ApoE gene. Addition of 1-2 propanediol showed the best results, caused optimization and revealed more specific and sharp bands. Conclusion: According to our findings 1-2 propanediol are the best organic reagent for improving the amplification of ApoE gene. Optimization procedure for each GC rich sequence is recommended to be performed separately in order to identify which of the additive agent is more efficient and applicable for a particular target.

  17. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail:; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)


    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  18. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan


    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  19. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    International Nuclear Information System (INIS)

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H12-NEC), dodecahydro-N-propylcarbazole (H12-NPC), and dodecahydro-N-butylcarbazole (H12-NBC), on Pt(111) and on Al2O3-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al2O3, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC

  20. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    International Nuclear Information System (INIS)

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

  1. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota


    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  2. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Directory of Open Access Journals (Sweden)

    Lei Zhang


    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  3. Evaluation of a rapid polymerase chain reaction based identification technique for Vibrio cholerae isolates. (United States)

    le Roux, W J; Masoabi, D; de Wet, C M E; Venter, S N


    Rapid and accurate identification of waterborne pathogens, such as Vibrio cholerae, in drinking-water sources is important to enable effective resource management and public health protection. Phenotypic systems currently being used for the identification of Vibrio cholerae isolates are time-consuming and the need exists for the development of suitable molecular techniques that can offer both fast and reliable identification. During this study, isolates identified as Vibrio cholerae by means of two different biochemical test systems (API 20E and VITEK 32) were analysed with the polymerase chain reaction (PCR) to compare the reliability of the various identification systems. The selected PCR technique amplified a sequence within the outer membrane protein of Vibrio cholerae, a gene specific for V. cholerae. It was found that out of 243 isolates biochemically identified as V. cholerae with either the API or VITEK system, 21 isolates did not give a positive result with the PCR detection method. Sequencing the 16S rDNA of more than half of these isolates and comparison of the sequences with Internet databases indicated that most of the isolates belonged to the genus Aeromonas. The results indicated that the rapid PCR procedure was more accurate than the API or VITEK systems currently being used for the phenotypic identification of Vibrio cholerae isolates. PMID:15318514

  4. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  5. Improving Nuclear Safety of Fast Reactors by Slowing Down Fission Chain Reaction

    Directory of Open Access Journals (Sweden)

    G. G. Kulikov


    Full Text Available Light materials with small atomic mass (light or heavy water, graphite, and so on are usually used as a neutron reflector and moderator. The present paper proposes using a new, heavy element as neutron moderator and reflector, namely, “radiogenic lead” with dominant content of isotope 208Pb. Radiogenic lead is a stable natural lead. This isotope is characterized by extremely low micro cross-section of radiative neutron capture (~0.23 mb for thermal neutrons, which is smaller than graphite and deuterium cross-sections. The reflector-converter for a fast reactor core is the structure capable of transforming some part of prompt neutrons leaked from the core into the reflected neutrons with properties similar to those of delayed neutrons, that is, sufficiently large contribution to reactivity at the level of effective fraction of delayed neutrons and relatively long lifetime, comparable with lifetimes of radionuclides-emitters of delayed neutrons. It is evaluated that the use of radiogenic lead makes it possible to slow down the chain fission reaction on prompt neutrons in the fast reactor. This can improve the fast reactor safety and reduce some requirements to the technologies used to fabricate fuel for the fast reactor.

  6. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas


    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  7. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis. (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T


    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  8. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  9. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu


    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  10. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples. (United States)

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H


    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  11. GSH2 promoter methylation in pancreatic cancer analyzed by quantitative methylation-specific polymerase chain reaction (United States)



    Tumor suppressor gene silencing via promoter hypermethylation is an important event in pancreatic cancer pathogenesis. Aberrant DNA hypermethylation events are highly tumor specific, and may provide a diagnostic tool for pancreatic cancer patients. The objective of the current study was to identify novel methylation-related genes that may potentially be used to establish novel therapeutic and diagnostic strategies against pancreatic cancer. The methylation status of the GS homeobox 2 (GSH2) gene was analyzed using the sodium bisulfite sequencing method. The GSH2 methylation ratio was examined in primary carcinomas and corresponding normal tissues derived from 47 patients with pancreatic cancer, using quantitative methylation-specific polymerase chain reaction. Methylation ratios were found to be associated with the patient's clinicopathological features. GSH2 gene methylation was detected in 26 (55.3%) of the 47 pancreatic cancer patients, indicating that it occurs frequently in pancreatic cancer. A significant association with methylation was observed for tumor-node-metastasis stage (P=0.031). GSH2 may be a novel methylation-sensitive tumor suppressor gene in pancreatic cancer and may be a tumor-specific biomarker of the disease. PMID:26171036

  12. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    Institute of Scientific and Technical Information of China (English)

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan


    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  13. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms

    Directory of Open Access Journals (Sweden)

    Lars Gerdes


    The droplet separation value allows for easy and reproducible assay performance evaluation. The combination of separation value with the experience matrix simplifies the choice of adequate assay parameters for a given GMO event.

