WorldWideScience

Sample records for chain reaction analysis

  1. Chain reaction

    International Nuclear Information System (INIS)

    Balogh, Brian.

    1991-01-01

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  2. Critical analysis: use of polymerase chain reaction to diagnose leprosy

    Directory of Open Access Journals (Sweden)

    Flaviane Granero Maltempe

    Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

  3. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

    2003-01-01

    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  4. Polyneutron Chain Reactions

    International Nuclear Information System (INIS)

    John C. Fisher

    2000-01-01

    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of ∼60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N≥12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between 16 O and A Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound 16 O A Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the 16 O and A Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of A Nt is prevented by the buildup of Coulomb energy associated with transforming A Nt into A H in close proximity to 16 O. Thus, it is possible that 16 O A Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the A Nt component can tunnel to an adjacent nucleus, and if the adjacent nucleus is 18 O, a

  5. The first nuclear chain reaction

    International Nuclear Information System (INIS)

    Zinn, W.H.

    1989-01-01

    The author offers his recollections of the experimental efforts beginning in 1939 which culminated in the Chain Reaction in the squash court on December 2, 1942. Recalled are Columbia University experiments which did much to establish the feasibility of the chain in natural uranium and which stimulated the creation of the Manhattan District. The Columbia group moved to the University of Chicago, where, in early summer of 1942, construction and analysis of a number of subcritical reactors (piles) gave assurance with a high probability that only a reasonable amount of uranium and moderator would be required

  6. Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

    Science.gov (United States)

    Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

    2013-01-01

    Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

  7. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

    Science.gov (United States)

    Ririe, K M; Rasmussen, R P; Wittwer, C T

    1997-02-15

    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  8. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti

    2011-01-01

    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  9. Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.

    Science.gov (United States)

    Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay

    2018-01-10

    Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.

  10. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO

    1993-01-01

    reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...

  11. Supply chain reaction

    International Nuclear Information System (INIS)

    Snieckus, Darius

    2000-01-01

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  12. Fusion chain reaction - a chain reaction with charged particles

    International Nuclear Information System (INIS)

    Peres, A.; Shvarts, D.

    1975-01-01

    When a DT-plasma is compressed to very high density, the particles resulting from nuclear reactions give their energy mostly to D and T ions, by nuclear collisions, rather than to electrons as usual. Fusion can thus proceed as a chain reaction, without the need of thermonuclear temperatures. In this paper, we derive relations for the suprathermal ion population created by a fusion reaction. Numerical integration of these equations shows that a chain reaction can proceed in a cold infinite DT-plasma at densities above 8.4x10 27 ions.cm -3 . Seeding the plasma with a small amount of 6 Li reduces the critical density to 7.2x10 27 ions.cm -3 (140000times the normal solid density). (author)

  13. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    Science.gov (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

  14. Evaluation of the LTQ-Orbitrap mass spectrometer for the analysis of polymerase chain reaction products.

    Science.gov (United States)

    Manduzio, Hélène; Ezan, Eric; Fenaille, François

    2010-12-30

    We have investigated the potential and robustness of the off-line coupling of polymerase chain reaction (PCR) with electrospray ionization mass spectrometry (ESI-MS), for further applications in the screening of single-nucleotide polymorphisms (SNPs). This was based on recently reported data demonstrating that anion-exchange solid-phase extraction was the most efficient technique for efficiently desalting PCR products, with a recovery of ∼70%. Results showed that this purification approach efficiently removes almost all the chemicals commonly added to PCR buffers. ESI-MS analysis of a model 114-bp PCR product performed on the LTQ-Orbitrap instrument demonstrated that detection limits in the nM range along with an average mass measurement uncertainty of 9.15 ± 7.11 ppm can be routinely obtained using an external calibration. The PCR/ESI-MS platform was able to detect just a few copies of a targeted oligonucleotide. However, it was shown that if two PCR products are present in a mixture in a ratio higher than 10 to 1, the lower abundance one might not be reproducibly detected. Applications to SNPs demonstrated that an LTQ-Orbitrap with a resolution of 30 000 (at m/z 400) easily identified a single (A ↔ G) switch, i.e. a 16 Da difference, in binary mixtures of ∼ 35 kDa PCR products. Complementary experiments also showed that the combination of endonucleases and ESI-MS could be used to confirm base composition and sequence, and thus to screen for unknown polymorphisms in specific sequences. For example, a single (T ↔ A) switch (9 Da mass difference) was successfully identified in a 114-bp PCR product. Copyright © 2010 John Wiley & Sons, Ltd.

  15. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    International Nuclear Information System (INIS)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

    1990-01-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

  16. Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

    OpenAIRE

    ÖZKUL, Aykut

    2002-01-01

    In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

  17. Thermally multiplexed polymerase chain reaction.

    Science.gov (United States)

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  18. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  19. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  20. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard

    2015-01-01

    Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...

  1. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    Science.gov (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  2. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  3. Chain chemical reactions during matrix devitrification

    International Nuclear Information System (INIS)

    Barkalov, I.M.

    1980-01-01

    Investigation results of chain reaction mechanisms, proceeding at devitrification of glass-like matrices under the effect of γ-irradiation are summarized. Peculiarities of kinetics and mechanism of chain reactions proceeding at devitrification are considered: hydrocarbon chlorination, polymerization of vinyl monomers, copolymerization and graft polymerization. Possible application aspects of the chain reaction conducting during matrix devitrification are also considered

  4. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  5. Clonality assessment of lymphoproliferative lesions using the polymerase chain reaction: An analysis of two methods

    Directory of Open Access Journals (Sweden)

    Nikhil Moorchung

    2011-01-01

    Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.

  6. Cost analysis of real-time polymerase chain reaction microbiological diagnosis in patients with septic shock.

    Science.gov (United States)

    Alvarez, J; Mar, J; Varela-Ledo, E; Garea, M; Matinez-Lamas, L; Rodriguez, J; Regueiro, B

    2012-11-01

    Antibiotic treatment for septic shock is generally prescribed on an empirical basis using broad-spectrum antibiotics. Molecular diagnostic techniques can detect the presence of microbial DNA in blood within a few hours and facilitate early, targeted treatment. The aim of this study was to evaluate the economic impact of a real-time polymerase chain reaction technique, LightCycler SeptiFast (LSC), in patients with sepsis. A cost-minimisation study was carried out in patients admitted with a diagnosis of severe sepsis or septic shock to the intensive care unit of a university hospital. The stay in the intensive care unit, hospital admission, 28-day and six-month mortality, and the economic cost of the clinical process were also evaluated. The study involved 48 patients in the LSC group and 54 patients in the control group. The total cost was €42,198 in the control group versus €32,228 in the LCS group with statistically significant differences (P average net saving of €9970 per patient. The mortality rate was similar in both groups. The main finding of this study was the significant economic saving afforded by the use of the LCS technique, due to the shortening of intensive care unit stay and the use of fewer antibiotics.

  7. Analysis of hepcidin expression: in situ hybridization and quantitative polymerase chain reaction from paraffin sections.

    Science.gov (United States)

    Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi

    2012-07-28

    To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  8. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    Science.gov (United States)

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

  9. Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

    Science.gov (United States)

    Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

    2011-12-01

    Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

  10. Method of identification of unbranched chain reaction with cross termination of chain

    International Nuclear Information System (INIS)

    Poluehktov, V.A.; Begishev, I.R.

    1977-01-01

    Gas-phase chlorination of unsymmetrical difluoroethane initiated by gamma quanta of Co 60 has been studied. At decreased temperatures the only hydrogen is replaced by a chlorine atom. Over a wide range of ratios of the initial reagents, the reaction occurs with a chain rupture. An analysis of the kinetics of such a reaction provides a method for identification of an unbranched chain reaction with a cross-rupture of the chain

  11. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    Science.gov (United States)

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. The value of routine polymerase chain reaction analysis of intraocular fluid specimens in the diagnosis of infectious posterior uveitis.

    Science.gov (United States)

    Scheepers, Marius A; Lecuona, Karin A; Rogers, Graeme; Bunce, Catey; Corcoran, Craig; Michaelides, Michel

    2013-01-01

    To assess the value of routine polymerase chain reaction (PCR) analysis on intraocular fluid from patients presenting with a first episode of suspected active infectious posterior uveitis in a population with a high prevalence of human immunodeficiency virus infection. Retrospective, interventional case series. Participants. 159 consecutive patients presenting at a tertiary care hospital over a five-year period. PCR analysis was performed for cytomegalovirus, varicella zoster virus, herpes simplex virus types 1 and 2, Toxoplasma gondii, and Mycobacterium tuberculosis. PCR analysis confirmed the initial clinical diagnosis in 55 patients (35%) and altered the initial clinical diagnosis in 36 patients (23%). The clinical diagnosis prior to PCR testing was nonspecific (uncertain) in 51 patients (32%), with PCR providing a definitive final diagnosis in 20 of these patients (39%); necrotizing herpetic retinopathy and ocular toxoplasmosis were particularly difficult to diagnose correctly without the use of PCR analysis. The clinical phenotype alone was unreliable in diagnosing the underlying infectious cause in a quarter of patients in this study. Since the outcome of incorrectly treated infective uveitis can be blinding, PCR analysis of ocular fluids is recommended early in the disease even in resource poor settings.

  13. Polymerase chain reaction analysis for viruses in paraffin-embedded myocardium from dogs with dilated cardiomyopathy or myocarditis.

    Science.gov (United States)

    Maxson, T R; Meurs, K M; Lehmkuhl, L B; Magnon, A L; Weisbrode, S E; Atkins, C E

    2001-01-01

    To perform polymerase chain reaction (PCR) analysis on paraffin-embedded myocardium from dogs with dilated cardiomyopathy (DCM) and dogs with myocarditis to screen for canine parvovirus, adenovirus types 1 and 2, and herpesvirus. Myocardial specimens from 18 dogs with an antemortem diagnosis of DCM and 9 dogs with a histopathologic diagnosis of myocarditis were evaluated. Paraffin-embedded myocardial specimens were screened for viral genome by PCR analysis. Positive-control specimens were developed from cell cultures as well as paraffin-embedded tissue specimens from dogs with clinical and histopathologic diagnoses of viral infection with canine parvovirus, adenovirus types 1 and 2, and herpesvirus. The histologic characteristics of all myocardial specimens were classified regarding extent, location, and type of inflammation and fibrosis. Canine adenovirus type 1 was amplified from 1 specimen from a dog with DCM. Canine parvovirus, adenovirus type 2, and herpesvirus were not amplified from any myocardial specimens. Histologic analysis of specimens from dogs with DCM revealed variable amounts of fibrosis; myocardial inflammation was observed in 1 affected dog. Histopathologic analysis of specimens from dogs with myocarditis disclosed variable degrees of inflammation and fibrosis. Viral agents canine parvovirus, adenovirus types 1 and 2, and herpesvirus are not commonly associated with DCM or active myocarditis in dogs. Additional studies evaluating for nucleic acid from viruses that less commonly affect dogs or different types of infectious agents may be warranted to gain insight into the cause of DCM and myocarditis in dogs.

  14. The chain re-action

    CERN Multimedia

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  15. Nuclear chain reaction: forty years later

    International Nuclear Information System (INIS)

    Sachs, R.G.

    1984-01-01

    The proceedings from a 1982 symposium 40 years after the first controlled nuclear chain reaction took place in Chicago covers four sessions and public discussion. The session covered the history of the chain reaction; peaceful uses in technology, medicine, and biological science; peaceful uses in power generation; and nuclear weapons control. Among the speakers were Eugene Wigner, Glenn Seaborg, Alvin Weinberg, and others who participated in the first chain reaction experiments. The proceedings reflect differences of opinion among the scientists as well as the general public. References, slides, and tables used to illustrate the individual talks are included with the papers

  16. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription.

    Science.gov (United States)

    Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof

    2012-05-15

    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  17. Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Barbara, D J; Morton, A; Spence, N J; Miller, A

    1995-09-01

    Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

  18. Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

    1998-02-01

    A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

  19. The diagnostic value of intraocular fluid analysis by polymerase chain reaction in Thai patients with uveitis.

    Science.gov (United States)

    Pathanapitoon, Kessara; Kongyai, Natedao; Sirirungsi, Wasna; de Groot-Mijnes, Jolanda D F; Leechanachai, Pranee; Choovuthayakorn, Janejit; Kunavisarut, Paradee; Rothova, Aniki

    2011-11-01

    Uveitis is a major cause of severe visual impairment throughout the world and can be initiated by various infectious and non-infectious causes. Early recognition of specific infections is important as the treatment with antimicrobial agents might stop the progression or even cure the eye disease. To determine the infectious causes of uveitis in Thailand, intraocular fluid samples of 100 HIV-negative patients and 47 HIV-positive patients with uveitis were examined using real-time PCR analysis for herpes simplex virus, varicella zoster virus, cytomegalovirus and Toxoplasma gondii. Positive PCR results were found in 33/100 (33%) HIV-negative patients and in 33/47 (70%) HIV-positive patients with uveitis. In Thailand, cytomegalovirus was identified as the most frequent cause of infectious uveitis in both HIV-negative and HIV-positive patients (49 and 91%, respectively). PCR analysis of intraocular samples in uveitis was a valuable diagnostic assay. The pattern of uveitis observed in the Far East differs from that found in the West. Copyright © 2011 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

  20. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

    Science.gov (United States)

    Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

    2016-11-01

    Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016

  1. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  2. Evaluation of reference gene suitability for quantitative expression analysis by quantitative polymerase chain reaction in the mandibular condyle of sheep.

    Science.gov (United States)

    Jiang, Xin; Xue, Yang; Zhou, Hongzhi; Li, Shouhong; Zhang, Zongmin; Hou, Rui; Ding, Yuxiang; Hu, Kaijin

    2015-10-01

    Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.

  3. Bacterial analysis of combined periodontal-endodontic lesions by polymerase chain reaction-denaturing gradient gel electrophoresis.

    Science.gov (United States)

    Xia, Minghui; Qi, Qingguo

    2013-01-01

    We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.

  4. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

    Science.gov (United States)

    Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

    2013-11-27

    The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

  5. Determination of locust bean gum and guar gum by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R

    2001-01-01

    A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.

  6. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  7. Miltenberger blood group typing by real-time polymerase chain reaction (qPCR) melting curve analysis in Thai population.

    Science.gov (United States)

    Vongsakulyanon, A; Kitpoka, P; Kunakorn, M; Srikhirin, T

    2015-12-01

    To develop reliable and convenient methods for Miltenberger (Mi(a) ) blood group typing. To apply real-time polymerase chain reaction (qPCR) melting curve analysis to Mi(a) blood group typing. The Mi(a) blood group is the collective set of glycophorin hybrids in the MNS blood group system. Mi(a+) blood is common among East Asians and is also found in the Thai population. Incompatible Mi(a) blood transfusions pose the risk of life-threatening haemolysis; therefore, Mi(a) blood group typing is necessary in ethnicities where the Mi(a) blood group is prevalent. One hundred and forty-three blood samples from Thai blood donors were used in the study. The samples included 50 Mi(a+) samples and 93 Mi(a-) samples, which were defined by serology. The samples were typed by Mi(a) typing qPCR, and 50 Mi(a+) samples were sequenced to identify the Mi(a) subtypes. Mi(a) subtyping qPCR was performed to define GP.Mur. Both Mi(a) typing and Mi(a) subtyping were tested on a conventional PCR platform. The results of Mi(a) typing qPCR were all concordant with serology. Sequencing of the 50 Mi(a+) samples revealed 47 GP.Mur samples and 3 GP.Hop or Bun samples. Mi(a) subtyping qPCR was the supplementary test used to further define GP.Mur from other Mi(a) subtypes. Both Mi(a) typing and Mi(a) subtyping performed well using a conventional PCR platform. Mi(a) typing qPCR correctly identified Mi(a) blood groups in a Thai population with the feasibility of Mi(a) subtype discrimination, and Mi(a) subtyping qPCR was able to further define GP.Mur from other Mi(a) subtypes. © 2015 British Blood Transfusion Society.

  8. Analysis of colorectal cancer and polyp for presence herpes simplex virus and cytomegalovirus DNA sequences by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sahar Mehrabani khasraghi

    2016-05-01

    Full Text Available Introduction: In recent years, it was demonstrated that there is a clear association between the complicated course of colorectal cancer (CRC and the presence of herpes viruses. Despite a great number of published reports, the exact pathogenic role of herpes viruses remains unclear in these patients. The purpose of this study is to explore the prevalence of herpes simplex virus (HSV and cytomegalovirus (CMV in patients with CRC and polyp in comparison with healthy subjects using the polymerase chain reaction (PCR method. Methods: In this case-control study, 15 biopsies of patients with CRC and 20 colorectal polyp sample were selected. From each patient, two tissue samples were obtained: one sample from malignant tissue, and the other from normal colorectal tissue in an area located 15 cm away from the malignant tissue. Furthermore, 35 samples from healthy people as controls were selected. After DNA extraction, PCR was used to determine HSV and CMV genomes by specific primers. A statistical analysis was performed using the chi-square test. Results: Five CRC patients (33.3% had HSV DNA detected in both the malignant and the matched normal tissue. Five CRC patients (33.3% and seven polyp patients (35.0% had CMV DNA detected in both the malignant and the matched normal tissue. HSV DNA was found in 20% and CMV DNA in 37.1% of samples from healthy people as a control group. Thus, no significant association was observed between the prevalence of HSV and CMV, and an incidence of CRC and polyps according to the location of the samples as compared with the control group. Conclusion: The findings demonstrated that there is no direct molecular evidence to support the association between HSV and CMV and human colorectal malignancies. However, the results from this study do not exclude a possible oncogenic role of these viruses in the neoplastic development of colon cells.

  9. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    Science.gov (United States)

    Nasarabadi, Shanavaz [Livermore, CA

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  10. Nuclear fission, chain reaction and criticality

    International Nuclear Information System (INIS)

    Reuss, Paul

    2016-01-01

    Criticality is, notably for nuclear reactors, the status which separates the case of a fission chain reaction which inexorably decays, from that of a reaction which grows faster and faster until a counter-reaction occurs. If this status is an objective in nuclear reactors, it must not be reached or exceeded in any case in other types of installations in which fissile materials are handled (fabrication, transports, nuclear fuel processing). The author proposes an insight into this notion of criticality, discusses elements of neutron science which allow the multiplication factor to be assessed, analyses accidental scenarios which may happen, and presents associated experiments and computation codes

  11. The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

    Science.gov (United States)

    Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

    2002-03-01

    Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

  12. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    Science.gov (United States)

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  13. Estimation of the reaction efficiency in polymerase chain reaction

    NARCIS (Netherlands)

    Lalam, N.

    2006-01-01

    Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

  14. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    Science.gov (United States)

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  15. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...

  16. MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

    Science.gov (United States)

    Wigner, E.P.; Weinberg, A.M.

    1961-01-24

    A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

  17. Competing irreversible cooperative reactions on polymer chains

    International Nuclear Information System (INIS)

    Evans, J.W.; Hoffman, D.K.; Burgess, D.R.

    1984-01-01

    We analyze model processes involving competition between several irreversible reactions at the sites of a 1D, infinite, uniform polymer chain. These reactions can be cooperative, i.e., the corresponding rates depend on the state of the surrounding sites. An infinite hierarchy of rate equations is readily derived for the probabilities of various subconfigurations. By exploiting a shielding property of suitable blocks of unreacted sites, we show how exact hierarchy truncation and solution is sometimes possible. The behavior of solutions is illustrated in several cases by plotting families of ''reaction trajectories'' for varying ratios of reactant concentrations. As a specific application, we consider competition between coordination of ZnCl 2 to pairs of oxygen atoms and to single oxygen atoms in poly(propylene oxide). The observed glass transition temperature behavior is eludicated

  18. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

    Science.gov (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

    2014-01-01

    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  19. Value of Candida polymerase chain reaction and vaginal cytokine analysis for the differential diagnosis of women with recurrent vulvovaginitis.

    Science.gov (United States)

    Weissenbacher, S; Witkin, S S; Tolbert, V; Giraldo, P; Linhares, I; Haas, A; Weissenbacher, E R; Ledger, W J

    2000-01-01

    OBJECTIVES: Recurrent vulvovaginitis remains difficult to diagnose accurately and to treat. The present investigation evaluated the utility of testing vaginal specimens from women with symptomatic recurrent vulvovaginitis for Candida species by polymerase chain reaction (PCR) and for cytokine responses. METHODS: Sixty-one consecutive symptomatic women with pruritus, erythema, and/or a thick white discharge and a history of recurrent vulvovaginitis and 31 asymptomatic women with no such history were studied. Vaginal swabs were tested for Candida species by PCR, for the antiinflammatory cytokine interleukin (IL)-10, and for the proinflammatory cytokine IL-12. RESULTS: C. albicans was detected in 19 (31.1%) of the patients as well as in three (9.7%) controls (P = 0.03). Both IL-10 (31.1% vs. 0%) and IL-12 (42.6% vs. 6.5%) were also more prevalent in the recurrent vulvovaginitis patients (P vulvovaginitis are not infected with Candida. Testing for Candida should be required in this population. Treatment with only anti-Candida medication will clearly be inadequate for the majority of women with this condition. PMID:11220486

  20. A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

    Science.gov (United States)

    Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

    2017-01-01

    To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

  1. Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

    Science.gov (United States)

    Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

    1998-04-01

    Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

  2. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

    DEFF Research Database (Denmark)

    Guil-Luna, S.; Stenvang, Jan; Brünner, Nils

    2014-01-01

    and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors...

  3. Transformational leadership: a cascading chain reaction.

    Science.gov (United States)

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.

  4. Comparative analysis of fluorescence in situ hybridizationand real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Ali, J.; Khan, S.A.; Rauf, S.E.; Ayyub, M.; Ali, N.

    2017-01-01

    To compare the sensitivity and specificity of fluorescence in situ hybridization (FISH) with real time polymerase chain reaction (RT-PCR) in the diagnosis of Chronic Myeloid Leukemia (CML). Study Design: A cross-sectional, analytical study. Place and Duration of Study: Haematology Department, Armed Forces Institute of Pathology, Rawalpindi, from January 2012 to February 2014. Methodology:A total number of 87 patients of CML were studied. The diagnosis was made on the basis of clinical history, peripheral blood and bone marrow aspiration. These patients were tested for the presence of BCR-ABL1 fusion gene by RT-PCR and FISH. About 5 ml of venous blood was collected, half was taken in heparin for FISH and half in ethylenediamine tetra-acetic acid (EDTA) for CBC and PCR. For FISH, cells were cultured for 24 hours in RPMI 1640 medium and evaluated using BX51 fluorescence microscope for dual fusion signal of yellow colour. Samples having 20 or more interphases positive for dual fusion signals were taken as positive. For PCR, RNA extraction was done by Tri-Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT-PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of RT-PCR and FISH were compared. Results: Out of the 87 patients, 85 (97.7%) were PCR positive and 2 (2.3%) were PCR negative, whereas in FISH 83 (95.4%) were positive and 4 (4.5%) were negative. Sensitivity and specificity of FISH was 97.6% and 100%, respectively. Conclusion: FISH is a reliable supplementary method to PCR for detection of BCR-ABL1 fusion gene in the diagnosis of CML. (author)

  5. Leading coordinate analysis of reaction pathways in proton chain transfer: Application to a two-proton transfer model for the green fluorescent protein

    International Nuclear Information System (INIS)

    Wang Sufan; Smith, Sean C.

    2006-01-01

    The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information

  6. Pathogen detection by the polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

    1994-05-01

    In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

  7. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Mania, Hubert

    2010-01-01

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  8. Real-time polymerase chain reaction with melting analysis of positive blood culture specimens in bloodstream infections: diagnostic value and turnaround time.

    Science.gov (United States)

    Angeletti, Silvia; Gherardi, Giovanni; De Florio, Lucia; Avola, Alessandra; Crea, Francesca; Riva, Elisabetta; Vitali, Massimiliano Andrea; Galluzzo, Sara; Dicuonzo, Giordano

    2013-01-01

    A Real-time polymerase chain reaction (PCR) with melting analysis was devised to target bacterial and fungal genes together with the most prevalent antimicrobial resistance genes in 250 positive blood culture broths. This method allowed the blood culture cultivated pathogens to be classified into clinically relevant groups such as Enterobacteriaceae, oxidase-positive bacilli, oxidase-positive coccobacilli, S. aureus and yeast. Enterococci and streptococci could be distinguished from CoNS only by the Gram stain. Gram-positive bacilli were discriminated from Gram-positive cocci by Gram stain. Furthermore, the most important antimicrobial resistant genes such as mecA, vanA, bla TEM , bla SHV and bla CTX-M could be identified. All results were obtained with a turnaround time of three hours from the moment of blood culture positivity compared to 24-72 hours for phenotypic methods. In conclusion, the proposed approach can allow the clinician to implement proper early management of sepsis patients.

  9. Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

    Directory of Open Access Journals (Sweden)

    Nayereh Nouri

    2014-01-01

    Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

  10. Polymerase chain reaction to search for Herpes viruses in uveitic ...

    African Journals Online (AJOL)

    Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.

  11. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  12. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    Science.gov (United States)

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  13. Infectious uveitis in immunocompromised patients and the diagnostic value of polymerase chain reaction and Goldmann-Witmer coefficient in aqueous analysis.

    Science.gov (United States)

    Westeneng, Arnaud C; Rothova, Aniki; de Boer, Joke H; de Groot-Mijnes, Jolanda D F

    2007-11-01

    To establish the causes of uveitis in immunocompromised patients and to determine the contribution of polymerase chain reaction (PCR) and Goldmann-Witmer coefficient (GWC) analysis of aqueous humor in patients with an infectious etiology. Retrospective case series of 56 consecutive immunocompromised patients with uveitis. All patients underwent full ophthalmologic examination and laboratory blood analysis for uveitis. Aqueous humor analyses were performed using PCR and GWC for cytomegalovirus (CMV), herpes simplex virus (HSV), varicella zoster virus (VZV), and Toxoplasma gondii. Of 56 immunocompromised patients, 43 (77%), all posterior and panuveitis, had intraocular infections. Twenty-one (49%) had CMV, three (7%) had VZV, 11 (26%) had T. gondii, six (14%) had Treponema pallidum, and one (2%) each had Aspergillus and Candida. In AIDS patients, CMV was the most common cause. A strong correlation between AIDS and ocular syphilis was also observed (P = .007). In nonAIDS immunocompromised patients, T. gondii was most frequently detected. Twenty-seven patients were examined by both PCR and GWC; five (18.5%) were positive by both assays, 15 (55.5%) were positive by PCR alone and seven (26%) by GWC alone. Viral infections were detected by PCR in 16 of 17 (94%) cases; T. gondii in four of 10 (40%) patients. Using GWC, a viral infection was diagnosed in three of 17 (18%) and T. gondii in nine of 10 (90%) cases. In immunocompromised patients, PCR is superior in diagnosing viral infections. Analysis of intraocular antibody production played a decisive role in the diagnosis of ocular toxoplasmosis.

  14. Quantitative detection and typing of hepatitis D virus in human serum by real-time polymerase chain reaction and melting curve analysis.

    Science.gov (United States)

    Hofmann, Joerg; Frenzel, Katrin; Minh, Bui Q; von Haeseler, Arndt; Edelmann, Anke; Ross, Stefan R; Berg, Thomas; Krüger, Detlev H; Meisel, Helga

    2010-06-01

    Hepatitis D virus (HDV) infection is an important etiologic agent of fulminant hepatitis and may aggravate the clinical course of chronic hepatitis B infection resulting in cirrhosis and liver failure. This report describes the establishment of a real-time reverse transcriptase polymerase chain reaction method that allows the quantitative detection of HDV-1 and HDV-3 with a sensitivity in a linear range of 2 x 10(3) to 10(8) copies/mL. Additionally, the new assay provides the opportunity to distinguish HDV-1 from HDV-3 by a subsequent melting curve analysis, an important option because these HDV types are highly associated with severe clinical outcome. The results of the melting curve analysis of 42 HDV sequences obtained in this study and the phylogenetic analysis based on 139 full-length sequences from GenBank were consistent and showed that all sequences described here cluster within the HDV-1 clade. Therefore, this assay is useful for monitoring of antiviral treatment and molecular epidemiologic studies of HDV distribution. Copyright 2010 Elsevier Inc. All rights reserved.

