WorldWideScience

Sample records for chain reaction analysis

  1. Chain reaction

    International Nuclear Information System (INIS)

    Balogh, Brian.

    1991-01-01

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  2. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

    2003-01-01

    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  3. Polymerase chain reaction system

    Science.gov (United States)

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  4. Microfluidic polymerase chain reaction

    Science.gov (United States)

    Maltezos, George; Gomez, Alvaro; Zhong, Jiang; Gomez, Frank A.; Scherer, Axel

    2008-12-01

    We implement microfluidic technology to miniaturize a thermal cycling system for amplifying DNA fragments. By using a microfluidic thermal heat exchanger to cool a Peltier junction, we have demonstrated rapid heating and cooling of small volumes of solution. We use a miniature K-type thermocouple to provide a means for in situ sensing of the temperature inside the microrefrigeration system. By combining the thermocouple, two power supplies controlled by a relay system, and computer automation, we reproduce the function of a commercial polymerase chain reaction thermal cycler and demonstrate amplification of a DNA sample of about 1000 base pairs.

  5. Polyneutron Chain Reactions

    International Nuclear Information System (INIS)

    John C. Fisher

    2000-01-01

    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of ∼60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N≥12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between 16 O and A Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound 16 O A Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the 16 O and A Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of A Nt is prevented by the buildup of Coulomb energy associated with transforming A Nt into A H in close proximity to 16 O. Thus, it is possible that 16 O A Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the A Nt component can tunnel to an adjacent nucleus, and if the adjacent nucleus is 18 O, a

  6. The first nuclear chain reaction

    International Nuclear Information System (INIS)

    Zinn, W.H.

    1989-01-01

    The author offers his recollections of the experimental efforts beginning in 1939 which culminated in the Chain Reaction in the squash court on December 2, 1942. Recalled are Columbia University experiments which did much to establish the feasibility of the chain in natural uranium and which stimulated the creation of the Manhattan District. The Columbia group moved to the University of Chicago, where, in early summer of 1942, construction and analysis of a number of subcritical reactors (piles) gave assurance with a high probability that only a reasonable amount of uranium and moderator would be required

  7. Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

    Science.gov (United States)

    Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

    2013-01-01

    Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

  8. Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.

    Science.gov (United States)

    Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay

    2018-01-10

    Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.

  9. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...

  10. Genotyping of RHD by multiplex polymerase chain reaction analysis of six RHD-specific exons

    NARCIS (Netherlands)

    Maaskant-van Wijk, P. A.; Faas, B. H.; de Ruijter, J. A.; Overbeeke, M. A.; von dem Borne, A. E.; van Rhenen, D. J.; van der Schoot, C. E.

    1998-01-01

    Qualitative RHD variants are the result of the replacement of RHD exons by their RHCE counterparts or of point mutations in RHD causing amino acid substitutions. For RHD typing, the use of at least two RHD typing polymerase chain reaction (PCR) assays directed at different regions of RHD is advised

  11. Supply chain reaction

    International Nuclear Information System (INIS)

    Snieckus, Darius

    2000-01-01

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  12. Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

    International Nuclear Information System (INIS)

    Zlokazov, V B; Utyonkov, V K

    2017-01-01

    The analysis of decay chains starting at superheavy nuclei 293 Ts and 289 Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249 Bk+ 48 Ca and 243 Am+ 48 Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd- Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α -particle energies and decay times of nuclei assigned to isotopes 289 Mc, 285 Nh and 281 Rg observed in both reactions. (paper)

  13. Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

    Science.gov (United States)

    Zlokazov, V. B.; Utyonkov, V. K.

    2017-07-01

    The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

  14. Fusion chain reaction - a chain reaction with charged particles

    International Nuclear Information System (INIS)

    Peres, A.; Shvarts, D.

    1975-01-01

    When a DT-plasma is compressed to very high density, the particles resulting from nuclear reactions give their energy mostly to D and T ions, by nuclear collisions, rather than to electrons as usual. Fusion can thus proceed as a chain reaction, without the need of thermonuclear temperatures. In this paper, we derive relations for the suprathermal ion population created by a fusion reaction. Numerical integration of these equations shows that a chain reaction can proceed in a cold infinite DT-plasma at densities above 8.4x10 27 ions.cm -3 . Seeding the plasma with a small amount of 6 Li reduces the critical density to 7.2x10 27 ions.cm -3 (140000times the normal solid density). (author)

  15. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    M.S. Santos

    2010-08-01

    Full Text Available Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP. More specifically: a to evaluate 3 different amplification regions, b to investigate 3 different restriction enzymes, and c to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2 were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas - FMTAM were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  16. Quantitation of transgenic plant DNA in leachate water: real-time polymerase chain reaction analysis.

    Science.gov (United States)

    Gulden, Robert H; Lerat, Sylvain; Hart, Miranda M; Powell, Jeff R; Trevors, Jack T; Pauls, K Peter; Klironomos, John N; Swanton, Clarence J

    2005-07-27

    Roundup Ready (RR) genetically modified (GM) corn and soybean comprise a large portion of the annual planted acreage of GM crops. Plant growth and subsequent plant decomposition introduce the recombinant DNA (rDNA) into the soil environment, where its fate has not been completely researched. Little is known of the temporal and spatial distribution of plant-derived rDNA in the soil environment and in situ transport of plant DNA by leachate water has not been studied before. The objectives of this study were to determine whether sufficient quantities of plant rDNA were released by roots during growth and early decomposition to be detected in water collected after percolating through a soil profile and to determine the influence of temperature on DNA persistence in the leachate water. Individual plants of RR corn and RR soybean were grown in modified cylinders in a growth room, and the cylinders were flushed with rain water weekly. Immediately after collection, the leachate was subjected to DNA purification followed by rDNA quantification using real-time Polymerase Chain Reaction (PCR) analysis. To test the effects of temperature on plant DNA persistence in leachate water, water samples were spiked with known quantities of RR soybean or RR corn genomic DNA and DNA persistence was examined at 5, 15, and 25 degrees C. Differences in the amounts and temporal distributions of root-derived rDNA were observed between corn and soybean plants. The results suggest that rainfall events may distribute plant DNA throughout the soil and into leachate water. Half-lives of plant DNA in leachate water ranged from 1.2 to 26.7 h, and persistence was greater at colder temperatures (5 and 15 degrees C).

  17. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...... and efficient method for switching the liquid flow between the PT and PCR chamber. Purification of human genomic DNA from EDTA-treated blood and multiplex PCR were successfully carried out on-chip using the developed lab-on-a-chip system....

  18. When the chain reaction started

    International Nuclear Information System (INIS)

    1968-01-01

    It was 2 December 1942. Just as the band of distinguished scientists were waiting for the world's first chain reaction to start in the first atomic pile Enrico Fermi looked at his watch and said 'Gentlemen, time for lunch'. This incident was part of the first-hand story related to members of the Agency staff on 3 September this year by Professor Herbert L. Anderson of Chicago University, one of the team engaged in the project. (author)

  19. Quantitative Analysis of Periodontal Pathogens Using Real-Time Polymerase Chain Reaction (PCR).

    Science.gov (United States)

    Marin, Mª José; Figuero, Elena; Herrera, David; Sanz, Mariano

    2017-01-01

    The quantitative polymerase chain reaction (qPCR) is a variant of PCR aimed to detect and quantify a targeted DNA molecule through the addition of probes labeled with fluorescent molecules that emit fluorescence within each amplification cycle, what results in fluorescence values proportional to the amount of accumulated PCR product. This chapter presents the detailed procedures for quantification of different periodontal pathogens (Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Campylobacter rectus, and Fusobacterium spp.) using qPCR. It also includes the description of the most frequent problems encountered and how to solve them. In addition, a detailed protocol for multiplex qPCR to detect and quantify P. gingivalis and A. actinomycetemcomitans is included.

  20. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    Science.gov (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  1. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  2. Clonality assessment of lymphoproliferative lesions using the polymerase chain reaction: An analysis of two methods

    Directory of Open Access Journals (Sweden)

    Nikhil Moorchung

    2011-01-01

    Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.

  3. Analysis of hepcidin expression: in situ hybridization and quantitative polymerase chain reaction from paraffin sections.

    Science.gov (United States)

    Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi

    2012-07-28

    To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  4. Cost analysis of real-time polymerase chain reaction microbiological diagnosis in patients with septic shock.

    Science.gov (United States)

    Alvarez, J; Mar, J; Varela-Ledo, E; Garea, M; Matinez-Lamas, L; Rodriguez, J; Regueiro, B

    2012-11-01

    Antibiotic treatment for septic shock is generally prescribed on an empirical basis using broad-spectrum antibiotics. Molecular diagnostic techniques can detect the presence of microbial DNA in blood within a few hours and facilitate early, targeted treatment. The aim of this study was to evaluate the economic impact of a real-time polymerase chain reaction technique, LightCycler SeptiFast (LSC), in patients with sepsis. A cost-minimisation study was carried out in patients admitted with a diagnosis of severe sepsis or septic shock to the intensive care unit of a university hospital. The stay in the intensive care unit, hospital admission, 28-day and six-month mortality, and the economic cost of the clinical process were also evaluated. The study involved 48 patients in the LSC group and 54 patients in the control group. The total cost was €42,198 in the control group versus €32,228 in the LCS group with statistically significant differences (P average net saving of €9970 per patient. The mortality rate was similar in both groups. The main finding of this study was the significant economic saving afforded by the use of the LCS technique, due to the shortening of intensive care unit stay and the use of fewer antibiotics.

  5. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  6. Triplex Real-time Polymerase Chain Reaction Optimization for AZF Y-chromosome Microdeletion Analysis.

    Science.gov (United States)

    Torres, Tatiana Puga; Rojas, Xavier Blum; Narváez, Medardo Blum; Montanero, Edith López; Sarasti, Alexandra Narváez

    2015-05-01

    Y chromosome microdeletions at the "Azoospermia Factor" regions (AZFa, AZFb, AZFc) are the second genetic cause of spermatogenic failure in infertile men. Despite its importance for the treatment of infertile patients, no prior investigations have been previously published in Ecuador. . The purpose of this study is to optimize a molecular technique that allows detection of microdeletions in the AZF region. Using a genomic DNA of healthy male with natural conceived offsprings, a multiplex real time polymerase chain reaction (qPCR) was standarized with eigth sequence-tagged site (STS) sY85, G34990, sY133, sY127, sY254, sY255, and using as internal control sex-determine region Y (SRY) and Ameologenin Y (AMELY). With this technique, 35 DNA samples taken from peripheral blood of patients with severe oligozoospermia were analyzed. A triplex qPCR was standardized using EvaGreen DNA-binding dye to obtain melting temperature (Tm) of the STS previously mentioned. Three of the patients evaluated were detected to have partial microdeletion in the AZFa region, with a frequency of 8.8%; being losses in the G34990 section (one patient) and sY85 section (two patients). No cases of microdeletions in other AZF regions were found. The triplex qPCR optimizated allows the identification of microdeletions in AZFa, AZFb and AZFc region in infertile men and a better clinical management of the patient's treatment decision. This first report for Ecuador reveled a higher prevalence of microdeletions in the AZFa region in comparison with those previously described in other populations.

  7. Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

    Science.gov (United States)

    Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

    2010-01-01

    Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

  8. Analysis of the predator community of a subterranean herbivorous insect based on polymerase chain reaction.

    Science.gov (United States)

    Lundgren, Jonathan G; Ellsbury, Michael E; Prischmann, Deirdre A

    2009-12-01

    The identity and impact of trophic linkages within subterranean arthropod communities are challenging to establish, a fact that hinders the development of conservation biological control programs of subterranean herbivores. Diabrotica virgifera (the western corn rootworm) is a severe agricultural pest that lives subterraneously during its pre-imaginal stages and succumbs to high levels of pre-imaginal mortality from unknown agents. The guts of 1500 field-collected arthropod predators were analyzed for D. virgifera-specific DNA sequences using quantitative polymerase chain reaction (qPCR). These gut analyses were used to generate relative and taxon-specific prey consumption indices for the major predator taxa and to determine relative consumption levels during D. virgifera egg and larval stages by predator feeding guilds. Laboratory feeding assays were used to determine the meal size consumed during 5 min and digestion rates of D. virgifera DNA of four predators abundant in D. virgifera-infested cornfields. More than 17 taxa consumed D. virgifera in the field. Harvestmen and small rove beetles were the most abundant predators captured, and the most frequent predators within the community to consume D. virgifera. The largest proportions of individual species' populations testing positive for D. virgifera DNA were found in ground beetles (Scarites quadriceps and Poecilus chalcites) and spiders, wolf spiders, and predaceous mites. Because of the longer duration of the egg stage, significantly more predators consumed D. virgifera eggs than larvae, but a similar proportion of the predator community fed on eggs and larvae. Predators with sucking mouthparts had a higher consumption index than chewing predators. Laboratory assays confirmed that sucking predators consume more D. virgifera DNA during 5 min than the chewing predators, and all four predators digested this DNA at a similar rate. This research substantiates that a diverse community of soil-dwelling and

  9. Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

    Science.gov (United States)

    Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

    2011-12-01

    Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

  10. Method of identification of unbranched chain reaction with cross termination of chain

    International Nuclear Information System (INIS)

    Poluehktov, V.A.; Begishev, I.R.

    1977-01-01

    Gas-phase chlorination of unsymmetrical difluoroethane initiated by gamma quanta of Co 60 has been studied. At decreased temperatures the only hydrogen is replaced by a chlorine atom. Over a wide range of ratios of the initial reagents, the reaction occurs with a chain rupture. An analysis of the kinetics of such a reaction provides a method for identification of an unbranched chain reaction with a cross-rupture of the chain

  11. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard

    2015-01-01

    reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days......-positive/PCR-negative cases underlines the importance of increasing the quantity and quality of samples. Moreover, it is important that samples analyzed with PCR are cultured, owing to higher-sensitivity drug susceptibility testing, differential diagnosis, and surveillance....

  12. The Value of Routine Polymerase Chain Reaction Analysis of Intraocular Fluid Specimens in the Diagnosis of Infectious Posterior Uveitis

    Directory of Open Access Journals (Sweden)

    Marius A. Scheepers

    2013-01-01

    Full Text Available Objective. To assess the value of routine polymerase chain reaction (PCR analysis on intraocular fluid from patients presenting with a first episode of suspected active infectious posterior uveitis in a population with a high prevalence of human immunodeficiency virus infection. Design. Retrospective, interventional case series. Participants. 159 consecutive patients presenting at a tertiary care hospital over a five-year period. Methods. PCR analysis was performed for cytomegalovirus, varicella zoster virus, herpes simplex virus types 1 and 2, Toxoplasma gondii, and Mycobacterium tuberculosis. Results. PCR analysis confirmed the initial clinical diagnosis in 55 patients (35% and altered the initial clinical diagnosis in 36 patients (23%. The clinical diagnosis prior to PCR testing was nonspecific (uncertain in 51 patients (32%, with PCR providing a definitive final diagnosis in 20 of these patients (39%; necrotizing herpetic retinopathy and ocular toxoplasmosis were particularly difficult to diagnose correctly without the use of PCR analysis. Conclusion. The clinical phenotype alone was unreliable in diagnosing the underlying infectious cause in a quarter of patients in this study. Since the outcome of incorrectly treated infective uveitis can be blinding, PCR analysis of ocular fluids is recommended early in the disease even in resource poor settings.

  13. The value of routine polymerase chain reaction analysis of intraocular fluid specimens in the diagnosis of infectious posterior uveitis.

    Science.gov (United States)

    Scheepers, Marius A; Lecuona, Karin A; Rogers, Graeme; Bunce, Catey; Corcoran, Craig; Michaelides, Michel

    2013-01-01

    To assess the value of routine polymerase chain reaction (PCR) analysis on intraocular fluid from patients presenting with a first episode of suspected active infectious posterior uveitis in a population with a high prevalence of human immunodeficiency virus infection. Retrospective, interventional case series. Participants. 159 consecutive patients presenting at a tertiary care hospital over a five-year period. PCR analysis was performed for cytomegalovirus, varicella zoster virus, herpes simplex virus types 1 and 2, Toxoplasma gondii, and Mycobacterium tuberculosis. PCR analysis confirmed the initial clinical diagnosis in 55 patients (35%) and altered the initial clinical diagnosis in 36 patients (23%). The clinical diagnosis prior to PCR testing was nonspecific (uncertain) in 51 patients (32%), with PCR providing a definitive final diagnosis in 20 of these patients (39%); necrotizing herpetic retinopathy and ocular toxoplasmosis were particularly difficult to diagnose correctly without the use of PCR analysis. The clinical phenotype alone was unreliable in diagnosing the underlying infectious cause in a quarter of patients in this study. Since the outcome of incorrectly treated infective uveitis can be blinding, PCR analysis of ocular fluids is recommended early in the disease even in resource poor settings.

  14. The chain re-action

    CERN Multimedia

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  15. Serological and polymerase chain reaction-based analysis of aqueous humour samples in patients with AIDS and necrotizing retinitis

    NARCIS (Netherlands)

    Verbraak, F. D.; Galema, M.; van den Horn, G. H.; Bruinenberg, M.; Luyendijk, L.; Danner, S. A.; Kijlstra, A.

    1996-01-01

    To evaluate the measurement of intraocular antibody production and detection of DNA by the polymerase chain reaction (PCR) for diagnosis of the causative microorganism in patients with AIDS and necrotizing retinitis. Paired serum and aqueous humour samples obtained from 28 patients with AIDS and

  16. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot...

  17. An Immunofluorescence-Assisted Microfluidic Single Cell Quantitative Reverse Transcription Polymerase Chain Reaction Analysis of Tumour Cells Separated from Blood

    Directory of Open Access Journals (Sweden)

    Kazunori Hoshino

    2015-11-01

    Full Text Available Circulating tumour cells (CTCs are important indicators of metastatic cancer and may provide critical information for individualized treatment. As CTCs are usually very rare, the techniques to obtain information from very small numbers of cells are crucial. Here, we propose a method to perform a single cell quantitative reverse transcription polymerase chain reaction (qPCR analysis of rare tumour cells. We utilized a microfluidic immunomagnetic assay to separate cancer cells from blood. A combination of detailed immunofluorescence and laser microdissection enabled the precise selection of individual cells. Cancer cells that were spiked into blood were successfully separated and picked up for a single cell PCR analysis. The breast cancer cell lines MCF7, SKBR3 and MDAMB231 were tested with 10 different genes. The result of the single cell analysis matched the results from a few thousand cells. Some markers (e.g., ER, HER2 that are commonly used for cancer identification showed relatively large deviations in expression levels. However, others (e.g., GRB7 showed deviations that are small enough to supplement single cell disease profiling.

  18. Nuclear chain reaction: forty years later

    International Nuclear Information System (INIS)

    Sachs, R.G.

    1984-01-01

    The proceedings from a 1982 symposium 40 years after the first controlled nuclear chain reaction took place in Chicago covers four sessions and public discussion. The session covered the history of the chain reaction; peaceful uses in technology, medicine, and biological science; peaceful uses in power generation; and nuclear weapons control. Among the speakers were Eugene Wigner, Glenn Seaborg, Alvin Weinberg, and others who participated in the first chain reaction experiments. The proceedings reflect differences of opinion among the scientists as well as the general public. References, slides, and tables used to illustrate the individual talks are included with the papers

  19. The diagnostic value of intraocular fluid analysis by polymerase chain reaction in Thai patients with uveitis.

    Science.gov (United States)

    Pathanapitoon, Kessara; Kongyai, Natedao; Sirirungsi, Wasna; de Groot-Mijnes, Jolanda D F; Leechanachai, Pranee; Choovuthayakorn, Janejit; Kunavisarut, Paradee; Rothova, Aniki

    2011-11-01

    Uveitis is a major cause of severe visual impairment throughout the world and can be initiated by various infectious and non-infectious causes. Early recognition of specific infections is important as the treatment with antimicrobial agents might stop the progression or even cure the eye disease. To determine the infectious causes of uveitis in Thailand, intraocular fluid samples of 100 HIV-negative patients and 47 HIV-positive patients with uveitis were examined using real-time PCR analysis for herpes simplex virus, varicella zoster virus, cytomegalovirus and Toxoplasma gondii. Positive PCR results were found in 33/100 (33%) HIV-negative patients and in 33/47 (70%) HIV-positive patients with uveitis. In Thailand, cytomegalovirus was identified as the most frequent cause of infectious uveitis in both HIV-negative and HIV-positive patients (49 and 91%, respectively). PCR analysis of intraocular samples in uveitis was a valuable diagnostic assay. The pattern of uveitis observed in the Far East differs from that found in the West. Copyright © 2011 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

  20. Validation of housekeeping genes for gene expression analysis in glioblastoma using quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Aithal, Madhuri G S; Rajeswari, Narayanappa

    2015-04-01

    Quantitative real-time polymerase chain reaction (qPCR) is the most reliable tool for gene expression studies. Selection of housekeeping genes (HKGs) that are having most stable expression is critical to carry out accurate gene expression profiling. There is no 'universal' HKG having stable expression in all kinds of tissues under all experimental conditions. The present study aims to identify most appropriate HKGs for gene expression analysis in glioblastoma (GBM) samples. Based on literature survey, six most commonly used HKGs that are invariant in GBM were chosen. We performed qPCR using RNA from formalin fixed paraffin embedded GBM samples and normal brain samples to investigate the expression pattern of HPRT, GAPDH, TBP, B2M, B2M, RPL13A, and RN18S1 with different abundance. A simple Δcycle threshold approach was employed to calculate the fold change. Our study shows that the expression of RPL13A and TBP were found to be most stable across all the samples and are thus suitable for gene expression analysis in human GBM. Except for TBP, none of the other conventionally used HKGs in GBM studies e.g., HPRT and GAPDH were found to be suitable as they showed variation in RNA expression. Validation of HKGs is therefore immensely specific for a particular experimental setup and is crucial in assessing any new setup.

  1. Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Barbara, D J; Morton, A; Spence, N J; Miller, A

    1995-09-01

    Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

  2. Polymerase chain reaction identification of Trypanosoma brucei ...

    African Journals Online (AJOL)

    Polymerase chain reaction identification of Trypanosoma brucei rhodesiense in wild tsetse flies from Nkhotakota Wildlife Reserve, Malawi. Janelisa Musaya, John Chisi, Edward Senga, Peter Nambala, Emmanuel Maganga, Enock Matovu, John Enyaru ...

  3. Real-time LightCycler polymerase chain reaction and melting temperature analysis for identification of clinically important Candida spp.

    Science.gov (United States)

    Khan, Ziauddin; Mustafa, Abu Salim; Alam, Fasahat Fakhar

    2009-08-01

    Invasive candidiasis is a major fungal infection occurring in patients who have prolonged hospital admissions. The rapid detection and confirmation of Candida spp. in clinical specimens is essential for efficient management and improved prognosis of these patients. The purpose of this study was to develop a real-time LightCycler polymerase chain reaction (PCR) assay for the identification of Candida spp. commonly associated with invasive infections. Using the LightCycler PCR System, the targets of genomic DNA isolated from the reference strains of 6 Candida spp. were amplified using genus- and species-specific primers, and detected in real-time employing SYBR Green fluorescent dye. The identity of Candida spp. was established by melting curve analysis. A similar analysis was performed with clinical isolates (n = 72) previously identified by conventional methods. The melting curve analysis of amplified DNA from the reference strains could differentiate between Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Candida krusei, and Candida dubliniensis. The specificity of the real-time PCR assay was validated by testing 72 clinical isolates of Candida spp. with 100% concordance, as compared with conventional identification methods. The notable findings of the study were differentiation of C. krusei from all other Candida spp. tested and of C. dubliniensis from C. albicans by melting temperature analysis; the latter 2 species share common phenotypic characteristics of germ-tube formation and chlamydospore production, so are often misidentified. Real-time PCR using LightCycler and melting curve analysis are reliable methods for rapid identification of 6 Candida spp. frequently associated with candidemia and invasive candidiasis.

  4. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  5. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

    Science.gov (United States)

    Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

    2013-11-27

    The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

  6. Detection of Congenital Cytomegalovirus Infection by Real-Time Polymerase Chain Reaction Analysis of Saliva or Urine Specimens

    Science.gov (United States)

    Ross, Shannon A.; Ahmed, Amina; Palmer, April L.; Michaels, Marian G.; Sánchez, Pablo J.; Bernstein, David I.; Tolan, Robert W.; Novak, Zdenek; Chowdhury, Nazma; Fowler, Karen B.; Boppana, Suresh B.

    2014-01-01

    Viral culture of urine or saliva has been the gold standard technique for the diagnosis of congenital cytomegalovirus (CMV) infection. Results of rapid culture and polymerase chain reaction (PCR) analysis of urine and saliva specimens from 80 children were compared to determine the clinical utility of a real-time PCR assay for diagnosis of congenital CMV infection. Results of urine PCR were positive in 98.8% of specimens. Three PCR-positive urine samples were culture negative. Results of saliva PCR and culture were concordant in 78 specimens (97.5%). Two PCR-positive saliva samples were culture negative. These findings demonstrate that PCR performs as well as rapid culture of urine or saliva specimens for diagnosing congenital CMV infection and saliva specimens are easier to collect. Because PCR also offers more rapid turnaround, is unlikely to be affected by storage and transport conditions, has lower cost, and may be adapted to high-throughput situations, it is well suited for targeted testing and large-scale screening for CMV. PMID:24799600

  7. Analysis of clinical information and reverse transcriptase-polymerase chain reaction for early diagnosis of enteroviral meningitis

    OpenAIRE

    Jin, Dahee; Heo, Tae Hoon; Byeon, Jung Hye; Kim, Gun-Ha; Kim, Mi Kyung; Eun, So-Hee; Eun, Baik-Lin

    2015-01-01

    Purpose Meningitis is among the most common infections affecting the central nervous system. It can be difficult to determine the exact pathogen responsible for the infection and patients are often treated with empiric antibiotics. This study was conducted to identify the most common clinical characteristics of enteroviral meningitis in children and evaluate the diagnostic efficacy of reverse transcriptase-polymerase chain reaction (RT-PCR) for early detection of an enterovirus. Methods We an...

  8. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  9. Assessment of hybridization among wild and cultivated Vigna unguiculata subspecies revealed by arbitrarily primed polymerase chain reaction analysis.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2012-01-01

    Intra-species hybridization and incompletely homogenized ribosomal RNA repeat units have earlier been reported in 21 accessions of Vigna unguiculata from six subspecies using internal transcribed spacer (ITS) and 5S intergenic spacer (IGS) analyses. However, the relationships among these accessions were not clear from these analyses. We therefore assessed intra-species hybridization in the same set of accessions. Arbitrarily primed polymerase chain reaction (AP-PCR) analysis was carried out using 12 primers. The PCR products were resolved on agarose gels and the DNA fragments were scored manually. Genetic relationships were inferred by TREECON software using unweighted paired group method with arithmetic averages (UPGMA) cluster analysis evaluated by bootstrapping and compared with previous analyses based on ITS and 5S IGS. A total of 202 (86 %) fragments were found to be polymorphic and used for generating a genetic distance matrix. Twenty-one V. unguiculata accessions were grouped into three main clusters. The cultivated subspecies (var. unguiculata) and most of its wild progenitors (var. spontanea) were placed in cluster I along with ssp. pubescens and ssp. stenophylla. Whereas var. spontanea were grouped with ssp. alba and ssp. tenuis accessions in cluster II, ssp. alba and ssp. baoulensis were included in cluster III. Close affinities of ssp. unguiculata, ssp. alba and ssp. tenuis suggested inter-subspecies hybridization. Multi-locus AP-PCR analysis reveals that intra-species hybridization is prevalent among V. unguiculata subspecies and suggests that grouping of accessions from two different subspecies is not solely due to the similarity in the ITS and 5S IGS regions but also due to other regions of the genome.

  10. Miltenberger blood group typing by real-time polymerase chain reaction (qPCR) melting curve analysis in Thai population.

    Science.gov (United States)

    Vongsakulyanon, A; Kitpoka, P; Kunakorn, M; Srikhirin, T

    2015-12-01

    To develop reliable and convenient methods for Miltenberger (Mi(a) ) blood group typing. To apply real-time polymerase chain reaction (qPCR) melting curve analysis to Mi(a) blood group typing. The Mi(a) blood group is the collective set of glycophorin hybrids in the MNS blood group system. Mi(a+) blood is common among East Asians and is also found in the Thai population. Incompatible Mi(a) blood transfusions pose the risk of life-threatening haemolysis; therefore, Mi(a) blood group typing is necessary in ethnicities where the Mi(a) blood group is prevalent. One hundred and forty-three blood samples from Thai blood donors were used in the study. The samples included 50 Mi(a+) samples and 93 Mi(a-) samples, which were defined by serology. The samples were typed by Mi(a) typing qPCR, and 50 Mi(a+) samples were sequenced to identify the Mi(a) subtypes. Mi(a) subtyping qPCR was performed to define GP.Mur. Both Mi(a) typing and Mi(a) subtyping were tested on a conventional PCR platform. The results of Mi(a) typing qPCR were all concordant with serology. Sequencing of the 50 Mi(a+) samples revealed 47 GP.Mur samples and 3 GP.Hop or Bun samples. Mi(a) subtyping qPCR was the supplementary test used to further define GP.Mur from other Mi(a) subtypes. Both Mi(a) typing and Mi(a) subtyping performed well using a conventional PCR platform. Mi(a) typing qPCR correctly identified Mi(a) blood groups in a Thai population with the feasibility of Mi(a) subtype discrimination, and Mi(a) subtyping qPCR was able to further define GP.Mur from other Mi(a) subtypes. © 2015 British Blood Transfusion Society.

  11. Economic analysis of rapid and sensitive polymerase chain reaction testing in the emergency department for influenza infections in children.

    Science.gov (United States)

    Nelson, Richard E; Stockmann, Chris; Hersh, Adam L; Pavia, Andrew T; Korgenksi, Kent; Daly, Judy A; Couturier, Marc R; Ampofo, Krow; Thorell, Emily A; Doby, Elizabeth H; Robison, Jeff A; Blaschke, Anne J

    2015-06-01

    Rapid multiplex polymerase chain reaction (PCR) assays simultaneously detect several respiratory viral pathogens with high sensitivity. Maximizing detection of influenza at the point of care has the potential to reduce unnecessary antibiotic use, laboratory tests and hospitalizations. However, the cost-effectiveness of rapid multiplex PCR assays for influenza has not been compared with other diagnostic methods in children. For children presenting to the emergency department with influenza-like illness, we compared costs and outcomes using 4 different testing strategies for detection of influenza: (1) a rapid multiplex PCR platform (FilmArray); (2) traditional PCR; (3) direct-fluorescent antibody and (4) rapid antigen tests. Costs were assessed from the hospital perspective, and effectiveness was defined as quality-adjusted life years (QALYs). Input parameters were obtained from previous studies, and the model was run separately for children aged 3-36 months and 3-18 years. Rapid multiplex PCR testing was the most effective testing strategy for children in both age groups. The incremental cost-effectiveness when compared with rapid antigen tests was $115,556 per QALY for children aged 3-36 months and from $228,000 per QALY for children aged 3-18 years. The cost-effectiveness of rapid multiplex PCR was sensitive to estimates for influenza prevalence, the proportion of patients treated with antivirals and the cost per test. Our model identifies scenarios in which identification of influenza in the emergency department using rapid multiplex PCR testing is a cost-effective strategy for infants and children 3 months through 18 years. Including detection of other respiratory viruses in the analysis would further improve cost-effectiveness.

  12. Genetic divergence between Mexican Opuntia accessions inferred by polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Samah, S; Valadez-Moctezuma, E; Peláez-Luna, K S; Morales-Manzano, S; Meza-Carrera, P; Cid-Contreras, R C

    2016-06-03

    Molecular methods are powerful tools in characterizing and determining relationships between plants. The aim of this study was to study genetic divergence between 103 accessions of Mexican Opuntia. To accomplish this, polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis of three chloroplast intergenic spacers (atpB-rbcL, trnL-trnF, and psbA-trnH), one chloroplast gene (ycf1), two nuclear genes (ppc and PhyC), and one mitochondrial gene (cox3) was conducted. The amplified products from all the samples had very similar molecular sizes, and there were only very small differences between the undigested PCR amplicons for all regions, with the exception of ppc. We obtained 5850 bp from the seven regions, and 136 fragments were detected with eight enzymes, 37 of which (27.2%) were polymorphic. We found that 40% of the fragments from the chloroplast regions were polymorphic, 9.8% of the bands detected in the nuclear genes were polymorphic, and 20% of the bands in the mitochondrial locus were polymorphic. trnL-trnF and psbA-trnH were the most variable regions. The Nei and Li/Dice distance was very short, and ranged from 0 to 0.12; indeed, 77 of the 103 genotypes had the same genetic profile. All the xoconostle accessions (acidic fruits) were grouped together without being separated from three genotypes of prickly pear (sweet fruits). We assume that the genetic divergence between prickly pears and xoconostles is very low, and question the number of Opuntia species currently considered in Mexico.

  13. Analysis of colorectal cancer and polyp for presence herpes simplex virus and cytomegalovirus DNA sequences by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sahar Mehrabani khasraghi

    2016-05-01

    Full Text Available Introduction: In recent years, it was demonstrated that there is a clear association between the complicated course of colorectal cancer (CRC and the presence of herpes viruses. Despite a great number of published reports, the exact pathogenic role of herpes viruses remains unclear in these patients. The purpose of this study is to explore the prevalence of herpes simplex virus (HSV and cytomegalovirus (CMV in patients with CRC and polyp in comparison with healthy subjects using the polymerase chain reaction (PCR method. Methods: In this case-control study, 15 biopsies of patients with CRC and 20 colorectal polyp sample were selected. From each patient, two tissue samples were obtained: one sample from malignant tissue, and the other from normal colorectal tissue in an area located 15 cm away from the malignant tissue. Furthermore, 35 samples from healthy people as controls were selected. After DNA extraction, PCR was used to determine HSV and CMV genomes by specific primers. A statistical analysis was performed using the chi-square test. Results: Five CRC patients (33.3% had HSV DNA detected in both the malignant and the matched normal tissue. Five CRC patients (33.3% and seven polyp patients (35.0% had CMV DNA detected in both the malignant and the matched normal tissue. HSV DNA was found in 20% and CMV DNA in 37.1% of samples from healthy people as a control group. Thus, no significant association was observed between the prevalence of HSV and CMV, and an incidence of CRC and polyps according to the location of the samples as compared with the control group. Conclusion: The findings demonstrated that there is no direct molecular evidence to support the association between HSV and CMV and human colorectal malignancies. However, the results from this study do not exclude a possible oncogenic role of these viruses in the neoplastic development of colon cells.

  14. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO

    1993-01-01

    of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib......Analysis of rearranged immunoglobulin genes used by B lymphocytes of known specificity is an important tool for the study of diversity and selection of B lymphocytes. Usually hybridoma cell lines are used for such analyses, but they are difficult to obtain from humans and may not be representative......CP-specific B lymphocytes were isolated by antigen-coated immunomagnetic beads. After the purification, at least 98% of the immunoglobulin-secreting recovered cells were HibCP specific. The RNA was isolated and amplified by cDNA synthesis using a kappa constant region primer followed by polymerase chain...

  15. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot....... salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for characterization...

  16. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    Science.gov (United States)

    Nasarabadi, Shanavaz [Livermore, CA

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  17. Real-Time Polymerase Chain Reaction

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 13; Issue 4. Real-Time Polymerase Chain Reaction - A Revolution in Diagnostics. Simarjot Singh Pabla Sarabjot Singh Pabla. General Article Volume 13 Issue 4 April 2008 pp 369-377 ...

  18. Immunoassay and polymerase chain reaction techniques for ...

    African Journals Online (AJOL)

    Objectives: To compare the Reverse Passive Latex Agglutination (RPLA) and Enzyme Linked Immunosorbent Assay (ELISA) techniques with a Polymerase Chain Reaction (PCR) for detection of enterotoxigenic Bacillus cereus. Design: A cross-sectional study. Setting: The Department of Public Health, Pharmacology and ...

  19. Polymerase chain reaction (PCR) based molecular characterization ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) based molecular characterization of popular wheat varieties of Khyber Pukhtunkhwa (KPK) region of Pakistan. ... Molecular markers used in this study show high rate of genetic diversity that can be used to assist a breeding program for the improvement of wheat in KPK-Pakistan. Key words: ...

  20. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...

  1. The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

    Science.gov (United States)

    Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

    2002-03-01

    Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

  2. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO

    1993-01-01

    -secreting cells. Examples of rearranged kappa genes used by HibCP-specific antibody-secreting cells from 4 adult vaccinees are given, representing the 3 largest of the 4 kappa variable region families. This method is a new tool for the investigation of vaccine-induced antibody responses with special reference...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...

  3. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    Science.gov (United States)

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  4. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach

    Directory of Open Access Journals (Sweden)

    Iñiguez Alena M

    2003-01-01

    Full Text Available The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences.

  5. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    Science.gov (United States)

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  6. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    Science.gov (United States)

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  7. Analysis of plasma viral RNA levels during acute dengue virus infection using quantitative competitor reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Sudiro, T M; Zivny, J; Ishiko, H; Green, S; Vaughn, D W; Kalayanarooj, S; Nisalak, A; Norman, J E; Ennis, F A; Rothman, A L

    2001-01-01

    There is increasing recognition of the potential importance of viral burden in the pathogenesis of dengue hemorrhagic fever (DHF). There is little data available, however, describing the kinetics of viral replication in humans with natural dengue virus (DV) infection. Standard procedures for measuring titers of infectious virus in clinical specimens are either laborious or insensitive. We developed a method for measurement of DV RNA in plasma samples based on reverse transcription-polymerase chain reaction (RT-PCR) using a mutant RNA target as a competitor. This technique was reproducible and accurate for samples containing any of the four DV serotypes, and could be applied to samples containing as few as 250 copies of RNA per reaction. We examined plasma viral RNA levels in 80 children with acute DV infection; sequential plasma samples were tested in 34 of these children. Plasma viral RNA levels ranged as high as 10(9) RNA copies/ml, and correlated with titers of infectious virus measured in mosquitoes (r= 0.69). Plasma viral RNA levels fell rapidly during the last several days of the febrile period. We did not find a significant difference in maximal plasma viral RNA levels between children with DHF and children with dengue fever, but peak viral RNA levels were identified in only 16 subjects. We conclude that this quantitative RT-PCR method will be valuable for further studies of natural DV infections.

  8. Competing irreversible cooperative reactions on polymer chains

    International Nuclear Information System (INIS)

    Evans, J.W.; Hoffman, D.K.; Burgess, D.R.