  14. Platypus chain reaction: directional and ordered meiotic pairing of the multiple sex chromosome chain in Ornithorhynchus anatinus. (United States)

    Daish, Tasman; Casey, Aaron; Grützner, Frank


    Monotremes are phylogenetically and phenotypically unique animals with an unusually complex sex chromosome system that is composed of ten chromosomes in platypus and nine in echidna. These chromosomes are alternately linked (X1Y1, X2Y2, ...) at meiosis via pseudoautosomal regions and segregate to form spermatozoa containing either X or Y chromosomes. The physical and epigenetic mechanisms involved in pairing and assembly of the complex sex chromosome chain in early meiotic prophase I are completely unknown. We have analysed the pairing dynamics of specific sex chromosome pseudoautosomal regions in platypus spermatocytes during prophase of meiosis I. Our data show a highly coordinated pairing process that begins at the terminal Y5 chromosome and completes with the union of sex chromosomes X1Y1. The consistency of this ordered assembly of the chain is remarkable and raises questions about the mechanisms and factors that regulate the differential pairing of sex chromosomes and how this relates to potential meiotic silencing mechanisms and alternate segregation. PMID:19874721

  15. Diagnosis of. alpha. sub 1 -antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products

    Energy Technology Data Exchange (ETDEWEB)

    Newton, C.R.; Graham, A.; Powell, S.; Gammack, A.; Riley, J.; Markham, A.F. (ICI Diagnostics, Cheshire (England)); Kalsheker, N. (Univ. of Wales, Cardiff (Wales))


    The authors have compared sequencing of cloned polymerase chain reaction (PCR) products and the direct sequencing of PCR products in the examination of individuals from six families affected with {alpha}{sub 1}-antitrypsin (AAT) deficiency. In families where paternity was in question they confirmed consanguinity by DNA fingerprinting using a panel of locus-specific minisatellite probes. They demonstrate that direct sequencing of PCR amplification products is the method of choice for the absolutely specific diagnosis of AAT deficiency and can distinguish normals, heterozygotes and homozygotes in a single, rapid and facile assay. Furthermore, they demonstrate the reproducibility of the PCR and a rapid DNA isolation procedure. They have also shown that two loci can be simultaneously amplified and that the PCR product from each locus can be independently examined by direct DNA sequencing.

  16. Molecular diagnosis of eosinophilic meningitis due to Angiostrongylus cantonensis (Nematoda: Metastrongyloidea by polymerase chain reaction-DNA sequencing of cerebrospinal fluids of patients

    Directory of Open Access Journals (Sweden)

    Praphathip Eamsobhana


    Full Text Available Cerebrospinal fluid (CSF samples from clinically diagnosed patients with detectable Angiostrongylus canto-nensis-specific antibodies (n = 10, patients with clinically suspected cases that tested negative for A. cantonensis-an-tibodies (n = 5 and patients with cerebral gnathostomiasis (n = 2 and neurocysticercosis (n = 2 were examined by a single-step polymerase chain reaction (PCR method using the AC primers for the 66-kDa native protein gene. The PCR method detected A. cantonensis DNA in CSF samples from four of 10 serologically confirmed angiostrongyliasis cases. The PCR results were negative for the remaining CSF samples. The nucleotide sequences of three positive CSF-PCR samples shared 98.8-99.2% similarity with the reference sequence of A. cantonensis. These results indicate the potential application of this PCR assay with clinical CSF samples for additional support in the confirmation of eosinophilic meningitis due to A. cantonensis.

  17. Development of bioreporter assays for the detection of bioavailability of long chain alkanes based on the marine bacterium Alcanivorax borkumensis strain SK2


    Kumari, Rekha; Tecon, Robin; Beggah, Siham; Rutler, Rebecca; Arey, J. Samuel; van der Meer, Jan Roelof


    Long-chain alkanes are a major component of crude oil and therefore potentially good indicators of hydrocarbon spills. Here we present a set of new bacterial bioreporters and assays that allow to detect long-chain alkanes. These reporters are based on the regulatory protein AlkS and the alkB1 promoter from Alcanivorax borkumensis SK2, a widespread alkane degrader in marine habitats. Escherichia coli cells with the reporter construct reacted strongly to octane in short-term (6 h) aqueous suspe...