  15. Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

    Science.gov (United States)

    Rozi; Rahayu, K.; Daruti, D. N.

    2018-04-01

    The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

  16. Analysis of microbial diversity on deli slicers using polymerase chain reaction and denaturing gradient gel electrophoresis technologies.

    Science.gov (United States)

    Koo, O K; Mertz, A W; Akins, E L; Sirsat, S A; Neal, J A; Morawicki, R; Crandall, P G; Ricke, S C

    2013-02-01

    Cross-contamination of pathogenic and spoilage bacteria from food-contact surfaces to food products is a serious public health issue. Bacteria may survive and attach to food-contact surfaces by residual food components and/or background bacteria which may subsequently transfer to other food products. Deli slicers, generally used for slicing ready-to-eat products, can serve as potential sources for considerable bacterial transfer. The objective of this study was to assess the extent and distribution of microbial diversity of deli slicers by identification of pathogenic and background bacteria. Slicer-swab samples were collected from restaurants in Arkansas and Texas in the United States. Ten surface areas for each slicer were swabbed using sterile sponges. Denaturing gradient gel electrophoresis (DGGE) was applied to investigate the fingerprint of samples, and each band was further identified by sequence analysis. Pseudomonads were identified as the dominant bacteria followed by Enterobacteriaceae family, and lactic acid bacteria such as Lactococcus lactis and Streptococcus thermophilus were also found. Bacterial distribution was similar for all surface areas, while the blade guard exhibited the greatest diversity. This study provides a profile of the microbial ecology of slicers using DGGE to develop more specific sanitation practices and to reduce cross-contamination during slicing. © 2012 The Society for Applied Microbiology.

  17. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  18. 16S Ribosomal Ribonucleic Acid Gene Polymerase Chain Reaction in the Diagnosis of Bloodstream Infections: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Su, Guoming; Fu, Zhuqing; Hu, Liren; Wang, Yueying; Zhao, Zuguo; Yang, Weiqing

    2015-01-01

    We aim to evaluate the accuracy of the 16S ribosomal ribonucleic acid (rRNA) gene polymerase chain reaction (PCR) test in the diagnosis of bloodstream infections through a systematic review and meta-analysis. A computerized literature search was conducted to identify studies that assessed the diagnostic value of 16S rRNA gene PCR test for bloodstream infections. Study quality was assessed using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. We calculated the sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR) and their 95% confidence intervals (95% CI) for each study. Summary receiver operating characteristic (SROC) curve was used to summarize overall test performance. Statistical analysis was performed in Meta-DiSc 1.4 and Stata/SE 12.0 software. Twenty-eight studies were included in our meta-analysis. Using random-effect model analysis, the pooled sensitivity, specificity, PLR, NLR, and DOR were 0.87 (95% CI, 0.85-0.89), 0.94 (95% CI, 0.93-0.95), 12.65 (95% CI, 8.04-19.90), 0.14 (95% CI, 0.08-0.24), and 116.76 (95% CI, 52.02-262.05), respectively. The SROC curve indicated that the area under the curve (AUC) was 0.9690 and the maximum joint sensitivity and specificity (Q*) was 0.9183. In addition, heterogeneity was statistically significant but was not caused by the threshold effect. Existing data suggest that 16S rRNA gene PCR test is a practical tool for the rapid screening of sepsis. Further prospective studies are needed to assess the diagnostic value of PCR amplification and DNA microarray hybridization of 16S rRNA gene in the future.

  19. Commercial enzyme-linked immunosorbent assay versuspolymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Pedro Emmanuel Alvarenga Americano do Brasil

    2016-01-01

    Full Text Available Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA and polymerase chain reaction (PCR diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects.

  20. Galactomannan and Polymerase Chain Reaction-Based Screening for Invasive Aspergillosis Among High-Risk Hematology Patients: A Diagnostic Meta-analysis.

    Science.gov (United States)

    Arvanitis, Marios; Anagnostou, Theodora; Mylonakis, Eleftherios

    2015-10-15

    Screening of high-risk patients for invasive aspergillosis (IA) has the potential to decrease the use of empiric antifungal agents. However, the performance of different screening methods has not been studied. We performed a meta-analysis of published studies to assess the diagnostic performance of galactomannan (GM) and polymerase chain reaction (PCR) as weekly screening tests in high-risk populations. The sensitivity and specificity of 6 approaches combining GM and PCR were estimated using the bivariate model. Thirteen studies with 1670 patients met our inclusion criteria. Single positive test results had modest sensitivity and specificity for screening (respectively, 92% and 90% for GM; 84% and 76% for PCR). The screening approach with the highest sensitivity was the one that used at least 1 GM- or PCR-positive result to define a positive episode, achieving a sensitivity of 99%, significantly higher than any single test (P = .0018 compared with GM and P value of 100%, whereas the presence of at least 2 positive results is highly suggestive of an active infection with a positive predictive value of 88%. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Detection of high-risk subtypes of human papillomavirus in cervical swabs: routine use of the Digene Hybrid Capture assay and polymerase chain reaction analysis.

    LENUS (Irish Health Repository)

    Brennan, M M

    2012-02-03

    Human papillomaviruses (HPVs) are major causative agents in the pathogenesis of cervical cancer, and more than twenty types are associated with its development. With the introduction of liquid-based preparation systems, it is envisaged that large-scale HPV testing will be established in the near future. Preliminary studies demonstrate the accessibility of these samples for DNA testing using both the Digene Hybrid Capture assay (DHCA) and polymerase chain reaction (PCR) techniques. This study aims to assess the validity and sensitivity of the DHCA system to detect high-risk HPV DNA, using two sets of HPV consensus primers (Gp5+\\/Gp6+ and MY09\\/MY11) in tandem with routine assessment of cervical smear and biopsy samples. Results indicate that the combination of DHCA and PCR detects more high-grade lesions than does the DHCA alone. DHCA-negative cases were categorised by subsequent PCR amplification into low-grade HPV-negative (12\\/16) cervical lesions and high-grade HPV-positive (7\\/9) cervical lesions. Gp5+\\/Gp6+ primers were less sensitive in detecting HPV-positive samples than was the MY09\\/MY11 primer set. These results support the use of high-risk HPV testing by DHCA, with subsequent analysis of DHCA-negative samples by PCR using the MY09\\/MY11 primers.

  2. Multi-template polymerase chain reaction.

    Science.gov (United States)

    Kalle, Elena; Kubista, Mikael; Rensing, Christopher

    2014-12-01

    PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  3. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  4. The diagnostic value of polymerase chain reaction for Mycobacterium tuberculosis to distinguish intestinal tuberculosis from crohn's disease: A meta-analysis.

    Science.gov (United States)

    Jin, Ting; Fei, Baoying; Zhang, Yu; He, Xujun

    2017-01-01

    Intestinal tuberculosis (ITB) and Crohn's disease (CD) are important differential diagnoses that can be difficult to distinguish. Polymerase chain reaction (PCR) for Mycobacterium tuberculosis (MTB) is an efficient and promising tool. This meta-analysis was performed to systematically and objectively assess the potential diagnostic accuracy and clinical value of PCR for MTB in distinguishing ITB from CD. We searched PubMed, Embase, Web of Science, Science Direct, and the Cochrane Library for eligible studies, and nine articles with 12 groups of data were identified. The included studies were subjected to quality assessment using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. The summary estimates were as follows: sensitivity 0.47 (95% CI: 0.42-0.51); specificity 0.95 (95% CI: 0.93-0.97); the positive likelihood ratio (PLR) 10.68 (95% CI: 6.98-16.35); the negative likelihood ratio (NLR) 0.49 (95% CI: 0.33-0.71); and diagnostic odds ratio (DOR) 21.92 (95% CI: 13.17-36.48). The area under the curve (AUC) was 0.9311, with a Q* value of 0.8664. Heterogeneity was found in the NLR. The heterogeneity of the studies was evaluated by meta-regression analysis and subgroup analysis. The current evidence suggests that PCR for MTB is a promising and highly specific diagnostic method to distinguish ITB from CD. However, physicians should also keep in mind that negative results cannot exclude ITB for its low sensitivity. Additional prospective studies are needed to further evaluate the diagnostic accuracy of PCR.

  5. Use of length heterogeneity polymerase chain reaction (LH-PCR as non-invasive approach for dietary analysis of Svalbard reindeer, Rangifer tarandus platyrhynchus.

    Directory of Open Access Journals (Sweden)

    Sungbae Joo

    Full Text Available To efficiently investigate the forage preference of Svalbard reindeer (Rangifer tarandus platyrhynchus, we applied length-heterogeneity polymerase chain reaction (LH-PCR based on length differences of internal transcribed spacer (ITS regions of ribosomal RNA (rRNA to fecal samples from R. tarandus platyrhynchus. A length-heterogeneity (LH database was constructed using both collected potential food sources of Svalbard reindeer and fecal samples, followed by PCR, cloning and sequencing. In total, eighteen fecal samples were collected between 2011 and 2012 from 2 geographic regions and 15 samples were successfully amplified by PCR. The LH-PCR analysis detected abundant peaks, 18.6 peaks on an average per sample, ranging from 100 to 500 bp in size and showing distinct patterns associated with both regions and years of sample collection. Principal component analysis (PCA resulted in clustering of 15 fecal samples into 3 groups by the year of collection and region with a statistically significant difference at 99.9% level. The first 2 principal components (PCs explained 71.1% of the total variation among the samples. Through comparison with LH database and identification by cloning and sequencing, lichens (Stereocaulon sp. and Ochrolechia sp. and plant species (Salix polaris and Saxifraga oppositifolia were detected as the food sources that contributed most to the Svalbard reindeer diet. Our results suggest that the use of LH-PCR analysis would be a non-invasive and efficient monitoring tool for characterizing the foraging strategy of Svalbard reindeer. Additionally, combining sequence information would increase its resolving power in identification of foraged diet components.

  6. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  7. The application of polymerase chain reaction-denaturing gradient ...

    African Journals Online (AJOL)

    Jane

    2011-05-23

    May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.

  8. Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

    Directory of Open Access Journals (Sweden)

    Tuti Susanti Legiastuti

    2013-04-01

    Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

  9. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Directory of Open Access Journals (Sweden)

    Fei Cheng

    Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  10. Predictive value and cost-effectiveness analysis of a rapid polymerase chain reaction for preoperative detection of nasal carriage of Staphylococcus aureus.

    Science.gov (United States)

    Shrestha, Nabin K; Shermock, Kenneth M; Gordon, Steven M; Tuohy, Marion J; Wilson, Deborah A; Cwynar, Roberta E; Banbury, Michael K; Longworth, David L; Isada, Carlos M; Mawhorter, Steven D; Procop, Gary W

    2003-05-01

    To determine the accuracy and cost-effectiveness of a polymerase chain reaction (PCR) for detecting nasal carriage of Staphylococcus aureus directly from clinical specimens. CROSS-SECTIONAL STUDY: This occurred in a tertiary-care hospital in Cleveland, Ohio, and included 239 consecutive patients who were scheduled for a cardiothoracic surgical procedure. Conventional cultures and a PCR for S. aureus from nasal swabs were used as measurements. COST-EFFECTIVENESS ANALYSIS: Data sources were market prices and Bureau of Labor Statistics. The time horizon was the maximum period for availability of culture results (3 days). Interventions included universal mupirocin therapy without testing; initial therapy, with termination if PCR negative (treat-PCR); initial therapy, with termination if culture negative (treat-culture); treat PCR-positive carriers (PCR-guided treatment); and treat culture-positive carriers (culture-guided treatment). The perspective was institutional and costs and the length of time to treatment were outcome measures. Sixty-seven (28%) of the 239 swabs grew S. aureus. Rapid PCR was 97.0% sensitive and 97.1% specific for the detection of S. aureus. For populations with prevalences of nasal S. aureus carriage of up to 50%, the PCR assay had negative predictive values of greater than 97%. PCR-guided treatment had the lowest incremental cost-effectiveness ratio (1.93 dollars per additional day compared with the culture strategy). Among immediate treatment strategies, treat-PCR was most cost-effective. The universal therapy strategy cost 38.19 dollars more per additional day gained with carrier identification compared with the PCR strategy. Rapid real-time PCR is an accurate, rapid, and cost-effective method for identifying S. aureus carriers for preoperative intervention.

  11. Adhesion of mutans streptococci to self-ligating ceramic brackets: in vivo quantitative analysis with real-time polymerase chain reaction.

    Science.gov (United States)

    Jung, Woo-Sun; Yang, Il-Hyung; Lim, Won Hee; Baek, Seung-Hak; Kim, Tae-Woo; Ahn, Sug-Joon

    2015-12-01

    To analyze in vivo mutans streptococci (MS) adhesion to self-ligating ceramic brackets [Clarity-SL (CSL) and Clippy-C (CC)] and the relationships between bacterial adhesion and oral hygiene indices. Four central incisor brackets from the maxilla and mandible were collected from 40 patients (20 patients per each bracket type) at debonding immediately after plaque and gingival indices were measured. Adhesions of Streptococcus mutans, S. sobrinus, and total bacteria were quantitatively determined using real-time polymerase chain reaction after genomic DNA was extracted. Factorial analysis of variance was used to analyze bacterial adhesion to the brackets with respect to the bracket type and jaw position. Correlation coefficients were calculated to determine the relationships of bacterial adhesion to oral hygiene indices. Adhesion of total bacteria and S. mutans to CSL was higher than that to CC (P brackets was higher than that to the maxillary ones (P brackets were higher than that in the mandibular ones (P brackets and jaw positions. Interestingly, no significant relationships were found between bacterial adhesions and oral hygiene indices. Complex bracket configurations may significantly influence bacterial adhesion to orthodontic brackets. Further in vivo study using bracket raw materials will help to define the relationships between bacteria adhesion and enamel demineralization. Because oral hygiene indices were not significantly correlated with adhesions of MS to self-ligating ceramic brackets, careful examinations around the brackets should be needed to prevent enamel demineralization, regardless of oral hygiene status. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  12. Comparison of polymerase chain reaction (PCR) and loop-mediated ...

    African Journals Online (AJOL)

    Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...

  13. Exploiting Fission Chain Reaction Dynamics to Image Fissile Materials

    Science.gov (United States)

    Chapman, Peter Henry

    Radiation imaging is one potential method to verify nuclear weapons dismantlement. The neutron coded aperture imager (NCAI), jointly developed by Oak Ridge National Laboratory (ORNL) and Sandia National Laboratories (SNL), is capable of imaging sources of fast (e.g., fission spectrum) neutrons using an array of organic scintillators. This work presents a method developed to discriminate between non-multiplying (i.e., non-fissile) neutron sources and multiplying (i.e., fissile) neutron sources using the NCAI. This method exploits the dynamics of fission chain-reactions; it applies time-correlated pulse-height (TCPH) analysis to identify neutrons in fission chain reactions. TCPH analyzes the neutron energy deposited in the organic scintillator vs. the apparent neutron time-of-flight. Energy deposition is estimated from light output, and time-of-flight is estimated from the time between the neutron interaction and the immediately preceding gamma interaction. Neutrons that deposit more energy than can be accounted for by their apparent time-of-flight are identified as fission chain-reaction neutrons, and the image is reconstructed using only these neutron detection events. This analysis was applied to measurements of weapons-grade plutonium (WGPu) metal and 252Cf performed at the Nevada National Security Site (NNSS) Device Assembly Facility (DAF) in July 2015. The results demonstrate it is possible to eliminate the non-fissile 252Cf source from the image while preserving the fissileWGPu source. TCPH analysis was also applied to additional scenes in which theWGPu and 252Cf sources were measured individually. The results of these separate measurements further demonstrate the ability to remove the non-fissile 252Cf source and retain the fissileWGPu source. Simulations performed using MCNPX-PoliMi indicate that in a one hour measurement, solid spheres ofWGPu are retained at a 1sigma level for neutron multiplications M -˜ 3.0 and above, while hollowWGPu spheres are

  14. Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

    Science.gov (United States)

    Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

    2011-12-01

    Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

  15. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Science.gov (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Comparison of the accuracy of Hybrid Capture II and polymerase chain reaction in detecting clinically important cervical dysplasia: a systematic review and meta-analysis

    International Nuclear Information System (INIS)

    Luu, Hung N; Dahlstrom, Kristina R; Mullen, Patricia Dolan; VonVille, Helena M; Scheurer, Michael E

    2013-01-01

    The effectiveness of screening programs for cervical cancer has benefited from the inclusion of Human papillomavirus (HPV) DNA assays; which assay to choose, however, is not clear based on previous reviews. Our review addressed test accuracy of Hybrid Capture II (HCII) and polymerase chain reaction (PCR) assays based on studies with stronger designs and with more clinically relevant outcomes. We searched OvidMedline, PubMed, and the Cochrane Library for English language studies comparing both tests, published 1985–2012, with cervical dysplasia defined by the Bethesda classification. Meta-analysis provided pooled sensitivity, specificity, and 95% confidence intervals (CIs); meta-regression identified sources of heterogeneity. From 29 reports, we found that the pooled sensitivity and specificity to detect high-grade squamous intraepithelial lesion (HSIL) was higher for HCII than PCR (0.89 [CI: 0.89–0.90] and 0.85 [CI: 0.84–0.86] vs. 0.73 [CI: 0.73–0.74] and 0.62 [CI: 0.62–0.64]). Both assays had higher accuracy to detect cervical dysplasia in Europe than in Asia-Pacific or North America (diagnostic odd ratio – dOR = 4.08 [CI: 1.39–11.91] and 4.56 [CI: 1.86–11.17] for HCII vs. 2.66 [CI: 1.16–6.53] and 3.78 [CI: 1.50–9.51] for PCR) and accuracy to detect HSIL than atypical squamous cells of undetermined significance (ASCUS)/ low-grade squamous intraepithelial lesion (LSIL) (HCII-dOR = 9.04 [CI: 4.12–19.86] and PCR-dOR = 5.60 [CI: 2.87–10.94]). For HCII, using histology as a gold standard results in higher accuracy than using cytology (dOR = 2.87 [CI: 1.31–6.29]). Based on higher test accuracy, our results support the use of HCII in cervical cancer screening programs. The role of HPV type distribution should be explored to determine the worldwide comparability of HPV test accuracy

  17. Effectiveness of real-time polymerase chain reaction assay for the detection of Mycobacterium tuberculosis in pathological samples: a systematic review and meta-analysis.

    Science.gov (United States)

    Babafemi, Emmanuel O; Cherian, Benny P; Banting, Lee; Mills, Graham A; Ngianga, Kandala

    2017-10-25

    Rapid and accurate diagnosis of tuberculosis (TB) is key to manage the disease and to control and prevent its transmission. Many established diagnostic methods suffer from low sensitivity or delay of timely results and are inadequate for rapid detection of Mycobacterium tuberculosis (MTB) in pulmonary and extra-pulmonary clinical samples. This study examined whether a real-time polymerase chain reaction (RT-PCR) assay, with a turn-a-round time of 2 h, would prove effective for routine detection of MTB by clinical microbiology laboratories. A systematic literature search was performed for publications in any language on the detection of MTB in pathological samples by RT-PCR assay. The following sources were used MEDLINE via PubMed, EMBASE, BIOSIS Citation Index, Web of Science, SCOPUS, ISI Web of Knowledge and Cochrane Infectious Diseases Group Specialised Register, grey literature, World Health Organization and Centres for Disease Control and Prevention websites. Forty-six studies met set inclusion criteria. Generated pooled summary estimates (95% CIs) were calculated for overall accuracy and bivariate meta-regression model was used for meta-analysis. Summary estimates for pulmonary TB (31 studies) were as follows: sensitivity 0.82 (95% CI 0.81-0.83), specificity 0.99 (95% CI 0.99-0.99), positive likelihood ratio 43.00 (28.23-64.81), negative likelihood ratio 0.16 (0.12-0.20), diagnostic odds ratio 324.26 (95% CI 189.08-556.09) and area under curve 0.99. Summary estimates for extra-pulmonary TB (25 studies) were as follows: sensitivity 0.70 (95% CI 0.67-0.72), specificity 0.99 (95% CI 0.99-0.99), positive likelihood ratio 29.82 (17.86-49.78), negative likelihood ratio 0.33 (0.26-0.42), diagnostic odds ratio 125.20 (95% CI 65.75-238.36) and area under curve 0.96. RT-PCR assay demonstrated a high degree of sensitivity for pulmonary TB and good sensitivity for extra-pulmonary TB. It indicated a high degree of specificity for ruling in TB infection from sampling

  18. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  19. The role of chain carriers in fusion reaction kinetics

    International Nuclear Information System (INIS)

    Harms, A.A.; Krenciglowa, E.M.

    1980-01-01

    The role of chain carriers as contributors to multiplicative closed cycles in advanced fusion fuels is examined. Emphasis is placed on rate processes which can be used to characterize critical/supercritical/subcritical tendencies of arbitrary closed fusion cycles. Temporal trajectories for the chain carriers which describe both increasing and decreasing multiplicative processes have been found to exist and identified according to their fusion fuel cycle characteristics. Practical criteria to ensure the attainment of steady-state fusion reaction processes have been formulated in terms of fusion reaction rate relationships. (author)

  20. Tangled nonlinear driven chain reactions of all optical singularities

    Science.gov (United States)

    Vasil'ev, V. I.; Soskin, M. S.

    2012-03-01

    Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

  1. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    2012-03-30

    Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...

  2. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  3. A Double Polymerase Chain Reaction Method for Detecting African ...

    African Journals Online (AJOL)

    Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.

  4. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    African Journals Online (AJOL)

    Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

  5. Polymerase Chain Reaction (PCR) provides a superior tool for the ...

    African Journals Online (AJOL)

    Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

  6. Polymerase chain reaction for the detection of Mycobacterium leprae

    NARCIS (Netherlands)

    Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

    1989-01-01

    A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

  7. Polymerase chain reaction versus enzyme-linked immunosorbent ...

    African Journals Online (AJOL)

    Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.

  8. Effectiveness of real-time polymerase chain reaction assay for the detection of Mycobacterium tuberculosis in pathological samples: a systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Emmanuel O. Babafemi

    2017-10-01

    Full Text Available Abstract Background Rapid and accurate diagnosis of tuberculosis (TB is key to manage the disease and to control and prevent its transmission. Many established diagnostic methods suffer from low sensitivity or delay of timely results and are inadequate for rapid detection of Mycobacterium tuberculosis (MTB in pulmonary and extra-pulmonary clinical samples. This study examined whether a real-time polymerase chain reaction (RT-PCR assay, with a turn-a-round time of 2 h, would prove effective for routine detection of MTB by clinical microbiology laboratories. Methods A systematic literature search was performed for publications in any language on the detection of MTB in pathological samples by RT-PCR assay. The following sources were used MEDLINE via PubMed, EMBASE, BIOSIS Citation Index, Web of Science, SCOPUS, ISI Web of Knowledge and Cochrane Infectious Diseases Group Specialised Register, grey literature, World Health Organization and Centres for Disease Control and Prevention websites. Forty-six studies met set inclusion criteria. Generated pooled summary estimates (95% CIs were calculated for overall accuracy and bivariate meta-regression model was used for meta-analysis. Results Summary estimates for pulmonary TB (31 studies were as follows: sensitivity 0.82 (95% CI 0.81–0.83, specificity 0.99 (95% CI 0.99–0.99, positive likelihood ratio 43.00 (28.23–64.81, negative likelihood ratio 0.16 (0.12–0.20, diagnostic odds ratio 324.26 (95% CI 189.08–556.09 and area under curve 0.99. Summary estimates for extra-pulmonary TB (25 studies were as follows: sensitivity 0.70 (95% CI 0.67–0.72, specificity 0.99 (95% CI 0.99–0.99, positive likelihood ratio 29.82 (17.86–49.78, negative likelihood ratio 0.33 (0.26–0.42, diagnostic odds ratio 125.20 (95% CI 65.75–238.36 and area under curve 0.96. Conclusions RT-PCR assay demonstrated a high degree of sensitivity for pulmonary TB and good sensitivity for extra-pulmonary TB. It indicated a

  9. Two-step bacterial broad-range polymerase chain reaction analysis of heart valve tissue improves bacteriological diagnosis of infective endocarditis.

    Science.gov (United States)

    Boussier, Rémi; Rogez, Sylvie; François, Bruno; Denes, Eric; Ploy, Marie-Cécile; Garnier, Fabien

    2013-03-01

    Positive heart valve (HV) culture is a major Duke's criterion for the diagnosis of infective endocarditis but is poorly sensitive. Two broad-range 16S rDNA polymerase chain reaction (PCR) methods were applied to 31 HV samples: first, a real-time method, then conventional end-point PCR was applied to HV samples on which the first PCR was negative. Five specific real-time PCR procedures were also used in order to identify Bartonella spp., Tropheryma whipplei, Chlamydophila pneumoniae, Mycoplasma pneumonia, and Coxiella burnetii. A strategy combining the 2-step broad-range PCR methods improved the sensitivity of the molecular method from 38.7% to 58%. Specific PCR identified 1 T. whipplei, which was also identified by conventional end-point PCR. These results confirm that blood culture is the gold standard for the diagnosis of infective endocarditis, shows that molecular methods applied to HV can be useful when blood culture is negative, and that 2-step broad-range PCR approach seems to be more sensitive. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Toxoplasma gondii and pre-treatment protocols for polymerase chain reaction analysis of milk samples: a field trial in sheep from Southern Italy

    Directory of Open Access Journals (Sweden)

    Alice Vismarra

    2017-02-01

    Full Text Available Toxoplasmosis is a zoonotic disease caused by the protozoan Toxoplasma gondii. Ingestion of raw milk has been suggested as a risk for transmission to humans. Here the authors evaluated pre-treatment protocols for DNA extraction on T. gondii tachyzoite-spiked sheep milk with the aim of identifying the method that resulted in the most rapid and reliable polymerase chain reaction (PCR positivity. This protocol was then used to analyse milk samples from sheep of three different farms in Southern Italy, including real time PCR for DNA quantification and PCR-restriction fragment length polymorphism for genotyping. The pre-treatment protocol using ethylenediaminetetraacetic acid and Tris-HCl to remove casein gave the best results in the least amount of time compared to the others on spiked milk samples. One sample of 21 collected from sheep farms was positive on one-step PCR, real time PCR and resulted in a Type I genotype at one locus (SAG3. Milk usually contains a low number of tachyzoites and this could be a limiting factor for molecular identification. Our preliminary data has evaluated a rapid, cost-effective and sensitive protocol to treat milk before DNA extraction. The results of the present study also confirm the possibility of T. gondii transmission through consumption of raw milk and its unpasteurised derivatives.

  11. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2014-10-01

    Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  12. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  13. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...... citation network. The effect is discussed using innovation decision process theory as a point of departure to identify the factors that created a bandwagon effect leading to the reported observations....... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  14. Markov Chain Ontology Analysis (MCOA).

    Science.gov (United States)

    Frost, H Robert; McCray, Alexa T

    2012-02-03

    Biomedical ontologies have become an increasingly critical lens through which researchers analyze the genomic, clinical and bibliographic data that fuels scientific research. Of particular relevance are methods, such as enrichment analysis, that quantify the importance of ontology classes relative to a collection of domain data. Current analytical techniques, however, remain limited in their ability to handle many important types of structural complexity encountered in real biological systems including class overlaps, continuously valued data, inter-instance relationships, non-hierarchical relationships between classes, semantic distance and sparse data. In this paper, we describe a methodology called Markov Chain Ontology Analysis (MCOA) and illustrate its use through a MCOA-based enrichment analysis application based on a generative model of gene activation. MCOA models the classes in an ontology, the instances from an associated dataset and all directional inter-class, class-to-instance and inter-instance relationships as a single finite ergodic Markov chain. The adjusted transition probability matrix for this Markov chain enables the calculation of eigenvector values that quantify the importance of each ontology class relative to other classes and the associated data set members. On both controlled Gene Ontology (GO) data sets created with Escherichia coli, Drosophila melanogaster and Homo sapiens annotations and real gene expression data extracted from the Gene Expression Omnibus (GEO), the MCOA enrichment analysis approach provides the best performance of comparable state-of-the-art methods. A methodology based on Markov chain models and network analytic metrics can help detect the relevant signal within large, highly interdependent and noisy data sets and, for applications such as enrichment analysis, has been shown to generate superior performance on both real and simulated data relative to existing state-of-the-art approaches.