    1984-01-01

    We analyze model processes involving competition between several irreversible reactions at the sites of a 1D, infinite, uniform polymer chain. These reactions can be cooperative, i.e., the corresponding rates depend on the state of the surrounding sites. An infinite hierarchy of rate equations is readily derived for the probabilities of various subconfigurations. By exploiting a shielding property of suitable blocks of unreacted sites, we show how exact hierarchy truncation and solution is sometimes possible. The behavior of solutions is illustrated in several cases by plotting families of ''reaction trajectories'' for varying ratios of reactant concentrations. As a specific application, we consider competition between coordination of ZnCl 2 to pairs of oxygen atoms and to single oxygen atoms in poly(propylene oxide). The observed glass transition temperature behavior is eludicated

  9. Dual phase multiplex polymerase chain reaction

    Science.gov (United States)

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  10. A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

    Science.gov (United States)

    Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

    2017-01-01

    To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

  11. [The contamination under polymerase chain reaction studies: problems and solutions].

    Science.gov (United States)

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  12. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

    DEFF Research Database (Denmark)

    Guil-Luna, S.; Stenvang, Jan; Brünner, Nils

    2014-01-01

    and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors...

  13. Application of LightCycler polymerase chain reaction and melting curve analysis to the authentication of the traditional Chinese medicinal plant Cimicifuga foetida.

    Science.gov (United States)

    Xue, Chun-Ying; Li, De-Zhu; Wang, Qing-Zhong

    2009-06-01

    DNA sequence analysis of rDNA internal transcribed spacer (ITS) and fluorescence melting curve analysis of LightCycler real-time polymerase chain reaction products were exploited for their applications in the authentication of the traditional Chinese medicinal plant Cimicifuga foetida from four substitutes: C. heracleifolia, C. dahurica, C. acerina, and C. simplex. According to the melting temperature--which is a function of the GC/AT ratio, length, and nucleotide sequences of the amplified product--C. foetida was differentiated from C. heracleifolia, C. dahurica, C. acerina, and C. simplex. Melting curve analysis offers a rapid and reliable method for the authentication of the traditional Chinese medicinal plant C. foetida.

  14. Leading coordinate analysis of reaction pathways in proton chain transfer: Application to a two-proton transfer model for the green fluorescent protein

    International Nuclear Information System (INIS)

    Wang Sufan; Smith, Sean C.

    2006-01-01

    The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information

  15. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Mania, Hubert

    2010-01-01

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  16. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  17. Real-time polymerase chain reaction with melting analysis of positive blood culture specimens in bloodstream infections: diagnostic value and turnaround time.

    Science.gov (United States)

    Angeletti, Silvia; Gherardi, Giovanni; De Florio, Lucia; Avola, Alessandra; Crea, Francesca; Riva, Elisabetta; Vitali, Massimiliano Andrea; Galluzzo, Sara; Dicuonzo, Giordano

    2013-01-01

    A Real-time polymerase chain reaction (PCR) with melting analysis was devised to target bacterial and fungal genes together with the most prevalent antimicrobial resistance genes in 250 positive blood culture broths. This method allowed the blood culture cultivated pathogens to be classified into clinically relevant groups such as Enterobacteriaceae, oxidase-positive bacilli, oxidase-positive coccobacilli, S. aureus and yeast. Enterococci and streptococci could be distinguished from CoNS only by the Gram stain. Gram-positive bacilli were discriminated from Gram-positive cocci by Gram stain. Furthermore, the most important antimicrobial resistant genes such as mecA, vanA, bla TEM , bla SHV and bla CTX-M could be identified. All results were obtained with a turnaround time of three hours from the moment of blood culture positivity compared to 24-72 hours for phenotypic methods. In conclusion, the proposed approach can allow the clinician to implement proper early management of sepsis patients.

  18. Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

    Science.gov (United States)

    Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

    2014-02-01

    Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

  19. A chain reaction approach to modelling gene pathways.

    Science.gov (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  20. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  1. Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

    Directory of Open Access Journals (Sweden)

    Nayereh Nouri

    2014-01-01

    Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

  2. Long chain branching on linear polypropylene by solid state reactions

    NARCIS (Netherlands)

    Borsig, E.; Gotsis, A. D.; Picchioni, F.

    A method was developed for the long chain branching (LCB) of isotactic polypropylene (iPP) via modification in the solid state. PP long chains have been linked as branches to the original linear iPP chains using solid state reactions in the presence of a free radical initiator and a multifunctional

  3. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  4. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    Science.gov (United States)

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  5. Infectious uveitis in immunocompromised patients and the diagnostic value of polymerase chain reaction and Goldmann-Witmer coefficient in aqueous analysis.

    Science.gov (United States)

    Westeneng, Arnaud C; Rothova, Aniki; de Boer, Joke H; de Groot-Mijnes, Jolanda D F

    2007-11-01

    To establish the causes of uveitis in immunocompromised patients and to determine the contribution of polymerase chain reaction (PCR) and Goldmann-Witmer coefficient (GWC) analysis of aqueous humor in patients with an infectious etiology. Retrospective case series of 56 consecutive immunocompromised patients with uveitis. All patients underwent full ophthalmologic examination and laboratory blood analysis for uveitis. Aqueous humor analyses were performed using PCR and GWC for cytomegalovirus (CMV), herpes simplex virus (HSV), varicella zoster virus (VZV), and Toxoplasma gondii. Of 56 immunocompromised patients, 43 (77%), all posterior and panuveitis, had intraocular infections. Twenty-one (49%) had CMV, three (7%) had VZV, 11 (26%) had T. gondii, six (14%) had Treponema pallidum, and one (2%) each had Aspergillus and Candida. In AIDS patients, CMV was the most common cause. A strong correlation between AIDS and ocular syphilis was also observed (P = .007). In nonAIDS immunocompromised patients, T. gondii was most frequently detected. Twenty-seven patients were examined by both PCR and GWC; five (18.5%) were positive by both assays, 15 (55.5%) were positive by PCR alone and seven (26%) by GWC alone. Viral infections were detected by PCR in 16 of 17 (94%) cases; T. gondii in four of 10 (40%) patients. Using GWC, a viral infection was diagnosed in three of 17 (18%) and T. gondii in nine of 10 (90%) cases. In immunocompromised patients, PCR is superior in diagnosing viral infections. Analysis of intraocular antibody production played a decisive role in the diagnosis of ocular toxoplasmosis.

  6. Comparative evaluation of Polymerase Chain Reaction-Restriction Enzyme Analysis (PRA) and sequencing of heat shock protein 65 (hsp65) gene for identification of aquatic mycobacteria.

    Science.gov (United States)

    Pourahmad, F; Thompson, K D; Adams, A; Richards, R H

    2009-02-01

    Traditional identification of mycobacteria based on cultural and biochemical tests can take several weeks and may fail to provide a precise identification. Polymerase Chain Reaction-Restriction Enzyme Analysis (PRA) of the gene encoding heat shock protein 65 kDa (hsp65) gene has been proposed as a rapid and inexpensive alternative approach. Despite being widely used for differentiation of mammalian mycobacteria, this method has only been applied in the identification of a small number of aquatic mycobacteria. The present study aimed to evaluate the potential use of PRA of hsp65 for the identification of aquatic mycobacteria compared with sequence analysis. Seventy one mycobacterial isolates including, 10 type/reference strains and the remainder field isolates, were subjected to PRA of a 441 bp fragment of this gene. For 68 representative isolates, sequence analysis was performed. All rapidly and slowly growing mycobacteria had best matches with 99.3% to 100% similarity with their corresponding species in the databanks. PRA proved to be a simple and rapid method for identifying aquatic mycobacteria. However, the incidence of similar or identical restriction patterns for some species of mycobacteria, and in particular, identification of new species of mycobacteria is a major problem using such a method. In contrast, the nucleic acid sequencing of the hsp65 gene yielded unambiguous results.

  7. Quantitative detection and typing of hepatitis D virus in human serum by real-time polymerase chain reaction and melting curve analysis.

    Science.gov (United States)

    Hofmann, Joerg; Frenzel, Katrin; Minh, Bui Q; von Haeseler, Arndt; Edelmann, Anke; Ross, Stefan R; Berg, Thomas; Krüger, Detlev H; Meisel, Helga

    2010-06-01

    Hepatitis D virus (HDV) infection is an important etiologic agent of fulminant hepatitis and may aggravate the clinical course of chronic hepatitis B infection resulting in cirrhosis and liver failure. This report describes the establishment of a real-time reverse transcriptase polymerase chain reaction method that allows the quantitative detection of HDV-1 and HDV-3 with a sensitivity in a linear range of 2 x 10(3) to 10(8) copies/mL. Additionally, the new assay provides the opportunity to distinguish HDV-1 from HDV-3 by a subsequent melting curve analysis, an important option because these HDV types are highly associated with severe clinical outcome. The results of the melting curve analysis of 42 HDV sequences obtained in this study and the phylogenetic analysis based on 139 full-length sequences from GenBank were consistent and showed that all sequences described here cluster within the HDV-1 clade. Therefore, this assay is useful for monitoring of antiviral treatment and molecular epidemiologic studies of HDV distribution. Copyright 2010 Elsevier Inc. All rights reserved.

  8. COMPARISON OF ENTEROCOCCUS MEASUREMENTS IN FRESHWATER AT TWO RECREATIONAL BEACHES BY QUANTITATIVE POLYMERASE CHAIN REACTION AND MEMBRANE FILER CULTURE ANALYSIS

    Science.gov (United States)

    Cell densities of the fecal pollution indicator genus, Enterococcus, were determined by a rapid (2-3 hr) quantitative PCR (QPCR) analysis based method in 100 ml water samples collected from recreational beaches on Lake Michigan and Lake Erie during the summer of 2003. Enumeration...

  9. Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

    Science.gov (United States)

    Aravindran, S.; Sahilah, A. M.; Aminah, A.

    2014-09-01

    Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

  10. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene.

    Science.gov (United States)

    Soares, Vítor Yamashiro Rocha; Silva, Jailthon Carlos da; Silva, Kleverton Ribeiro da; Pires e Cruz, Maria do Socorro; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

    2014-06-01

    An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  11. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    Directory of Open Access Journals (Sweden)

    Vítor Yamashiro Rocha Soares

    2014-06-01

    Full Text Available An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis of the mitochondrial cytochrome B (cytb gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1, Bos taurus (1 and Equus caballus (2. Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  12. An analysis of the subtypes of dengue fever infections in Barbados 2003–2007 by reverse transcriptase polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Gittens-St Hilaire M

    2008-12-01

    Full Text Available Abstract Background To perform a retrospective analysis of patients with IgM antibodies to dengue fever infection to determine the serotypes present by molecular techniques. A representative sample (~20%/per year of patients diagnosed with dengue fever infection were selected based on the detection of IgM antibodies in the acute phase serum sample. RNA was extracted from each sample and reverse transcribed. Following this, the amplicons were electrophoresed and serotyped based on band sizes. Results This study consisted of 71 males and 101 females ranging in age from 0 – 50+ yrs giving a total of 172 persons with an average of 34.4 patients per year. Onset averaged 6.9 days ranging from 0–90 days. Common symptoms were as follows: fever (69%, headache (52%, arthralgia (36%, ocular pain (32%, emesis (15% and lumbar pain (15%. All patients investigated with the exception of one, were infected with DENV-3. Conclusion DENV-3 is currently circulating on the island and not DENV-1 or DENV-2 as in previous years. This has implications for the enhancement of clinical, laboratory and environmental surveillance systems.

  13. Analysis of microbial diversity on deli slicers using polymerase chain reaction and denaturing gradient gel electrophoresis technologies.

    Science.gov (United States)

    Koo, O K; Mertz, A W; Akins, E L; Sirsat, S A; Neal, J A; Morawicki, R; Crandall, P G; Ricke, S C

    2013-02-01

    Cross-contamination of pathogenic and spoilage bacteria from food-contact surfaces to food products is a serious public health issue. Bacteria may survive and attach to food-contact surfaces by residual food components and/or background bacteria which may subsequently transfer to other food products. Deli slicers, generally used for slicing ready-to-eat products, can serve as potential sources for considerable bacterial transfer. The objective of this study was to assess the extent and distribution of microbial diversity of deli slicers by identification of pathogenic and background bacteria. Slicer-swab samples were collected from restaurants in Arkansas and Texas in the United States. Ten surface areas for each slicer were swabbed using sterile sponges. Denaturing gradient gel electrophoresis (DGGE) was applied to investigate the fingerprint of samples, and each band was further identified by sequence analysis. Pseudomonads were identified as the dominant bacteria followed by Enterobacteriaceae family, and lactic acid bacteria such as Lactococcus lactis and Streptococcus thermophilus were also found. Bacterial distribution was similar for all surface areas, while the blade guard exhibited the greatest diversity. This study provides a profile of the microbial ecology of slicers using DGGE to develop more specific sanitation practices and to reduce cross-contamination during slicing. © 2012 The Society for Applied Microbiology.

  14. Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

    Science.gov (United States)

    Rozi; Rahayu, K.; Daruti, D. N.

    2018-04-01

    The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

  15. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...... developed a closed system in which airborne contamination was minimized. Analysis of 228 clinical samples tested by cell culture, IDEIA enzyme immunosorbent assay (Medico-Nobel, Boots-Celltech Ltd., Berkshire, United Kingdom), and PCR showed a sensitivity of 100%, a specificity of 93% when PCR was compared...

  16. 16S Ribosomal Ribonucleic Acid Gene Polymerase Chain Reaction in the Diagnosis of Bloodstream Infections: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Su, Guoming; Fu, Zhuqing; Hu, Liren; Wang, Yueying; Zhao, Zuguo; Yang, Weiqing

    2015-01-01

    We aim to evaluate the accuracy of the 16S ribosomal ribonucleic acid (rRNA) gene polymerase chain reaction (PCR) test in the diagnosis of bloodstream infections through a systematic review and meta-analysis. A computerized literature search was conducted to identify studies that assessed the diagnostic value of 16S rRNA gene PCR test for bloodstream infections. Study quality was assessed using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. We calculated the sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR) and their 95% confidence intervals (95% CI) for each study. Summary receiver operating characteristic (SROC) curve was used to summarize overall test performance. Statistical analysis was performed in Meta-DiSc 1.4 and Stata/SE 12.0 software. Twenty-eight studies were included in our meta-analysis. Using random-effect model analysis, the pooled sensitivity, specificity, PLR, NLR, and DOR were 0.87 (95% CI, 0.85-0.89), 0.94 (95% CI, 0.93-0.95), 12.65 (95% CI, 8.04-19.90), 0.14 (95% CI, 0.08-0.24), and 116.76 (95% CI, 52.02-262.05), respectively. The SROC curve indicated that the area under the curve (AUC) was 0.9690 and the maximum joint sensitivity and specificity (Q*) was 0.9183. In addition, heterogeneity was statistically significant but was not caused by the threshold effect. Existing data suggest that 16S rRNA gene PCR test is a practical tool for the rapid screening of sepsis. Further prospective studies are needed to assess the diagnostic value of PCR amplification and DNA microarray hybridization of 16S rRNA gene in the future.

  17. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  18. Assessing HER2 amplification by IHC, FISH, and real-time polymerase chain reaction analysis (real-time PCR) following LCM in formalin-fixed paraffin embedded tissue from 40 women with ovarian cancer

    DEFF Research Database (Denmark)

    Hillig, Thore; Thode, Jørgen; Breinholt, Ellen Marie

    2012-01-01

    We compare HER2 receptor amplification analysis by immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), and real-time polymerase chain reaction (real-time PCR) DNA copy-number assay following laser capture microdissection (LCM) in formalin-fixed paraffin embedded tissue from 40...

  19. Detection of high-risk subtypes of human papillomavirus in cervical swabs: routine use of the Digene Hybrid Capture assay and polymerase chain reaction analysis.

    LENUS (Irish Health Repository)

    Brennan, M M

    2012-02-03

    Human papillomaviruses (HPVs) are major causative agents in the pathogenesis of cervical cancer, and more than twenty types are associated with its development. With the introduction of liquid-based preparation systems, it is envisaged that large-scale HPV testing will be established in the near future. Preliminary studies demonstrate the accessibility of these samples for DNA testing using both the Digene Hybrid Capture assay (DHCA) and polymerase chain reaction (PCR) techniques. This study aims to assess the validity and sensitivity of the DHCA system to detect high-risk HPV DNA, using two sets of HPV consensus primers (Gp5+\\/Gp6+ and MY09\\/MY11) in tandem with routine assessment of cervical smear and biopsy samples. Results indicate that the combination of DHCA and PCR detects more high-grade lesions than does the DHCA alone. DHCA-negative cases were categorised by subsequent PCR amplification into low-grade HPV-negative (12\\/16) cervical lesions and high-grade HPV-positive (7\\/9) cervical lesions. Gp5+\\/Gp6+ primers were less sensitive in detecting HPV-positive samples than was the MY09\\/MY11 primer set. These results support the use of high-risk HPV testing by DHCA, with subsequent analysis of DHCA-negative samples by PCR using the MY09\\/MY11 primers.

  20. Galactomannan and Polymerase Chain Reaction-Based Screening for Invasive Aspergillosis Among High-Risk Hematology Patients: A Diagnostic Meta-analysis.

    Science.gov (United States)

    Arvanitis, Marios; Anagnostou, Theodora; Mylonakis, Eleftherios

    2015-10-15

    Screening of high-risk patients for invasive aspergillosis (IA) has the potential to decrease the use of empiric antifungal agents. However, the performance of different screening methods has not been studied. We performed a meta-analysis of published studies to assess the diagnostic performance of galactomannan (GM) and polymerase chain reaction (PCR) as weekly screening tests in high-risk populations. The sensitivity and specificity of 6 approaches combining GM and PCR were estimated using the bivariate model. Thirteen studies with 1670 patients met our inclusion criteria. Single positive test results had modest sensitivity and specificity for screening (respectively, 92% and 90% for GM; 84% and 76% for PCR). The screening approach with the highest sensitivity was the one that used at least 1 GM- or PCR-positive result to define a positive episode, achieving a sensitivity of 99%, significantly higher than any single test (P = .0018 compared with GM and P value of 100%, whereas the presence of at least 2 positive results is highly suggestive of an active infection with a positive predictive value of 88%. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Commercial enzyme-linked immunosorbent assay versus polymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis

    Science.gov (United States)

    do Brasil, Pedro Emmanuel Alvarenga Americano; Castro, Rodolfo; de Castro, Liane

    2016-01-01

    Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects. PMID:26814640

  2. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  3. Comparison of polymerase chain reaction methods and plating for analysis of enriched cultures of Listeria monocytogenes when using the ISO11290-1 method.

    Science.gov (United States)

    Dalmasso, Marion; Bolocan, Andrei Sorin; Hernandez, Marta; Kapetanakou, Anastasia E; Kuchta, Tomáš; Manios, Stavros G; Melero, Beatriz; Minarovičová, Jana; Muhterem, Meryem; Nicolau, Anca Ioana; Rovira, Jordi; Skandamis, Panagiotis N; Stessl, Beatrix; Wagner, Martin; Jordan, Kieran; Rodríguez-Lázaro, David

    2014-03-01

    Analysis for Listeria monocytogenes by ISO11290-1 is time-consuming, entailing two enrichment steps and subsequent plating on agar plates, taking five days without isolate confirmation. The aim of this study was to determine if a polymerase chain reaction (PCR) assay could be used for analysis of the first and second enrichment broths, saving four or two days, respectively. In a comprehensive approach involving six European laboratories, PCR and traditional plating of both enrichment broths from the ISO11290-1 method were compared for the detection of L. monocytogenes in 872 food, raw material and processing environment samples from 13 different dairy and meat food chains. After the first and second enrichments, total DNA was extracted from the enriched cultures and analysed for the presence of L. monocytogenes DNA by PCR. DNA extraction by chaotropic solid-phase extraction (spin column-based silica) combined with real-time PCR (RTi-PCR) was required as it was shown that crude DNA extraction applying sonication lysis and boiling followed by traditional gel-based PCR resulted in fewer positive results than plating. The RTi-PCR results were compared to plating, as defined by the ISO11290-1 method. For first and second enrichments, 90% of the samples gave the same results by RTi-PCR and plating, whatever the RTi-PCR method used. For the samples that gave different results, plating was significantly more accurate for detection of positive samples than RTi-PCR from the first enrichment, but RTi-PCR detected a greater number of positive samples than plating from the second enrichment, regardless of the RTi-PCR method used. RTi-PCR was more accurate for non-food contact surface and food contact surface samples than for food and raw material samples especially from the first enrichment, probably because of sample matrix interference. Even though RTi-PCR analysis of the first enrichment showed less positive results than plating, in outbreak scenarios where a rapid result is

  4. Differentiation of Moraxella bovoculi sp. nov. from other coccoid moraxellae by the use of polymerase chain reaction and restriction endonuclease analysis of amplified DNA.

    Science.gov (United States)

    Angelos, John A; Ball, Louise M

    2007-09-01

    Moraxella ovis was historically the only coccoid Moraxella identified in cultures of ocular fluid from cattle with infectious bovine keratoconjunctivitis (IBK) and could be morphologically and biochemically differentiated from Moraxella bovis. Moraxella bovoculi sp. nov. is a recently characterized Moraxella isolated from ulcerated eyes of calves with IBK in northern California in 2002. Like Moraxella ovis, M. bovoculi sp. nov. is a gram-negative coccus/diplococcus. All 18 original isolates of M. bovoculi sp. nov. possessed phenylalanine deaminase (PADase) activity and could therefore be differentiated from M. ovis and M. bovis. During the characterization of 44 additional isolates of hemolytic gram-negative cocci that were cultured from ulcerated eyes of IBK-affected calves, 2 PADase-negative isolates were identified that could not be differentiated biochemically from M. ovis; however, the DNA sequence of the 16S-23S intergenic spacer region (ISR) of the isolates matched the 16S-23S ISR DNA sequence of M. bovoculi sp. nov. To facilitate the identification of PADase-negative moraxellae, a polymerase chain reaction (PCR) coupled with restriction enzyme digestion analysis of amplified DNA was developed. Amplification of the 16S-23S ISR followed by AfaI digestion of amplified DNA could differentiate M. bovoculi sp. nov. from M. ovis and other moraxellae. The DNA sequence analysis of the amplified 16S-23S ISR from the 42 PADase-positive isolates of hemolytic gram-negative cocci indicated that all were M. bovoculi sp. nov. and all possessed an AfaI site. A PCR coupled with restriction analysis of amplified DNA can aid in identifying M. bovoculi sp. nov.

  5. The diagnostic value of polymerase chain reaction for Mycobacterium tuberculosis to distinguish intestinal tuberculosis from crohn's disease: A meta-analysis.

    Science.gov (United States)

    Jin, Ting; Fei, Baoying; Zhang, Yu; He, Xujun

    2017-01-01

    Intestinal tuberculosis (ITB) and Crohn's disease (CD) are important differential diagnoses that can be difficult to distinguish. Polymerase chain reaction (PCR) for Mycobacterium tuberculosis (MTB) is an efficient and promising tool. This meta-analysis was performed to systematically and objectively assess the potential diagnostic accuracy and clinical value of PCR for MTB in distinguishing ITB from CD. We searched PubMed, Embase, Web of Science, Science Direct, and the Cochrane Library for eligible studies, and nine articles with 12 groups of data were identified. The included studies were subjected to quality assessment using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. The summary estimates were as follows: sensitivity 0.47 (95% CI: 0.42-0.51); specificity 0.95 (95% CI: 0.93-0.97); the positive likelihood ratio (PLR) 10.68 (95% CI: 6.98-16.35); the negative likelihood ratio (NLR) 0.49 (95% CI: 0.33-0.71); and diagnostic odds ratio (DOR) 21.92 (95% CI: 13.17-36.48). The area under the curve (AUC) was 0.9311, with a Q* value of 0.8664. Heterogeneity was found in the NLR. The heterogeneity of the studies was evaluated by meta-regression analysis and subgroup analysis. The current evidence suggests that PCR for MTB is a promising and highly specific diagnostic method to distinguish ITB from CD. However, physicians should also keep in mind that negative results cannot exclude ITB for its low sensitivity. Additional prospective studies are needed to further evaluate the diagnostic accuracy of PCR.

  6. Improvement of specific polymerase chain reaction (PCR) for the ...

    African Journals Online (AJOL)

    Improvement of specific polymerase chain reaction (PCR) for the identification of Mycoplasma capricolum subsp. capripneumoniae. H Ying, Z Nian-zhang, Z Ping, C Yue-feng, G Peng-cheng, Z Jian-jun, L Zhong-xin ...

  7. Simplex and triplex polymerase chain reaction (PCR) for ...

    African Journals Online (AJOL)

    Simplex and triplex polymerase chain reaction (PCR) for identification of three medically important Candida species. Nabil S Harmal, Alireza Khodavandi, Mohammed A Alshawsh, Farida Jamal, Zamberi Sekawi, Ng Kee Peng, Pei Pei Chong ...

  8. Real-Time Polymerase Chain Reaction (PCR) Capability in Space

    Data.gov (United States)

    National Aeronautics and Space Administration — The goal of this project is enabling the real-time polymerase chain reaction (real-time PCR) technology in space. In space, the real-time PCR technology can be used...

  9. Chain reaction mechanism in hydrogen/fluorine combustion.

    Science.gov (United States)

    Matsugi, Akira; Shiina, Hiroumi; Tsuchiya, Kentaro; Miyoshi, Akira

    2013-12-27

    Vibrationally excited species have been considered to play significant roles in H2/F2 reaction systems. In the present study, in order to obtain further understanding of the chain reaction mechanism in the combustion of mixtures containing H2 and F2, burning velocities for H2/F2/O2/N2 flames were measured and compared to that obtained from kinetic simulations using a detailed kinetic model, which involves the vibrationally excited species, HF(ν) and H2(ν), and the chain-branching reactions, HF(ν > 2) + F2 = HF + F + F (R1) and H2(ν = 1) + F2 = HF + H + F (R2). The results indicated that reaction R1 is not responsible for chain branching, whereas reaction R2 plays a dominant role in the chain reaction mechanism. The kinetic model reproduced the experimental burning velocities with the presumed rate constant of k2 = 6.6 × 10(-10) exp(-59 kJ mol(-1)/RT) cm(3) s(-1) for R2. The suggested chain-branching reaction was also investigated by quantum chemical calculations at the MRCI-F12+CV+Q/cc-pCVQZ-F12 level of theory.

  10. Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

    Directory of Open Access Journals (Sweden)

    Tuti Susanti Legiastuti

    2013-04-01

    Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

  11. Identification of medically important Candida species by polymerase chain reaction-restriction fragment length polymorphism analysis of the rDNA ITS1 and ITS2 regions

    Directory of Open Access Journals (Sweden)

    Suphi Bayraktar

    2017-01-01

    Full Text Available Aim: We aimed to identify the distribution of species in candidal strains isolated from clinical samples and restriction fragment length polymorphism (RFLP method based on Msp I and Bln I restrictive enzyme cuts of polymerase chain reaction (PCR products after the amplification of ITS1 and ITS2 regions of rDNA genotypically. Materials and Methods: One hundred and fifty candidal strains isolated from various clinical samples were studies/ included. Phenotypic species assessment was performed using automated VITEK-2 system and kit used with the biochemical tests. Common genomic region amplification peculiar to candidal strains was carried out using ITS1 and ITS2 primer pairs. After the amplification, PCR products were cut with Msp I and Bln I restriction enzymes for species identification. Results: The majority of Candida isolates were isolated from urine (78.6% while other isolates were composed of strains isolated from swab, wound, blood and other samples by 11.3%, 3.3%, 2% and 4.7%, respectively. The result of RFLP analysis carried out with Msp I and Bln I restriction enzymes showed that candidal strains were Candida albicans by 45.3%, Candida glabrata by 19.3%, Candida tropicalis by 14.6%, Candida parapsilosis by 5.3%, Candida krusei by 5.3%, Candida lusitaniae by 0.6% and other candidal strains by 9.3%. Conclusion: When the ability to identify Candida to species level of phenotypic and PCR-RFLP methods was assessed, a great difference was found between these two methods. It may be argued that Msp I and Bln I restriction enzyme fragments can be used in the identification of medically important Candida species. Further studies are needed to develop this kind of restriction profile to be used in the identification of candidal strains.

  12. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Directory of Open Access Journals (Sweden)

    Fei Cheng

    Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  13. Molecular typing of Iranian mycobacteria isolates by polymerase chain reaction-restriction fragment length polymorphism analysis of 360-bp rpoB gene.

    Science.gov (United States)

    Hadifar, Shima; Moghim, Sharareh; Fazeli, Hossein; GhasemianSafaei, Hajieh; Havaei, Seyed Asghar; Farid, Fariba; Esfahani, Bahram Nasr

    2015-01-01

    Diagnosis and typing of Mycobacterium genus provides basic tools for investigating the epidemiology and pathogenesis of this group of bacteria. Polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis (PRA) is an accurate method providing diagnosis and typing of species of mycobacteria. The present study is conducted by the purpose of determining restriction fragment profiles of common types of mycobacteria by PRA method of rpoB gene in this geographical region. Totally 60 clinical and environmental isolates from February to October, 2013 were collected and subcultured and identified by phenotypic methods. A 360 bp fragment of the rpoB gene amplified by PCR and products were digested by MspI and HaeIII enzymes. In the present study, of all mycobacteria isolates identified by PRA method, 13 isolates (21.66%) were Mycobacterium tuberculosis, 34 isolates (56.66%) were rapidly growing Nontuberculosis Mycobacteria (NTM) that including 26 clinical isolates (43.33%) and 8 environmental isolates (13.33%), 11 isolates (18.33%) were clinical slowly growing NTM. among the clinical NTM isolates, Mycobacterium fortuitum Type I with the frequency of 57.77% was the most prevalent type isolates. Furthermore, an unrecorded of the PRA pattern of Mycobacterium conceptionense (HeaIII: 120/90/80, MspI: 120/105/80) was found. This study demonstrated that the PRA method was high discriminatory power for identification and typing of mycobacteria species and was able to identify 96.6% of all isolates. Based on the result of this study, rpoB gene could be a potentially useful tool for identification and investigation of molecular epidemiology of mycobacterial species.

  14. Rapid electrochemiluminescence assays of polymerase chain reaction products.

    Science.gov (United States)

    Kenten, J H; Casadei, J; Link, J; Lupold, S; Willey, J; Powell, M; Rees, A; Massey, R

    1991-09-01

    We demonstrate the first use of an electrochemiluminescent (ECL) label, [4-(N-succimidyloxycarbonylpropyl)-4'-methyl-2,2'- bipyridine]ruthenium(II) dihexafluorophosphate (Origen label; IGEN Inc.), in DNA probe assays. This label allows rapid (less than 25 min) quantification and detection of polymerase chain reaction (PCR)-amplified products from oncogenes, viruses, and cloned genes. For the PCR, we used labeled oligonucleotide primers complementary to human papiloma virus and the Ha-ras oncogene. These samples were followed by ECL analysis or hybridization with specific, Origen-labeled oligonucleotide probes. These studies demonstrate the speed, specificity, and effectiveness of the new ECL labels, compared with 32P, for nucleic acid probe applications. We describe formats involving conventional methodologies and a new format that requires no wash step, allowing simple and rapid sample analysis. These rapid assays also reduce PCR contamination, by requiring less sample handling. Improvements in ECL detectability are currently under investigation for use in DNA probe assays without amplification.

  15. Comparison of polymerase chain reaction (PCR) and loop-mediated ...

    African Journals Online (AJOL)

    Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...

  16. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... and subsequent downstream applications (England et al.,. 2001; England and Trevors, 2003; Sayler et al., 2001; ... Real time polymerase chain reaction (PCR). The cDNA produced can be used for real-time ... phoresis after completion of the reaction, real-time qPCR technology allows quantification of PCR ...

  17. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Science.gov (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Comparison of the accuracy of Hybrid Capture II and polymerase chain reaction in detecting clinically important cervical dysplasia: a systematic review and meta-analysis

    International Nuclear Information System (INIS)

    Luu, Hung N; Dahlstrom, Kristina R; Mullen, Patricia Dolan; VonVille, Helena M; Scheurer, Michael E

    2013-01-01

    The effectiveness of screening programs for cervical cancer has benefited from the inclusion of Human papillomavirus (HPV) DNA assays; which assay to choose, however, is not clear based on previous reviews. Our review addressed test accuracy of Hybrid Capture II (HCII) and polymerase chain reaction (PCR) assays based on studies with stronger designs and with more clinically relevant outcomes. We searched OvidMedline, PubMed, and the Cochrane Library for English language studies comparing both tests, published 1985–2012, with cervical dysplasia defined by the Bethesda classification. Meta-analysis provided pooled sensitivity, specificity, and 95% confidence intervals (CIs); meta-regression identified sources of heterogeneity. From 29 reports, we found that the pooled sensitivity and specificity to detect high-grade squamous intraepithelial lesion (HSIL) was higher for HCII than PCR (0.89 [CI: 0.89–0.90] and 0.85 [CI: 0.84–0.86] vs. 0.73 [CI: 0.73–0.74] and 0.62 [CI: 0.62–0.64]). Both assays had higher accuracy to detect cervical dysplasia in Europe than in Asia-Pacific or North America (diagnostic odd ratio – dOR = 4.08 [CI: 1.39–11.91] and 4.56 [CI: 1.86–11.17] for HCII vs. 2.66 [CI: 1.16–6.53] and 3.78 [CI: 1.50–9.51] for PCR) and accuracy to detect HSIL than atypical squamous cells of undetermined significance (ASCUS)/ low-grade squamous intraepithelial lesion (LSIL) (HCII-dOR = 9.04 [CI: 4.12–19.86] and PCR-dOR = 5.60 [CI: 2.87–10.94]). For HCII, using histology as a gold standard results in higher accuracy than using cytology (dOR = 2.87 [CI: 1.31–6.29]). Based on higher test accuracy, our results support the use of HCII in cervical cancer screening programs. The role of HPV type distribution should be explored to determine the worldwide comparability of HPV test accuracy

  19. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  20. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    Science.gov (United States)

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  1. Evaluation of nested Polymerase Chain Reaction targeting hup B ...

    African Journals Online (AJOL)

    The objectives of this study are to evaluate the role of nested Polymerase Chain Reaction (PCR) targeting hup B gene as a rapid diagnostic modality of tubercular ascites and also to detect the infecting species (Mycobacterium tuberculosis and Mycobacterium bovis). 100 suspected tubercular ascites patients were enrolled ...

  2. Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

    African Journals Online (AJOL)

    Multiplex polymerase chain reaction (PCR) and fluorescence-based capillary electrophoresis (CE) of blood and tissue samples have been used to distinguish between deer species such as red deer, sika deer, wapiti and reindeer. We constructed 4 species-specific primers by using the D-loop of mitochondrial DNA and ...

  3. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    African Journals Online (AJOL)

    Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

  4. A Double Polymerase Chain Reaction Method for Detecting African ...

    African Journals Online (AJOL)

    A Double Polymerase Chain Reaction Method for Detecting African Swine Fever and Swine Vesicular Disease Virus. ... specificity as only the recombinant plasmids of ASFV and SVDV were amplified and control plasmids for three other diseases - porcine circovirus (PCV), pseudorabies virus (PRV), and porcine parvovirus ...

  5. (DNA) fragment using two-step polymerase chain reaction (PCR)

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR), an essential tool in many fields such as molecular biology, normally comprises three steps: denaturation at a high temperature, annealing at a low temperature and elongation at a moderate temperature. Here, we report a two-step PCR method which incorporates annealing and elongation ...

  6. Polymerase chain reaction: Theory, practice and application: A review

    African Journals Online (AJOL)

    Polymerase Chain Reaction (PCR) is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension ...

  7. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    Science.gov (United States)

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  8. Polymerase chain reaction for the detection of Mycobacterium leprae

    NARCIS (Netherlands)

    Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

    1989-01-01

    A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

  9. Evaluation of Usefulness of Polymerase Chain Reaction in the ...

    African Journals Online (AJOL)

    Methods used included Giemsa staining procedure for estimation of parasite densities and polymerase chain reaction (PCR) to detect the presence of malaria parasite in the whole blood. Using microscopy as reference gold standard, patients comprising 120 males and 330 females with age ranging between less than 1 ...

  10. Polymerase chain reaction (PCR) detection of the predominant ...

    African Journals Online (AJOL)

    The aim of the present study was to assess the presence of microcystins (MCs) and identify the genotypes of MC-producing cyanobacteria in Mozambique. Polymerase chain reaction (PCR) based detection methods were used to analyze samples from three study freshwater bodies which are used as sources of drinking ...

  11. Randomly amplified polymorphic DNA-polymerase chain reaction ...

    Indian Academy of Sciences (India)

    Genetic similarity and diversity of cultured catfish Silurus asotus populations collected from two areas in western Korea were examined using randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR). Out of 20 random primers tested, 5 produced 1344 RAPD bands ranging from 8.2 to 13.6 polymorphic ...

  12. Species specific polymerase chain reaction (PCR) assay for ...

    African Journals Online (AJOL)

    A highly specific single step polymerase chain reaction (PCR) is described for the detection of pig (Sus domesticus) meat. A PCR assay was successfully optimized for amplification of 629 and 322-bp DNA fragment extracted from pig meat using designed species-specific primer pairs based on mitochondrial D-loop and 12S ...

  13. Development of a sensitive nested-polymerase chain reaction (PCR ...

    African Journals Online (AJOL)

    A species-specific polymerase chain reaction (PCR) assay was developed for rapid and accurate detection of Ustilago scitaminea, the causal agent of sugarcane smut disease. Based on nucleotide differences in the internal transcribed spacer (ITS) sequences of U. scitaminea, a pair of species-specific primers, SL1 ...

  14. Polymerase Chain Reaction (PCR) provides a superior tool for the ...

    African Journals Online (AJOL)

    Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

  15. Polymerase chain reaction to search for Herpes viruses in uveitic ...

    African Journals Online (AJOL)

    Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African perspective. Debbie Laaks1, Derrick P Smit1, Justin Harvey2. 1. Division of Ophthalmology, Department of Surgical Sciences, Faculty of Health Sciences,. University of Stellenbosch, South Africa. 2. Center for Statistical ...

  16. Direct colony polymerase chain reaction (PCR): An efficient ...

    African Journals Online (AJOL)

    ... chain reaction (PCR): An efficient technique to rapidly identify and distinguish Mycosphaerella fijiensis and Mycosphaerella musicola. Roberto Vázquez-Euán, Rosa Grijalva-Arango, Bartolomé Chi-Manzanero, Miguel Tzec-Simá, Ignacio Islas-Flores, Cecilia Rodríguez-García, Leticia Peraza-Echeverría, Andrew C James, ...

