WorldWideScience

Sample records for chain reaction analysis

  1. Mathematics analysis of polymerase chain reaction kinetic curves.

    Science.gov (United States)

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V

    2016-01-01

    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  2. Chain reaction

    International Nuclear Information System (INIS)

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  3. Analysis of human cytomegalovirus using the polymerase chain reaction.

    Science.gov (United States)

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  4. Detection and analysis of polymerase chain reaction products by mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  5. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    Science.gov (United States)

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  6. Diagnostic RAS mutation analysis by polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Ian A. Cree

    2016-06-01

    Full Text Available RAS mutation analysis is an important companion diagnostic test. Treatment of colorectal cancer with anti-Epidermal Growth Factor Receptor (EGFR therapy requires demonstration of RAS mutation status (both KRAS and NRAS, and it is good practice to include BRAF. In Non-Small Cell Lung Cancer (NSCLC and melanoma, assessment of RAS mutation status can be helpful in triaging patient samples for more extensive testing. This mini-review will discuss the role of PCR methods in providing rapid diagnostic information for cancer patients.

  7. Polymerase chain reaction

    OpenAIRE

    Gaurav Solanki

    2015-01-01

    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  8. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    OpenAIRE

    2012-01-01

    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  9. Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Gaurav Solanki

    2012-10-01

    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  10. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti

    2011-01-01

    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  11. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-06-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted.

  12. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.;

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...

  13. Supply chain reaction

    International Nuclear Information System (INIS)

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  14. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    Science.gov (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  15. Analysis of polymorphism in the bovine casein genes by use of the polymerase chain reaction.

    Science.gov (United States)

    Pinder, S J; Perry, B N; Skidmore, C J; Savva, D

    1991-01-01

    Methods have been devised for detecting polymorphisms in the bovine beta- and kappa-casein genes using the polymerase chain reaction (PCR) followed either by restriction enzyme digestion (to reveal a restriction fragment length polymorphism (RFLP] or by hybridization of an allele-specific oligonucleotide. These methods, as well as being faster and more sensitive than traditional RFLP methods, are of more general applicability since they can detect any change in DNA sequence. They require only a small sample of blood or semen and are applicable to animals of any age or sex. These methods make possible large-scale screening and thus selection for alleles at these loci. Typing of blood DNA can give erroneous results when the animal concerned is a twin; however, this can be overcome by retesting using milk or semen. Analysis of the kappa-casein genotype of Holstein-Friesian bulls gives frequencies for the A and B alleles of 0.80 and 0.20 respectively. Selection in favour of the B allele, which is superior for cheese production, could thus have a large effect. The A3 and B alleles at the beta-casein locus have been shown to be rare in the Holstein-Friesian population. Linkage disequilibrium exists between beta-casein B and kappa-casein B.

  16. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;

    2015-01-01

    Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  17. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Santos, M S; Souza, E S; S Junior, R M; Talhari, S; Souza, J V B

    2010-08-01

    Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP). More specifically: a) to evaluate 3 different amplification regions, b) to investigate 3 different restriction enzymes, and c) to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2) were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel) produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas--FMTAM) were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  18. Early detection of Brucella canis via quantitative polymerase chain reaction analysis.

    Science.gov (United States)

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A

    2014-02-01

    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  19. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. (Univ. of Illinois, Chicago (USA)); Wunder, J.S.; Andrulis, I.L. (Mount Sinai Hospital, Toronto, Ontario (Canada)); Gazdar, A.F. (National Cancer Inst., Bethesda, MD (USA)); Willman, C.L.; Griffith, B. (Univ. of New Mexico, Albuquerque (USA)); Von Hoff, D.D. (Univ. of Texas, San Antonio (USA))

    1990-09-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  20. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    Science.gov (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  1. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  2. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  3. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  4. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF

    2000-01-01

    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  5. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota

    2012-01-01

    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  6. Analysis of adult otitis media: polymerase chain reaction versus culture for bacteria and viruses.

    Science.gov (United States)

    Liederman, E M; Post, J C; Aul, J J; Sirko, D A; White, G J; Buchman, C A; Ehrlich, G D

    1998-01-01

    Recent studies using the polymerase chain reaction (PCR) have identified bacterial and viral genomic sequences in culture-negative pediatric middle ear effusions. To evaluate this technique in adults, 19 effusions were analyzed to compare bacterial and viral culture and PCR detection of Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and adenovirus. Effusions from 4 subjects positive for human immunodeficiency virus (HIV) were analyzed by PCR for HIV virus. Three of 19 effusions were culture-positive for bacteria, and 0 of 19 for viruses. Fifteen of 19 effusions were PCR-positive for bacterial genomic sequences, and 0 of 19 for adenovirus. Thirteen of 15 PCR-positive specimens demonstrated S pneumoniae, 5 of 15 H influenzae, and 0 of 13 M catarrhalis. All 4 effusions from HIV-positive subjects were PCR-positive for HIV. No effusion was culture-positive and PCR-negative. These results confirm that culture-negative middle ear effusions contain genomic sequences from bacterial pathogens. Finding of HIV RNA and DNA in effusion from HIV-positives suggests replicating virus in this fluid.

  7. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  8. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  9. Extraction of DNA from exfoliative cytology specimens and its suitability for analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Payne, J; Bell, S; Lewis, F A; Taylor, G R; Peel, K R; Sutton, J; Quirke, P

    1990-01-01

    The extraction of DNA from archival exfoliative cytology samples would allow the molecular biological analysis of this readily available material using the polymerase chain reaction (PCR). We have quantitatively and qualitatively studied the extraction of DNA from a variety of cytological preparations. For both fresh and archival cervical smears, overnight incubation with proteinase K produces high yields of high molecular weight DNA, but simply boiling the samples produces DNA suitable for PCR amplification of a single copy gene. Increasing the proteinase K incubation to several days allows the extraction of DNA from fixed and stained archival cytology slides from a variety of sites. The extracted DNA was again suitable for PCR analysis. Fresh and archival cytological material can be utilized for molecular biological study of disease processes using PCR. Archival cytological material is probably the best source of DNA and RNA after stored frozen tissue.

  10. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO;

    1993-01-01

    CP-specific B lymphocytes were isolated by antigen-coated immunomagnetic beads. After the purification, at least 98% of the immunoglobulin-secreting recovered cells were HibCP specific. The RNA was isolated and amplified by cDNA synthesis using a kappa constant region primer followed by polymerase chain...... reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...

  11. The chain re-action

    CERN Multimedia

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  12. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.;

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot...

  13. Testing vaccines in human experimental malaria: statistical analysis of parasitemia measured by a quantitative real-time polymerase chain reaction.

    NARCIS (Netherlands)

    Hermsen, C.C.; Vlas, S.J. de; Gemert, G.J.A. van; Telgt, D.S.C.; Verhage, D.F.; Sauerwein, R.W.

    2004-01-01

    Clinical trials are an essential step in evaluation of safety and efficacy of malaria vaccines, and human experimental malaria infections have been used for evaluation of protective immunity of Plasmodium falciparum malaria. In this study, a quantitative real-time polymerase chain reaction was used

  14. Polymorphism analysis of Chinese Theileria sergenti using allele-specific polymerase chain reaction of the major piroplasm surface protein gene.

    Science.gov (United States)

    Liu, Ai Hong; Guan, Gui Quan; Liu, Jun Long; Liu, Zhi Jie; Leblanc, Neil; Li, You Quan; Gao, Jin Liang; Ma, Mi Ling; Niu, Qing Li; Ren, Qiao Yun; Bai, Qi; Yin, Hong; Luo, Jian Xun

    2011-02-01

    Theileria sergenti is a tick-borne parasite found in many parts of the world. The major piroplasm surface protein (MPSP), a conserved protein in all Theileria species, has been used as a marker for epidemiological and phylogenetic studies of benign Theileria species. In this study, Chinese species of T. sergenti were characterized by allele-specific polymerase chain reaction (PCR) and DNA sequence analysis of the MPSP gene. Using universal or allele-specific primer sets for PCR amplification of the MPSP gene, 98 of 288 cattle blood samples, collected from 6 provinces in China, were found to be positive. Among the positive samples, only 3 allelic MPSP gene types (Chitose [C]-, Ikeda [I]-, and buffeli [B]-type) were successfully amplified. Moreover, the results revealed that the majority of the parasites sampled in this study were C- and I-type (prevalence of 84 and 69%, respectively), whereas the B-type was less common (prevalence of 36%). Co-infections with C-, I-, and B-type T. sergenti also were found. An additional known allele, Thai-type, was not detected. Phylogenetic analysis based on the MPSP gene sequences, including 3 standard stocks generated in the laboratory ( T. sergenti Wenchuan, T. sergenti Ningxian, and T. sergenti Liaoyang), revealed that the isolates of Chinese sergenti were comprised of at least 4 allelic MPSP gene types, i.e., C-, I-, B1-, and B2-type, and these parasites with 6 MPSP types 1-5 and 7 were present in China.

  15. Primer-introduced restriction analysis polymerase chain reaction method for non-invasive prenatal testing of β-thalassemia.

    Science.gov (United States)

    Liu, Saijun; Chen, Liyuan; Zhang, Xiandong; Li, Jian; Lin, Haiying; Liu, Louhui; Xie, Jiansheng; Ge, Huijuan; Ye, Minglan; Chen, Caifen; Ji, Xingwen; Zhang, Caifen; Xu, Fengping; Jiang, Hui; Zhen, Hefu; Chen, Shiping; Wang, Wei

    2015-01-01

    We have developed a new method for non-invasive prenatal testing (NIPT) of paternally inherited fetal mutants for β-thalassemia (β-thal). Specially designed primer-introduced restriction analysis-polymerase chain reaction (PIRA-PCR) were used to detect four major mutations [IVS-II-654, HBB: c.316-197C > T; codon 17 (A > T), HBB: c.52A > T; -28 (A > G), HBB: c.-78A > G and codons 41/42 (-TTCT), HBB: c.126_129delCTTT] causing β-thal in China. The PIRA-PCR assay was first tested in a series of mixed DNA with different concentrations and mixed proportions. Subsequently, this assay was further tested in 10 plasma DNA samples collected from pregnant women. In the DNA mixture simulation test, the PIRA-PCR assay was able to detect 3.0% target genomic DNA (gDNA) mixed in 97.0% wild-type gDNA isolated from whole blood. For plasma DNA testing, the results detected by PIRA-PCR assay achieved 100.0% consistency with those obtained from the amniocentesis analysis. This new method could potentially be used for NIPT of paternally inherited fetal mutants for β-thal.

  16. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription

    Institute of Scientific and Technical Information of China (English)

    Stephen Johnston; Zachary Gallaher; Krzysztof Czaja

    2012-01-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2-ΔΔCt normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  17. Detection of congenital cytomegalovirus infection by real-time polymerase chain reaction analysis of saliva or urine specimens.

    Science.gov (United States)

    Ross, Shannon A; Ahmed, Amina; Palmer, April L; Michaels, Marian G; Sánchez, Pablo J; Bernstein, David I; Tolan, Robert W; Novak, Zdenek; Chowdhury, Nazma; Fowler, Karen B; Boppana, Suresh B

    2014-11-01

    Viral culture of urine or saliva has been the gold standard technique for the diagnosis of congenital cytomegalovirus (CMV) infection. Results of rapid culture and polymerase chain reaction (PCR) analysis of urine and saliva specimens from 80 children were compared to determine the clinical utility of a real-time PCR assay for diagnosis of congenital CMV infection. Results of urine PCR were positive in 98.8% of specimens. Three PCR-positive urine samples were culture negative. Results of saliva PCR and culture were concordant in 78 specimens (97.5%). Two PCR-positive saliva samples were culture negative. These findings demonstrate that PCR performs as well as rapid culture of urine or saliva specimens for diagnosing congenital CMV infection and saliva specimens are easier to collect. Because PCR also offers more rapid turnaround, is unlikely to be affected by storage and transport conditions, has lower cost, and may be adapted to high-throughput situations, it is well suited for targeted testing and large-scale screening for CMV.

  18. Identification of roots of woody species using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis

    Science.gov (United States)

    Bobowski; Hole; Wolf; Bryant

    1999-03-01

    Within the last two decades, substantial progress has been made in understanding seed-bank dynamics and the contribution of the soil seed bank to a postdisturbance plant community. There has been relatively little progress, however, in understanding perennial bud-bank dynamics and the contribution of the soil bud bank to secondary succession. This lack of information is due primarily to the inability to reliably identify roots, rhizomes and lignotubers that lie dormant beneath the soil surface. This investigation addressed the issue of identification of below-ground woody structures. The first objective was to develop a method that used molecular tools to identify woody plant species from subsoil tissue samples. The second objective was to develop a key in which molecular markers served as criteria for the identification and differentiation of selected tree and shrub species common to the mountains of northeast Oregon and southeast Washington. Application of restriction fragment length polymorphism (RFLP) analysis of polymerase chain reaction (PCR)-amplified rbcL appears to be a reliable method to identify and differentiate 15 plants to the genus level. Two restriction enzymes, DpnII and HhaI, provided restriction site polymorphisms in the PCR product. The fragment number and length were used to develop an identification key. However, plants not analysed in this 'exploratory key' might share the same banding patterns, resulting in a false identification of unknowns. PMID:10199009

  19. Value of Candida polymerase chain reaction and vaginal cytokine analysis for the differential diagnosis of women with recurrent vulvovaginitis.

    OpenAIRE

    Stephanie Weissenbacher; Witkin, Steven S.; Vera Tolbert; Paulo Giraldo; Iara Linhares; Andrea Haas; E. Rainer Weissenbacher; Ledger, William J.

    2000-01-01

    Objectives: Recurrent vulvovaginitis remains difficult to diagnose accurately and to treat. The present investigation evaluated the utility of testing vaginal specimens from women with symptomatic recurrent vulvovaginitis for Candida species by polymerase chain reaction (PCR) and for cytokine responses.Methods: Sixty-one consecutive symptomatic women with pruritus, erythema, and/or a thick white discharge and a history of recurrent vulvovaginitis and 31 asymptomatic women with no such history...

  20. Analysis of colorectal cancer and polyp for presence herpes simplex virus and cytomegalovirus DNA sequences by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sahar Mehrabani khasraghi

    2016-05-01

    Full Text Available Introduction: In recent years, it was demonstrated that there is a clear association between the complicated course of colorectal cancer (CRC and the presence of herpes viruses. Despite a great number of published reports, the exact pathogenic role of herpes viruses remains unclear in these patients. The purpose of this study is to explore the prevalence of herpes simplex virus (HSV and cytomegalovirus (CMV in patients with CRC and polyp in comparison with healthy subjects using the polymerase chain reaction (PCR method. Methods: In this case-control study, 15 biopsies of patients with CRC and 20 colorectal polyp sample were selected. From each patient, two tissue samples were obtained: one sample from malignant tissue, and the other from normal colorectal tissue in an area located 15 cm away from the malignant tissue. Furthermore, 35 samples from healthy people as controls were selected. After DNA extraction, PCR was used to determine HSV and CMV genomes by specific primers. A statistical analysis was performed using the chi-square test. Results: Five CRC patients (33.3% had HSV DNA detected in both the malignant and the matched normal tissue. Five CRC patients (33.3% and seven polyp patients (35.0% had CMV DNA detected in both the malignant and the matched normal tissue. HSV DNA was found in 20% and CMV DNA in 37.1% of samples from healthy people as a control group. Thus, no significant association was observed between the prevalence of HSV and CMV, and an incidence of CRC and polyps according to the location of the samples as compared with the control group. Conclusion: The findings demonstrated that there is no direct molecular evidence to support the association between HSV and CMV and human colorectal malignancies. However, the results from this study do not exclude a possible oncogenic role of these viruses in the neoplastic development of colon cells.

  1. Analysis of the rDNA internal transcribed spacer region of the Fusarium species by polymerase chain reaction-restriction fragment length polymorphism

    OpenAIRE

    Zarrin, Majid; GANJ, FARZANEH; FARAMARZI, SAMA

    2016-01-01

    The Fusarium species are a widely spread phytopathogen identified in an extensive variety of hosts. The Fusarium genus is one of the most heterogeneous fungi and is difficult to classify. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis is a useful method in detection of DNA polymorphism in objective sequences. The aim of the present study was to identify the phylogenetic associations and usefulness of the internal transcribed spacer (ITS) region as a gen...

  2. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...

  3. Polymerase Chain Reaction for Educational Settings.

    Science.gov (United States)

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  4. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach

    Directory of Open Access Journals (Sweden)

    Iñiguez Alena M

    2003-01-01

    Full Text Available The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences.

  5. The polymerase chain reaction (PCR): general methods.

    Science.gov (United States)

    Waters, Daniel L E; Shapter, Frances M

    2014-01-01

    The polymerase chain reaction (PCR) converts very low quantities of DNA into very high quantities and is the foundation of many specialized techniques of molecular biology. PCR utilizes components of the cellular machinery of mitotic cell division in vitro which respond predictably to user inputs. This chapter introduces the principles of PCR and discusses practical considerations from target sequence definition through to optimization and application.

  6. Leishmania spp. identification by polymerase chain reaction-restriction fragment length polymorphism analysis and its applications in French Guiana.