  15. Pasteurella multocida in backyard chickens in Upper Egypt: incidence with polymerase chain reaction analysis for capsule type, virulence in chicken embryos and antimicrobial resistance.

    Science.gov (United States)

    Mohamed, Moemen A; Mohamed, Mohamed-Wael A; Ahmed, Ahmed I; Ibrahim, Awad A; Ahmed, Mohamed S

    2012-01-01

    The prevalence of Pasteurella multocida strains among 275 backyard chickens from different regions of Upper Egypt was studied. A total of 21 isolates of P. multocida were recovered in 21 out of 275 chickens tested (7.6%) and were confirmed using phenotypic characterisation. Somatic serotyping of the 21 isolates resulted in 12 isolates being classed as serotype A:1 (57.14%), 4 as serotype A:3 (19.05%) and 5 could not be typed (23.8%). Capsular typing, using multiplex polymerase chain reaction (PCR), demonstrated that 18 strains were capsular type A (85.7%), and 3 were type D (14.3%). The present findings suggest that a multiplex capsular PCR could be valuable for the rapid identification of P. multocida in cases of fowl cholera infection. A total of 5 isolates of P. multocida were selected to study their pathogenicity in embryonated chicken eggs instead of conducting a study in mature chickens. The results showed a variation in pathogenicity between the strains tested, namely: serotype A:1 strains caused 80% mortality, in contrast to 20% mortality by type D strains. Pathological findings included severe congestion of the entire embryo, haemorrhaging of the skin, feather follicles and toe, and ecchymotic haemorrhages on the liver of the inoculated embryos. The observations in this study indicate that P. multocida serogroup A could be highly pathogenic for mature chickens and therefore might be a cause of considerable economic losses in commercial production. A total of 10 isolates were subjected to antimicrobial susceptibility to determine the minimal inhibitory concentration of 7 antimicrobials. All isolates were susceptible to ciprofloxacin, florfenicol, streptomycin and sulphamethoxazol with trimethoprim and with varying degrees of sensitivity to the other agents.

  16. Determination of real-time polymerase chain reaction uncertainty of measurement using replicate analysis and a graphical user interface with Fieller's theorem.

    Science.gov (United States)

    Stuart, James Ian; Delport, Johan; Lannigan, Robert; Zahariadis, George

    2014-07-01

    Disease monitoring of viruses using real-time polymerase chain reaction (PCR) requires knowledge of the precision of the test to determine what constitutes a significant change. Calculation of quantitative PCR confidence limits requires bivariate statistical methods. To develop a simple-to-use graphical user interface to determine the uncertainty of measurement (UOM) of BK virus, cytomegalovirus (CMV) and Epstein-Barr virus (EBV) real-time PCR assays. Thirty positive clinical samples for each of the three viral assays were repeated once. A graphical user interface was developed using a spreadsheet (Excel, Microsoft Corporation, USA) to enable data entry and calculation of the UOM (according to Fieller's theorem) and PCR efficiency. The confidence limits for the BK virus, CMV and EBV tests were ∼0.5 log, 0.5 log to 1.0 log, and 0.5 log to 1.0 log, respectively. The efficiencies of these assays, in the same order were 105%, 119% and 90%. The confidence limits remained stable over the linear range of all three tests. A >5 fold (0.7 log) and a >3-fold (0.5 log) change in viral load were significant for CMV and EBV when the results were ≤1000 copies/mL and >1000 copies/mL, respectively. A >3-fold (0.5 log) change in viral load was significant for BK virus over its entire linear range. PCR efficiency was ideal for BK virus and EBV but not CMV. Standardized international reference materials and shared reporting of UOM among laboratories are required for the development of treatment guidelines for BK virus, CMV and EBV in the context of changes in viral load.

  17. Determination of real-time polymerase chain reaction uncertainty of measurement using replicate analysis and a graphical user interface with Fieller’s theorem

    Science.gov (United States)

    Stuart, James Ian; Delport, Johan; Lannigan, Robert; Zahariadis, George

    2014-01-01

    BACKGROUND: Disease monitoring of viruses using real-time polymerase chain reaction (PCR) requires knowledge of the precision of the test to determine what constitutes a significant change. Calculation of quantitative PCR confidence limits requires bivariate statistical methods. OBJECTIVE: To develop a simple-to-use graphical user interface to determine the uncertainty of measurement (UOM) of BK virus, cytomegalovirus (CMV) and Epstein-Barr virus (EBV) real-time PCR assays. METHODS: Thirty positive clinical samples for each of the three viral assays were repeated once. A graphical user interface was developed using a spreadsheet (Excel, Microsoft Corporation, USA) to enable data entry and calculation of the UOM (according to Fieller’s theorem) and PCR efficiency. RESULTS: The confidence limits for the BK virus, CMV and EBV tests were ∼0.5 log, 0.5 log to 1.0 log, and 0.5 log to 1.0 log, respectively. The efficiencies of these assays, in the same order were 105%, 119% and 90%. The confidence limits remained stable over the linear range of all three tests. DISCUSSION: A >5 fold (0.7 log) and a >3-fold (0.5 log) change in viral load were significant for CMV and EBV when the results were ≤1000 copies/mL and >1000 copies/mL, respectively. A >3-fold (0.5 log) change in viral load was significant for BK virus over its entire linear range. PCR efficiency was ideal for BK virus and EBV but not CMV. Standardized international reference materials and shared reporting of UOM among laboratories are required for the development of treatment guidelines for BK virus, CMV and EBV in the context of changes in viral load. PMID:25285125

  18. Pasteurella multocida in backyard chickens in Upper Egypt: incidence with polymerase chain reaction analysis for capsule type, virulence in chicken embryos and antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Moemen A. Mohamed

    2012-03-01

    Full Text Available The prevalence of Pasteurella multocida strains among 275 backyard chickens from different regions of Upper Egypt was studied. A total of 21 isolates of P. multocida were recovered in 21 out of 275 chickens tested (7.6% and were confirmed using phenotypic characterisation. Somatic serotyping of the 21 isolates resulted in 12 isolates being classed as serotype A:1 (57.14%, 4 as serotype A:3 (19.05% and 5 could not be typed (23.8%. Capsular typing, using multiplex polymerase chain reaction (PCR, demonstrated that 18 strains were capsular type A (85.7%, and 3 were type D (14.3%. The present findings suggest that a multiplex capsular PCR could be valuable for the rapid identification of P. multocida in cases of fowl cholera infection. A total of 5 isolates of P. multocida were selected to study their pathogenicity in embryonated chicken eggs instead of conducting a study in mature chickens. The results showed a variation in pathogenicity between the strains tested, namely: serotype A:1 strains caused 80% mortality, in contrast to 20% mortality by type D strains. Pathological findings included severe congestion of the entire embryo, haemorrhaging of the skin, feather follicles and toe, and ecchymotic haemorrhages on the liver of the inoculated embryos. The observations in this study indicate that P. multocida serogroup A could be highly pathogenic for mature chickens and therefore might be a cause of considerable economic losses in commercial production. A total of 10 isolates were subjected to antimicrobial susceptibility to determine the minimal inhibitory concentration of 7 antimicrobials. All isolates were susceptible to ciprofloxacin, florfenicol, streptomycin and sulphamethoxazol with trimethoprim and with varying degrees of sensitivity to the other agents.

  19. Human parvovirus B19, varicella zoster virus, and human herpesvirus-6 in mesenchymal stem cells of patients with osteoarthritis: analysis with quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Rollín, R; Alvarez-Lafuente, R; Marco, F; Jover, J A; Hernández-García, C; Rodríguez-Navas, C; López-Durán, L; Fernández-Gutiérrez, B

    2007-04-01

    To investigate whether there is a possible viral transmission using mesenchymal stem cells (MSCs) in autologous or allogeneic transplantation in the context of osteoarthritis (OA) patients. The presence of parvovirus B19 (B19), varicella zoster virus (VZV), and human herpesvirus-6 (HHV-6) was studied in MSCs from bone marrow of patients with OA and healthy controls. MSCs were prepared from bone marrow aspirates obtained from 18 patients undergoing joint replacement as a result of OA and from 10 healthy controls. DNA was extracted from primary MSCs' culture established from these cells and quantitative real-time polymerase chain reaction was performed to analyse the prevalence and viral load of B19, VZV and HHV-6. The prevalence of total viral DNA among patients with OA was 16.7% (3/18), with a mean viral load of 29.7 copies/microg of DNA. One out of 18 was positive for B19 (viral load, 61.2 copies/microg of DNA), two for VZV (mean viral load, 14.4 copies/microg of DNA), and none for HHV-6. The prevalence of total viral DNA in the control group was 20% (2/10), with a mean viral load of 13.4 copies/microg of DNA. Both positive results were of B19 parvoviruses. There were no statistically significant differences among patients and controls. This first approach to the viral prevalence in MSCs of bone marrow in OA patients and healthy controls seems to show a very low risk of viral transmission or reactivation in a possible MSCs' transplantation.

  20. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

    OpenAIRE

    İLHAK, O. İrfan; ARSLAN, Ali

    2014-01-01

    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  1. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin

    2005-01-01

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  2. Automated generation of burnup chain for reactor analysis applications

    International Nuclear Information System (INIS)

    Tran, Viet-Phu; Tran, Hoai-Nam; Yamamoto, Akio; Endo, Tomohiro

    2017-01-01

    This paper presents the development of an automated generation of burnup chain for reactor analysis applications. Algorithms are proposed to reevaluate decay modes, branching ratios and effective fission product (FP) cumulative yields of a given list of important FPs taking into account intermediate reactions. A new burnup chain is generated using the updated data sources taken from the JENDL FP decay data file 2011 and Fission yields data file 2011. The new burnup chain is output according to the format for the SRAC code system. Verification has been performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Burnup calculations using the new burnup chain have also been performed based on UO_2 and MOX fuel pin cells and compared with a reference chain th2cm6fp193bp6T.

  3. Automated generation of burnup chain for reactor analysis applications

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Viet-Phu [VINATOM, Hanoi (Viet Nam). Inst. for Nuclear Science and Technology; Tran, Hoai-Nam [Duy Tan Univ., Da Nang (Viet Nam). Inst. of Research and Development; Yamamoto, Akio; Endo, Tomohiro [Nagoya Univ., Nagoya-shi (Japan). Dept. of Materials, Physics and Energy Engineering

    2017-05-15

    This paper presents the development of an automated generation of burnup chain for reactor analysis applications. Algorithms are proposed to reevaluate decay modes, branching ratios and effective fission product (FP) cumulative yields of a given list of important FPs taking into account intermediate reactions. A new burnup chain is generated using the updated data sources taken from the JENDL FP decay data file 2011 and Fission yields data file 2011. The new burnup chain is output according to the format for the SRAC code system. Verification has been performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Burnup calculations using the new burnup chain have also been performed based on UO{sub 2} and MOX fuel pin cells and compared with a reference chain th2cm6fp193bp6T.

  4. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

    Science.gov (United States)

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

  5. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  6. Polymerase chain reaction: Theory, practice and application: A review

    Directory of Open Access Journals (Sweden)

    S E Atawodi

    2010-01-01

    Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

  7. Development of the polymerase chain reaction for diagnosis of chancroid.

    Science.gov (United States)

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

    1993-01-01

    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  8. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

    Science.gov (United States)

    Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

    2012-11-16

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

  9. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  10. Early detection of typhoid by polymerase chain reaction

    International Nuclear Information System (INIS)

    Haque, A.; Qureshi, Javed A.; Ahmed, J.

    1999-01-01

    Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

  11. Theory and applications of the polymerase chain reaction.

    Science.gov (United States)

    Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

    1990-04-01

    The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

  12. Automated generation of burnup chain for reactor analysis applications

    International Nuclear Information System (INIS)

    Tran Viet Phu; Tran Hoai Nam; Akio Yamamoto; Tomohiro Endo

    2015-01-01

    This paper presents the development of an automated generation of a new burnup chain for reactor analysis applications. The JENDL FP Decay Data File 2011 and Fission Yields Data File 2011 were used as the data sources. The nuclides in the new chain are determined by restrictions of the half-life and cumulative yield of fission products or from a given list. Then, decay modes, branching ratios and fission yields are recalculated taking into account intermediate reactions. The new burnup chain is output according to the format for the SRAC code system. Verification was performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Further development and applications are being planned with the burnup chain code. (author)

  13. Markov chain aggregation and its applications to combinatorial reaction networks.

    Science.gov (United States)

    Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz

    2014-09-01

    We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

  14. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    Science.gov (United States)

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  15. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    Science.gov (United States)

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  16. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium.

    Science.gov (United States)

    Die, Jose V; Baldwin, Ransom L; Rowland, Lisa J; Li, Robert; Oh, Sunghee; Li, Congjun; Connor, Erin E; Ranilla, Maria-Jose

    2017-01-01

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following introduction of solid feed to the weaning neonate as well as affecting the metabolism of other nutrients and absorption of nutrients in in vitro experiments. The objective of the present study was to validate expression stability of eight putative reference genes bovine rumen, considering the intrinsic heterogeneity of bovine rumen with regard to different luminal characteristics due to direct infusion of butyrate to double the intra-ruminal content of the rumen liquor. Our focus was on identifying stable reference genes which are suitable to normalize real-time RT-qPCR experiments from rumen samples collected from clinical assays, irrespective of localization within the organ and the across physiological state. The most stably expressed genes included: ACTB, UXT, DBNDD2, RPS9, DDX54 and HMBS. Their high stability values suggest these reference genes will facilitate better evaluation of variation of across an array of conditions including: localization within the rumen, differences among cattle fed an array of rations, as well as response to development in the weaning animal. Moreover, we anticipate these reference genes may be useful for expression studies in other ruminants.

  17. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR analysis in the rumen epithelium.

    Directory of Open Access Journals (Sweden)

    Jose V Die

    Full Text Available The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following introduction of solid feed to the weaning neonate as well as affecting the metabolism of other nutrients and absorption of nutrients in in vitro experiments. The objective of the present study was to validate expression stability of eight putative reference genes bovine rumen, considering the intrinsic heterogeneity of bovine rumen with regard to different luminal characteristics due to direct infusion of butyrate to double the intra-ruminal content of the rumen liquor. Our focus was on identifying stable reference genes which are suitable to normalize real-time RT-qPCR experiments from rumen samples collected from clinical assays, irrespective of localization within the organ and the across physiological state. The most stably expressed genes included: ACTB, UXT, DBNDD2, RPS9, DDX54 and HMBS. Their high stability values suggest these reference genes will facilitate better evaluation of variation of across an array of conditions including: localization within the rumen, differences among cattle fed an array of rations, as well as response to development in the weaning animal. Moreover, we anticipate these reference genes may be useful for expression studies in other ruminants.

  18. Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

    Science.gov (United States)

    Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

    2011-03-01

    The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

  19. Analysis of transcriptional isoforms of collagen types IX, II, and I in the developing avian cornea by competitive polymerase chain reaction.

    Science.gov (United States)

    Fitch, J M; Gordon, M K; Gibney, E P; Linsenmayer, T F

    1995-01-01

    The genes for the alpha 1(IX), alpha 1(II), and alpha 2(I) collagen chains can give rise to different isoforms of mRNA, generated by alternative promotor usage [for alpha 1(IX) and alpha 2(I)] or alternative splicing [for alpha 1(II)]. In this study, we employed competitive reverse transcriptase PCR to quantitate the amounts of transcriptional isoforms for these genes in the embryonic avian cornea from its inception (about 3 1/2 days of development) to 11 days. In order to compare values at different time points, the results were normalized to those obtained for the "housekeeping" enzyme, glycerol-3-phosphate dehydrogenase (G3PDH). These values were compared to those obtained from other tissues (anterior optic cup and cartilage) that synthesize different combinations of the collagen isoforms. We found that, in the cornea, transcripts from the upstream promotor of alpha 1(IX) collagen (termed "long IX") were predominant at stage 18-20 (about 3 1/2 days), but then fell rapidly, and remained at a low level. By 5 days (just before stromal swelling) the major mRNA isoform of alpha 1(IX) was from the downstream promoter (termed "short IX"). The relative amount of transcript for the short form of type IX collagen rose to a peak at about 6 days of development, and then declined. Throughout this period, the predominant transcriptional isoform of the collagen type II gene was IIA (i.e., containing the alternatively spliced exon 2). This indicates that the molecules of type II collagen that are assembled into heterotypic fibrils with type I collagen possess, at least transiently, an amino-terminal globular domain similar to that found in collagen types I, III, and V. For type I, the "bone/tendon" mRNA isoform of the alpha 2(I) collagen gene was predominant; transcripts from the downstream promotor were at basal levels. In other tissues expressing collagen types IX and II, long IX was expressed predominantly with the IIA form in the anterior optic cup at stage 22/23; in 14 1

  20. Detecting beef meatball contamination with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hoda A.

    2017-10-01

    Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.

  1. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-01-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  2. A polymerase chain reaction strategy for the diagnosis of camelpox.

    Science.gov (United States)

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

    2009-03-01

    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  3. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  4. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    Directory of Open Access Journals (Sweden)

    Anupam Berwal

    2017-01-01

    Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

  5. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  6. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  7. Evidence of simian retrovirus type D by polymerase chain reaction.

    Science.gov (United States)

    Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

    2017-06-01

    Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis.

    Science.gov (United States)

    Fan, Hongxin; Robetorye, Ryan S

    2013-01-01

    Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.

  9. Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve analysis.

    Science.gov (United States)

    Kongklieng, Amornmas; Intapan, Pewpan M; Boonmars, Thidarut; Thanchomnang, Tongjit; Janwan, Penchom; Sanpool, Oranuch; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

    2015-03-01

    A real-time fluorescence resonance energy transfer polymerase chain reaction (qFRET PCR) coupled with melting curve analysis was developed for detection of Babesia canis vogeli and Hepatozoon canis infections in canine blood samples in a single tube assay. The target of the assay was a region within the 18S ribosomal RNA gene amplified in either species by a single pair of primers. Following amplification from the DNA of infected dog blood, a fluorescence melting curve analysis was done. The 2 species, B. canis vogeli and H. canis, could be detected and differentiated in infected dog blood samples (n = 37) with high sensitivity (100%). The detection limit for B. canis vogeli was 15 copies of a positive control plasmid, and for H. canis, it was 150 copies of a positive control plasmid. The assay could simultaneously distinguish the DNA of both parasites from the DNA of controls. Blood samples from 5 noninfected dogs were negative, indicating high specificity. Several samples can be run at the same time. The assay can reduce misdiagnosis and the time associated with microscopic examination, and is not prone to the carryover contamination associated with the agarose gel electrophoresis step of conventional PCR. In addition, this qFRET PCR method would be useful to accurately determine the range of endemic areas or to discover those areas where the 2 parasites co-circulate. © 2015 The Author(s).

  10. Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

    Science.gov (United States)

    Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

    2016-01-01

    Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

  11. A study of the frequency of infection of peripheral blood mononuclear cells of chronic hepatitis B virus carriers using the polymerase chain reaction and hybridization analysis

    Energy Technology Data Exchange (ETDEWEB)

    Yap, S F; Wong, P W; Goh, K L; Wong, N W [Malaya Univ., Kuala Lumpur (Malaysia). Depts. of Pathology and Dept. of Medicine

    1994-05-01

    Peripheral blood mononuclear cells (PBMCs) from 100 consecutive chronic carriers of the Hepatitis B virus (HBV) were analysed to determine the frequency of infection of the PBMCs. Cells were isolated using a ficoll gradient and DNA extracted by phenol following an overnight incubation with proteinase K and tween-20. Target nucleic acid were amplified using a set of primers spanning the S region of the viral genome between nucleotides 79 and 761. Following amplification, the samples were gel electrophoresed and the fragments visualized by ethidium bromide staining. The presence of a fragment of about 720 bp was taken as indicative of specific amplification of the HBV nucleic acid sequences. Specificity of amplification was confirmed by hybridization analysis using virus specific probes. Thirty-six out of 41 (87.8%) HBeAg seropositive cases and 15/54 (27.8%) anti-HBe positive cases had HBV DNA detectable by gel electrophoresis. Following hybridization all carriers were found to harbour the virus in their mononuclear cells. The sensitivity using ethidium bromide staining to visualize the amplified sequences was about 1 pg. With hybridization analysis, sensitivity was increased about 10{sup 5}-fold. (author). 12 refs, 1 fig., 1 tab.

  12. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    Science.gov (United States)

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  13. Social network analysis and supply chain management

    Directory of Open Access Journals (Sweden)

    Raúl Rodríguez Rodríguez

    2016-01-01

    Full Text Available This paper deals with social network analysis and how it could be integrated within supply chain management from a decision-making point of view. Even though the benefits of using social analysis have are widely accepted at both academic and industry/services context, there is still a lack of solid frameworks that allow decision-makers to connect the usage and obtained results of social network analysis – mainly both information and knowledge flows and derived results- with supply chain management objectives and goals. This paper gives an overview of social network analysis, the main social network analysis metrics, supply chain performance and, finally, it identifies how future frameworks could close the gap and link the results of social network analysis with the supply chain management decision-making processes.

  14. Suitability of DNA extracted from archival specimens of fruit-eating bats of the genus Artibeus (Chiroptera, Phyllostomidae for polymerase chain reaction and sequencing analysis

    Directory of Open Access Journals (Sweden)

    Mário Pinzan Scatena

    2008-01-01

    Full Text Available To establish a technique which minimized the effects of fixation on the extraction of DNA from formalin-fixed tissues preserved in scientific collections we extracted DNA samples from fixed tissues using different methods and evaluated the effect of the different procedures on PCR and sequencing analysis. We investigated muscle and liver tissues from museum specimens of five species of fruit-eating (frugivorous bats of the Neotropical genus Artibeus (Chiroptera, Phyllostomidae: A. fimbriatus, A. lituratus, A. jamaicensis, A. obscurus, and A. planirostris. The results indicated that treatment of tissues in buffered solutions at neutral pH and about 37 °C for at least four days improves the quality and quantity of extracted DNA and the quality of the amplification and sequencing products. However, the comparison between the performance of DNA obtained from fixed and fresh tissues showed that, in spite of the fact that both types of tissue generate reliable sequences for use in phylogenetic analyses, DNA samples from fixed tissues presented a larger rate of errors in the different stages of the study. These results suggest that DNA extracted from formalin-fixed tissue can be used in molecular studies of Neotropical Artibeus bats and that our methodology may be applicable to other animal groups.

  15. Retrospective analysis of multiplex polymerase chain reaction-based molecular diagnostics (SES in 70 patients with suspected central nervous system infections: A single-center study

    Directory of Open Access Journals (Sweden)

    Rama Krishnan Tiruppur Chinnappan Ramalingam

    2016-01-01

    Full Text Available Background: Central nervous system (CNS infections present a grave health care challenge due to high morbidity and mortality. Clinical findings and conventional laboratory assessments are not sufficiently distinct for specific etiologic diagnosis. Identification of pathogens is a key to appropriate therapy. Aim: In this retrospective observational study, we evaluated the efficacy and clinical utility of syndrome evaluation system (SES for diagnosing clinically suspected CNS infections. Materials and Methods: This retrospective analysis included inpatients in our tertiary level neurointensive care unit (NICU and ward from February 2010 to December 2013. Cerebrospinal fluid (CSF samples of 70 patients, clinically suspected of having CNS infections, were subjected to routine laboratory tests, culture, imaging, and SES. We analyzed the efficacy of SES in the diagnosis of CNS infections and its utility in therapeutic decision-making. Results: SES had a clinical sensitivity of 57.4% and clinical specificity of 95.6%. Streptococcus pneumoniae and Pseudomonas aeruginosa were the top two bacterial pathogens, whereas Herpes simplex virus (HSV was the most common viral pathogen. Polymicrobial infections were detected in 32.14% of SES-positive cases. SES elicited a change in the management in 30% of the patients from initial empiric therapy. At discharge, 51 patients recovered fully while 11 patients had partial recovery. Three-month follow-up showed only six patients to have neurological deficits. Conclusion: In a tertiary care center, etiological microbial diagnosis is central to appropriate therapy and outcomes. Sensitive and accurate multiplex molecular diagnostics play a critical role in not only identifying the causative pathogen but also in helping clinicians to institute appropriate therapy, reduce overuse of antimicrobials, and ensure superior clinical outcomes.

  16. Retrospective analysis of multiplex polymerase chain reaction-based molecular diagnostics (SES) in 70 patients with suspected central nervous system infections: A single-center study.

    Science.gov (United States)

    Ramalingam, Rama Krishnan Tiruppur Chinnappan; Chakraborty, Dipanjan

    2016-01-01

    Central nervous system (CNS) infections present a grave health care challenge due to high morbidity and mortality. Clinical findings and conventional laboratory assessments are not sufficiently distinct for specific etiologic diagnosis. Identification of pathogens is a key to appropriate therapy. In this retrospective observational study, we evaluated the efficacy and clinical utility of syndrome evaluation system (SES) for diagnosing clinically suspected CNS infections. This retrospective analysis included inpatients in our tertiary level neurointensive care unit (NICU) and ward from February 2010 to December 2013. Cerebrospinal fluid (CSF) samples of 70 patients, clinically suspected of having CNS infections, were subjected to routine laboratory tests, culture, imaging, and SES. We analyzed the efficacy of SES in the diagnosis of CNS infections and its utility in therapeutic decision-making. SES had a clinical sensitivity of 57.4% and clinical specificity of 95.6%. Streptococcus pneumoniae and Pseudomonas aeruginosa were the top two bacterial pathogens, whereas Herpes simplex virus (HSV) was the most common viral pathogen. Polymicrobial infections were detected in 32.14% of SES-positive cases. SES elicited a change in the management in 30% of the patients from initial empiric therapy. At discharge, 51 patients recovered fully while 11 patients had partial recovery. Three-month follow-up showed only six patients to have neurological deficits. In a tertiary care center, etiological microbial diagnosis is central to appropriate therapy and outcomes. Sensitive and accurate multiplex molecular diagnostics play a critical role in not only identifying the causative pathogen but also in helping clinicians to institute appropriate therapy, reduce overuse of antimicrobials, and ensure superior clinical outcomes.

  17. Use of competitive polymerase chain reaction to determine HIV-1 levels in response to antiviral treatments

    NARCIS (Netherlands)

    Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.