  17. TaqMan Real-Time Polymerase Chain Reaction and ...

    African Journals Online (AJOL)

    TaqMan Real-Time Polymerase Chain Reaction and Pyrosequencing using Single Nucleotide Polymorphism Protocol for Rapid Determination of ALDH2 *2 in a Chinese Population. J Li, J Wu, Y Zhang, X Wang, J Jin, Y Wang ...

  18. Polymerase chain reaction for detection of herpes simplex virus encephalitis.

    Science.gov (United States)

    Aslanzadeh, J; Skiest, D J

    1994-06-01

    A patient with herpes simplex virus encephalitis is described. The polymerase chain reaction (PCR) was used to confirm the diagnosis in cerebrospinal fluid. PCR allows the rapid diagnosis of many infectious organisms, such as HSV, in which prompt diagnosis is essential.

  19. Polymerase chain reaction for detection of herpes simplex virus encephalitis.

    OpenAIRE

    Aslanzadeh, J; Skiest, D J

    1994-01-01

    A patient with herpes simplex virus encephalitis is described. The polymerase chain reaction (PCR) was used to confirm the diagnosis in cerebrospinal fluid. PCR allows the rapid diagnosis of many infectious organisms, such as HSV, in which prompt diagnosis is essential.

  20. Application of polymerase chain reaction to differentiate between ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR) assay was used to identify and differentiate between strains of Campylobacter jejuni and Campylobacter coli. Nine Campylobacter reference strains; C. jejuni NCTC 11168, C. jejuni NCTC 11322, C. jejuni NCTC 11828, Campylobacter coli NCTC 12110, C. coli NCTC 11437, C. coli ...

  1. Polymerase chain reaction (PCR) detection of the predominant ...

    African Journals Online (AJOL)

    use

    2011-12-21

    Dec 21, 2011 ... genotypes of MC-producing cyanobacteria in Mozambique. Polymerase chain reaction (PCR) based detection methods were used to analyze samples from three study freshwater bodies which are used as sources of drinking water. The occurrence of cyanobacterial toxic genes in Nhambavale lake and.

  2. The application of polymerase chain reaction-denaturing gradient ...

    African Journals Online (AJOL)

    Jane

    2011-05-23

    May 23, 2011 ... paper proposed the application of polymerase chain reaction (PCR)-DGGE method in reducing the complicated work in microorganism ... for it takes time to examine these precisely. To improve the efficiency in ..... Explorative screening of complex microbial communities by real-time 16S rDNA restriction.

  3. A Double Polymerase Chain Reaction Method for Detecting African ...

    African Journals Online (AJOL)

    Purpose: To establish a double polymerase chain reaction (PCR) method for the simultaneous detection of African swine fever virus (ASFV) and swine vesicular disease virus (SVDV). Methods: By using reference sequences of ASFV and SVDV, this study synthesized parts of the genes connected to the 19-T vector which ...

  4. Effectiveness of real-time polymerase chain reaction assay for the detection of Mycobacterium tuberculosis in pathological samples: a systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Emmanuel O. Babafemi

    2017-10-01

    Full Text Available Abstract Background Rapid and accurate diagnosis of tuberculosis (TB is key to manage the disease and to control and prevent its transmission. Many established diagnostic methods suffer from low sensitivity or delay of timely results and are inadequate for rapid detection of Mycobacterium tuberculosis (MTB in pulmonary and extra-pulmonary clinical samples. This study examined whether a real-time polymerase chain reaction (RT-PCR assay, with a turn-a-round time of 2 h, would prove effective for routine detection of MTB by clinical microbiology laboratories. Methods A systematic literature search was performed for publications in any language on the detection of MTB in pathological samples by RT-PCR assay. The following sources were used MEDLINE via PubMed, EMBASE, BIOSIS Citation Index, Web of Science, SCOPUS, ISI Web of Knowledge and Cochrane Infectious Diseases Group Specialised Register, grey literature, World Health Organization and Centres for Disease Control and Prevention websites. Forty-six studies met set inclusion criteria. Generated pooled summary estimates (95% CIs were calculated for overall accuracy and bivariate meta-regression model was used for meta-analysis. Results Summary estimates for pulmonary TB (31 studies were as follows: sensitivity 0.82 (95% CI 0.81–0.83, specificity 0.99 (95% CI 0.99–0.99, positive likelihood ratio 43.00 (28.23–64.81, negative likelihood ratio 0.16 (0.12–0.20, diagnostic odds ratio 324.26 (95% CI 189.08–556.09 and area under curve 0.99. Summary estimates for extra-pulmonary TB (25 studies were as follows: sensitivity 0.70 (95% CI 0.67–0.72, specificity 0.99 (95% CI 0.99–0.99, positive likelihood ratio 29.82 (17.86–49.78, negative likelihood ratio 0.33 (0.26–0.42, diagnostic odds ratio 125.20 (95% CI 65.75–238.36 and area under curve 0.96. Conclusions RT-PCR assay demonstrated a high degree of sensitivity for pulmonary TB and good sensitivity for extra-pulmonary TB. It indicated a

  5. Two-step bacterial broad-range polymerase chain reaction analysis of heart valve tissue improves bacteriological diagnosis of infective endocarditis.

    Science.gov (United States)

    Boussier, Rémi; Rogez, Sylvie; François, Bruno; Denes, Eric; Ploy, Marie-Cécile; Garnier, Fabien

    2013-03-01

    Positive heart valve (HV) culture is a major Duke's criterion for the diagnosis of infective endocarditis but is poorly sensitive. Two broad-range 16S rDNA polymerase chain reaction (PCR) methods were applied to 31 HV samples: first, a real-time method, then conventional end-point PCR was applied to HV samples on which the first PCR was negative. Five specific real-time PCR procedures were also used in order to identify Bartonella spp., Tropheryma whipplei, Chlamydophila pneumoniae, Mycoplasma pneumonia, and Coxiella burnetii. A strategy combining the 2-step broad-range PCR methods improved the sensitivity of the molecular method from 38.7% to 58%. Specific PCR identified 1 T. whipplei, which was also identified by conventional end-point PCR. These results confirm that blood culture is the gold standard for the diagnosis of infective endocarditis, shows that molecular methods applied to HV can be useful when blood culture is negative, and that 2-step broad-range PCR approach seems to be more sensitive. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. [Establishing a new genotyping method of hepatitis B virus by polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) to analysis on S region and its application].

    Science.gov (United States)

    Peng, Liang; Ding, Jing-Juan; Zhang, Li-Sha

    2004-08-01

    To establish a new polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method of genotyping HBV using Mbo I, BsTN I, BsmA I, Hpa II and investigate the relationship between genotype and clinical spectrum of hepatitis B. 124 full-genomic HBV sequences and 13 S-genomic sequences were analyzed, genotype specific regions were identified by the restriction enzymes Mbo I, BsTN I, BsmA I, Hpa II. And 176 samples from different kinds of hepatitis B were genotyped by this method. Five samples had been randomly selected and directly sequenced their S gene, to assess the accuracy. In 176 serum samples of patients with hepatitis B from Guizhou area, genotype B and C were found in 56.8% and 43.2% respectively. The proportions of genotype B and C in ASC were 40.0% and 15.7% (chi-square = 12.16, P < 0.005); and they were 31.6% and 14.0% in CHB (chi-square = 7.88, P < 0.005). Genotyping HBV, based on S gene RFLP seems to be highly sensitive, differential and accurate and could be used in large-scale surveys. HBV genotype B and C are existed in Guizhou area.

  7. Toxoplasma gondii and pre-treatment protocols for polymerase chain reaction analysis of milk samples: a field trial in sheep from Southern Italy

    Directory of Open Access Journals (Sweden)

    Alice Vismarra

    2017-02-01

    Full Text Available Toxoplasmosis is a zoonotic disease caused by the protozoan Toxoplasma gondii. Ingestion of raw milk has been suggested as a risk for transmission to humans. Here the authors evaluated pre-treatment protocols for DNA extraction on T. gondii tachyzoite-spiked sheep milk with the aim of identifying the method that resulted in the most rapid and reliable polymerase chain reaction (PCR positivity. This protocol was then used to analyse milk samples from sheep of three different farms in Southern Italy, including real time PCR for DNA quantification and PCR-restriction fragment length polymorphism for genotyping. The pre-treatment protocol using ethylenediaminetetraacetic acid and Tris-HCl to remove casein gave the best results in the least amount of time compared to the others on spiked milk samples. One sample of 21 collected from sheep farms was positive on one-step PCR, real time PCR and resulted in a Type I genotype at one locus (SAG3. Milk usually contains a low number of tachyzoites and this could be a limiting factor for molecular identification. Our preliminary data has evaluated a rapid, cost-effective and sensitive protocol to treat milk before DNA extraction. The results of the present study also confirm the possibility of T. gondii transmission through consumption of raw milk and its unpasteurised derivatives.

  8. Pigmented cutaneous papillomatosis (pigmented epidermal nevus) in three pug dogs; histopathology, electron microscopy and analysis of viral DNA by the polymerase chain reaction.

    Science.gov (United States)

    Narama, I; Kobayashi, Y; Yamagami, T; Ozaki, K; Ueda, Y

    2005-01-01

    Canine pigmented epidermal nevus (CPEN) is a skin disorder of some breeds of dog characterized by multiple black plaques of the haired and non-haired skin. Three cases of pigmented cutaneous papillomatosis (previously described also as CPEN) in pug dogs were investigated histopathologically, immunohistochemically and electron microscopically. Additionally, DNA analyses with the polymerase chain reaction (PCR) were performed in two cases. Many nuclei of the stratum granulosa were diffusely immunolabelled for specific structural antigens of bovine papillomavirus (subgroup A), but nuclear inclusion bodies were not detected by retrospective examination of haematoxylin and eosin-stained sections of the affected skin. Aggregates of small numbers of viral particles (ranging from 37 to 43 nm in diameter) with a hexagonal structure were sparsely scattered throughout the nuclei of some of the superficial keratinocytes. PCR amplification targeted for the L1 gene of papillomavirus cloned from a case of CPEN yielded an expected fragment of 194-bp in the two CPEN cases examined but not in a case of canine oral papilloma.

  9. Polymerase chain reaction and bacteriological comparative analysis of raw milk samples and buffalo mozzarella produced and marketed in Caserta in the Campania region of Italy

    Directory of Open Access Journals (Sweden)

    Elisabetta Di Giannatale

    2009-09-01

    Full Text Available To help identify an epidemiological link between the consumption of buffalo mozzarella prepared with raw milk (not heat-treated and cases of human brucellosis, 80 samples of raw buffalo milk and 315 samples of mozzarella were tested for the presence of Brucella spp. Samples originated from Caserta, the province with the highest number of Brucella-positive buffalo herds in Campania, the region in which 96.02% of all cases of human brucellosis reported in 2000-2005 were recorded. To take into account possible seasonal variations, between February 2006 and March 2007, samples were purchased directly from 72 dairy outlets that were representative of the province. Samples were tested for Brucella spp. using the polymerase chain reaction (PCR and bacterial isolation. Samples tested negative for Brucella using both methods. Spiked samples were then prepared and tested by PCR and bacterial isolation and the sensitivity, specificity, repeatability, reproducibility and limit of detection were determined. The PCR limit of detection was below 1 colony-forming unit (cfu/g. The repeatability and reproducibility of the method were 100% (p = 0.95, the sensitivity was 96.7% (p = 0.95 and the specificity was 100% (p = 0.95.

  10. Markov Chain Ontology Analysis (MCOA

    Directory of Open Access Journals (Sweden)

    Frost H

    2012-02-01

    Full Text Available Abstract Background Biomedical ontologies have become an increasingly critical lens through which researchers analyze the genomic, clinical and bibliographic data that fuels scientific research. Of particular relevance are methods, such as enrichment analysis, that quantify the importance of ontology classes relative to a collection of domain data. Current analytical techniques, however, remain limited in their ability to handle many important types of structural complexity encountered in real biological systems including class overlaps, continuously valued data, inter-instance relationships, non-hierarchical relationships between classes, semantic distance and sparse data. Results In this paper, we describe a methodology called Markov Chain Ontology Analysis (MCOA and illustrate its use through a MCOA-based enrichment analysis application based on a generative model of gene activation. MCOA models the classes in an ontology, the instances from an associated dataset and all directional inter-class, class-to-instance and inter-instance relationships as a single finite ergodic Markov chain. The adjusted transition probability matrix for this Markov chain enables the calculation of eigenvector values that quantify the importance of each ontology class relative to other classes and the associated data set members. On both controlled Gene Ontology (GO data sets created with Escherichia coli, Drosophila melanogaster and Homo sapiens annotations and real gene expression data extracted from the Gene Expression Omnibus (GEO, the MCOA enrichment analysis approach provides the best performance of comparable state-of-the-art methods. Conclusion A methodology based on Markov chain models and network analytic metrics can help detect the relevant signal within large, highly interdependent and noisy data sets and, for applications such as enrichment analysis, has been shown to generate superior performance on both real and simulated data relative to existing

  11. Markov Chain Ontology Analysis (MCOA).

    Science.gov (United States)

    Frost, H Robert; McCray, Alexa T

    2012-02-03

    Biomedical ontologies have become an increasingly critical lens through which researchers analyze the genomic, clinical and bibliographic data that fuels scientific research. Of particular relevance are methods, such as enrichment analysis, that quantify the importance of ontology classes relative to a collection of domain data. Current analytical techniques, however, remain limited in their ability to handle many important types of structural complexity encountered in real biological systems including class overlaps, continuously valued data, inter-instance relationships, non-hierarchical relationships between classes, semantic distance and sparse data. In this paper, we describe a methodology called Markov Chain Ontology Analysis (MCOA) and illustrate its use through a MCOA-based enrichment analysis application based on a generative model of gene activation. MCOA models the classes in an ontology, the instances from an associated dataset and all directional inter-class, class-to-instance and inter-instance relationships as a single finite ergodic Markov chain. The adjusted transition probability matrix for this Markov chain enables the calculation of eigenvector values that quantify the importance of each ontology class relative to other classes and the associated data set members. On both controlled Gene Ontology (GO) data sets created with Escherichia coli, Drosophila melanogaster and Homo sapiens annotations and real gene expression data extracted from the Gene Expression Omnibus (GEO), the MCOA enrichment analysis approach provides the best performance of comparable state-of-the-art methods. A methodology based on Markov chain models and network analytic metrics can help detect the relevant signal within large, highly interdependent and noisy data sets and, for applications such as enrichment analysis, has been shown to generate superior performance on both real and simulated data relative to existing state-of-the-art approaches.

  12. Proximity-dependent initiation of hybridization chain reaction

    Science.gov (United States)

    Koos, Björn; Cane, Gaëlle; Grannas, Karin; Löf, Liza; Arngården, Linda; Heldin, Johan; Clausson, Carl-Magnus; Klaesson, Axel; Hirvonen, M. Karoliina; de Oliveira, Felipe M. S.; Talibov, Vladimir O.; Pham, Nhan T.; Auer, Manfred; Danielson, U. Helena; Haybaeck, Johannes; Kamali-Moghaddam, Masood; Söderberg, Ola

    2015-01-01

    Sensitive detection of protein interactions and post-translational modifications of native proteins is a challenge for research and diagnostic purposes. A method for this, which could be used in point-of-care devices and high-throughput screening, should be reliable, cost effective and robust. To achieve this, here we design a method (proxHCR) that combines the need for proximal binding with hybridization chain reaction (HCR) for signal amplification. When two oligonucleotide hairpins conjugated to antibodies bind in close proximity, they can be activated to reveal an initiator sequence. This starts a chain reaction of hybridization events between a pair of fluorophore-labelled oligonucleotide hairpins, generating a fluorescent product. In conclusion, we show the applicability of the proxHCR method for the detection of protein interactions and posttranslational modifications in microscopy and flow cytometry. As no enzymes are needed, proxHCR may be an inexpensive and robust alternative to proximity ligation assays. PMID:26065580

  13. Block copolymer nanoparticles as nanobeads for the polymerase chain reaction.

    Science.gov (United States)

    Zhang, Siyan; Prud'homme, Robert K; Link, A James

    2011-04-13

    New sequencing technologies based on massively parallel signature sequencing (MPSS) have been developed to reduce the cost of genome sequencing. In some current MPSS platforms, DNA-modified micrometer-scale beads are used to template the polymerase chain reaction (PCR). Reducing the size of the beads to nanoscale can lead to significant improvements in sequencing throughput. To this end, we have assembled polymeric nanobeads that efficiently template PCR, resulting in DNA-decorated "nanobeads" with a high extent of functionalization.

  14. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...... citation network. The effect is discussed using innovation decision process theory as a point of departure to identify the factors that created a bandwagon effect leading to the reported observations.......This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  15. Sensitive and simultaneous analysis of five transgenic maizes using multiplex polymerase chain reaction, capillary gel electrophoresis, and laser-induced fluorescence.

    Science.gov (United States)

    García-Cañas, Virginia; González, Ramón; Cifuentes, Alejandro

    2004-07-01

    The benefits of using multiplex polymerase chain reaction (PCR) followed by capillary gel electrophoresis with laser-induced fluorescence (CGE-LIF) for the simultaneous detection of five transgenic maizes (Bt11, T25, MON810, GA21, and Bt176) are demonstrated. The method uses a hexaplex PCR protocol to amplify the five mentioned transgenic amplicons plus the zein gene used as reference, followed by a CGE-LIF method to analyze the six DNA fragments. CGE-LIF was demonstrated very useful and informative for optimizing multiplex PCR parameters such as time extension, PCR buffer concentration and primers concentration. The method developed is highly sensitive and allows the simultaneous detection in a single run of percentages of transgenic maize as low as 0.054% of Bt11, 0.057% of T25, 0.036% of MON810, 0.064% of GA21, and 0.018% of Bt176 in flour obtaining signals still far from the detection limit (namely, the signal/noise ratios for the corresponding DNA peaks were 41, 124, 98, 250, 252, and 473, respectively). These percentages are well below the minimum threshold marked by the European Regulation for transgenic food labeling (i.e., 0.5-0.9%). A study on the reproducibility of the multiplex PCR-CGE-LIF procedure was also performed. Thus, values of RSD lower than 0.67 and 6.80% were obtained for migration times and corrected peak areas, respectively, for the same sample and three different days (n = 12). On the other hand, the reproducibility of the whole procedure, including four different multiplex PCR amplifications, was determined to be better than 0.66 and 23.3% for migration times and corrected peak areas, respectively. Agarose gel electrophoresis (AGE) and CGE-LIF were compared in terms of resolution and sensitivity for detecting PCR products, demonstrating that CGE-LIF can solve false positives induced by artifacts from the multiplex PCR reaction that could not be addressed by AGE. Moreover, CGE-LIF provides better resolution and sensitivity. To our knowledge

  16. Pasteurella multocida in backyard chickens in Upper Egypt: incidence with polymerase chain reaction analysis for capsule type, virulence in chicken embryos and antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Moemen A. Mohamed

    2012-03-01

    Full Text Available The prevalence of Pasteurella multocida strains among 275 backyard chickens from different regions of Upper Egypt was studied. A total of 21 isolates of P. multocida were recovered in 21 out of 275 chickens tested (7.6% and were confirmed using phenotypic characterisation. Somatic serotyping of the 21 isolates resulted in 12 isolates being classed as serotype A:1 (57.14%, 4 as serotype A:3 (19.05% and 5 could not be typed (23.8%. Capsular typing, using multiplex polymerase chain reaction (PCR, demonstrated that 18 strains were capsular type A (85.7%, and 3 were type D (14.3%. The present findings suggest that a multiplex capsular PCR could be valuable for the rapid identification of P. multocida in cases of fowl cholera infection. A total of 5 isolates of P. multocida were selected to study their pathogenicity in embryonated chicken eggs instead of conducting a study in mature chickens. The results showed a variation in pathogenicity between the strains tested, namely: serotype A:1 strains caused 80% mortality, in contrast to 20% mortality by type D strains. Pathological findings included severe congestion of the entire embryo, haemorrhaging of the skin, feather follicles and toe, and ecchymotic haemorrhages on the liver of the inoculated embryos. The observations in this study indicate that P. multocida serogroup A could be highly pathogenic for mature chickens and therefore might be a cause of considerable economic losses in commercial production. A total of 10 isolates were subjected to antimicrobial susceptibility to determine the minimal inhibitory concentration of 7 antimicrobials. All isolates were susceptible to ciprofloxacin, florfenicol, streptomycin and sulphamethoxazol with trimethoprim and with varying degrees of sensitivity to the other agents.

  17. Pasteurella multocida in backyard chickens in Upper Egypt: incidence with polymerase chain reaction analysis for capsule type, virulence in chicken embryos and antimicrobial resistance.

    Science.gov (United States)

    Mohamed, Moemen A; Mohamed, Mohamed-Wael A; Ahmed, Ahmed I; Ibrahim, Awad A; Ahmed, Mohamed S

    2012-01-01

    The prevalence of Pasteurella multocida strains among 275 backyard chickens from different regions of Upper Egypt was studied. A total of 21 isolates of P. multocida were recovered in 21 out of 275 chickens tested (7.6%) and were confirmed using phenotypic characterisation. Somatic serotyping of the 21 isolates resulted in 12 isolates being classed as serotype A:1 (57.14%), 4 as serotype A:3 (19.05%) and 5 could not be typed (23.8%). Capsular typing, using multiplex polymerase chain reaction (PCR), demonstrated that 18 strains were capsular type A (85.7%), and 3 were type D (14.3%). The present findings suggest that a multiplex capsular PCR could be valuable for the rapid identification of P. multocida in cases of fowl cholera infection. A total of 5 isolates of P. multocida were selected to study their pathogenicity in embryonated chicken eggs instead of conducting a study in mature chickens. The results showed a variation in pathogenicity between the strains tested, namely: serotype A:1 strains caused 80% mortality, in contrast to 20% mortality by type D strains. Pathological findings included severe congestion of the entire embryo, haemorrhaging of the skin, feather follicles and toe, and ecchymotic haemorrhages on the liver of the inoculated embryos. The observations in this study indicate that P. multocida serogroup A could be highly pathogenic for mature chickens and therefore might be a cause of considerable economic losses in commercial production. A total of 10 isolates were subjected to antimicrobial susceptibility to determine the minimal inhibitory concentration of 7 antimicrobials. All isolates were susceptible to ciprofloxacin, florfenicol, streptomycin and sulphamethoxazol with trimethoprim and with varying degrees of sensitivity to the other agents.

  18. Reverse transcription and polymerase chain reaction: principles and applications in dentistry

    OpenAIRE

    Santos,Carlos Ferreira dos; Sakai,Vivien Thiemy; Machado,Maria Aparecida de Andrade Moreira; Schippers,Daniela Nicole; Greene,Andrew Seth

    2004-01-01

    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA ...

  19. Relation chain based clustering analysis

    Science.gov (United States)

    Zhang, Cheng-ning; Zhao, Ming-yang; Luo, Hai-bo

    2011-08-01

    Clustering analysis is currently one of well-developed branches in data mining technology which is supposed to find the hidden structures in the multidimensional space called feature or pattern space. A datum in the space usually possesses a vector form and the elements in the vector represent several specifically selected features. These features are often of efficiency to the problem oriented. Generally, clustering analysis goes into two divisions: one is based on the agglomerative clustering method, and the other one is based on divisive clustering method. The former refers to a bottom-up process which regards each datum as a singleton cluster while the latter refers to a top-down process which regards entire data as a cluster. As the collected literatures, it is noted that the divisive clustering is currently overwhelming both in application and research. Although some famous divisive clustering methods are designed and well developed, clustering problems are still far from being solved. The k - means algorithm is the original divisive clustering method which initially assigns some important index values, such as the clustering number and the initial clustering prototype positions, and that could not be reasonable in some certain occasions. More than the initial problem, the k - means algorithm may also falls into local optimum, clusters in a rigid way and is not available for non-Gaussian distribution. One can see that seeking for a good or natural clustering result, in fact, originates from the one's understanding of the concept of clustering. Thus, the confusion or misunderstanding of the definition of clustering always derives some unsatisfied clustering results. One should consider the definition deeply and seriously. This paper demonstrates the nature of clustering, gives the way of understanding clustering, discusses the methodology of designing a clustering algorithm, and proposes a new clustering method based on relation chains among 2D patterns. In

  20. Rapid (ligase-free) subcloning of polymerase chain reaction products.

    Science.gov (United States)

    Shuldiner, A R; Tanner, K

    1993-01-01

    The polymerase chain reaction (PCR) is a versatile, widely used method for the production of a very large number of copies of a specific DNA molecule (1,2). For some applications, it is advantageous to subclone the PCR product into a plasmid vector for subsequent replication in bacteria (3-6). Subcloning the PCR product into a plasmid vector has several advantages: (1) the amplified fragment can be sequenced with greater reliability, (2) only one allele is sequenced per clone, and (3) the vector containing the PCR product may be used for other molecular biological experiments, e.g., in vitro transcription, radiolabeling, and further amplification in bacteria.

  1. Automated generation of burnup chain for reactor analysis applications

    International Nuclear Information System (INIS)

    Tran, Viet-Phu; Tran, Hoai-Nam; Yamamoto, Akio; Endo, Tomohiro

    2017-01-01

    This paper presents the development of an automated generation of burnup chain for reactor analysis applications. Algorithms are proposed to reevaluate decay modes, branching ratios and effective fission product (FP) cumulative yields of a given list of important FPs taking into account intermediate reactions. A new burnup chain is generated using the updated data sources taken from the JENDL FP decay data file 2011 and Fission yields data file 2011. The new burnup chain is output according to the format for the SRAC code system. Verification has been performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Burnup calculations using the new burnup chain have also been performed based on UO 2 and MOX fuel pin cells and compared with a reference chain th2cm6fp193bp6T.

  2. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin

    2005-01-01

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  3. A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

    Science.gov (United States)

    Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

    2009-11-01

    To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

  4. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

    Science.gov (United States)

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

  5. Photoisomerization of alfa calcidol by a sensitized quantum chain reaction.

    Science.gov (United States)

    Estruch, Gastón A; Aramendía, Pedro F

    2012-01-01

    The production of vitamin D3 is a pharmaceutically relevant process, producing high added-value products. Precursors are extracts from vegetal origin but bearing mainly an E geometry in the 5,6 double bond. The synthesis of vitamin D3 (5-E-α-calcidol) with the correct Z stereochemistry in the 5,6 double bond from the E isomer using anthracene and triethylamine (TEA) as the sensitizer system was studied from the kinetic and mechanistic point of view. The sensitized isomerization of E-calcidol by irradiation of anthracene takes place only in deoxygenated solution and yields the Z isomer in ca 5% yield in the photostationary state. When TEA is added to the system, the E-Z reaction is not inhibited by oxygen any more, the quantum yield of photoisomerization to the Z isomer grows linearly with the concentration of E-calcidol, while conversions higher than 95% to the Z isomer are reached in the photostationary state and E-Z quantum yields as high as 45 at [E-calcidol] = 25 mM are reached. If TEA is replaced by 1,4-diazabicyclo[2.2.2]octane, the reaction rate drops to one-third at the same amine concentration. The observations can be explained by a quantum chain reaction mechanism. The high conversion achieved eliminates the need of isomer separation. © 2011 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2011 The American Society of Photobiology.

  6. Detection of Clostridium septicum hemolysin gene by polymerase chain reaction.

    Science.gov (United States)

    Takeuchi, S; Hashizume, N; Kinoshita, T; Kaidoh, T; Tamura, Y

    1997-09-01

    A polymerase chain reaction (PCR) was developed for the detection of the hemolysin (alpha toxin) gene of Clostridium septicum. The PCR primers were designed from the sequence of the hemolysin gene and synthesized. A DNA fragment of 270 bp was amplified from 10 strains of C. septicum, but was not from strains of C. chauvoei, C. perfringens, C. novyi, or C. haemolyticum. When the PCR product was digested with Sau3AI, two DNA fragments of the expected 148 bp and 122 bp were recognized. The lowest detectable threshold of PCR for the hemolysin gene was 3.8 x 10(3) cells/ml. The PCR technique may be useful for rapid detection or identification of C. septicum associated with malignant edema.

  7. Polymerase chain reaction: Theory, practice and application: A review

    Directory of Open Access Journals (Sweden)

    S E Atawodi

    2010-01-01

    Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

  8. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

    Science.gov (United States)

    Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

    2012-11-16

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

  9. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  10. Theory and applications of the polymerase chain reaction.

    Science.gov (United States)

    Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

    1990-04-01

    The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

  11. Markov chain aggregation and its applications to combinatorial reaction networks.

    Science.gov (United States)

    Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz

    2014-09-01

    We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

  12. Simulation and Analysis of Chain Drive Systems

    DEFF Research Database (Denmark)

    Pedersen, Sine Leergaard

    The subject of this thesis is simulation and analysis of large roller chain drive systems, such as e.g. used in marine diesel engines. The aim of developing a chain drive simulation program is to analyse dynamic phenomena of chain drive systems and investigate different design changes...... to the systems, in order to remove unwanted phenomena. Such a computer program can, when properly validated, be used as an alternative to or in combination with physical experiments. Prior investigations in this area have been done with a focus on smaller chains in high speed chain drives. For large low speed...... systems other phenomena occur and therefore, a specific model of the marine engine chain drive is of interest. The research objective of the work presented in this thesis is to contribute with a novel theoretical basis for the analysis of chain drive systems, by posing and validating different...

  13. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    Science.gov (United States)

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  14. Detection of stress resistance genes in transgenic maize by multiplex and touchdown polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Bannikova M. A.

    2015-10-01

    Full Text Available Aim. To develop a methodology for detection of the genes of resistance to the stress factors in transgenic maize by multiplex (mPCR and touchdown polymerase chain reactions. Methods. isolation of total DNA by CTAB method, purification of DNA from RNA and proteins, electrophoresis of total DNA and amplification products in agarose gel, polymerase chain reaction. Results. The protocol of multiplex and touchdown polymerase chain reactions has been developed for simultaneous verification of the quality of total DNA extracted from the studied maize plant samples and detection of the following genes that determine resistance to the stress factors in the transgenic maize and maize transformation events: BT176, MON810, MON88017, DAS1507, DAS59122, MIR604, GA21, NK603 (mPCR, Bt11, MON863, MON89034, T25 (touchdown PCR. The multiplex PCR and touchdown PCR were developed using the reference samples. Conclusions. The proposed protocol of mPCR and touchdown PCR reactions can be used for mass analysis of maize samples to detect the genes of tolerance/resistance to herbicides and genes of resistance to insects reliably, authentically, quickly and cheaply.

  15. Detection and typing of human papillomaviruses present in fixed and stained archival cervical smears by a consensus polymerase chain reaction and direct sequence analysis allow the identification of a broad spectrum of human papillomavirus types

    NARCIS (Netherlands)

    Smits, H. L.; Tieben, L. M.; Tjong-A-Hung, S. P.; Jebbink, M. F.; Minnaar, R. P.; Jansen, C. L.; ter Schegget, J.

    1992-01-01

    DNA well suited for polymerase chain reaction (PCR) amplification was purified from archival Papanicolaou smears. The detection of a wide range of human papillomavirus (HPV) types was made possible using a HPV-specific consensus primer pair, and typing was conveniently done by direct sequence

  16. Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

    Science.gov (United States)

    Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

    2011-03-01

    The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

  17. Analysis of mitochondrial DNA for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon) by polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Fajardo, Violeta; González, Isabel; López-Calleja, Inés; Martin, Irene; Rojas, Maria; Pavón, Miguel Angel; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2007-01-01

    The prevention of fraudulent labeling of game meat constitutes an important part of food regulatory control and quality assurance systems. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis based on mitochondrial deoxyribonucleic acid (DNA) was developed for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon). Amplification and restriction site analysis of a DNA fragment about 720 base pairs (bp) from the mitochondrial 12S rRNA gene of all analyzed species permitted the selection of Msel and Apol endonucleases for meat speciation. The 12S rRNA restriction profiles obtained allowed the unequivocal identification of chamois, pyrenean ibex, and mouflon/sheep and their differentiation from meats of domestic species such as cattle, goat, and swine. The highly variable mitochondrial D-loop gene was also targeted to attempt discrimination between mouflon and sheep meats. A D-loop region (700-1000 bp) was amplified and sequenced in all game and domestic species analyzed, and a primer set was designed for the selective amplification of a 370 bp DNA fragment from mouflon and sheep. PCR-RFLP analysis with the selected Maell enzyme generated a single electrophoretic profile characteristic for sheep, whereas 3 different fragment patterns were obtained for mouflon meats. Consequently, the PCR-RFLP technique developed can be routinely applied in inspection programs in order to verify the correct labeling of game species.

  18. Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis.

    Science.gov (United States)

    Fan, Hongxin; Robetorye, Ryan S

    2013-01-01

    Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.

  19. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    Directory of Open Access Journals (Sweden)

    Anupam Berwal

    2017-01-01

    Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

  20. An Emulsion System Based on a Chip Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Pinfei Yu

    2008-12-01

    Full Text Available In this paper we describe a novel method for detecting many DNA fragments through efficient amplification by using an emulsion system based on “on-chip” PCR instead of conventional multiplex polymerase chain reaction (PCR. During the preparation of on-chip PCR, a set of primers were immobilized on a slide and other sets were in an emulsion system. Different emulsion phase primers and other related PCR components were dispersed in different droplets of the emulsion system, and then, due to the thermal instability of emulsion droplets, they would be released onto the surface of the slide after preheating in the first PCR step. To test the above method, we used plasma DNAs from pregnant women who was carrying a male fetus for gender identification. Four different Y chromosome DNA fragments were selected. Results showed that different DNA fragments could be simultaneously amplified with satisfactory results. It is suggested that a simple, convenient and inexpensive on-chip PCR method has been developed.

  1. Nucleic acid amplification: Alternative methods of polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Md Fakruddin

    2013-01-01

    Full Text Available Nucleic acid amplification is a valuable molecular tool not only in basic research but also in application oriented fields, such as clinical medicine development, infectious diseases diagnosis, gene cloning and industrial quality control. A comperehensive review of the literature on the principles, applications, challenges and prospects of different alternative methods of polymerase chain reaction (PCR was performed. PCR was the first nucleic acid amplification method. With the advancement of research, a no of alternative nucleic acid amplification methods has been developed such as loop mediated isothermal amplification, nucleic acid sequence based amplification, strand displacement amplification, multiple displacement amplification. Most of the alternative methods are isothermal obviating the need for thermal cyclers. Though principles of most of the alternate methods are relatively complex than that of PCR, they offer better applicability and sensitivity in cases where PCR has limitations. Most of the alternate methods still have to prove themselves through extensive validation studies and are not available in commercial form; they pose the potentiality to be used as replacements of PCR. Continuous research is going on in different parts of the world to make these methods viable technically and economically.

  2. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  3. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  4. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-01-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  5. MULTI INFEKSI PADA UDANG Litopenaeus vannamei : DIAGNOSIS DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR)

    OpenAIRE

    Isti Koesharyani; Lila Gardenia; Hambali Supriyadi

    2012-01-01

    Penelitian ini dilakukan karena adanya masalah yang dihadapi seperti pertumbuhan udang yang tidak seragam (ukuran bervariasi), penampakan klinis yang abnormal dan organ yang tidak sempurna. Gejala tersebut akibat dari infeksi penyakit yang disebabkan oleh virus. Untuk mengetahui jenis virus yang menyerang udang tersebut, maka dilakukan analisis Polymerase Chain Reaction (PCR) dan Reverse TranscriptasePolymerase Chain Reaction (RT-PCR) menggunakan berbagai jenis spesifik primer WSSV, IHHNV, MB...

  6. Social network analysis and supply chain management

    Directory of Open Access Journals (Sweden)

    Raúl Rodríguez Rodríguez

    2016-01-01

    Full Text Available This paper deals with social network analysis and how it could be integrated within supply chain management from a decision-making point of view. Even though the benefits of using social analysis have are widely accepted at both academic and industry/services context, there is still a lack of solid frameworks that allow decision-makers to connect the usage and obtained results of social network analysis – mainly both information and knowledge flows and derived results- with supply chain management objectives and goals. This paper gives an overview of social network analysis, the main social network analysis metrics, supply chain performance and, finally, it identifies how future frameworks could close the gap and link the results of social network analysis with the supply chain management decision-making processes.

  7. Application of a real-time fluorescence resonance energy transfer polymerase chain reaction assay with melting curve analysis for the detection of Paragonimus heterotremus eggs in the feces of experimentally infected cats.

    Science.gov (United States)

    Tantrawatpan, Chairat; Intapan, Pewpan M; Thanchomnang, Tongjit; Sanpool, Oranuch; Janwan, Penchom; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai

    2013-09-01

    Paragonimus heterotremus is a medically important lung fluke that causes human and animal paragonimiasis in Southeast Asia, including Thailand. In the current study, a real-time fluorescence resonance energy transfer polymerase chain reaction (real-time FRET PCR) with melting curve analysis was developed and evaluated to detect P. heterotremus eggs in the feces of experimentally infected cats. The detection limit of this method for the P. heterotremus DNA sequence was 3 × 10(2) copies of the positive control plasmid and 10(-3) ng of P. heterotremus genomic DNA. The assay system could detect 10 eggs of P. heterotremus per gram of cat feces. No fluorescence signal was observed when DNA purified from 16 other organisms or genomic DNA from cats and human beings were tested. Real-time FRET PCR yielded positive results for all fecal samples from 17 P. heterotremus-infected cats and showed a negative relationship (r = -0.852, P Paragonimus species examined were divided into 4 groups by melting peak analysis. This assay can be useful for the detection of, and epidemiological studies on, P. heterotremus infection in endemic areas.

  8. Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

    Science.gov (United States)

    Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

    2016-01-01

    Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

  9. Evaluation of the reference genes for expression analysis using quantitative real-time polymerase chain reaction in the green peach aphid, Myzus persicae.