    Science.gov (United States)

    Simon, Stéphane; Veron, Vincent; Carme, Bernard

    2010-02-01

    Leishmania (Viannia) guyanensis was for many years the only species commonly identified in French Guiana, but precise species identifications were quite rare. We describe a new restriction fragment length polymorphism-polymerase chain reaction technique using a 615-bp fragment of the RNA polymerase II gene and 2 restriction enzymes, TspRI and HgaI. Seven reference strains (Leishmania (Leishmania) amazonensis, Leishmania (Viannia) lainsoni, Leishmania (Viannia) braziliensis, L. (V.) guyanensis, Leishmania (Viannia) naiffi, Leishmania (Leishmania) major, Leishmania (Leishmania) infantum) and 112 clinical samples from positive lesions were used for the development of the technique. The rates of positive species identification were 85.7% for punch skin biopsy specimens, 93.1% for positive Giemsa-stained smears, and 100% for positive culture supernatants. In the framework of cutaneous leishmaniasis species surveillance for the 2006 to 2008 period, parasite identification was carried out for 199 samples from different patients. The prevalence of the various Leishmania spp. was 84.4% for L. (V.) guyanensis, 8.0% for L. (V.) braziliensis, 5.0% for L. (L.) amazonensis, and 2.6% for L. (V.) lainsoni. L. (V.) braziliensis seems to be locally an emerging pathogen.

  7. Haplotyping using a combination of polymerase chain reaction-single-strand conformational polymorphism analysis and haplotype-specific PCR amplification.

    Science.gov (United States)

    Zhou, Huitong; Li, Shaobin; Liu, Xiu; Wang, Jiqing; Luo, Yuzhu; Hickford, Jon G H

    2014-12-01

    A single nucleotide polymorphism (SNP) may have an impact on phenotype, but it may also be influenced by multiple SNPs within a gene; hence, the haplotype or phase of multiple SNPs needs to be known. Various methods for haplotyping SNPs have been proposed, but a simple and cost-effective method is currently unavailable. Here we describe a haplotyping approach using two simple techniques: polymerase chain reaction-single-strand conformational polymorphism (PCR-SSCP) and haplotype-specific PCR. In this approach, individual regions of a gene are analyzed by PCR-SSCP to identify variation that defines sub-haplotypes, and then extended haplotypes are assembled from the sub-haplotypes either directly or with the additional use of haplotype-specific PCR amplification. We demonstrate the utility of this approach by haplotyping ovine FABP4 across two variable regions that contain seven SNPs and one indel. The simplicity of this approach makes it suitable for large-scale studies and/or diagnostic screening.

  8. Randomly amplified polymorphic DNA-polymerase chain reaction analysis of two different populations of cultured Korean catfish Silurus asotus

    Indian Academy of Sciences (India)

    Jong-Man Yoon; Gye-Woong Kim

    2001-12-01

    Genetic similarity and diversity of cultured catfish Silurus asotus populations collected from two areas in western Korea were examined using randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR). Out of 20 random primers tested, 5 produced 1344 RAPD bands ranging from 8.2 to 13.6 polymorphic bands per primer. The polymorphic bands in these populations ranged from 56.4% to 59.6%. Polymorphic bands per lane within populations ranged from 4.9% to 5.3%. The similarity within the Kunsan population varied from 0.39 to 0.82 with a mean (± SD) of 0.56 ± 0.08. The level of bandsharing values was 0.59 ± 0.07 within the catfish population from Yesan. The genetic similarity in cultured catfish populations may have been caused because individuals from two populations were reared in the same environmental conditions or by inbreeding during several generations. However, in view of bandsharing values, polymorphic bands and also the specific major bands that were inter-population-specific, significant genetic differentiation between these populations were present even if bandsharing (BS) values were somewhat numerically different. Therefore, the number of RAPD polymorphisms identified in this study may be sufficient to permit estimating genetic similarity and diversity. However, in future, additional populations, sampling sites and individuals will be necessary to make up for these weak points.

  9. Detection of Listeria monocytogenes by using the polymerase chain reaction

    International Nuclear Information System (INIS)

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  10. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  11. [The contamination under polymerase chain reaction studies: problems and solutions].

    Science.gov (United States)

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  12. Bcl-1 gene rearrangements in mantle cell lymphoma : A comprehensive analysis of 118 cases, including B-5-fixed tissue, by polymerase chain reaction and southern transfer analysis

    NARCIS (Netherlands)

    Chibbar, R; Leung, K; McCormick, S; Ritzkalla, K; Strickler, J; Staggs, R; Poppema, S; Brunning, RD; McGlennen, RC

    1998-01-01

    We evaluated 118 cases of mantle cell lymphoma by polymerase chain reaction (PCR) for the major translocation cluster (MIG) region and another breakpoint corresponding to probe p94(PS), located 24 kb telomeric to the MTC locus on chromosome 11. The specimens included 64 frozen, 19 formalin-fixed, an

  13. Avian haemosporidian parasites (Haemosporida): A comparative analysis of different polymerase chain reaction assays in detection of mixed infections.

    Science.gov (United States)

    Bernotienė, Rasa; Palinauskas, Vaidas; Iezhova, Tatjana; Murauskaitė, Dovilė; Valkiūnas, Gediminas

    2016-04-01

    Mixed infections of different species and genetic lineages of haemosporidian parasites (Haemosporida) predominate in wildlife, and such infections are particularly virulent. However, currently used polymerase chain reaction (PCR)-based detection methods often do not read mixed infections. Sensitivity of different PCR assays in detection of mixed infections has been insufficiently tested, but this knowledge is essential in studies addressing parasite diversity in wildlife. Here, we applied five different PCR assays, which are broadly used in wildlife avian haemosporidian research, and compared their sensitivity in detection of experimentally designed mixed infections of Haemoproteus and Plasmodium parasites. Three of these PCR assays use primer sets that amplify fragments of cytochrome b gene (cyt b), one of cytochrome oxidase subunit I (COI) gene, and one target apicoplast genome. We collected blood from wild-caught birds and, using microscopic and PCR-based methods applied in parallel, identified single infections of ten haemosporidian species with similar parasitemia. Then, we prepared 15 experimental mixes of different haemosporidian parasites, which often are present simultaneously in wild birds. Similar concentration of total DNA was used in each parasite lineage during preparation of mixes. Positive amplifications were sequenced, and the presence of mixed infections was reported by visualising double-base calling in sequence electropherograms. This study shows that the use of each single PCR assay markedly underestimates biodiversity of haemosporidian parasites. The application of at least 3 PCR assays in parallel detected the majority, but still not all lineages present in mixed infections. We determined preferences of different primers in detection of parasites belonging to different genera of haemosporidians during mixed infections.

  14. Transformational leadership: a cascading chain reaction.

    Science.gov (United States)

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  15. [Species identification of grouper and snapper in Taiwan Strait using polymerase chain reaction-restriction fragment length polymorphism analysis and lab-on-a-chip system].

    Science.gov (United States)

    Chen, Shuangya; Zhang, Jin; Chen, Weiling; Xu, Dunming; Zhou, Yu

    2011-07-01

    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis and lab-on-a-chip system were used to identify grouper and snapper species in Taiwan Strait. A fragment of 464 bp length of mitochondrial cytochrome b gene was amplified by PCR and the products were digested with restriction enzymes Dde I , Hae III and NLa III, individually. The fragments generated after digestion were further resolved on the DNA Chip. Eight grouper species and five snapper species were successfully identified. The results demonstrated that PCR-RFLP analysis and lab-on-a-chip system provide a fast, easy, automated, and reliable analysis approach. This approach is potential for the purpose of fish adulteration control.

  16. Degenerate Oligonucleotide Primed-Polymerase Chain Reaction-Based Array Comparative Genomic Hybridization for Extensive Amplicon Profiling of Breast Cancers : A New Approach for the Molecular Analysis of Paraffin-Embedded Cancer Tissue

    OpenAIRE

    Daigo, Yataro; Chin, Suet-Feung; Gorringe, Kylie L.; Bobrow, Lynda G; Bruce A J Ponder; Pharoah, Paul D P; Caldas, Carlos

    2001-01-01

    We have developed a protocol for degenerate oligonucleotide-primed-polymerase chain reaction-based array comparative genomic hybridization (array CGH) that, when combined with a laser microdissection technique, allows the analysis of cancer cell populations isolated from routine, formalin-fixed, paraffin-embedded tissue samples. Comparison of copy number changes detected by degenerate oligonucleotide-primed-polymerase chain reaction-based array CGH to those detected by conventional array CGH ...

  17. Leading coordinate analysis of reaction pathways in proton chain transfer: Application to a two-proton transfer model for the green fluorescent protein

    International Nuclear Information System (INIS)

    The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information

  18. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  19. Polymerase Chain Reaction on a Viral Nanoparticle.

    Science.gov (United States)

    Carr-Smith, James; Pacheco-Gómez, Raúl; Little, Haydn A; Hicks, Matthew R; Sandhu, Sandeep; Steinke, Nadja; Smith, David J; Rodger, Alison; Goodchild, Sarah A; Lukaszewski, Roman A; Tucker, James H R; Dafforn, Timothy R

    2015-12-18

    The field of synthetic biology includes studies that aim to develop new materials and devices from biomolecules. In recent years, much work has been carried out using a range of biomolecular chassis including α-helical coiled coils, β-sheet amyloids and even viral particles. In this work, we show how hybrid bionanoparticles can be produced from a viral M13 bacteriophage scaffold through conjugation with DNA primers that can template a polymerase chain reaction (PCR). This unprecedented example of a PCR on a virus particle has been studied by flow aligned linear dichroism spectroscopy, which gives information on the structure of the product as well as a new protototype methodology for DNA detection. We propose that this demonstration of PCR on the surface of a bionanoparticle is a useful addition to ways in which hybrid assemblies may be constructed using synthetic biology.

  20. [Polymerase chain reaction and its application].

    Science.gov (United States)

    Sárosi, I; Gerald, E; Girish, V N

    1992-07-01

    The polymerase chain reaction (PCR) is one of the most important new methods in molecular biology. It is widely used in genetic and anthropologic basic research, in oncology and virology, in all those fields, where molecular biologic methods can give answers to the questions raised. The procedure enables one to multiply with extreme precision targeted pieces of amounts as little as one target molecule of DNA or RNA by five to six logs, making them easy to be handled and examined by routine molecular biological methods. The method is presented through one possible application field, that is of great importance in the study of hepatocarcinogenesis. Sensitivity of PCR in detection of hepatitis B virus DNA is greater by four logs than animal inoculation, the last most sensitive method known.

  1. EFFECTIVE METHOD TO EXTRACT DNA FROM ENVIRONMENTAL SAMPLES FOR POLYMERASE CHAIN REACTION AMPLIFICATION AND DNA FINGERPRINT ANALYSIS

    Science.gov (United States)

    A rapid direct-extraction method was used to obtain DNA from environmental soil samples. eat, enzymes, and guanidine isothiocyanate were utilized to lyse cells. he DNA was purified by agarose gel electrophoresis, amplified with 16S based primers by use of the polymerase chain rea...

  2. Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

    Science.gov (United States)

    Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

    2014-02-01

    Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

  3. Performance of Polymerase Chain Reaction Analysis of the Amniotic Fluid of Pregnant Women for Diagnosis of Congenital Toxoplasmosis: A Systematic Review and Meta-Analysis

    Science.gov (United States)

    2016-01-01

    Introduction Congenital infection caused by Toxoplasma gondii can cause serious damage that can be diagnosed in utero or at birth, although most infants are asymptomatic at birth. Prenatal diagnosis of congenital toxoplasmosis considerably improves the prognosis and outcome for infected infants. For this reason, an assay for the quick, sensitive, and safe diagnosis of fetal toxoplasmosis is desirable. Goal To systematically review the performance of polymerase chain reaction (PCR) analysis of the amniotic fluid of pregnant women with recent serological toxoplasmosis diagnoses for the diagnosis of fetal toxoplasmosis. Method A systematic literature review was conducted via a search of electronic databases; the literature included primary studies of the diagnostic accuracy of PCR analysis of amniotic fluid from pregnant women who seroconverted during pregnancy. The PCR test was compared to a gold standard for diagnosis. Results A total of 1.269 summaries were obtained from the electronic database and reviewed, and 20 studies, comprising 4.171 samples, met the established inclusion criteria and were included in the review. The following results were obtained: studies about PCR assays for fetal toxoplasmosis are generally susceptible to bias; reports of the tests’ use lack critical information; the protocols varied among studies; the heterogeneity among studies was concentrated in the tests’ sensitivity; there was evidence that the sensitivity of the tests increases with time, as represented by the trimester; and there was more heterogeneity among studies in which there was more time between maternal diagnosis and fetal testing. The sensitivity of the method, if performed up to five weeks after maternal diagnosis, was 87% and specificity was 99%. Conclusion The global sensitivity heterogeneity of the PCR test in this review was 66.5% (I2). The tests show low evidence of heterogeneity with a sensitivity of 87% and specificity of 99% when performed up to five weeks

  4. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  5. Quantitative polymerase chain reaction analysis with allele-specific oligonucleotide primers for individual IgH VDJ regions to evaluate tumor burden in myeloma patients.

    Science.gov (United States)

    Sata, Hiroshi; Shibayama, Hirohiko; Maeda, Ikuhiro; Habuchi, Yoko; Nakatani, Eiji; Fukushima, Kentaro; Fujita, Jiro; Ezoe, Sachiko; Tadokoro, Seiji; Maeda, Tetsuo; Mizuki, Masao; Kosugi, Satoru; Nakagawa, Masashi; Ueda, Shuji; Iida, Masato; Tokumine, Yukihiro; Azenishi, Yasuhiko; Mitsui, Hideki; Oritani, Kenji; Kanakura, Yuzuru

    2015-05-01

    Quantitative polymerase chain reaction (PCR) with patient-specific, allele-specific oligonucleotide (ASO) primers for individual immunoglobulin H VDJ region (ASO-PCR) amplification was performed using several sources of clinical material, including mRNA from peripheral blood cells (PBMNCs), whole bone marrow cells (BMMNCs), and the CD20+ CD38- B-cell population in bone marrow, as well as cell-free DNA from the sera of patients with multiple myeloma (MM). We designed the ASO primers and produced sufficient PCR fragments to evaluate tumor burden in 20 of 30 bone marrow samples at diagnosis. Polymerase chain reaction amplification efficiency depended on primer sequences because the production of ASO-PCR fragments did not correlate with serum M-protein levels. However, the ASO-PCR levels in BMMNCs showed statistically significant correlations with those in PBMNCs and CD20+ CD38- B-cells. The good association between the BMMNC and PBMNC data indicated that PBMNCs could be a suitable source for monitoring minimal residual disease (MRD). In the case of cell-free DNA, ASO-PCR levels showed a unique pattern and remained high even after treatment. Because the sequence information for each ASO-PCR product was identical to the original, the cell-free DNA might also be useful for evaluating MRD. Moreover, the ASO-PCR products were clearly detected in 17 of 22 mRNA samples from CD20+ CD38- populations, suggesting that MM clones might exist in relatively earlier stages of B cells than in plasma cells. Thus, ASO-PCR analysis using various clinical materials is useful for detecting MRD in MM patients as well as for clarifying MM pathogenesis.

  6. Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

    Directory of Open Access Journals (Sweden)

    Nayereh Nouri

    2014-01-01

    Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

  7. Genome shuffling of Saccharomyces cerevisiae for enhanced glutathione yield and relative gene expression analysis using fluorescent quantitation reverse transcription polymerase chain reaction.

    Science.gov (United States)

    Yin, Hua; Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Zhao, Junfeng; Dong, Jianjun; Yu, Junhong; Chang, Zongming

    2016-08-01

    Genome shuffling is an efficient and promising approach for the rapid improvement of microbial phenotypes. In this study, genome shuffling was applied to enhance the yield of glutathione produced by Saccharomyces cerevisiae YS86. Six isolates with subtle improvements in glutathione yield were obtained from populations generated by ultraviolet (UV) irradiation and nitrosoguanidine (NTG) mutagenesis. These yeast strains were then subjected to recursive pool-wise protoplast fusion. A strain library that was likely to yield positive colonies was created by fusing the lethal protoplasts obtained from both UV irradiation and heat treatments. After two rounds of genome shuffling, a high-yield recombinant YSF2-19 strain that exhibited 3.2- and 3.3-fold increases in glutathione production in shake flask and fermenter respectively was obtained. Comparative analysis of synthetase gene expression was conducted between the initial and shuffled strains using FQ (fluorescent quantitation) RT-PCR (reverse transcription polymerase chain reaction). Delta CT (threshold cycle) relative quantitation analysis revealed that glutathione synthetase gene (GSH-I) expression at the transcriptional level in the YSF2-19 strain was 9.9-fold greater than in the initial YS86. The shuffled yeast strain has a potential application in brewing, other food, and pharmaceutical industries. Simultaneously, the analysis of improved phenotypes will provide more valuable data for inverse metabolic engineering. PMID:27302037

  8. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

    DEFF Research Database (Denmark)

    Guil-Luna, S.; Stenvang, Jan; Brünner, Nils;

    2014-01-01

    and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...