    1993-01-01

    OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind

  18. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  19. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  20. O6-Methylguanine-DNA methyltransferase protein expression by immunohistochemistry in brain and non-brain systemic tumours: systematic review and meta-analysis of correlation with methylation-specific polymerase chain reaction

    International Nuclear Information System (INIS)

    Brell, Marta; Ibáñez, Javier; Tortosa, Avelina

    2011-01-01

    The DNA repair protein O 6 -Methylguanine-DNA methyltransferase (MGMT) confers resistance to alkylating agents. Several methods have been applied to its analysis, with methylation-specific polymerase chain reaction (MSP) the most commonly used for promoter methylation study, while immunohistochemistry (IHC) has become the most frequently used for the detection of MGMT protein expression. Agreement on the best and most reliable technique for evaluating MGMT status remains unsettled. The aim of this study was to perform a systematic review and meta-analysis of the correlation between IHC and MSP. A computer-aided search of MEDLINE (1950-October 2009), EBSCO (1966-October 2009) and EMBASE (1974-October 2009) was performed for relevant publications. Studies meeting inclusion criteria were those comparing MGMT protein expression by IHC with MGMT promoter methylation by MSP in the same cohort of patients. Methodological quality was assessed by using the QUADAS and STARD instruments. Previously published guidelines were followed for meta-analysis performance. Of 254 studies identified as eligible for full-text review, 52 (20.5%) met the inclusion criteria. The review showed that results of MGMT protein expression by IHC are not in close agreement with those obtained with MSP. Moreover, type of tumour (primary brain tumour vs others) was an independent covariate of accuracy estimates in the meta-regression analysis beyond the cut-off value. Protein expression assessed by IHC alone fails to reflect the promoter methylation status of MGMT. Thus, in attempts at clinical diagnosis the two methods seem to select different groups of patients and should not be used interchangeably

  1. O6-Methylguanine-DNA methyltransferase protein expression by immunohistochemistry in brain and non-brain systemic tumours: systematic review and meta-analysis of correlation with methylation-specific polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Ibáñez Javier

    2011-01-01

    Full Text Available Abstract Background The DNA repair protein O6-Methylguanine-DNA methyltransferase (MGMT confers resistance to alkylating agents. Several methods have been applied to its analysis, with methylation-specific polymerase chain reaction (MSP the most commonly used for promoter methylation study, while immunohistochemistry (IHC has become the most frequently used for the detection of MGMT protein expression. Agreement on the best and most reliable technique for evaluating MGMT status remains unsettled. The aim of this study was to perform a systematic review and meta-analysis of the correlation between IHC and MSP. Methods A computer-aided search of MEDLINE (1950-October 2009, EBSCO (1966-October 2009 and EMBASE (1974-October 2009 was performed for relevant publications. Studies meeting inclusion criteria were those comparing MGMT protein expression by IHC with MGMT promoter methylation by MSP in the same cohort of patients. Methodological quality was assessed by using the QUADAS and STARD instruments. Previously published guidelines were followed for meta-analysis performance. Results Of 254 studies identified as eligible for full-text review, 52 (20.5% met the inclusion criteria. The review showed that results of MGMT protein expression by IHC are not in close agreement with those obtained with MSP. Moreover, type of tumour (primary brain tumour vs others was an independent covariate of accuracy estimates in the meta-regression analysis beyond the cut-off value. Conclusions Protein expression assessed by IHC alone fails to reflect the promoter methylation status of MGMT. Thus, in attempts at clinical diagnosis the two methods seem to select different groups of patients and should not be used interchangeably.

  2. Hydropower Manufacturing and Supply Chain Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Cotrell, Jason R [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2018-01-02

    Hydropower Manufacturing and Supply Chain Analysis presentation from the WPTO FY14-FY16 Peer Review. The project objective is to provide data and insights to inform investment strategies, policy, and other decisions to promote economic growth and manufacturing.

  3. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  4. Analytic study of the chain dark decomposition reaction of iodides - atomic iodine donors - in the active medium of a pulsed chemical oxygen-iodine laser: 1. Criteria for the development of the branching chain dark decomposition reaction of iodides

    International Nuclear Information System (INIS)

    Andreeva, Tamara L; Kuznetsova, S V; Maslov, Aleksandr I; Sorokin, Vadim N

    2009-01-01

    The scheme of chemical processes proceeding in the active medium of a pulsed chemical oxygen-iodine laser (COIL) is analysed. Based on the analysis performed, the complete system of differential equations corresponding to this scheme is replaced by a simplified system of equations describing in dimensionless variables the chain dark decomposition of iodides - atomic iodine donors, in the COIL active medium. The procedure solving this system is described, the basic parameters determining the development of the chain reaction are found and its specific time intervals are determined. The initial stage of the reaction is analysed and criteria for the development of the branching chain decomposition reaction of iodide in the COIL active medium are determined. (active media)

  5. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    Science.gov (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  6. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    Science.gov (United States)

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  7. Hybridization chain reaction: a versatile molecular tool for biosensing, bioimaging, and biomedicine.

    Science.gov (United States)

    Bi, Sai; Yue, Shuzhen; Zhang, Shusheng

    2017-07-17

    Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.

  8. The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

    International Nuclear Information System (INIS)

    Sun Jiazhen

    2003-01-01

    Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

  9. Analysis of kinetic reaction mechanisms

    CERN Document Server

    Turányi, Tamás

    2014-01-01

    Chemical processes in many fields of science and technology, including combustion, atmospheric chemistry, environmental modelling, process engineering, and systems biology, can be described by detailed reaction mechanisms consisting of numerous reaction steps. This book describes methods for the analysis of reaction mechanisms that are applicable in all these fields. Topics addressed include: how sensitivity and uncertainty analyses allow the calculation of the overall uncertainty of simulation results and the identification of the most important input parameters, the ways in which mechanisms can be reduced without losing important kinetic and dynamic detail, and the application of reduced models for more accurate engineering optimizations. This monograph is invaluable for researchers and engineers dealing with detailed reaction mechanisms, but is also useful for graduate students of related courses in chemistry, mechanical engineering, energy and environmental science and biology.

  10. Identification of duck plague virus by polymerase chain reaction

    Science.gov (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  11. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

  12. Value chain analysis in quality management context

    Directory of Open Access Journals (Sweden)

    Popescu, M.

    2011-01-01

    Full Text Available Based on the description of value chain analysis, which is a strategic management tool attributed to Michel Porter, the paper aims to demonstrate that quality management applies this method, under specific forms. The paper's specific objectives are: to redefine the functions of value chain analysis in the context of quality management; to clarify the significance and the possibilities of measuring the value added; to present management tools and techniques needed to control and systematically improve performance. Research methodology is based on examples, previous studies and a case study that reveals the diversity of indicators for measuring the value added and analysis tools used in quality management.

  13. The effect of composition of mixture on rate of radiation initiation of chain reactions

    International Nuclear Information System (INIS)

    Poluehktov, V.A.; Begishev, I.R.; Podkhalyuzin, A.T.; Babkina, Eh.I.; Morozov, V.A.; Shapovalov, V.V.

    1977-01-01

    The effect of the composition of starting components on the rate of a number of chain liquid-phase reactions initiated by γ-quanta of Co 60 has been investigated at constant temperature and dosage rate. In regard to 1,1-difluoroethane chlorination, cyclohexene phosphorylation and adamantane alkylation with hexafluoropropylene reactions, abnormal effect of the reagent compositions on reaction rates has been discovered. The possible radical - starting molecule complexing reaction and molecular complexing from the starting components have been considered

  14. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng; Qu, Chengke; He, Junpo

    2015-01-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b

  15. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary

    2012-08-01

    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  16. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction.

    Science.gov (United States)

    Cobbs, Gary

    2012-08-16

    Numerous models for use in interpreting quantitative PCR (qPCR) data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the literature. They also give better estimates of

  17. Selective amplification of T-cell receptor variable region species is demonstrable but not essential in early lesions of psoriasis vulgaris: analysis by anchored polymerase chain reaction and hypervariable region size spectratyping.

    Science.gov (United States)

    Vekony, M A; Holder, J E; Lee, A J; Horrocks, C; Eperon, I C; Camp, R D

    1997-07-01

    Several groups have investigated the role of T cells in the pathogenesis of psoriasis by determination of T-cell receptor (TCR) B-chain variable (V) region usage, both in chronic plaque (psoriasis vulgaris) and guttate forms, with various results. Because there are no data on TCR expression in early psoriasis vulgaris, when specific cellular immune events may be expected to be most pronounced, we have analyzed early lesions (less than 3 wk old) of ten patients, with highly reproducible results. We have developed a highly controlled anchored polymerase chain reaction (PCR) method in which TCR beta chain species are all amplified with the same primer pair and products are quantified by dot blot hybridization with BV family-specific oligonucleotide probes. Overexpression of certain TCR BV genes was observed in the majority of lesional biopsies, but in samples in which the expanded BV family formed more than 10% of total lesional BV (half of the samples analyzed), BV2 and BV6 predominated. The consistency of overexpression of these BV species between patients was much less than in previous studies of TCRBV usage in established chronic plaque psoriasis lesions. Complementarity-determining region 3 (CDR3) size spectratyping demonstrated evidence for selective clonal T cell accumulation in less than half of the lesional samples showing BV expansion. These results indicate that selective amplification of TCRBV species occurs in early psoriasis vulgaris but is not essential to the pathogenic process and may be more important in the maintenance or expansion of chronic lesions.

  18. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  19. Quantitative analysis of waterfowl parvoviruses in geese and Muscovy ducks by real-time polymerase chain reaction: correlation between age, clinical symptoms and DNA copy number of waterfowl parvoviruses

    Directory of Open Access Journals (Sweden)

    Woźniakowski Grzegorz

    2012-03-01

    Full Text Available Abstract Background Waterfowl parvoviruses cause serious loss in geese and ducks production. Goose parvovirus (GPV is infectious for geese and ducks while Muscovy duck parvovirus (MDPV infects Muscovy ducks only. So far, for these viruses' sensitive detection polymerase chain reaction (PCR and loop-mediated isothermal amplification (LAMP were applied. However, there was no molecular biology method for both waterfowl parvoviruses detection and quantification which could unify the laboratory procedures. The level of GPV and MDPV replication and distribution plays a significant role in the parvoviral infection progress and is strictly correlated to clinical symptoms. Meanwhile, experiments conducted previously on GPV distribution in geese, performed as animal trial, did not involve epidemiological data from the disease field cases. The study on the correlation between age, clinical symptoms and viral DNA copy number may be benefitable in understanding the GPV and MDPV infection. Such data may also aid in determination of the stage and severity of the infection with parvoviruses. Therefore the aim of this study was to develop quantitative real-time PCR for parallel detection of GPV and MDPV in geese and Muscovy ducks and to determine the correlation between the age of the infected birds, clinical symptoms and DNA copy number for the estimation of the disease stage or severity. Results In order to develop quantitative real-time PCR the viral material was collected from 13 farms of geese and 3 farms of Muscovy ducks. The designed primers and Taqman probe for real-time PCR were complementary to GPV and MDPV inverted terminal repeats region. The pITR plasmid was constructed, purified and used to prepare dilutions for standard curve preparation and DNA quantification. The applied method detected both GPV and MDPV in all the examined samples extracted from the heart and liver of the infected birds. The conducted correlation tests have shown relationship

  20. Investigating radical cation chain processes in the electrocatalytic Diels-Alder reaction.

    Science.gov (United States)

    Imada, Yasushi; Okada, Yohei; Chiba, Kazuhiro

    2018-01-01

    Single electron transfer (SET)-triggered radical ion-based reactions have proven to be powerful options in synthetic organic chemistry. Although unique chain processes have been proposed in various photo- and electrochemical radical ion-based transformations, the turnover number, also referred to as catalytic efficiency, remains unclear in most cases. Herein, we disclose our investigations of radical cation chain processes in the electrocatalytic Diels-Alder reaction, leading to a scalable synthesis. A gram-scale synthesis was achieved with high current efficiency of up to 8000%. The reaction monitoring profiles showed sigmoidal curves with induction periods, suggesting the involvement of intermediate(s) in the rate determining step.

  1. Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.

    Science.gov (United States)

    Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François

    2010-04-01

    To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.

  2. Energy Chain Analysis of Passenger Car Transport

    Directory of Open Access Journals (Sweden)

    Hans Jakob Walnum

    2011-02-01

    Full Text Available Transport makes up 20 percent of the World’s energy use; in OECD countries this has exceeded 30 percent. The International Energy Agency (IEA estimates that the global energy consumption will increase by 2.1 percent annually, a growth rate that is higher than for any other sector. The high energy consumption means that transportation accounts for nearly 30 percent of CO2 emission in OECD countries and is also one of the main sources of regional and local air pollution. In this article, we analyze energy consumption and greenhouse gas emissions from passenger car transport using an energy chain analysis. The energy chain analysis consists of three parts: the net direct energy use, the energy required for vehicle propulsion; the gross direct chain, which includes the net direct energy consumption plus the energy required to produce it; and, finally, the indirect energy chain, which includes the energy consumption for production, maintenance and operation of infrastructure plus manufacturing of the vehicle itself. In addition to energy consumption, we also analyze emissions of greenhouse gases measured by CO2-equivalents. We look at the trade-offs between energy use and greenhouse gas emissions to see whether some drivetrains and fuels perform favourable on both indicators. Except for the case of electric cars, where hydropower is the only energy source in the Norwegian context, no single car scores favourably on both energy consumption and greenhouse gas emissions.

  3. Identification of aflatoxigenic fungi using polymerase chain reaction-based assay

    Directory of Open Access Journals (Sweden)

    Šošo Vladislava M.

    2014-01-01

    Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009

  4. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    Science.gov (United States)

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  5. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

    Science.gov (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-08-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

  6. Specific Identification of Biomphalaria tenagophila and Biomphalaria occidentalis Populations by the Low Stringency Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Edina Rodrigues Pires

    1997-01-01

    Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive

  7. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    Garrison, W.M.

    1983-11-01

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  8. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    International Nuclear Information System (INIS)

    East, L.V.

    1994-05-01

    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

  9. Detection of Cryptosporidium species in feces or gastric contents from snakes and lizards as determined by polymerase chain reaction analysis and partial sequencing of the 18S ribosomal RNA gene.

    Science.gov (United States)

    Richter, Barbara; Nedorost, Nora; Maderner, Anton; Weissenböck, Herbert

    2011-05-01

    Cryptosporidiosis is a well-known gastrointestinal disease of snakes and lizards. In the current study, 672 samples (feces and/or gastric contents or regurgitated food items) of various snakes and lizards were examined for the presence of cryptosporidia by polymerase chain reaction (PCR) assay targeting a part of the 18S ribosomal RNA gene. A consecutive sequencing reaction was used to identify the cryptosporidian species present in PCR-positive samples. Cryptosporidium varanii (saurophilum) was detected in 17 out of 106 (16%) samples from corn snakes (Pantherophis guttatus) and in 32 out of 462 (7%) samples from leopard geckos (Eublepharis macularius). Cryptosporidium serpentis was found in 8 out of 462 (2%) leopard gecko samples, but in no other reptile. The Cryptosporidium sp. "lizard genotype" was present in 1 leopard gecko sample, and 1 sample from a corn snake showed a single nucleotide mismatch to this genotype. Pseudoparasitic cryptosporidian species were identified in 5 out of 174 (3%) ophidian samples, but not in lizards. Other sequences did not show complete similarity to previously published Cryptosporidium sequences. The results stress the importance for diagnostic methods to be specific for Cryptosporidium species especially in snakes and show a relatively high prevalence of C. varanii in leopard geckos and corn snakes. © 2011 The Author(s)

  10. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    Science.gov (United States)

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  11. Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

    Science.gov (United States)

    Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

    2013-03-28

    This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

  12. Analysis of supply chain management of N1-EAM project

    International Nuclear Information System (INIS)

    Wu Jize; Liu Xujia; Liu Huanhuan

    2014-01-01

    Supply chain management directly affect the safe and stable operation of nuclear power plants. China's nuclear power production management information system N1-EAM covers supply chain management business. This paper firstly N1-EAM supply chain management functions, advanced analysis of business processes, Qinshan area combined with supply chain management situation, the initial application of the proposed solutions. (authors)

  13. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  14. Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

    Science.gov (United States)

    Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

    2004-03-01

    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

  15. Real-time ligation chain reaction for DNA quantification and identification on the FO-SPR.

    Science.gov (United States)

    Knez, Karel; Spasic, Dragana; Delport, Filip; Lammertyn, Jeroen

    2015-05-15

    Different assays have been developed in the past years to meet point-of-care diagnostic tests requirements for fast and sensitive quantification and identification of targets. In this paper, we developed the ligation chain reaction (LCR) assay on the Fiber Optic Surface Plasmon Resonance (FO-SPR) platform, which enabled simultaneous quantification and cycle-to-cycle identification of DNA during amplification. The newly developed assay incorporated FO-SPR DNA melting assay, previously developed by our group. This required establishment of several assay parameters, including buffer ionic strength and thermal ramping speed as these parameters both influence the ligation enzyme performance and the hybridization yield of the gold nanoparticles (Au NPs) on the FO-SPR sensor. Quantification and identification of DNA targets was achieved over a wide concentration range with a calibration curve spanning 7 orders of magnitude and LOD of 13.75 fM. Moreover, the FO-SPR LCR assay could discriminate single nucleotide polymorphism (SNPs) without any post reaction analysis, featuring thus all the essential requirements of POC tests. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

    National Research Council Canada - National Science Library

    McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

    2005-01-01

    ...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

  17. Time-resolved studies of free radicals and laser-initiated chain reactions: Final report, 1 April 1979-31 March 1988

    International Nuclear Information System (INIS)

    Leone, S.R.

    1988-03-01

    Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH 2 I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained

  18. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  19. False-negative HIV-1 polymerase chain reaction in a 15-month-old ...

    African Journals Online (AJOL)

    Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...

  20. Evaluation of a new HTLV-I/II polymerase chain reaction

    NARCIS (Netherlands)

    Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.

    1997-01-01

    AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA

  1. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

  2. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    Science.gov (United States)

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  3. Rapid and specific identification of Yersinia pestis by using a nested polymerase chain reaction procedure.

    OpenAIRE

    Campbell, J; Lowe, J; Walz, S; Ezzell, J

    1993-01-01

    We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.

  4. Animal DNA identification in food products and animal feed by real time polymerase chain reaction method

    Directory of Open Access Journals (Sweden)

    Людмила Мар’янівна Іщенко

    2016-11-01

    Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer 

  5. Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens

    NARCIS (Netherlands)

    de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.

    1993-01-01

    The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent

  6. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  7. Real-time TaqMan polymerase chain reaction to quantify the effects ...

    African Journals Online (AJOL)

    TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...

  8. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  9. Polymerase chain Reaction in molecular biotechnology; appropriate technology for developing countries

    NARCIS (Netherlands)

    Felice, A. E.; Alshinawi, C.

    1996-01-01

    The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and

  10. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    Science.gov (United States)

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  11. Spread and epidemiology of Clostridium difficile polymerase chain reaction ribotype 027/toxinotype III in The Netherlands

    NARCIS (Netherlands)

    Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.

    2007-01-01

    After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and

  12. Emergence of Clostridium difficile infection due to a new hypervirulent strain, polymerase chain reaction ribotype 078

    NARCIS (Netherlands)

    Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.

    2008-01-01

    Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to

  13. Case Report:False-negative HIV-1 polymerase chain reaction in a ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...

  14. Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

    NARCIS (Netherlands)

    Hatta, Mochammad; Smits, Henk L.

    2007-01-01

    A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

  15. On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment

    International Nuclear Information System (INIS)

    Anghaie, S.; Froelich, P.; Monkhorst, H.J.

    1990-01-01

    In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, 6 Li nd 7 Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur

  16. Biofuel supply chain, market, and policy analysis

    Science.gov (United States)

    Zhang, Leilei

    Renewable fuel is receiving an increasing attention as a substitute for fossil based energy. The US Department of Energy (DOE) has employed increasing effort on promoting the advanced biofuel productions. Although the advanced biofuel remains at its early stage, it is expected to play an important role in climate policy in the future in the transportation sector. This dissertation studies the emerging biofuel supply chain and markets by analyzing the production cost, and the outcomes of the biofuel market, including blended fuel market price and quantity, biofuel contract price and quantity, profitability of each stakeholder (farmers, biofuel producers, biofuel blenders) in the market. I also address government policy impacts on the emerging biofuel market. The dissertation is composed with three parts, each in a paper format. The first part studies the supply chain of emerging biofuel industry. Two optimization-based models are built to determine the number of facilities to deploy, facility locations, facility capacities, and operational planning within facilities. Cost analyses have been conducted under a variety of biofuel demand scenarios. It is my intention that this model will shed light on biofuel supply chain design considering operational planning under uncertain demand situations. The second part of the dissertation work focuses on analyzing the interaction between the key stakeholders along the supply chain. A bottom-up equilibrium model is built for the emerging biofuel market to study the competition in the advanced biofuel market, explicitly formulating the interactions between farmers, biofuel producers, blenders, and consumers. The model simulates the profit maximization of multiple market entities by incorporating their competitive decisions in farmers' land allocation, biomass transportation, biofuel production, and biofuel blending. As such, the equilibrium model is capable of and appropriate for policy analysis, especially for those policies

  17. Chain reaction

    International Nuclear Information System (INIS)

    Newby-Fraser, A.R.

    1979-01-01

    This book covers a review of twenty years of nuclear research and development by the South Africa Atomic Energy Board. A wide spectrum of topics is covered, for example, uranium mining and production, the construction of the Safari-1 reactor as well as the Koeberg-1 reactor, and the irradiation of food and medical supplies

  18. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......Hypochlorous acid (HOCl) is a potent oxidant, which is produced in vivo by activated phagocytes. This compound is an important antibacterial agent, but excessive or misplaced production has been implicated in a number of human diseases, including atherosclerosis, arthritis, and some cancers....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  19. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)

    2016-05-06

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  20. Integrating structure, conduct and performance into value chain analysis

    NARCIS (Netherlands)

    Santana De Figueiredo Junior, H.; Meuwissen, M.P.M.; Oude Lansink, A.G.J.M.

    2014-01-01

    Value chain analysis has been adopted by several research and funding institutions for analysing local development opportunities. Development practitioners, however, are still looking for more solid grounds for value chain strategy development, especially since the expected outcomes of

  1. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas

    2014-11-01

    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  2. Fetal RHD Genotyping Using Real-Time Polymerase Chain Reaction Analysis of Cell-Free Fetal DNA in Pregnancy of RhD Negative Women in South of Iran

    Directory of Open Access Journals (Sweden)

    Leili Moezzi

    2016-05-01

    Full Text Available Background: Maternal-fetal RhD antigen incompatibility causes approximately 50% of clinically significant alloimmunization cases. The routine use of prophylactic anti-D immunoglobulin has dramatically reduced hemolytic disease of the fetus and newborn. Recently, fetal RHD genotyping in RhD negative pregnant women has been suggested for appropriate use of anti-D immunoglobulin antenatal prophylaxis and decrease unnecessary prenatal interventions. Materials and Methods: In this prospective cohort study, in order to develop a reliable and non-invasive method for fetal RHD genotyping, cell free fetal DNA (cffDNA was extracted from maternal plasma. Real-time quantitative polymerase chain reaction (qPCR for detection of RHD exons 7, 5, 10 and intron 4 was performed and the results were compared to the serological results of cord blood cells as the gold standard method. SRY gene and hypermethylated Ras-association domain family member 1 (RASSF1A gene were used to confirm the presence of fetal DNA in male and female fetuses, respectively. Results: Out of 48 fetuses between 8 and 32 weeks (wks of gestational age (GA, we correctly diagnosed 45 cases (93.75% of RHD positive fetuses and 2 cases (4.16% of the RHD negative one. Exon 7 was amplified in one sample, while three other RHD gene sequences were not detected; the sample was classified as inconclusive, and the RhD serology result after birth showed that the fetus was RhD-negative. Conclusion: Our results showed high accuracy of the qPCR method using cffDNA for fetal RHD genotyping and implicate on the efficiency of this technique to predict the competence of anti-D immunoglobulin administration.

  3. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931

  4. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

  5. Analysis of a quantum Markov chain

    International Nuclear Information System (INIS)

    Marbeau, J.; Gudder, S.

    1990-01-01

    A quantum chain is analogous to a classical stationary Markov chain except that the probability measure is replaced by a complex amplitude measure and the transition probability matrix is replaced by a transition amplitude matrix. After considering the general situation, we study a particular example of a quantum chain whose transition amplitude matrix has the form of a Dirichlet matrix. Such matrices generate a discrete analog of the usual continuum Feynman amplitude. We then compute the probability distribution for these quantum chains

  6. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  7. Measurement errors in polymerase chain reaction are a confounding factor for a correct interpretation of 5-HTTLPR polymorphism effects on lifelong premature ejaculation: a critical analysis of a previously published meta-analysis of six studies.

    Science.gov (United States)

    Janssen, Paddy K C; Olivier, Berend; Zwinderman, Aeilko H; Waldinger, Marcel D

    2014-01-01

    To analyze a recently published meta-analysis of six studies on 5-HTTLPR polymorphism and lifelong premature ejaculation (PE). Calculation of fraction observed and expected genotype frequencies and Hardy Weinberg equilibrium (HWE) of cases and controls. LL,SL and SS genotype frequencies of patients were subtracted from genotype frequencies of an ideal population (LL25%, SL50%, SS25%, p = 1 for HWE). Analysis of PCRs of six studies and re-analysis of the analysis and Odds ratios (ORs) reported in the recently published meta-analysis. Three studies deviated from HWE in patients and one study deviated from HWE in controls. In three studies in-HWE the mean deviation of genotype frequencies from a theoretical population not-deviating from HWE was small: LL(1.7%), SL(-2.3%), SS(0.6%). In three studies not-in-HWE the mean deviation of genotype frequencies was high: LL(-3.3%), SL(-18.5%) and SS(21.8%) with very low percentage SL genotype concurrent with very high percentage SS genotype. The most serious PCR deviations were reported in the three not-in-HWE studies. The three in-HWE studies had normal OR. In contrast, the three not-in-HWE studies had a low OR. In three studies not-in-HWE and with very low OR, inadequate PCR analysis and/or inadequate interpretation of its gel electrophoresis resulted in very low SL and a resulting shift to very high SS genotype frequency outcome. Consequently, PCRs of these three studies are not reliable. Failure to note the inadequacy of PCR tests makes such PCRs a confounding factor in clinical interpretation of genetic studies. Currently, a meta-analysis can only be performed on three studies-in-HWE. However, based on the three studies-in-HWE with OR of about 1 there is not any indication that in men with lifelong PE the frequency of LL,SL and SS genotype deviates from the general male population and/or that the SL or SS genotype is in any way associated with lifelong PE.

  8. Measurement errors in polymerase chain reaction are a confounding factor for a correct interpretation of 5-HTTLPR polymorphism effects on lifelong premature ejaculation: a critical analysis of a previously published meta-analysis of six studies.

    Directory of Open Access Journals (Sweden)

    Paddy K C Janssen

    Full Text Available OBJECTIVE: To analyze a recently published meta-analysis of six studies on 5-HTTLPR polymorphism and lifelong premature ejaculation (PE. METHODS: Calculation of fraction observed and expected genotype frequencies and Hardy Weinberg equilibrium (HWE of cases and controls. LL,SL and SS genotype frequencies of patients were subtracted from genotype frequencies of an ideal population (LL25%, SL50%, SS25%, p = 1 for HWE. Analysis of PCRs of six studies and re-analysis of the analysis and Odds ratios (ORs reported in the recently published meta-analysis. RESULTS: Three studies deviated from HWE in patients and one study deviated from HWE in controls. In three studies in-HWE the mean deviation of genotype frequencies from a theoretical population not-deviating from HWE was small: LL(1.7%, SL(-2.3%, SS(0.6%. In three studies not-in-HWE the mean deviation of genotype frequencies was high: LL(-3.3%, SL(-18.5% and SS(21.8% with very low percentage SL genotype concurrent with very high percentage SS genotype. The most serious PCR deviations were reported in the three not-in-HWE studies. The three in-HWE studies had normal OR. In contrast, the three not-in-HWE studies had a low OR. CONCLUSIONS: In three studies not-in-HWE and with very low OR, inadequate PCR analysis and/or inadequate interpretation of its gel electrophoresis resulted in very low SL and a resulting shift to very high SS genotype frequency outcome. Consequently, PCRs of these three studies are not reliable. Failure to note the inadequacy of PCR tests makes such PCRs a confounding factor in clinical interpretation of genetic studies. Currently, a meta-analysis can only be performed on three studies-in-HWE. However, based on the three studies-in-HWE with OR of about 1 there is not any indication that in men with lifelong PE the frequency of LL,SL and SS genotype deviates from the general male population and/or that the SL or SS genotype is in any way associated with lifelong PE.

  9. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Directory of Open Access Journals (Sweden)

    Lei Zhang

    2014-01-01

    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  10. Polymerase chain reaction as a tool for developing stress protein probes

    Energy Technology Data Exchange (ETDEWEB)

    Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)

    1994-08-01

    Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

  11. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction.

    Science.gov (United States)

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-11-27

    Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  12. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    Science.gov (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  13. Polymerase chain reaction detection of retinoblastoma gene deletions in paraffin-embedded mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1991-01-01

    A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  14. An exonuclease-assisted amplification electrochemical aptasensor for Hg(2+) detection based on hybridization chain reaction.