    Science.gov (United States)

    Kang, Zhi-Wei; Liu, Fang-Hua; Tian, Hong-Gang; Zhang, Meng; Guo, Shan-Shan; Liu, Tong-Xian

    2017-04-01

    The green peach aphid, Myzus persicae Sulzer (Hemiptera, Aphididae), is an important cosmopolitan pest. Real time qRT-PCR has been used for target gene expression analysis on M. persicae. Using real time qRT-PCR, the expression levels are normalized on the basis of the reliable reference genes. However, to date, the stability of available reference genes has been insufficient. In this study, we evaluated nine candidate reference genes from M. persicae under diverse experimental conditions. The tested candidate genes were comprehensively ranked based on five alternative methods (RefFinder, geNorm, Normfinder, BestKeeper and the comparative ΔC t method). 18s, Actin and ribosomal protein L27 (L27) were recommended as the most stable reference genes for M. persicae, whereas ribosomal protein L27 (L27) was found to be the least stable reference genes for abiotic studies (photoperiod, temperature and insecticide susceptibility). Our finding not only sheds light on establishing an accurate and reliable normalization of real time qRT-PCR data in M. persicae but also lays a solid foundation for further studies of M. persicae involving RNA interference and functional gene research. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  10. Suitability of DNA extracted from archival specimens of fruit-eating bats of the genus Artibeus (Chiroptera, Phyllostomidae for polymerase chain reaction and sequencing analysis

    Directory of Open Access Journals (Sweden)

    Mário Pinzan Scatena

    2008-01-01

    Full Text Available To establish a technique which minimized the effects of fixation on the extraction of DNA from formalin-fixed tissues preserved in scientific collections we extracted DNA samples from fixed tissues using different methods and evaluated the effect of the different procedures on PCR and sequencing analysis. We investigated muscle and liver tissues from museum specimens of five species of fruit-eating (frugivorous bats of the Neotropical genus Artibeus (Chiroptera, Phyllostomidae: A. fimbriatus, A. lituratus, A. jamaicensis, A. obscurus, and A. planirostris. The results indicated that treatment of tissues in buffered solutions at neutral pH and about 37 °C for at least four days improves the quality and quantity of extracted DNA and the quality of the amplification and sequencing products. However, the comparison between the performance of DNA obtained from fixed and fresh tissues showed that, in spite of the fact that both types of tissue generate reliable sequences for use in phylogenetic analyses, DNA samples from fixed tissues presented a larger rate of errors in the different stages of the study. These results suggest that DNA extracted from formalin-fixed tissue can be used in molecular studies of Neotropical Artibeus bats and that our methodology may be applicable to other animal groups.

  11. Retrospective analysis of multiplex polymerase chain reaction-based molecular diagnostics (SES) in 70 patients with suspected central nervous system infections: A single-center study.

    Science.gov (United States)

    Ramalingam, Rama Krishnan Tiruppur Chinnappan; Chakraborty, Dipanjan

    2016-01-01

    Central nervous system (CNS) infections present a grave health care challenge due to high morbidity and mortality. Clinical findings and conventional laboratory assessments are not sufficiently distinct for specific etiologic diagnosis. Identification of pathogens is a key to appropriate therapy. In this retrospective observational study, we evaluated the efficacy and clinical utility of syndrome evaluation system (SES) for diagnosing clinically suspected CNS infections. This retrospective analysis included inpatients in our tertiary level neurointensive care unit (NICU) and ward from February 2010 to December 2013. Cerebrospinal fluid (CSF) samples of 70 patients, clinically suspected of having CNS infections, were subjected to routine laboratory tests, culture, imaging, and SES. We analyzed the efficacy of SES in the diagnosis of CNS infections and its utility in therapeutic decision-making. SES had a clinical sensitivity of 57.4% and clinical specificity of 95.6%. Streptococcus pneumoniae and Pseudomonas aeruginosa were the top two bacterial pathogens, whereas Herpes simplex virus (HSV) was the most common viral pathogen. Polymicrobial infections were detected in 32.14% of SES-positive cases. SES elicited a change in the management in 30% of the patients from initial empiric therapy. At discharge, 51 patients recovered fully while 11 patients had partial recovery. Three-month follow-up showed only six patients to have neurological deficits. In a tertiary care center, etiological microbial diagnosis is central to appropriate therapy and outcomes. Sensitive and accurate multiplex molecular diagnostics play a critical role in not only identifying the causative pathogen but also in helping clinicians to institute appropriate therapy, reduce overuse of antimicrobials, and ensure superior clinical outcomes.

  12. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  13. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  14. Hydropower Manufacturing and Supply Chain Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Cotrell, Jason R [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2018-01-02

    Hydropower Manufacturing and Supply Chain Analysis presentation from the WPTO FY14-FY16 Peer Review. The project objective is to provide data and insights to inform investment strategies, policy, and other decisions to promote economic growth and manufacturing.

  15. O6-Methylguanine-DNA methyltransferase protein expression by immunohistochemistry in brain and non-brain systemic tumours: systematic review and meta-analysis of correlation with methylation-specific polymerase chain reaction

    International Nuclear Information System (INIS)

    Brell, Marta; Ibáñez, Javier; Tortosa, Avelina

    2011-01-01

    The DNA repair protein O 6 -Methylguanine-DNA methyltransferase (MGMT) confers resistance to alkylating agents. Several methods have been applied to its analysis, with methylation-specific polymerase chain reaction (MSP) the most commonly used for promoter methylation study, while immunohistochemistry (IHC) has become the most frequently used for the detection of MGMT protein expression. Agreement on the best and most reliable technique for evaluating MGMT status remains unsettled. The aim of this study was to perform a systematic review and meta-analysis of the correlation between IHC and MSP. A computer-aided search of MEDLINE (1950-October 2009), EBSCO (1966-October 2009) and EMBASE (1974-October 2009) was performed for relevant publications. Studies meeting inclusion criteria were those comparing MGMT protein expression by IHC with MGMT promoter methylation by MSP in the same cohort of patients. Methodological quality was assessed by using the QUADAS and STARD instruments. Previously published guidelines were followed for meta-analysis performance. Of 254 studies identified as eligible for full-text review, 52 (20.5%) met the inclusion criteria. The review showed that results of MGMT protein expression by IHC are not in close agreement with those obtained with MSP. Moreover, type of tumour (primary brain tumour vs others) was an independent covariate of accuracy estimates in the meta-regression analysis beyond the cut-off value. Protein expression assessed by IHC alone fails to reflect the promoter methylation status of MGMT. Thus, in attempts at clinical diagnosis the two methods seem to select different groups of patients and should not be used interchangeably

  16. O6-Methylguanine-DNA methyltransferase protein expression by immunohistochemistry in brain and non-brain systemic tumours: systematic review and meta-analysis of correlation with methylation-specific polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Ibáñez Javier

    2011-01-01

    Full Text Available Abstract Background The DNA repair protein O6-Methylguanine-DNA methyltransferase (MGMT confers resistance to alkylating agents. Several methods have been applied to its analysis, with methylation-specific polymerase chain reaction (MSP the most commonly used for promoter methylation study, while immunohistochemistry (IHC has become the most frequently used for the detection of MGMT protein expression. Agreement on the best and most reliable technique for evaluating MGMT status remains unsettled. The aim of this study was to perform a systematic review and meta-analysis of the correlation between IHC and MSP. Methods A computer-aided search of MEDLINE (1950-October 2009, EBSCO (1966-October 2009 and EMBASE (1974-October 2009 was performed for relevant publications. Studies meeting inclusion criteria were those comparing MGMT protein expression by IHC with MGMT promoter methylation by MSP in the same cohort of patients. Methodological quality was assessed by using the QUADAS and STARD instruments. Previously published guidelines were followed for meta-analysis performance. Results Of 254 studies identified as eligible for full-text review, 52 (20.5% met the inclusion criteria. The review showed that results of MGMT protein expression by IHC are not in close agreement with those obtained with MSP. Moreover, type of tumour (primary brain tumour vs others was an independent covariate of accuracy estimates in the meta-regression analysis beyond the cut-off value. Conclusions Protein expression assessed by IHC alone fails to reflect the promoter methylation status of MGMT. Thus, in attempts at clinical diagnosis the two methods seem to select different groups of patients and should not be used interchangeably.

  17. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  18. A 20-year experience of ocular herpes virus detection using immunofluorescence and polymerase chain reaction.

    Science.gov (United States)

    Satpathy, Gita; Behera, Himansu S; Sharma, Anjana; Mishra, Abhisek K; Mishra, Deepanshi; Sharma, Namrata; Tandon, Radhika; Agarwal, Tushar; Titiyal, Jeewan S

    2018-03-06

    To detect the presence of herpes virus in corneal scrapings/corneal grafts of suspected herpetic keratitis patients attending the outpatient department/casualty of the Dr Rajendra Prasad Centre for Ophthalmic Sciences, All India Institute of Medical Sciences, New Delhi for the past 20 years with immunofluorescence assay and to analyse the efficacy of polymerase chain reaction over immunofluorescence for routine laboratory diagnosis in some of the specimens. Corneal scrapings and corneal grafts were collected by the ophthalmologists from 1,926 suspected herpetic keratitis patients between 1996 and 2015, among whom 1,863 patients were processed with immunofluorescence assay and 302 patients were processed with polymerase chain reaction assay for the detection of herpes virus. Of the 302 patients, clinical specimens from 239 patients were analysed by both polymerase chain reaction and immunofluorescence assay. Of the 1,863 suspected herpetic keratitis patients diagnosed with immunofluorescence assay, 277 (14.9 per cent) were found positive for herpes simplex virus 1 antigen. Similarly, of the 302 suspected herpetic keratitis patients diagnosed by polymerase chain reaction, 70 (23.2 per cent) were found positive for herpes simplex virus DNA. Of the 239 patients diagnosed by both polymerase chain reaction and immunofluorescence assay, 35 (14.6 per cent) were found positive with immunofluorescence assay, 59 (24.7 per cent) were found positive with polymerase chain reaction, 30 (12.5 per cent) were positive with both immunofluorescence and polymerase chain reaction assay. Efficacy and accuracy of the polymerase chain reaction assay was greater compared to the immunofluorescence assay for detection of herpes virus in corneal scrapings/corneal grafts of suspected herpetic keratitis patients. Although the immunofluorescence assay is a rapid test for the detection of herpes virus in suspected herpetic keratitis patients, a combination of polymerase chain reaction with

  19. The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

    International Nuclear Information System (INIS)

    Sun Jiazhen

    2003-01-01

    Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

  20. Value chain analysis in quality management context

    Directory of Open Access Journals (Sweden)

    Popescu, M.

    2011-01-01

    Full Text Available Based on the description of value chain analysis, which is a strategic management tool attributed to Michel Porter, the paper aims to demonstrate that quality management applies this method, under specific forms. The paper's specific objectives are: to redefine the functions of value chain analysis in the context of quality management; to clarify the significance and the possibilities of measuring the value added; to present management tools and techniques needed to control and systematically improve performance. Research methodology is based on examples, previous studies and a case study that reveals the diversity of indicators for measuring the value added and analysis tools used in quality management.

  1. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Science.gov (United States)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  2. Identification of duck plague virus by polymerase chain reaction

    Science.gov (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  3. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

  4. Analysis of kinetic reaction mechanisms

    CERN Document Server

    Turányi, Tamás

    2014-01-01

    Chemical processes in many fields of science and technology, including combustion, atmospheric chemistry, environmental modelling, process engineering, and systems biology, can be described by detailed reaction mechanisms consisting of numerous reaction steps. This book describes methods for the analysis of reaction mechanisms that are applicable in all these fields. Topics addressed include: how sensitivity and uncertainty analyses allow the calculation of the overall uncertainty of simulation results and the identification of the most important input parameters, the ways in which mechanisms can be reduced without losing important kinetic and dynamic detail, and the application of reduced models for more accurate engineering optimizations. This monograph is invaluable for researchers and engineers dealing with detailed reaction mechanisms, but is also useful for graduate students of related courses in chemistry, mechanical engineering, energy and environmental science and biology.

  5. Genotyping of human neutrophil antigens by polymerase chain reaction sequence-based typing

    Science.gov (United States)

    He, Junjun; Zhang, Wei; Wang, Wei; Chen, Nanying; Han, Zhedong; He, Ji; Zhu, Faming; Lv, Hangjun

    2014-01-01

    Background Genotyping for human neutrophil antigen (HNA) systems is required in the investigation of disorders involving alloimmunisation to HNA. We established a polymerase chain reaction sequence-based typing method for genotyping HNA and determined the genotype and allele frequencies of HNA in the Zhejiang Han population of China. Materials and methods Four hundred, healthy unrelated Zhejiang Han individuals were recruited. Specific primers for HNA were designed and the polymerase chain reaction amplification conditions were optimised. Amplification amplicons were purified with enzyme digestion and then sequenced. Results The frequencies of the FCGR3B*01 and FCGR3B*02 alleles were 0.613 and 0.387; no FCGR3B*03 allele was found. The frequencies of the SLC44A2*1 and SLC44A2*2 alleles were 0.654 and 0.346, respectively, while the frequencies of the ITGAL*1 (HNA-5a) and ITGAL*2 (HNA-5b) alleles were 0.896 and 0.104. Only ITGAM*1 (HNA-4a) allele was found in this study. Six single nucleotide polymorphisms were confirmed on sequenced regions separate from HNA polymorphisms, including FCGR3B (IVS3+39G >A and IVS3+52G >A), CD177(172A >G), SLC44A2 (IVS5-44A >G and IVS7-15T >C) and ITGAM (IVS3+118T >C). Discussion The polymerase chain reaction sequence-based typing method for genotyping HNA is reliable. These data of HNA alleles frequencies could contribute to the analysis of alloimmunisation to HNA in China. PMID:23867183

  6. Opisthorchis viverrini: Detection by polymerase chain reaction (PCR) in human stool samples

    Digital Repository Service at National Institute of Oceanography (India)

    Umesha, K.R.; SanathKumar; Parvathi, A.; Duenngai, K.; Sithithaworn, P.; Karunasagar, Indrani; Karunasagar, Iddya

    A polymerase chain reaction (PCR) assay was evaluated for detection of Opisthorchis viverrini eggs in the stool specimens of light and heavily infected individuals in Khon Kaen province of Thailand. A total of 75 fecal specimens were analyzed by PCR...

  7. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction.

    Science.gov (United States)

    Cobbs, Gary

    2012-08-16

    Numerous models for use in interpreting quantitative PCR (qPCR) data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the literature. They also give better estimates of

  8. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary

    2012-08-01

    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  9. Identification of Bacterial Plant Pathogens Using Multilocus Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry

    Science.gov (United States)

    2008-01-01

    1156 PHYTOPATHOLOGY Techniques Identification of Bacterial Plant Pathogens Using Multilocus Polymerase Chain Reaction/Electrospray Ionization... Phytopathology 98:1156-1164. Polymerase chain reaction/electrospray ionization-mass spectrometry (PCR/ESI-MS, previously known as “TIGER”) utilizes PCR with...based assays have been developed for bacterial plant pathogens (6,12,13,16,18, reviewed in 19). PCR-based diagnos- tics can be highly specific and are

  10. Chain Analysis for Large-scale Communication Systems: A Methodology for Information Exchange in Chains

    NARCIS (Netherlands)

    Grijpink, J.H.A.M.

    2010-01-01

    The chain concept is introduced to explain how large-scale information infrastructures so often fail and sometimes even backfire. Next, the assessment framework of the doctrine of Chain-computerisation and its chain analysis procedure are outlined. In this procedure chain description precedes

  11. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  12. Quantitative analysis of waterfowl parvoviruses in geese and Muscovy ducks by real-time polymerase chain reaction: correlation between age, clinical symptoms and DNA copy number of waterfowl parvoviruses

    Directory of Open Access Journals (Sweden)

    Woźniakowski Grzegorz

    2012-03-01

    Full Text Available Abstract Background Waterfowl parvoviruses cause serious loss in geese and ducks production. Goose parvovirus (GPV is infectious for geese and ducks while Muscovy duck parvovirus (MDPV infects Muscovy ducks only. So far, for these viruses' sensitive detection polymerase chain reaction (PCR and loop-mediated isothermal amplification (LAMP were applied. However, there was no molecular biology method for both waterfowl parvoviruses detection and quantification which could unify the laboratory procedures. The level of GPV and MDPV replication and distribution plays a significant role in the parvoviral infection progress and is strictly correlated to clinical symptoms. Meanwhile, experiments conducted previously on GPV distribution in geese, performed as animal trial, did not involve epidemiological data from the disease field cases. The study on the correlation between age, clinical symptoms and viral DNA copy number may be benefitable in understanding the GPV and MDPV infection. Such data may also aid in determination of the stage and severity of the infection with parvoviruses. Therefore the aim of this study was to develop quantitative real-time PCR for parallel detection of GPV and MDPV in geese and Muscovy ducks and to determine the correlation between the age of the infected birds, clinical symptoms and DNA copy number for the estimation of the disease stage or severity. Results In order to develop quantitative real-time PCR the viral material was collected from 13 farms of geese and 3 farms of Muscovy ducks. The designed primers and Taqman probe for real-time PCR were complementary to GPV and MDPV inverted terminal repeats region. The pITR plasmid was constructed, purified and used to prepare dilutions for standard curve preparation and DNA quantification. The applied method detected both GPV and MDPV in all the examined samples extracted from the heart and liver of the infected birds. The conducted correlation tests have shown relationship

  13. One-stop polymerase chain reaction (PCR): An improved PCR ...

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... improved PCR method with speedy operation and ... novel PCR method is desired to compatibilize Taq DNA .... as template. A 20 ul traditional PCR mixture included 10×PCR reaction buffer, 2 µl, 40 mM dNTP (10mM each), 0.5 µl; Taq DNA polymerase, 0.2 µl (1 unit), 0.5 µl forward and reverse primer mix ...

  14. Energy Chain Analysis of Passenger Car Transport

    Directory of Open Access Journals (Sweden)

    Hans Jakob Walnum

    2011-02-01

    Full Text Available Transport makes up 20 percent of the World’s energy use; in OECD countries this has exceeded 30 percent. The International Energy Agency (IEA estimates that the global energy consumption will increase by 2.1 percent annually, a growth rate that is higher than for any other sector. The high energy consumption means that transportation accounts for nearly 30 percent of CO2 emission in OECD countries and is also one of the main sources of regional and local air pollution. In this article, we analyze energy consumption and greenhouse gas emissions from passenger car transport using an energy chain analysis. The energy chain analysis consists of three parts: the net direct energy use, the energy required for vehicle propulsion; the gross direct chain, which includes the net direct energy consumption plus the energy required to produce it; and, finally, the indirect energy chain, which includes the energy consumption for production, maintenance and operation of infrastructure plus manufacturing of the vehicle itself. In addition to energy consumption, we also analyze emissions of greenhouse gases measured by CO2-equivalents. We look at the trade-offs between energy use and greenhouse gas emissions to see whether some drivetrains and fuels perform favourable on both indicators. Except for the case of electric cars, where hydropower is the only energy source in the Norwegian context, no single car scores favourably on both energy consumption and greenhouse gas emissions.

  15. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    Energy Technology Data Exchange (ETDEWEB)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures that typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.

  16. Identification of spoilage yeasts in a food-production chain by microsatellite polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Baleiras Couto, M.M.; Hartog, B.J.; Veld, J.H.J. Huis in 't; Hofstra, H.; Vossen, J.M.B.M. van der

    1996-01-01

    A survey of yeast strains present in the production chain of mayonnaise and salad dressings was carried out over a period of 14 months. Attempts were made to identify the isolated yeasts with the API system, but identification of all species involved was not possible. In the investigation the

  17. Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

    Science.gov (United States)

    Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

    2017-11-28

    Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

  18. Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.

    Science.gov (United States)

    Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François

    2010-04-01

    To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.

  19. Identification of aflatoxigenic fungi using polymerase chain reaction-based assay

    Directory of Open Access Journals (Sweden)

    Šošo Vladislava M.

    2014-01-01

    Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009

  20. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    Science.gov (United States)

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-01-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  1. Detection of Cryptosporidium species in feces or gastric contents from snakes and lizards as determined by polymerase chain reaction analysis and partial sequencing of the 18S ribosomal RNA gene.

    Science.gov (United States)

    Richter, Barbara; Nedorost, Nora; Maderner, Anton; Weissenböck, Herbert

    2011-05-01

    Cryptosporidiosis is a well-known gastrointestinal disease of snakes and lizards. In the current study, 672 samples (feces and/or gastric contents or regurgitated food items) of various snakes and lizards were examined for the presence of cryptosporidia by polymerase chain reaction (PCR) assay targeting a part of the 18S ribosomal RNA gene. A consecutive sequencing reaction was used to identify the cryptosporidian species present in PCR-positive samples. Cryptosporidium varanii (saurophilum) was detected in 17 out of 106 (16%) samples from corn snakes (Pantherophis guttatus) and in 32 out of 462 (7%) samples from leopard geckos (Eublepharis macularius). Cryptosporidium serpentis was found in 8 out of 462 (2%) leopard gecko samples, but in no other reptile. The Cryptosporidium sp. "lizard genotype" was present in 1 leopard gecko sample, and 1 sample from a corn snake showed a single nucleotide mismatch to this genotype. Pseudoparasitic cryptosporidian species were identified in 5 out of 174 (3%) ophidian samples, but not in lizards. Other sequences did not show complete similarity to previously published Cryptosporidium sequences. The results stress the importance for diagnostic methods to be specific for Cryptosporidium species especially in snakes and show a relatively high prevalence of C. varanii in leopard geckos and corn snakes. © 2011 The Author(s)

  2. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    International Nuclear Information System (INIS)

    East, L.V.

    1994-05-01

    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

  3. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    Garrison, W.M.

    1983-11-01

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  4. Use of polymerase chain reaction for laboratory diagnosis of herpes simplex virus encephalitis.

    Science.gov (United States)

    Aslanzadeh, J; Garner, J G; Feder, H M; Ryan, R W

    1993-01-01

    Polymerase chain reaction was used to detect herpes simplex virus (HSV) specific deoxyribonucleic acid (DNA) sequences in acute and convalescent cerebrospinal fluid (CSF) and brain tissue of a 78-year-old man and in CSF of a neonate who died of complications owing to herpes simplex virus encephalitis (HSVE). Polymerase chain reaction (PCR) was carried out for 35 cycles with a set of primers that bracketed a 92 base pair segment unique to the HSV DNA polymerase gene. Amplified DNA was electrophoresed on 3 percent agarose gel, blotted onto a nylon membrane, and probed with 32p-labeled oligonucleotide internal to the primers. The HSV specific DNA sequences were detected in the specimens from both patients. No HSV specific DNA was detected in CSFs from 20 patients with suspected Lyme disease or neurosyphilis. Polymerase chain reaction is a rapid and noninvasive technique for the diagnosis of HSVE.

  5. High-throughput microfluidic single-cell digital polymerase chain reaction.

    Science.gov (United States)

    White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L

    2013-08-06

    Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.

  6. TaqMan Real-Time Polymerase Chain Reaction and ...

    African Journals Online (AJOL)

    Results: Pyrosequencing and TaqMan real time PCR methods were successfully developed to identify. ALDH2 *2 polymorphisms. The allele ..... than for RFLP analysis [16]. A method using real- time PCR offers an advantage over RFLP in that it can be modified for high-throughput applications, but it does not provide direct.

  7. Chain Analysis for large-scale Communication systems

    NARCIS (Netherlands)

    Grijpink, Jan|info:eu-repo/dai/nl/095130861

    2010-01-01

    The chain concept is introduced to explain how large-scale information infrastructures so often fail and sometimes even backfire. Next, the assessment framework of the doctrine of Chain-computerisation and its chain analysis procedure are outlined. In this procedure chain description precedes

  8. Analysis of supply chain management of N1-EAM project

    International Nuclear Information System (INIS)

    Wu Jize; Liu Xujia; Liu Huanhuan

    2014-01-01

    Supply chain management directly affect the safe and stable operation of nuclear power plants. China's nuclear power production management information system N1-EAM covers supply chain management business. This paper firstly N1-EAM supply chain management functions, advanced analysis of business processes, Qinshan area combined with supply chain management situation, the initial application of the proposed solutions. (authors)

  9. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    Science.gov (United States)

    Pérez, Lester J.; de Arce, Heidy Díaz

    2009-01-01

    Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

  10. Real-time ligation chain reaction for DNA quantification and identification on the FO-SPR.

    Science.gov (United States)

    Knez, Karel; Spasic, Dragana; Delport, Filip; Lammertyn, Jeroen

    2015-05-15

    Different assays have been developed in the past years to meet point-of-care diagnostic tests requirements for fast and sensitive quantification and identification of targets. In this paper, we developed the ligation chain reaction (LCR) assay on the Fiber Optic Surface Plasmon Resonance (FO-SPR) platform, which enabled simultaneous quantification and cycle-to-cycle identification of DNA during amplification. The newly developed assay incorporated FO-SPR DNA melting assay, previously developed by our group. This required establishment of several assay parameters, including buffer ionic strength and thermal ramping speed as these parameters both influence the ligation enzyme performance and the hybridization yield of the gold nanoparticles (Au NPs) on the FO-SPR sensor. Quantification and identification of DNA targets was achieved over a wide concentration range with a calibration curve spanning 7 orders of magnitude and LOD of 13.75 fM. Moreover, the FO-SPR LCR assay could discriminate single nucleotide polymorphism (SNPs) without any post reaction analysis, featuring thus all the essential requirements of POC tests. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

    National Research Council Canada - National Science Library

    McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

    2005-01-01

    ...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

  12. Biofuel supply chain, market, and policy analysis

    Science.gov (United States)

    Zhang, Leilei

    Renewable fuel is receiving an increasing attention as a substitute for fossil based energy. The US Department of Energy (DOE) has employed increasing effort on promoting the advanced biofuel productions. Although the advanced biofuel remains at its early stage, it is expected to play an important role in climate policy in the future in the transportation sector. This dissertation studies the emerging biofuel supply chain and markets by analyzing the production cost, and the outcomes of the biofuel market, including blended fuel market price and quantity, biofuel contract price and quantity, profitability of each stakeholder (farmers, biofuel producers, biofuel blenders) in the market. I also address government policy impacts on the emerging biofuel market. The dissertation is composed with three parts, each in a paper format. The first part studies the supply chain of emerging biofuel industry. Two optimization-based models are built to determine the number of facilities to deploy, facility locations, facility capacities, and operational planning within facilities. Cost analyses have been conducted under a variety of biofuel demand scenarios. It is my intention that this model will shed light on biofuel supply chain design considering operational planning under uncertain demand situations. The second part of the dissertation work focuses on analyzing the interaction between the key stakeholders along the supply chain. A bottom-up equilibrium model is built for the emerging biofuel market to study the competition in the advanced biofuel market, explicitly formulating the interactions between farmers, biofuel producers, blenders, and consumers. The model simulates the profit maximization of multiple market entities by incorporating their competitive decisions in farmers' land allocation, biomass transportation, biofuel production, and biofuel blending. As such, the equilibrium model is capable of and appropriate for policy analysis, especially for those policies

  13. Agricultural Value Chains in Developing Countries A Framework for Analysis

    OpenAIRE

    Trienekens, Jacques H.

    2011-01-01

    The paper presents a framework for developing country value chain analysis made up of three components. The first consists of identifying major constraints for value chain upgrading: market access restrictions, weak infrastructures, lacking resources and institutional voids. In the second component three elements of a value chain are defined: value addition, horizontal and vertical chain-network structure and value chain governance mechanisms. Finally, upgrading options are defined in the are...

  14. Time-resolved studies of free radicals and laser-initiated chain reactions: Final report, 1 April 1979-31 March 1988

    International Nuclear Information System (INIS)

    Leone, S.R.

    1988-03-01

    Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH 2 I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained

  15. Animal DNA identification in food products and animal feed by real time polymerase chain reaction method

    Directory of Open Access Journals (Sweden)

    Людмила Мар’янівна Іщенко

    2016-11-01

    Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer 

  16. Blunt-end vectors generated by polymerase chain reaction (PCR) for ...

    African Journals Online (AJOL)

    Blunt-end cloning is a convenient way to clone polymerase chain reaction (PCR) products generated by proof-reading DNA polymerase. However, it is a time consuming procedure to prepare the linearized blunt-end vector, which usually involves plasmid extraction and restriction enzyme digestion. Moreover, 5' ...

  17. Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens

    NARCIS (Netherlands)

    de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.

    1993-01-01

    The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent

  18. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

  19. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    Science.gov (United States)

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  20. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  1. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    A total of 280 persons were HLA-DQA1 typed by two different polymerase chain reaction (PCR) based methods; (i) a reverse dot-blot (RDB) method, which can differentiate between six alleles, and (ii) a combined PCR-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification...

  2. Rapid and specific identification of Yersinia pestis by using a nested polymerase chain reaction procedure.

    OpenAIRE

    Campbell, J; Lowe, J; Walz, S; Ezzell, J

    1993-01-01

    We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.

  3. False-negative HIV-1 polymerase chain reaction in a 15-month-old ...

    African Journals Online (AJOL)

    Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...

  4. Case Report:False-negative HIV-1 polymerase chain reaction in a ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...

  5. Real-time TaqMan polymerase chain reaction to quantify the effects ...

    African Journals Online (AJOL)

    TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...

  6. Polymerase chain Reaction in molecular biotechnology; appropriate technology for developing countries

    NARCIS (Netherlands)

    Felice, A. E.; Alshinawi, C.

    1996-01-01

    The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and

  7. Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

    NARCIS (Netherlands)

    White, P.L.; Wingard, J.R.; Bretagne, S.; Loffler, J.; Patterson, T.F.; Slavin, M.A.; Barnes, R.A.; Pappas, P.G.; Donnelly, J.P.

    2015-01-01

    BACKGROUND: Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised.

  8. Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

    NARCIS (Netherlands)

    Hatta, Mochammad; Smits, Henk L.

    2007-01-01

    A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

  9. Potato virus a detection by reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Cerovska, N.; Moravec, T.; Mraz, I.; Petrzik, K.

    1998-01-01

    Simple and reliable procedure for sample preparation and reverse transcription-polymerase chain reaction (RT-PCR) detection of potato virus A (PVA) is described. PVA-specific primers used in the RT-PCR defined a target sequence of 321 bp and did not produce amplification product(s) with potato virus Y. (authors)

  10. Rapid and sensitive detection of Campylobacter spp. in chicken products by using the polymerase chain reaction

    NARCIS (Netherlands)

    Giesendorf, B A; Quint, W G; Henkens, M H; Stegeman, H; Huf, F A; Niesters, H G

    1992-01-01

    The polymerase chain reaction (PCR) after a short enrichment culture was used to detect Campylobacter spp. in chicken products. After the 16S rRNA gene sequence of Campylobacter jejuni was determined and compared with known sequences from other enterobacteria, a primer and probe combination was

  11. On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment

    International Nuclear Information System (INIS)

    Anghaie, S.; Froelich, P.; Monkhorst, H.J.

    1990-01-01

    In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, 6 Li nd 7 Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur

  12. Diversity of Enterococcus faecalis Genotypes from Multiple Oral Sites Associated with Endodontic Failure Using Repetitive Sequence-based Polymerase Chain Reaction and Arbitrarily Primed Polymerase Chain Reaction.

    Science.gov (United States)

    Delboni, Maraísa G; Gomes, Brenda P F A; Francisco, Priscila A; Teixeira, Fabrício B; Drake, David

    2017-03-01

    The aim of this study was to evaluate the diversity and similarity of Enterococcus faecalis genotype isolates from multiple oral sites using repetitive sequence-based polymerase chain reaction and arbitrarily primed polymerase chain reaction (AP-PCR). Forty-two endodontically treated teeth with apical periodontitis were selected. A total of 126 microbial samples were collected from 3 different sites (saliva, pulp chamber, and root canals, all n = 42) during the nonsurgical retreatment procedures. After growth on m-Enterococcus agar, the colonies were isolated, characterized as gram-positive catalase negative cocci, and identified using an API 20 Strep kit (bioMérieux, Marcy-l'Etoile, France). Seventy-four colonies from 10 patients were confirmed as E. faecalis by polymerase chain reaction (16S ribosomal RNA). Repetitive sequence-based polymerase chain reactions using ERIC and AP-PCR using RW3A primers were performed in all 74 colonies. Fingerprints were analyzed and separated into genotypic groups based on the Dice coefficient percentage of similarity (82% or greater) as determined by ERIC reproducibility assays involving E. faecalis controls. Seven different E. faecalis genotypes (GTs) (GT1 = 27%, GT2 = 17.6%, GT3 = 1.3%, GT4 = 18.9%, GT5 = 9.5%, GT6 = 14.9%, and GT7 = 10.8%) were observed in different subjects and oral sites associated with endodontic failure. Remarkably, in 4 of 5 patients, the same GTs present in the infected root canals were also isolated from either the pulp chamber or the saliva samples. In particular, GT6 was detected in all 3 oral sites of patient 37. E. faecalis GTs isolated from saliva, the pulp chamber, and the root canal were similar using the Rep-PCR and AP-PCR methods. These findings suggest that coronal microleakage is a conceivable cause of endodontic failure. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  13. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)

    2016-05-06

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  14. Integrating structure, conduct and performance into value chain analysis

    NARCIS (Netherlands)

    Santana De Figueiredo Junior, H.; Meuwissen, M.P.M.; Oude Lansink, A.G.J.M.

    2014-01-01

    Value chain analysis has been adopted by several research and funding institutions for analysing local development opportunities. Development practitioners, however, are still looking for more solid grounds for value chain strategy development, especially since the expected outcomes of

  15. MULTI INFEKSI PADA UDANG Litopenaeus vannamei : DIAGNOSIS DENGAN POLYMERASE CHAIN REACTION (PCR DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR

    Directory of Open Access Journals (Sweden)

    Isti Koesharyani

    2012-04-01

    Full Text Available Penelitian ini dilakukan karena adanya masalah yang dihadapi seperti pertumbuhan udang yang tidak seragam (ukuran bervariasi, penampakan klinis yang abnormal dan organ yang tidak sempurna. Gejala tersebut akibat dari infeksi penyakit yang disebabkan oleh virus. Untuk mengetahui jenis virus yang menyerang udang tersebut, maka dilakukan analisis Polymerase Chain Reaction (PCR dan Reverse TranscriptasePolymerase Chain Reaction (RT-PCR menggunakan berbagai jenis spesifik primer WSSV, IHHNV, MBV, TSV, IMNV, dan PvNV. Sampel udang yang secara visual normal dan abnormal diambil lalu disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisis di laboratorium dengan metode yang sudah dikembangkan oleh Pusat Penelitian dan Pengembangan Perikanan Budidaya. Hasilnya menunjukkan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus IHHNV dan IMNV. Hasil penelitian ini juga mengindikasikan bahwa udang yang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan, sedangkan udang yang diserang IMNV otot daging di tubuh memutih terutama pada bagian punggung dan dapat menimbulkan kematian.

  16. Fetal RHD Genotyping Using Real-Time Polymerase Chain Reaction Analysis of Cell-Free Fetal DNA in Pregnancy of RhD Negative Women in South of Iran

    Directory of Open Access Journals (Sweden)

    Leili Moezzi

    2016-05-01

    Full Text Available Background: Maternal-fetal RhD antigen incompatibility causes approximately 50% of clinically significant alloimmunization cases. The routine use of prophylactic anti-D immunoglobulin has dramatically reduced hemolytic disease of the fetus and newborn. Recently, fetal RHD genotyping in RhD negative pregnant women has been suggested for appropriate use of anti-D immunoglobulin antenatal prophylaxis and decrease unnecessary prenatal interventions. Materials and Methods: In this prospective cohort study, in order to develop a reliable and non-invasive method for fetal RHD genotyping, cell free fetal DNA (cffDNA was extracted from maternal plasma. Real-time quantitative polymerase chain reaction (qPCR for detection of RHD exons 7, 5, 10 and intron 4 was performed and the results were compared to the serological results of cord blood cells as the gold standard method. SRY gene and hypermethylated Ras-association domain family member 1 (RASSF1A gene were used to confirm the presence of fetal DNA in male and female fetuses, respectively. Results: Out of 48 fetuses between 8 and 32 weeks (wks of gestational age (GA, we correctly diagnosed 45 cases (93.75% of RHD positive fetuses and 2 cases (4.16% of the RHD negative one. Exon 7 was amplified in one sample, while three other RHD gene sequences were not detected; the sample was classified as inconclusive, and the RhD serology result after birth showed that the fetus was RhD-negative. Conclusion: Our results showed high accuracy of the qPCR method using cffDNA for fetal RHD genotyping and implicate on the efficiency of this technique to predict the competence of anti-D immunoglobulin administration.

  17. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931

  18. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  19. Deubiquitinase–based analysis of ubiquitin chain architecture using Ubiquitin Chain Restriction (UbiCRest)

    OpenAIRE

    Hospenthal, Manuela K.; Mevissen, Tycho E.T.; Komander, David

    2015-01-01

    Protein ubiquitination is a versatile protein modification that regulates virtually all cellular processes. This versatility originates from polyubiquitin chains, which can be linked in eight distinct ways. The combinatorial complexity of eight linkage types in homotypic (one chain type per polymer) and heterotypic (multiple linkage types per polymer) chains poses significant problems for biochemical analysis. Here we describe UbiCRest, in which substrates (ubiquitinated proteins or polyubiqu...

  20. [Comprehensive examination of the female urogenital tract infection by polymerase chain reaction using multiplex test systems].

    Science.gov (United States)

    Demkin, V V; Kurinov, A M; Kuz'micheva, R A; Karlina, V P; Korneva, I N; Suchkov, S V

    2010-08-01

    The results of the polymerase chain reaction studies performed in 2006-2008 were used to make a retrospective analysis of the detection of urogenital herpesvirus infections in reproductive-aged women constituting the urban population of the central region of Russia. The study used both monotarget and mutiplex test systems to detect herpes simplex virus (HSV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpesvirus types 6 and 7. A total of about 7.500 referrals; the detection rate for HSV was about 1%; that for CMV was from 0.3 in 2006 to 1% in 2008; that for EBV was from 0.1% in 2006 to 0.3% in 2008. More than a half of HSV-, CMV-, or EBY-positive samples also contained DNA of other causative agents and some samples did two pathogens or more. Multiplex test systems for herpesviruses considerably enhance the efficiency of diagnostic studies and reduce the material and time costs of diagnosis.

  1. A Continuous-Flow Polymerase Chain Reaction Microchip With Regional Velocity Control

    Science.gov (United States)

    Li, Shifeng; Fozdar, David Y.; Ali, Mehnaaz F.; Li, Hao; Shao, Dongbing; Vykoukal, Daynene M.; Vykoukal, Jody; Floriano, Pierre N.; Olsen, Michael; McDevitt, John T.; Gascoyne, Peter R.C.; Chen, Shaochen

    2009-01-01

    This paper presents a continuous-flow polymerase chain reaction (PCR) microchip with a serpentine microchannel of varying width for “regional velocity control.” Varying the channel width by incorporating expanding and contracting conduits made it possible to control DNA sample velocities for the optimization of the exposure times of the sample to each temperature phase while minimizing the transitional periods during temperature transitions. A finite element analysis (FEA) and semi-analytical heat transfer model was used to determine the distances between the three heating assemblies that are responsible for creating the denaturation (96 °C), hybridization (60 °C), and extension (72 °C) temperature zones within the microchip. Predictions from the thermal FEA and semi-analytical model were compared with temperature measurements obtained from an infrared (IR) camera. Flow-field FEAs were also performed to predict the velocity distributions in the regions of the expanding and contracting conduits to study the effects of the microchannel geometry on flow recirculation and bubble nucleation. The flow fields were empirically studied using micro particle image velocimetry (μ-PIV) to validate the flow-field FEA’s and to determine experimental velocities in each of the regions of different width. Successful amplification of a 90 base pair (bp) bacillus anthracis DNA fragment was achieved. PMID:19829760

  2. Polymerase chain reaction detection of retinoblastoma gene deletions in paraffin-embedded mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1991-01-01

    A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  3. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction.