  9. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    Science.gov (United States)

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  10. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    Science.gov (United States)

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  11. COMPARISON OF ENTEROCOCCUS MEASUREMENTS IN FRESHWATER AT TWO RECREATIONAL BEACHES BY QUANTITATIVE POLYMERASE CHAIN REACTION AND MEMBRANE FILER CULTURE ANALYSIS

    Science.gov (United States)

    Cell densities of the fecal pollution indicator genus, Enterococcus, were determined by a rapid (2-3 hr) quantitative PCR (QPCR) analysis based method in 100 ml water samples collected from recreational beaches on Lake Michigan and Lake Erie during the summer of 2003. Enumeration...

  12. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    Directory of Open Access Journals (Sweden)

    Vítor Yamashiro Rocha Soares

    2014-06-01

    Full Text Available An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis of the mitochondrial cytochrome B (cytb gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1, Bos taurus (1 and Equus caballus (2. Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  13. Identification of Mycobacterium marinum 65 kD heat shock protein gene by polymerase chain reaction restriction analysis from lesions of swimming pool granuloma

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Background Nontuberculous mycobacterium (NTM) had been reported to cause cutaneous infections which are difficult to interpret due to the variability of the clinical manifestations. Among NTM infections, Mycobacterium marinum (M. marinum) are mostly seen to cause skin infection. It is therefore important to establish a rapid approach for detection and identification of M. marinum from lesions of patients with suspected M. marinum infections. Methods Specimens were obtained from 5 patients with swimming pool granuloma. DNA was extracted and polymerase chain reaction (PCR) was performed. PCR products were digested with Hae III and BstE II, then analysed by pattern restriction analysis to detect heat shock protein (hsp) 65 kD gene. Results The 65 kD hsp gene was found in all specimens from patients with swimming pool granuloma. PCR restriction analysis (PRA) identified all 5 samples to be M. marinum infections, and the result was consistent with that of routine bacteriological identification. The lesions subsided or markedly improved upon treatment. Conclusions PRA is a sensitive, specific and rapid method in identification of mycobacteria. Application of this method will be helpful for early diagnosis of mycobacterial skin infections.

  14. An analysis of the subtypes of dengue fever infections in Barbados 2003–2007 by reverse transcriptase polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Gittens-St Hilaire M

    2008-12-01

    Full Text Available Abstract Background To perform a retrospective analysis of patients with IgM antibodies to dengue fever infection to determine the serotypes present by molecular techniques. A representative sample (~20%/per year of patients diagnosed with dengue fever infection were selected based on the detection of IgM antibodies in the acute phase serum sample. RNA was extracted from each sample and reverse transcribed. Following this, the amplicons were electrophoresed and serotyped based on band sizes. Results This study consisted of 71 males and 101 females ranging in age from 0 – 50+ yrs giving a total of 172 persons with an average of 34.4 patients per year. Onset averaged 6.9 days ranging from 0–90 days. Common symptoms were as follows: fever (69%, headache (52%, arthralgia (36%, ocular pain (32%, emesis (15% and lumbar pain (15%. All patients investigated with the exception of one, were infected with DENV-3. Conclusion DENV-3 is currently circulating on the island and not DENV-1 or DENV-2 as in previous years. This has implications for the enhancement of clinical, laboratory and environmental surveillance systems.

  15. Molecular Analysis of Oral Bacteria in Heart Valve of Patients With Cardiovascular Disease by Real-Time Polymerase Chain Reaction.

    Science.gov (United States)

    Oliveira, Francisco Artur Forte; Forte, Clarissa Pessoa Fernandes; Silva, Paulo Goberlânio de Barros; Lopes, Camile B; Montenegro, Raquel Carvalho; Santos, Ândrea Kely Campos Ribeiro Dos; Sobrinho, Carlos Roberto Martins Rodrigues; Mota, Mário Rogério Lima; Sousa, Fabrício Bitu; Alves, Ana Paula Negreiros Nunes

    2015-11-01

    Structural deficiencies and functional abnormalities of heart valves represent an important cause of cardiovascular morbidity and mortality, and a number of diseases, such as aortic stenosis, have been recently associated with infectious agents. This study aimed to analyze oral bacteria in dental plaque, saliva, and cardiac valves of patients with cardiovascular disease. Samples of supragingival plaque, subgingival plaque, saliva, and cardiac valve tissue were collected from 42 patients with heart valve disease. Molecular analysis of Streptococcus mutans, Prevotella intermedia, Porphyromonas gingivalis, and Treponema denticola was performed through real-time PCR. The micro-organism most frequently detected in heart valve samples was the S. mutans (89.3%), followed by P. intermedia (19.1%), P. gingivalis (4.2%), and T. denticola (2.1%). The mean decayed, missing, filled teeth (DMFT) was 26.4 ± 6.9 (mean ± SD), and according to the highest score of periodontal disease observed for each patient, periodontal pockets > 4 mm and dental calculus were detected in 43.4% and 34.7% of patients, respectively. In conclusion, oral bacteria, especially S. mutans, were found in the cardiac valve samples of patients with a high rate of caries and gingivitis/periodontitis. PMID:26632711

  16. Commercial enzyme-linked immunosorbent assay versuspolymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis.

    Science.gov (United States)

    Brasil, Pedro Emmanuel Alvarenga Americano do; Castro, Rodolfo; Castro, Liane de

    2016-01-01

    Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects.

  17. Detection of high-risk subtypes of human papillomavirus in cervical swabs: routine use of the Digene Hybrid Capture assay and polymerase chain reaction analysis.

    LENUS (Irish Health Repository)

    Brennan, M M

    2012-02-03

    Human papillomaviruses (HPVs) are major causative agents in the pathogenesis of cervical cancer, and more than twenty types are associated with its development. With the introduction of liquid-based preparation systems, it is envisaged that large-scale HPV testing will be established in the near future. Preliminary studies demonstrate the accessibility of these samples for DNA testing using both the Digene Hybrid Capture assay (DHCA) and polymerase chain reaction (PCR) techniques. This study aims to assess the validity and sensitivity of the DHCA system to detect high-risk HPV DNA, using two sets of HPV consensus primers (Gp5+\\/Gp6+ and MY09\\/MY11) in tandem with routine assessment of cervical smear and biopsy samples. Results indicate that the combination of DHCA and PCR detects more high-grade lesions than does the DHCA alone. DHCA-negative cases were categorised by subsequent PCR amplification into low-grade HPV-negative (12\\/16) cervical lesions and high-grade HPV-positive (7\\/9) cervical lesions. Gp5+\\/Gp6+ primers were less sensitive in detecting HPV-positive samples than was the MY09\\/MY11 primer set. These results support the use of high-risk HPV testing by DHCA, with subsequent analysis of DHCA-negative samples by PCR using the MY09\\/MY11 primers.

  18. Commercial enzyme-linked immunosorbent assay versus polymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis

    Science.gov (United States)

    do Brasil, Pedro Emmanuel Alvarenga Americano; Castro, Rodolfo; de Castro, Liane

    2016-01-01

    Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects. PMID:26814640

  19. Robust quantification of polymerase chain reactions using global fitting.

    Directory of Open Access Journals (Sweden)

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  20. Analysis of p53 gene mutations in human gliomas by polymerase chain reaction-based single-strand conformation polymorphism and DNA sequencing.

    Science.gov (United States)

    Sarkar, F H; Kupsky, W J; Li, Y W; Sreepathi, P

    1994-03-01

    Mutations in the p53 gene have been recognized in brain tumors, and clonal expansion of p53 mutant cells has been shown to be associated with glioma progression. However, studies on the p53 gene have been limited by the need for frozen tissues. We have developed a method utilizing polymerase chain reaction (PCR) for the direct analysis of p53 mutation by single-strand conformation polymorphism (SSCP) and by direct DNA sequencing of the p53 gene using a single 10-microns paraffin-embedded tissue section. We applied this method to screen for p53 gene mutations in exons 5-8 in human gliomas utilizing paraffin-embedded tissues. Twenty paraffin blocks containing tumor were selected from surgical specimens from 17 different adult patients. Tumors included six anaplastic astrocytomas (AAs), nine glioblastomas (GBs), and two mixed malignant gliomas (MMGs). The tissue section on the stained glass slide was used to guide microdissection of an unstained adjacent tissue section to ensure > 90% of the tumor cell population for p53 mutational analysis. Simultaneously, microdissection of the tissue was also carried out to obtain normal tissue from adjacent areas as a control. Mutations in the p53 gene were identified in 3 of 17 (18%) patients by PCR-SSCP analysis and subsequently confirmed by PCR-based DNA sequencing. Mutations in exon 5 resulting in amino acid substitution were found in one thalamic AA (codon 158, CGC > CTT: Arg > Leu) and one cerebral hemispheric GB (codon 151, CCG > CTG: Pro > Leu).(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Use of length heterogeneity polymerase chain reaction (LH-PCR as non-invasive approach for dietary analysis of Svalbard reindeer, Rangifer tarandus platyrhynchus.

    Directory of Open Access Journals (Sweden)

    Sungbae Joo

    Full Text Available To efficiently investigate the forage preference of Svalbard reindeer (Rangifer tarandus platyrhynchus, we applied length-heterogeneity polymerase chain reaction (LH-PCR based on length differences of internal transcribed spacer (ITS regions of ribosomal RNA (rRNA to fecal samples from R. tarandus platyrhynchus. A length-heterogeneity (LH database was constructed using both collected potential food sources of Svalbard reindeer and fecal samples, followed by PCR, cloning and sequencing. In total, eighteen fecal samples were collected between 2011 and 2012 from 2 geographic regions and 15 samples were successfully amplified by PCR. The LH-PCR analysis detected abundant peaks, 18.6 peaks on an average per sample, ranging from 100 to 500 bp in size and showing distinct patterns associated with both regions and years of sample collection. Principal component analysis (PCA resulted in clustering of 15 fecal samples into 3 groups by the year of collection and region with a statistically significant difference at 99.9% level. The first 2 principal components (PCs explained 71.1% of the total variation among the samples. Through comparison with LH database and identification by cloning and sequencing, lichens (Stereocaulon sp. and Ochrolechia sp. and plant species (Salix polaris and Saxifraga oppositifolia were detected as the food sources that contributed most to the Svalbard reindeer diet. Our results suggest that the use of LH-PCR analysis would be a non-invasive and efficient monitoring tool for characterizing the foraging strategy of Svalbard reindeer. Additionally, combining sequence information would increase its resolving power in identification of foraged diet components.

  2. Use of length heterogeneity polymerase chain reaction (LH-PCR) as non-invasive approach for dietary analysis of Svalbard reindeer, Rangifer tarandus platyrhynchus.

    Science.gov (United States)

    Joo, Sungbae; Han, Donguk; Lee, Eun Ju; Park, Sangkyu

    2014-01-01

    To efficiently investigate the forage preference of Svalbard reindeer (Rangifer tarandus platyrhynchus), we applied length-heterogeneity polymerase chain reaction (LH-PCR) based on length differences of internal transcribed spacer (ITS) regions of ribosomal RNA (rRNA) to fecal samples from R. tarandus platyrhynchus. A length-heterogeneity (LH) database was constructed using both collected potential food sources of Svalbard reindeer and fecal samples, followed by PCR, cloning and sequencing. In total, eighteen fecal samples were collected between 2011 and 2012 from 2 geographic regions and 15 samples were successfully amplified by PCR. The LH-PCR analysis detected abundant peaks, 18.6 peaks on an average per sample, ranging from 100 to 500 bp in size and showing distinct patterns associated with both regions and years of sample collection. Principal component analysis (PCA) resulted in clustering of 15 fecal samples into 3 groups by the year of collection and region with a statistically significant difference at 99.9% level. The first 2 principal components (PCs) explained 71.1% of the total variation among the samples. Through comparison with LH database and identification by cloning and sequencing, lichens (Stereocaulon sp. and Ochrolechia sp.) and plant species (Salix polaris and Saxifraga oppositifolia) were detected as the food sources that contributed most to the Svalbard reindeer diet. Our results suggest that the use of LH-PCR analysis would be a non-invasive and efficient monitoring tool for characterizing the foraging strategy of Svalbard reindeer. Additionally, combining sequence information would increase its resolving power in identification of foraged diet components.

  3. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  4. A chain reaction approach to modelling gene pathways.

    Science.gov (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  5. Use of real-time polymerase chain reaction for the diagnosis of Pneumocystis pneumonia in immunocompromised patients: a meta-analysis

    Institute of Scientific and Technical Information of China (English)

    Hanssa Summah; ZHU Ying-gang; Matthew E Falagas; Evridiki K Vouloumanou; QU Jie-ming

    2013-01-01

    Background The diagnosis of Pneumocystis pneumonia (PCP) in immunocompromised patients is still challenging today due to the absence of an in vitro culture system and the low diagnostic accuracy of microscopic examinations.Herein,weperformed a meta-analysis to evaluate the accuracy of real-time polymerase chain reaction (PCR) in the diagnosis of PCP.Methods We searched Web of Knowledge and Medline from 1990 to May 2010 for studies reporting diagnostic accuracy data regarding the use of real-time PCR in the diagnosis of PCP in immunocompromised patients.Results Ten individual studies were included.Overall,the sensitivity of real-time PCR was 97% (95% CI:93%-99%);the specificity was 94% (95% CI:90%-96%).The area under the HSROC curve (95% CI) for real-time PCR was 0.99(0.97-0.99).In a subgroup analysis regarding studies involving HIV patients among the study population,the sensitivity and specificity were 97% (95% CI:93%-99%) and 93% (95% CI:89%-96%),respectively.Regarding studies using Bronchoalveolar lavage (BAL) samples only:sensitivity =98% (95% CI:94%-99%); specificity =93% (95% CI:89%-96%),respectively.Regarding studies using microscopy as a reference standard:sensitivity =97% (95% CI:92%-99%);specificity =93% (95% CI:88%-96%).However,high between-study statistical heterogeneity was observed in all analyses.Conclusions Real-time PCR has a good diagnostic accuracy and may provide a useful adjunctive tool for the diagnosis of PCP in immunocompromised patients.Further studies are needed in order to identify any differences in the diagnostic performance of real-time PCR in HIV and non-HIV immunocompromised patients.

  6. Comparison of SYBR Green and TaqMan methods in quantitative real-time polymerase chain reaction analysis of four adenosine receptor subtypes

    Directory of Open Access Journals (Sweden)

    Mohamadhasan Tajadini

    2014-01-01

    Full Text Available Background: Real-time polymerase chain reaction (PCR is based on the revolutionary method of PCR. This technique is the result of PCR enormous sensitivity and real-time monitoring combination. In quantitative gene expression analysis, two methods have more popularity, SYBR Green and TaqMan, SYBR Green is relatively cost benefit and easy to use and technically based on binding the fluorescent dye to double-stranded deoxyribonucleic acid (dsDNA where TaqMan method has more expensive and based on dual labeled oligonucleotide and exonuclease activity of Taq polymerase enzyme. Specificity is the most important concern with the usage of any non-specific dsDNA-binding Dyes such as SYBR Green whiles more specificity showed by labeled oligonucleotide method such as TaqMan. In this study, we compared two common RT PCR methods, TaqMan and SYBR Green in measurement gene expression profile of adenosine receptors. Materials and Methods: Gene expression profiles of A1, A2A, A2B and A3 Adenosine receptors were analyzed by optimized TaqMan and SYBR Green quantitative RT PCR in breast cancer tissues. Primary expression data was normalizing by B. actin reference gene. Results: Efficiencies were calculated more than 95% for TaqMan and SYBR Green methods in all genes. The correlations between means of normalized data of each gene in two methods were positive and significant (P < 0.05. Conclusion: Data analysis showed that with the use of high performance primer and by use proper protocols and material we can make precise data by SYBR Green as TaqMan method. In other word by optimization of SYBR Green method, its performance and quality could be comparable to TaqMan method.

  7. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors.

    Science.gov (United States)

    Guil-Luna, S; Stenvang, J; Brünner, N; Sánchez-Céspedes, R; Millán, Y; Gómez-Laguna, J; de las Mulas, J Martín

    2014-09-01

    Cloning and sequencing of the progesterone receptor gene in dogs have revealed 2 isoforms, A and B, transcribed from a single gene. Distribution of isoforms A and B in canine mammary lesions has hitherto been investigated only by Western blot analysis. This study analyzed progesterone receptor and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign tumors, and 59% of carcinomas. Carcinomas, and particularly simple epithelial-type carcinomas, displayed the lowest levels of expression. A high rate of agreement was recorded between RT-qPCR and immunohistochemical labeling. Isoforms A and B were successfully amplified, with correlation coefficients of 0.99 and amplification efficiencies close to 2, and were expressed in all lesion types analyzed. Predominance of A over B expression was observed in carcinomas and complex adenomas. Low-grade tumors exhibited higher progesterone receptor messenger RNA (mRNA) levels, but no difference was observed in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors of the canine mammary gland. These findings will facilitate future research into the role of progesterone receptor isoforms in the progression of canine mammary tumors. PMID:24249219

  8. Detection of Francisella tularensis in blood by polymerase chain reaction.

    OpenAIRE

    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.

    1993-01-01

    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.

  9. Comparative quantitative analysis of BCR-ABL transcripts with the T315I mutant clone by polymerase chain reaction (PCR)-Invader method.