    Science.gov (United States)

    Bao, Ting; Wen, Wei; Zhang, Xiuhua; Xia, Qinghua; Wang, Shengfu

    2015-08-15

    In this work, a novel electrochemical aptasensor was developed for Hg(2+) detection based on exonuclease-assisted target recycling and hybridization chain reaction (HCR) dual signal amplification strategy. The presence of Hg(2+) induced the T-rich DNA partly folded into duplex-like structure via the Hg(2+) mediated T-Hg(2+)-T base pairs, which triggered the activity of exonuclease III (Exo III). Exo III selectively digested the double-strand DNA containing multiple T-Hg(2+)-T base pairs from its 3'-end, the released Hg(2+) participated analyte recycle. With each digestion cycle, a digestion product named as help DNA was obtained, which acted as a linkage between the capture DNA and auxiliary DNA. The presence of help DNA and two auxiliary DNA collectively facilitated successful HCR process and formed long double-stranded DNA. [Ru(NH3)6](3+) was used as redox indicator, which electrostatically bound to the double strands and produced an electrochemical signal. Exo III-assisted target recycling and HCR dual amplification significantly improved the sensitivity for Hg(2+) with a detection limit of 0.12 pM (S/N=3). Furthermore, the proposed aptasensor had a promising potential for the application of Hg(2+) detection in real aquatic sample analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. A polymerase chain reaction assay for detection of virulent and attenuated strains of duck plague virus.

    Science.gov (United States)

    Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi

    2017-11-01

    Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.

  16. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    Science.gov (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  17. Synthesis and Intramolecular [4+2] Cycloaddition Reactions of 4-Pyridazinecarbonitriles with Alkyne Side Chains

    Directory of Open Access Journals (Sweden)

    Norbert Haider

    1998-01-01

    Full Text Available The preparation of a series of new 3-(alkynyl-X-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2] cycloaddition reaction.

  18. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain

    2010-02-01

    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  19. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    Science.gov (United States)

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  20. Simulation and Analysis of Roller Chain Drive Systems

    DEFF Research Database (Denmark)

    Pedersen, Sine Leergaard

    The subject of this thesis is simulation and analysis of large roller chain drive systems, such as e.g. used in marine diesel engines. The aim of developing a chain drive simulation program is to analyse dynamic phenomena of chain drive systems and investigate different design changes to the syst......The subject of this thesis is simulation and analysis of large roller chain drive systems, such as e.g. used in marine diesel engines. The aim of developing a chain drive simulation program is to analyse dynamic phenomena of chain drive systems and investigate different design changes...... mathematical models, and compare to the prior done research. Even though the model is developed at first for the use of analysing chain drive systems in marine engines, the methods can with small changes be used in general, as for e.g. chain drives in industrial machines, car engines and motorbikes. A novel...

  1. Introduction;Commemorating the first self-sustaining nuclear chain reaction on 2 December 1942

    Energy Technology Data Exchange (ETDEWEB)

    Eklund, S [International Atomic Energy Agency, Vienna (Austria)

    1962-12-02

    On the occasion of the 20th anniversary of the conducting of the first self-sustaining nuclear chain reaction and following development of nuclear reactors, the article reviews the work and scientific development behind this achievement. The impact of atomic energy on economics, benefits of nuclear reactors for electricity production and the by-product - radio isotopes, used in different areas such as industry, medicine, agriculture etc. are pointed out

  2. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  3. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    OpenAIRE

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-01-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

  4. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  5. MODESTY, Statistical Reaction Cross-Sections and Particle Spectra in Decay Chain

    International Nuclear Information System (INIS)

    Mattes, W.

    1977-01-01

    1 - Nature of the physical problem solved: Code MODESTY calculates all energetically possible reaction cross sections and particle spectra within a nuclear decay chain. 2 - Method of solution: It is based on the statistical nuclear model following the method of Uhl (reference 1) where the optical model is used in the calculation of partial widths and the Blatt-Weisskopf single particle model for gamma rays

  6. Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

    Science.gov (United States)

    Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

    2014-07-24

    This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

  7. STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Honcharova S.Y.

    2015-08-01

    Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

  8. MicroRNA-671-3p inhibits the development of breast cancer: A study based on in vitro experiments, in-house quantitative polymerase chain reaction and bioinformatics analysis

    Science.gov (United States)

    He, Rong-Quan; Lan, Ai-Hua; Zhong, Jin-Cai; Chen, Gang; Feng, Zhen-Bo; Wei, Kang-Lai

    2018-01-01

    MicroRNAs (miRNAs or miRs) are highly conserved small noncoding RNA molecules involved in gene regulation. An increasing number of studies have demonstrated that miRNAs act as oncogenes or antioncogenes in various types of cancer, including breast cancer (BC). However, the exact role of miR-671-3p in BC has not yet been reported. In the present study, in vitro experiments were implemented to explore the effects of miR-671-3p on the proliferation and apoptosis of BC cells, and reverse transcription-quantitative polymerase chain reaction was conducted using in-house clinical BC samples to address the expression level and clinical value of miR-671-3p in BC. Simultaneously, miR-671-3p target genes were collected, and subsequent bioinformatics analyses were executed to probe the potential signaling pathway through which miR-671-3p influenced the occurrence and progression of BC. According to the results, the expression level of miR-671-3p was lower in BC tissues compared with that in adjacent non-tumorous tissues (P=0.048), and the area under the curve was 0.697 (95% confidence interval=0.538-0.856), with a sensitivity and specificity of 0.818 and 0.579, respectively. Forced miR-671-3p expression in the BC cell line MDA-MB-231 evidently arrested cell proliferation and induced cell apoptosis. Furthermore, in silico enrichment analyses suggested that miR-671-3p may be involved in the initiation and progression of BC through the targeting of genes associated with the Wnt signaling pathway. In conclusion, the present study findings suggested that miR-671-3p may function as a tumor suppressor in BC by influencing the Wnt signaling cascade, which provides a prospective molecular target for the therapy of BC. PMID:29620195

  9. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng

    2015-05-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  10. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.

    1990-01-01

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  11. Simulation and Analysis of Chain Drive Systems

    DEFF Research Database (Denmark)

    Pedersen, Sine Leergaard

    mathematical models, and compare to the prior done research. Even though the model is developed at first for the use of analysing chain drive systems in marine engines, the methods can with small changes be used in general, as for e.g. chain drives in industrial machines, car engines and motorbikes. A novel...... with a real tooth profile proves superior to other applied models. With this model it is possible to perform a dynamic simulation of large marine engine chain drives. Through the application of this method, it is shown that the interrelated dynamics of the elements in the chain drive system is captured...

  12. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  13. Supply Chain Visibility with Linked Open Data for Supply Chain Risk Analysis

    NARCIS (Netherlands)

    Hofman, W.J.

    2011-01-01

    Current customs applications are declaration based to support the various customs procedures based on (inter)national laws and regulations. To be able to perform a proper supply chain risk analysis, customs requires to have all data in supply chains. The current declaration procedures are not

  14. Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

    Science.gov (United States)

    Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

    2007-03-01

    A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

  15. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Leone, S.R.

    1990-01-01

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C 2 H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH 3 ; and ammonia, which produces NH 2 . In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  16. Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

    Science.gov (United States)

    Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

    1997-01-01

    Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

  17. Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

    Science.gov (United States)

    Denisov, E. T.; Shestakov, A. F.

    2018-05-01

    Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

  18. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend

    1991-01-01

    the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

  19. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend

    1993-01-01

    the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

  20. SCit: web tools for protein side chain conformation analysis.

    Science.gov (United States)

    Gautier, R; Camproux, A-C; Tufféry, P

    2004-07-01

    SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each protein for side chain positioning and the identification of side chains with unlikely conformations. The SCit web server is accessible at http://bioserv.rpbs.jussieu.fr/SCit.

  1. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    Science.gov (United States)

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  2. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    OpenAIRE

    Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.

  3. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  4. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  5. Analysis of supply chain management of shallots in Medan

    Science.gov (United States)

    Alam, M. C.; Supriana, T.

    2018-02-01

    Supply chain is important for business. One of supply chain that needs to be studied is the shallots supply chain. Medan have high demand while the supply of shallots is limited. This study aims to analyze the flow of shallots supply chain distribution in Medan. The method used was survey by using questionnaires to shallots producers, collecting traders, distributors, traders as well as government involved in shallots supply chain. Descriptive analysis was used to explain the shallots supply chain distribution flow. The results showed that there are two shallots supply chain model in Medan that was local shallots model and imported shallots model. Local shallots model could be distinguished based on three producer area, those were models of Medan Marelan, Samosir, and Simalungun. Medan Marelan and Simalungun models have seven supply chains, while the Samosir Model has eight supply chains. This condition indicates that the local shallots supply chain management in Medan was not efficient because of the length of the distribution channel. Supply chain imported shallots was more efficient because it had a shorter distribution flow with five supply chains.

  6. Newtonian Analysis of a Folded Chain Drop

    Science.gov (United States)

    Mungan, Carl E.

    2018-05-01

    Consider a chain of length L that hangs in a U shape with end A fixed to a rigid support and free end E released from rest starting from the same initial height (call it y = 0) as A. Figure 1 sketches the chain after end E has fallen a distance y. Points O and A are assumed to be close enough to each other and the chain flexible enough that the radius of curvature r at the bottom point C can be taken to be negligibly small (compared to the length of the chain). The problem is to compare the speed of descent v(y) = dy/dt of the free end E of the chain to the speed vfree(y )=√{2 g y } of a free-falling point mass that has descended the same distance y. If v(y) > vfree (y) for all y > 0, then, in a race to fall any arbitrary distance Y (where 0 < Y < L), the chain end E will always beat a simultaneously released point mass, because the fall time t for E will be shorter than tfree for the point mass, t = ∫0 Y d/y v (y )

  7. Stability analysis and stabilization strategies for linear supply chains

    Science.gov (United States)

    Nagatani, Takashi; Helbing, Dirk

    2004-04-01

    Due to delays in the adaptation of production or delivery rates, supply chains can be dynamically unstable with respect to perturbations in the consumption rate, which is known as “bull-whip effect”. Here, we study several conceivable production strategies to stabilize supply chains, which is expressed by different specifications of the management function controlling the production speed in dependence of the stock levels. In particular, we will investigate, whether the reaction to stock levels of other producers or suppliers has a stabilizing effect. We will also demonstrate that the anticipation of future stock levels can stabilize the supply system, given the forecast horizon τ is long enough. To show this, we derive linear stability conditions and carry out simulations for different control strategies. The results indicate that the linear stability analysis is a helpful tool for the judgement of the stabilization effect, although unexpected deviations can occur in the non-linear regime. There are also signs of phase transitions and chaotic behavior, but this remains to be investigated more thoroughly in the future.

  8. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Science.gov (United States)

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  9. Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

    Directory of Open Access Journals (Sweden)

    Wen-Pin Chou

    2017-02-01

    Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

  10. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  11. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    International Nuclear Information System (INIS)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping

    2013-01-01

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling

  12. Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases

    Directory of Open Access Journals (Sweden)

    Sharma J

    2010-01-01

    Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.

  13. Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

    Science.gov (United States)

    Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

    2018-04-01

    Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

  14. Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

    Science.gov (United States)

    Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

    1995-06-01

    A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

  15. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  16. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  17. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  18. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    Science.gov (United States)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

    1989-04-01

    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  19. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  20. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  1. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  2. SCit: web tools for protein side chain conformation analysis

    OpenAIRE

    Gautier, R.; Camproux, A.-C.; Tufféry, P.

    2004-01-01

    SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each...

  3. Bayesian analysis for reversible Markov chains

    NARCIS (Netherlands)

    Diaconis, P.; Rolles, S.W.W.

    2006-01-01

    We introduce a natural conjugate prior for the transition matrix of a reversible Markov chain. This allows estimation and testing. The prior arises from random walk with reinforcement in the same way the Dirichlet prior arises from Pólya’s urn. We give closed form normalizing constants, a simple

  4. Effects of medium-chain triacylglycerols on Maillard reaction in bread baking.

    Science.gov (United States)

    Toyosaki, Toshiyuki

    2018-06-01

    To investigate the relationship between the fatty acid composition of medium-chain triacylglycerols (MCTs) and the Maillard reaction induced during bread baking, a comparison with various fatty acids was conducted. Saturated fatty acids had a remarkable inhibitory effect on the amount of advanced glycation end products (AGEs) generated from the Maillard reaction in bread baking compared to unsaturated fatty acids. The amount of AGEs produced by each fatty acid (mg kg -1 ) was as follows: C18:0, 18.7; C12:0, 35.2; C16:0, 21.4; C18:0, 38.2; C18:1, 68.7; C18:2, 80.1; C20:4, 80.8; C22:4, 89.8. Saturated fatty acids were possibly involved in the Maillard reaction and, as a result, acted to inhibit it. In the case of unsaturated fatty acids, amounts of AGEs during the Maillard reaction in baking tended to increase as the degree of unsaturation increased. In other words, there was a positive correlation between the degree of unsaturation and the amount of AGEs. It was also confirmed that the air pore distribution in baked bread was closely related to AGEs. These results led us to conclude that the fatty acid composition of the added lipids also influences properties that determine the tastiness of bread. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  5. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.

    2009-01-01

    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  6. Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.

    Science.gov (United States)

    Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F

    2015-01-01

    Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.

  7. PEMERIKSAAN BAKTERI LEPTOSPIRA PADA SAMPEL DARAH MANUSIA SUSPECT LEPTOSPIROSIS MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Sefrita Tri Utami

    2014-01-01

    Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

  8. Probabilistic sensitivity analysis of biochemical reaction systems.

    Science.gov (United States)

    Zhang, Hong-Xuan; Dempsey, William P; Goutsias, John

    2009-09-07

    Sensitivity analysis is an indispensable tool for studying the robustness and fragility properties of biochemical reaction systems as well as for designing optimal approaches for selective perturbation and intervention. Deterministic sensitivity analysis techniques, using derivatives of the system response, have been extensively used in the literature. However, these techniques suffer from several drawbacks, which must be carefully considered before using them in problems of systems biology. We develop here a probabilistic approach to sensitivity analysis of biochemical reaction systems. The proposed technique employs a biophysically derived model for parameter fluctuations and, by using a recently suggested variance-based approach to sensitivity analysis [Saltelli et al., Chem. Rev. (Washington, D.C.) 105, 2811 (2005)], it leads to a powerful sensitivity analysis methodology for biochemical reaction systems. The approach presented in this paper addresses many problems associated with derivative-based sensitivity analysis techniques. Most importantly, it produces thermodynamically consistent sensitivity analysis results, can easily accommodate appreciable parameter variations, and allows for systematic investigation of high-order interaction effects. By employing a computational model of the mitogen-activated protein kinase signaling cascade, we demonstrate that our approach is well suited for sensitivity analysis of biochemical reaction systems and can produce a wealth of information about the sensitivity properties of such systems. The price to be paid, however, is a substantial increase in computational complexity over derivative-based techniques, which must be effectively addressed in order to make the proposed approach to sensitivity analysis more practical.

  9. Rice value chain analysis in Tanzania: identification of constraints ...

    African Journals Online (AJOL)

    The importance of rice (Oryza sativa L.) as a food and cash crop in Eastern Africa, is increasing, but its value chain is becoming complex. In 2012/13, rice value chain analysis was conducted in rice farming systems of Lake, Eastern and Southern-Highlands zones of Tanzania. A sample of 240 producers, 60 traders and 30 ...

  10. Value chain analysis on cassava and cassava based - products in ...

    African Journals Online (AJOL)

    This study examined the value Chain analysis (production process and cost related to each element of production chain to add value) on cassava and cassava products in Imo State specifically to ascertain the farm size holdings of the respondents as well as the ownerships of the land used for production. It also identified` ...

  11. Agricultural Value Chains in Developing Countries; a Framework for Analysis

    NARCIS (Netherlands)

    Trienekens, J.H.

    2011-01-01

    The paper presents a framework for developing country value chain analysis made up of three components. The first consists of identifying major constraints for value chain upgrading: market access restrictions, weak infrastructures, lacking resources and institutional voids. In the second component

  12. Value Chain Analysis in Interfirm Relationships: A Field Study.

    NARCIS (Netherlands)

    Dekker, H.C.

    2003-01-01

    Interfirm relationships introduce new challenges for management accounting. One such challenge is the provision of information for the coordination and optimization of activities across firms in a value chain. According to the literature, a value chain analysis (VCA) is a useful tool to meet this

  13. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    Science.gov (United States)

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  14. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  15. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

    OpenAIRE

    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

    1993-01-01

    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  16. Reaction of oxygen with the respiratory chain in cells and tissues.

    Science.gov (United States)

    Chance, B

    1965-09-01

    This paper considers the way in which the oxygen reaction described by Dr. Nicholls and the ADP control reactions described by Dr. Racker could cooperate to establish a purposeful metabolic control phenomenon in vivo. This has required an examination of the kinetic properties of the respiratory chain with particular reference to methods for determinations of oxygen affinity (K(m)). The constant parameter for tissue respiration is k(1), the velocity constant for the reaction of oxygen with cytochrome oxidase. Not only is this quantity a constant for a particular tissue or mitochondria; it appears to vary little over a wide range of biological material, and for practical purposes a value of 5 x 10(7) at 25 degrees close to our original value (20) is found to apply with adequate accuracy for calculation of K(m) for mammalia. The quantity which will depend upon the tissue and its metabolic state is the value of K(m) itself, and K(m) may be as large as 0.5 microM and may fall to 0.05 microM or less in resting, controlled, or inhibited states. The control characteristic for ADP may depend upon the electron flux due to the cytochrome chain (40); less ADP is required to activate the slower electron transport at lower temperatures than at higher temperatures. The affinity constants for ADP control appear to be less dependent upon substrate supplied to the system. The balance of ADP and oxygen control in vivo is amply demonstrated experimentally and is dependent on the oxygen concentration as follows. In the presence of excess oxygen, control may be due to the ADP or phosphate (or substrate), and the kinetics of oxygen utilization will be independent of the oxygen concentration. As the oxygen concentration is diminished, hemoglobin becomes disoxygenated, deep gradients of oxygen concentration develop in the tissue, and eventually cytochrome oxidase becomes partially and then completely reduced. DPN at this point will become reduced and the electron flow diminished. The rate

  17. A taxonomy of integral reaction path analysis

    Energy Technology Data Exchange (ETDEWEB)

    Grcar, Joseph F.; Day, Marcus S.; Bell, John B.

    2004-12-23

    W. C. Gardiner observed that achieving understanding through combustion modeling is limited by the ability to recognize the implications of what has been computed and to draw conclusions about the elementary steps underlying the reaction mechanism. This difficulty can be overcome in part by making better use of reaction path analysis in the context of multidimensional flame simulations. Following a survey of current practice, an integral reaction flux is formulated in terms of conserved scalars that can be calculated in a fully automated way. Conditional analyses are then introduced, and a taxonomy for bidirectional path analysis is explored. Many examples illustrate the resulting path analysis and uncover some new results about nonpremixed methane-air laminar jets.

  18. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  19. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    International Nuclear Information System (INIS)

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.

    1998-01-01

    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  20. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences

    1998-07-01

    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  1. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

    Science.gov (United States)

    Siqueira, José F; Rôças, Isabela N

    2003-08-01

    Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and

  2. Markov Chain Analysis of Musical Dice Games

    Science.gov (United States)

    Volchenkov, D.; Dawin, J. R.

    2012-07-01

    A system for using dice to compose music randomly is known as the musical dice game. The discrete time MIDI models of 804 pieces of classical music written by 29 composers have been encoded into the transition matrices and studied by Markov chains. Contrary to human languages, entropy dominates over redundancy, in the musical dice games based on the compositions of classical music. The maximum complexity is achieved on the blocks consisting of just a few notes (8 notes, for the musical dice games generated over Bach's compositions). First passage times to notes can be used to resolve tonality and feature a composer.

  3. Analysis of Milk Marketing Chain – Pakistan

    Directory of Open Access Journals (Sweden)

    U. Zia

    2010-02-01

    Full Text Available With an estimated annual milk production of approximately 29 million tonnes in 2004-2005, Pakistan is one of the world’s top milk producers. The competitiveness of Milk Marketing Chains in Pakistan was studied, including constraints and opportunities. The study also includes unprecendented legal research on the government’s role vis a vis the private sector contribution. Buffaloes and cows are the main source of milk production, with an estimated 67% of the milk being produced by buffaloes and 30% by cows.

  4. Performance analysis of Supply Chain Management with Supply Chain Operation reference model

    Science.gov (United States)

    Hasibuan, Abdurrozzaq; Arfah, Mahrani; Parinduri, Luthfi; Hernawati, Tri; Suliawati; Harahap, Bonar; Rahmah Sibuea, Siti; Krianto Sulaiman, Oris; purwadi, Adi

    2018-04-01

    This research was conducted at PT. Shamrock Manufacturing Corpora, the company is required to think creatively to implement competition strategy by producing goods/services that are more qualified, cheaper. Therefore, it is necessary to measure the performance of Supply Chain Management in order to improve the competitiveness. Therefore, the company is required to optimize its production output to meet the export quality standard. This research begins with the creation of initial dimensions based on Supply Chain Management process, ie Plan, Source, Make, Delivery, and Return with hierarchy based on Supply Chain Reference Operation that is Reliability, Responsiveness, Agility, Cost, and Asset. Key Performance Indicator identification becomes a benchmark in performance measurement whereas Snorm De Boer normalization serves to equalize Key Performance Indicator value. Analiytical Hierarchy Process is done to assist in determining priority criteria. Measurement of Supply Chain Management performance at PT. Shamrock Manufacturing Corpora produces SC. Responsiveness (0.649) has higher weight (priority) than other alternatives. The result of performance analysis using Supply Chain Reference Operation model of Supply Chain Management performance at PT. Shamrock Manufacturing Corpora looks good because its monitoring system between 50-100 is good.

  5. Stakeholder Analysis for Farmer inclusive Value chain Development in Mango

    OpenAIRE

    Nadhika K; Jayasree Krishnankutty

    2017-01-01

    Mango is being cultivated over a substantial area in Palakkad District of Kerala state. Being one of the significant agricultural commodity value chains existing in Kerala, the mango value chain of Palakkad district needs urgent attention to improve its performance. The study highlights the stakeholder analysis and SWOC matrix analysis of the mango sector. Stakeholders were asked to identify the strengths, weaknesses, opportunities and challenges in the mango sector. Based on the highest scor...

  6. Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

    Science.gov (United States)

    Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

    1993-01-01

    A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

  7. The use of real-time polymerase chain reaction with high resolution melting (real-time PCR-HRM) analysis for the detection and discrimination of nematodes Bursaphelenchus xylophilus and Bursaphelenchus mucronatus.

    Science.gov (United States)

    Filipiak, Anna; Hasiów-Jaroszewska, Beata

    2016-04-01

    The real-time PCR-HRM analysis was developed for the detection and discrimination of the quarantine nematode Bursaphelenchus xylophilus and Bursaphelenchus mucronatus. A set of primers was designed to target the ITS region of rDNA. The results have demonstrated that this analysis is a valuable tool for differentiation of these both species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

    2005-01-01

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  9. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  10. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  11. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.

    Science.gov (United States)

    Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S

    2010-03-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  12. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  13. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  14. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  15. Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

    Science.gov (United States)

    Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

    2017-09-27

    Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

  16. Chain reaction. History of the atomic bomb; Kettenreaktion. Die Geschichte der Atombombe

    Energy Technology Data Exchange (ETDEWEB)

    Mania, Hubert

    2010-07-01

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  17. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.

    Science.gov (United States)

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.

  18. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    Science.gov (United States)

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  19. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi

    2014-12-01

    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  20. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  1. IDENTIFICATION OF MYCOBACTERIUM GENAVENSE IN A DIANA MONKEY (CERCOPITHECUS DIANA) BY POLYMERASE CHAIN REACTION AND HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY.

    Science.gov (United States)

    Kelly, Kathleen M; Wack, Allison N; Bradway, Dan; Simons, Brian W; Bronson, Ellen; Osterhout, Gerard; Parrish, Nicole M; Montali, Richard J

    2015-06-01

    A 25-yr-old Diana monkey (Cercopithecus diana) with a 1.5-yr history of chronic colitis and diarrhea was found to have disseminated granulomatous disease with intralesional acid fast bacilli. Bacilli were identified as Mycobacterium genavense by polymerase chain reaction, sequencing of the 16S-23S ribosomal RNA intergenic spacer (ITS) gene, and mycolic acid analysis by high-performance liquid chromatography. Mycobacterium genavense is a common cause of mycobacteriosis in free-ranging and captive birds. In addition, recognition of opportunistic infection in human immunodeficiency virus-positive patients is increasing. Disease manifestations of M. genavense are similar to Mycobacterium avium complex (MAC) and include fever, wasting, and diarrhea with disseminated disease. Similar clinical signs and lesions were observed in this monkey. Mycobacterium genavense should be considered as a differential for disseminated mycobacterial disease in nonhuman primates as this agent can mimic MAC and related mycobacteria.

  2. Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2015-12-01

    Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber

  3. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  4. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

    Science.gov (United States)

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

    2016-08-24

    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    Science.gov (United States)

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

  6. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    International Nuclear Information System (INIS)

    Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian

    2012-01-01

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

  7. Modeling methodology for supply chain synthesis and disruption analysis

    Science.gov (United States)

    Wu, Teresa; Blackhurst, Jennifer

    2004-11-01

    The concept of an integrated or synthesized supply chain is a strategy for managing today's globalized and customer driven supply chains in order to better meet customer demands. Synthesizing individual entities into an integrated supply chain can be a challenging task due to a variety of factors including conflicting objectives, mismatched incentives and constraints of the individual entities. Furthermore, understanding the effects of disruptions occurring at any point in the system is difficult when working toward synthesizing supply chain operations. Therefore, the goal of this research is to present a modeling methodology to manage the synthesis of a supply chain by linking hierarchical levels of the system and to model and analyze disruptions in the integrated supply chain. The contribution of this research is threefold: (1) supply chain systems can be modeled hierarchically (2) the performance of synthesized supply chain system can be evaluated quantitatively (3) reachability analysis is used to evaluate the system performance and verify whether a specific state is reachable, allowing the user to understand the extent of effects of a disruption.

  8. Analysis of a complex shape chain plate using Transmission Photoelasticity

    Directory of Open Access Journals (Sweden)

    Dasari N.

    2010-06-01

    -3]. A loading fixture was used to load the model during stress freezing in the furnace. The integrated fringe pattern of the offset chain plate is shown in Figure 2. Slices are cut in the offset zone to understand the nature of the stress distribution. A Simple photoelastic analysis of this has revealed a wealth of information to take suitable decision on the design of such plates taking into account the constraints in manufacturing.

  9. Specifications for surface reaction analysis apparatus

    International Nuclear Information System (INIS)

    Teraoka, Yuden; Yoshigoe, Akitaka

    2001-03-01

    A surface reaction analysis apparatus was installed at the JAERI soft x-ray beamline in the SPring-8 as an experimental end-station for the study of surface chemistry. The apparatus is devoted to the study concerning the influence of translational kinetic energy of incident molecules to chemical reactions on solid surfaces with gas molecules. In order to achieve the research purpose, reactive molecular scattering experiments and photoemission spectroscopic measurements using synchrotron radiation are performed in that apparatus via a supersonic molecular beam generator, an electron energy analyzer and a quadrupole mass analyzer. The detail specifications for the apparatus are described in this report. (author)

  10. Assessing HER2 amplification by IHC, FISH, and real-time polymerase chain reaction analysis (real-time PCR) following LCM in formalin-fixed paraffin embedded tissue from 40 women with ovarian cancer

    DEFF Research Database (Denmark)

    Hillig, Thore; Thode, Jørgen; Breinholt, Ellen Marie

    2012-01-01

    . Only few ovarian cancer patients were HER2 overexpressed measured by IHC or FISH and thus could be eligible for antibody-based therapy with trastuzumab (Herceptin). Interestingly, we find an increased number of HER2 positive patients by real-time PCR analysis on microdissected cancer cells, suggesting...