  18. A Theoretical Investigation on the Reaction Mechanism of the C8H+·10 Side-Chain Decomposition Processes

    Institute of Scientific and Technical Information of China (English)

    CHENG Xue-Li; ZHAO Yan-Yun; LI Feng


    The dissociation of ethylbenzene cation C8H+·10 served as a prototype to investigate the decompasition mechanisms of alkylbenzene cations.The reactions of C8H+·10 decomposition reaction system have been studied extensively at the B3L YP/6-311++G** level with Gaussion 98 package.The chain reaction of C8H+·10 dissociation is initiated by C-H bond rupture.All reaction channels were fully investigated with the vibrational mode analysis to confirm the transition states and reveal the reaction mechanism.The energetically most favorable pathway is C8H+·10→TS4→·P2+H· and the channel ieading to C8H+·10 and C2H4 is also competitive.

  19. Stereoselective synthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-ulose via autoxidation reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Hong-Min; ZHANG Fuyi; TAO Jing-Chao


    Many different approaches for synthesis of branched chain sugars have beenestablished,1 because they are very useful intermediates for synthesis of other non-sugar chiralmolecules, and usually occur in nature. Branched chain glycosidulose can be used for construction offive- and six-membered carbocyclic rings to which two chiral carbons of sugar are incorporated byintramolecular aldol condensation and Robinson annulation,2 Therefore they are useful in thesynthesis of natural products which consist of annulated carbohydrates or where a highlyfunctionalised enantiomerically pure cyclopentane or cyclohexane is required. Also, this type ofbranched chain sugar can be considered as the synthons of monoterpenoid natural products of theiridoid class which have the cyclopentan-(c)-pyran structure. In view of the importance of branchedchain glycosiduloses, it is desirable to have a general, convenient methodology to their synthesis.However, none of the literature methods was reported on their synthesis by a nuclephilic addition toa partially protected glycosidulose, due to the fact that these glycosiduloses are very difficult tosynthesize selectively and unstable;3 and what is more, one-step synthesis branched chainglycosidulose using this method is almost impossible.In this paper, we report on a general, convenient method for stereoselective syntheses of2,2-bis(C-branched-chain)glucopyranosid-3-uloses by the new reaction of 1 with various activemethylene compounds. The generality of this method was examined in detail. The optimumtemperature was 18-25℃. The solvent DMF was better than the others. In all cases he yields werehigher than 60%.All the 2,2-bis(C-branched-chain)glucopyranosid-3-uloses were characterized by X-raycrystallographic analyses. In addition, the important iintermediate in this reaction was isolated,which is the product of autoxidation of 1 at C-3 position. Thus the reaction mechanism for thesynthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-uloses

  20. High throughput microwell spectrophotometric assay for olmesartan medoxomil in tablets based on its charge-transfer reaction with DDQ

    Directory of Open Access Journals (Sweden)

    Darwish Ibrahim A.


    Full Text Available The study describes the development and validation of a new microwell-based spectrophotometric assay for determination of olmesartan medoxomil (OLM in tablets. The formation of a colored charge-transfer (CT complex between OLM as an n-electron donor and 2,3-dichloro- -5,6-dicyano-1,4-benzoquinone (DDQ as a p-electron acceptor was investigated, and employed as the basis for the development of the new assay. The proposed assay was conducted in 96-microwell plates. The absorbance of the colored-CT complex was measured at 460 nm with a microplate reader. Optimum conditions of the reaction and the analytical procedures of the assay were established. Under the optimum conditions, a linear relationship with a good correlation coefficient was found between the absorbance and the concentration of OLM in the range of 2-200 μg per well. The limits of detection and quantitation were 0.53 and 1.61 μg per well, respectively. No interference was observed from the excipients present in OLM tablets or from hydrochlorothiazide and amlodipine besylate that were co-formulated with OLM in some of its formulations. The assay was successfully applied to the analysis of OLM in tablets with good accuracy and precision. The assay described herein has a great practical value in the routine analysis of OLM in quality control laboratories, since it has a high throughput property and consumes low volumes of organic solvent. It thus offers a reduction in the exposure of analysts to the toxic effects of organic solvents, as well as a reduction in the cost of analysis.

  1. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods (United States)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.