    Science.gov (United States)

    Tadokoro, Kenichi; Ishikawa, Maho; Suzuki, Makoto; Saito, Tomoyoshi; Suzuki, Yoshie; Yamaguchi, Toshikazu; Yagasaki, Fumiharu

    2011-09-01

    Drug resistance is a serious complication in the treatment of chronic myeloid leukemia (CML). The most common and best-characterized mechanism of secondary imatinib resistance in CML is the development of kinase domain mutations in the BCR-ABL gene. Second-generation tyrosine kinase inhibitors, such as dasatinib or nilotinib, overcome most of these mutations, but they are not effective against the T315I mutant. To determine whether these mutations contribute to clinical resistance, it is necessary to monitor the ratio of the mutant and wild-type forms. Here, we developed a polymerase chain reaction (PCR)-Invader assay for comparative quantitative analysis (qPI assay) of BCR-ABL transcripts with the T315I mutant clone. T315I ratios were calculated for the wild-type and mutant fold-over-zero (FOZ) values. In examination with 2 kinds of plasmids containing wild-type or T315I mutant PCR amplicons, mutant FOZ values were detected down to 1% of the total. The results of 12 serial samples from 2 patients (case A: Philadelphia-positive acute lymphoblastic leukemia and case B: CML) with the T315I mutant clone were compared with those of direct sequencing or 2 kinds of allele-specific oligonucleotide (ASO)-PCR. All samples showed the T315I mutation by qPI assay and ASO-PCR, and 10 samples showed it by direct sequencing. Significant correlation (correlation coefficient; r2 = 0.951) was noted between the qPI assay and quantitative ASO-PCR to analyze T315I mutant ratios. Thus, the qPI assay is a useful method for evaluating the T315I mutant clone in BCR-ABL transcripts.

  10. Expression of steroidogenic enzymes and their transcription factors in cortisol-producing adrenocortical adenomas: immunohistochemical analysis and quantitative real-time polymerase chain reaction studies.

    Science.gov (United States)

    Kubota-Nakayama, Fumie; Nakamura, Yasuhiro; Konosu-Fukaya, Sachiko; Azmahani, Abdullah; Ise, Kazue; Yamazaki, Yuto; Kitawaki, Yuko; Felizola, Saulo J A; Ono, Yoshikiyo; Omata, Kei; Morimoto, Ryo; Iwama, Noriyuki; Satoh, Fumitoshi; Sasano, Hironobu

    2016-08-01

    Adrenal Cushing syndrome (CS) is caused by the overproduction of cortisol in adrenocortical tumors including adrenal cortisol-producing adenoma (CPA). In CS, steroidogenic enzymes such as 17α-hydroxylase/17, 20-lase (CYP17A1), 3β-hydroxysteroid dehydrogenase (HSD3B), and 11β-hydroxylase (CYP11B1) are abundantly expressed in tumor cells. In addition, several transcriptional factors have been reported to play pivotal roles in the regulation of these enzymes in CPA, but their correlations with those enzymes above have still remained largely unknown. Therefore, in this study, we examined the status of steroidogenic enzymes and their transcriptional factors in 78 and 15 CPA cases by using immunohistochemistry and quantitative real-time polymerase chain reaction (qPCR), respectively. Immunoreactivity of HSD3B2, CYP11B1, CYP17A1, steroidogenic factor-1 (SF1[NR5A1]), GATA6, and nerve growth factor induced-B (NGFIB[NR4A1]) was detected in tumor cells. Results of qPCR analysis revealed that expression of HSD3B2 mRNA was significantly higher than that of HSD3B1, and CYP11B1 mRNA was significantly higher than CYP11B2. In addition, the expression of CYP11B1 mRNA was positively correlated with those of NR5A1, GATA6, and NR4A1. These results all indicated that HSD3B2 but not HSD3B1 was mainly involved in cortisol overproduction in CPA. In addition, NR5A1, GATA6, and NR4A1 were all considered to play important roles in cortisol overproduction through regulating CYP11B1 gene transcription. PMID:27085553

  11. A noncontact temperature measurement method in polymerase chain reaction reactors

    Science.gov (United States)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  12. Polymerase chain reaction and Southern blot-based analysis of the C9orf72 hexanucleotide repeat in different motor neuron diseases.

    Science.gov (United States)

    Hübers, Annemarie; Marroquin, Nicolai; Schmoll, Birgit; Vielhaber, Stefan; Just, Marlies; Mayer, Benjamin; Högel, Josef; Dorst, Johannes; Mertens, Thomas; Just, Walter; Aulitzky, Anna; Wais, Verena; Ludolph, Albert C; Kubisch, Christian; Weishaupt, Jochen H; Volk, Alexander E

    2014-05-01

    The GGGGCC-hexanucleotide repeat expansion in C9orf72 is the most common genetic cause of familial amyotrophic lateral sclerosis and frontotemporal dementia. This study determined the frequency of C9orf72 repeat expansions in different motor neuron diseases (amyotrophic lateral sclerosis (ALS), motor neuron diseases affecting primarily the first or the second motor neuron and hereditary spastic paraplegia). Whereas most studies on C9orf72 repeat expansions published so far rely on a polymerase chain reaction-based screening, we applied both polymerase chain reaction-based techniques and Southern blotting. Furthermore, we determined the sensitivity and specificity of Southern blotting of the C9orf72 hexanucleotide repeat in DNA derived from lymphoblastoid cell lines. C9orf72 repeat expansions were found in 27.1% out of 166 familial ALS patients, only once in 68 sporadic ALS patients, and not in 61 hereditary spastic paraplegia patients or 52 patients with motor neuron diseases affecting clinically primarily either the first or the second motor neuron. We found hints for a correlation between C9orf72 repeat length and the age of onset. Somatic instability of the C9orf72 repeat was observed in lymphoblastoid cell lines compared with DNA derived from whole blood from the same patient and therefore caution is warranted for repeat length determination in immortalized cell lines.

  13. Comparison of the accuracy of Hybrid Capture II and polymerase chain reaction in detecting clinically important cervical dysplasia: a systematic review and meta-analysis.

    Science.gov (United States)

    Luu, Hung N; Dahlstrom, Kristina R; Mullen, Patricia Dolan; VonVille, Helena M; Scheurer, Michael E

    2013-06-01

    The effectiveness of screening programs for cervical cancer has benefited from the inclusion of Human papillomavirus (HPV) DNA assays; which assay to choose, however, is not clear based on previous reviews. Our review addressed test accuracy of Hybrid Capture II (HCII) and polymerase chain reaction (PCR) assays based on studies with stronger designs and with more clinically relevant outcomes. We searched OvidMedline, PubMed, and the Cochrane Library for English language studies comparing both tests, published 1985-2012, with cervical dysplasia defined by the Bethesda classification. Meta-analysis provided pooled sensitivity, specificity, and 95% confidence intervals (CIs); meta-regression identified sources of heterogeneity. From 29 reports, we found that the pooled sensitivity and specificity to detect high-grade squamous intraepithelial lesion (HSIL) was higher for HCII than PCR (0.89 [CI: 0.89-0.90] and 0.85 [CI: 0.84-0.86] vs. 0.73 [CI: 0.73-0.74] and 0.62 [CI: 0.62-0.64]). Both assays had higher accuracy to detect cervical dysplasia in Europe than in Asia-Pacific or North America (diagnostic odd ratio - dOR = 4.08 [CI: 1.39-11.91] and 4.56 [CI: 1.86-11.17] for HCII vs. 2.66 [CI: 1.16-6.53] and 3.78 [CI: 1.50-9.51] for PCR) and accuracy to detect HSIL than atypical squamous cells of undetermined significance (ASCUS)/ low-grade squamous intraepithelial lesion (LSIL) (HCII-dOR = 9.04 [CI: 4.12-19.86] and PCR-dOR = 5.60 [CI: 2.87-10.94]). For HCII, using histology as a gold standard results in higher accuracy than using cytology (dOR = 2.87 [CI: 1.31-6.29]). Based on higher test accuracy, our results support the use of HCII in cervical cancer screening programs. The role of HPV type distribution should be explored to determine the worldwide comparability of HPV test accuracy.

  14. Comparison of the accuracy of Hybrid Capture II and polymerase chain reaction in detecting clinically important cervical dysplasia: a systematic review and meta-analysis

    Science.gov (United States)

    Luu, Hung N; Dahlstrom, Kristina R; Mullen, Patricia Dolan; VonVille, Helena M; Scheurer, Michael E

    2013-01-01

    The effectiveness of screening programs for cervical cancer has benefited from the inclusion of Human papillomavirus (HPV) DNA assays; which assay to choose, however, is not clear based on previous reviews. Our review addressed test accuracy of Hybrid Capture II (HCII) and polymerase chain reaction (PCR) assays based on studies with stronger designs and with more clinically relevant outcomes. We searched OvidMedline, PubMed, and the Cochrane Library for English language studies comparing both tests, published 1985–2012, with cervical dysplasia defined by the Bethesda classification. Meta-analysis provided pooled sensitivity, specificity, and 95% confidence intervals (CIs); meta-regression identified sources of heterogeneity. From 29 reports, we found that the pooled sensitivity and specificity to detect high-grade squamous intraepithelial lesion (HSIL) was higher for HCII than PCR (0.89 [CI: 0.89–0.90] and 0.85 [CI: 0.84–0.86] vs. 0.73 [CI: 0.73–0.74] and 0.62 [CI: 0.62–0.64]). Both assays had higher accuracy to detect cervical dysplasia in Europe than in Asia-Pacific or North America (diagnostic odd ratio – dOR = 4.08 [CI: 1.39–11.91] and 4.56 [CI: 1.86–11.17] for HCII vs. 2.66 [CI: 1.16–6.53] and 3.78 [CI: 1.50–9.51] for PCR) and accuracy to detect HSIL than atypical squamous cells of undetermined significance (ASCUS)/ low-grade squamous intraepithelial lesion (LSIL) (HCII-dOR = 9.04 [CI: 4.12–19.86] and PCR-dOR = 5.60 [CI: 2.87–10.94]). For HCII, using histology as a gold standard results in higher accuracy than using cytology (dOR = 2.87 [CI: 1.31–6.29]). Based on higher test accuracy, our results support the use of HCII in cervical cancer screening programs. The role of HPV type distribution should be explored to determine the worldwide comparability of HPV test accuracy. PMID:23930214

  15. Comparison of the accuracy of Hybrid Capture II and polymerase chain reaction in detecting clinically important cervical dysplasia: a systematic review and meta-analysis

    International Nuclear Information System (INIS)

    The effectiveness of screening programs for cervical cancer has benefited from the inclusion of Human papillomavirus (HPV) DNA assays; which assay to choose, however, is not clear based on previous reviews. Our review addressed test accuracy of Hybrid Capture II (HCII) and polymerase chain reaction (PCR) assays based on studies with stronger designs and with more clinically relevant outcomes. We searched OvidMedline, PubMed, and the Cochrane Library for English language studies comparing both tests, published 1985–2012, with cervical dysplasia defined by the Bethesda classification. Meta-analysis provided pooled sensitivity, specificity, and 95% confidence intervals (CIs); meta-regression identified sources of heterogeneity. From 29 reports, we found that the pooled sensitivity and specificity to detect high-grade squamous intraepithelial lesion (HSIL) was higher for HCII than PCR (0.89 [CI: 0.89–0.90] and 0.85 [CI: 0.84–0.86] vs. 0.73 [CI: 0.73–0.74] and 0.62 [CI: 0.62–0.64]). Both assays had higher accuracy to detect cervical dysplasia in Europe than in Asia-Pacific or North America (diagnostic odd ratio – dOR = 4.08 [CI: 1.39–11.91] and 4.56 [CI: 1.86–11.17] for HCII vs. 2.66 [CI: 1.16–6.53] and 3.78 [CI: 1.50–9.51] for PCR) and accuracy to detect HSIL than atypical squamous cells of undetermined significance (ASCUS)/ low-grade squamous intraepithelial lesion (LSIL) (HCII-dOR = 9.04 [CI: 4.12–19.86] and PCR-dOR = 5.60 [CI: 2.87–10.94]). For HCII, using histology as a gold standard results in higher accuracy than using cytology (dOR = 2.87 [CI: 1.31–6.29]). Based on higher test accuracy, our results support the use of HCII in cervical cancer screening programs. The role of HPV type distribution should be explored to determine the worldwide comparability of HPV test accuracy

  16. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  17. Analysis of phosphate-accumulating organisms cultivated under different carbon sources with polymerase chain reaction-denaturing gradient gel electrophoresis assay

    Institute of Scientific and Technical Information of China (English)

    YU Shui-li; LIU Ya-nan; JING Guo-lin; ZHAO Bing-jie; GUO Si-yuan

    2005-01-01

    To investigate the microbial communities of microorganisms cultivated under different carbon sources, three sequencing batch reactors were operated. They were supplied with sewage, glucose and sodium acetate as carbon sources respectively and showed high phosphorus removal performance. The results of denaturing gradient gel electrophoresis(DGGE) of polymerase chain reaction-amplified (PCR) 16S rDNA fragments demonstrated that β-protebacteria, Actinomyces sp. and γ-protebacteria only exited in 1 # reactor. The microbiological diversity of 1 # reactor exceeded the other two reactors. Flavobacterium, Bacillales, Actinomyces, Actinobacteridae and uncultured bacteria(AF527584, AF502204, AY592749, AB076862, AJ619051, AF495454 and AY133070) could be detected in the biological phosphorus removal reactors.

  18. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    Science.gov (United States)

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  19. The generalised self-sustaining chain reaction theory about ADS

    International Nuclear Information System (INIS)

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  20. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  1. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    Science.gov (United States)

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  2. Comparison of different polymerase chain reaction-based approaches for clonality assessment of immunoglobulin heavy-chain gene rearrangements in B-cell neoplasia

    NARCIS (Netherlands)

    Derksen, P W; Langerak, A W; Kerkhof, E; Wolvers-Tettero, I L; Boor, P P; Mulder, A H; Vrints, L W; Coebergh, J W; van Krieken, J H; Schuuring, E; Kluin, P M; van Dongen, J J

    1999-01-01

    Several frequently applied polymerase chain reaction strategies for analysis of immunoglobulin heavy-chain gene rearrangements were compared by analyzing 70 B-cell lymphoproliferative disorders and 24 reactive lymphoid lesions. Southern blot analysis was used as the "gold standard" for clonality ass

  3. Assessing HER2 amplification by IHC, FISH, and real-time polymerase chain reaction analysis (real-time PCR) following LCM in formalin-fixed paraffin embedded tissue from 40 women with ovarian cancer

    DEFF Research Database (Denmark)

    Hillig, Thore; Thode, Jørgen; Breinholt, Ellen Marie;

    2012-01-01

    We compare HER2 receptor amplification analysis by immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), and real-time polymerase chain reaction (real-time PCR) DNA copy-number assay following laser capture microdissection (LCM) in formalin-fixed paraffin embedded tissue from 40....... Only few ovarian cancer patients were HER2 overexpressed measured by IHC or FISH and thus could be eligible for antibody-based therapy with trastuzumab (Herceptin). Interestingly, we find an increased number of HER2 positive patients by real-time PCR analysis on microdissected cancer cells, suggesting...

  4. Markov Chain Ontology Analysis (MCOA

    Directory of Open Access Journals (Sweden)

    Frost H

    2012-02-01

    Full Text Available Abstract Background Biomedical ontologies have become an increasingly critical lens through which researchers analyze the genomic, clinical and bibliographic data that fuels scientific research. Of particular relevance are methods, such as enrichment analysis, that quantify the importance of ontology classes relative to a collection of domain data. Current analytical techniques, however, remain limited in their ability to handle many important types of structural complexity encountered in real biological systems including class overlaps, continuously valued data, inter-instance relationships, non-hierarchical relationships between classes, semantic distance and sparse data. Results In this paper, we describe a methodology called Markov Chain Ontology Analysis (MCOA and illustrate its use through a MCOA-based enrichment analysis application based on a generative model of gene activation. MCOA models the classes in an ontology, the instances from an associated dataset and all directional inter-class, class-to-instance and inter-instance relationships as a single finite ergodic Markov chain. The adjusted transition probability matrix for this Markov chain enables the calculation of eigenvector values that quantify the importance of each ontology class relative to other classes and the associated data set members. On both controlled Gene Ontology (GO data sets created with Escherichia coli, Drosophila melanogaster and Homo sapiens annotations and real gene expression data extracted from the Gene Expression Omnibus (GEO, the MCOA enrichment analysis approach provides the best performance of comparable state-of-the-art methods. Conclusion A methodology based on Markov chain models and network analytic metrics can help detect the relevant signal within large, highly interdependent and noisy data sets and, for applications such as enrichment analysis, has been shown to generate superior performance on both real and simulated data relative to existing

  5. Selection of internal reference genes for normalization of quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis in the canine brain and other organs.