  11. Reaction pathway towards formation of cobalt single chain magnets and nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)

    2010-03-15

    With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.

  12. Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

    Science.gov (United States)

    Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

    2018-05-01

    Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Electrochemical detection of C-reactive protein using Copper nanoparticles and hybridization chain reaction amplifying signal.

    Science.gov (United States)

    Zhang, Junjun; Zhang, Wenjuan; Guo, Jinjin; Wang, Junchun; Zhang, Yuzhong

    2017-12-15

    In this study, a sandwich-type electrochemical immunosensor for the detection of C-reactive protein (CRP) is described. In design, Copper nanoparticles (Cu NPs) were used for signal tag and hybridization chain reaction (HCR)amplified output signal. The immunosensor fabrication involved three steps: (i) primary antibodies (Ab 1 ) were immobilized on the surface of gold nanoparticles (Au NPs); (ii) the sandwich-type structure formation contained "primary antibodies-antigen-secondary antibodies conjugated with primer (Ab 2 -S 0 )"; and (iii) long DNA concatemers intercalating amounts of Cu NPs was linked to the sandwich-type structure via hybridization reaction. Differential pulse voltammetry (DPV) was used to record the response signal of the immunosensor in phosphate-buffered saline (PBS). Under optimal conditions, the anodic peak currents of Cu NPs at the peak potential of about 0.08V(VS.SCE) were linear with the logarithm of CRP concentration in the range of 1.0 fg mL -1 to 100 ng mL -1 with a detection limit of 0.33 fg mL -1 (at signal/noise [S/N] = 3). In addition, the practical application of immunosensor was evaluated by analyzing CRP in real human serum samples, the recoveries obtained were within 95.3%-103.8%, indicating the immunosensor possessed potential application ability for practical disease diagnosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

    Science.gov (United States)

    Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

    2017-05-01

    The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. The generation of radiolabeled DNA and RNA probes with polymerase chain reaction

    International Nuclear Information System (INIS)

    Schowalter, D.B.; Sommer, S.S.

    1989-01-01

    By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence

  16. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  17. Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

    Directory of Open Access Journals (Sweden)

    Zhouli Wang

    Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

  18. Global Carbon Fiber Composites Supply Chain Competitiveness Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Sujit Das, Josh Warren, Devin West, Susan M. Schexnayder

    2016-05-01

    This analysis identifies key opportunities in the carbon fiber supply chain where resources and investments can help advance the clean energy economy. The report focuses on four application areas — wind energy, aerospace, automotive, and pressure vessels — that top the list of industries using carbon fiber and carbon fiber reinforced polymers. For each of the four application areas, the report addresses the supply and demand trends within that sector, supply chain, and costs of carbon fiber and components.

  19. Kinematics of roller chain drives - Exact and approximate analysis

    DEFF Research Database (Denmark)

    Fuglede, Niels; Thomsen, Jon Juel

    2016-01-01

    An exact and approximate kinematic analysis of a roller chain drive modeled as a four-bar mechanism is presented. The span connects the sprockets such that they rotate in the same direction, and the sprocket size, number of teeth, and shaft center distance can be arbitrary. The driven sprocket...... to be very good agreement. All together this gives new insights into the characteristics of chain drive kinematics and the influence of main design parameters....

  20. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M Figueiredo

    1997-05-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  1. New paradigm for simplified combustion modeling of energetic solids: Branched chain gas reaction

    Energy Technology Data Exchange (ETDEWEB)

    Brewster, M.Q.; Ward, M.J. [Univ. of Illinois, Urbana, IL (United States); Son, S.F. [Los Alamos National Lab., NM (United States)

    1997-09-01

    Two combustion models with simple but rational chemistry are compared: the classical high gas activation energy (E{sub g}/RT {much_gt} 1) Denison-Baum-Williams (DBW) model, and a new low gas activation energy (E{sub g}/RT {much_lt} 1) model recently proposed by Ward, Son, and Brewster (WSB). Both models make the same simplifying assumptions of constant properties, Lewis number unity, single-step, second order gas phase reaction, and single-step, zero order, high activation energy condensed phase decomposition. The only difference is in the gas reaction activation energy E{sub g} which is asymptotically large for DBW and vanishingly small for WSB. For realistic parameters the DBW model predicts a nearly constant temperature sensitivity {sigma}{sub p} and a pressure exponent n approaching 1. The WSB model predicts generally observed values of n = 0.7 to 0.9 and {sigma}{sub p}(T{sub o},P) with the generally observed variations with temperature (increasing) and pressure (decreasing). The WSB temperature profile also matches measured profiles better. Comparisons with experimental data are made using HMX as an illustrative example (for which WSB predictions for {sigma}{sub p}(T{sub o},P) are currently more accurate than even complex chemistry models). WSB has also shown good agreement with NC/NG double base propellant and HNF, suggesting that at the simplest level of combustion modeling, a vanishingly small gas activation energy is more realistic than an asymptotically large one. The authors conclude from this that the important (regression rate determining) gas reaction zone near the surface has more the character of chain branching than thermal decomposition.

  2. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    Science.gov (United States)

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  3. 188 An Empirical Investigation of Value-Chain Analysis and ...

    African Journals Online (AJOL)

    User

    Analysis has a positive but insignificant impact on Competitive Advantage of a manufacturing firm in ... chain analysis is a means of increasing customer satisfaction and managing costs more ... The linkages express the relationships between the ... margins, return on assets, benchmarking, and capital budgeting. When a.

  4. Identification of a new genetic marker in Mycoplasma synoviae vaccine strain MS-H and development of a strategy using polymerase chain reaction and high-resolution melting curve analysis for differentiating MS-H from field strains.

    Science.gov (United States)

    Zhu, Ling; Konsak, Barbara M; Olaogun, Olusola M; Agnew-Crumptona, Rebecca; Kanci, Anna; Marenda, Marc S; Browning, Glenn F; Noormohammadi, Amir H

    2017-10-01

    Mycoplasma synoviae (MS) is an economically important avian pathogen worldwide, causing subclinical respiratory tract infection and infectious synovitis in chickens and turkeys. A temperature-sensitive (ts + ) live attenuated vaccine MS-H, derived from the Australian field strain 86079/7NS, is now widely used in many countries to control the disease induced by MS. Differentiation of MS-H vaccine from field strains is crucial for monitoring vaccination programs in commercial poultry. Comparison of genomic sequences of MS-H and its parent strain revealed an adenine deletion at nucleotide position 468 of the MS-H oppF-1 gene. This mutation was shown to be unique to MS-H in further comparative analyses of oppF-1 genes of MS-H re-isolates and field strains from Australia and other countries. Based on this single nucleotide, a combination of nested PCR and high-resolution melting (HRM) curve analysis was used to evaluate its potential for use in differentiation of MS-H from field strains. The mean genotype confidence percentages of 99.27 and 48.20 for MS-H and field strains, respectively, demonstrated the high discriminative power of the newly developed assay (oppF PCR-HRM). A set of 13 tracheal swab samples collected from MS-H vaccinated specific pathogen free birds and commercial chicken flocks infected with MS were tested using the oppF PCR-HRM test and results were totally consistent with those obtained using vlhA genotyping. The nested-PCR HRM method established in this study proved to be a rapid, simple and cost effective tool for discriminating the MS-H vaccine strain from Australian and international strains in pure cultures and on tracheal swabs. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.

    Science.gov (United States)

    Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon

    2011-06-07

    Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.

  6. Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

  7. Rapid genomic fingerprinting of Lactococcus lactis strains by arbitrarily primed polymerase chain reaction with 32P and fluorescent labels.

    OpenAIRE

    Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E

    1992-01-01

    Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.

  8. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

  9. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....

  10. Whole Blood Polymerase Chain Reaction in a Neonate with Disseminated Herpes Simplex Virus Infection and Liver Failure

    Directory of Open Access Journals (Sweden)

    Jennifer A. Scoble

    2013-10-01

    Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.

  11. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...

  12. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  13. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  14. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  15. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...

  16. Stakeholder Analysis for Farmer inclusive Value chain Development in Mango

    Directory of Open Access Journals (Sweden)

    Nadhika K

    2017-12-01

    Full Text Available Mango is being cultivated over a substantial area in Palakkad District of Kerala state. Being one of the significant agricultural commodity value chains existing in Kerala, the mango value chain of Palakkad district needs urgent attention to improve its performance. The study highlights the stakeholder analysis and SWOC matrix analysis of the mango sector. Stakeholders were asked to identify the strengths, weaknesses, opportunities and challenges in the mango sector. Based on the highest score obtained, four strategic options viz., enhancing value addition and product development, promotion of branding, educating the farmers on building competitiveness and increasing export potential by addressing quality parameters were identified.

  17. Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

    Science.gov (United States)

    Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

    2018-05-01

    It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

  18. Molecular typing for blood group antigens within 40 min by direct polymerase chain reaction from plasma or serum.

    Science.gov (United States)

    Wagner, Franz F; Flegel, Willy A; Bittner, Rita; Döscher, Andrea

    2017-03-01

    Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fy a , Fy b , Jk a and Jk b antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. © 2016 John Wiley & Sons Ltd.

  19. Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Stephen Duffett

    2012-01-01

    Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

  20. Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol

    Directory of Open Access Journals (Sweden)

    Elisabetta Di Giannatale

    2010-03-01

    Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.

  1. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  2. Detection of potentially cariogenic strains of Streptococcus mutans using the polymerase chain reaction.

    Science.gov (United States)

    Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C

    2002-01-01

    Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.

  3. Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

    Science.gov (United States)

    Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

    2015-01-01

    The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

  4. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    Science.gov (United States)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  5. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2014-10-01

    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  6. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays.

    Science.gov (United States)

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua

    2016-07-15

    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Directory of Open Access Journals (Sweden)

    Daniela Camargos Costa

    2014-02-01

    Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  8. Maedi in slaughtered sheep: a pathology and polymerase chain reaction study in southwestern Iran.

    Science.gov (United States)

    Azizi, Shahrzad; Tajbakhsh, Elahe; Fathi, Farzad; Oryan, Ahmad; Momtaz, Hassan; Goodarzi, Mehdi

    2012-01-01

    Maedi-visna (MV) is an important slow viral disease of sheep leading to a progressive lymphoproliferative disease. It affects multiple organs primarily the lungs, where it causes interstitial pneumonia (maedi). In this study, the lungs of 1,000 sheep carcasses were grossly inspected and those suspected to have maedi were studied at histopathological and molecular levels. A polymerase chain reaction (PCR) technique that amplified a 291-base pair DNA in the long terminal repeat (LTR) sequence of MV provirus was conducted on all the 50 suspected lungs together with 10 normal appearing lungs as controls. Amplicons of the expected size were detected in 11 (n=11/50) suspected sheep, and one of the 10 control sheep. Histopathologic study of the pulmonary lesions of all 11 (n=11/11) positive sheep showed MV lesions, including hyperplasia of the perivascular and peribronchiolar lymphoid cells, interstitial lymphoplasmacytic infiltration and smooth muscle hyperplasia and the histopathologic findings were correlated with PCR results. In contrast, the tissue sections of control animals were almost normal at histopathological level; however, PCR technique demonstrated that one of them was affected by maedi. This study showed that the LTR-PCR had high specificity and sensitivity in diagnosis of this viral infection. This study is the first to evaluate the prevalence of MV virus infection in sheep in Iran.

  9. Performance of an HF chain-reaction laser with high initiation efficiency

    International Nuclear Information System (INIS)

    Whittier, J.S.; Kerber, R.L.

    1974-01-01

    Output-pulse observations are presented for a transverse electrically initiated, helium-diluted HF laser pumped by the H 2 + F 2 chain reaction. Performance of this laser is studied over a wide range of the gas composition and for initial pressures between 0.1 and 0.5 atm. The gas mixture was stabilized by premixing O 2 , F 2 , and He and flowing this mixture into a cold trap (84 0 K) before mixing with H 2 . Optimum conversion of electrical-initiation energy into laser energy was found for a 240-torr mixture with a mole ratio 1 F 2 :0.23 H 2 :0.08 O 2 :12 He which, when initiated with a 25-kV, 333-pF discharge, gave a pulse energy of 0.150 J. This corresponds to a ratio of laser output energy to electrical input energy of 144 percent. After unnecessary losses are taken into account, this ratio becomes 160 percent. (U.S.)

  10. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Natália Malaguti

    2015-01-01

    Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  11. Continuous Excretion of Leptospira borgpetersenii Ballum in Mice Assessed by Viability Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Soupé-Gilbert, Marie-Estelle; Bierque, Emilie; Geroult, Sophie; Teurlai, Magali; Goarant, Cyrille

    2017-10-01

    Rodents are the main reservoir animals of leptospirosis. In this study, we characterized and quantified the urinary excretion dynamics of Leptospira by Mus musculus infected with 2 × 10 8 virulent Leptospira borgpetersenii serogroup Ballum. Each micturition was collected separately in metabolic cages, at 12 time points from 7 to 117 days post-infection (dpi). We detected Leptospira in all urine samples collected (up to 8 per time point per mouse) proving that Leptospira excretion is continuous with ca. 90% live L. borgpetersenii Ballum, revealed by viability quantitative polymerase chain reaction. Microscopic visualization by Live/Dead fluorescence confirmed this high proportion of live bacteria and demonstrated that L. borgpetersenii Ballum are excreted, at least partly, as bacterial aggregates. We observed two distinct phases in the excretion dynamics, first an increase in Leptospira concentration shed in the urine between 7 and 63 dpi followed by a plateau phase from 63 dpi onward, with up to 3 × 10 7 Leptospira per mL of urine. These two phases seem to correspond to progressive colonization of renal tubules first, then to stable cell survival and maintenance in kidneys. Therefore, chronically infected adult mice are able to contaminate the environment via urine at each micturition event throughout their lifetime. Because Leptospira excretion reached its maximum 2 months after infection, older rodents have a greater risk of contaminating their surrounding environment.

  12. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Trisadee Khamlor

    2014-10-01

    Full Text Available Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP gene and sex-determining region Y (SRY were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99% comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05. The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90% as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

  13. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

    Science.gov (United States)

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

    2016-01-01

    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  14. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    Dolapci, Istar; Tekeli, Alper; Ozsan, Murat; Elhan, Atilla; Yaman, Onder; Ergin, Sureyya

    2005-01-01

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  15. Introduction of a dermatophyte polymerase chain reaction assay to the diagnostic mycology service in Scotland.

    Science.gov (United States)

    Alexander, C L; Shankland, G S; Carman, W; Williams, C

    2011-05-01

    Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  16. Polymerase chain reaction for detection of invasive Shigella flexneri in food.

    Science.gov (United States)

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

    1990-06-01

    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

  17. AFM Imaging of Hybridization Chain Reaction Mediated Signal Transmission between Two DNA Origami Structures.

    Science.gov (United States)

    Helmig, Sarah; Gothelf, Kurt Vesterager

    2017-10-23

    Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Detection of periodontal bacteria in thrombi of patients with acute myocardial infarction by polymerase chain reaction.

    Science.gov (United States)

    Ohki, Takahiro; Itabashi, Yuji; Kohno, Takashi; Yoshizawa, Akihiro; Nishikubo, Shuichi; Watanabe, Shinya; Yamane, Genyuki; Ishihara, Kazuyuki

    2012-02-01

    Numerous reports have demonstrated that periodontal bacteria are present in plaques from atherosclerotic arteries. Although periodontitis has recently been recognized as a risk factor for coronary artery disease, the direct relationship between periodontal bacteria and coronary artery disease has not yet been clarified. It has been suggested that these bacteria might contribute to inflammation and plaque instability. We assumed that if periodontal bacteria induce inflammation of plaque, the bacteria would be released into the bloodstream when vulnerable plaque ruptures. To determine whether periodontal bacteria are present in thrombi at the site of acute myocardial infarction, we tried to detect periodontal bacteria in thrombi of patients with acute myocardial infarction by polymerase chain reaction (PCR). We studied 81 consecutive adults with ST-segment elevation acute myocardial infarction who underwent primary percutaneous coronary intervention (PCI). All patients underwent removal of thrombus with aspiration catheters at the beginning of percutaneous coronary intervention, and a small sample of thrombus was obtained for PCR. The detection rates of periodontal bacteria by PCR were 19.7% for Aggregatibacter actinomycetemcomitans, 3.4% for Porphyromonas gingivalis, and 2.3% for Treponema denticola. Three species of periodontal bacteria were detected in the thrombi of patients with acute myocardial infarction. This raises the possibility that such bacteria are latently present in plaque and also suggests that these bacteria might have a role in plaque inflammation and instability. Copyright © 2012 Mosby, Inc. All rights reserved.

  19. Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler

    Directory of Open Access Journals (Sweden)

    Chan-Young Park

    2016-10-01

    Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.

  20. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Lai-yu Kwok

    Full Text Available The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  1. Pouched Rats’ Detection of Tuberculosis in Human Sputum: Comparison to Culturing and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Amanda Mahoney

    2012-01-01

    Full Text Available Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%, and the mean specificity was 87.3% (range 84.7–90.3%. Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries.

  2. Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.

    Science.gov (United States)

    Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne

    2017-06-01

    To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

  3. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan

    2014-09-01

    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  4. Evaluation of multiplex polymerase chain reaction as an alternative to conventional antibiotic sensitivity test

    Directory of Open Access Journals (Sweden)

    K. Rathore

    2018-04-01

    Full Text Available Aim: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR as an alternative to conventional antibiotic sensitivity test. Materials and Methods: Isolates of Staphylococcus aureus (total = 36 from clinical cases presented to Teaching Veterinary Clinical Complex of College of Veterinary and Animal Sciences (CVAS, Navania, Udaipur, were characterized by morphological, cultural, and biochemical methods. Then, the isolates were further subjected to molecular characterization by PCR targeting S. aureus-specific sequence (107 bp. Phenotypic antibiotic sensitivity pattern was analyzed by Kirby Bauer disc diffusion method against 11 commonly used antibiotics in veterinary medicine in and around Udaipur region. The genotypic antibiotic sensitivity pattern was studied against methicillin, aminoglycosides, and tetracycline targeting the gene mecA, aacA-aphD, and tetK by multiplex PCR. Results: There was 100% correlation between the phenotype and genotype of aminoglycoside resistance, more than 90% correlation for methicillin resistance, and 58.3% in the case tetracycline resistance. Conclusion: As there is a good correlation between phenotype and genotype of antibiotic resistance, multiplex PCR can be used as an alternative to the conventional antibiotic susceptibility testing, as it can give a rapid and true prediction of antibiotic sensitivity pattern.

  5. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

    2004-01-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  6. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    International Nuclear Information System (INIS)

    Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng

    2007-01-01

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

  7. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  8. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong

    2012-01-01

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  9. Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer

    Science.gov (United States)

    Madadelahi, M.; Kalan, K.; Shamloo, A.

    2018-05-01

    Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.

  10. Real-Time Polymerase Chain Reaction Quantification of Phytophthora capsici in Different Pepper Genotypes.

    Science.gov (United States)

    Silvar, C; Díaz, J; Merino, F

    2005-12-01

    ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.

  11. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  12. Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.

    Science.gov (United States)

    Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A

    2002-10-01

    ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.

  13. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  14. Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

    Science.gov (United States)

    White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

    2015-01-01

    Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

  15. Five years' experience of classical swine fever polymerase chain reaction ring trials in France.

    Science.gov (United States)

    Po, F; Le Dimna, M; Le Potier, M F

    2011-12-01

    Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.

  16. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    Science.gov (United States)

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  17. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Samira Mohammadi

    2017-01-01

    Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  18. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Science.gov (United States)

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  19. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  20. The neutrino interaction analysis chain in OPERA

    CERN Document Server

    Rescigno, Regina

    Th e aim of the OPERA experiment i s to provide a “smoking - gun” proof of neutrino oscillation s, through the detecti on of the appearance signal of ν τ ’s in an initially pure ν μ beam. The beam is produced at CERN, 732 Km fa r from the detector , which is located underground in t he Gran Sasso laboratory. The evidence of the appearance signal will be provided by the detection of the daughter particles produced in the decay of the τ lepton. A micro - metric spatial resolution is needed in order to measure a nd study the topology of the ν τ - induced events. With this goal, n uclear emulsions, the highest resolution tracking detector , were chosen to be the core of the OPERA apparatus. The analysis of the large amount of nuclear emulsions used in the OPERA experime n t has required the development of a new generation of fast automatic mi croscopes , featuring a scanning speed more than one order of magnitude hi g h er than in p...

  1. Phases for the value chain design and analysis in organizations

    Directory of Open Access Journals (Sweden)

    Emilio García Vega

    2015-09-01

    Full Text Available Value generation is a key issue in the management of organizations because it allows the consumer satisfaction, dynamic face of competition and reward the owners or shareholders. Its treatment reflects both the academic and the business world; i.e. teachers, researchers, executives and managers of the enterprises, whether they are micro, small, medium or large. Although there are different approaches to the subject, this paper will seek to develop an approach from a competitive perspective and through the value chain, as it can be considered a valid tool for designing and analysing how organizations generate value. Also, this research tries to present the evolution of the generation of value, based on the classical models of McKinsey & Co. and Michael Porter. Then some approaches and contributions to the value chain of different authors and from different perspectives are presented, so that we can count with a number of additional ideas, which the author considers relevant to face the value chain design and analysis. Finally, on the basis of capital contribution of the mentioned Harvard University Professor, a series of recommendations for the strategic application of the value chain in the management of today's organizations, which are organized into nine phases (phases for the design and analysis of the value chain are presented.

  2. Hybrid modeling and empirical analysis of automobile supply chain network

    Science.gov (United States)

    Sun, Jun-yan; Tang, Jian-ming; Fu, Wei-ping; Wu, Bing-ying

    2017-05-01

    Based on the connection mechanism of nodes which automatically select upstream and downstream agents, a simulation model for dynamic evolutionary process of consumer-driven automobile supply chain is established by integrating ABM and discrete modeling in the GIS-based map. Firstly, the rationality is proved by analyzing the consistency of sales and changes in various agent parameters between the simulation model and a real automobile supply chain. Second, through complex network theory, hierarchical structures of the model and relationships of networks at different levels are analyzed to calculate various characteristic parameters such as mean distance, mean clustering coefficients, and degree distributions. By doing so, it verifies that the model is a typical scale-free network and small-world network. Finally, the motion law of this model is analyzed from the perspective of complex self-adaptive systems. The chaotic state of the simulation system is verified, which suggests that this system has typical nonlinear characteristics. This model not only macroscopically illustrates the dynamic evolution of complex networks of automobile supply chain but also microcosmically reflects the business process of each agent. Moreover, the model construction and simulation of the system by means of combining CAS theory and complex networks supplies a novel method for supply chain analysis, as well as theory bases and experience for supply chain analysis of auto companies.

  3. Value Chain Analysis: A Framework for Management of Distance Education.

    Science.gov (United States)

    Woudstra, Andrew; Powell, Richard

    1989-01-01

    Discussion of the benefits of value chain analysis in the management of distance education organizations focuses on an example at Athabasca University. The effects of policies and decisions on the organization and its value system are considered, cost drivers for activities are described, and a future-oriented perspective is emphasized. (14…

  4. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  5. Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

    1999-07-01

    Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

  6. Helicobacter-negative gastritis: polymerase chain reaction for Helicobacter DNA is a valuable tool to elucidate the diagnosis.

    Science.gov (United States)

    Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G

    2016-04-01

    Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.

  7. Use of the polymerase chain reaction to directly detect malaria parasites in blood samples from the Venezuelan Amazon.

    Science.gov (United States)

    Laserson, K F; Petralanda, I; Hamlin, D M; Almera, R; Fuentes, M; Carrasquel, A; Barker, R H

    1994-02-01

    We have examined the reproducibility, sensitivity, and specificity of detecting Plasmodium falciparum using the polymerase chain reaction (PCR) and the species-specific probe pPF14 under field conditions in the Venezuelan Amazon. Up to eight samples were field collected from each of 48 consenting Amerindians presenting with symptoms of malaria. Sample processing and analysis was performed at the Centro Amazonico para la Investigacion y Control de Enfermedades Tropicales Simon Bolivar. A total of 229 samples from 48 patients were analyzed by PCR methods using four different P. falciparum-specific probes. One P. vivax-specific probe and by conventional microscopy. Samples in which results from PCR and microscopy differed were reanalyzed at a higher sensitivity by microscopy. Results suggest that microscopy-negative, PCR-positive samples are true positives, and that microscopy-positive and PCR-negative samples are true negatives. The sensitivity of the DNA probe/PCR method was 78% and its specificity was 97%. The positive predictive value of the PCR method was 88%, and the negative predictive value was 95%. Through the analysis of multiple blood samples from each individual, the DNA probe/PCR methodology was found to have an inherent reproducibility that was highly statistically significant.

  8. Reaction kinetic analysis of reactor surveillance data

    Energy Technology Data Exchange (ETDEWEB)

    Yoshiie, T., E-mail: yoshiie@rri.kyoto-u.ac.jp [Research Reactor Institute, Kyoto University, Kumatori-cho, Sennan-gun, Osaka-fu 590-0494 (Japan); Kinomura, A. [Research Reactor Institute, Kyoto University, Kumatori-cho, Sennan-gun, Osaka-fu 590-0494 (Japan); Nagai, Y. [The Oarai Center, Institute for Materials Research, Tohoku University, Oarai, Ibaraki 311-1313 (Japan)

    2017-02-15

    In the reactor pressure vessel surveillance data of a European-type pressurized water reactor (low-Cu steel), it was found that the concentration of matrix defects was very high, and a large number of precipitates existed. In this study, defect structure evolution obtained from surveillance data was simulated by reaction kinetic analysis using 15 rate equations. The saturation of precipitation and the growth of loops were simulated, but it was not possible to explain the increase in DBTT on the basis of the defect structures. The sub-grain boundary segregation of solutes was discussed for the origin of the DBTT increase.

  9. Bakteri Legionella pneumophila Terdeteksi pada Air Kolam Renang di Kota Surabaya dengan Nested Polymerase Chain Reaction (LEGIONELLA PNEUMOPHILA BACTERIADETECTED IN SWIMMING POOL WATER OF SURABAYA BY USING NESTED POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Eduardus Bimo Aksono

    2017-06-01

    Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup

  10. An Application of Graph Theory in Markov Chains Reliability Analysis

    Directory of Open Access Journals (Sweden)

    Pavel Skalny

    2014-01-01

    Full Text Available The paper presents reliability analysis which was realized for an industrial company. The aim of the paper is to present the usage of discrete time Markov chains and the flow in network approach. Discrete Markov chains a well-known method of stochastic modelling describes the issue. The method is suitable for many systems occurring in practice where we can easily distinguish various amount of states. Markov chains are used to describe transitions between the states of the process. The industrial process is described as a graph network. The maximal flow in the network corresponds to the production. The Ford-Fulkerson algorithm is used to quantify the production for each state. The combination of both methods are utilized to quantify the expected value of the amount of manufactured products for the given time period.

  11. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio

    2010-11-01

    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  12. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  13. Value of polymerase chain reaction in patients with presumptively diagnosed and treated as tuberculous pericardial effusion

    International Nuclear Information System (INIS)

    Rehman, H.; Hafizullah, M.; Shah, S.T.; Khan, S.B.; Hadi, A.; Ahmad, F.; Shah, I.; Gul, A.M.