    Science.gov (United States)

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-11-27

    Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  4. Utility of real-time polymerase chain reaction in diagnosing and treating acanthamoeba keratitis.

    Science.gov (United States)

    Itahashi, Motoki; Higaki, Shiro; Fukuda, Masahiko; Mishima, Hiroshi; Shimomura, Yoshikazu

    2011-11-01

    Using real-time polymerase chain reaction (PCR), we detected Acanthamoeba and monitored the changes in Acanthamoeba DNA copy number over the treatment course in patients suspected of Acanthamoeba keratitis (AK). Subjects were 6 patients (average age, 26.2 years) suspected of AK at the Kinki University Outpatient Clinic. For detection of Acanthamoeba, patients' corneal scrapings were collected for smear analysis, culture, and real-time PCR. After the diagnosis of AK was confirmed, treatment was initiated based on the quantitative result of the real-time PCR. Both the smear and culture were positive for Acanthamoeba in 4 cases and negative in 2 cases (agreement in 3 cases and disagreement in 2 cases). By real-time PCR, all 6 cases were positive for Acanthamoeba with an average DNA copy number of 4.8 ± 9.1 × 10 copies per sample. We further monitored the variation in the Acanthamoeba DNA copy number over the treatment course and successfully treated all the patients. DNA copy number provided a parallel with other clinical features of AK. Real-time PCR can be a useful method for a rapid and precise diagnosis of AK. Moreover, utility of the Acanthamoeba DNA copy number obtained by real-time PCR can help ophthalmologists in making the best treatment decision.

  5. An exonuclease-assisted amplification electrochemical aptasensor for Hg(2+) detection based on hybridization chain reaction.

    Science.gov (United States)

    Bao, Ting; Wen, Wei; Zhang, Xiuhua; Xia, Qinghua; Wang, Shengfu

    2015-08-15

    In this work, a novel electrochemical aptasensor was developed for Hg(2+) detection based on exonuclease-assisted target recycling and hybridization chain reaction (HCR) dual signal amplification strategy. The presence of Hg(2+) induced the T-rich DNA partly folded into duplex-like structure via the Hg(2+) mediated T-Hg(2+)-T base pairs, which triggered the activity of exonuclease III (Exo III). Exo III selectively digested the double-strand DNA containing multiple T-Hg(2+)-T base pairs from its 3'-end, the released Hg(2+) participated analyte recycle. With each digestion cycle, a digestion product named as help DNA was obtained, which acted as a linkage between the capture DNA and auxiliary DNA. The presence of help DNA and two auxiliary DNA collectively facilitated successful HCR process and formed long double-stranded DNA. [Ru(NH3)6](3+) was used as redox indicator, which electrostatically bound to the double strands and produced an electrochemical signal. Exo III-assisted target recycling and HCR dual amplification significantly improved the sensitivity for Hg(2+) with a detection limit of 0.12 pM (S/N=3). Furthermore, the proposed aptasensor had a promising potential for the application of Hg(2+) detection in real aquatic sample analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain

    2010-02-01

    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  7. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    OpenAIRE

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction pattern...

  8. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  9. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  10. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.

    OpenAIRE

    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W; Atlas, R M

    1992-01-01

    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can di...

  11. Compact-like kink in a real electrical reaction-diffusion chain

    Energy Technology Data Exchange (ETDEWEB)

    Comte, J.C. [Laboratoire de Physiopathologie des Reseaux Neuronaux du Cycle Veille-Sommeil, CNRS UMR 5167, Faculte de Medecine Laennec 7, Rue Guillaume Paradin, 69372 Lyon Cedex 08 (France)]. E-mail: comtejc@sommeil.univ-lyon1.fr; Marquie, P. [Laboratoire d' Electronique, Informatique et Image (LE2i) UMR CNRS 5158, Aile des Sciences de l' Ingenieur, BP 47870, 21078 Dijon Cedex (France)

    2006-07-15

    We demonstrate experimentally the compact-like kinks existence in a real electrical reaction-diffusion chain. Our measures show that such entities are strictly localized and consequently present a finite spatial extent. We show equally that the kink velocity is threshold-dependent. A theoretical quantification of the critical coupling under which propagation fails is also achieved and reveals that nonlinear coupling leads to a propagation failure reduction.

  12. Specific detection of Campylobacter jejuni and Campylobacter coli by using polymerase chain reaction.

    OpenAIRE

    Oyofo, B A; Thornton, S A; Burr, D H; Trust, T J; Pavlovskis, O R; Guerry, P

    1992-01-01

    Development of a routine detection assay for Campylobacter jejuni and Campylobacter coli in clinical specimens was undertaken by using the polymerase chain reaction (PCR). An oligonucleotide primer pair from a conserved 5' region of the flaA gene of C. coli VC167 was used to amplify a 450-bp region by PCR. The primer pair specifically detected 4 strains of C. coli and 47 strains of C. jejuni; but it did not detect strains of Campylobacter fetus, Campylobacter lari, Campylobacter upsaliensis, ...

  13. Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray.

    Directory of Open Access Journals (Sweden)

    Jarmo Ritari

    Full Text Available Sensitive and specific detection of human papillomaviruses (HPV in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93% gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

  14. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng

    2015-05-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  15. Supply Chain Visibility with Linked Open Data for Supply Chain Risk Analysis

    NARCIS (Netherlands)

    Hofman, W.J.

    2011-01-01

    Current customs applications are declaration based to support the various customs procedures based on (inter)national laws and regulations. To be able to perform a proper supply chain risk analysis, customs requires to have all data in supply chains. The current declaration procedures are not

  16. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.

    1990-01-01

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  17. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  18. Simulation and Analysis of Roller Chain Drive Systems

    DEFF Research Database (Denmark)

    Pedersen, Sine Leergaard

    The subject of this thesis is simulation and analysis of large roller chain drive systems, such as e.g. used in marine diesel engines. The aim of developing a chain drive simulation program is to analyse dynamic phenomena of chain drive systems and investigate different design changes...... to the systems, in order to remove unwanted phenomena. Such a computer program can, when properly validated, be used as an alternative to or in combination with physical experiments. Prior investigations in this area have been done with a focus on smaller chains in high speed chain drives. For large low speed...... systems other phenomena occur and therefore, a specific model of the marine engine chain drive is of interest. The research objective of the work presented in this thesis is to contribute with a novel theoretical basis for the analysis of chain drive systems, by posing and validating different...

  19. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......) x s(-1)) > backbone amides (10-10(-3) M(-1) x s(-1)) > Gln(0.03 M(-1) x s(-1)) approximately Asn (0.03 M(-1) x s(-1)). The rate constants for reaction of HOCl with backbone amides (peptide bonds) vary by 4 orders of magnitude with uncharged peptide bonds reacting more readily with HOCl than those....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  20. Optimization of quantitative polymerase chain reactions for detection and quantification of eight periodontal bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Decat Ellen

    2012-12-01

    Full Text Available Abstract Background The aim of this study was to optimize quantitative (real-time polymerase chain reaction (qPCR assays for 8 major periodontal pathogens, i.e. Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum, Parvimonas micros, Porphyromonas gingivalis, Prevotella intermedia, Tanerella forsythia and Treponema denticola, and of the caries pathogen Streptococcus mutans. Results Eighteen different primer pairs were analyzed in silico regarding specificity (using BLAST analysis and the presence of secondary structures at primer binding sites (using mFOLD. The most specific and efficiently binding primer pairs, according to these analyses, were selected for qPCR-analysis to determine amplification efficiency, limit of quantification and intra-run reproducibility. For the selected primer pairs, one for each species, the specificity was confirmed by assessing amplification of DNA extracts from isolates of closely related species. For these primer pairs, the intercycler portability was evaluated on 3 different thermal cyclers (the Applied Biosystems 7300, the Bio-Rad iQ5 and the Roche Light Cycler 480. For all assays on the different cyclers, a good correlation of the standard series was obtained (i.e. r2 ≥ 0.98, but quantification limits varied among cyclers. The overall best quantification limit was obtained by using a 2 μl sample in a final volume of 10 μl on the Light Cycler 480. Conclusions In conclusion, the proposed assays allow to quantify the bacterial loads of S. mutans, 6 periodontal pathogenic species and the genus Fusobacterium.This can be of use in assessing periodontal risk, determination of the optimal periodontal therapy and evaluation of this treatment.

  1. Cytogenetic and real-time quantitative reverse-transcriptase polymerase chain reaction analyses in pleomorphic rhabdomyosarcoma.

    Science.gov (United States)

    Li, Guidong; Ogose, Akira; Kawashima, Hiroyuki; Umezu, Hajime; Hotta, Tetsuo; Tohyama, Tsuyoshi; Ariizumi, Takashi; Endo, Naoto

    2009-07-01

    Pleomorphic rhabdomyosarcoma (PRMS) is a rare variant of rhabdomyosarcoma that occurs mostly in adults. A few cytogenetic studies of PRMS have been reported, but no consistent specific chromosome aberrations were detected. We herein report a cytogenetic study of three cases of pleomorphic rhabdomyosarcoma using a conventional G-banded karyotyping analysis. The three cases appeared to exhibit an extremely complex karyotype with numeric and structural rearrangements. Although the three cases displayed several common aberrations, including -2, -4, -9, -13, -14, -15, -19, -21, add(X)(p11), add(1)(q11), add(7)(p11), and add(13)(p11), no recurrent characteristic chromosomal aberrations could be detected. In addition, among these cases and seven other cases of previously reported PRMS, the most frequent chromosomal alterations were -2, -13, -14, -15, -16, and -19. No obviously consistent structural alterations can be found in these 10 PRMS cases, however, thereby suggesting that it is difficult to confirm whether these complex karyotypes correlated with the diagnosis or clinical outcome in PRMS. In this study, we detected MyoD1 and myogenin gene transcripts at the mRNA level in four cases of PRMS together with other soft-tissue sarcomas, including seven cases of malignant fibrous hitiocytoma, five cases of liposacroma, and three cases of leiomyosacroma using a real-time quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) analysis. High-level expressions of MyoD1 and myogenin gene transcripts were determined in all cases of PRMS. In contrast, the other non-PRMS sarcomas showed either no expression or extremely weak expressions for both genes. Our findings suggest that the detections of MyoD1 and myogenin transcripts using real-time quantitative RT-PCR, combined with immunohistochemical stains, are extremely sensitive and useful for the diagnosis of PRMS.

  2. A fast-and-robust profiler for improving polymerase chain reaction diagnostics.

    Directory of Open Access Journals (Sweden)

    George J Besseris

    Full Text Available Polymerase chain reaction (PCR is an in vitro technology in molecular genetics that progressively amplifies minimal copies of short DNA sequences in a fast and inexpensive manner. However, PCR performance is sensitive to suboptimal processing conditions. Compromised PCR conditions lead to artifacts and bias that downgrade the discriminatory power and reproducibility of the results. Promising attempts to resolve the PCR performance optimization issue have been guided by quality improvement tactics adopted in the past for industrial trials. Thus, orthogonal arrays (OAs have been employed to program quick-and-easy structured experiments. Profiling of influences facilitates the quantification of effects that may counteract the detectability of amplified DNA fragments. Nevertheless, the attractive feature of reducing greatly the amount of work and expenditures by planning trials with saturated-unreplicated OA schemes is known to be relinquished in the subsequent analysis phase. This is because of an inherent incompatibility of ordinary multi-factorial comparison techniques to convert small yet dense datasets. Treating unreplicated-saturated data with either the analysis of variance (ANOVA or regression models destroys the information extraction process. Both of those mentioned approaches are rendered blind to error since the examined effects absorb all available degrees of freedom. Therefore, in lack of approximating an experimental uncertainty, any outcome interpretation is rendered subjective. We propose a profiling method that permits the non-linear maximization of amplicon resolution by eliminating the necessity for direct error estimation. Our approach is distribution-free, calibration-free, simulation-free and sparsity-free with well-known power properties. It is also user-friendly by promoting rudimentary analytics. Testing our method on published amplicon count data, we found that the preponderant effect is the concentration of MgCl2 (p0

  3. A fast-and-robust profiler for improving polymerase chain reaction diagnostics.

    Science.gov (United States)

    Besseris, George J

    2014-01-01

    Polymerase chain reaction (PCR) is an in vitro technology in molecular genetics that progressively amplifies minimal copies of short DNA sequences in a fast and inexpensive manner. However, PCR performance is sensitive to suboptimal processing conditions. Compromised PCR conditions lead to artifacts and bias that downgrade the discriminatory power and reproducibility of the results. Promising attempts to resolve the PCR performance optimization issue have been guided by quality improvement tactics adopted in the past for industrial trials. Thus, orthogonal arrays (OAs) have been employed to program quick-and-easy structured experiments. Profiling of influences facilitates the quantification of effects that may counteract the detectability of amplified DNA fragments. Nevertheless, the attractive feature of reducing greatly the amount of work and expenditures by planning trials with saturated-unreplicated OA schemes is known to be relinquished in the subsequent analysis phase. This is because of an inherent incompatibility of ordinary multi-factorial comparison techniques to convert small yet dense datasets. Treating unreplicated-saturated data with either the analysis of variance (ANOVA) or regression models destroys the information extraction process. Both of those mentioned approaches are rendered blind to error since the examined effects absorb all available degrees of freedom. Therefore, in lack of approximating an experimental uncertainty, any outcome interpretation is rendered subjective. We propose a profiling method that permits the non-linear maximization of amplicon resolution by eliminating the necessity for direct error estimation. Our approach is distribution-free, calibration-free, simulation-free and sparsity-free with well-known power properties. It is also user-friendly by promoting rudimentary analytics. Testing our method on published amplicon count data, we found that the preponderant effect is the concentration of MgCl2 (p0.1). Comparison of the

  4. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Jong Gyun Ahn

    2012-11-01

    Full Text Available &lt;B&gt;Purpose:&lt;/B&gt; Methods for quick and reliable detection of &lt;I&gt;Streptococcus pneumoniae&lt;/I&gt; are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving &lt;I&gt;S. pneumoniae -positive&lt;/i&gt; results. &lt;B&gt;Methods:&lt;/B&gt; Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. &lt;B&gt;Results:&lt;/B&gt; Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. &lt;B&gt;Conclusion:&lt;/B&gt; As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  5. Origin And Propagation Characteristics Of The Explosive Decomposition Chain Reaction In Heavy Metal Azides

    Science.gov (United States)

    Aluker, E. D.; Belokurov, G. M.; Krechetov, A. G.; Mitrofanov, A. Yu.; Pashpekin, A. S.; Aduev, B. P.

    2006-08-01

    Pre-explosive luminescence has been used to visualize the nascence and propagation of a chain reaction over the sample. Results of investigations on nascence and propagation of pre-explosive luminescence in silver azide using streak-camera (space resolution 50 μm, time resolution ˜ 1 ns) are as follows: under homogeneity initiation by a laser pulse and electron accelerator pulse luminescence originates in discrete centers and then propagates over a sample. From the data obtained authors hypothesized the following: a) discrete center nature of nascence of the reaction considered is provided by stochastic nature of initiation process and is not associated with unsoundness of a sample; b) propagation of the reaction over the sample is provided by diffusion of electrons.

  6. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Leone, S.R.

    1990-01-01

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C 2 H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH 3 ; and ammonia, which produces NH 2 . In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  7. Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

    Science.gov (United States)

    Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

    1997-01-01

    Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

  8. SMACS, Probabilistic Seismic Analysis Chain with Statistics

    International Nuclear Information System (INIS)

    Johnson, J.J.; Maslenikov, O.R.; Tiong, L.W.; Mraz, M.J.; Bumpus, S.; Gerhard, M.A.

    1989-01-01

    1 - Description of program or function: The SMACS (Seismic Methodology Analysis Chain with Statistics) system of computer programs is one of the major computational tools of the U.S. NRC Seismic Safety Margins Research Program (SSMRP). SMACS is comprised of the core program SMAX, which performs the SSI response analyses, five pre- processing programs, and two post-processors. The pre-processing programs include: GLAY and CLAN, which generate the nominal impedance matrices and wave scattering vectors for surface-founded structures; INSSIN, which projects the dynamic properties of structures to the foundation in the form of modal participation factors and mass matrices; SAPPAC, which projects the dynamic and pseudo-static properties of multiply-supported piping systems to the support locations, and LNGEN, which can be used to generate the multiplication factors to be applied to the nominal soil, structural, and subsystem properties for each of the response calculations in accounting for random variations of these properties. The post-processors are: PRESTO, which performs statistical operations on the raw data from the response vectors that SMAX produces to calculate best fit lognormal distributions for each response location, and CHANGO, which manipulates the data produced by PRESTO to produce other results of interest to the user. Also included is the computer program SAP4 (a modified version of the University of California, Berkeley SAPIV program), a general linear structural analysis program used for eigenvalue extractions and pseudo-static mode calculations of the models of major structures and subsystems. SAP4 is used to prepare input to the INSSIN and SAPPAC preprocessing programs. The GLAY and CLAN programs were originally developed by J.E. Luco (UCSD) and H.L. Wong (USC). 2 - Method of solution: SMACS performs repeated deterministic analyses, each analysis simulating an earthquake occurrence. Uncertainty is accounted for by performing many such analyses

  9. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend

    1991-01-01

    the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

  10. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend

    1993-01-01

    the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

  11. Analysis of supply chain management of shallots in Medan

    Science.gov (United States)

    Alam, M. C.; Supriana, T.

    2018-02-01

    Supply chain is important for business. One of supply chain that needs to be studied is the shallots supply chain. Medan have high demand while the supply of shallots is limited. This study aims to analyze the flow of shallots supply chain distribution in Medan. The method used was survey by using questionnaires to shallots producers, collecting traders, distributors, traders as well as government involved in shallots supply chain. Descriptive analysis was used to explain the shallots supply chain distribution flow. The results showed that there are two shallots supply chain model in Medan that was local shallots model and imported shallots model. Local shallots model could be distinguished based on three producer area, those were models of Medan Marelan, Samosir, and Simalungun. Medan Marelan and Simalungun models have seven supply chains, while the Samosir Model has eight supply chains. This condition indicates that the local shallots supply chain management in Medan was not efficient because of the length of the distribution channel. Supply chain imported shallots was more efficient because it had a shorter distribution flow with five supply chains.

  12. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  13. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality...

  14. 188 An Empirical Investigation of Value-Chain Analysis and ...

    African Journals Online (AJOL)

    User

    chain analysis and competitive advantage in telecommunication firms in the. United Kingdom”, administered a total of one thousand three hundred and sixteen (1316) copies of questionnaire on staff of marketing department of telecommunication companies to elicit their responses on the relevance of value chain analysis in ...

  15. Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

    Directory of Open Access Journals (Sweden)

    Wen-Pin Chou

    2017-02-01

    Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

  16. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus.

    Science.gov (United States)

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A

    2011-01-01

    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  17. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Science.gov (United States)

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  18. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  19. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    International Nuclear Information System (INIS)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping

    2013-01-01

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling

  20. Application of polymerase chain reaction (PCR) for diagnosis of equine herpes virus-1 (EHV-1).

    Science.gov (United States)

    Gupta, A K; Singh, B K; Yadav, M P

    1996-11-01

    Fifty aborted foetus samples were diagnosed for the presence of equine herpes virus-1 (EHV-1) by polymerase chain reaction (PCR) technique. Specific primer pair for amplification of a particular segment of EHV-1 DNA in gc region having 3 Hae III restriction endonuclease sites was used. A 409 base pair segment obtained as PCR amplification product in 9 samples was digested with Hae III to confirm the presence of EHV-1 as the infectious agent in aborted tissues. It was observed that PCR technique was more sensitive, specific and rapid than the conventional virological diagnostic methods.

  1. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested...

  2. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...

  3. Amplification of the Fusion Gene of Rinderpest Virus by Polymerase Chain Reaction and Cloning in Bacteria

    OpenAIRE

    BULUT, Hakan

    2014-01-01

    In this study, amplification of the rinderpest virus (RPV) fusion (F) gene with polymerase chain reaction (PCR) and cloning of the F gene in Escherichia coli were reported. For this purpose, first total mRNA from Vero cells infected with vaccine strain of RPV was obtained and then cDNA from this mRNA preparation was acquired with reverse transcription. In PCR, cDNA from infected Vero cells and F gene specific primers were used and the F gene was amplified. Both the PCR product and the clonin...

  4. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    OpenAIRE

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-01-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-staine...

  5. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications

    Czech Academy of Sciences Publication Activity Database

    Španová, A.; Horák, Daniel; Soudková, E.; Rittich, B.

    2004-01-01

    Roč. 800, 1-2 (2004), s. 27-32 ISSN 1570-0232. [International Symposium on Separations in the Bioscience /3./. Moscow, 13.05.2003-18.05.2003] R&D Projects: GA ČR GA202/02/1361; GA ČR GA525/02/0287 Institutional research plan: CEZ:AV0Z4050913 Keywords : polymer ase chain reaction inhibition * magnetic microspheres * methacrylates Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.176, year: 2004

  6. Influence of the chain-transfer reactions on the emulsion post-polymerization process

    International Nuclear Information System (INIS)

    Lukhovitskij, V.I.; Polikarpov, V.V.; Pozdeeva, R.M.

    1975-01-01

    A probability of free radical exit from latex particle in the course of chain transfer reaction is defined by properties of the radical itself. In the case of emulsive post-polymerization of styrene in the presence of H-dodecylmercantane the value α for CCL 3 is about 3x10 -2 , for radical C 12 H 25 it is close to zero and for the radical generated under transfer to the monomer it is approximately 10 -2 . The effect of transfer to the monomer on the emulsive post-polymerization is discussed: it is responsible for the high degree of monomer conversion

  7. Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

    Science.gov (United States)

    Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

    1995-06-01

    A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

  8. Identifiability of parameters and behaviour of MCMC chains: a case study using the reaction norm model.

    Science.gov (United States)

    Shariati, M M; Korsgaard, I R; Sorensen, D

    2009-04-01

    Markov chain Monte Carlo (MCMC) enables fitting complex hierarchical models that may adequately reflect the process of data generation. Some of these models may contain more parameters than can be uniquely inferred from the distribution of the data, causing non-identifiability. The reaction norm model with unknown covariates (RNUC) is a model in which unknown environmental effects can be inferred jointly with the remaining parameters. The problem of identifiability of parameters at the level of the likelihood and the associated behaviour of MCMC chains were discussed using the RNUC as an example. It was shown theoretically that when environmental effects (covariates) are considered as random effects, estimable functions of the fixed effects, (co)variance components and genetic effects are identifiable as well as the environmental effects. When the environmental effects are treated as fixed and there are other fixed factors in the model, the contrasts involving environmental effects, the variance of environmental sensitivities (genetic slopes) and the residual variance are the only identifiable parameters. These different identifiability scenarios were generated by changing the formulation of the model and the structure of the data and the models were then implemented via MCMC. The output of MCMC sampling schemes was interpreted in the light of the theoretical findings. The erratic behaviour of the MCMC chains was shown to be associated with identifiability problems in the likelihood, despite propriety of posterior distributions, achieved by arbitrarily chosen uniform (bounded) priors. In some cases, very long chains were needed before the pattern of behaviour of the chain may signal the existence of problems. The paper serves as a warning concerning the implementation of complex models where identifiability problems can be difficult to detect a priori. We conclude that it would be good practice to experiment with a proposed model and to understand its features

  9. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  10. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  11. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  12. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  13. Application of data envelopment analysis models in supply chain management

    DEFF Research Database (Denmark)

    Soheilirad, Somayeh; Govindan, Kannan; Mardani, Abbas

    2017-01-01

    have been attained to reach a comprehensive review of data envelopment analysis models in evaluation supply chain management. Consequently, the selected published articles have been categorized by author name, the year of publication, technique, application area, country, scope, data envelopment...... analysis purpose, study purpose, research gap and contribution, results and outcome, and journals and conferences in which they appeared. The results of this study indicated that areas of supplier selection, supply chain efficiency and sustainable supply chain have had the highest frequently than other...... of interest as a mathematical tool to evaluate supply chain management. While, various data envelopment analysis models have been suggested to measure and evaluate the supply chain management, there is a lack of research regarding to systematic literature review and classification of study in this field...

  14. Value Chain Analysis in Interfirm Relationships: A Field Study.

    NARCIS (Netherlands)

    Dekker, H.C.

    2003-01-01

    Interfirm relationships introduce new challenges for management accounting. One such challenge is the provision of information for the coordination and optimization of activities across firms in a value chain. According to the literature, a value chain analysis (VCA) is a useful tool to meet this

  15. RICE VALUE CHAIN ANALYSIS IN TANZANIA: IDENTIFICATION OF ...

    African Journals Online (AJOL)

    ACSS

    The importance of rice (Oryza sativa L.) as a food and cash crop in Eastern Africa, is increasing, but its value chain is becoming complex. In 2012/13, rice value chain analysis was conducted in rice farming systems of Lake,. Eastern and Southern-Highlands zones of Tanzania. A sample of 240 producers, 60 traders and 30 ...

  16. Rice value chain analysis in Tanzania: identification of constraints ...

    African Journals Online (AJOL)

    The importance of rice (Oryza sativa L.) as a food and cash crop in Eastern Africa, is increasing, but its value chain is becoming complex. In 2012/13, rice value chain analysis was conducted in rice farming systems of Lake, Eastern and Southern-Highlands zones of Tanzania. A sample of 240 producers, 60 traders and 30 ...

  17. Agricultural Value Chains in Developing Countries; a Framework for Analysis

    NARCIS (Netherlands)

    Trienekens, J.H.

    2011-01-01

    The paper presents a framework for developing country value chain analysis made up of three components. The first consists of identifying major constraints for value chain upgrading: market access restrictions, weak infrastructures, lacking resources and institutional voids. In the second component

  18. Value chain analysis on cassava and cassava based - products in ...

    African Journals Online (AJOL)

    This study examined the value Chain analysis (production process and cost related to each element of production chain to add value) on cassava and cassava products in Imo State specifically to ascertain the farm size holdings of the respondents as well as the ownerships of the land used for production. It also identified` ...

  19. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.

    2009-01-01

    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  20. Effects of medium-chain triacylglycerols on Maillard reaction in bread baking.

    Science.gov (United States)

    Toyosaki, Toshiyuki

    2017-12-11

    To investigate the relationship between the fatty acid composition of medium-chain triacylglycerols (MCTs) and the Maillard reaction induced during bread baking, a comparison with various fatty acids was conducted. Saturated fatty acids had a remarkable inhibitory effect on the amount of advanced glycation end products (AGEs) generated from the Maillard reaction in bread baking compared to unsaturated fatty acids. The amount of AGEs produced by each fatty acid (mg kg -1 ) was as follows: C18:0, 18.7; C12:0, 35.2; C16:0, 21.4; C18:0, 38.2; C18:1, 68.7; C18:2, 80.1; C20:4, 80.8; C22:4, 89.8. Saturated fatty acids were possibly involved in the Maillard reaction and, as a result, acted to inhibit it. In the case of unsaturated fatty acids, amounts of AGEs during the Maillard reaction in baking tended to increase as the degree of unsaturation increased. In other words, there was a positive correlation between the degree of unsaturation and the amount of AGEs. It was also confirmed that the air pore distribution in baked bread was closely related to AGEs. These results led us to conclude that the fatty acid composition of the added lipids also influences properties that determine the tastiness of bread. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  1. Rigorous modal analysis of metallic nanowire chains.

    Science.gov (United States)

    Hochman, Amit; Leviatan, Yehuda

    2009-08-03

    Nanowire chains (NCs) are analyzed by use of a rigorous, full-wave, Source-Model Technique (SMT). The technique employs a proper periodic Green's function which converges regardless of whether the structure is lossless or lossy. By use of this Green's function, it is possible to determine the complex propagation constants of the NC modes directly and accurately, as solutions of a dispersion equation. To demonstrate the method, dispersion curves and mode profiles for a few NCs are calculated.

  2. [Detection of the genetically modified organisms in genetically modified soybean and maize by polymerase chain reaction method].

    Science.gov (United States)

    Mao, Deqian; Mu, Weipeng; Yang, Xiaoguang

    2002-06-01

    A method for the detection of the (genetically modified organism GMOs) in genetically modified soybean (Round-up Ready soybean, RR soybean) and maize(Bt-176 maize) is described. The polymerase chain reaction (PCR) method is discussed with the genetically modified soybean and maize whose contents are known. The detection limit can be 0.1%, that is to say, we can detect the GMO in the food whose content is only 0.1%, the detection method is just a screening method. The procedure includes: (1) extraction of genomic DNA of maize and soybean, (2) amplification of the inserted genes, CaMV35S promoter and the NOS terminator inserted by means of the polymerase chain reaction (PCR) method, (3) amplification of the specific genes of maize and soybean in order to determine that the samples are maize and soybean, (4) characterization and confirmation of the PCR products by restriction enzyme analysis and the electrophoresis on agarose gel. The RR soybean contains CaMV35S promoter and NOS terminator, and the Bt-176 maize contains only CaMV35S promoter. Due to the high content of the starch in maize, the effect of the electrophororesis is not so good as of the soybean's.

  3. Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.

    Science.gov (United States)

    Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F

    2015-01-01

    Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.

  4. Exploiting the tetrazine-norbornene reaction for single polymer chain collapse

    Science.gov (United States)

    Hansell, Claire F.; Lu, Annhelen; Patterson, Joseph P.; O'Reilly, Rachel K.

    2014-03-01

    Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and 1H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated.Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and 1H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated. Electronic supplementary information (ESI) available: Further synthetic detail, 1H and 13C NMR spectra, control experiments, TEM images, SANS and DLS data. See DOI: 10.1039/c3nr06706h

  5. Multiplex polymerase chain reaction for detection of Campylobacter from stool specimen.

    Science.gov (United States)

    Sarkar, S R; Ray, N C; Hossain, M A; Paul, S K; Sarkar, S; Kobayashi, N

    2014-07-01

    This was a study to prospectively evaluate the sensitivity and specificity of multiplex polymerase chain reaction (PCR) to identify Campylobacter. Multiplex polymerase chain reaction (PCR) based on cadF, hipO & asp gene for Campylobacter genus, C. jejuni & C. coli were tested for detection of Campylobacter jejuni & C. coli in naturally infected faecal samples of human. All the samples were subjected to the cultural isolation of organism and biochemical characterization. The samples resulted in the amplification of a DNA fragment of size 400 bp, 500 bp &735 bp in PCR assay. Two hundred faecal samples comprising diarrheal stools, 23(11.5%) could be detected by isolation whereas 24(12.0%) were found positive by PCR. All culture positive cases were positive by PCR and among 01 culture negative case, were positive by PCR. PCR was found to be more sensitive for Campylobacter detection in faecal samples 12.0% as relative to culture isolation which could detect the organism in 11.5% samples. Sensitivity and specificity of PCR were 100% and 99.4% respectively taking Culture as gold standard. The results depicted the superior efficacy of PCR for rapid screening of samples owing to its high sensitivity, specificity and automation potential.

  6. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    Science.gov (United States)

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  7. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  8. [A real-time polymerase chain reaction-based test system for quantitation of Gumboro disease virus].

    Science.gov (United States)

    Pogoda, A A; Potekhina, M A

    2010-01-01

    A real-time polymerase chain reaction-based test system for quantitation of infectious bursal disease (Gumboro disease) virus was developed. The reaction parameters were analyzed, which affected the linear relationship of a C1 depentanizer to the quantity of cDNA. The use of specific primers for reverse transcription was shown tohave some advantage over that of random hexanucleotides.

  9. Probabilistic sensitivity analysis of biochemical reaction systems.

    Science.gov (United States)

    Zhang, Hong-Xuan; Dempsey, William P; Goutsias, John

    2009-09-07

    Sensitivity analysis is an indispensable tool for studying the robustness and fragility properties of biochemical reaction systems as well as for designing optimal approaches for selective perturbation and intervention. Deterministic sensitivity analysis techniques, using derivatives of the system response, have been extensively used in the literature. However, these techniques suffer from several drawbacks, which must be carefully considered before using them in problems of systems biology. We develop here a probabilistic approach to sensitivity analysis of biochemical reaction systems. The proposed technique employs a biophysically derived model for parameter fluctuations and, by using a recently suggested variance-based approach to sensitivity analysis [Saltelli et al., Chem. Rev. (Washington, D.C.) 105, 2811 (2005)], it leads to a powerful sensitivity analysis methodology for biochemical reaction systems. The approach presented in this paper addresses many problems associated with derivative-based sensitivity analysis techniques. Most importantly, it produces thermodynamically consistent sensitivity analysis results, can easily accommodate appreciable parameter variations, and allows for systematic investigation of high-order interaction effects. By employing a computational model of the mitogen-activated protein kinase signaling cascade, we demonstrate that our approach is well suited for sensitivity analysis of biochemical reaction systems and can produce a wealth of information about the sensitivity properties of such systems. The price to be paid, however, is a substantial increase in computational complexity over derivative-based techniques, which must be effectively addressed in order to make the proposed approach to sensitivity analysis more practical.

  10. Visual detection of nucleic acids based on lateral flow biosensor and hybridization chain reaction amplification.

    Science.gov (United States)

    Ying, Na; Ju, Chuanjing; Li, Zhongyi; Liu, Wensen; Wan, Jiayu

    2017-03-01

    In this study, a new lateral flow nucleic acid biosensor (LFNAB) using hybridization chain reaction (HCR) for signal amplification was developed for visual detection of nucleic acids with high sensitivity and low cost. A "sandwich-type" detection strategy was employed in our design. The sandwich system of capture probe (CP)/target DNA/reporter probe (RP)-HCR complexes was fabricated as the sensing platform. As the initiator strand, reporter probe propagated a chain reaction of hybridization events between the two hairpin probes modified with biotin, and determined whether long nicked DNA polymers were formed. The biotin-labeled double-strand DNA polymers then introduced numerous Streptavidin (SA)-labeled gold nanoparticles (AuNPs) on the lateral flow device. The CP/target DNA/RP-HCR complexes were captured on the test zone by the specific reaction between anti-Fam monoclonal antibody (anti-Fam mAb) on the test zone and Fam of the complexes. The accumulation of AuNPs on the test zone of the biosensor enabled the visual detection of specific sequences. The detection limit of specific DNA was as low as 1.76pM, which was about 2 orders lower than that of the LFNAB without HCR amplification. And the detection limit of Salmonella was 3×10 3 cfumL -1 . In conclusion, this visual detection system, HCR-LFNAB, is suitable for non-specialist personnel and point-of-care (POC) diagnosis in low-resource settings. Copyright © 2016. Published by Elsevier B.V.

  11. Markov Chain Analysis of Musical Dice Games

    Science.gov (United States)

    Volchenkov, D.; Dawin, J. R.

    2012-07-01

    A system for using dice to compose music randomly is known as the musical dice game. The discrete time MIDI models of 804 pieces of classical music written by 29 composers have been encoded into the transition matrices and studied by Markov chains. Contrary to human languages, entropy dominates over redundancy, in the musical dice games based on the compositions of classical music. The maximum complexity is achieved on the blocks consisting of just a few notes (8 notes, for the musical dice games generated over Bach's compositions). First passage times to notes can be used to resolve tonality and feature a composer.

  12. A microfluidic device providing continuous-flow polymerase chain reaction heating and cooling

    Science.gov (United States)

    Harandi, A.; Farquhar, T.

    2014-11-01

    The objective of this study is to describe a new type of microfluidic device that could be used to manipulate fluid temperature in many microfluidic applications. The key component is a composite material containing a thermally conductive phase placed in a purposeful manner to manipulate heat flow into and out of an embedded microchannel. In actual use, the device is able to vary temperature along a defined flow path with remarkable precision. As a demonstration of capability, a functional prototype was designed and fabricated using four layers of patterned copper laminated between alternating layers of polyimide and acrylic. The key fabrication steps included laser micromachining, acid etching, microchannel formation, and hot lamination. In order to achieve the desired temperature variations along the microchannel, an outer optimization loop and an inner finite element analysis loop were used to iteratively obtain a near-optimal copper pattern. With a minor loss of generality, admissible forms were restricted to comb-like patterns. For a given temperature profile, the pattern was found by refining a starting guess based on a deterministic rubric. Thermal response was measured using fine thermocouples placed at critical locations along the microchannel wall. At most of these points, the agreement between measured and predicted temperatures was within 1 °C, and temperature gradients as high as ±45 °C mm-1 (equivalent to ±90 °C s-1 at 2 μl min-1 flow rate) were obtained within the range of 59-91 °C. The particular profile chosen for case study makes it possible to perform five cycles of continuous-flow polymerase chain reaction (PCR) in less than 15 s, i.e. it entails five successive cycles of cooling from 91 to 59 °C, rapid reheating from 59 to 73 °C, slow reheating from 73 to 76 °C, and a final reheating from 73 to 91 °C, using a resistively heated source at 100 °C at and a thermoelectrically cooled sink at 5 °C.

  13. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

    OpenAIRE

    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

    1993-01-01

    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  14. Toluene combustion: reaction paths, thermochemical properties, and kinetic analysis for the methylphenyl radical + O2 reaction.

    Science.gov (United States)

    da Silva, Gabriel; Chen, Chiung-Chu; Bozzelli, Joseph W

    2007-09-06

    Aromatic compounds such as toluene and xylene are major components of many fuels. Accurate kinetic mechanisms for the combustion of toluene are, however, incomplete, as they do not accurately model experimental results such as strain rates and ignition times and consistently underpredict conversion. Current kinetic mechanisms for toluene combustion neglect the reactions of the methylphenyl radicals, and we believe that this is responsible, in part, for the shortcomings of these models. We also demonstrate how methylphenyl radical formation is important in the combustion and pyrolysis of other alkyl-substituted aromatic compounds such as xylene and trimethylbenzene. We have studied the oxidation reactions of the methylphenyl radicals with O2 using computational ab initio and density functional theory methods. A detailed reaction submechanism is presented for the 2-methylphenyl radical + O2 system, with 16 intermediates and products. For each species, enthalpies of formation are calculated using the computational methods G3 and G3B3, with isodesmic work reactions used to minimize computational errors. Transition states are calculated at the G3B3 level, yielding high-pressure limit elementary rate constants as a function of temperature. For the barrierless methylphenyl + O2 and methylphenoxy + O association reactions, rate constants are determined from variational transition state theory. Multichannel, multifrequency quantum Rice-Ramsperger-Kassel (qRRK) theory, with master equation analysis for falloff, provides rate constants as a function of temperature and pressure from 800 to 2400 K and 1 x 10(-4) to 1 x 10(3) atm. Analysis of our results shows that the dominant pathways for reaction of the three isomeric methylphenyl radicals is formation of methyloxepinoxy radicals and subsequent ring opening to methyl-dioxo-hexadienyl radicals. The next most important reaction pathway involves formation of methylphenoxy radicals + O in a chain branching process. At lower

  15. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    International Nuclear Information System (INIS)

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.