    Science.gov (United States)

    Park, Sang-Je; Huh, Jae-Won; Kim, Young-Hyun; Lee, Sang-Rae; Kim, Sang-Hyun; Kim, Sun-Uk; Kim, Heui-Soo; Kim, Min Kyu; Chang, Kyu-Tae

    2013-05-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a specific and sensitive technique for quantifying gene expression. To analyze qRT-PCR data accurately, suitable reference genes that show consistent expression patterns across different tissues and experimental conditions should be selected. The objective of this study was to obtain the most stable reference genes in dogs, using samples from 13 different brain tissues and 10 other organs. 16 well-known candidate reference genes were analyzed by the geNorm, NormFinder, and BestKeeper programs. Brain tissues were derived from several different anatomical regions, including the forebrain, cerebrum, diencephalon, hindbrain, and metencephalon, and grouped accordingly. Combination of the three different analyses clearly indicated that the ideal reference genes are ribosomal protien S5 (RPS5) in whole brain, RPL8 and RPS5 in whole body tissues, RPS5 and RPS19 in the forebrain and cerebrum, RPL32 and RPS19 in the diencephalon, GAPDH and RPS19 in the hindbrain, and MRPS7 and RPL13A in the metencephalon. These genes were identified as ideal for the normalization of qRT-PCR results in the respective tissues. These findings indicate more suitable and stable reference genes for future studies of canine gene expression.

  6. Polymerase chain reaction-single strand conformational polymorphism analysis of rearranged during transfection proto-oncogene in Chinese familial hirschsprung's disease

    Institute of Scientific and Technical Information of China (English)

    Tao Guan; Ji-Cheng Li; Min-Ju Li; Jin-Fa Tou

    2005-01-01

    AIM: To investigate the relationship between mutations of rearranged during transfection (RET) proto-oncogene and Chinese patients with Hirschsprung's disease (HD), and to elucidate the genetic mechanism of familial HD patient at the molecular level.METHODS: Genomic DNA was extracted from venous blood of probands and their relatives in two genealogies.Polymerase chain reaction (PCR) products, which were amplified using specific primers (RET, exons 11, 13, 15and 17), were electrophoresed to analyze the single-strand conformational polymorphism (SSCP) patterns. The positive amplified products were sequenced. Forty-eight sporadic HD patients and 30 normal children were screened for mutations of RET proto-oncogene simultaneously.RESULTS: Three cases with HD in one family were found to have a G heterozygous insertion at nucleotide 18 974 in exon 13 of RET cDNA (18 974insG), which resulted in a frameshift mutation. In another family, a heterozygosity for T to G transition at nucleotide 18 888 in the same exon which resulted in a synonymous mutation of Leu at codon 745 was detected in the proband and his father. Eight RET mutations were confirmed in 48 sporadic HD patients.CONCLUSION: Mutations of RET proto-oncogene may play an important role in the pathogenesis of Chinese patients with HD. Detection of mutated RET proto-oncogene carriers may be used for genetic counseling of potential risk for HD in the affected families.

  7. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  8. Polymerase chain reaction and bacteriological comparative analysis of raw milk samples and buffalo mozzarella produced and marketed in Caserta in the Campania region of Italy

    Directory of Open Access Journals (Sweden)

    Elisabetta Di Giannatale

    2009-09-01

    Full Text Available To help identify an epidemiological link between the consumption of buffalo mozzarella prepared with raw milk (not heat-treated and cases of human brucellosis, 80 samples of raw buffalo milk and 315 samples of mozzarella were tested for the presence of Brucella spp. Samples originated from Caserta, the province with the highest number of Brucella-positive buffalo herds in Campania, the region in which 96.02% of all cases of human brucellosis reported in 2000-2005 were recorded. To take into account possible seasonal variations, between February 2006 and March 2007, samples were purchased directly from 72 dairy outlets that were representative of the province. Samples were tested for Brucella spp. using the polymerase chain reaction (PCR and bacterial isolation. Samples tested negative for Brucella using both methods. Spiked samples were then prepared and tested by PCR and bacterial isolation and the sensitivity, specificity, repeatability, reproducibility and limit of detection were determined. The PCR limit of detection was below 1 colony-forming unit (cfu/g. The repeatability and reproducibility of the method were 100% (p = 0.95, the sensitivity was 96.7% (p = 0.95 and the specificity was 100% (p = 0.95.

  9. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Science.gov (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents.

  10. Fluorescence-based temperature control for polymerase chain reaction.

    Science.gov (United States)

    Sanford, Lindsay N; Wittwer, Carl T

    2014-03-01

    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  11. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维

    2003-01-01

    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  12. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.

    OpenAIRE

    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S

    1996-01-01

    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  13. Simultaneous confirmatory analysis of different transgenic maize (zea mays) lines using multiplex polymerase chain reaction-restriction analysis and capillary gel electrophoresis with laser induced fluorescence detection.

    Science.gov (United States)

    García-Cañas, Virginia; Cifuentes, Alejandro

    2008-09-24

    A novel analytical procedure based on the combination of multiplex PCR, restriction analysis, and CGE-LIF to unambiguosly and simultaneously confirm the presence of multiple lines of genetically modified corn is proposed. This methodology is based on the amplification of event-specific DNA regions by multiplex PCR using 6-FAM-labeled primers. Subsequently, PCR products are digested by a mixture containing specific restriction endonucleases. Thus, restriction endonucleases selectively recognize DNA target sequences contained in the PCR products and cleave the double-stranded DNA at a given cleavage site. Next, the restriction digest is analyzed by CGE-LIF corroborating the length of the expected restriction fragments, confirming (or not) the existence of GMOs. For accurate size determination of the DNA fragments by CGE-LIF a special standard DNA mixture was produced in this laboratory for calibration. The suitability of this mixture for size determination of labeled DNA fragments is also demonstrated. The usefulness of the proposed methodology is demonstrated through the simultaneous detection and confirmatory analysis of samples containing 0.5% of GA21 and MON863 maize plus an endogenous gene of maize as control.

  14. Comparative Analysis of Real-Time Polymerase Chain Reaction Methods to Typing HLA-B*57:01 in HIV-1-Positive Patients.

    Science.gov (United States)

    Falasca, Francesca; Dello Russo, Cinzia; Mora, Barbara; Pirazzoli, Antonella; Fantauzzi, Alessandra; Navarra, Pierluigi; Pizzuti, Antonio; De Vito, Corrado; Antonelli, Guido; Turriziani, Ombretta

    2016-07-01

    The HLA-B*57:01 allele is strongly associated with the hypersensitivity reaction to Abacavir (ABC). Therefore, treatment guidelines recommend that patients initiating ABC are preventively tested for the presence of this allele. To date, four different commercial assays based on the real-time quantitative polymerase chain reaction (Q-PCR) technique are available for the detection of HLA-B*57:01: Duplicα-RealTime Reagent Set HLA-B*57:01 by Euroclone, HLA-B*57:01 Real-TM by Sacace Biotechnologies, COBAS AmpliPrep/COBAS TaqMan HLA-B*57:01 Screening Test by Roche Diagnostic, and HLA-B*57:01 by Nuclear Laser Medicine. The study was carried out to compare the performance of the first three commercially available Q-PCR kits in a routine clinical setting. A total of 98 samples from Policlinico Umberto I Hospital were tested. Results obtained by the Duplicα-RealTime Genotyping kit and AmpliPrep/TaqMan system were 100% concordant. In contrast, genotyping by the HLA-B*57:01 Real-TM kit showed poor agreement with the other systems, that is, 12 out of 33 positive samples were detected as HLA-B*57:01 negative. To confirm the correct genotype of these discordant samples, two additional methods with rapid turnaround times and already implemented into routine clinical practice were used, that is, a PCR-based microsequence-specific primer DNA typing test and a laboratory-developed screening test in Q-PCR. All 12 discordant samples were genotyped as HLA-B*57:01-positive samples using these two additional methods in a single-blinded manner, thus confirming the low sensitivity of HLA-B*57:01 Real-TM test. These findings underline the need to compare results obtained with commercial assays before choosing a test suitable for use in a routine clinical laboratory. PMID:26750774

  15. Multiplex polymerase chain reaction analysis of UV-A- and UV-B-induced delayed and early mutations in V79 Chinese hamster cells.

    Science.gov (United States)

    Dahle, Jostein; Noordhuis, Paul; Stokke, Trond; Svendsrud, Debbie Hege; Kvam, Egil

    2005-01-01

    We previously reported that approximately 10% of V79 Chinese hamster fibroblast populations clonally derived from single cells immediately after irradiation with either ultraviolet B (UV-B, 290-320 nm, mainly 311 nm) or ultraviolet A (UV-A, 320-400 nm, mainly 350-390 nm) radiation exhibit genomic instability. The instability is revealed by relatively high mutation frequencies in the hypoxanthine phosphoribosyl transferase (hprt) gene up to 23 cell generations after irradiation. These delayed mutant clones exhibited higher levels of oxidative stress than normal cells. Therefore, persistently increased oxidative stress has been proposed as a mechanism for UV-induced genomic instability. This study investigates whether this mechanism is reflected in the deletion spectrum of delayed mutant clones. Eighty-eight percent of the delayed mutant clones derived from UV-A-irradiated populations were found to have total deletion of the hprt gene. Correspondingly, 81% of UV-A-induced early mutations (i.e. detected shortly after irradiation) also had total deletions. Among delayed UV-B-induced mutant clones, 23% had total deletions and 8% had deletion of one exon, whereas all early UV-B events were either point mutations or small deletions or insertions. In conclusion, the multiplex polymerase chain reaction deletion screen showed that there were explicit differences in the occurrence of large gene alterations between early and delayed mutations induced by UV-B radiation. For UV-A radiation the deletion spectra were similar for delayed and early mutations. UV-A radiation is, in contrast to UV-B radiation, only weakly absorbed by DNA and probably induces mutation almost solely via production of reactive oxygen species. Therefore, the present results support the hypothesis that persistent increase in oxidative stress is involved in the mechanism of UV-induced genomic instability.

  16. Pasteurella multocida in backyard chickens in Upper Egypt: incidence with polymerase chain reaction analysis for capsule type, virulence in chicken embryos and antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Moemen A. Mohamed

    2012-03-01

    Full Text Available The prevalence of Pasteurella multocida strains among 275 backyard chickens from different regions of Upper Egypt was studied. A total of 21 isolates of P. multocida were recovered in 21 out of 275 chickens tested (7.6% and were confirmed using phenotypic characterisation. Somatic serotyping of the 21 isolates resulted in 12 isolates being classed as serotype A:1 (57.14%, 4 as serotype A:3 (19.05% and 5 could not be typed (23.8%. Capsular typing, using multiplex polymerase chain reaction (PCR, demonstrated that 18 strains were capsular type A (85.7%, and 3 were type D (14.3%. The present findings suggest that a multiplex capsular PCR could be valuable for the rapid identification of P. multocida in cases of fowl cholera infection. A total of 5 isolates of P. multocida were selected to study their pathogenicity in embryonated chicken eggs instead of conducting a study in mature chickens. The results showed a variation in pathogenicity between the strains tested, namely: serotype A:1 strains caused 80% mortality, in contrast to 20% mortality by type D strains. Pathological findings included severe congestion of the entire embryo, haemorrhaging of the skin, feather follicles and toe, and ecchymotic haemorrhages on the liver of the inoculated embryos. The observations in this study indicate that P. multocida serogroup A could be highly pathogenic for mature chickens and therefore might be a cause of considerable economic losses in commercial production. A total of 10 isolates were subjected to antimicrobial susceptibility to determine the minimal inhibitory concentration of 7 antimicrobials. All isolates were susceptible to ciprofloxacin, florfenicol, streptomycin and sulphamethoxazol with trimethoprim and with varying degrees of sensitivity to the other agents.

  17. Reaction chain modeling of denitrification reactions during a push-pull test

    Science.gov (United States)

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.

    2013-05-01

    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  18. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    Science.gov (United States)

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  19. Convective polymerase chain reaction around micro immersion heater

    Science.gov (United States)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  20. Towards quantitative mRNA analysis in paraffin-embedded tissues using real-time reverse transcriptase-polymerase chain reaction: a methodological study on lymph nodes from melanoma patients.

    Science.gov (United States)

    Abrahamsen, Helene Nortvig; Steiniche, Torben; Nexo, Ebba; Hamilton-Dutoit, Stephen J; Sorensen, Boe Sandahl

    2003-02-01

    Improved extraction techniques combined with sensitive real-time reverse transcriptase-polymerase chain reaction may allow detection of mRNA in formalin-fixed, paraffin-embedded (FFPE) materials, but the factors affecting mRNA quantification in clinical material using these methods have not been systematically analyzed. We designed analyses using real-time reverse transcriptase-polymerase chain reaction for quantification of MART-1, beta-actin, and beta(2)-microglobulin mRNAs. The analytical intra- and interassay imprecision (coefficient of variation) was in the range 10 to 20% for all three genes studied. Using these protocols, we studied the influence of tissue autolysis and length of formalin-fixation on mRNA detection in metastatic melanoma. Delay in freezing reduced detectable mRNA, although this was less than predicted and mostly occurred early in autolysis. MART-1, beta-actin, and beta(2)-microglobulin mRNAs were consistently detected in FFPE metastatic melanoma even after fixation for up to 3 weeks, although the total mRNA detected was markedly reduced in fixed compared with fresh tissues (up to 99%). Quantification of MART-1 was, however, possible if this was expressed relative to a housekeeping gene. The polymerase chain reaction product from FFPE tissues could be increased up to 100-fold amplifying short (tissue processing and in fixation length seem to be less important sources of imprecision than previously assumed. Our findings suggest that quantitative analysis of mRNA in archive and routine diagnostic tissues may be possible.

  1. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  2. Single-species reactions on a random catalytic chain

    Energy Technology Data Exchange (ETDEWEB)

    Oshanin, G [Laboratoire de Physique Theorique des Liquides, Universite Paris 6, 4 Place Jussieu, 75252 Paris (France); Burlatsky, S F [United Technologies Research Center, United Technologies Corporation, 411 Silver Lane, 129-21 East Hartford, CT (United States)

    2002-11-29

    We present an exact solution for a catalytically activated annihilation A+A {yields} 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P{sup (quen)} per site of such a chain is given by P{sup (quen)} P{sup (Lan)} + {beta}{sup -1}F, where P{sup (Lan)}={beta}{sup -1} ln(1+z) is the Langmuir adsorption pressure, (z being the activity and {beta}{sup -1} the temperature), while {beta}{sup -1}F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2x2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented. (letter to the editor)

  3. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    International Nuclear Information System (INIS)

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  4. Automated polymerase chain reaction in capillary tubes with hot air.

    Science.gov (United States)

    Wittwer, C T; Fillmore, G C; Hillyard, D R

    1989-06-12

    We describe a simple, compact, inexpensive thermal cycler that can be used for the polymerase chain reaction. Based on heat transfer with air to samples in sealed capillary tubes, the apparatus resembles a recirculating hair dryer. The temperature is regulated via thermocouple input to a programmable set-point process controller that provides proportional output to a solid state relay controlling a heating coil. For efficient cooling after the denaturation step, the controller activates a solenoid that opens a door to vent hot air and allows cool air to enter. Temperature-time profiles and amplification results approximate those obtained using water baths and microfuge tubes.

  5. Identification of Erwinia stewartii by a ligase chain reaction assay.

    OpenAIRE

    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A

    1994-01-01

    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...

  6. Simultaneous Removal of Multiple DNA Segments by Polymerase Chain Reactions.

    Science.gov (United States)

    Krishnamurthy, Vishnu; Zhang, Kai

    2017-01-01

    Precise DNA manipulation is a key enabling technology for synthetic biology. Approaches based on restriction digestion are often limited by the presence of certain restriction enzyme recognition sites. Recent development of restriction-free cloning approaches has greatly enhanced the flexibility and speed of molecular cloning. Most restriction-free cloning methods focus on DNA assembly. Much less work has been dedicated towards DNA removal. Here we introduce a protocol that allows simultaneous removal of multiple DNA segments from a plasmid using polymerase chain reactions (PCR). Our approach will be beneficial to applications in multiple sites mutagenesis, DNA library construction, genetic and protein engineering, and synthetic biology. PMID:27671942

  7. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  8. APPLICATION OF POLYMERASE CHAIN REACTION FOR DIAGNOSING AMEBIC LIVER ABSCESS

    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏

    1996-01-01

    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  9. Automated generation of burnup chain for reactor analysis applications

    International Nuclear Information System (INIS)

    This paper presents the development of an automated generation of a new burnup chain for reactor analysis applications. The JENDL FP Decay Data File 2011 and Fission Yields Data File 2011 were used as the data sources. The nuclides in the new chain are determined by restrictions of the half-life and cumulative yield of fission products or from a given list. Then, decay modes, branching ratios and fission yields are recalculated taking into account intermediate reactions. The new burnup chain is output according to the format for the SRAC code system. Verification was performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Further development and applications are being planned with the burnup chain code. (author)

  10. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  11. Nested methylation-specific polymerase chain reaction cancer detection method

    Science.gov (United States)

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  12. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  13. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  14. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed

    2012-03-01

    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  15. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  16. Controlling Hybridization Chain Reactions with pH.