    2012-01-01

    Objective: To know the sensitivity of polymerase chain reaction (PCR) in pericardial fluid and response to antituberculous treatment (ATT) in PCR positive patients who were presumptively diagnosed and treated as tuberculous pericardial effusion. Methodology: This was a descriptive cross sectional study carried out from June 1, 2009 to 31 May 2010 at Cardiology Department, Lady Reading Hospital, Peshawar. Patients with presumptive diagnosis and receiving treatment for tuberculous pericardial effusion were included. Pericardial fluid sample was aspirated under fluoroscopy for the routine work up. The specimens were subjected to PCR detection of mycobacterium tuberculous DNA. Results: During 12 month study period, a total of 54 patients with large pericardial effusion presented to Cardiology department, Lady Reading Hospital, Peshawar. Of them, 46 patients fulfilled the criteria for presumptive diagnosis of tuberculous pericardial effusion. PCR for mycobacterium tuberculous DNA in pericardial fluid was positive in 45.7%(21). Patients were followed for three months. In PCR positive group, 01 patient while in PCR negative group 3 patients were lost to follow up. Among PCR positive patients 17(85%) while in PCR negative group 11(47.82%) patient responded to ATT both clinically and echo-cardio graphically. We found that patients who were PCR positive responded better to therapy than those who were PCR negative and this finding was statistically significant (p=0.035). Conclusion: PCR, with all its limitations, is potentially a useful diagnostic test in patients with presumptively diagnosed tuberculous pericardial effusion. A PCR positive patient responds better to therapy as compared to PCR negative patient. (author)

  14. Clinical application of polymerase chain reaction to diagnose Clostridium difficile in hospitalized patients with diarrhea.

    Science.gov (United States)

    Morelli, Michael S; Rouster, Susan D; Giannella, Ralph A; Sherman, Kenneth E

    2004-08-01

    Clostridium difficile is a common cause of diarrhea in hospitalized patients and is associated with significant morbidity and cost. The current diagnostic standard, enzyme immunoassay (EIA), has low sensitivity, leading to duplicate testing and empiric treatment. We sought to show the usefulness and potential cost effectiveness of polymerase chain reaction (PCR) amplification of toxin B gene for diagnosis of C. difficile-induced diarrhea. A total of 148 stool samples from academic and community-based hospitals were sent for EIA testing and were evaluated prospectively for the presence of toxin B gene by PCR. Results were compared with EIA regarding sensitivity, specificity, and predictive values. Medical charts were reviewed to determine the following: (1) number of EIAs sent per admission, (2) number sent within a 24-hour time period, and (3) how caregivers practiced based on EIA results. The mean age of 130 patients was 55 years. EIA and PCR were positive in 6.8% and 13.6% of patients, respectively. EIA sensitivity was 40%, specificity was 98%, and positive and negative predictive values were 80% and 91%, respectively. The cost of the PCR was $22/sample. Empiric treatment for C. difficile was given unnecessarily in 42% of EIA-negative results. Thirty percent of patients had 3 or more EIAs sent during their hospital admission. Of patients with multiple samples sent, 57% had more than 1 sample sent in a 24-hour period. Many physicians do not conform to practice guidelines regarding recommended diagnosis and empiric treatment of C. difficile. Toxin B gene PCR represents a more sensitive and potentially cost-effective method to diagnose C. difficile-induced diarrhea than EIA and should be considered for use as an alternative diagnostic standard.

  15. Newborn screening for congenital cytomegalovirus using real-time polymerase chain reaction in umbilical cord blood.

    Science.gov (United States)

    Barkai, Galia; Barzilai, Asher; Mendelson, Ella; Tepperberg-Oikawa, Michal; Roth, Daphne Ari-Even; Kuint, Jacob

    2013-06-01

    Congenital cytomegalovirus (C-CMV) infection affects 0.4-2% of newborn infants in Israel, most of whom are asymptomatic. Of these, 10-20% will subsequently develop hearing impairment and may have benetitted from early detection by neonatal screeing. To retrospectively anaIyze the results of a screening program for C-CMV performed at the Sheba Medical Center, Tel, Hashomer, during a 1 year period, using real-time polymerase chain reaction (rt-PCR) from umbilical cord blood. CMV DNA was detected by rt-PCR performed on infants' cord blood. C-CMV was confirmed by urine culture (Shell-vial). All confirmed cases were further investigated for C-CMV manifestations by head ultrasound, complete blood count, liver enzyme measurement, ophthalmology examination and hearing investigation. During the period 1 June 2009 to 31 May 2010, 11,022 infants were born at the Sheba Medical Center, of whom 8105 (74%) were screened. Twenty-three (0.28%) were positive for CMV and 22 of them (96%) were confirmed by urine culture. Two additional infants, who had not been screened, were detected after clinical suspicion. All 24 infants were further Investigated, and 3 (12.5%) had central nervous system involvement (including hearing impairment) and were offered intravenous ganciclovir for 6 weeks. Eighteen infants (82%) would not otherwise have been diagnosed. The relatively low incidence of C-CMV detected in our screening program probably reflects the low sensitivity of cord blood screening. Nevertheless, this screening program reliably detected a non-negligible number of infants who could benefit from early detection. Other screening methods using saliva should be investigated further.

  16. A polymerase chain reaction-based methodology to detect gene doping.

    Science.gov (United States)

    Carter, Adam; Flueck, Martin

    2012-04-01

    The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

  17. Polymerase chain reaction-based denaturing gradient gel electrophoresis in the evaluation of oral microbiota.

    Science.gov (United States)

    Li, Y; Saxena, D; Barnes, V M; Trivedi, H M; Ge, Y; Xu, T

    2006-10-01

    Clinical evaluation of oral microbial reduction after a standard prophylactic treatment has traditionally been based on bacterial cultivation methods. However, not all microbes in saliva or dental plaque can be cultivated. Polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) is a cultivation-independent molecular fingerprinting technique that allows the assessment of the predominant bacterial species present in the oral cavity. This study sought to evaluate the oral microbial changes that occurred after a standard prophylactic treatment with a conventional oral care product using PCR-DGGE. Twelve healthy adults participated in the study. Pooled plaque samples were collected at baseline, 24 h after prophylaxis (T1), and 4 days after toothbrushing with fluoride toothpaste (T4). The total microbial genomic DNA of the plaque was isolated. PCR was performed with a set of universal bacterial 16S rDNA primers. The PCR-amplified 16S rDNA fragments were separated by DGGE. The effects of the treatment and of dental brushing were assessed by comparing the PCR-DGGE fingerprinting profiles. The mean numbers of detected PCR amplicons were 22.3 +/- 6.1 for the baseline group, 13.0 +/- 3.1 for the T1 group, and 13.5 +/- 4.3 for the T4 group; the differences among the three groups were statistically significant (P < 0.01). The study also found a significant difference in the mean similarities of microbial profiles between the baseline and the treatment groups (P < 0.001). PCR-based DGGE has been shown to be an excellent means of rapidly and accurately assessing oral microbial changes in this clinical study.

  18. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

    Directory of Open Access Journals (Sweden)

    Clemencia Ovalle Bracho

    2007-08-01

    Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

  19. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis].

    Science.gov (United States)

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P

    2013-06-01

    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; Pvalue of EV PCR in serum. It suggests that in some children and under certain conditions (age >3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.

    Science.gov (United States)

    Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum

    2012-12-01

    The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.

  1. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses

    Directory of Open Access Journals (Sweden)

    Kieu The Loan Trinh

    2016-05-01

    Full Text Available Purpose: We aim to fabricate a thermoplastic poly(methylmethacrylate (PMMA Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs for rapid molecular detection of foodborne pathogen bacteria. Methods: A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. Results: A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. Conclusions: In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.

  2. Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Tashfeen, S.; Ahmed, S.; Bhatti, F.A.; Ali, N.

    2014-01-01

    Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

  3. Postinduction minimal residual disease monitoring by polymerase chain reaction in children with acute lymphoblastic leukemia.

    Science.gov (United States)

    Paganin, Maddalena; Fabbri, Giulia; Conter, Valentino; Barisone, Elena; Polato, Katia; Cazzaniga, Giovanni; Giraldi, Eugenia; Fagioli, Franca; Aricò, Maurizio; Valsecchi, Maria Grazia; Basso, Giuseppe

    2014-11-01

    Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. Monitoring minimal residual disease (MRD) by using real-time quantitative polymerase chain reaction (RQ-PCR) provides information for patient stratification and individual risk-directed treatment. Cooperative studies have documented that measurement of blast clearance from the bone marrow during and after induction therapy identifies patient populations with different risk of relapse. We explored the possible contribution of measurements of MRD during the course of treatment. We used RQ-PCR to detect MRD in 110 unselected patients treated in Italy in the International Collaborative Treatment Protocol for Children and Adolescents With Acute Lymphoblastic Leukemia (AIEOP-BFM ALL 2000). The trial took place in AIEOP centers during postinduction chemotherapy. Results were categorized as negative, low positive (below the quantitative range [< 5 × 10(-4)]), or high positive (≥ 5 × 10(-4)). Patients with at least one low-positive or high-positive result were assigned to the corresponding subgroup. Patients who tested high positive, low positive, or negative had significantly different cumulative incidences of leukemia relapse: 83.3%, 34.8%, and 8.6%, respectively (P < .001). Two thirds of positive cases were identified within 4 months after induction-consolidation therapy, suggesting that this time frame may be most suitable for cost-effective MRD monitoring, particularly in patients who did not clear their disease at the end of consolidation. These findings provide further insights into the dynamic of MRD and the ongoing effort to define molecular relapse in childhood ALL. © 2014 by American Society of Clinical Oncology.

  4. Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?

    Directory of Open Access Journals (Sweden)

    Yoo Jin Lee

    2016-11-01

    Full Text Available Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB, but it is time-consuming. Polymerase chain reaction (PCR is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA, acid-fast bacilli (AFB staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1% and a high specificity (86.3% based on the culture results of other studies. The sensitivity was higher (65.5% in cases with necrotizing granuloma but showed the highest sensitivity (66.7% in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis.

  5. Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

    Science.gov (United States)

    Fahrimal, Y; Goff, W L; Jasmer, D P

    1992-01-01

    Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

  6. Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY)

    OpenAIRE

    Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati

    2014-01-01

    Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...

  7. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Science.gov (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  8. Detection of retinoblastoma gene deletions in spontaneous and radiation-induced mouse lung adenocarcinomas by polymerase chain reaction

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-01-01

    A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs

  9. Identification of nickel response genes in abnormal early developments of sea urchin by differential display polymerase chain reaction.

    Science.gov (United States)

    Ryu, Tae Kwon; Lee, Gunsup; Rhee, Yong; Park, Heung-Sik; Chang, Man; Lee, Sukchan; Lee, Jaean; Lee, Taek-Kyun

    2012-10-01

    Bioassays and biomarkers have been previously developed to assess the effects of heavy metal contaminants on the early life stages of the sea urchin. In this study, malformation in the early developmental processes was observed in sea urchin (Strongylocentrotus intermedius) larvae exposed to 10 ppm Ni for over 30 h. The most critical stage at which the triggering of nickel effects takes place is thought to be the blastula stage, which occurs after fertilization in larval development. To investigate the molecular-level responses of sea urchin exposed to heavy metal stress and to explore the differentially expressed genes that are induced or repressed by nickel, differential display polymerase chain reaction (DD-PCR) was used with sea urchin mRNAs. The malformation-related genes expressed in the early life stages of the sea urchin were cloned from larvae exposed to 10 ppm of nickel for 15 h, and accessed via DD-PCR. Sequence analysis results revealed that each of the genes evidenced high homology with EGF2, PCSK9, serine/threonine protein kinase, apolipophorin precursor protein, and MGC80921 protein/transcript variant 2. This result may prove useful in the development of novel biomarkers for the assessment of heavy metal stresses on sea urchin embryos. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Babesia bovis and B. bigemina DNA detected in cattle and ticks from Zimbabwe by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    I. Smeenk

    2000-07-01

    Full Text Available From blood collected from 94 cattle at 12 locations in the eastern and northeastern areas of Zimbabwe, DNA was extracted and analysed by polymerase chain reaction with primers previously reported to be specific for Babesia bigemina and Babesia bovis. Overall, DNA of Babesia bigemina was detected in the blood of 33/94 (35 % cattle and DNA from B. bovis was detected in 27/58 (47 % of cattle. The prevalence of DNA of B. bigemina was significantly higher in young animals (<2 years (23/46 than in animals over 2 years of age (10/48; (chi2 = 8.77; P < 0.01 %. Although tick sampling was not thorough, Boophilus decoloratus could be collected at 7/9 sites sampled and Boophilus microplus at 4/9 sites. Of the 20 B. decoloratus allowed to oviposit before PCR analysis, 1 (5 % contained DNA that could be amplified with primers for B. bigemina while 12 (60 % were positive with primers for B. bovis. Of the B. microplus allowed to oviposit, 11/16 (69 % were positive for B. bovis DNAby PCR and 2/16 (12 % were positive for B. bigemina.

  11. On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system.

    Science.gov (United States)

    Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori

    2017-09-01

    Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sundaran S. Tinky

    2015-04-01

    Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

  13. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    Gokahmetoglu, S.; Deniz, E.

    2007-01-01

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  14. Polymerase chain reaction as a prospect for the early diagnosis and prediction of periodontal diseases in adolescents.

    Science.gov (United States)

    Birsan, I

    2015-02-01

    This study was to determine the markers representative of pathogenic periodontal microflora [Prevotella intermedia (P.i), Tannerella forsythia (T.f) [Bacteroides forsythus], Treponema denticola (T.d), Actinobacillus actinomycetemcomitans (A.a), Porphyromonas gingivalis (P.g)] in the dental plaque of adolescents with various degrees of severity of periodontium inflammation. Forty-patients aged 15-16 years of age were examined using PMA, CPI and Green-Vermillion indices (Müller 2001). The hygiene status of each patient was also determined using Durr Dental's Vista Proof intraoral camera (Germany). The polymerase chain reaction (PCR) was performed using a Biometra Thermocycler to detect DNA of pathogenic periodontal bacteria in dental plaque. All marker microorganisms (P.i.+T.f.+T.d.+A.a.+P.g.) were identified in patients diagnosed with periodontitis in dental plaque. A direct correlation between the level of oral hygiene and the severity of the pathological process in it was determined. It was found that the increase in the severity of the disease was accompanied by increased pathogenic periodontal microflora in dental plaque. Identification of periodontal pathogens in dental plaque by PCR greatly enhances the early diagnosis of Cronic cattaral gingivitis (CCG) risk factors in adolescents, and allows for detailed analysis of the relation between each factor and severity of the process. This method may be used for the diagnosis of periodontal diseases, prediction of their future course, and reasonable choice of antimicrobial therapy.

  15. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    International Nuclear Information System (INIS)

    Khan, S. A.; Ahmed, S.; Khan, F. A.; Shamshad, G. U.; Joyia, Z.; Mushahid, N.; Saeed, S.

    2013-01-01

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  16. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  17. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

    Science.gov (United States)

    Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

    2018-01-18

    Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  19. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    Science.gov (United States)

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  20. [Using the polymerase chain reaction to Borrelia burgdorferi infection in localized scleroderma injure (morphea), in Venezuelan patients].

    Science.gov (United States)

    Espinoza-León, Fabiola; Arocha, Francisco; Hassanhi, Manzur; Arévalo, Julio

    2010-09-01

    Borrelia burgdorferi is the causative agent of Lyme Borreliosis, an infectious multisystemic disease transmitted to humans by the Ixodes ticks bite. A possible association of Borrelia burgdorferi with localized scleroderma has been postulated. However, published data do not provide unequivocal results. Previous serologic analysis of patients with localized scleroderma in South American countries (including Venezuela), have been reported as yielding some reactivity. The present study looked for evidence of Borrelia burgdorferi infection in venezuelan patients with localized scleroderma, using the polymerase chain reaction to analyze 21 skin samples of patients with this skin condition. The results were negative in all the samples studied. Our data do not support an association of Borrelia burgdorferi infection and the sclerotic lesions of localized scleroderma; but do not rule out the possibility of a relationship between localized scleroderma and an unknown geno-specie of Borrelia burgdorferi sensu lato complex, a different Borrelia specie or a different spirochetal organism, as the etiological agents of the skin lesions in this area.

  1. Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

    Science.gov (United States)

    Lily; Siregar, Y.; Ilyas, S.

    2018-03-01

    This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

  2. Automation and integration of polymerase chain reaction with capillary electrophoresis for high throughput genotyping and disease diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, N.

    1999-02-12

    Genotyping is to detect specific loci in the human genome. These loci provide important information for forensic testing, construction of genetic linkage maps, gene related disease diagnosis and pharmacogenetic research. Genotyping is becoming more and more popular after these loci can be easily amplified by polymerase chain reaction (PCR). Capillary electrophoresis has its unique advantages for DNA analysis due to its fast heat dissipation and ease of automation. Four projects are described in which genotyping is performed by capillary electrophoresis emphasizing different aspects. First, the author demonstrates a principle to determine the genotype based on capillary electrophoresis system. VNTR polymorphism in the human D1S80 locus was studied. Second, the separation of four short tandem repeat (STR) loci vWF, THO1, TPOX and CSF1PO (CTTv) by using poly(ethylene oxide) (PEO) was studied in achieving high resolution and preventing rehybridization of the DNA fragments. Separation under denaturing, non-denaturing conditions and at elevated temperature was discussed. Third, a 250 {micro}m i.d., 365 {micro}m o.d. fused silica capillary was used as the microreactor for PCR. Fourth, direct PCR from blood was studied to simplify the sample preparation for genotyping to minimum.

  3. Detection of clarithromycin-resistant Helicobacter pylori by polymerase chain reaction using residual samples from rapid urease test

    Directory of Open Access Journals (Sweden)

    Jae-Sik Jeon

    2017-01-01

    Full Text Available Background: Approximately 50% of the world population is infected with Helicobacter pylori, which corresponds to a high infection rate. Furthermore, the incidence of antibiotic-resistant H. pylori has increased with the recent rise in use of antibiotics for H. pylori elimination, suggesting growing treatment failures. Aim: The study was aimed to assess the use of residual samples from rapid urease test (RUT for biomolecular testing as an effective and accurate method to detect antibiotic-resistant H. pylori. Settings and Design: This study was a retrospective study performed using data obtained from medical records of previously isolated H. pylori strains. Materials and Methods: RUT was conducted for 5440 biopsy samples from individuals who underwent health examination in South Korea. Subsequently, 469 RUT residual samples were randomly selected and subjected to polymerase chain reaction (PCR to detect antibiotic-resistant H. pylori. Statistical Analysis Used: The Chi-square test was used to analyse categorical data. P < 0.05 was considered statistically significant. Results: The results showed a concordance between the results of PCR and conventional RUT in 450 of 469 samples, suggesting that the H. pylori PCR test is a time- and cost-effective detection method. Conclusions: This study demonstrated that PCR test can aid physicians to prescribe the appropriate antibiotics at the time of diagnosis, thus preventing the reduction in H. pylori eradication due to antibiotic resistance, averting progression to serious diseases and increasing the treatment success rate.

  4. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  5. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  6. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    P. D. Luka

    2014-10-01

    Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.

  7. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    Science.gov (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  8. Prognostic significance of bi/oligoclonality in childhood acute lymphoblastic leukemia as determined by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Scrideli

    2001-09-01

    Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.

  9. LISA data analysis using Markov chain Monte Carlo methods

    International Nuclear Information System (INIS)

    Cornish, Neil J.; Crowder, Jeff

    2005-01-01

    The Laser Interferometer Space Antenna (LISA) is expected to simultaneously detect many thousands of low-frequency gravitational wave signals. This presents a data analysis challenge that is very different to the one encountered in ground based gravitational wave astronomy. LISA data analysis requires the identification of individual signals from a data stream containing an unknown number of overlapping signals. Because of the signal overlaps, a global fit to all the signals has to be performed in order to avoid biasing the solution. However, performing such a global fit requires the exploration of an enormous parameter space with a dimension upwards of 50 000. Markov Chain Monte Carlo (MCMC) methods offer a very promising solution to the LISA data analysis problem. MCMC algorithms are able to efficiently explore large parameter spaces, simultaneously providing parameter estimates, error analysis, and even model selection. Here we present the first application of MCMC methods to simulated LISA data and demonstrate the great potential of the MCMC approach. Our implementation uses a generalized F-statistic to evaluate the likelihoods, and simulated annealing to speed convergence of the Markov chains. As a final step we supercool the chains to extract maximum likelihood estimates, and estimates of the Bayes factors for competing models. We find that the MCMC approach is able to correctly identify the number of signals present, extract the source parameters, and return error estimates consistent with Fisher information matrix predictions

  10. Analytical definition of fission chain reaction parameters for cylindrical uranium bar and energy release evaluations for HIF hybrid targets

    International Nuclear Information System (INIS)

    Imshennik, V.S.

    2006-01-01

    Within the conditions of Heavy-Ion Fusion (HIF) arises a possibility to obtain the fission chain reaction for a cylindrical HIF target. The paper contains the solution interpolated with the diffusion approximation in order to receive the general approximation expressions for the bar critical radius as well as for over-critical state. The obtained critical parameters generalized for uranium envelope are used for rough evaluation of the energy release in HIF hybrid targets [ru

  11. Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction

    OpenAIRE

    Saed, Mohand O.; Torbati, Amir H.; Nair, Devatha P.; Yakacki, Christopher M.

    2016-01-01

    This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addi...

  12. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura

    2016-06-01

    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  13. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    OpenAIRE

    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

    2004-01-01

    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  14. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade

    2013-01-01

    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  15. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    Science.gov (United States)

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Information technology portfolio in supply chain management using factor analysis

    Directory of Open Access Journals (Sweden)

    Ahmad Jaafarnejad

    2013-11-01

    Full Text Available The adoption of information technology (IT along with supply chain management (SCM has become increasingly a necessity among most businesses. This enhances supply chain (SC performance and helps companies achieve the organizational competitiveness. IT systems capture and analyze information and enable management to make decisions by considering a global scope across the entire SC. This paper reviews the existing literature on IT in SCM and considers pertinent criteria. Using principal component analysis (PCA of factor analysis (FA, a number of related criteria are divided into smaller groups. Finally, SC managers can develop an IT portfolio in SCM using mean values of few extracted components on the relevance –emergency matrix. A numerical example is provided to explain details of the proposed method.

  17. Multifunctional Nanomaterials Utilizing Hybridization Chain Reaction for Molecular Diagnostics and Bioanalytical Applications

    Science.gov (United States)

    Rana, Md. Muhit

    DNA nanotechnology has shown great promise in molecular diagnostic, bioanalytical and biomedical applications. The great challenge of detecting target analytes, biomarkers and small molecules, in molecular diagnostics is low yield sensitivity. To address this challenge, different nanomaterials have been used for a long time and to date there is no such cost-effective bioanalytical technique which can detect these target biomarkers (DNA, RNA, circulating DNA/miRNA) or environmental heavy metal ions (Hg2+ and Ag+) in a cost-effective and efficient manner. Herein, we initially discuss two possible bioanalytical detection methods- a) colorimetric and b) fluorometric assays which are very popular nowadays due to their distinctive spectroscopic properties. Finally, we report the promising colorimetric assay using a novel DNA based amplification strategy know as hybridization chain reaction (HCR) for potential application in the visual detection of low copies of biomarkers (miRNAs as little as 20 femtomole in an RNA pool and cell extracts in seven different combinations and Ebola virus DNA as low as 400 attomoles in liquid biopsy mimics in sixteen different combinations), environmental and biological heavy metal ions (mercury and silver concentrations as low as 10 pM in water, soil and urine samples) and also successfully applied to a molecular logic gate operation to distinguish OR and AND logic gates. No results showed any false-positive or false-negative information. On the other hand, we also discuss the future possibilities of HCR amplification technology, which is very promising for fluorometric bioanalysis. The HCR based nanoprobe technology has numerous remarkable advantages over other methods. It is re-programmable, simple, inexpensive, easy to assemble and operate and can be performed with visual and spectroscopic read-outs upon recognition of the target analytes. This rapid, specific and sensitive approach for biomarkers and heavy metal ion detection generates

  18. Results of Multiplex Polymerase Chain Reaction Assay to Identify Urethritis Pathogens

    Directory of Open Access Journals (Sweden)

    Mehmet Sarıer

    2017-03-01

    Full Text Available Objective: The purpose of this study was to evaluate the results of multiplex polymerase chain reaction (PCR test applied to identify the pathogens in male patients who attended our urology clinic with a pre-diagnosis of urethritis related with sexual intercourse. Materials and Methods: In this study, we included a total of 91 male patients, who sought medical advice in our clinic between August 2015 and October 2016 due to complaints of urethral discharge, dysuria and urethral itching, having a visible urethral discharge during the physical examination or a positive leukocyte esterase test (Combur-Test®-Roche in the first urine sample. In the urethral swab samples of these patients, urethritis pathogens were searched with a multiplex PCR test. The multiplex PCR kit, which is able to identify nine pathogens and produced by PathoFinder® (Holland, was used in the process. The pathogens that could be detected by the kit were Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Gardnerella vaginalis, Trichomonas vaginalis, Treponema pallidum, and Candida albicans. Results: The average age of the subjects was 35.1 (19-57 years. Sixty one out of 91 patients (67% were found to have a pathogen in the urethral swab sample. In 45 patients (49.4%, only one pathogen, in 12 (13.1% - two different pathogens and in 4 (4.3% patients, 3 different pathogens were detected. The pathogens found were as follows: Ureaplasma urealyticum in 22 patients (27.1%, Gardnerella vaginalis in 15 (18.6%, Neisseria gonorrhoeae in 13 (16.1%, Mycoplasma genitalium (10 patients; 12.3%, Mycoplasma hominis (8 patients; 9.9%, Chlamydia trachomatis (8 patients; 9.9%, Trichomonas vaginalis (3 patients; 3.8%, and Candida albicans (2 patients; 2.4%. None of the patients were identified with Treponema pallidum. None of the pathogens were identified in 30 patients (32.9% whose samples were examined by PCR method. Conclusion

  19. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S

    2015-09-01

    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  20. Saliva Polymerase-Chain-Reaction Assay for Cytomegalovirus Screening in Newborns

    Science.gov (United States)

    Boppana, Suresh B.; Ross, Shannon A.; Shimamura, Masako; Palmer, April L.; Ahmed, Amina; Michaels, Marian G.; Sánchez, Pablo J.; Bernstein, David I.; Tolan, Robert W.; Novak, Zdenek; Chowdhury, Nazma; Britt, William J.; Fowler, Karen B.

    2011-01-01

    BACKGROUND Congenital cytomegalovirus (CMV) infection is an important cause of hearing loss, and most infants at risk for CMV-associated hearing loss are not identified early in life because of failure to test for the infection. The standard assay for newborn CMV screening is rapid culture performed on saliva specimens obtained at birth, but this assay cannot be automated. Two alternatives — real-time polymerase-chain-reaction (PCR)–based testing of a liquid-saliva or dried-saliva specimen obtained at birth — have been developed. METHODS In our prospective, multicenter screening study of newborns, we compared real-time PCR assays of liquid-saliva and dried-saliva specimens with rapid culture of saliva specimens obtained at birth. RESULTS A total of 177 of 34,989 infants (0.5%; 95% confidence interval [CI], 0.4 to 0.6) were positive for CMV, according to at least one of the three methods. Of 17,662 newborns screened with the use of the liquid-saliva PCR assay, 17,569 were negative for CMV, and the remaining 85 infants (0.5%; 95% CI, 0.4 to 0.6) had positive results on both culture and PCR assay. The sensitivity and specificity of the liquid-saliva PCR assay were 100% (95% CI, 95.8 to 100) and 99.9% (95% CI, 99.9 to 100), respectively, and the positive and negative predictive values were 91.4% (95% CI, 83.8 to 96.2) and 100% (95% CI, 99.9 to 100), respectively. Of 17,327 newborns screened by means of the dried-saliva PCR assay, 74 were positive for CMV, whereas 76 (0.4%; 95% CI, 0.3 to 0.5) were found to be CMV-positive on rapid culture. Sensitivity and specificity of the dried-saliva PCR assay were 97.4% (95% CI, 90.8 to 99.7) and 99.9% (95% CI, 99.9 to 100), respectively. The positive and negative predictive values were 90.2% (95% CI, 81.7 to 95.7) and 99.9% (95% CI, 99.9 to 100), respectively. CONCLUSIONS Real-time PCR assays of both liquid- and dried-saliva specimens showed high sensitivity and specificity for detecting CMV infection and should be

  1. Standardization and application of real-time polymerase chain reaction for rapid detection of bluetongue virus

    Directory of Open Access Journals (Sweden)

    I. Karthika Lakshmi

    2018-04-01

    Full Text Available Aim: The present study was designed to standardize real-time polymerase chain reaction (PCR for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. Materials and Methods: A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 105 ml and RNA was isolated by the Trizol method. Both reverse transcription -PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD. The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect and molecular confirmation (by BTV-NS1 group-specific PCR. The standardized technique was then applied to field samples (blood for detecting BTV. Results: The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269Ex103 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 103 TCID 50/ml and 104 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 102 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Conclusion: Real-time PCR was found to be a very sensitive as well as reliable method

  2. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    Directory of Open Access Journals (Sweden)

    Thabit AK

    2016-06-01

    Full Text Available Abrar K Thabit,1,2 David P Nicolau1,3 1Center for Anti-Infective Research and Development, Hartford Hospital, Hartford, CT, USA; 2Faculty of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia; 3Division of Infectious Diseases, Hartford Hospital, Hartford, CT, USA Background: Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated.Aim: We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day, length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting.Methods: Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest.Results: The most common ribotypes were 027 (38%, 014/020 (21%, and 106/174 (21%. Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2. The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively. Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6. Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters, although the degree of nausea/vomiting did not differ between the three groups (P=0.3. A serum creatinine level ≥1.5 times the premorbid level was seen in only three

  3. Markov chain model for demersal fish catch analysis in Indonesia

    Science.gov (United States)

    Firdaniza; Gusriani, N.