    1998-01-01

    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  16. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences

    1998-07-01

    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  17. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  18. Purification and characterization of a common soil component which inhibits the polymerase chain reaction.

    Science.gov (United States)

    Watson, R J; Blackwell, B

    2000-07-01

    DNA prepared from soil usually contains a brown-tinted inhibitor of the polymerase chain reaction (PCR) which limits the sensitivity of this technique for specific detection of microorganisms. To localize the inhibitor, soil fractions were tested for their inhibitory effect on the PCR reaction. A highly inhibitory activity, sufficient to account for the inhibition typically exhibited by soil DNA, was found to be tightly associated with the soil microorganism fraction. After cell breakage, the inhibitory material became soluble, and was not separable from DNA by standard purification procedures. A method was derived by which most of the inhibitory material could be selectively solubilized from the microorganism fraction without cell breakage, using successive washes with buffers differing in EDTA concentration. This technique was used to isolate a substance with characteristics suggesting that it is the major PCR inhibitor contaminating DNA purified from soil. It was found to be an organic, water-soluble compound of high molecular weight, and was present in a variety of soil types from different locations. It was found to be distinctly different in its solubility properties from humic and fulvic acids, and also in its FT-IR and NMR spectra. It forms a complex with protein and may inhibit the PCR reaction by an interaction with Taq DNA polymerase.

  19. On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)

    Science.gov (United States)

    Persat, Alexandre; Santiago, Juan

    2008-11-01

    We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.

  20. Effect of duration of fixation on quantitative reverse transcription polymerase chain reaction analyses.

    Science.gov (United States)

    Macabeo-Ong, Maricris; Ginzinger, David G; Dekker, Nusi; McMillan, Alex; Regezi, Joseph A; Wong, David T W; Jordan, Richard C K

    2002-09-01

    Increasingly, there is the need to analyze gene expression in tumor tissues and correlate these findings with clinical outcome. Because there are few tissue banks containing enough frozen material suitable for large-scale genetic analyses, methods to isolate and quantify messenger RNA (mRNA) from formalin-fixed, paraffin-embedded tissue sections are needed. Recovery of RNA from routinely processed biopsies and quantification by the polymerase chain reaction (PCR) has been reported; however, the effects of formalin fixation have not been well studied. We used a proteinase K-salt precipitation RNA isolation protocol followed by TaqMan quantitative PCR to compare the effect of formalin fixation for 24, 48, and 72 hours and for 1 week in normal (2), oral epithelial dysplasia (3), and oral squamous cell carcinoma (4) specimens yielding 9 fresh and 36 formalin-fixed samples. We also compared mRNA and protein expression levels using immunohistochemistry for epidermal growth factor receptor (EGFR), matrix metalloproteinase (MMP)-1, p21, and vascular endothelial growth factor (VEGF) in 15 randomly selected and routinely processed oral carcinomas. We were able to extract RNA suitable for quantitative reverse transcription (RT) from all fresh (9/9) and formalin-fixed (36/36) specimens fixed for differing lengths of time and from all (15/15) randomly selected oral squamous cell carcinoma. We found that prolonged formalin fixation (>48 h) had a detrimental effect on quantitative RT polymerase chain reaction results that was most marked for MMP-1 and VEGF but less evident for p21 and EGFR. Comparisons of quantitative RT polymerase chain reaction and immunohistochemistry showed that for all markers, except p21, there was good correlation between mRNA and protein levels. p21 mRNA was overexpressed in only one case, but protein levels were elevated in all but one tumor, consistent with the established translational regulation of p21. These results show that RNA can be reliably

  1. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    Science.gov (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  2. Modeling methodology for supply chain synthesis and disruption analysis

    Science.gov (United States)

    Wu, Teresa; Blackhurst, Jennifer

    2004-11-01

    The concept of an integrated or synthesized supply chain is a strategy for managing today's globalized and customer driven supply chains in order to better meet customer demands. Synthesizing individual entities into an integrated supply chain can be a challenging task due to a variety of factors including conflicting objectives, mismatched incentives and constraints of the individual entities. Furthermore, understanding the effects of disruptions occurring at any point in the system is difficult when working toward synthesizing supply chain operations. Therefore, the goal of this research is to present a modeling methodology to manage the synthesis of a supply chain by linking hierarchical levels of the system and to model and analyze disruptions in the integrated supply chain. The contribution of this research is threefold: (1) supply chain systems can be modeled hierarchically (2) the performance of synthesized supply chain system can be evaluated quantitatively (3) reachability analysis is used to evaluate the system performance and verify whether a specific state is reachable, allowing the user to understand the extent of effects of a disruption.

  3. Analysis of a complex shape chain plate using Transmission Photoelasticity

    Directory of Open Access Journals (Sweden)

    Dasari N.

    2010-06-01

    -3]. A loading fixture was used to load the model during stress freezing in the furnace. The integrated fringe pattern of the offset chain plate is shown in Figure 2. Slices are cut in the offset zone to understand the nature of the stress distribution. A Simple photoelastic analysis of this has revealed a wealth of information to take suitable decision on the design of such plates taking into account the constraints in manufacturing.

  4. Vibrio cholerae Detection in Water and Wastewater by Polymerase Chain Reaction Assay

    Directory of Open Access Journals (Sweden)

    Behnaz Barzamini

    2014-11-01

    Full Text Available Background: Vibrio cholerae is a significant human pathogen worldwide and annually causes some cases of deaths. Contaminated water plays an important role in transmission of this pathogen, which indicates the importance of early diagnosis. Objectives: The current study aimed to perform Polymerase Chain Reaction (PCR on water and wastewater samples to determine the detection limit for Vibrio cholerae. Materials and Methods: PCR was performed on the DNA extracted from Vibrio cholerae of the contaminated water and wastewater using ctxA gene specific primers. The accuracy of PCR method to detect these bacteria was also assessed. Results: The result of PCR performed on the extracted DNA showed a specific 241 base pair band. The limit of bacterial detection for water and wastewater were 40 cfu/mL and 81 cfu/mL, respectively. Conclusions: In the current study, PCR performance using the ctxA gene specific primers to detect Vibrio cholerae was found highly accurate and specific.

  5. Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis

    Directory of Open Access Journals (Sweden)

    Songelwayo L. Chisi

    2017-09-01

    Full Text Available Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100% diagnostic sensitivity and specificity. Polymerase chain reaction (PCR has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

  6. Multiplex polymerase chain reaction for distinguishing Taylorella equigenitalis from Taylorella equigenitalis-like organisms.

    Science.gov (United States)

    Arata, A B; Cooke, C L; Jang, S S; Hirsh, D C

    2001-05-01

    It is difficult to distinguish isolates of Taylorella equigenitalis, the cause of contagious equine metritis, from a T. equigenitalis-like organism isolated from asymptomatic donkeys and horses. Although T. equigenitalis is responsible for a severe, contagious disease of the reproductive tract of equids, the T. equigenitalis-like organism, although contagious, does not appear to produce disease. Because of the economic consequences of correctly distinguishing isolates of these 2 microorganisms, a polymerase chain reaction (PCR)-based assay was developed that will distinguish isolates of T. equigenitalis from the T. equigenitalis-like microorganism. The primers used in the PCR assay were designed to amplify unique regions of the gene encoding the 16S ribosomal RNA.

  7. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  8. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.

    Science.gov (United States)

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.

  9. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

    Science.gov (United States)

    Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

    2017-04-15

    Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Evaluation of polymerase chain reaction in the routine diagnosis for tegumentary leishmaniasis in a referral centre

    Directory of Open Access Journals (Sweden)

    Aline Fagundes

    2010-02-01

    Full Text Available The present study investigated the diagnostic value of polymerase chain reaction (PCR performed in parallel to conventional methods at an American tegumentary leishmaniasis (ATL referral centre for diagnosis. Accuracy parameters for PCR were calculated using 130 patients with confirmed ATL (ATL group, 15 patients established with other diseases and 23 patients with a lesion suggestive of ATL, but without parasitological confirmation (NDEF group. PCR showed 92.3% sensitivity, 93.3% specificity, a 99.2% positive predictive value and a 13.84 positive likelihood ratio. In the NDEF group, PCR confirmed ATL in 13 of the 23 patients, seven of whom responded to leishmaniasis treatment and six who presented spontaneous healing of the lesion. PCR should be included in the routine diagnostic procedures for ATL, especially for cases found to be negative by conventional methods.

  11. Evaluation of polymerase chain reaction in the routine diagnosis for tegumentary leishmaniasis in a referral centre.

    Science.gov (United States)

    Fagundes, Aline; Schubach, Armando; Paula, Cíntia Cristiane de; Bogio, Alessandra; Antonio, Liliane de Fátima; Schiavoni, Patrícia Botelho; Monteiro, Vivian de Souza; Madeira, Maria de Fátima; Quintella, Leonardo Pereira; Valete-Rosalino, Claudia Maria; Vasconcellos, Erica de Camargo Ferreira e; Azeredo-Coutinho, Rilza Beatriz Gayoso de; Pacheco, Rachel S; Marzochi, Mauro C A; Marzochi, Keyla B F

    2010-02-01

    The present study investigated the diagnostic value of polymerase chain reaction (PCR) performed in parallel to conventional methods at an American tegumentary leishmaniasis (ATL) referral centre for diagnosis. Accuracy parameters for PCR were calculated using 130 patients with confirmed ATL (ATL group), 15 patients established with other diseases and 23 patients with a lesion suggestive of ATL, but without parasitological confirmation (NDEF group). PCR showed 92.3% sensitivity, 93.3% specificity, a 99.2% positive predictive value and a 13.84 positive likelihood ratio. In the NDEF group, PCR confirmed ATL in 13 of the 23 patients, seven of whom responded to leishmaniasis treatment and six who presented spontaneous healing of the lesion. PCR should be included in the routine diagnostic procedures for ATL, especially for cases found to be negative by conventional methods.

  12. Polymerase chain reaction for detection of Ureaplasma diversum from urogenital swabs in cattle in Australia.

    Science.gov (United States)

    Smith, A; Chousalkar, K K; Chenoweth, P C

    2012-07-01

    Ureaplasma diversum has been associated with various reproductive problems in cattle, including granular vulvovaginitis, endometritis, salpingitis, early embryonic death, weak calves, decreased conception rates, balanoprosthitis, impaired spermatozoids and seminal vesiculitis in bulls. This study briefly outlines the use of polymerase chain reaction (PCR) for the rapid detection of U. diversum directly from urogenital swabs collected from Australian beef cattle. The 16S ribosomal RNA gene sequences obtained from the PCR products of the clinical samples were closely related to U. diversum strain A417. The present test enabled detection of the organism directly from clinical swabs collected from animals with or without lesions. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

  13. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  14. Validation study of HPV DNA detection from stained FNA smears by polymerase chain reaction

    DEFF Research Database (Denmark)

    Channir, Hani Ibrahim; Larsen, Christian Grønhøj; Ahlborn, Lise Barlebo

    2016-01-01

    BACKGROUND: Human papillomavirus (HPV)-related oropharyngeal squamous cell carcinoma (OPSCC) often presents with cystic cervical metastasis and a small primary tumor localized in the palatine tonsils or base of the tongue, which is diagnostically challenging. Testing for HPV DNA in fine......-needle aspiration (FNA) smears from metastases may facilitate a targeted diagnostic workup for identifying the primary tumor. This study was designed to assess the ability to detect HPV DNA in FNA smears with polymerase chain reaction (PCR). METHODS: May-Grünvald-Giemsa (MGG)-stained FNA smears from metastases...... and corresponding surgical specimens were collected from 71 patients with known HPV-positive OPSCC, 12 patients with oral squamous cell carcinoma (OSCC), 20 patients with branchial cleft cysts, and 20 patients with Warthin tumors. Thirty-eight patients with OPSCC and 7 patients with OSCC had FNA smears available...

  15. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  16. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  17. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  18. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Directory of Open Access Journals (Sweden)

    Seiki Kuramitsu

    2013-03-01

    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  19. Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

    Science.gov (United States)

    Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

    2017-09-27

    Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

  20. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis

    Directory of Open Access Journals (Sweden)

    Padmavathy L

    2003-05-01

    Full Text Available Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patients with various types of cutaneous tuberculosis were subjected to PCR. Results: An overall positivity of 64% was observed, which is comparable to other series. Seventy five percent of lupus vulgaris cases, 62.2% of tuberculosis verrucosa cutis and 50% of scrofuloderma cases showed PCR positivity. Conclusion: Though useful, the cost and the technique involved limit the use of PCR in developing countries like ours.

  1. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    A total of 280 persons were HLA-DQA1 typed by two different polymerase chain reaction (PCR) based methods; (i) a reverse dot-blot (RDB) method, which can differentiate between six alleles, and (ii) a combined PCR-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification...... (ASA) method, which together recognise eight alleles. In 146 unrelated Danish individuals, the HLA-DQA1 alleles were in Hardy-Weinberg equilibrium. For identity testing, the power of discrimination (PD) of HLA-DQA1 was 0.932 with the RDB method and 0.942 with the PCR-RFLP/ASA method. For paternity...... testing, the theoretical chance of exclusion in HLA-DQA1 of non-fathers was 0.634 with the RDB method and 0.660 with the PCR-RFLP/ASA method....

  2. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction.

    Science.gov (United States)

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F

    2017-01-01

    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment.

  3. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

    2005-01-01

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  4. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  5. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  6. [The intratypic characterization of the poliovirus by the polymerase chain reaction technic].

    Science.gov (United States)

    Avalos Redón, I; Más Lago, P J; Sarmiento Pérez, L R; Palomera Puente, R; Muné Jiménez, M; Bello Corredor, M; Pérez Santos, L

    1998-01-01

    The polymerase chain reaction techniques was introduced for the intratypic characterization of Poliovirus. Primers were used only to promote the amplification of the Sabin vaccine strains proved by electrophoretic run of the amplified DNA products (Sabin 1-97 pb, Sabin 2-71 pb, Sabin 3-44 pb) and whose specificity was satisfactorily verified. 23 Cuban poliovirus strains isolated and identified at the Laboratory of Enterovirus of the "Pedro Kourí" Tropical Medicine Institute from 1993 to 1994 were studied by this technique. All of them were of the vaccine type. It was observed how the Sabin vaccine poliovirus may be the cause of viral meningoencephalitis as a milder neurological complication. This study provided one more evidence about the non circulation of the wild poliovirus in Cuba.

  7. IDENTIFICATION OF MYCOBACTERIUM GENAVENSE IN A DIANA MONKEY (CERCOPITHECUS DIANA) BY POLYMERASE CHAIN REACTION AND HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY.

    Science.gov (United States)

    Kelly, Kathleen M; Wack, Allison N; Bradway, Dan; Simons, Brian W; Bronson, Ellen; Osterhout, Gerard; Parrish, Nicole M; Montali, Richard J

    2015-06-01

    A 25-yr-old Diana monkey (Cercopithecus diana) with a 1.5-yr history of chronic colitis and diarrhea was found to have disseminated granulomatous disease with intralesional acid fast bacilli. Bacilli were identified as Mycobacterium genavense by polymerase chain reaction, sequencing of the 16S-23S ribosomal RNA intergenic spacer (ITS) gene, and mycolic acid analysis by high-performance liquid chromatography. Mycobacterium genavense is a common cause of mycobacteriosis in free-ranging and captive birds. In addition, recognition of opportunistic infection in human immunodeficiency virus-positive patients is increasing. Disease manifestations of M. genavense are similar to Mycobacterium avium complex (MAC) and include fever, wasting, and diarrhea with disseminated disease. Similar clinical signs and lesions were observed in this monkey. Mycobacterium genavense should be considered as a differential for disseminated mycobacterial disease in nonhuman primates as this agent can mimic MAC and related mycobacteria.

  8. Stochastic flux analysis of chemical reaction networks.

    Science.gov (United States)

    Kahramanoğulları, Ozan; Lynch, James F

    2013-12-07

    Chemical reaction networks provide an abstraction scheme for a broad range of models in biology and ecology. The two common means for simulating these networks are the deterministic and the stochastic approaches. The traditional deterministic approach, based on differential equations, enjoys a rich set of analysis techniques, including a treatment of reaction fluxes. However, the discrete stochastic simulations, which provide advantages in some cases, lack a quantitative treatment of network fluxes. We describe a method for flux analysis of chemical reaction networks, where flux is given by the flow of species between reactions in stochastic simulations of the network. Extending discrete event simulation algorithms, our method constructs several data structures, and thereby reveals a variety of statistics about resource creation and consumption during the simulation. We use these structures to quantify the causal interdependence and relative importance of the reactions at arbitrary time intervals with respect to the network fluxes. This allows us to construct reduced networks that have the same flux-behavior, and compare these networks, also with respect to their time series. We demonstrate our approach on an extended example based on a published ODE model of the same network, that is, Rho GTP-binding proteins, and on other models from biology and ecology. We provide a fully stochastic treatment of flux analysis. As in deterministic analysis, our method delivers the network behavior in terms of species transformations. Moreover, our stochastic analysis can be applied, not only at steady state, but at arbitrary time intervals, and used to identify the flow of specific species between specific reactions. Our cases study of Rho GTP-binding proteins reveals the role played by the cyclic reverse fluxes in tuning the behavior of this network.

  9. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  10. Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2015-12-01

    Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber

  11. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

    Science.gov (United States)

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

    2016-08-24

    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    International Nuclear Information System (INIS)

    Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian

    2012-01-01

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

  13. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: ruark@126.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: zhouximi@yahoo.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)

    2012-03-09

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  14. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    Science.gov (United States)

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  15. Global Carbon Fiber Composites Supply Chain Competitiveness Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Sujit Das, Josh Warren, Devin West, Susan M. Schexnayder

    2016-05-01

    This analysis identifies key opportunities in the carbon fiber supply chain where resources and investments can help advance the clean energy economy. The report focuses on four application areas — wind energy, aerospace, automotive, and pressure vessels — that top the list of industries using carbon fiber and carbon fiber reinforced polymers. For each of the four application areas, the report addresses the supply and demand trends within that sector, supply chain, and costs of carbon fiber and components.

  16. [Usefulness of Helicobacter pylori detection from feces specimens of the patients with peptic ulcer by polymerase chain reaction].

    Science.gov (United States)

    Kurokawa, M; Minamide, M; Nukina, M; Nakanishi, H; Miki, K; Tomita, S; Tohdo, A; Haruta, T

    1997-11-01

    Detection of Helicobacter pylori was studied on the feces and biopsy specimens of 91 patients with gastric ulcer by using cultured and polymerase chain reaction methods. Number of samples from feces and biopsy specimens were 1 (1.1%) and 56 (61.5%) by culture method, on the other hands 49 (53.8%) and 70 (76.9%) in polymerase chain reaction method, respectively. Sensitivity of polymerase chain reaction applied to feces and biopsy specimens were 68.1 and 97.2, respectively. Noninvasive diagnosis such as detection of organisms from feces is effective for patients who have difficulty in collecting the gastric biopsy specimens. Infection route was not clarified, however, fecal-to-oral transmission was strongly suggested by the fact that the organisms were detected from feces samples in this study.

  17. Detection of genital human papillomaviruses by polymerase chain reaction amplification with degenerate nested primers.

    Science.gov (United States)

    Williamson, A L; Rybicki, E P

    1991-03-01

    Degenerate oligonucleotide primers were designed for in vitro amplification by polymerase chain reaction (PCR) of a relatively well-conserved portion of the L1 capsid protein gene of genital human papillomaviruses. A specific 441bp fragment was amplified by PCR from genomic clones and clinical biopsy specimens containing DNA from HPV types 6, 11, 16, 18, 31, and 33, as well as from a number of other clinical specimens known to contain unclassified HPV isolates. As some HPV non-specific DNA was also often amplified, another set of degenerate primers was designed which amplified a 335 bp sequence contained within the 441 bp sequence. These nested primers could be used in a two-stage PCR reaction to obtain distinct HPV-specific DNA fragments suitable for direct sequencing. Two-stage PCR was used to demonstrate the presence of HPV DNA in 13 out of 16 biopsies, which had been classified histologically as cervical intraepithelial neoplasia (CIN), but which were negative for HPV on Southern blot hybridization. Seven of these amplification products were sequenced, and one proved to be a previously unsequenced HPV type. The results have important implications for the routine detection and typing of genital and other HPV types in clinical samples.

  18. Reaction pathway towards formation of cobalt single chain magnets and nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)

    2010-03-15

    With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.

  19. Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

    Directory of Open Access Journals (Sweden)

    Zhouli Wang

    Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

  20. Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

    Science.gov (United States)

    Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

    2017-05-01

    The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. New paradigm for simplified combustion modeling of energetic solids: Branched chain gas reaction

    Energy Technology Data Exchange (ETDEWEB)

    Brewster, M.Q.; Ward, M.J. [Univ. of Illinois, Urbana, IL (United States); Son, S.F. [Los Alamos National Lab., NM (United States)

    1997-09-01

    Two combustion models with simple but rational chemistry are compared: the classical high gas activation energy (E{sub g}/RT {much_gt} 1) Denison-Baum-Williams (DBW) model, and a new low gas activation energy (E{sub g}/RT {much_lt} 1) model recently proposed by Ward, Son, and Brewster (WSB). Both models make the same simplifying assumptions of constant properties, Lewis number unity, single-step, second order gas phase reaction, and single-step, zero order, high activation energy condensed phase decomposition. The only difference is in the gas reaction activation energy E{sub g} which is asymptotically large for DBW and vanishingly small for WSB. For realistic parameters the DBW model predicts a nearly constant temperature sensitivity {sigma}{sub p} and a pressure exponent n approaching 1. The WSB model predicts generally observed values of n = 0.7 to 0.9 and {sigma}{sub p}(T{sub o},P) with the generally observed variations with temperature (increasing) and pressure (decreasing). The WSB temperature profile also matches measured profiles better. Comparisons with experimental data are made using HMX as an illustrative example (for which WSB predictions for {sigma}{sub p}(T{sub o},P) are currently more accurate than even complex chemistry models). WSB has also shown good agreement with NC/NG double base propellant and HNF, suggesting that at the simplest level of combustion modeling, a vanishingly small gas activation energy is more realistic than an asymptotically large one. The authors conclude from this that the important (regression rate determining) gas reaction zone near the surface has more the character of chain branching than thermal decomposition.

  2. Modification of soy protein hydrolysates by Maillard reaction: Effects of carbohydrate chain length on structural and interfacial properties.

    Science.gov (United States)

    Li, Weiwei; Zhao, Haibo; He, Zhiyong; Zeng, Maomao; Qin, Fang; Chen, Jie

    2016-02-01

    This study investigated the effects of carbohydrate chain length on the structural and interfacial properties of the Maillard reaction conjugates of soy protein hydrolysates (Mw>30 kDa). The covalent attachment of sugars to soy peptides was confirmed by amino acid analysis and examination of the Fourier-transform infrared spectra. The results suggested that the emulsion stability of the conjugates increased as the length of the carbohydrate chains increased. The surface activity measurement revealed that the soy peptide-dextran conjugates were closely packed and that each molecule occupied a small area of the interface. It was further confirmed that the soy peptide-dextran conjugates formed a thick adsorbed layer at the oil-water interface, as observed in the confocal laser scanning micrographs. The interfacial layer of soy peptides was rheologically complex with broad linear viscoelastic region and strong elastic modulus, and the soy peptide-dextran conjugates might form multilayer adsorption at the interface. This study suggested that the improved surface properties of the soy peptide-dextran conjugates were a result of the strong membrane formed by the closely packed molecular and multilayer adsorption at the interface, which provided steric hindrance to flocculation. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select......A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control...

  4. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    Science.gov (United States)

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  5. VALUE CHAIN AND SWOT ANALYSIS OF THE MANITOBA ...

    African Journals Online (AJOL)

    babatunde Nuga

    The Value chain analysis identified production, harvesting, processing and storage, transportation, and marketing, as the main subjects in value addition. Identifying the. Strengths, Weaknesses, Opportunities and Threats (SWOT analysis) of the sector is a .... It is therefore important for the means to achieving prompt.

  6. Isolation and identification of Dichelobacter nodosus and Fusobacterium necrophorum using the polymerase chain reaction method in sheep with footrot

    Directory of Open Access Journals (Sweden)

    Ediz Kagan Ozgen

    2015-01-01

    Full Text Available Footrot is an important infectious disease of small ruminants leading to severe economical losses. The aim of the present study was to determine isolation and identification rates of Dichelobacter nodosus and Fusobacterium necrophorum in the culture techniques and reveal the specificity and sensitivity of the culture technique based on the polymerase chain reaction (PCR method in sheep with footrot. Dry swabs and swabs with Amies medium from 83 sheep were subjected to PCR and culture analyses. In dry swabs, 4 samples were positive for F. necrophorum and all were negative for D. nodosus. Colonies in Eugon and Fusobacterium selective agars from swabs with Amies medium were evaluated. Polymerase chain reaction analysis was conducted on macroscopically and microscopically unidentified samples. The positivity rate was 55.4% for D. nodosus and 69.8% for F. necrophorum in cultures from Fusobacterium selective agars. The positivity rate for D. nodosus in Fusobacterium selective agars was higher than that in Eugon agar. Performing PCR and culture methods increased positivity as compared to performing them alone. In comparison with the PCR method, culturing in Fusobacterium selective agars had moderate sensitivity and low specificity for D. nodosus (71.7 and 28.7% and F. necrophorum (61.3 and 80.0%, respectively. In conclusion, Fusobacterium selective agar (without antibiotics for isolation and identification of D. nodosus is superior to Eugon agar. Fusobacterium necrophorum should also be considered as a provoking agent for footrot in small ruminants. The PCR method on culture increases elucidation of definitive aetiology.

  7. Identification of a new genetic marker in Mycoplasma synoviae vaccine strain MS-H and development of a strategy using polymerase chain reaction and high-resolution melting curve analysis for differentiating MS-H from field strains.

    Science.gov (United States)

    Zhu, Ling; Konsak, Barbara M; Olaogun, Olusola M; Agnew-Crumptona, Rebecca; Kanci, Anna; Marenda, Marc S; Browning, Glenn F; Noormohammadi, Amir H

    2017-10-01

    Mycoplasma synoviae (MS) is an economically important avian pathogen worldwide, causing subclinical respiratory tract infection and infectious synovitis in chickens and turkeys. A temperature-sensitive (ts + ) live attenuated vaccine MS-H, derived from the Australian field strain 86079/7NS, is now widely used in many countries to control the disease induced by MS. Differentiation of MS-H vaccine from field strains is crucial for monitoring vaccination programs in commercial poultry. Comparison of genomic sequences of MS-H and its parent strain revealed an adenine deletion at nucleotide position 468 of the MS-H oppF-1 gene. This mutation was shown to be unique to MS-H in further comparative analyses of oppF-1 genes of MS-H re-isolates and field strains from Australia and other countries. Based on this single nucleotide, a combination of nested PCR and high-resolution melting (HRM) curve analysis was used to evaluate its potential for use in differentiation of MS-H from field strains. The mean genotype confidence percentages of 99.27 and 48.20 for MS-H and field strains, respectively, demonstrated the high discriminative power of the newly developed assay (oppF PCR-HRM). A set of 13 tracheal swab samples collected from MS-H vaccinated specific pathogen free birds and commercial chicken flocks infected with MS were tested using the oppF PCR-HRM test and results were totally consistent with those obtained using vlhA genotyping. The nested-PCR HRM method established in this study proved to be a rapid, simple and cost effective tool for discriminating the MS-H vaccine strain from Australian and international strains in pure cultures and on tracheal swabs. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Stakeholder Analysis for Farmer inclusive Value chain Development in Mango

    Directory of Open Access Journals (Sweden)

    Nadhika K

    2017-12-01

    Full Text Available Mango is being cultivated over a substantial area in Palakkad District of Kerala state. Being one of the significant agricultural commodity value chains existing in Kerala, the mango value chain of Palakkad district needs urgent attention to improve its performance. The study highlights the stakeholder analysis and SWOC matrix analysis of the mango sector. Stakeholders were asked to identify the strengths, weaknesses, opportunities and challenges in the mango sector. Based on the highest score obtained, four strategic options viz., enhancing value addition and product development, promotion of branding, educating the farmers on building competitiveness and increasing export potential by addressing quality parameters were identified.

  9. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    Science.gov (United States)

    Rocke, Tonie E.; Smith, Susan R.; Miyamoto, Amy; Shadduck, Daniel J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  10. Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

  11. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-04-01

    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  12. The neutrino interaction analysis chain in OPERA

    CERN Document Server

    Rescigno, Regina

    Th e aim of the OPERA experiment i s to provide a “smoking - gun” proof of neutrino oscillation s, through the detecti on of the appearance signal of ν τ ’s in an initially pure ν μ beam. The beam is produced at CERN, 732 Km fa r from the detector , which is located underground in t he Gran Sasso laboratory. The evidence of the appearance signal will be provided by the detection of the daughter particles produced in the decay of the τ lepton. A micro - metric spatial resolution is needed in order to measure a nd study the topology of the ν τ - induced events. With this goal, n uclear emulsions, the highest resolution tracking detector , were chosen to be the core of the OPERA apparatus. The analysis of the large amount of nuclear emulsions used in the OPERA experime n t has required the development of a new generation of fast automatic mi croscopes , featuring a scanning speed more than one order of magnitude hi g h er than in p...

  13. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  14. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot hybrid...

  15. Whole Blood Polymerase Chain Reaction in a Neonate with Disseminated Herpes Simplex Virus Infection and Liver Failure

    Directory of Open Access Journals (Sweden)

    Jennifer A. Scoble

    2013-10-01

    Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.

  16. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...

  17. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  18. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...

  19. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

  20. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR-BM). M...

  1. Development and application of a hexaplex reverse transcription polymerase chain reaction for screening global Citrus tristeza virus isolates

    Science.gov (United States)

    The discovery of the diversity of Citrus tristeza virus (CTV) genotypes has complicated detection and diagnostic measures. To simplify the identification and differentiation of CTV genotypes, an efficient multiplex reverse transcription polymerase chain reaction (M-RT-PCR) technique for the screenin...

  2. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  3. Analysis of serum free light chains by crossed immunoelectrophoresis: comparison with urinary light chains in light chain disease.

    Science.gov (United States)

    McLeod, B C; Viernes, A; Kyle, R A; Sassetti, R J

    1984-10-01

    We investigated the relationship between serum free light chain levels measured by crossed immunoelectrophoresis in ten patients with light chain disease and traditional 24-hour urinary light chains in the same patients. The crossed immunoelectrophoresis test requires only a venipuncture for specimen acquisition, can be completed within 24 hours, and has a reproducibility (+/- 14%) comparable with that of other immunoprecipitin techniques. Twenty-eight serum-urine pairs, representing 18 discrete intervals, were analyzed. There was a close relationship between changes in serum and urine light chain levels, with a correlation coefficient of .77 or .93, depending on the method of calculation. This suggests that serum light chain levels measured by crossed immunoelectrophoresis would be equivalent to urinary light chain levels as indicators of tumor burden. Monitoring serum levels would have the advantage of greatly simplified specimen acquisition. In patients with renal failure, serum light chain levels should be a superior indicator of light chain synthesis.

  4. Phases for the value chain design and analysis in organizations

    Directory of Open Access Journals (Sweden)

    Emilio García Vega

    2015-09-01

    Full Text Available Value generation is a key issue in the management of organizations because it allows the consumer satisfaction, dynamic face of competition and reward the owners or shareholders. Its treatment reflects both the academic and the business world; i.e. teachers, researchers, executives and managers of the enterprises, whether they are micro, small, medium or large. Although there are different approaches to the subject, this paper will seek to develop an approach from a competitive perspective and through the value chain, as it can be considered a valid tool for designing and analysing how organizations generate value. Also, this research tries to present the evolution of the generation of value, based on the classical models of McKinsey & Co. and Michael Porter. Then some approaches and contributions to the value chain of different authors and from different perspectives are presented, so that we can count with a number of additional ideas, which the author considers relevant to face the value chain design and analysis. Finally, on the basis of capital contribution of the mentioned Harvard University Professor, a series of recommendations for the strategic application of the value chain in the management of today's organizations, which are organized into nine phases (phases for the design and analysis of the value chain are presented.

  5. Hybrid modeling and empirical analysis of automobile supply chain network

    Science.gov (United States)

    Sun, Jun-yan; Tang, Jian-ming; Fu, Wei-ping; Wu, Bing-ying

    2017-05-01

    Based on the connection mechanism of nodes which automatically select upstream and downstream agents, a simulation model for dynamic evolutionary process of consumer-driven automobile supply chain is established by integrating ABM and discrete modeling in the GIS-based map. Firstly, the rationality is proved by analyzing the consistency of sales and changes in various agent parameters between the simulation model and a real automobile supply chain. Second, through complex network theory, hierarchical structures of the model and relationships of networks at different levels are analyzed to calculate various characteristic parameters such as mean distance, mean clustering coefficients, and degree distributions. By doing so, it verifies that the model is a typical scale-free network and small-world network. Finally, the motion law of this model is analyzed from the perspective of complex self-adaptive systems. The chaotic state of the simulation system is verified, which suggests that this system has typical nonlinear characteristics. This model not only macroscopically illustrates the dynamic evolution of complex networks of automobile supply chain but also microcosmically reflects the business process of each agent. Moreover, the model construction and simulation of the system by means of combining CAS theory and complex networks supplies a novel method for supply chain analysis, as well as theory bases and experience for supply chain analysis of auto companies.

  6. Molecular typing for blood group antigens within 40 min by direct polymerase chain reaction from plasma or serum.

    Science.gov (United States)

    Wagner, Franz F; Flegel, Willy A; Bittner, Rita; Döscher, Andrea

    2017-03-01

    Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fy a , Fy b , Jk a and Jk b antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. © 2016 John Wiley & Sons Ltd.

  7. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2007-01-23

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  8. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2017-01-01

    Full Text Available Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

  9. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2014-10-01

    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  10. Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler

    Directory of Open Access Journals (Sweden)

    Chan-Young Park

    2016-10-01

    Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.

  11. Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Stephen Duffett

    2012-01-01

    Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

  12. Quantitative polymerase chain reaction: another tool to evaluate viable virus content in live attenuated orf vaccine

    Directory of Open Access Journals (Sweden)

    Durlav Prasad Bora

    2012-12-01

    Full Text Available A probe-based real-time polymerase chain reaction (PCR assay based on the highly conserved DNA polymerase gene of orf virus (ORFV for the quality control of attenuated orf vaccine is reported. Primary lamb testis (PLT cells were infected with orf vaccine virus and harvested at a critical time point to obtain maximum viable virus content as determined by real-time PCR. DNA extracted from these harvests was subjected to real-time PCR. A critical time point for the harvesting of PLT cells infected with various log10 dilutions of vaccine virus was found to be 42 h (highest slope of 3.335, which was obtained by comparing the slopes of standard curves of different time intervals. The assay was employed to evaluate viable virus content in different batches of orf vaccine. The titres estimated by real-time PCR and conventional TCID50 were comparable with a correlation of 0.8169. Thus, the real-time PCR assay could provide an alternative method or supplementary tool to estimate live ORFV particles in attenuated orf vaccine.

  13. Utility of polymerase chain reaction for detection of Mycobacterium tuberculosis in suspected cases of tuberculosis lymphadenopathy

    Directory of Open Access Journals (Sweden)

    Khushpreet Kaur

    2016-01-01

    Full Text Available Introduction: There is a need for a rapid and cost-effective technique for reliable diagnosis of tubercular lymphadenopathy, particularly in low-resource setting. In this study, we have used various diagnostic techniques including polymerase chain reaction (PCR to diagnose clinically suspected cases of tubercular lymphadenopathy and compared the results to see which of the techniques are more sensitive, specific, and cost-effective. Materials and Methods: All patients having swelling in the neck, axillary, and inguinal regions were recruited for the study. Sputum for acid-fast Bacillus (AFB, fine-needle aspiration cytology, excision biopsy, DNA-PCR, AFB smear of the same material was done as per standard protocol. Results: 32% patients have granulomas with necrosis, whereas 30% have acute suppurative lesions and 24% and 14% patients were having only granulomas and only necrosis, respectively. A significant difference was observed between the PCR-negative and positive cases with respect to their cytomorphologic features. Positive AFB and tuberculosis-PCR (TB-PCR results were significantly more common in the cases with chronic granulomatous inflammation in comparison to the cases showing chronic inflammation only. Sensitivity and specificity of TB-PCR were found to be 71.4% and 28.4%, respectively. Conclusion: PCR is a sensitive and rapid technique in the demonstration of Mycobacterium tuberculosis. It should be done in clinically suspected patients of tuberculous lymphadenopathy when their AFB stain is even negative.

  14. Non-radioactive DNA probe and polymerase chain reaction procedures for the specific detection of Acanthamoeba.

    Science.gov (United States)

    Lai, S; Asgari, M; Henney, H R

    1994-02-01

    Acanthamoebae are potential pathogens which can cause serious infections of humans. A non-radioactive rDNA probe and polymerase chain reaction (PCR) amplification procedures which are specific, rapid, sensitive and safe for the detection of Acanthamoeba have been developed. A restriction fragment (126 bp; ArDNA-a) from a variable region of the cloned 26S rDNA unit of Acanthamoeba castellanii (from plasmid pAR2) was labelled by biotinylation. Cells and DNAs were incubated with the labelled rDNA probe to define conditions providing the highest hybridization specificity for Acanthamoeba by both colorimetric and chemiluminescent assays. Four recent isolates of Acanthamoeba, Acanthamoeba polyphaga, various bacteria, Herpes simplex virus, other eukaryotic amoebae and human cell lines, were sources of DNA for testing. The rDNA probe was found to be highly specific for Acanthamoeba and is capable of directly detecting about 250 cells without prior DNA purification. PCR primers for this unique ArDNA-a fragment have also been designed. Amplification of the targeted sequence by PCR using those primers yielded a single product which was specifically generated for Acanthamoeba template DNA and not DNA from the other control cells. This PCR procedure provided increased sensitivity with the direct detection of as few as 10 Acanthamoeba cells.