    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  2. Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

  3. Relevance of semen polymerase chain reaction positive for tuberculosis in asymptomatic men undergoing infertility evaluation

    Directory of Open Access Journals (Sweden)

    Subodh Kumar Regmi


    Full Text Available OBJECTIVE: Male partners of infertile women with genital tuberculosis (TB are often screened for genital TB. We aimed to evaluate the clinical significance of a positive screening semen polymerase chain reaction (PCR for Mycobacterium tuberculosis test (TB-PCR in asymptomatic men undergoing infertility evaluation and determine the need for a detailed investigation and treatment for TB. MATERIALS AND METHODS: Between March 2012 and January 2013, male partners of 15 infertile women with a diagnosis of genitourinary TB (GUTB as the cause of infertility, tested positive either on semen PCR for TB (13 cases, or Mycobacterium Growth Indicator Tube-960 test (2 cases. These asymptomatic men underwent infertility evaluation along with evaluation for GUTB. Diagnosis of GUTB was based on standard clinical criteria, which included a high index of suspicion along with clinical, laboratory, and/or radiological evidence of GUTB. Men who had no clinical evidence of GUTB were followed up with clinical evaluation, semen analysis, and repeat semen PCR for TB after 6 months. RESULTS: Fourteen subjects consented for inclusion in the study. One had a history of pulmonary TB 20 years earlier. Another patient was found to have mediastinal lymphadenopathy (tubercular. All except one had a normal semen analysis. None of the patients met the standard clinical criteria for GUTB diagnosis. 8 patients followed up at 6 months with repeat semen analysis, which was similar to the baseline values and no clinical evidence of TB. INTERPRETATION AND CONCLUSIONS: Asymptomatic men with positive screening semen PCR for TB do not have clinical evidence of TB. Male partners of women with infertility and GUTB should not be screened if they have no symptoms.

  4. Use of polymerase chain reaction in the diagnosis of Whipple's disease. (United States)

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi


    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight. PMID:26390825

  5. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Directory of Open Access Journals (Sweden)

    Grace Q. Chen


    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.

  6. Human von Willebrand factor gene and pseudogene: Structural analysis and differentiation by polymerase chain reaction

    International Nuclear Information System (INIS)

    Structural analysis of the von Willebrand factor gene located on chromosome 12 is complicated by the presence of a partial unprocessed pseudogene on chromosome 22q11-13. The structures of the von Willebrand factor pseudogene and corresponding segment of the gene were determined, and methods were developed for the rapid differentiation of von Willebrand factor gene and pseudogene sequences. The pseudogene is 21-29 kilobases in length and corresponds to 12 exons (exons 23-34) of the von Willebrand factor gene. Approximately 21 kilobases of the gene and pseudogene were sequenced, including the 5' boundary of the pseudogene. The 3' boundary of the pseudogene lies within an 8-kb region corresponding to intron 34 of the gene. The presence of splice site and nonsense mutations suggests that the pseudogene cannot yield functional transcripts. The pseudogene has diverged ∼3.1% in nucleotide sequence from the gene. This suggests a recent evolutionary origin ∼19-29 million years ago, near the time of divergence of humans and apes from monkeys. Several repetitive sequences were identified, including 4 Alu, one Line-1, and several short simple sequence repeats. Several of these simple repeats differ in length between the gene and pseudogene and provide useful markers for distinguishing these loci. Sequence differences between the gene and pseudogene were exploited to design oligonucleotide primers for use in the polymerase chain reaction to selectivity amplify sequences corresponding to exons 23-34 from either the von Willebrand factor gene or the pseudogene. This method is useful for the analysis of gene defects in patients with von Willebrand disease, without interference from homologous sequences in the pseudogene

  7. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Jong Gyun Ahn


    Full Text Available &lt;B&gt;Purpose:&lt;/B&gt; Methods for quick and reliable detection of &lt;I&gt;Streptococcus pneumoniae&lt;/I&gt; are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving &lt;I&gt;S. pneumoniae -positive&lt;/i&gt; results. &lt;B&gt;Methods:&lt;/B&gt; Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. &lt;B&gt;Results:&lt;/B&gt; Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. &lt;B&gt;Conclusion:&lt;/B&gt; As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  8. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine

    Directory of Open Access Journals (Sweden)

    K.R. Caleffi


    Full Text Available Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT and dapsone, rifampicin and clofazimine for borderline (BB and lepromatous (LL forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73 of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306. In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386. PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033. Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  9. Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127. (United States)

    Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao


    For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products. PMID:22087473

  10. Chain extension and branching of poly(L-lactic acid produced by reaction with a DGEBA-based epoxy resin

    Directory of Open Access Journals (Sweden)