    Science.gov (United States)

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco

    2015-08-12

    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  17. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    Science.gov (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  18. Sustainability Analysis for Gayo Coffee Supply Chain

    Directory of Open Access Journals (Sweden)

    Rachman Jaya

    2013-01-01

    Full Text Available Sustainable supply chain is a development of the conventional supply chains that discuses trade-off among economic, social and environmental dimensions in order to achieve better responsiveness in terms of quality, quantity and time-delivery in the supply chain structure. The objective of this research was to determine the Gayo coffee supply chain sustainability. The research was conducted at Bener Meriah and Aceh Tengah Districts, Aceh Province, Indonesia. Key actors in the supply chain considered were farmers, collectors, agro-industry and exporter. Sustainability dimensions considered in this research were the economic, social, environmental and material resources. The performance of each aspect was analyzed by using Multi-dimensional scaling and leverage analysis. The result of the research showed that the composite of Gayo coffee supply chain sustainability index was 33.53 which mean less sustainable level. Therefore it is recommended to reengineering the Gayo coffee supply chain by considering all of the four sustainability dimensions above.

  19. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  20. Detection of hemoplasma infection of goats by use of a quantitative polymerase chain reaction assay and risk factor analysis for infection.

    Science.gov (United States)

    Johnson, Kathy A; do Nascimento, Naíla C; Bauer, Amy E; Weng, Hsin-Yi; Hammac, G Kenitra; Messick, Joanne B

    2016-08-01

    OBJECTIVE To develop and validate a real-time quantitative PCR (qPCR) assay for the detection and quantification of Mycoplasma ovis in goats and investigate the prevalence and risk factors for hemoplasma infection of goats located in Indiana. ANIMALS 362 adult female goats on 61 farms. PROCEDURES Primers were designed for amplification of a fragment of the dnaK gene of M ovis by use of a qPCR assay. Blood samples were collected into EDTA-containing tubes for use in total DNA extraction, blood film evaluation, and determination of PCV. Limit of detection, intra-assay variability, interassay variability, and specificity of the assay were determined. RESULTS Reaction efficiency of the qPCR assay was 94.45% (R(2), 0.99; slope, -3.4623), and the assay consistently detected as few as 10 copies of plasmid/reaction. Prevalence of infection in goats on the basis of results for the qPCR assay was 18.0% (95% confidence interval, 14% to 22%), with infected goats ranging from 1 to 14 years old, whereby 61% (95% confidence interval, 47% to 73%) of the farms had at least 1 infected goat. Bacterial load in goats infected with M ovis ranged from 1.05 × 10(3) target copies/mL of blood to 1.85 × 10(5) target copies/mL of blood; however, no bacteria were observed on blood films. Production use of a goat was the only risk factor significantly associated with hemoplasma infection. CONCLUSIONS AND CLINICAL RELEVANCE The qPCR assay was more sensitive for detecting hemoplasma infection than was evaluation of a blood film, and production use of a goat was a risk factor for infection. PMID:27463552

  1. Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections.

    Science.gov (United States)

    Coates, P J; d'Ardenne, A J; Khan, G; Kangro, H O; Slavin, G

    1991-02-01

    The polymerase chain reaction was applied to the analysis of DNA contained in archival paraffin wax embedded material. DNA suitable for the reaction was obtained from these tissues by simple extraction methods, without previous dewaxing of tissue sections. When compared with unfixed material, the reaction efficiency was compromised, so that an increased number of amplification cycles were required to produce equivalent amounts of amplified product. This in turn led to an increase in amplification artefacts, which can be minimised by a simple modification of the standard reaction. Amplification of relatively large DNA fragments was not always successful, and it seems prudent to bear this in mind when designing oligonucleotide primers which are to be used for the amplification of archival material. The efficiency of the procedure can be improved by dividing the amplification cycles into two parts: this reduces the amount of reagent needed, is relatively simple and inexpensive, and can be performed in one working day.

  2. Polymerase chain reaction for Enterococcus faecalis in drain fluid: the first screening test for symptomatic colorectal anastomotic leakage. The Appeal-study: analysis of parameters predictive for evident anastomotic leakage.

    NARCIS (Netherlands)

    Komen, N.; Slieker, J.; Willemsen, P.; Mannaerts, G.; Pattyn, P.; Karsten, T.; Wilt, H. de; Harst, E. van der; Leeuwen, W. van; Decaestecker, C.; Jeekel, H.; Lange, J.F.

    2014-01-01

    PURPOSE: With current diagnostic methods, the majority of patients with symptomatic colorectal anastomotic leakage(CAL) is identified approximately 1 week after operation.The aim of this study is to determine whether real-time polymerase chain reaction (RT-PCR) for detection of Escherichia coli and

  3. Pea (Pisum sativum) genes involved in symbiosis with nitrogen-fixing bacteria.1.Analysis of the expression of the early nodulin gene ENOD12 using the polymerase chain-reaction

    NARCIS (Netherlands)

    Zalenskii, A.O.; Kozik, A.V.; Scheres, B.J.G.; Bisseling, A.; Tikhonovich, I.A.

    1991-01-01

    The polymerase chain reaction (PCR) was used to detect the transcription products of the early nodulin gene in the pea. Single-stranded DNA copies were prepared using a primer corresponding to the terminal part of a previously sequenced cDNA clone and a total RNA isolate. The presence of amplificati

  4. Social network analysis and supply chain management

    Directory of Open Access Journals (Sweden)

    Raúl Rodríguez Rodríguez

    2016-01-01

    Full Text Available This paper deals with social network analysis and how it could be integrated within supply chain management from a decision-making point of view. Even though the benefits of using social analysis have are widely accepted at both academic and industry/services context, there is still a lack of solid frameworks that allow decision-makers to connect the usage and obtained results of social network analysis – mainly both information and knowledge flows and derived results- with supply chain management objectives and goals. This paper gives an overview of social network analysis, the main social network analysis metrics, supply chain performance and, finally, it identifies how future frameworks could close the gap and link the results of social network analysis with the supply chain management decision-making processes.

  5. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  6. Social network analysis and supply chain management

    OpenAIRE

    Raúl Rodríguez Rodríguez

    2016-01-01

    This paper deals with social network analysis and how it could be integrated within supply chain management from a decision-making point of view. Even though the benefits of using social analysis have are widely accepted at both academic and industry/services context, there is still a lack of solid frameworks that allow decision-makers to connect the usage and obtained results of social network analysis – mainly both information and knowledge flows and derived results- with supply chain manag...

  7. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  8. Investigation on detection of Haemophilus ducreyi by Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xibao(张锡宝); FEI Shi(费实); DENG Wenguo(邓文国); CAO wenlig(曹文苓); ZHU huilan(朱慧兰); MENG jinxiu(孟锦秀); YAN jinglan(颜景兰)

    2002-01-01

    Objective:To investigate the application of polymerase chain reaction (PCR) detection of Haemophilus ducreyi in clinical diagnosis of chancroid.Methods: Nucleotide sequences of 16srRNA gene specific for H. Dureyi were used to develop primer sets for amplification of two strains. The amplified products were tested via PCR and sequenced by electrophoresis in a 1.5 % gel.These products were compared with those of heterogeneous species or related bacteria to test the specificity of the PCR assay. PCR amplification with different concentrations of H.ducreyi was performed to test its sensitivity.Results: PCR amplification of two strains of H. Ducreyi produced a single band of expected 438bp length. The sequence was identified with genomic DNA. None of the other 19 reference species amplified under the same conditions gave this result. The highest sensitivity of PCR assay in the present test was 10ng/L.Conclusions: PCR assay for detection of H. Ducreyi is a rapid, specific, and sensitive detection method. If laboratory conditions are strictly controlled, PCR assay is a potentially useful laboratory test for H. Ducreyi infection diagnosis.

  9. Monitoring infection: from blood culture to polymerase chain reaction (PCR).

    Science.gov (United States)

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank

    2013-06-01

    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  10. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  11. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  12. Identifying of meat species using polymerase chain reaction (PCR)

    Science.gov (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  13. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei

    2011-01-01

    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  14. Application of a real-time fluorescence resonance energy transfer polymerase chain reaction assay with melting curve analysis for the detection of Paragonimus heterotremus eggs in the feces of experimentally infected cats.

    Science.gov (United States)

    Tantrawatpan, Chairat; Intapan, Pewpan M; Thanchomnang, Tongjit; Sanpool, Oranuch; Janwan, Penchom; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai

    2013-09-01

    Paragonimus heterotremus is a medically important lung fluke that causes human and animal paragonimiasis in Southeast Asia, including Thailand. In the current study, a real-time fluorescence resonance energy transfer polymerase chain reaction (real-time FRET PCR) with melting curve analysis was developed and evaluated to detect P. heterotremus eggs in the feces of experimentally infected cats. The detection limit of this method for the P. heterotremus DNA sequence was 3 × 10(2) copies of the positive control plasmid and 10(-3) ng of P. heterotremus genomic DNA. The assay system could detect 10 eggs of P. heterotremus per gram of cat feces. No fluorescence signal was observed when DNA purified from 16 other organisms or genomic DNA from cats and human beings were tested. Real-time FRET PCR yielded positive results for all fecal samples from 17 P. heterotremus-infected cats and showed a negative relationship (r = -0.852, P Paragonimus species examined were divided into 4 groups by melting peak analysis. This assay can be useful for the detection of, and epidemiological studies on, P. heterotremus infection in endemic areas.

  15. Localization of the CYP2D gene locus to human chromosome 22q13. 1 by polymerase chain reaction, in situ hybridization, and linkage analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gouch, A.C.; Howell, S.M.; Bryant, S.P.; Spurr, N.K. (Clare Hall Lab., Hertfordshire (United Kingdom)); Smith, C.A.D.; Wolf, C.R. (Cancer Research Fund, Edinburgh (United Kingdom))

    1993-02-01

    Using a combination of somatic cell hybrids, in situ hybridization, and linkage mapping, we have been able to localize the cytochrome P450 CYP2D6 gene to chromosome 22 in the region q13.1. Linkage analysis, using locus-specific primers, showed a maximum sex-average lod score of 8.12 ([theta] = 0.00) between the marker pH130 (D22S64) and CYPsD6, of 6.92 ([theta] - 0.00) between the marker KI839 (D22S95) and CYP2D6, and 4.80 ([theta] = 0.036) between the platelet-derived growth factor [beta] subunit gene (PDGFB) and CYP2D6. 16 refs., 2 figs.

  16. ESTIMATION OF CHAIN REACTION BANKRUPTCY STRUCTURE BY CHANCE DISCOVERY METHOD- WITH TIME ORDER METHOD AND DIRECTED KEYGRAPH

    Institute of Scientific and Technical Information of China (English)

    Shinichi GODA; Yukio OHSAWA

    2007-01-01

    Chain reaction bankruptcy is regarded as common phenomenon and its effect is to be taken into account when credit risk portfolio is analyzed. But consideration and modeling of its effect leave much room for improvement. That is mainly because method for grasping relations among companies with limited data is underdeveloped. In this article, chance discovery method is applied to estimate industrial relations that are to include companies' relations that transmit chain reaction of bankruptcy.Time order method and directed KeyGraph are newly introduced to distinguish and express the time order among defaults that is essential information for the analysis of chain reaction bankruptcy. The steps for the data analysis are introduced and result of example analysis with default data in Kyushu,Japan, 2005 is presented. The structure estimated by the new method is compared with the structure of actual account receivable holders of bankrupted companies for evaluation.

  17. Suitability of DNA extracted from archival specimens of fruit-eating bats of the genus Artibeus (Chiroptera, Phyllostomidae for polymerase chain reaction and sequencing analysis

    Directory of Open Access Journals (Sweden)

    Mário Pinzan Scatena

    2008-01-01

    Full Text Available To establish a technique which minimized the effects of fixation on the extraction of DNA from formalin-fixed tissues preserved in scientific collections we extracted DNA samples from fixed tissues using different methods and evaluated the effect of the different procedures on PCR and sequencing analysis. We investigated muscle and liver tissues from museum specimens of five species of fruit-eating (frugivorous bats of the Neotropical genus Artibeus (Chiroptera, Phyllostomidae: A. fimbriatus, A. lituratus, A. jamaicensis, A. obscurus, and A. planirostris. The results indicated that treatment of tissues in buffered solutions at neutral pH and about 37 °C for at least four days improves the quality and quantity of extracted DNA and the quality of the amplification and sequencing products. However, the comparison between the performance of DNA obtained from fixed and fresh tissues showed that, in spite of the fact that both types of tissue generate reliable sequences for use in phylogenetic analyses, DNA samples from fixed tissues presented a larger rate of errors in the different stages of the study. These results suggest that DNA extracted from formalin-fixed tissue can be used in molecular studies of Neotropical Artibeus bats and that our methodology may be applicable to other animal groups.

  18. Extended haplotype analysis of ovine ADRB3 using polymerase chain reaction single strand conformational polymorphism on two regions of the gene.

    Science.gov (United States)

    Yang, Guo; Hickford, Jon G H; Zhou, Huitong; Fang, Qian; Forrest, Rachel H

    2011-07-01

    The β3 adrenergic receptor (ADRB3) plays a critical role in the regulation of energy metabolism in mammals. In sheep, intronic polymorphism of the ADRB3 gene has been associated with lamb survival and various production traits. This study investigates variation in the ovine ADRB3 3' untranslated region (3'UTR), a region that may impact expression of the gene. Using PCR- single strand conformational polymorphism (SSCP), six unique patterns (named a-f) were observed in an approximately 304-bp amplicon. Sequencing revealed three single-nucleotide polymorphisms (c.*233A>C, c.*271G>C, c.*357A>T) and a single-nucleotide deletion (c.*257delG). Haplotype analyses showed that the previously described allele A defined by variation in the ovine ADRB3 intron can be divided into three haplotypes (Aa, Ab, and Ac). In total, 16 haplotypes through ovine ADRB3 were detected. This study suggests that ovine ADRB3 is highly polymorphic and that the extended haplotype analysis through the promoter, 5'UTR, coding sequence, intron, and 3'UTR needs to be performed to define the full extent of variation in this gene. PMID:21348572

  19. O6-Methylguanine-DNA methyltransferase protein expression by immunohistochemistry in brain and non-brain systemic tumours: systematic review and meta-analysis of correlation with methylation-specific polymerase chain reaction

    International Nuclear Information System (INIS)

    The DNA repair protein O6-Methylguanine-DNA methyltransferase (MGMT) confers resistance to alkylating agents. Several methods have been applied to its analysis, with methylation-specific polymerase chain reaction (MSP) the most commonly used for promoter methylation study, while immunohistochemistry (IHC) has become the most frequently used for the detection of MGMT protein expression. Agreement on the best and most reliable technique for evaluating MGMT status remains unsettled. The aim of this study was to perform a systematic review and meta-analysis of the correlation between IHC and MSP. A computer-aided search of MEDLINE (1950-October 2009), EBSCO (1966-October 2009) and EMBASE (1974-October 2009) was performed for relevant publications. Studies meeting inclusion criteria were those comparing MGMT protein expression by IHC with MGMT promoter methylation by MSP in the same cohort of patients. Methodological quality was assessed by using the QUADAS and STARD instruments. Previously published guidelines were followed for meta-analysis performance. Of 254 studies identified as eligible for full-text review, 52 (20.5%) met the inclusion criteria. The review showed that results of MGMT protein expression by IHC are not in close agreement with those obtained with MSP. Moreover, type of tumour (primary brain tumour vs others) was an independent covariate of accuracy estimates in the meta-regression analysis beyond the cut-off value. Protein expression assessed by IHC alone fails to reflect the promoter methylation status of MGMT. Thus, in attempts at clinical diagnosis the two methods seem to select different groups of patients and should not be used interchangeably

  20. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  1. Rapid and efficient identification of the mouse leptin receptor mutation (C57BL/KsJ-db/db) by tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) analysis.

    Science.gov (United States)

    Jung, Harry; Nam, Hajin; Suh, Jun-Gyo

    2016-03-01

    The C57BLKS/J-Lepr(db) mouse has a point mutation in the leptin receptor gene and is one of the most useful animal model for non-insulin dependent diabetes mellitus in human. Since the homozygote of C57BLKS/J-Lepr(db) mouse is infertile, detection of point mutation in the leptin receptor gene is important for efficient maintaining strains as well as mass production of homozygotes. To develop a rapid and efficient genotyping method for C57BLKS/J-Lepr(db) mouse, the tetra-primer amplification-refractory mutation system polymerase chain reaction (ARMS-PCR) was used. The 407 and 199 bp PCR products were amplified from normal (+/+) mice; while the 407 and 268 bp PCR products were amplified from homozygotes (db/db) mice; and the 407, 268, and 199 bp PCR products were amplified from heterozygotes (db/+) mice. This result showed that the tetra-primer ARMS-PCR analysis by us is suitable to detect point mutation of the leptin receptor gene. Taken together, our method will dramatically reduce animal use for maintenance of strains as well as production of homozygote in the C57BLKS/J-Lepr(db) strains.

  2. Assessing HER2 amplification by IHC, FISH, and real-time polymerase chain reaction analysis (real-time PCR) following LCM in formalin-fixed paraffin embedded tissue from 40 women with ovarian cancer.