  15. Improved Multiplex Polymerase Chain Reaction for Rapid Staphylococcus Aureus Detection in Meat and Milk Matrices

    Directory of Open Access Journals (Sweden)

    Šramková Zuzana

    2016-06-01

    Full Text Available Staphylococcal food poisoning represents one of the most frequently occurring intoxications, caused by staphylococcal enterotoxins (SE-s and staphylococcal enterotoxin-like proteins (SEl-s. Therefore, there is a need for rapid, sensitive and specific detection method for this human pathogen and its toxin genes in food matrices. The present work is focused on Staphylococcus aureus detection by a nonaplex polymerase chain reaction, which targets the 23S rRNA gene for identification of S. aureus at the species level, genes for classical SE-s (SEA, SEC, SED, new SE-s (SEH, SEI, SEl-s (SEK, SEL and tsst-1 gene (toxic shock syndrome toxin. Primers were properly designed to avoid undesirable interactions and to create a reliably identifiable profile of amplicons when visualized in agarose gel. According to obtained results, this approach is able to reach the detection sensitivity of 12 colony forming units from milk and meat matrices without prior culturing and DNA extraction.

  16. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Lai-yu Kwok

    Full Text Available The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  17. Differentiation of Naegleria fowleri and other Naegleriae by polymerase chain reaction and hybridization methods.

    Science.gov (United States)

    Sparagano, O

    1993-07-01

    In order to detect and identify Naegleria fowleri strains an assay based on the Polymerase Chain Reaction (PCR) was evaluated. The amplified DNA fragments were detected by gel electrophoresis and ethidium bromide staining, followed by Southern blot hybridization with an internal digoxigenin-labeled probe. A set of primers (B1B2) which flank a 678-bp region within a virulence-associated gene, allowed for the highly specific identification of N. fowleri, since Naegleriae (N. lovaniensis, N. australiensis, N. gruberi, N. andersoni and N. jadini) and other Protozoa did not react. These primers did not detect amplification products from various organisms: Gram-positive bacteria, Gram-negative bacteria, algae, yeasts and human DNA. Whereas a second set of primers (A1A2), which flank a different sequence, detected various Naegleriae and Acanthamoebae strains. After 40 amplification cycles, the limit of detection was a single cell (cyst or trophozoite). Thus, the PCR appears to be a rapid and powerful tool for identification and detection of N. fowleri.

  18. Introduction of a dermatophyte polymerase chain reaction assay to the diagnostic mycology service in Scotland.

    Science.gov (United States)

    Alexander, C L; Shankland, G S; Carman, W; Williams, C

    2011-05-01

    Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  19. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  20. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    Dolapci, Istar; Tekeli, Alper; Ozsan, Murat; Elhan, Atilla; Yaman, Onder; Ergin, Sureyya

    2005-01-01

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  1. Detection of helicobacter pylori in benign laryngeal lesions by polymerase chain reaction: a cross sectional study

    Directory of Open Access Journals (Sweden)

    Izadi Farzad

    2012-04-01

    Full Text Available Abstract Background Although Helicobacter Pylori (HP was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR. By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR. Methods The samples were taken from 55 patients with benign laryngeal lesions and frozen in −20°C. One milliliter (ml of lysis buffer was added to 100 mg (mg of each sample and the tube was placed in 56°C overnight. Then DNA extraction was carried out. Results To find HP DNA, in-house PCR was performed that revealed 5 positive results among 55 patients with benign laryngeal lesions. Of them, 3 were polyp, 1 was nodule and 1 was papilloma. Conclusion Although the number of positive results was not a lot in this study, it was in contrast with previous studies which could not find any HP tracks in benign laryngeal lesions by other methods. More studies about the prevalence of HP in benign laryngeal lesions improve judging about the effect of this infection on benign laryngeal lesions.

  2. Performance of an HF chain-reaction laser with high initiation efficiency

    International Nuclear Information System (INIS)

    Whittier, J.S.; Kerber, R.L.

    1974-01-01

    Output-pulse observations are presented for a transverse electrically initiated, helium-diluted HF laser pumped by the H 2 + F 2 chain reaction. Performance of this laser is studied over a wide range of the gas composition and for initial pressures between 0.1 and 0.5 atm. The gas mixture was stabilized by premixing O 2 , F 2 , and He and flowing this mixture into a cold trap (84 0 K) before mixing with H 2 . Optimum conversion of electrical-initiation energy into laser energy was found for a 240-torr mixture with a mole ratio 1 F 2 :0.23 H 2 :0.08 O 2 :12 He which, when initiated with a 25-kV, 333-pF discharge, gave a pulse energy of 0.150 J. This corresponds to a ratio of laser output energy to electrical input energy of 144 percent. After unnecessary losses are taken into account, this ratio becomes 160 percent. (U.S.)

  3. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  4. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification.

    Science.gov (United States)

    Baransel, Aysun; Dulger, Hikmet E; Tokdemir, Mehmet

    2004-06-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5'-CGCGCCGG-3' and 5'-TGCCGAGCTG-3') and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers.

  5. Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

    Science.gov (United States)

    Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

    2015-01-01

    The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

  6. Quality of sputum in the performance of polymerase chain reaction for diagnosis of pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Rosemeri Maurici da Silva

    Full Text Available SETTING: faster alternative techniques are required to improve the diagnosis and control of pulmonary tuberculosis. OBJECTIVE: To evaluate the sample quality in the performance of PCR for diagnosis of pulmonary tuberculosis. METHOD: during one year, sputum samples were collected from 72 pulmonary tuberculosis patients and 12 non-tuberculosis controls, which were admitted to the Nereu Ramos hospital, Florianópolis city, Brazil. The samples were subjected to Ziehl-Neelsen-stained sputum smear microscopy and Lowestein-Jensen medium culture, which were defined as gold standard tests for mycobacteria, and polymerase chain reaction (PCR. Those samples that presented more than 40% of viable cells and less than 25% of epithelial cells were defined as high quality samples. RESULTS: PCR showed sensitivity of 55.6%, specificity of 41.7%, positive predictive value of 85.1%, negative predictive value of 13.5%, and accuracy of 53.6%. High quality samples showed sensitivity of 72.4%, specificity of 50%, positive predictive value of 91.3%, negative predictive value of 20%, and accuracy of 69.7%. Low quality samples showed sensitivity of 44.2%, specificity of 37.5%, positive predictive value of 79.2%, negative predictive value of 11.1%, and accuracy of 43.1%. CONCLUSION: use of high quality samples improved significantly the PCR performance, especially on their sensitivity and positive predictive values.

  7. Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol

    Directory of Open Access Journals (Sweden)

    Elisabetta Di Giannatale

    2010-03-01

    Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.

  8. Utility of Real-Time Quantitative Polymerase Chain Reaction in Detecting Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Zhongquan Lv

    2017-01-01

    Full Text Available This study aimed to assess the value of real-time quantitative polymerase chain reaction (RT-qPCR for the detection of Mycobacterium tuberculosis (MTB. Samples from 192 patients with suspected MTB were examined by RT-qPCR and an improved Löwenstein–Jensen (L-J culture method. To evaluate the diagnostic usefulness of RT-qPCR in detecting MTB, a receiver operating characteristic (ROC curve for RT-qPCR was generated, and the area under the curve (AUC as well as a cutoff value was calculated. Using the L-J culture method as the gold standard, accuracy of the RT-qPCR method for detecting MTB was 92.7%, with sensitivity and specificity of 62.5% and 97.02%, respectively. In comparison with the improved L-J culture method, the AUC of RT-qPCR ROC curve was 0.957, which was statistically significant (p<0.001. The Youden Index reached the maximum value (0.88 for gene copy number of 794.5 IU/mL, which was used as the cutoff value. RT-qPCR detection of MTB yielded results consistent with those of the improved L-J culture method, with high accuracy. RT-qPCR may be used as an auxiliary method for etiological diagnosis of tuberculosis.

  9. Real-time polymerase chain reaction in the diagnosis of acute postoperative endophthalmitis.

    Science.gov (United States)

    Joseph, Cornelia Reena; Lalitha, Prajna; Sivaraman, Kavitha R; Ramasamy, Kim; Behera, Umesh Chandra

    2012-06-01

    To evaluate the efficacy of quantitative real-time polymerase chain reaction (qPCR) in the diagnosis of postoperative bacterial endophthalmitis among patients who underwent cataract surgery at a tertiary care center. Prospective experimental study. This was a single-center study of 64 eyes of 64 patients presenting with clinical signs and symptoms of endophthalmitis within 1 year of cataract surgery. Patients with glaucoma filtering or cornea surgery in the past year, postoperative trauma, fungal endophthalmitis, or preoperative inflammatory conditions were excluded. Vitreous samples were obtained during vitreous tap or vitrectomy and sent for both culture and qPCR with sequencing. Vitreous samples obtained from 50 patients undergoing vitrectomy for noninflammatory indications served as controls. The main outcome measures were the sensitivity of qPCR compared to culture and concordance of results of pathogen identification with sequencing vs phenotypic speciation. qPCR detected 16s bacterial DNA in 37 patients (66%), compared to 19 (34%) with traditional culture. Only 1 patient had a positive result by culture (Nocardia species) but negative result by qPCR. For the 18 samples positive by both qPCR and culture, there was a 100% concordance in pathogen identification between sequencing and phenotypic speciation. In cases of suspected bacterial endophthalmitis, qPCR offers an improved diagnostic yield and may be a useful adjunct to traditional culture. Further large-scale clinical studies are needed to elucidate the full clinical utility of qPCR. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. A quantitative real-time polymerase chain reaction assay for the seagrass pathogen Labyrinthula zosterae.

    Science.gov (United States)

    Bergmann, Nina; Fricke, Birgit; Schmidt, Martina C; Tams, Verena; Beining, Katrin; Schwitte, Hildegard; Boettcher, Anne A; Martin, Daniel L; Bockelmann, Anna-Christina; Reusch, Thorsten B H; Rauch, Gisep

    2011-11-01

    The protist Labyrinthula zosterae (Phylum Bigyra, sensu Tsui et al. 2009) has been identified as a causative agent of wasting disease in eelgrass (Zostera marina), of which the most intense outbreak led to the destruction of 90% of eelgrass beds in eastern North America and western Europe in the 1930s. Outbreaks still occur today, albeit at a smaller scale. Traditionally, L. zosterae has been quantified by measuring the necrotic area of Z. marina leaf tissue. This indirect method can however only lead to a very rough estimate of pathogen load. Here, we present a quantitative real-time polymerase chain reaction (qPCR) approach to directly detect and quantify L. zosterae in eelgrass tissue. Based on the internal transcribed spacer (ITS) sequences of rRNA genes, species-specific primers were designed. Using our qPCR, we were able to quantify accurately and specifically L. zosterae load both from culture and eelgrass leaves using material from Europe and North America. Our detection limit was less than one L. zosterae cell. Our results demonstrate the potential of this qPCR assay to provide rapid, accurate and sensitive molecular identification and quantification of L. zosterae. In view of declining seagrass populations worldwide, this method will provide a valuable tool for seagrass ecologists and conservation projects. © 2011 Blackwell Publishing Ltd.

  11. Continuous Excretion of Leptospira borgpetersenii Ballum in Mice Assessed by Viability Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Soupé-Gilbert, Marie-Estelle; Bierque, Emilie; Geroult, Sophie; Teurlai, Magali; Goarant, Cyrille

    2017-10-01

    Rodents are the main reservoir animals of leptospirosis. In this study, we characterized and quantified the urinary excretion dynamics of Leptospira by Mus musculus infected with 2 × 10 8 virulent Leptospira borgpetersenii serogroup Ballum. Each micturition was collected separately in metabolic cages, at 12 time points from 7 to 117 days post-infection (dpi). We detected Leptospira in all urine samples collected (up to 8 per time point per mouse) proving that Leptospira excretion is continuous with ca. 90% live L. borgpetersenii Ballum, revealed by viability quantitative polymerase chain reaction. Microscopic visualization by Live/Dead fluorescence confirmed this high proportion of live bacteria and demonstrated that L. borgpetersenii Ballum are excreted, at least partly, as bacterial aggregates. We observed two distinct phases in the excretion dynamics, first an increase in Leptospira concentration shed in the urine between 7 and 63 dpi followed by a plateau phase from 63 dpi onward, with up to 3 × 10 7 Leptospira per mL of urine. These two phases seem to correspond to progressive colonization of renal tubules first, then to stable cell survival and maintenance in kidneys. Therefore, chronically infected adult mice are able to contaminate the environment via urine at each micturition event throughout their lifetime. Because Leptospira excretion reached its maximum 2 months after infection, older rodents have a greater risk of contaminating their surrounding environment.

  12. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

    2004-01-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  13. Streptococcus equi Detection Polymerase Chain Reaction Assay for Equine Nasopharyngeal and Guttural Pouch Wash Samples.

    Science.gov (United States)

    Boyle, A G; Rankin, S C; Duffee, L; Boston, R C; Wheeler-Aceto, H

    2016-01-01

    Bacterial culture and polymerase chain reaction (PCR) assays for the detection of Streptococcus equi in nasopharyngeal washes (NPW) and guttural pouch lavage (GPL) samples have low sensitivity. In human diagnostics, processing of samples with flocked swabs has improved recovery rates of bacterial agents because of improved surface area and elution factors. For S. equi subsp. equi (S. equi) detection in NPW and GPL samples we hypothesized that: direct-PCR would be more reliable than flocked swab culture (FS culture); flocked swab PCR (FS-PCR) would be equivalent to direct-PCR; and FS culture would be more reliable than traditional culture. A total of 193 samples (134 NPW and 59 GPL) from 113 horses with either suspected S. equi infection, convalescing from a known S. equi infection, or asymptomatic horses screened for S. equi. Prospective study. Samples were submitted for S. equi direct-PCR. Using logistic regression, direct-PCR (gold standard) was compared to FS culture, traditional culture, and FS-PCR also performed. Direct-PCR was statistically more sensitive than FS-PCR, FS culture, and traditional culture (P equi via either PCR or bacterial culture from samples. Direct-PCR is the preferred method of detection of S. equi. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  14. Touchdown polymerase chain reaction detection of polycystic kidney disease and laboratory findings in different cat populations.

    Science.gov (United States)

    Scalon, Marcela C; da Silva, Thamiris F; Aquino, Larissa C; Carneiro, Filipe T; Lima, Maíra G da M; Lemos, Marcelle Dos S; Paludo, Giane R

    2014-07-01

    Autosomal-dominant polycystic kidney disease (ADPKD) is the most prevalent inherited genetic disease of cats, predominantly affecting Persian and Persian-related cats. A point mutation (C→A transversion) in exon 29 of the PKD1 gene causes ADPKD, and is the specific molecular target for genetic diagnosis in cats. The current study describes a newly developed touchdown polymerase chain reaction (PCR) to detect this single point mutation, using 2 primers specific for the mutant allele, adapted from an existing multiplex amplification refractory mutation system (ARMS PCR). Furthermore, correlations between the clinical outcomes of tested animals and the results of the genetic test were investigated. A total of 334 cats were tested, 188 from the Veterinary Hospital of Small Animals at the University of Brasilia, and 146 from an anti-rabies vaccine campaign of the Federal District. A total prevalence of 9% was evident among the samples, with 33% of the Persian cats testing positive, and 7% of the Brazilian long- and shorthaired cats testing positive. Prevalence was not correlated with gender or hemogram. Positive animals exhibited hyperglobulinemia ( P = 0.02). This research demonstrated that the mutation does not only occur in Persian and Persian-related cats, and that a touchdown PCR can be used to diagnose ADPKD.

  15. Maedi in slaughtered sheep: a pathology and polymerase chain reaction study in southwestern Iran.

    Science.gov (United States)

    Azizi, Shahrzad; Tajbakhsh, Elahe; Fathi, Farzad; Oryan, Ahmad; Momtaz, Hassan; Goodarzi, Mehdi

    2012-01-01

    Maedi-visna (MV) is an important slow viral disease of sheep leading to a progressive lymphoproliferative disease. It affects multiple organs primarily the lungs, where it causes interstitial pneumonia (maedi). In this study, the lungs of 1,000 sheep carcasses were grossly inspected and those suspected to have maedi were studied at histopathological and molecular levels. A polymerase chain reaction (PCR) technique that amplified a 291-base pair DNA in the long terminal repeat (LTR) sequence of MV provirus was conducted on all the 50 suspected lungs together with 10 normal appearing lungs as controls. Amplicons of the expected size were detected in 11 (n=11/50) suspected sheep, and one of the 10 control sheep. Histopathologic study of the pulmonary lesions of all 11 (n=11/11) positive sheep showed MV lesions, including hyperplasia of the perivascular and peribronchiolar lymphoid cells, interstitial lymphoplasmacytic infiltration and smooth muscle hyperplasia and the histopathologic findings were correlated with PCR results. In contrast, the tissue sections of control animals were almost normal at histopathological level; however, PCR technique demonstrated that one of them was affected by maedi. This study showed that the LTR-PCR had high specificity and sensitivity in diagnosis of this viral infection. This study is the first to evaluate the prevalence of MV virus infection in sheep in Iran.

  16. Pouched Rats’ Detection of Tuberculosis in Human Sputum: Comparison to Culturing and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Amanda Mahoney

    2012-01-01

    Full Text Available Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%, and the mean specificity was 87.3% (range 84.7–90.3%. Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries.

  17. Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.

    Science.gov (United States)

    Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne

    2017-06-01

    To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

  18. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong

    2012-01-01

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  19. Real-Time Polymerase Chain Reaction Quantification of Phytophthora capsici in Different Pepper Genotypes.

    Science.gov (United States)

    Silvar, C; Díaz, J; Merino, F

    2005-12-01

    ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.

  20. Multiplex polymerase chain reaction method discriminating Escherichia coli and Shigella sp.

    Science.gov (United States)

    Yamazaki, Y; Fukasawa, A

    2011-02-01

    To distinguish between Escherichia coli and other bacteria that have similar biochemical characteristics, 3 polymerase chain reaction techniques were combined. The primer sets cydA-F2-A2 and cydA-R2-A2 were designed to amplify 605 base pairs of nucleotide sequence specific for the cydA gene of Escherichia coli; primer sets lacZ-F-A and lacZ-R-A to amplify 1,023 bp of nucleotide sequence specific for the lacZ gene of Escherichia coli; and primers lacA-F2-A2 and lacA-R2-A2 to amplify 325 bp of nucleotide sequence specific for the lacA gene of Escherichia coli. As a result, 3 nucleotide fragments were generated when 3 samples DNA from Escherichia coli were used as template. On the other hand, 1,023- and 605-bp products were obtained when DNA of Shigella sonnei was used, and a 605-bp product was obtained when DNA of Shigella flexneri was used. The specificity of the technique was confirmed by comparing it with the conventional culture test; the consistency rate of both tests was 0.749. These results suggest that the technique described in the present study will be useful for distinguishing Escherichia coli from Shigella species with accuracy and specificity.

  1. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Science.gov (United States)

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  2. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  3. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Directory of Open Access Journals (Sweden)

    Daniela Camargos Costa

    2014-02-01

    Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  4. Multiplex polymerase chain reaction assay developed to diagnose adult bacterial meningitis in Taiwan.

    Science.gov (United States)

    Lee, Chi-Tsung; Hsiao, Kuang-Ming; Chen, Jin-Cherng; Su, Cheng-Chuan

    2015-11-01

    Acute bacterial meningitis causes high morbidity and mortality; the associated clinical symptoms often are insensitive or non-specific; and the pathogenic bacteria are geographically diverse. Clinical diagnosis requires a rapid and accurate methodology. This study aimed to develop a new multiplex polymerase chain reaction (mPCR) assay to detect simultaneously six major bacteria that cause adult bacterial meningitis in Taiwan: Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus pneumoniae, Staphylococcus aureus, Escherichia coli, and Acinetobacter baumannii. Species-specific primers for the six bacteria were developed using reference strains. The specificities of the mPCRs for these bacteria were validated, and the sensitivities were evaluated via serial dilutions. The mPCR assay specifically detected all of the six pathogens, particularly with sensitivities of 12 colony forming units (CFU)/mL, 90 CFU/mL, and 390 CFU/mL for E. coli, S. pneumoniae, and K. pneumoniae, respectively. This mPCR assay is a rapid and specific tool to detect the six major bacterial pathogens that cause acute adult meningitis in Taiwan, particularly sensitive for detecting E. coli, S. pneumoniae, and K. pneumoniae. The assay may facilitate early diagnosis and guidance for antimicrobial therapy for adult patients with this deadly disease in Taiwan. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  5. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  6. Amebic liver abscess diagnosed by polymerase chain reaction in 14 returning travelers.

    Science.gov (United States)

    Vallois, Dorothée; Epelboin, Loïc; Touafek, Feriel; Magne, Denis; Thellier, Marc; Bricaire, François; Caumes, Eric

    2012-12-01

    Amebic liver abscesses (ALA) are not commonly described in travelers. The ALA diagnosis is usually based on serology and Entamoeba histolytica polymerase chain reaction (PCR) is a new tool. We retrospectively reviewed all ALA cases diagnosed by PCR on the liver abscess pus aspirate of patients admitted in 4 teaching hospitals in Paris, France between 2007 and 2011. Fourteen cases (10 male, median age 48 years) were included. The median lag time between return and onset of symptoms was 23 days among 10 patients (interquartile range [IQ] 18–24) whereas the remaining patients had travelled over 2 years ago.All patients had an elevated C-reactive protein level, and 11 had leukocytosis. The ALA was multiple in five patients, localized in the right lobe in 12, and higher than 5 cm in 11. Serology was initially negative in one patient, whereas PCR was positive. There was bacterial co-infection in one patient. The outcome was good. Liver puncture allows a rapid diagnosis of ALA with PCR and helps identify the association with a bacterial dual infection [corrected]..

  7. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses.

    Science.gov (United States)

    Trinh, Kieu The Loan; Zhang, Hainan; Kang, Dong-Jin; Kahng, Sung-Hyun; Tall, Ben D; Lee, Nae Yoon

    2016-05-01

    We aim to fabricate a thermoplastic poly(methylmethacrylate) (PMMA) Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs) for rapid molecular detection of foodborne pathogen bacteria. A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane) interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.

  8. AFM Imaging of Hybridization Chain Reaction Mediated Signal Transmission between Two DNA Origami Structures.

    Science.gov (United States)

    Helmig, Sarah; Gothelf, Kurt Vesterager

    2017-10-23

    Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Accuracy of the serological ELISA test compared with the polymerase chain reaction for the diagnosis of cytomegalovirus infection in pregnancy

    Directory of Open Access Journals (Sweden)

    Silvana Varella Parmigiani

    Full Text Available CONTEXT: The most frequently used methods for detecting antibodies are the indirect immunofluorescence test and the enzymatic immunoassay (ELISA. The polymerase chain reaction is a molecular biology technique in which the production of large amounts of specific DNA fragments is induced from very low concentrations of complex substrates aloowing the detection of very low amounts of viral particles. OBJECTIVE: To assess the accuracy of serological/ELISA tests in comparison with the polymerase chain reaction in maternal blood to diagnose cytomegalovirus infection. DESIGN: A descriptive study was performed. SETTING: High-risk outpatient clinic of Campinas University (Unicamp. PARTICIPANTS: We selected 243 pregnant women. All of them had been indicated for blood sampling because of suspicions of cytomegalovirus infection and also because of other infections. MAIN MEASUREMENTS: The group was tested for cytomegalovirus. Serological tests were run and compared to the polymerase chain reaction, which was considered to be the gold standard. Status analyses were done using Fisher's exact test, via the SAS software. RESULTS: The previous cytomegalovirus infection rate was 94.6%. The main reasons for inclusion in the study were fetal nervous system malformation (25.5%, maternal toxoplasmosis (25.5% and Rh isoimmunization (14.8%. Only two women were included because of positive serological immunoglobulin M test for cytomegalovirus. The sensitivity and specificity of the serological tests were 94% and 6% for immunoglobulin G. CONCLUSION: Serological tests had lower sensitivity in comparison with the polymerase chain reaction test when diagnosing cytomegalovirus infection. The consequences of positive polymerase chain reaction and negative immunoglobulin M in women remain unknown.

  10. An Empirical Investigation of Value-Chain Analysis and Competitive ...

    African Journals Online (AJOL)

    This research work was designed to examine the impact of the Value-Chain Analysis on Competitive Advantage of manufacturing firms in Nigeria. To achieve this purpose, hypothesis was formulated and a review of related literature was made. The population of this study consists of those manufacturing companies quoted ...

  11. Value Chain Analysis: A Framework for Management of Distance Education.

    Science.gov (United States)

    Woudstra, Andrew; Powell, Richard

    1989-01-01

    Discussion of the benefits of value chain analysis in the management of distance education organizations focuses on an example at Athabasca University. The effects of policies and decisions on the organization and its value system are considered, cost drivers for activities are described, and a future-oriented perspective is emphasized. (14…

  12. Are Neutral-Neutral Reactions Effective for the Carbon-Chain Growth of Cyanopolyynes and Polyacetylenes in Interstellar Space?

    International Nuclear Information System (INIS)

    Fukuzawa, K.; Osamura, Y.; Schaefer, H.F. III

    1998-01-01

    Ab initio molecular quantum-mechanical methods have been applied to explore the possibility of neutral-neutral reactions leading to the formation of cyanopolyynes and polyacetylenes in interstellar cloud. Potential energy surfaces for the reactions between the CN radical and polyacetylenes indicate that all reactions, C 2n H 2 + CN (n = 1 endash 4), which form HC 2n+1 N molecules, are exothermic and have no energy barriers. We have also examined the possibility of the various product channels from the reactions C 2n H 2 + CN based on the thermochemical relationships. The theoretical results show that none of the product channels is exothermic except the case which produces HC 2n+1 N, with the carbon chain being longer than the reactant polyacetylene. Similar results are obtained for the regioselectivity of the reactions, C 2n H 2 + C 2 H (n = 1 endash 4), to produce hydrocarbons. The only possible products from the latter reactions are shown to be HC 2n+2 H + H under the conditions of interstellar space. These results clearly demonstrate the importance of the neutral-neutral reactions on the carbon-chain growth of cyanopolyynes and polyacetylenes. copyright copyright 1998. The American Astronomical Society

  13. Platypus chain reaction: directional and ordered meiotic pairing of the multiple sex chromosome chain in Ornithorhynchus anatinus.

    Science.gov (United States)

    Daish, Tasman; Casey, Aaron; Grützner, Frank

    2009-01-01

    Monotremes are phylogenetically and phenotypically unique animals with an unusually complex sex chromosome system that is composed of ten chromosomes in platypus and nine in echidna. These chromosomes are alternately linked (X1Y1, X2Y2, ...) at meiosis via pseudoautosomal regions and segregate to form spermatozoa containing either X or Y chromosomes. The physical and epigenetic mechanisms involved in pairing and assembly of the complex sex chromosome chain in early meiotic prophase I are completely unknown. We have analysed the pairing dynamics of specific sex chromosome pseudoautosomal regions in platypus spermatocytes during prophase of meiosis I. Our data show a highly coordinated pairing process that begins at the terminal Y5 chromosome and completes with the union of sex chromosomes X1Y1. The consistency of this ordered assembly of the chain is remarkable and raises questions about the mechanisms and factors that regulate the differential pairing of sex chromosomes and how this relates to potential meiotic silencing mechanisms and alternate segregation.

  14. Biological Sabatier reaction with CFD analysis

    Science.gov (United States)

    Leonzio, Grazia

    2016-12-01

    The biological Sabatier reaction is a suitable option for the future energy storage. In this research a computational fluid dynamics analysis is carried out to study the mixing inside the anaerobic digester, to evaluate the gas to liquid mass transfer and the efficiency of the reaction. A detailed modeling about the hydrodynamics and mixing is developed: the standard k-ɛ mixture turbulence model and the Eulerian-Eulerian approach are used to simulate the flow inside the anaerobic digestion. The system mixing uses external sludge re-circulating pumps. Results of simulations show that with higher liquid velocity there are higher mass to transfer from gas to liquid and turbulent dissipation rate. The future construction of the anaerobic digester will provide the obtained results.

  15. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  16. Helicobacter-negative gastritis: polymerase chain reaction for Helicobacter DNA is a valuable tool to elucidate the diagnosis.

    Science.gov (United States)

    Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G

    2016-04-01

    Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.

  17. Bakteri Legionella pneumophila Terdeteksi pada Air Kolam Renang di Kota Surabaya dengan Nested Polymerase Chain Reaction (LEGIONELLA PNEUMOPHILA BACTERIADETECTED IN SWIMMING POOL WATER OF SURABAYA BY USING NESTED POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Eduardus Bimo Aksono

    2017-06-01

    Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup

  18. Real Time Polymerase Chain Reaction (rt-PCR): A New Patent to Diagnostic Purposes for Paracoccidioidomycosis.

    Science.gov (United States)

    Rocha-Silva, Fabiana; Gomes, Luciana I; Gracielle-Melo, Cidiane; Goes, Alfredo M; Caligiorne, Rachel B

    2017-01-01

    Paracoccidioidomycosis (PCM) is a systemic mycosis caused by dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. It is prevalent in Latin American, mainly in Brazil. Therefore, PCM has fundamental impact on the Brazilian global economy, especially in public health system, since it is affecting economical active population in different country regions. The present study aimed to standardize the Real Time-Polymerase Chain Reaction (rt-PCR) for an efficient and safe PCM diagnosis amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. To standardize a methodology of rt-PCR using species-specific primers and probe designed for annealing in this specific region of the fungi´s genome, amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. Followed by design in silico, experiments were performed in vitro to determine rt-PCR specificity, efficiency and genome detection limit. The primers and probe sequences were deposited in Brazilian Coordination of Technological Innovation and Transfer (CTIT), under patent reference number BR1020160078830. The present study demonstrated the rt-PCR applicability for support on diagnosis of paracoccidioidomycosis, presenting low cost, which makes it affordable for public health services in developing countries as Brazil. It is noteworthy that it is necessary to validate this methodology using clinical samples before to use as a safe method of diagnosis. A review of all patents related to this topic was performed and it was shown that, to date, there are no records of patent on kits for paracoccidioidomycosis´s diagnostic. Indeed, there is still a lot to go to reach this goal. The reaction developed was standardized and patented, opening perspectives to molecular diagnosis development for paracoccidioidomycosis, since rt-PCR can be applied to a broad spectrum of infectious diseases. It would need to be tested in biological

  19. One-heater flow-through polymerase chain reaction device by heat pipes cooling.

    Science.gov (United States)

    Chen, Jyh Jian; Liao, Ming Huei; Li, Kun Tze; Shen, Chia Ming

    2015-01-01

    This study describes a novel microfluidic reactor capable of flow-through polymerase chain reactions (PCR). For one-heater PCR devices in previous studies, comprehensive simulations and experiments for the chip geometry and the heater arrangement were usually needed before the fabrication of the device. In order to improve the flexibility of the one-heater PCR device, two heat pipes with one fan are used to create the requisite temperature regions in our device. With the integration of one heater onto the chip, the high temperature required for the denaturation stage can be generated at the chip center. By arranging the heat pipes on the opposite sides of the chip, the low temperature needed for the annealing stage is easy to regulate. Numerical calculations and thermal measurements have shown that the temperature distribution in the five-temperature-region PCR chip would be suitable for DNA amplification. In order to ensure temperature uniformity at specific reaction regions, the Re of the sample flow is less than 1. When the microchannel width increases and then decreases gradually between the denaturation and annealing regions, the extension region located in the enlarged part of the channel can be observed numerically and experimentally. From the simulations, the residence time at the extension region with the enlarged channel is 4.25 times longer than that without an enlarged channel at a flow rate of 2 μl/min. The treated surfaces of the flow-through microchannel are characterized using the water contact angle, while the effects of the hydrophilicity of the treated polydimethylsiloxane (PDMS) microchannels on PCR efficiency are determined using gel electrophoresis. By increasing the hydrophilicity of the channel surface after immersing the PDMS substrates into Tween 20 (20%) or BSA (1 mg/ml) solutions, efficient amplifications of DNA segments were proved to occur in our chip device. To our knowledge, our group is the first to introduce heat pipes into

  20. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio

    2010-11-01

    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  1. Simplifying Nucleic Acid Amplification from Whole Blood with Direct Polymerase Chain Reaction on Chitosan Microparticles.

    Science.gov (United States)

    Nanayakkara, Imaly A; Cao, Weidong; White, Ian M

    2017-03-21

    Tremendous advances have been made in the development of portable nucleic acid amplification devices for near-patient use. However, the true limitation in the realization of nucleic acid amplification tests (NAATs) for near-patient applications is not the amplification reaction, it is the complexity of the sample preparation. Conventional approaches require several precise intervention steps during the protocol. There are numerous reports in the literature that mimic the sample preparation procedure within a lab-on-a-chip device or cartridge, but these systems require a high number of integrated steps, making the devices and/or their supporting equipment too complex to meet the necessary cost targets and regulatory requirements for near-patient applications. Here we report a simplified method to purify and amplify DNA from complex samples in a minimal number of steps. We show that chitosan-coated microparticles can lyse human cells and capture the released DNA in a single mechanical agitation step, and we show that bound DNA can be amplified directly from the microparticle surface when the magnetic microparticles are transferred to a polymerase chain reaction (PCR). This procedure eliminates (i) the use of PCR-inhibiting reagents (e.g., chaotropic salts and alcohol) and (ii) the washing and elution steps that are required to remove these reagents and release DNA in typical NAAT sample preparation methods. To illustrate the use of this direct PCR method in diagnostics, we amplify human genomic DNA sequences from a ∼1 μL droplet of whole blood, and we amplify plasmid DNA spiked into whole blood droplets to represent circulating viral DNA or cell-free DNA. The qPCR threshold cycle for direct PCR from whole blood is comparable to that of direct PCR with purified DNA, demonstrating that the lysis and capture steps effectively bind DNA and sufficiently enable its amplification. Furthermore, the efficient amplification of plasmid DNA spiked into whole blood proves that

  2. Development and application of a real-time polymerase chain reaction method for Campylobacter jejuni detection.

    Science.gov (United States)

    Zhang, Mao-Jun; Qiao, Bo; Xu, Xue-Bin; Zhang, Jian-Zhong

    2013-05-28

    To develop a real-time polymerase chain reaction (PCR) method to detect and quantify Campylobacter jejuni (C. jejuni) from stool specimens. Primers and a probe for real-time PCR were designed based on the specific DNA sequence of the hipO gene in C. jejuni. The specificity of the primers and probe were tested against a set of Campylobacter spp. and other enteric pathogens. The optimal PCR conditions were determined by testing a series of conditions with standard a C. jejuni template. The detection limits were obtained using purified DNA from bacterial culture and extracted DNA from the stool specimen. Two hundred and forty-two specimens were analyzed for the presence of C. jejuni by direct bacterial culture and real-time PCR. The optimal PCR system was determined using reference DNA templates, 1 × uracil-DNA glycosylase, 3.5 mmol/L MgCl2, 1.25 U platinum Taq polymerase, 0.4 mmol/L PCR nucleotide mix, 0.48 μmol/L of each primer, 0.2 μmol/L of probe and 2 μL of DNA template in a final volume of 25 μL. The PCR reaction was carried as follows: 95 °C for 4 min, followed by 45 cycles of 10 s at 95 °C and 30 s at 59 °C. The detection limit was 4.3 CFU/mL using purified DNA from bacterial culture and 10(3) CFU/g using DNA from stool specimens. Twenty (8.3%, 20/242) C. jejuni strains were isolated from bacterial culture, while 41 (16.9%, 41/242) samples were found to be positive by real-time PCR. DNA sequencing of the PCR product indicated the presence of C. jejuni in the specimen. One mixed infection of C. jejuni and Salmonella was detected in one specimen and the PCR test for this specimen was positive. The sensitivity of detection of C. jejuni from stool specimens was much higher using this PCR assay than using the direct culture method.

  3. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  4. Findings in patients from Benin with osteomyelitis and polymerase chain reaction-confirmed Mycobacterium ulcerans infection.

    Science.gov (United States)

    Pommelet, Virginie; Vincent, Quentin B; Ardant, Marie-Françoise; Adeye, Ambroise; Tanase, Anca; Tondeur, Laura; Rega, Adelaide; Landier, Jordi; Marion, Estelle; Alcaïs, Alexandre; Marsollier, Laurent; Fontanet, Arnaud; Chauty, Annick

    2014-11-01

    Mycobacterium ulcerans is known to cause Buruli ulcer (BU), a necrotizing skin disease leading to extensive cutaneous and subcutaneous destruction and functional limitations. However, M. ulcerans infections are not limited to skin, and osteomyelitis, still poorly described in the literature, occurs in numerous young patients in Africa. In a retrospective matched case-control study conducted in a highly endemic area in Benin, we analyzed demographic, clinical, biological, and radiological features in all patients with M. ulcerans infections with bone involvement, identified from a cohort of 1257 patients with polymerase chain reaction-proved M. ulcerans infections. The 81 patients studied had a median age of 11 years (interquartile range, 7-16 years) and were predominantly male (male-female ratio, 2:1). Osteomyelitis was observed beneath active BU lesions (60.5%) or at a distance from active or apparently healed BU lesions (14.8%) but also in patients without a history of BU skin lesions (24.7%). These lesions had an insidious course, with nonspecific clinical findings leading to delayed diagnosis. A comparison with findings in 243 age- and sex-matched patients with BU without osteomyelitis showed that case patients were less likely to have received BCG immunization than controls (33.3% vs 52.7%; P = .01). They were also at higher risk of longer hospital stay (118 vs 69 days; P = .001), surgery (92.6% vs 63.0%; P = .001), and long-term crippling sequelae (55.6% vs 15.2%; P ulcerans osteomyelitis, with one-fourth of patients having no apparent history of BU skin lesions, including during the current course of illness. Delays in treatment contributed to the high proportion (55.6%) of patients with crippling sequelae. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Evaluation of polymerase chain reaction in nerve biopsy specimens of patients with Hansen's disease.