    2018-03-01

    As an archipelagic country, Indonesia has considerable potential fishery resources. One of the fish resources that has high economic value is demersal fish. Demersal fish is a fish with a habitat in the muddy seabed. Demersal fish scattered throughout the Indonesian seas. Demersal fish production in each Indonesia’s Fisheries Management Area (FMA) varies each year. In this paper we have discussed the Markov chain model for demersal fish yield analysis throughout all Indonesia’s Fisheries Management Area. Data of demersal fish catch in every FMA in 2005-2014 was obtained from Directorate of Capture Fisheries. From this data a transition probability matrix is determined by the number of transitions from the catch that lie below the median or above the median. The Markov chain model of demersal fish catch data was an ergodic Markov chain model, so that the limiting probability of the Markov chain model can be determined. The predictive value of demersal fishing yields was obtained by calculating the combination of limiting probability with average catch results below the median and above the median. The results showed that for 2018 and long-term demersal fishing results in most of FMA were below the median value.

  4. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    Science.gov (United States)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  5. Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction.

    Science.gov (United States)

    Pournajaf, Abazar; Rajabnia, Ramazan; Sedighi, Mansour; Kassani, Aziz; Moqarabzadeh, Vahid; Lotfollahi, Lida; Ardebilli, Abdollah; Emadi, Behzad; Irajian, Gholamreza

    2016-01-01

    This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR). A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. L. monocytogenes was detected in 46 (7.45%) of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.

  6. Analysis of Supply Chain Risk Management Strategies: Case Study of Supply Chain Disruptions

    OpenAIRE

    Marcelo Dias Carvalho; Leticia Ishikawa

    2016-01-01

    Supply Chain Risk Management refers to a set of strategies used by companies to avoid supply chain disruption caused by damage at production facilities, natural disasters, capacity issues, inventory problems, incorrect forecasts, and delays. Many companies use the techniques of the Toyota Production System, which in a way goes against a better management of supply chain risks. This paper studies key events in some multinationals to analyze the trade-off between the best supply chain risk mana...

  7. A scaling analysis of a cat and mouse Markov chain

    NARCIS (Netherlands)

    Litvak, Nelli; Robert, Philippe

    2012-01-01

    If ($C_n$) a Markov chain on a discrete state space $S$, a Markov chain ($C_n, M_n$) on the product space $S \\times S$, the cat and mouse Markov chain, is constructed. The first coordinate of this Markov chain behaves like the original Markov chain and the second component changes only when both

  8. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms.

    Science.gov (United States)

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

    2016-03-01

    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The

  9. Fresh fish distribution chains: An analysis of three Danish and three Australian chains

    DEFF Research Database (Denmark)

    Frederiksen, Marco Thorup; Bremner, Allan

    2001-01-01

    . Traceability is a most important issue in the high value product chains in Australia. No information technology methods, were in evidence. In the Danish chains, nearly all traceability was lost after the collector/auction stage and the only evaluation of quality parameters was by inspection.......Information on traceability was gathered for three domestic Danish fish chains typical of the current trading practices in fresh seafood and for three chains exporting products from Australia to Japan. The same standard questionnaires, coupled with personal interviews, were used in all six chains...

  10. Modelling and analysis of workflow for lean supply chains

    Science.gov (United States)

    Ma, Jinping; Wang, Kanliang; Xu, Lida

    2011-11-01

    Cross-organisational workflow systems are a component of enterprise information systems which support collaborative business process among organisations in supply chain. Currently, the majority of workflow systems is developed in perspectives of information modelling without considering actual requirements of supply chain management. In this article, we focus on the modelling and analysis of the cross-organisational workflow systems in the context of lean supply chain (LSC) using Petri nets. First, the article describes the assumed conditions of cross-organisation workflow net according to the idea of LSC and then discusses the standardisation of collaborating business process between organisations in the context of LSC. Second, the concept of labelled time Petri nets (LTPNs) is defined through combining labelled Petri nets with time Petri nets, and the concept of labelled time workflow nets (LTWNs) is also defined based on LTPNs. Cross-organisational labelled time workflow nets (CLTWNs) is then defined based on LTWNs. Third, the article proposes the notion of OR-silent CLTWNS and a verifying approach to the soundness of LTWNs and CLTWNs. Finally, this article illustrates how to use the proposed method by a simple example. The purpose of this research is to establish a formal method of modelling and analysis of workflow systems for LSC. This study initiates a new perspective of research on cross-organisational workflow management and promotes operation management of LSC in real world settings.

  11. Modeling Value Chain Analysis of Distance Education using UML

    Science.gov (United States)

    Acharya, Anal; Mukherjee, Soumen

    2010-10-01

    Distance education continues to grow as a methodology for the delivery of course content in higher education in India as well as abroad. To manage this growing demand and to provide certain flexibility, there must be certain strategic planning about the use of ICT tools. Value chain analysis is a framework for breaking down the sequence of business functions into a set of activities through which utility could be added to service. Thus it can help to determine the competitive advantage that is enjoyed by an institute. To implement these business functions certain visual representation is required. UML allows for this representation by using a set of structural and behavioral diagrams. In this paper, the first section defines a framework for value chain analysis and highlights its advantages. The second section gives a brief overview of related work in this field. The third section gives a brief discussion on distance education. The fourth section very briefly introduces UML. The fifth section models value chain of distance education using UML. Finally we discuss the limitations and the problems posed in this domain.

  12. Global Carbon Fiber Composites Supply Chain Competitiveness Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Das, Sujit [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Warren, Josh [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); West, Devin [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Schexnayder, Susan M. [Univ. of Tennessee, Knoxville, TN (United States)

    2016-05-01

    This study identifies key opportunities in the carbon fiber supply chain where the United States Department of Energy's Office of Energy Efficiency and Renewable Energy resources and investments can help the United States achieve or maintain a competitive advantage. The report focuses on four application areas--wind energy, aerospace, automotive, and pressure vessels--that top the list of industries using carbon fiber and carbon fiber reinforced polymers and are also particularly relevant to EERE's mission. For each of the four application areas, the report addresses the supply and demand trends within that sector, supply chain, and costs of carbon fiber and components, all contributing to a competitiveness assessment that addresses the United States' role in future industry growth. This report was prepared by researchers at Oak Ridge National Laboratory and the University of Tennessee for the Clean Energy Manufacturing Analysis Center.

  13. Profit Analysis and Supply Chain Planning Model for Closed-Loop Supply Chain in Fashion Industry

    Directory of Open Access Journals (Sweden)

    Jisoo Oh

    2014-12-01

    Full Text Available In recent decades, due to market growth and use of synthetic fiber, the fashion industry faces a rapid increase of CO2 emission throughout the production cycle and raises environmental issues in recovery processing. This study proposes a closed-loop supply chain (CLSC structure in fashion industry and develops its planning model as multi-objective mixed integer linear programming to find an optimal trade-off between CLSC profit and CO2 emission. The planning model is associated with the profit analysis of each member in CLSC to find the optimal price of products on CLSC network. The model determines optimal production, transportation, and inventory quantities on CLSC network. The proposed models are validated using numerical experiments and sensitivity analyses, and from the results some managerial insights are addressed.

  14. Reaction path analysis of sodium-water reaction phenomena in support of chemical reaction model development

    International Nuclear Information System (INIS)

    Kikuchi, Shin; Ohshima, Hiroyuki; Hashimoto, Kenro

    2011-01-01

    Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule to the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. The results are used as the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by JAEA toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR). (author)

  15. Rapid identification of Mycobacterium avium ssp paratuberculosis laboratory strains by IS900-Nested polymerase chain reaction.

    Science.gov (United States)

    Taheri, Mohammad Mohammad; Mosavari, Nader; Feizabadi, Mohammad Mehdi; Tadayon, Keyvan; Keshavarz, Rouholah; Pajoohi, Reza Aref; Soleimani, Kioomars; Pour, Shojaat Dashti

    2016-12-01

    Mycobacterium avium ssp paratuberculosis (MAP) causes paratuberculosis (Johne's disease) in ruminants. As a species, M. avium comprises M. avium subsp. hominissuis and a number of clones that are known to have evolved from this subspecies, namely M. avium subsp. avium (MAA), M. avium subsp. silvaticum, and MAP. Despite the very high genomic similarity of MAP and MAA, the insertion sequence IS900, which is 1,451-bp long, is now understood to be exclusively present in 10-20 copies in the genome of MAP. In the present study, a multidiscipline polymerase chain reaction (PCR)-based algorithm targeting16SrRNA, IS6110, IS901, IS1245, and IS900 markers has been employed to differentiate between six laboratory strains of M. avium complex (including MAP 316F, III&V, and 2e plus MAA D4), Mycobacterium tuberculosis DT, and Mycobacterium bovis AN5 strains used at the Razi Institute (Tehran, Iran) for the preparation of paratuberculin, avian, human, and bovine tuberculin, respectively. Three laboratory strains of III&V, 2e, and 316F were subcultured on Herrold's egg yolk medium, whereas the MAA strain of D4 along with M. bovis AN5 and M. tuberculosis DT were subcultured on Lowenstein-Jensen slopes. All the inoculated culture tubes were incubated for 8weeks at 37°C. Eventually, their genomic DNA was extracted according to the method of van Soolingen. Five individual PCRs were conducted on these templates to amplify 16SrRNA (genus-specific marker shared by all mycobacteria), IS900 (MAP-specific marker), IS901 (MAA-specific marker), IS1245 (M. avium complex (MAC)-specific marker), and IS6110 (M. tuberculosis complex (MTC)-specific marker) loci. Consequently, a 543-bp amplicon was amplified by all the six strains in PCR against 16SrRNA, an indication of their identity as members of Mycobacterium genus. A 245-bp fragment was detected in only IS6110-PCR with M. bovis AN5 as well as M. tuberculosis DT. In the IS1245 assessment, the MAA strain of D4 produced a 427-bp amplicon, whereas

  16. Analysis of environmental and economic aspects of international pellet supply chains

    Energy Technology Data Exchange (ETDEWEB)

    Ehrig, Rita

    2014-01-17

    Biomass plays a key role to achieve the EU's 20-20-20 energy and climate targets. Because of rising European demand and limited domestic resources, the EU relies on worldwide imports. Given this framework, the present thesis explores the influences on wood pellet supply chains considering different environmental policies, price risks and the effect of torrefaction pretreatment. The examinations refer to three real case studies for pellet trade from Australia, Canada, and Russia to Europe. In the first investigation, the efficiency of co-firing imported wood pellets in terms of CO{sub 2} savings and related subsidy schemes is analysed. Scenarios show that co-firing biomass is efficient to contribute to the EU energy targets. Though, policy makers could use these instruments more effective when directing sourcing decision towards options with even less environmental impacts. The second analysis explores the influence of statistically derived price risks on total supply chain economics. It is shown that price risks can effect strong fluctuations in the short term, which seriously affect the profitability of individual trade routes. Securing the supply chain is mainly based on individual producer-buyer agreements, personal branch experiences and fast reactions on the subsidy system. Systematic evaluation of supply chains could contribute to a more reliable market and thus foster investment decisions. In the last investigation, the economic and environmental performance of potential torrefaction-based supply chains is assessed. As a result, torrefaction-based supply chains turn out to be a certain alternative to conventional ones. Though, still huge research efforts and industrial demonstration are required to make torrefied biomass a real alternative on the market.

  17. Analysis of environmental and economic aspects of international pellet supply chains

    International Nuclear Information System (INIS)

    Ehrig, Rita

    2014-01-01

    Biomass plays a key role to achieve the EU's 20-20-20 energy and climate targets. Because of rising European demand and limited domestic resources, the EU relies on worldwide imports. Given this framework, the present thesis explores the influences on wood pellet supply chains considering different environmental policies, price risks and the effect of torrefaction pretreatment. The examinations refer to three real case studies for pellet trade from Australia, Canada, and Russia to Europe. In the first investigation, the efficiency of co-firing imported wood pellets in terms of CO 2 savings and related subsidy schemes is analysed. Scenarios show that co-firing biomass is efficient to contribute to the EU energy targets. Though, policy makers could use these instruments more effective when directing sourcing decision towards options with even less environmental impacts. The second analysis explores the influence of statistically derived price risks on total supply chain economics. It is shown that price risks can effect strong fluctuations in the short term, which seriously affect the profitability of individual trade routes. Securing the supply chain is mainly based on individual producer-buyer agreements, personal branch experiences and fast reactions on the subsidy system. Systematic evaluation of supply chains could contribute to a more reliable market and thus foster investment decisions. In the last investigation, the economic and environmental performance of potential torrefaction-based supply chains is assessed. As a result, torrefaction-based supply chains turn out to be a certain alternative to conventional ones. Though, still huge research efforts and industrial demonstration are required to make torrefied biomass a real alternative on the market.

  18. Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

    Science.gov (United States)

    Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

    2011-09-01

    Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

  19. Modifications in bacterial groups and short chain fatty acid production in the gut of healthy adult rats after long-term consumption of dietary Maillard reaction products.

    Science.gov (United States)

    Delgado-Andrade, Cristina; Pastoriza de la Cueva, Silvia; Peinado, M Jesús; Rufián-Henares, José Ángel; Navarro, M Pilar; Rubio, Luis A

    2017-10-01

    Bread crust (BC) is one of the major sources of Maillard reaction products (MRPs) in the Western diet. This work was designed to analyze the impact of diets containing important levels of MRPs from BC on intestinal bacterial growth and short chain fatty acids (SCFAs) production in adult rats. Additionally, the pools of compounds excreted in feces attending to their molecular weights were analyzed. Rats were fed for 88days a control diet or diets containing BC or its soluble high molecular weight (HMW), soluble low molecular weight (LMW) or insoluble fractions, respectively. Intestinal (cecum) microbiota composition was determined by qPCR analysis. Consumption of the BC diet lowered (PMaillard reaction products are in vivo fermented by the gut microbiota, thereby changing both the pattern of SCFAs production and the microbiota composition. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Multilayer Network Analysis of Nuclear Reactions

    Science.gov (United States)

    Zhu, Liang; Ma, Yu-Gang; Chen, Qu; Han, Ding-Ding

    2016-08-01

    The nuclear reaction network is usually studied via precise calculation of differential equation sets, and much research interest has been focused on the characteristics of nuclides, such as half-life and size limit. In this paper, however, we adopt the methods from both multilayer and reaction networks, and obtain a distinctive view by mapping all the nuclear reactions in JINA REACLIB database into a directed network with 4 layers: neutron, proton, 4He and the remainder. The layer names correspond to reaction types decided by the currency particles consumed. This combined approach reveals that, in the remainder layer, the β-stability has high correlation with node degree difference and overlapping coefficient. Moreover, when reaction rates are considered as node strength, we find that, at lower temperatures, nuclide half-life scales reciprocally with its out-strength. The connection between physical properties and topological characteristics may help to explore the boundary of the nuclide chart.

  1. Structural analysis of the carbohydrate chains of glycoproteins by 500-MHz 1H-NMR spectroscopy

    International Nuclear Information System (INIS)

    Mutsaers, J.H.G.M.

    1986-01-01

    This thesis deals with the structural analysis by 500-MHz 1 H-NMR spectroscopy of carbohydrate chains obtained from glycoproteins. In the chapters 1 to 6 the structural analysis of N-glycosidically linked carbohydrate chains is described. The chapters 7 to 10 describe the structural analysis of O-glycosidically linked carbohydrate chains. 381 refs.; 44 figs.; 24 tabs.; 7 schemes

  2. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    Directory of Open Access Journals (Sweden)

    Mahmood Shishegar

    2011-12-01

    Full Text Available Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2% of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%. Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensi-tivity profile in our geographic area.

  3. Application of Polymerase Chain Reaction for High Sensitivity Detection of Roundup Ready™ Soybean Seeds and Grains in Varietal Mixtures

    Directory of Open Access Journals (Sweden)

    Ashok Pandey

    2011-01-01

    Full Text Available Strong increase in the production of genetically modified organisms (GMOs observed over the years has led to a consolidation of transgenic seed industries worldwide. The dichotomy between the evaluated risk and the perceived risk of transgenic use has defined their level of acceptability among different global societies. GMOs have been widely applied to agricultural commodities, among them the Roundup Ready™ (RR™ soybean line GTS 40-3-2 has become the most prevalent transgenic crop in the world. This variety was developed to confer plant tolerance against glyphosate-based agricultural herbicide Roundup Ready™. Issues related to detection and traceability of GMOs have gained worldwide interest due to their increasing global diffusion and the related socioeconomic and health implications. Also, due to the widespread use of GMOs in food production, labelling regulations have been established in some countries to protect the right of consumers and producers. Besides regulatory demand, consumer concern issues have resulted in the development of several methods of detecting and quantifying foods derived from genetically engineered crops and their raw materials. Polymerase chain reaction (PCR has been proven to be the method of choice to detect the presence or absence of the introduced genes of GMOs at DNA level. The present paper aims to verify whether the PCR technique can detect RR™ soybean seeds among conventional ones to further certification as non-GM soybean seeds and grains. This analysis could be accomplished through the development of new methodology called 'intentional contamination' of soybean conventional seeds or grains with the respective RR™ soybeans. The results show that the PCR method can be applied with high sensitivity in order to certify conventional soybean seeds and grains.

  4. Sampling the genomic pool of protein tyrosine kinase genes using the polymerase chain reaction with genomic DNA.

    Science.gov (United States)

    Oates, A C; Wollberg, P; Achen, M G; Wilks, A F

    1998-08-28

    The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.

  5. Comparison of the diagnostic performance of microscopic examination with nested polymerase chain reaction for optimum malaria diagnosis in Upper Myanmar.

    Science.gov (United States)

    Kang, Jung-Mi; Cho, Pyo-Yun; Moe, Mya; Lee, Jinyoung; Jun, Hojong; Lee, Hyeong-Woo; Ahn, Seong Kyu; Kim, Tae Im; Pak, Jhang Ho; Myint, Moe Kyaw; Lin, Khin; Kim, Tong-Soo; Na, Byoung-Kuk

    2017-03-16

    Accurate diagnosis of Plasmodium infection is crucial for prompt malaria treatment and surveillance. Microscopic examination has been widely applied as the gold standard for malaria diagnosis in most part of malaria endemic areas, but its diagnostic value has been questioned, particularly in submicroscopic malaria. In this study, the diagnostic performance of microscopic examination and nested polymerase chain reaction (PCR) was evaluated to establish optimal malaria diagnosis method in Myanmar. A total of 1125 blood samples collected from residents in the villages and towns located in Naung Cho, Pyin Oo Lwin, Tha Beik Kyin townships and Mandalay of Upper Myanmar were screened by microscopic examination and species-specific nested PCR method. Among the 1125 blood samples, 261 samples were confirmed to be infected with malaria by microscopic examination. Evaluation of the 1125 samples by species-specific nested PCR analysis revealed that the agreement between microscopic examination and nested PCR was 87.3% (261/299). Nested PCR successfully detected 38 Plasmodium falciparum or Plasmodium vivax infections, which were missed in microscopic examination. Microscopic examinations also either misdiagnosed the infected Plasmodium species, or did not detect mixed infections with different Plasmodium species in 31 cases. The nested PCR method is more reliable than conventional microscopic examination for the diagnosis of malaria infections, and this is particularly true in cases of mixed infections and submicroscopic infections. Given the observed higher sensitivity and specificity of nested PCR, the molecular method holds enormous promise in malaria diagnosis and species differentiation, and can be applied as an effective monitoring tool for malaria surveillance, control and elimination in Myanmar.

  6. Alternating chain with Hubbard-type interactions: renormalization group analysis

    International Nuclear Information System (INIS)

    Buzatu, F. D.; Jackeli, G.

    1998-01-01

    A large amount of work has been devoted to the study of alternating chains for a better understanding of the high-T c superconductivity mechanism. The same phenomenon renewed the interest in the Hubbard model and in its one-dimensional extensions. In this work we investigate, using the Renormalization Group (RG) method, the effect of the Hubbard-type interactions on the ground-state properties of a chain with alternating on-site atomic energies. The one-particle Hamiltonian in the tight binding approximation corresponding to an alternating chain with two nonequivalent sites per unit cell can be diagonalized by a canonical transformation; one gets a two band model. The Hubbard-type interactions give rise to both intra- and inter-band couplings; however, if the gap between the two bands is sufficiently large and the system is more than half-filled, as for the CuO 3 chain occurring in high-T c superconductors, the last ones can be neglected in describing the low energy physics. We restrict our considerations to the Hubbard-type interactions (upper band) in the particular case of alternating on-site energies and equal hopping amplitudes. The standard RG analysis (second order) is done in terms of the g-constants describing the elementary processes of forward, backward and Umklapp scatterings: their expressions are obtained by evaluating the Hubbard-type interactions (upper band) at the Fermi points. Using the scaling to the exact soluble models Tomonaga-Luttinger and Luther-Emery, we can predict the low energy physics of our system. The ground-state phase diagrams in terms of the model parameters and at arbitrary band filling are determined, where four types of instabilities have been considered: Charge Density Waves (CDW), Spin Density Waves (SDW), Singlet Superconductivity (SS) and Triplet Superconductivity (TS). The 3/4-filled case in terms of some renormalized Hubbard constants is presented. The relevance of our analysis to the case of the undistorted 3/4-filled Cu

  7. The existence and characterization of self-sustaining multiplicative fusion and fission reaction chains

    International Nuclear Information System (INIS)

    Harms, A.A.; Heindler, M.

    1980-01-01

    The mathematical-physical similarities and differences between fusion and fission multiplication processes are investigated. It is shown that advanced fusion cycles can sustain excursion tendencies which are essentially analogous to conventional fission cycles. The result that fission excursions are unbounded and that fusion excursions eventually attain an asymptote represents a significant distinction between these fundamental self-sustaining nuclear multiplicative chains. (Auth.)

  8. Molecular weight control in emulsion polymerization by catalytic chain transfer : a reaction engineering approach

    NARCIS (Netherlands)

    Smeets, N.M.B.; Meda, U.S.; Heuts, J.P.A.; Keurentjes, J.T.F.; Herk, van A.M.; Meuldijk, J.

    2007-01-01

    For the application of catalytic chain transfer in (mini)emulsion polymerization, catalyst partitioning and deactivation are key parameters that govern the actual catalyst concentration at the locus of polymerization and consequently the final molecular weight distribution. A global model, based on

  9. A scaling analysis of a cat and mouse Markov chain

    NARCIS (Netherlands)

    Litvak, Nelli; Robert, Philippe

    Motivated by an original on-line page-ranking algorithm, starting from an arbitrary Markov chain $(C_n)$ on a discrete state space ${\\cal S}$, a Markov chain $(C_n,M_n)$ on the product space ${\\cal S}^2$, the cat and mouse Markov chain, is constructed. The first coordinate of this Markov chain

  10. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline

    2015-01-01

    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...

  11. Gm typing by immunoglobulin heavy-chain gene RFLP analysis.

    OpenAIRE

    Jazwinska, E C; Dunckley, H; Propert, D N; Gatenby, P A; Serjeantson, S W

    1988-01-01

    This study was undertaken to investigate a means of assigning Gm allotypes to Caucasians by RFLP analysis. A single immunoglobulin heavy-chain gamma-4 cDNA probe (HU gamma 4) was hybridized with genomic DNA digested separately with two restriction enzymes, TaqI and PvuII. Results showed excellent correlation (P less than .001) between serologically defined Gm allotypes G1m(1), G1m(2), G2m(23), and G1m;G3m (3;5,10) and RFLPs identified with the (HU gamma 4) probe. We conclude that it is now po...

  12. Markov chain analysis of single spin flip Ising simulations

    International Nuclear Information System (INIS)

    Hennecke, M.

    1997-01-01

    The Markov processes defined by random and loop-based schemes for single spin flip attempts in Monte Carlo simulations of the 2D Ising model are investigated, by explicitly constructing their transition matrices. Their analysis reveals that loops over all lattice sites using a Metropolis-type single spin flip probability often do not define ergodic Markov chains, and have distorted dynamical properties even if they are ergodic. The transition matrices also enable a comparison of the dynamics of random versus loop spin selection and Glauber versus Metropolis probabilities

  13. Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR

    Directory of Open Access Journals (Sweden)

    Adrián Ruiz-Villalba

    2017-12-01

    Full Text Available Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated to Cq or PCR efficiency values. Titration experiments showed that the occurrence of low and high melting temperature artifacts was shown to be determined by annealing temperature, primer concentration and cDNA input. To explore the range of input variations that occur in the normal use of the Cre assay these conditions were mimicked in a complete two-way design of template −plasmid DNA- and non-template −mouse cDNA- concentrations. These experiments showed that the frequency of the amplification of the correct product and the artifact, as well as the valid quantification of the correct product, depended on the concentration of the non-template cDNA. This finding questions the interpretation of dilution series in which template as well as non-template concentrations are simultaneously decreasing. Repetition of this cDNA concentration experiment with other templates revealed that exact reproduction qPCR experiments was affected by the time it takes to complete the pipetting of a qPCR plate. Long bench times were observed to lead to significantly more artifacts. However, the measurement of artifact-associated fluorescence can be avoided by inclusion of a small heating step after the elongation phase in the amplification protocol. Taken together, this trouble-shooting journey showed that reliability and reproducibility of qPCR experiments not only depends on standardization and reporting of the biochemistry and technical aspects but also on hitherto neglected factors as sample dilution and waiting times in the laboratory work flow. Keywords: RT-qPCR, Melting curve analysis, Reaction parameters, Artifacts

  14. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls

    OpenAIRE

    Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

    2010-01-01

    Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...

  15. Polymerase chain reaction fingerprints of methicillin-resistant Staphylococcus aureus clinical isolates in Greece are related to certain antibiotypes.

    Science.gov (United States)

    Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris

    2003-06-01

    Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.

  16. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff

    2000-01-01

    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  17. AFM Imaging of Hybridization Chain Reaction-Mediated Signal Transmission Between two DNA Origami Structures

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager

    2017-01-01

    transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...

  18. Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.

    2017-10-31

    Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.

  19. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen

    2011-01-01

    Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

  20. CONCERNING CHAIN GROWTH SPECIFIC REACTION RATE AS A PART OF THE PROCESS OF METHYL METHACRYLATE MASS RADICAL POLYMERIZATION

    Directory of Open Access Journals (Sweden)

    A. A. Sultanova

    2017-02-01

    Full Text Available It is the chain growth specific reaction rate that was determined for the process of methyl methacrylate mass radical polymerization within the temperature range of 40–900 С in quasi-steady approximation by means of Monte Carlo method. The theoretical model of radical polymerization was developed taking the gel effect into account. Computer software was developed that enables to imitate radical polymerization process taking gel effect into account within the minimum run time. The programme was tested on asymptotic examples as well as was applied for methyl methacrylate mass radical polymerization. The programme makes it possible to calculate monomer conversion, molecular mass variation, molecular-mass distribution, etc.