    Science.gov (United States)

    Hillig, Thore; Thode, Jørgen; Breinholt, Marie F; Franzmann, Maria-Benedicte; Pedersen, Carsten; Lund, Flemming; Mygind, Henrik; Sölétormos, György; Rudnicki, Martin

    2012-12-01

    We compare HER2 receptor amplification analysis by immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), and real-time polymerase chain reaction (real-time PCR) DNA copy-number assay following laser capture microdissection (LCM) in formalin-fixed paraffin embedded tissue from 40 women with verified ovarian cancer. We speculate that LCM should result in a more accurate assessment of HER2 amplification in our real-time PCR assay compared with IHC and FISH. HER2 overexpression measured by IHC, FISH, or real-time PCR was found in 5.0%, 5.0%, and 22.5%, respectively. HER2 negative results measured by IHC, FISH, or real-time PCR were found in 95%, 92.5%, and 60.0%, respectively. Analysis failed for IHC, FISH, or real-time PCR in 0%, 2.5%, or 17.5% of cases. Concordance between IHC and FISH, IHC and real-time PCR, or FISH and real-time PCR were 89.7%, 72.7%, or 78.1%, respectively. Only few ovarian cancer patients were HER2 overexpressed measured by IHC or FISH and thus could be eligible for antibody-based therapy with trastuzumab (Herceptin). Interestingly, we find an increased number of HER2 positive patients by real-time PCR analysis on microdissected cancer cells, suggesting a number of HER2 positive patients not detected by current methods. Thus, the concept of quantitative measurement of HER2 on microdissected cancer cells should be explored further.

  3. Pea (Pisum sativum) genes involved in symbiosis with nitrogen-fixing bacteria.1.Analysis of the expression of the early nodulin gene ENOD12 using the polymerase chain-reaction

    OpenAIRE

    Zalenskii, A.O.; Kozik, A.V.; Scheres, B.J.G.; Bisseling, A.; Tikhonovich, I.A.

    1991-01-01

    The polymerase chain reaction (PCR) was used to detect the transcription products of the early nodulin gene in the pea. Single-stranded DNA copies were prepared using a primer corresponding to the terminal part of a previously sequenced cDNA clone and a total RNA isolate. The presence of amplification products was detected using Southern hybridization. Expression of the ENOD12 gene was found to occur at the earliest developmental stages of the symbiosis between the pea and nitrogenfixing bact...

  4. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis.

    OpenAIRE

    1992-01-01

    We have determined and compared partial 16S rRNA sequences from 23 Lyme disease spirochete isolates and aligned these with 8 sequences previously presented. The 16S rRNA signature nucleotide compositions were defined for each isolate and compared with the genomic species signature nucleotide sets previously established. To identify positions truly indicative of species classification which could serve as targets for polymerase chain reaction species-specific identification primers, 16S rRNA-b...

  5. [Detection of leptospirosis reservoirs in Madagascar using the polymerase chain reaction technique].

    Science.gov (United States)

    Ralaiarijaona, R L; Bellenger, E; Chanteau, S; Roger, F; Pérolat, P; Rasolofo Razanamparany, V

    2001-01-01

    A polymerase chain reaction (PCR) technique was used for detection of the Leptospira interrogans rrs gene in kidney tissue from 115 rats, 50 zebu cattles and 13 pigs in an attempt to identify a possible animal reservoir of leptospirosis in Madagascar. In addition, serological testing of 105 individuals in close contact with animals was carried out. The PCR analysis was negative for all the samples tested and only one person was found seropositive at a low titer. The findings suggest that leptospirosis, if prevalent in Madagascar, is likely rare.

  6. [Identification of the causative agents of glanders and melioidosis by polymerase chain reaction].

    Science.gov (United States)

    Tkachenko, G A; Antonov, V A; Zamaraev, V S; Iliukhin, V I

    2003-01-01

    Burkholderia mallei and B. pseudomallei are causative agents of glanders and melioidosis, respectively, i.e. severe and fatal infection diseases of man and animal. The computer-based analysis of the 23S rRNA gene sites was used for selecting the primers. Two pairs of primers were chosen for the identification of B. mallei and Bpseudomallei. DNAs from 48 B. pseudomallei and 15 strains of B. mallei, unlike from other geterological bacteria, were positively amplified. Therefore, the method of polymerase chain reaction can be used in laboratory diagnosis of glanders and melioidosis.

  7. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan

    2004-01-01

    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  8. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.

    OpenAIRE

    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J

    1992-01-01

    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...

  9. CHARACTERISTICS OF THE VALUE CHAIN OF THE GLOBAL VALUE CHAIN AND THE SCOPE OF THE CHAIN ANALYSIS

    OpenAIRE

    Luu, Thai

    2013-01-01

    The value chain of vegetable industry is a line of production processing business of vegetable under the mode of globalization, of which, economic subjects of many countries involve in the different stages in the chain. The method of global approach under the value chain has been developed over time and is used as an analysis tool in market research of the global vegetable industry. Three key elements of the pattern of analysis scope of the global vegetable value chain analysis of the global ...

  10. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Science.gov (United States)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  11. Identification of duck plague virus by polymerase chain reaction

    Science.gov (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  12. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary

    2012-08-01

    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  13. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  14. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.

    OpenAIRE

    1991-01-01

    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  15. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.

    2001-03-08

    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  16. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  17. Energy Chain Analysis of Passenger Car Transport

    Directory of Open Access Journals (Sweden)

    Hans Jakob Walnum

    2011-02-01

    Full Text Available Transport makes up 20 percent of the World’s energy use; in OECD countries this has exceeded 30 percent. The International Energy Agency (IEA estimates that the global energy consumption will increase by 2.1 percent annually, a growth rate that is higher than for any other sector. The high energy consumption means that transportation accounts for nearly 30 percent of CO2 emission in OECD countries and is also one of the main sources of regional and local air pollution. In this article, we analyze energy consumption and greenhouse gas emissions from passenger car transport using an energy chain analysis. The energy chain analysis consists of three parts: the net direct energy use, the energy required for vehicle propulsion; the gross direct chain, which includes the net direct energy consumption plus the energy required to produce it; and, finally, the indirect energy chain, which includes the energy consumption for production, maintenance and operation of infrastructure plus manufacturing of the vehicle itself. In addition to energy consumption, we also analyze emissions of greenhouse gases measured by CO2-equivalents. We look at the trade-offs between energy use and greenhouse gas emissions to see whether some drivetrains and fuels perform favourable on both indicators. Except for the case of electric cars, where hydropower is the only energy source in the Norwegian context, no single car scores favourably on both energy consumption and greenhouse gas emissions.

  18. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  19. SABRE: A Tool for Stochastic Analysis of Biochemical Reaction Networks

    CERN Document Server

    Didier, Frederic; Mateescu, Maria; Wolf, Verena

    2010-01-01

    The importance of stochasticity within biological systems has been shown repeatedly during the last years and has raised the need for efficient stochastic tools. We present SABRE, a tool for stochastic analysis of biochemical reaction networks. SABRE implements fast adaptive uniformization (FAU), a direct numerical approximation algorithm for computing transient solutions of biochemical reaction networks. Biochemical reactions networks represent biological systems studied at a molecular level and these reactions can be modeled as transitions of a Markov chain. SABRE accepts as input the formalism of guarded commands, which it interprets either as continuous-time or as discrete-time Markov chains. Besides operating in a stochastic mode, SABRE may also perform a deterministic analysis by directly computing a mean-field approximation of the system under study. We illustrate the different functionalities of SABRE by means of biological case studies.

  20. Thermal reactions of polymer chains with coal structures

    Energy Technology Data Exchange (ETDEWEB)

    P. Straka; J. Nahunkova [Academy of Sciences of the Czech Republic, Prague (Czech Republic). Institute of Rock Structure and Mechanics

    2003-07-01

    The thermal decompositions of polyethylene, polystyrene and polyamide 6 in the presence of coal was studied by DSC and TGA methods and reactions of these polymers with coal were described. Tars and cokes obtained were characterized and mass balance of the process expressed. Polyethylene decomposes by a free radical mechanism and the major products are 1-alkenes, {alpha},{omega}-alkadienes and n-alkanes. In the presence of coal, formed unsaturated products are adsorbed on the inner surface of coal and semicoke. Maximum weight losses of the coal-polyethylene mixture occur at higher temperature in comparison with that from the decomposition of polyethylene alone. Further, thermal reactions of coal with polystyrene were studied. In the range of 410 490{sup o}C a thermal degradation of coal proceeded, simultaneously, with decomposition of polystyrene. Because coal is a strong H-donor, unsaturated products of polystyrene decomposition (mainly styrene) was hydrogenated by coal. Some aromatic products of polystyrene decomposition reacted with the coal tar structures and new aromatics were formed. That is why the conversion time of polystyrene decomposition was much higher in the presence of coal. The yields of tar from copyrolysis with styrene polymers are higher in comparison with pyrolysis of coal alone. Also composition of tar is changed. Finally, reactions of coal with polyamide 6 were investigated. During the thermal degradation of coal the decomposition of polyamide 6 occurs and {epsilon}-caprolactam and the cyclic dimer are formed. The {epsilon}-caprolactam formation is promoted by water and hydrogen from coal degradation as due to high content of hydrogen coal acts as a strong H- and water donor. Under high-temperature conditions of copyrolysis beside a-caprolactam mainly carbon oxides, methane, aliphatic hydrocarbons, simple aromatics and stable oil are formed. 8 refs., 3 figs., 7 tabs.

  1. High-throughput Procedure for Single Pollen Grain Collection and Polymerase Chain Reaction in Plants

    Institute of Scientific and Technical Information of China (English)

    Ping-Hua Chen; Yong-Bao Pan; Ru-Kai Chen

    2008-01-01

    Single pollen grain polymersse chain reaction (PCR) has succeeded in several species, however only limited numbers of pollen grains were involved due to difficulties in pollen isolation and lysis. This has limited its application in genetic analysis and mapping studies in plants. A high-throughput (HT) procedure for collecting and detecting genetic variation in a large number of individual pollen grains by PCR is reported. The HT procedure involved the collection of Individual pollen grains by a pair of special forceps and the lysis of pollen grains in a heated alkali/detergent solution followed by neutralization with a tris-ethylenediamine tetraacetic acid (TE) buffer. These resulting template solutions yielded PCR reactions involving the 5S ribosomal RNA intergenic spacers, randomly amplified polymorphic DNA, and simple sequence repeats markers. Using this procedure, one person with experience could collect and process up to 288 single pollen grain PCR reactions per day. The method worked well on sugarcane, corn, Miscanthus spp., snap bean, sorghum, and tomato. The ability to collect and conduct PCR on individual pollen grains on a large scale offers a new approach to genetic analyses and mapping studies in an easily controllable environment with a considerable cost reduction. The method will also significantly benefit studies in species that are difficult subjects for classical genetic research.

  2. A Theoretical Investigation on the Reaction Mechanism of the C8H+·10 Side-Chain Decomposition Processes

    Institute of Scientific and Technical Information of China (English)

    CHENG Xue-Li; ZHAO Yan-Yun; LI Feng

    2008-01-01

    The dissociation of ethylbenzene cation C8H+·10 served as a prototype to investigate the decompasition mechanisms of alkylbenzene cations.The reactions of C8H+·10 decomposition reaction system have been studied extensively at the B3L YP/6-311++G** level with Gaussion 98 package.The chain reaction of C8H+·10 dissociation is initiated by C-H bond rupture.All reaction channels were fully investigated with the vibrational mode analysis to confirm the transition states and reveal the reaction mechanism.The energetically most favorable pathway is C8H+·10→TS4→·P2+H· and the channel ieading to C8H+·10 and C2H4 is also competitive.

  3. Diagnosis of Progressive Spinal Muscular Atrophy by Using Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    姚娟; 丁新生; 陈克连; 程虹; 邓晓萱; 沈鸣九; 王颖

    2001-01-01

    Objective To understand the deletion in the survival motor neuron gene (SMN) of childhood-onset spinal muscular atrophy (SMA) in Chinese, and the value of diagnosis of SMA using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)method. Methods Deletions of SMN gene of exon 7 and 8 in 10 cases of presumed SMA, and 20 normal controls from 6 families and 30 unrelated controls were performed by PCR-RFLP analysis. Results Deletions of SMN gene detected in 9 of 10 (90%) cases of presumed SMA . No deletions of SMN in the telomere were found in the other members of families and controls.Conclusion PCR-RFLP is a sensitive, specific and simple method in diagnosis of SMA.

  4. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction.

    Science.gov (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-01-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  5. The Unit of Analysis in Supply Chain Management Research

    OpenAIRE

    Ma, Jingjing

    2014-01-01

    This dissertation will introduce the different unit of analysis in supply chain management research. The dissertation structure more base literature review dissertation. It selects several of academic journal bases on a periodicals journal list focus on supply chain management research. In this dissertation, it choice three issues which are supply chain relationship, sustainable supply chain and supply chain procurement. There were some units of analysis from these issues in order to find whi...

  6. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  7. Detection of Cryptosporidium species in feces or gastric contents from snakes and lizards as determined by polymerase chain reaction analysis and partial sequencing of the 18S ribosomal RNA gene.

    Science.gov (United States)

    Richter, Barbara; Nedorost, Nora; Maderner, Anton; Weissenböck, Herbert

    2011-05-01

    Cryptosporidiosis is a well-known gastrointestinal disease of snakes and lizards. In the current study, 672 samples (feces and/or gastric contents or regurgitated food items) of various snakes and lizards were examined for the presence of cryptosporidia by polymerase chain reaction (PCR) assay targeting a part of the 18S ribosomal RNA gene. A consecutive sequencing reaction was used to identify the cryptosporidian species present in PCR-positive samples. Cryptosporidium varanii (saurophilum) was detected in 17 out of 106 (16%) samples from corn snakes (Pantherophis guttatus) and in 32 out of 462 (7%) samples from leopard geckos (Eublepharis macularius). Cryptosporidium serpentis was found in 8 out of 462 (2%) leopard gecko samples, but in no other reptile. The Cryptosporidium sp. "lizard genotype" was present in 1 leopard gecko sample, and 1 sample from a corn snake showed a single nucleotide mismatch to this genotype. Pseudoparasitic cryptosporidian species were identified in 5 out of 174 (3%) ophidian samples, but not in lizards. Other sequences did not show complete similarity to previously published Cryptosporidium sequences. The results stress the importance for diagnostic methods to be specific for Cryptosporidium species especially in snakes and show a relatively high prevalence of C. varanii in leopard geckos and corn snakes.

  8. Method of carbon chain extension using novel aldol reaction

    Energy Technology Data Exchange (ETDEWEB)

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  9. Differentiation of Neisseria gonorrhoeae strains by polymerase chain reaction and restriction fragment length polymorphism of outer membrane protein IB genes.

    OpenAIRE

    Lau, Q C; Chow, V T; Poh, C. L.

    1995-01-01

    OBJECTIVES--To employ polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis for the rapid differentiation of Neisseria gonorrhoeae protein IB (PIB) isolates and to compare its usefulness with the widely accepted auxotype/serovar classification scheme. METHODS--The outer membrane protein IB genes of 47 gonococcal isolates belonging to 10 different serovars were amplified by PCR. The approximately 1 kb DNA products were then digested separately with restri...

  10. POLYMERASE CHAIN REACTION FOR THE DETECTION OF TOXIN A ( TCD A AND TOXIN B ( TCD B GENES OF CLOSTRIDIUM DIFFICILE ISOLATED FROM DIARRHOEAL CASES AND ANALYSIS OF THE CLINICAL SPECTRUM

    Directory of Open Access Journals (Sweden)

    Sherin

    2015-04-01

    Full Text Available BACKGROUND: Molecular methods for detection of toxigenic Clostridium difficile have been established in the developed countries though not very common in our country. AIMS: The study was intended to determine the presence of toxin A and toxin B genes of Clostridium difficile isolates by means of polymerase chain reaction (PCR and a nalysis of clinical picture of the patients. MATERIALS AND METHODS: The prospective study was conducted in a tertiary care teaching hospital, South India from January 2012 to December 2014. Stool samples were collected consecutively from 563 in patients with diarrhoea from various wards. Clostridium difficile was isolated and identified by semi quantitative culture, latex agglutination and biochemical reactions. These isolates were then subjected to PCR for the detection of toxin A and toxin B genes. In addition, enzyme immunoassay was performed on stool samples for the detection of toxins A and B. The clinical spectrum of PCR positive patients was also analyzed. RESULTS: From 563 stool specimens, 113 (20. 07% Clostridium difficile isolates wer e grown by culture and identified by latex agglutination and biochemical reactions. Out of 113 isolates, 94 were subjected to PCR. 50 (53. 19% isolates out of 94 were found to be positive. Three toxigenic types obtained were A + B + , A - B + and A + B - which accou nted for 6. 38%, 42.55% and 4. 26% respectively. A - B - isolates were 46. 81%. 30 (26.55% out of 113 stool samples (which were culture positive was also enzyme immunoassay positive. 32 (64% out of 50 PCR positive patients e xhibited antibiotic usage (p<0. 05 and 39 (78% revealed the presence of underl ying illnesses/conditions (p<0. 01. CONCLUSION: The study highlights the usefulness of PCR for detection of toxigenic Clostridium difficile and for determination of its molecular epidemiology.

  11. Preparation of End Grafted Polyacrylonitrile Brushes through Surface Confined Radical Chain Transfer Reaction

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    End grafted polyacrylonitrile (PAN) brush was prepared through surface initiated polymerization via the chain transfer process. The thiol-terminated monolayer and PAN brushes were characterized by FTIR, X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), ellipsometry and contact angle measurements ete. It is demonstrated that radical chain transfer reaction and surface initiated precipitate polymerization can be used to prepare end-grafted polymer brushes.