    Science.gov (United States)

    Tiwari, Vandana; Malhotra, Kiranpreet; Khan, Kainat; Maurya, Pradeep K; Singh, Ajai Kumar; Thacker, Anup Kumar; Husain, Nuzhat; Kulshreshtha, Dinkar

    2017-09-15

    Pure neuritic variety of leprosy (PNL) presents as peripheral neuropathy with absent skin lesions and negative skin smears. Diagnosing PNL is an uphill task as most of these patients have nonspecific changes on nerve biopsy. In such circumstances, additional molecular diagnostic tools like polymerase chain reaction (PCR) has proven to be useful in diagnosing leprosy. The present study was planned to evaluate the role of PCR in nerve biopsy specimens of patients with PNL. Patients attending the neuromuscular clinic from January 2013 to June 2014 with mononeuropathy multiplex underwent detailed diagnostic evaluation to ascertain the cause of neuropathy. Patients where this evaluation failed to establish an etiology underwent a nerve biopsy. Nerve biopsy was done in 52 patients, of which 35 were diagnosed as pure neuritic leprosy. Definite leprosy with positive wade fite staining for lepra bacilli was seen in 13 patients and 22 biopsies revealed a probable leprosy without lepra bacilli being identified. PCR for M. leprae was positive in 22 patients (62%). 12 of the 13 cases with definite leprosy on histopathology were PCR positive while in the AFB negative group, PCR was positive in 10 cases. PCR had a sensitivity of 92.3%, specificity of 54.5%. The positive and negative predictive value of PCR was 54.5% and 92.3% respectively. PCR helps in diagnosing PNL in doubtful cases. A positive PCR increases the sensitivity of detection of M. leprae especially in cases of probable PNL group where AFB cannot be demonstrated on histopathology. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Value of polymerase chain reaction in patients with presumptively diagnosed and treated as tuberculous pericardial effusion

    International Nuclear Information System (INIS)

    Rehman, H.; Hafizullah, M.; Shah, S.T.; Khan, S.B.; Hadi, A.; Ahmad, F.; Shah, I.; Gul, A.M.

    2012-01-01

    Objective: To know the sensitivity of polymerase chain reaction (PCR) in pericardial fluid and response to antituberculous treatment (ATT) in PCR positive patients who were presumptively diagnosed and treated as tuberculous pericardial effusion. Methodology: This was a descriptive cross sectional study carried out from June 1, 2009 to 31 May 2010 at Cardiology Department, Lady Reading Hospital, Peshawar. Patients with presumptive diagnosis and receiving treatment for tuberculous pericardial effusion were included. Pericardial fluid sample was aspirated under fluoroscopy for the routine work up. The specimens were subjected to PCR detection of mycobacterium tuberculous DNA. Results: During 12 month study period, a total of 54 patients with large pericardial effusion presented to Cardiology department, Lady Reading Hospital, Peshawar. Of them, 46 patients fulfilled the criteria for presumptive diagnosis of tuberculous pericardial effusion. PCR for mycobacterium tuberculous DNA in pericardial fluid was positive in 45.7%(21). Patients were followed for three months. In PCR positive group, 01 patient while in PCR negative group 3 patients were lost to follow up. Among PCR positive patients 17(85%) while in PCR negative group 11(47.82%) patient responded to ATT both clinically and echo-cardio graphically. We found that patients who were PCR positive responded better to therapy than those who were PCR negative and this finding was statistically significant (p=0.035). Conclusion: PCR, with all its limitations, is potentially a useful diagnostic test in patients with presumptively diagnosed tuberculous pericardial effusion. A PCR positive patient responds better to therapy as compared to PCR negative patient. (author)

  7. Enteroviral RNA sequences detected by polymerase chain reaction in muscle of patients with postviral fatigue syndrome.

    Science.gov (United States)

    Gow, J W; Behan, W M; Clements, G B; Woodall, C; Riding, M; Behan, P O

    1991-03-23

    To determine the presence of enteroviral sequences in muscle of patients with the postviral fatigue syndrome. Detection of sequences with the polymerase chain reaction in a well defined group of patients with the syndrome and controls over the same period. Institute of Neurological Sciences, Glasgow. 60 consecutive patients admitted to the institute with the postviral fatigue syndrome who had undergone extensive investigation to exclude other conditions. 41 controls from the same catchment area without evidence of fatigue, all undergoing routine surgery. Routine investigations, serological screen for antibodies to a range of viruses, and presence of enteroviral RNA sequences in muscle biopsy specimens. 15 (25%) patients and 10 (24.4%) controls had important serological findings. 12 patients had neutralising antibody titres of greater than or equal to 256 to coxsackieviruses B1-5 (six positive for enteroviral RNA sequences, six negative); three were positive for Epstein-Barr virus specific IgM (two positive, one negative). Six controls had similar neutralising antibody titres to coxsackieviruses (all negative); one was positive for Epstein-Barr virus specific IgM (negative); and three had titres of complement fixing antibody greater than or equal to 256 to cytomegalovirus (all negative). Overall, significantly more patients than controls had enteroviral RNA sequences in muscle (32/60, 53% v 6/41, 15%; odds ratio 6.7, 95% confidence interval 2.4 to 18.2). This was not correlated with duration of disease, patient and age, or to raised titres of antibodies to coxsackieviruses B1-5. Persistent enteroviral infection of muscle may occur in some patients with postviral fatigue syndrome and may have an aetiological role.

  8. Cleavage-based hybridization chain reaction for electrochemical detection of thrombin.

    Science.gov (United States)

    Chang, Yuanyuan; Chai, Yaqin; Xie, Shunbi; Yuan, Yali; Zhang, Juan; Yuan, Ruo

    2014-09-07

    In the present work, we constructed a new label-free "inter-sandwich" electrochemical aptasensor for thrombin (TB) detection by employing a cleavage-based hybridization chain reaction (HCR). The designed single-stranded DNA (defined as binding DNA), which contained the thrombin aptamer binding sequence, a DNAzyme cleavage site and a signal reporter sequence, was first immobilized on the electrode. In the absence of a target TB, the designed DNAzymes could combine with the thrombin aptamer binding sequence via complementary base pairing, and then Cu(2+) could cleave the binding DNA. In the presence of a target TB, TB could combine with the thrombin aptamer binding sequence to predominantly form an aptamer-protein complex, which blocked the DNAzyme cleavage site and prevented the binding DNA from being cleaved by Cu(2+)-dependent DNAzyme. As a result, the signal reporter sequence could leave the electrode surface to trigger HCR with the help of two auxiliary DNA single-strands, A1 and A2. Then, the electron mediator hexaammineruthenium (III) chloride ([Ru(NH3)6](3+)) was embedded into the double-stranded DNA (dsDNA) to produce a strong electrochemical signal for the quantitative measurement of TB. For further amplification of the electrochemical signal, graphene reduced by dopamine (PDA-rGO) was introduced as a platform in this work. With this strategy, the aptasensor displayed a wide linearity in the range of 0.0001 nM to 50 nM with a low detection limit of 0.05 pM. Moreover, the resulting aptasensor exhibited good specificity and acceptable reproducibility and stability. Because of these factors, the fabrication protocol proposed in this work may be extended to clinical application.

  9. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    Science.gov (United States)

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures. © 2014 The Author(s).

  10. Early polymerase chain reaction detection of Chagas disease reactivation in heart transplant patients.

    Science.gov (United States)

    da Costa, Priscilla Almeida; Segatto, Marcela; Durso, Danielle Fernandes; de Carvalho Moreira, Wagson José; Junqueira, Lucas Lodi; de Castilho, Fábio Morato; de Andrade, Silvio Amadeu; Gelape, Cláudio Léo; Chiari, Egler; Teixeira-Carvalho, Andréa; Junho Pena, Sergio Danilo; Machado, Carlos Renato; Franco, Gloria Regina; Filho, Geraldo Brasileiro; Vieira Moreira, Maria da Consolação; Mara Macedo, Andréa

    2017-07-01

    Heart transplantation is a valuable therapeutic option for Chagas disease patients with severe cardiomyopathy. During patient follow-up, the differential diagnosis between cardiac transplant rejection and Chagas disease infection reactivation remains a challenging task, which hinders rapid implementation of the appropriate treatment. Herein we investigate whether polymerase chain reaction (PCR) strategies could facilitate early detection of Trypanosoma cruzi (T cruzi) in transplanted endomyocardial biopsies (EMBs). In this study we analyzed 500 EMB specimens obtained from 58 chagasic cardiac transplant patients, using PCR approaches targeted to nuclear (rDNA 24Sα) and kinetoplastid (kDNA) markers, and compared the efficiency of these approaches with that of other tests routinely used. T cruzi DNA was detected in 112 EMB specimens derived from 39 patients (67.2%). The first positive result occurred at a median 1.0 month post-transplant. Conventional histopathologic, blood smear and hemoculture analyses showed lower sensitivity and higher median time to the first positive result. Patient follow-up revealed that 31 of 39 PCR-positive cases presented clinical reactivation of Chagas disease at different time-points after transplantation. PCR techniques showed considerable sensitivity (0.82) and specificity (0.60), with area under the receiver operating characteristic (ROC) curves of 0.708 (p = 0.001). Moreover, PCR techniques anticipated the clinical signs of Chagas disease reactivation by up to 36 months, with a median time of 6 months and an average of 9.1 months. We found a good association between the PCR diagnosis and the clinical signs of the disease, indicating that the PCR approaches used herein are suitable for early diagnosis of Chagas disease reactivation, with high potential to assist physicians in treatment decisions. For this purpose, an algorithm is proposed for surveillance based on the molecular tests. Copyright © 2017 International Society for the

  11. Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?

    Directory of Open Access Journals (Sweden)

    Yoo Jin Lee

    2016-11-01

    Full Text Available Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB, but it is time-consuming. Polymerase chain reaction (PCR is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA, acid-fast bacilli (AFB staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1% and a high specificity (86.3% based on the culture results of other studies. The sensitivity was higher (65.5% in cases with necrotizing granuloma but showed the highest sensitivity (66.7% in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis.

  12. Biosynthetic enhancement of the detection of bacteria by the polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Julie S Do

    Full Text Available Molecular viability testing (MVT was previously reported to specifically detect viable bacterial cells in complex samples. In MVT, brief nutritional stimulation induces viable cells, but not non-viable cells, to produce abundant amounts of species-specific ribosomal RNA precursors (pre-rRNA. Quantitative polymerase chain reaction (qPCR is used to quantify specific pre-rRNAs in a stimulated aliquot relative to a non-stimulated control. In addition to excluding background signal from non-viable cells and from free DNA, we report here that MVT increases the analytical sensitivity of qPCR when detecting viable cells. Side-by-side limit-of-detection comparisons showed that MVT is 5-fold to >10-fold more sensitive than standard (static DNA-targeted qPCR when detecting diverse bacterial pathogens (Aeromonas hydrophila, Acinetobacter baumannii, Listeria monocytogenes, Mycobacterium avium, and Staphylococcus aureus in serum, milk, and tap water. Sensitivity enhancement may come from the elevated copy number of pre-rRNA relative to genomic DNA, and also from the ratiometric measurement which reduces ambiguity associated with weak or borderline signals. We also report that MVT eliminates false positive signals from bacteria that have been inactivated by moderately elevated temperatures (pasteurization, a condition that can confound widely-used cellular integrity tests that utilize membrane-impermeant compounds such as propidium iodide (PI or propidium monoazide (PMA to differentiate viable from inactivated bacteria. MVT enables the sensitive and specific detection of very small numbers of viable bacteria in complex matrices.

  13. Detection of Typhoidal and Paratyphoidal Salmonella in Blood by Real-time Polymerase Chain Reaction.

    Science.gov (United States)

    Tennant, Sharon M; Toema, Deanna; Qamar, Farah; Iqbal, Najeeha; Boyd, Mary Adetinuke; Marshall, Joanna M; Blackwelder, William C; Wu, Yukun; Quadri, Farheen; Khan, Asia; Aziz, Fatima; Ahmad, Kumail; Kalam, Adil; Asif, Ehtisham; Qureshi, Shahida; Khan, Erum; Zaidi, Anita K; Levine, Myron M

    2015-11-01

    The gold standard for diagnosis of enteric fever caused by Salmonella Typhi or Salmonella Paratyphi A or B is bone marrow culture. However, because bone marrow aspiration is highly invasive, many hospitals and large health centers perform blood culture instead. As blood culture has several limitations, there is a need for novel typhoid diagnostics with improved sensitivity and more rapid time to detection. We developed a clyA-based real-time polymerase chain reaction (qPCR) method to detect Salmonella Typhi and Salmonella Paratyphi A simultaneously in blood. The sensitivity and specificity of this probeset was first evaluated in vitro in the laboratory and then in a typhoid-endemic population, in Karachi, Pakistan, and in healthy US volunteers. We optimized a DNA extraction and real-time PCR-based method that could reliably detect 1 colony-forming unit/mL of Salmonella Typhi. The probe set was able to detect clinical Salmonella Typhi and Salmonella Paratyphi A strains and also diarrheagenic Escherichia coli, but not invasive E. coli or other invasive bacteria. In the field, the clyA qPCR diagnostic was 40% as sensitive as blood culture. However, when qPCR-positive specimens were considered to be true positives, blood culture only exhibited 28.57% sensitivity. Specificity was ≥90% for all comparisons and in the healthy US volunteers. qPCR was significantly faster than blood culture in terms of detection of typhoid and paratyphoid. Based on lessons learned, we recommend that future field trials of this and other novel diagnostics that detect typhoidal and nontyphoidal Salmonella employ multiple methodologies to define a "positive" sample. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

    Directory of Open Access Journals (Sweden)

    Clemencia Ovalle Bracho

    2007-08-01

    Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

  15. Newborn screening for congenital cytomegalovirus using real-time polymerase chain reaction in umbilical cord blood.

    Science.gov (United States)

    Barkai, Galia; Barzilai, Asher; Mendelson, Ella; Tepperberg-Oikawa, Michal; Roth, Daphne Ari-Even; Kuint, Jacob

    2013-06-01

    Congenital cytomegalovirus (C-CMV) infection affects 0.4-2% of newborn infants in Israel, most of whom are asymptomatic. Of these, 10-20% will subsequently develop hearing impairment and may have benetitted from early detection by neonatal screeing. To retrospectively anaIyze the results of a screening program for C-CMV performed at the Sheba Medical Center, Tel, Hashomer, during a 1 year period, using real-time polymerase chain reaction (rt-PCR) from umbilical cord blood. CMV DNA was detected by rt-PCR performed on infants' cord blood. C-CMV was confirmed by urine culture (Shell-vial). All confirmed cases were further investigated for C-CMV manifestations by head ultrasound, complete blood count, liver enzyme measurement, ophthalmology examination and hearing investigation. During the period 1 June 2009 to 31 May 2010, 11,022 infants were born at the Sheba Medical Center, of whom 8105 (74%) were screened. Twenty-three (0.28%) were positive for CMV and 22 of them (96%) were confirmed by urine culture. Two additional infants, who had not been screened, were detected after clinical suspicion. All 24 infants were further Investigated, and 3 (12.5%) had central nervous system involvement (including hearing impairment) and were offered intravenous ganciclovir for 6 weeks. Eighteen infants (82%) would not otherwise have been diagnosed. The relatively low incidence of C-CMV detected in our screening program probably reflects the low sensitivity of cord blood screening. Nevertheless, this screening program reliably detected a non-negligible number of infants who could benefit from early detection. Other screening methods using saliva should be investigated further.

  16. THE METHOD OF POLYMERASE CHAIN REACTION FOR SEX DETERMINATION IN HUCHEN (HUCHO HUCHO

    Directory of Open Access Journals (Sweden)

    Yu. Rud

    2013-12-01

    Full Text Available Purpose. To analyse the nucleotide sequences of salmonids Y chromosome and to determine the fragment for specific primers selection and also to develop the PCR based method for sex determination in huchen H. hucho. Methodology. Using the ClustalW algorithm in MEGA 5.2, the nucleotide sequences of salmonids Y chromosome were analysed. For developing of method for rapid diagnostic of huchen sex the polymerase chain reaction (PCR assay was used. Tne nucleotide sequences of amplified products were investigated by sequencing. Findings. Using PCR assay the method of sex determination in huchen H. hucho was developed. It was shown that specific PCR products in size of 450 nucleotides were visible in huchen males only. In addition we showed that selected primers can be used in sex determination of rainbow trout Oncorhynchus mykiss and this fact is proved the high rate of sdY locus similarity and its wide destribution in salmonids. Originality. The nucleotide sequences of salmonids Y chromosome were analysed and highly conservative region of sdY locus for specific primers selection, which covers sex-linked marker, was identified. Practical Value. Rapid sex determination in huchen by the developed method will allow to identify reversal males in process of gormonal sex reversion. At the stage of reversal males screening, this method will allow to identify the genotypic males (XY in experimental group and discard them because only phenotypic males with XX genotype (reversal males must be used in the crosses with native femelas for getting of 100 % all-females stock.

  17. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis].

    Science.gov (United States)

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P

    2013-06-01

    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; Pvalue of EV PCR in serum. It suggests that in some children and under certain conditions (age >3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  18. Detection rates of trichomonas vaginalis, in different age groups, using real-time polymerase chain reaction.

    Science.gov (United States)

    Stemmer, Shlomo M; Adelson, Martin E; Trama, Jason P; Dorak, M Tevfik; Mordechai, Eli

    2012-10-01

    The study aimed to compare the overall detection rate of Trichomonas vaginalis to Chlamydia trachomatis and Neiserria gonorrhea and report detection rates by age groups. Real-time polymerase chain reaction was used to detect the presence of T. vaginalis, C. trachomatis, and N. gonorrhea in cervical samples obtained from patients during gynecological examinations. A total of 78,428, 119,451, and 117,494 samples from women age 12 to 75 years were retrospectively analyzed for the presence of T. vaginalis, C. trachomatis, and N. gonorrhea, respectively. T. vaginalis and C. trachomatis detection rates in Florida, New Jersey, and Texas were calculated in different age groups. The overall detection rate was 4.3% for T. vaginalis, 3.8% for C. trachomatis, and 0.6% for N. gonorrhea. The overall detection rate of T. vaginalis in Florida was 4.7% (n = 22,504), in New Jersey was 3.6% (n = 22,249), and in Texas was 4.5% (n = 33,675). Calculation of infection rates with T. vaginalis revealed differences between selected age groups with the highest detection rates in all 3 states found in age group 46 to 55 years (6.2%), which was higher than the overall detection rates in other age groups (p rate was found in age group 12 to 25 years (7.3%). The overall infection rates of T. vaginalis were higher compared with those of C. trachomatis and N. gonorrhea. Detection rates of T. vaginalis were found to be highest among women age 46 to 55 years and may be due to T. vaginalis infiltrating the subepithelial glands and being detected only during hormone-induced or antibiotic-induced changes in the vaginal flora.

  19. High-throughput double quantitative competitive polymerase chain reaction for determination of genetically modified organisms.

    Science.gov (United States)

    Mavropoulou, Anastasia K; Koraki, Theodora; Ioannou, Penelope C; Christopoulos, Theodore K

    2005-08-01

    Quantitative competitive polymerase chain reaction (PCR), especially the double competitive PCR methods (DC-PCR), have evolved as reliable approaches to quantification of genetically modified organisms (GMO) in food. However, DC-PCR is a low-throughput method because it requires titration of each sample with various amounts of a competitive internal standard, a protocol that involves several PCRs per sample followed by electrophoresis and densitometry. To address this drawback, we have developed a new method for GMO quantification, namely, a high-throughput double quantitative competitive PCR (HT-DCPCR). In HT-DCPCR, electrophoresis and densitometry are replaced by a rapid, microtiter well-based bioluminometric hybridization assay and there is no need for titration of each sample. The determination of GM soya was chosen as a model. We have constructed internal standards (DNA competitors) both for the 35S promoter sequence and for a plant-specific reference gene (lectin). The competitors have identical size and share the same primer binding sites with the target sequences but differ in a 24-bp internal segment. Each target sequence (35S and lectin) is coamplified with a constant amount (1000 copies) of the respective competitor. The four amplified fragments are hybridized with specific probes and captured on a universal solid phase to achieve simplicity and high throughput. The hybrids are determined by using streptavidin conjugated to the photoprotein aequorin. The ratio of the luminescence values obtained for the target and the competitor is linearly related to the starting amount of target DNA. The limit of quantification for the 35S promoter is 24 copies. The proposed method was evaluated by determining the GMO content of soybean powder certified reference materials. Also HT-DCPCR was compared to real-time PCR in a variety of real samples.

  20. Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Tashfeen, S.; Ahmed, S.; Bhatti, F.A.; Ali, N.

    2014-01-01

    Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

  1. Real-time polymerase chain reaction correlates well with clinical diagnosis of Clostridium difficile infection.

    Science.gov (United States)

    Berry, N; Sewell, B; Jafri, S; Puli, C; Vagia, S; Lewis, A M; Davies, D; Rees, E; Ch'ng, C L

    2014-06-01

    To determine the clinical utility of a rapid molecular assay for Clostridium difficile infection (CDI) in an acute hospital setting. From March to September 2011, stool specimens from inpatients in two acute hospitals with suspected CDI were tested prospectively by routine cell culture cytotoxin neutralization assay (CCNA), real-time polymerase chain reaction (PCR) using the GeneXpert (Cepheid Inc., Sunnyvale, CA, USA), and a dual testing algorithm [glutamate dehydrogenase (GDH)/toxin enzyme immuno-assay, Premier, Launch Diagnostics, Longfield, UK]. All patients with positive PCR, CCNA or discrepant results were reviewed by a multi-disciplinary team (treating clinician, gastroenterologist, microbiologist and infection control nurse). C. difficile detection rates were 11.7% (PCR), 6% (CCNA) and 13.8% (GDH). Out of 1034 stool specimens included in the study, 974 (94.1%) had concordant CCNA and PCR results. Eighty-nine percent (886/985) had concordant CCNA, PCR and GDH results, and 94.4% (930/985) had concordant GDH and PCR results. Using clinical diagnosis as the reference, PCR had sensitivity of 99.1%, specificity of 98.9%, positive predictive value (PPV) of 91.9% and negative predictive value (NPV) of 99.9%. CCNA on a single sample had sensitivity of 51%, specificity of 99.4%, PPV of 91.9% and NPV of 94.3%. GDH had sensitivity of 83.8%, specificity of 94.5%, PPV of 64.7% and NPV of 97.9%. Almost twice as many patients were positive by PCR compared with CCNA (121 vs 62); 54/59 of those with discrepant results were clinically confirmed as CDI. Rapid diagnosis of CDI using PCR was timely, accurate and correlated well with clinical diagnosis. Copyright © 2014 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  2. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis.

    Science.gov (United States)

    Ote, Isabelle; Taminiau, Bernard; Duprez, Jean-Noël; Dizier, Isabelle; Mainil, Jacques G

    2011-12-15

    Staphylococcus aureus is recognized worldwide as a pathogen causing many serious diseases in humans and animals, and is the most common aetiological agent of clinical and subclinical bovine mastitis. The importance of evaluating the combination of S. aureus virulence factors has been emphasized both in human and veterinary medicine, and knowledge about the genetic variability within different S. aureus populations would help in the design of efficient treatments. The aim of the present study was to determine the genetic profiles of S. aureus strains isolated from milk of cows suffering from clinical and subclinical mastitis in Belgium. The presence of about forty virulence-associated genes was investigated by specific polymerase chain reaction (PCR) amplification. A high number of genotypic subtypes were observed, demonstrating further the large variation in the presence of virulence genes in S. aureus isolates and the considerable diversity of strains populations that are able to cause mastitis in cows. In accordance with other studies, we showed that some genes are associated with mastitis-causing S. aureus isolates, whereas others are absent or rarely present. We also further highlighted the presence of conserved gene combinations, namely the enterotoxigenic egc-cluster and the bovine pathogenicity island SaPIbov. Importantly, the presence of isolates carrying genes coding for toxins involved in important human infections makes the milk of cows with mastitis a potential reservoir for these toxins, and therefore a potential danger in human health, which strengthens the importance to consider raw milk consumption and its processing very carefully. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY)

    OpenAIRE

    Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati

    2014-01-01

    Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...

  4. LISA data analysis using Markov chain Monte Carlo methods

    International Nuclear Information System (INIS)

    Cornish, Neil J.; Crowder, Jeff

    2005-01-01

    The Laser Interferometer Space Antenna (LISA) is expected to simultaneously detect many thousands of low-frequency gravitational wave signals. This presents a data analysis challenge that is very different to the one encountered in ground based gravitational wave astronomy. LISA data analysis requires the identification of individual signals from a data stream containing an unknown number of overlapping signals. Because of the signal overlaps, a global fit to all the signals has to be performed in order to avoid biasing the solution. However, performing such a global fit requires the exploration of an enormous parameter space with a dimension upwards of 50 000. Markov Chain Monte Carlo (MCMC) methods offer a very promising solution to the LISA data analysis problem. MCMC algorithms are able to efficiently explore large parameter spaces, simultaneously providing parameter estimates, error analysis, and even model selection. Here we present the first application of MCMC methods to simulated LISA data and demonstrate the great potential of the MCMC approach. Our implementation uses a generalized F-statistic to evaluate the likelihoods, and simulated annealing to speed convergence of the Markov chains. As a final step we supercool the chains to extract maximum likelihood estimates, and estimates of the Bayes factors for competing models. We find that the MCMC approach is able to correctly identify the number of signals present, extract the source parameters, and return error estimates consistent with Fisher information matrix predictions

  5. Differentiating Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii using nested polymerase chain reaction (PCR in rural communities in Malaysia

    Directory of Open Access Journals (Sweden)

    Ngui Romano

    2012-09-01

    Full Text Available Abstract Background In this study, a total of 426 human faecal samples were examined for the presence of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii infection via a combination of microscopic examination and nested polymerase chain reaction (PCR targeting 16S ribosomal RNA of Entamoeba species. Methods Faecal sample were collected from 426 participants in five rural villages in Peninsular Malaysia. The faecal samples were processed by direct wet smear and formalin ethyl acetate concentration technique followed by iodine staining and examined via microscopy for the presence of Entamoeba species and other intestinal parasites. Microscopically positive samples for Entamoeba species cysts were further characterized using a Nested Polymerase Chain Reaction (Nested-PCR targeting 16S-like ribosomal RNA gene. The data entry and analysis was carried out using the SPSS software (Statistical Package for the Social Sciences program for Windows version 17 (SPSS, Chicago, IL, USA. Results Based on single faecal examination, overall prevalence of Entamoeba infection was 17.6% (75/426. Females (19.1% were more commonly infected compared to males (15.9%. Comparison by age groups showed that adults (23.9% had higher infection rates than children (15.3%. The PCR results showed that 52 out of 75 microscopy positive samples successfully generated species-specific amplicons. The infection with E. histolytica (75.0%; 39/52 was the most common, followed by E. dispar (30.8%; 18/52 and E. moshkovskii (5.8%; 3/52. Of these, 33 (63.5% were shown to contain only E. histolytica, 10 (19.2% contained E. dispar and 3 (5.8% contained only E. moshkovskii. Mixed infection with E. histolytica and E. dispar was found in 6 (11.5% samples. Conclusions The present study essentially emphasized the benefit of molecular techniques in discriminating the pathogenic Entamoeba species from the non-pathogenic for accurate diagnosis and better management of amoebiasis. The

  6. Differentiating Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii using nested polymerase chain reaction (PCR) in rural communities in Malaysia.

    Science.gov (United States)

    Ngui, Romano; Angal, Lorainne; Fakhrurrazi, Siti Aminah; Lian, Yvonne Lim Ai; Ling, Lau Yee; Ibrahim, Jamaiah; Mahmud, Rohela

    2012-09-04

    In this study, a total of 426 human faecal samples were examined for the presence of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii infection via a combination of microscopic examination and nested polymerase chain reaction (PCR) targeting 16S ribosomal RNA of Entamoeba species. Faecal sample were collected from 426 participants in five rural villages in Peninsular Malaysia. The faecal samples were processed by direct wet smear and formalin ethyl acetate concentration technique followed by iodine staining and examined via microscopy for the presence of Entamoeba species and other intestinal parasites. Microscopically positive samples for Entamoeba species cysts were further characterized using a Nested Polymerase Chain Reaction (Nested-PCR) targeting 16S-like ribosomal RNA gene. The data entry and analysis was carried out using the SPSS software (Statistical Package for the Social Sciences) program for Windows version 17 (SPSS, Chicago, IL, USA). Based on single faecal examination, overall prevalence of Entamoeba infection was 17.6% (75/426). Females (19.1%) were more commonly infected compared to males (15.9%). Comparison by age groups showed that adults (23.9%) had higher infection rates than children (15.3%). The PCR results showed that 52 out of 75 microscopy positive samples successfully generated species-specific amplicons. The infection with E. histolytica (75.0%; 39/52) was the most common, followed by E. dispar (30.8%; 18/52) and E. moshkovskii (5.8%; 3/52). Of these, 33 (63.5%) were shown to contain only E. histolytica, 10 (19.2%) contained E. dispar and 3 (5.8%) contained only E. moshkovskii. Mixed infection with E. histolytica and E. dispar was found in 6 (11.5%) samples. The present study essentially emphasized the benefit of molecular techniques in discriminating the pathogenic Entamoeba species from the non-pathogenic for accurate diagnosis and better management of amoebiasis. The presence of E. moshkovskii is of great public health

  7. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Science.gov (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  8. Information technology portfolio in supply chain management using factor analysis

    Directory of Open Access Journals (Sweden)

    Ahmad Jaafarnejad

    2013-11-01

    Full Text Available The adoption of information technology (IT along with supply chain management (SCM has become increasingly a necessity among most businesses. This enhances supply chain (SC performance and helps companies achieve the organizational competitiveness. IT systems capture and analyze information and enable management to make decisions by considering a global scope across the entire SC. This paper reviews the existing literature on IT in SCM and considers pertinent criteria. Using principal component analysis (PCA of factor analysis (FA, a number of related criteria are divided into smaller groups. Finally, SC managers can develop an IT portfolio in SCM using mean values of few extracted components on the relevance –emergency matrix. A numerical example is provided to explain details of the proposed method.

  9. Importance of housekeeping gene selection for accurate reverse transcription-quantitative polymerase chain reaction in a wound healing model.

    Science.gov (United States)

    Turabelidze, Anna; Guo, Shujuan; DiPietro, Luisa A

    2010-01-01

    Studies in the field of wound healing have utilized a variety of different housekeeping genes for reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. However, nearly all of these studies assume that the selected normalization gene is stably expressed throughout the course of the repair process. The purpose of our current investigation was to identify the most stable housekeeping genes for studying gene expression in mouse wound healing using RT-qPCR. To identify which housekeeping genes are optimal for studying gene expression in wound healing, we examined all articles published in Wound Repair and Regeneration that cited RT-qPCR during the period of January/February 2008 until July/August 2009. We determined that ACTβ, GAPDH, 18S, and β2M were the most frequently used housekeeping genes in human, mouse, and pig studies. We also investigated nine commonly used housekeeping genes that are not generally used in wound healing models: GUS, TBP, RPLP2, ATP5B, SDHA, UBC, CANX, CYC1, and YWHAZ. We observed that wounded and unwounded tissues have contrasting housekeeping gene expression stability. The results demonstrate that commonly used housekeeping genes must be validated as accurate normalizing genes for each individual experimental condition. © 2010 by the Wound Healing Society.

  10. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  12. Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

    Science.gov (United States)

    Lily; Siregar, Y.; Ilyas, S.

    2018-03-01

    This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

  13. Babesia bovis and B. bigemina DNA detected in cattle and ticks from Zimbabwe by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    I. Smeenk

    2000-07-01

    Full Text Available From blood collected from 94 cattle at 12 locations in the eastern and northeastern areas of Zimbabwe, DNA was extracted and analysed by polymerase chain reaction with primers previously reported to be specific for Babesia bigemina and Babesia bovis. Overall, DNA of Babesia bigemina was detected in the blood of 33/94 (35 % cattle and DNA from B. bovis was detected in 27/58 (47 % of cattle. The prevalence of DNA of B. bigemina was significantly higher in young animals (<2 years (23/46 than in animals over 2 years of age (10/48; (chi2 = 8.77; P < 0.01 %. Although tick sampling was not thorough, Boophilus decoloratus could be collected at 7/9 sites sampled and Boophilus microplus at 4/9 sites. Of the 20 B. decoloratus allowed to oviposit before PCR analysis, 1 (5 % contained DNA that could be amplified with primers for B. bigemina while 12 (60 % were positive with primers for B. bovis. Of the B. microplus allowed to oviposit, 11/16 (69 % were positive for B. bovis DNAby PCR and 2/16 (12 % were positive for B. bigemina.

  14. Role of microbiological culture and polymerase chain reaction (PCR) of actinomyces in medication-related osteonecrosis of the jaw (MRONJ).

    Science.gov (United States)

    Panya, Sappasith; Fliefel, Riham; Probst, Florian; Tröltzsch, Matthias; Ehrenfeld, Michael; Schubert, Sören; Otto, Sven

    2017-03-01

    We hypothesized that local infection plays a critical role in the pathogenesis of medication-related osteonecrosis of the jaw (MRONJ). Recent developments in molecular methods have revolutionized new approaches for the rapid detection of microorganisms including those difficult to culture. The aim of our study is to identify the bacterial profiles in MRONJ by microbiological culture and polymerase chain reactions (PCR). A retrospective analysis was performed on MRONJ patients from 2008 to 2014. The bacterial profile from MRONJ bone samples was determined using microbiological culture and PCR. Ninety five patients fulfilled the inclusion criteria with mean age of 69.85 ± 8.71 years. A female predilection was detected. The mandible was more commonly affected than maxilla. Tooth extraction was the frequent triggering factor. Breast cancer was the primary cause for administration and intravenous bisphosphonates were the most commonly administrated antiresorptive drugs. The majority of patients were classified as stage 2. Posterior teeth were most commonly affected. Based on bone culture results, the most common microorganism were both actinomyces and mixed flora. PCR confirmed the presence of actinomyces in 55 patients. Our data suggest that PCR might be an innovative method for detection of microorganisms difficult to culture using traditional microbiological techniques. Copyright © 2017 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  15. Detection of low numbers of pathogenic Yersinia enterocolitica in environmental water and sewage samples by nested polymerase chain reaction.

    Science.gov (United States)

    Waage, A S; Vardund, T; Lund, V; Kapperud, G

    1999-12-01

    Isolation of pathogenic Yersinia enterocolitica from water and sewage by traditional culture techniques is time-consuming and subsequent differentiation between pathogenic and non-pathogenic strains can be difficult and unreliable. A nested polymerase chain reaction (PCR) procedure was used for the detection of low numbers of Y. enterocolitica in spiked samples from natural surface sources with variable background flora ranging from oligotrophic water to sewage. Water and sewage samples were filtered and filters enriched overnight in a non-selective medium. Nested PCR conducted on enriched broth, prepared by use of a rapid and simple preparation step consisting of centrifugation, proteinase K treatment and boiling, enabled the detection of 8-17 cfu 100 ml-1 water with background levels of up to 8700 heterotrophic organisms ml-1 and 10,000 cfu coliform organisms 100 ml-1 water. The analysis can be completed within 2-3 d and should be a significant tool in monitoring environmental waters and drinking water sources for the presence of pathogenic Y. enterocolitica.

  16. A novel polymerase chain reaction method for detection of human immunodeficiency virus in dried blood spots on filter paper.

    Science.gov (United States)

    Yourno, J; Conroy, J

    1992-11-01

    A method for detection of proviral human immunodeficiency virus DNA in dried blood spots on filter paper by direct polymerase chain reaction (PCR) has been developed. To develop the method, a standard system was used which was prepared from cells each containing a single integrated provirus and titrated with normal donor blood. This rapid procedure provides virtually quantitative yields of nuclear DNA and exploits most of the standard methodology described for blood specimens. A nested PCR using SK38-SK39 gag as the internal primer pair was also designed; this PCR detected a single copy of provirus per filter at near theoretical frequency with SK19 probe. The utility of the procedure was demonstrated with clinical specimens. Blood spot filters from human immunodeficiency virus-infected and uninfected individuals were readily and unequivocally discriminated. The method is designed for ultimate use with large (1.5-ml) sample preparation tubes that are compatible as PCR tubes with thermal cyclers. This will permit convenient, direct single-tube PCR of dried blood specimens on filters. It should be adaptable to analysis of dried blood spots for a variety of infectious or genetic diseases.

  17. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    International Nuclear Information System (INIS)

    Khan, S. A.; Ahmed, S.; Khan, F. A.; Shamshad, G. U.; Joyia, Z.; Mushahid, N.; Saeed, S.

    2013-01-01

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  18. Polymerase chain reaction for the evaluation of Schistosoma mansoni infection in two low endemicity areas of Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Gabriel Costa de Carvalho

    2012-11-01

    Full Text Available This study aimed to evaluate the occurrence of schistosomiasis in areas with low endemicity using polymerase chain reaction (PCR as a diagnostic method. We analysed faecal samples from 219 individuals residing in Piau and Coronel Pacheco, state of Minas Gerais, Brazil, using a single faecal sample from each individual and two slides of the Kato-Katz technique as a gold standard. Fifteen out of the 219 samples were positive with both methods of diagnosis. One sample was diagnosed as positive by the Kato-Katz technique only and 61 were diagnosed only by PCR. The positivity rates were 7.3% with the Kato-Katz method and 34.7% with PCR. When both techniques were assumed to have 100% specificity and positive individuals were identified by both methods, the sensitivity of the Kato-Katz method was 20.8% and the PCR sensitivity was 98.7%. The Kappa index between the two techniques was 0.234, suggesting weak agreement. The assessment of a single faecal sample by PCR detected more cases of infection than the analysis of one sample with two slides using the Kato-Katz technique, suggesting that PCR can be a useful diagnostic tool, particularly in areas with low endemicity.

  19. Detection of retinoblastoma gene deletions in spontaneous and radiation-induced mouse lung adenocarcinomas by polymerase chain reaction

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-01-01

    A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs

  20. High-throughput vector-borne disease environmental surveillance by polymerase chain reaction according to international accreditation requirements.

    Science.gov (United States)

    Soehnlen, Marty K; Crimmins, Stephen L; Clugston, Andrew S; Gruhn, Nina; Gomez, Carlos J; Cross, Michael E; Statham, Charles N

    2014-01-01

    Although vector-borne diseases are specific to the region of the host, there is a necessity for surveillance or reference laboratories to perform standardized, high-throughput testing capable of meeting the needs of a changing military environment and response efforts. The development of standardized, high-throughput, semiquantitative real-time and reverse transcription real-time polymerase chain reaction (PCR) methods allows for the timely dissemination of data to interested parties while providing a platform in which long-term sample storage is possible for the testing of new pathogens of interest using a historical perspective. PCR testing allows for the analysis of multiple pathogens from the same sample, thus reducing the workload of entomologists in the field and increasing the ability to determine if a pathogen has spread beyond traditionally defined locations. US Army Public Health Command Region-Europe (USAPHCR-Europe) Laboratory Sciences (LS) has standardized tests for 9 pathogens at multiple life stages. All tests are currently under international accreditation standards. Using these PCR methods and laboratory model, which have universal Department of Defense application, the USAPHCR-Europe LS will generate quality data that is scientifically sound and legally defensible to support force health protection for the US military in both deployed and garrison environments.