    Full Text Available Dicarboxylated poly(L-lactic acid (PLLA was synthesized by reacting succinic anhydride with L-lactic acid prepolymer prepared by melt polycondensation. PLLA and epoxy resin based on diglycidyl ether of bisphenol A (DGEBA copolymers were prepared by chain extension of dicarboxylated PLLA with DGEBA. Infrared spectra confirmed the formation of dicarboxylated PLLA and PLLA/DGEBA copolymer. Influences of reaction temperature, reaction time, and the amount of DGEBA on the molecular weight and gel content of PLLA/DGEBA copolymer were studied. The viscosity average molecular weight of PLLA/DGEBA copolymer reached 87 900 when reaction temperature, reaction time, and mol ratio of dicarboxylated PLLA to DGEBA is 150°C, 30 min, and 1:1 respectively, while gel content of PLLA/DGEBA copolymer is almost zero.

  11. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu


    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  12. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in wetlands, western Kenya: confirmation by polymerase chain reaction method. (United States)

    Ohba, Shin-Ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; Sonye, Gorge; Minakawa, Noboru; Takagi, Masahiro


    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  13. Hematobiochemical alterations and direct blood polymerase chain reaction detection of Theileria annulata in naturally infected crossbred cows

    Directory of Open Access Journals (Sweden)

    Anita Ganguly


    Full Text Available Aim: The aim was to determine hemato-biochemical changes and rapid diagnosis of Theileria annulata in naturally infected crossbred cows. Materials and Methods: Blood samples from lactating crossbred cows (n=40 between 3 and 7 years of age and showing clinical signs of tropical theileriosis were collected, with or without anticoagulant, and analyzed for tropical theileriosis by direct smear, direct blood polymerase chain reaction (PCR detection of merozoite-piroplasm surface antigen (Tams1 gene specific amplicon, estimation of hematological and biochemical parameters. Healthy crossbred cows (n=6, examined free from hemoprotozoan infections were included as control. Results: The infected crossbred cows revealed significantly (p<0.001 lower values of total erythrocytic counts (4.46±0.2× 106/μL, hemoglobin (Hb 6.025±0.39 g%, packed cell volume (17.05±1.1%, mean corpuscular volume (37.94±1.70 fL and mean corpuscular Hb (13.5±0.48 pg; p<0.002 compared with healthy control. The serum samples of infected cows revealed profound (p<0.05 hyponatremia (Na 133.21±2.36 mEq/l and hypocalcemia (Ca 8.39±0.34 mg%. Infected crossbred cows showed a significant increase (p<0.05 of mean serum activity of alanine aminotransferase (61.45±13.36 U/L, aspartate aminotransferase (146.1±20.97 U/L, blood urea nitrogen (28.26±3.90 mg%, creatinine (1.55±0.13 mg%, direct bilirubin (0.33±0.04 mg%; p<0.001 and lactate dehydrogenase (3001.32±167.0 U/L; p<001. Blood direct PCR revealed a 721-bp fragment amplified from the target gene encoding 30-kDa major merozoite surface antigen of T. annulata using specific primer pairs. This assay was positive for all the infected animals. Conclusion: The assessments of hemato-biochemical parameters in T. annulata infected crossbred cows may be useful in understanding disease pathogenesis, prognosis and corrective measures for supportive therapy. Moreover, blood direct PCR can reliably be used for rapid detection of T. annulata

  14. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard;


    . However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

  15. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade


    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  16. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction


    P. D. Luka; A. R. Jambol; B. Yakubu


    Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT) remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR) depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction ...

  17. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura


    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  18. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh


    T. M. Nabeel Muhammad; Sreedevi, B.


    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasa...

  19. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase


    Diaz, R S; Sabino, E. C.


    For certain applications of the polymerase chain reaction (PCR), it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq) DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We use...

  20. Viral etiology of respiratory infections in children in southwestern Saudi Arabia using multiplex reverse-transcriptase polymerase chain reaction


    Al-Ayed, Mohamed S.; Asaad, Ahmed M; Qureshi, Mohamed A.; Ameen, Mohammed S.


    Objectives: To investigate 15 respiratory viruses in children with acute respiratory tract infections (ARTIs) using multiplex reverse-transcriptase polymerase chain reaction (RT-PCR), and to analyze the clinical and epidemiological features of these viruses. Methods: In a cross-sectional study, 135 children, ≤5 years of age who presented with ARTIs in Najran Maternity and Children Hospital, Najran, Saudi Arabia between October 2012 and July 2013 were included. The clinical and sociodemographi...