  12. Sustainability Analysis for Gayo Coffee Supply Chain

    OpenAIRE

    Rachman Jaya; Machfud Machfud; Sapta Raharja; Marimin Marimin

    2013-01-01

    Sustainable supply chain is a development of the conventional supply chains that discuses trade-off among economic, social and environmental dimensions in order to achieve better responsiveness in terms of quality, quantity and time-delivery in the supply chain structure. The objective of this research was to determine the Gayo coffee supply chain sustainability. The research was conducted at Bener Meriah and Aceh Tengah Districts, Aceh Province, Indonesia. Key actors in the supply chain cons...

  13. Supply Chains and Social Network Analysis

    OpenAIRE

    Mueller, Rolf A.E.; Buergelt, Doreen; Seidel-Lass, Linda

    2008-01-01

    Judged by its currency, the supply chain is one of the more successful metaphors in economics. The metaphor borrows from mechanics the idea of the chain, that is something that consists of elements that are linked to each of their two immediate neighbors and which jointly provide a strong but flexible connection. The metaphor transplants the chain-idea into the sphere of economics where, before the introduction of supply chains, chains were, for most economists, things best left in the care o...

  14. An Integrated Nucleic Acid Extraction Microchip for Real-time Polymerase Chain Reaction Micro Total Analysis System%集成核酸提取的实时荧光PCR微全分析系统

    Institute of Scientific and Technical Information of China (English)

    赵树弥; 刘勇; 朱灵; 朱灿灿; 李阳; 王华东; 张龙; 堵棣威; 邓国庆; 王安

    2014-01-01

    集成核酸提取的实时荧光PCR微全分析系统将核酸提取、PCR扩增与实时荧光检测进行整合,在同一块微流控芯片上实现了核酸分析过程的全自动和全封闭,具有试剂用量少、分析速度快、操作简便等优点。本研究采用微机械加工技术制作集成核酸提取微流控芯片的阳极模,使用组合模具法和注塑法制作具有3D通道的PDMS基片,与玻璃基底通过等离子体键合封装成集成核酸提取芯片。构建了由微流体速度可调节(0~10 mL/min)的驱动控制装置、温控精度可达0.1℃的TEC温控平台、CCD检测功能模块等组成的微全分析系统。以人类血液裂解液为样品,采用硅胶膜进行芯片上核酸提取。系统根据设置好的时序自动执行,以2 mL/min的流体驱动速度完成20μL裂解液上样、清洗;以1 mL/min的流体驱动速度完成DNA洗脱,抽取PCR试剂与之混合注入到反应腔。提取的基因组DNA以链上内参基因GAPDH为检测对象,并以传统手工提取为对照,在该系统平台上进行PCR扩增和熔解曲线分析实验。片上PCR扩增结果显示,扩增曲线明显, Ct值分别为25.3和26.9。扩增产物进行熔解曲线分析得到的熔解温度一致,均为89.9℃。结果表明,此系统能够自动化、全封闭的在微流控芯片上完成核酸提取、PCR扩增与实时定量分析。%A real-time polymerase chain reaction ( PCR ) micro total analysis system (μ-TAS ) integrated nucleic acid extraction, PCR amplification and real-time-fluorescent PCR detection on a same microfluidic chip was prepared for the fully automated and on-chip analysis of nucleic acid. The proposed method had the advantage such as low sample consumption, fast analysis and simple operation and so on. Micromachining technology was used to fabricate the anodic molds of integrated nucleic acid extraction microfluidic chip. A polydimethylsiloxane (PDMS) substrate with 3D

  15. Biofuel supply chain, market, and policy analysis

    Science.gov (United States)

    Zhang, Leilei

    Renewable fuel is receiving an increasing attention as a substitute for fossil based energy. The US Department of Energy (DOE) has employed increasing effort on promoting the advanced biofuel productions. Although the advanced biofuel remains at its early stage, it is expected to play an important role in climate policy in the future in the transportation sector. This dissertation studies the emerging biofuel supply chain and markets by analyzing the production cost, and the outcomes of the biofuel market, including blended fuel market price and quantity, biofuel contract price and quantity, profitability of each stakeholder (farmers, biofuel producers, biofuel blenders) in the market. I also address government policy impacts on the emerging biofuel market. The dissertation is composed with three parts, each in a paper format. The first part studies the supply chain of emerging biofuel industry. Two optimization-based models are built to determine the number of facilities to deploy, facility locations, facility capacities, and operational planning within facilities. Cost analyses have been conducted under a variety of biofuel demand scenarios. It is my intention that this model will shed light on biofuel supply chain design considering operational planning under uncertain demand situations. The second part of the dissertation work focuses on analyzing the interaction between the key stakeholders along the supply chain. A bottom-up equilibrium model is built for the emerging biofuel market to study the competition in the advanced biofuel market, explicitly formulating the interactions between farmers, biofuel producers, blenders, and consumers. The model simulates the profit maximization of multiple market entities by incorporating their competitive decisions in farmers' land allocation, biomass transportation, biofuel production, and biofuel blending. As such, the equilibrium model is capable of and appropriate for policy analysis, especially for those policies

  16. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  17. Evaluation of IgG anti-toxoplasma avidity and polymerase chain reaction in the postnatal diagnosis of congenital toxoplasmosis.

    Science.gov (United States)

    Torres, Elizabeth; Rivera, Raul; Cardona, Nestor; Sanchez, Victor; Lora, Fabiana; Gómez-Marín, Jorge Enrique

    2013-06-01

    Confirmatory tests for congenital toxoplasmosis were evaluated in 23 infected and 31 uninfected newborns. Conventional polymerase chain reaction was better than real-time polymerase chain reaction, but did not identify additional cases. Avidity tests added 2 new cases that were not identified by other criteria. Overall sensitivity was 82.6%. Avidity assay, but not polymerase chain reaction, increased the sensitivity of confirmatory assays in congenital toxoplasmosis.

  18. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in wetlands, western Kenya: confirmation by polymerase chain reaction method.

    Science.gov (United States)

    Ohba, Shin-Ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; Sonye, Gorge; Minakawa, Noboru; Takagi, Masahiro

    2010-09-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  19. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    Science.gov (United States)

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  20. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    A total of 280 persons were HLA-DQA1 typed by two different polymerase chain reaction (PCR) based methods; (i) a reverse dot-blot (RDB) method, which can differentiate between six alleles, and (ii) a combined PCR-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification...

  1. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...

  2. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  3. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)

    1993-01-01

    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The resul

  4. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  5. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    Science.gov (United States)

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  6. RAPID DETECTION OF Salmonella IN SHRIMP BY POLYMERASE CHAIN REACTION [Deteksi Cepat Salmonella pada Udang dengan Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ulfah Amalia

    2014-06-01

    Full Text Available Shrimp is an important non-oil commodity for foreign trade in Indonesia. However, rejection of shrimp exports by the importing countries is still commonly encountered. In 2011, the USFDA recorded two cases of Salmonella spp. contamination in shrimp products from two shrimp processing companies in Indonesia. Analysis of Salmonella spp. in seafood is generally performed using a conventional method which takes at least 5 days. The objective of the study is to get a Salmonellae rapid detection method in shrimp by PCR. In this study, optimization of PCR protocol method to detect Salmonella invA gene was conducted using six different annealing temperatures (59, 59.5, 60.8, 62, 64 and 64.5°C. The results showed that 64°C was the optimum annealing temperature to detect the 284 bp fragment of Salmonella invA gene. The PCR based detection method has a DNA detection limit of 27.81ug/mL and 10°CFU/mL of viable salmonellae with 100% specificity. The PCR protocol is capable of detecting six different Salmonella serovars (S. Enteritidis, S. Hadar, S. Heidelberg, S. Kentucky, S. Paratyphi and S. Typhimurium but none of the non salmonellae isolates. Application of the PCR assay on Salmonella in shrimp after the selective enrichment step suggested that all 16 samples were positive for Salmonella. At the same time, the conventional method could only detected 3 samples for Salmonella positive.

  7. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou

    2005-01-01

    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  8. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Science.gov (United States)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  9. DIFFERENTIATION OF PSEUDOCONDYLOMA OF VULVA AND CONDYLOMA ACUMINATA BY DOT BLOT HYBRIDIZATION AND POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿

    1996-01-01

    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  10. Molecular sexing of birds: A comparative review of polymerase chain reaction (PCR)-based methods.

    Science.gov (United States)

    Morinha, F; Cabral, J A; Bastos, E

    2012-09-01

    Accurate identification of sex in birds is important for the management and conservation of avian wildlife in several ways, namely in the development of population, behavioral and ecological studies, as well as in the improvement of ex situ captive breeding programs. In general, nestlings, juveniles and adult birds of a wide number of sexually monomorphic species cannot be sexed based on phenotypic traits. The development of molecular methodologies for avian sexing overcame these difficulties, allowing a reliable gender differentiation for these species. The polymerase chain reaction (PCR)-based methods have been widely applied in molecular sexing of birds, using a large diversity of sex-linked markers. During the last 15 yrs, there was a continuous improvement in the PCR-based protocols for bird sexing, increasing the accuracy, speed and high-throughput applicability of these techniques. The recent advances in real-time PCR platforms and whole genome analysis methods provided new resources for the detection and analysis of novel specific markers and protocols. This review presents a comparative guide of classical and recent advances in PCR-based methods for avian molecular sexing, highlighting its strengths and limitations. Future research opportunities in this field are also addressed.

  11. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction.

    Science.gov (United States)

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T

    1997-01-01

    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  12. A novel technique for measuring variations in DNA copy-number: competitive genomic polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Nakagawara Akira

    2007-07-01

    Full Text Available Background Changes in genomic copy number occur in many human diseases including cancer. Characterization of these changes is important for both basic understanding and diagnosis of these diseases. Microarrays have recently become the standard technique and are commercially available. However, it is useful to have an affordable technique to complement them. Results We describe a novel polymerase chain reaction (PCR-based technique, termed competitive genomic PCR (CGP. The main characteristic of CGP is that different adaptors are added to the sample and control genomic DNAs after appropriate restriction enzyme digestion. These adaptor-supplemented DNAs are subjected to competitive PCR using an adaptor-primer and a locus-specific primer. The amplified products are then separated according to size differences between the adaptors. CGP eliminates the tedious steps inherent in quantitative PCR and achieves moderate throughput. Assays with different X chromosome numbers showed that it can provide accurate quantification. High-resolution analysis of neuroblastoma cell lines around the MYCN locus revealed novel junctions for amplification, which were not detected by a commercial array. Conclusion CGP is a moderate throughput technique for analyzing changes in genomic copy numbers. Because CGP can measure any genomic locus using PCR primers, it is especially useful for detailed analysis of a genomic region of interest.

  13. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    Science.gov (United States)

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  14. 基因扩增技术分析前质量控制的相关环节%Related Links of Quality Control before Polymerase Chain Reaction Analysis

    Institute of Scientific and Technical Information of China (English)

    阴斌霞; 罗超; 刘少棠; 李刚; 王博; 纪少云

    2015-01-01

    基因扩增技术(polymerase chain reaction 简称 PCR)是近年来分子生物学水平的一种新的疾病检测手段,具有灵敏、特异、微量、简便、快速等优点,操作中影响因素颇多,质量控制难以掌控,尤其是分析前质量控制涉及环节较多,是目前实验室质量控制中最薄弱也是最需要重视的环节。控制好这些环节,对提高 PCR 检验的准确度、可信度,提高分子生物学诊治水平,提高检验人员的业务水平,减少医患纠纷以及对 PCR 实验室的技术准入、验收都是非常重要的,也是非常必要的。笔者从 PCR 检验申请单正确填写,患者的准备,标本的采集、处理、运送、储存、不合格标本的拒收,实验室技术人员的要求,仪器设备的校准、维护,试剂、耗材的质检,标准化操作程序(SOP)的编写和执行、实验室安全等分析前的相关环节对PCR 检验质量的影响予以阐述,供同行参考。%Polymerase Chain Reaction (PCR)in recent years is a new disease detection methods basedon molecular biology level.It has the advantage of sensitive,specific,trace,simple,fast,but in the operation due to multiple factors,quality control is not easy to control.Especially in the first stage of quality control,it engages alot of operations and is weakest stage such needs most concern.It is necessary and important to have a good quality control;it not only improve the reliability and accu-racy of PCR testing,treatment of molecular biology,the professional level of work staff,but also reduce patient disputes and increase technology access,acceptance of the PCR laboratory.In this paper,the author from the factors which influence the first stage of PCR:whether correctly fill PCR test application form,patient preparation,handling,transportation,storage of good sample,unqualified specimen rejection,the requirement of laboratory technicians,calibration and maintenance on the in

  15. Fetal RHD Genotyping Using Real-Time Polymerase Chain Reaction Analysis of Cell-Free Fetal DNA in Pregnancy of RhD Negative Women in South of Iran

    Directory of Open Access Journals (Sweden)

    Leili Moezzi

    2016-05-01

    Full Text Available Background: Maternal-fetal RhD antigen incompatibility causes approximately 50% of clinically significant alloimmunization cases. The routine use of prophylactic anti-D immunoglobulin has dramatically reduced hemolytic disease of the fetus and newborn. Recently, fetal RHD genotyping in RhD negative pregnant women has been suggested for appropriate use of anti-D immunoglobulin antenatal prophylaxis and decrease unnecessary prenatal interventions. Materials and Methods: In this prospective cohort study, in order to develop a reliable and non-invasive method for fetal RHD genotyping, cell free fetal DNA (cffDNA was extracted from maternal plasma. Real-time quantitative polymerase chain reaction (qPCR for detection of RHD exons 7, 5, 10 and intron 4 was performed and the results were compared to the serological results of cord blood cells as the gold standard method. SRY gene and hypermethylated Ras-association domain family member 1 (RASSF1A gene were used to confirm the presence of fetal DNA in male and female fetuses, respectively. Results: Out of 48 fetuses between 8 and 32 weeks (wks of gestational age (GA, we correctly diagnosed 45 cases (93.75% of RHD positive fetuses and 2 cases (4.16% of the RHD negative one. Exon 7 was amplified in one sample, while three other RHD gene sequences were not detected; the sample was classified as inconclusive, and the RhD serology result after birth showed that the fetus was RhD-negative. Conclusion: Our results showed high accuracy of the qPCR method using cffDNA for fetal RHD genotyping and implicate on the efficiency of this technique to predict the competence of anti-D immunoglobulin administration.

  16. Measurement errors in polymerase chain reaction are a confounding factor for a correct interpretation of 5-HTTLPR polymorphism effects on lifelong premature ejaculation: a critical analysis of a previously published meta-analysis of six studies.

    Directory of Open Access Journals (Sweden)

    Paddy K C Janssen

    Full Text Available OBJECTIVE: To analyze a recently published meta-analysis of six studies on 5-HTTLPR polymorphism and lifelong premature ejaculation (PE. METHODS: Calculation of fraction observed and expected genotype frequencies and Hardy Weinberg equilibrium (HWE of cases and controls. LL,SL and SS genotype frequencies of patients were subtracted from genotype frequencies of an ideal population (LL25%, SL50%, SS25%, p = 1 for HWE. Analysis of PCRs of six studies and re-analysis of the analysis and Odds ratios (ORs reported in the recently published meta-analysis. RESULTS: Three studies deviated from HWE in patients and one study deviated from HWE in controls. In three studies in-HWE the mean deviation of genotype frequencies from a theoretical population not-deviating from HWE was small: LL(1.7%, SL(-2.3%, SS(0.6%. In three studies not-in-HWE the mean deviation of genotype frequencies was high: LL(-3.3%, SL(-18.5% and SS(21.8% with very low percentage SL genotype concurrent with very high percentage SS genotype. The most serious PCR deviations were reported in the three not-in-HWE studies. The three in-HWE studies had normal OR. In contrast, the three not-in-HWE studies had a low OR. CONCLUSIONS: In three studies not-in-HWE and with very low OR, inadequate PCR analysis and/or inadequate interpretation of its gel electrophoresis resulted in very low SL and a resulting shift to very high SS genotype frequency outcome. Consequently, PCRs of these three studies are not reliable. Failure to note the inadequacy of PCR tests makes such PCRs a confounding factor in clinical interpretation of genetic studies. Currently, a meta-analysis can only be performed on three studies-in-HWE. However, based on the three studies-in-HWE with OR of about 1 there is not any indication that in men with lifelong PE the frequency of LL,SL and SS genotype deviates from the general male population and/or that the SL or SS genotype is in any way associated with lifelong PE.

  17. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    OpenAIRE

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  18. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.;

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  19. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend;

    1991-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...... was minimized. The polymerase chain reaction detected a higher number of Chlamydia trachomatis infections among both symptomatic and asymptomatic females and males, and it also detected Chlamydia trachomatis at an earlier stage of infection when compared to cell culture. The polymerase chain reaction did...

  20. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend;

    1993-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...... was minimized. The polymerase chain reaction detected a higher number of Chlamydia trachomatis infections among both symptomatic and asymptomatic females and males, and it also detected Chlamydia trachomatis at an earlier stage of infection when compared to cell culture. The polymerase chain reaction did...

  1. Supply Chain Visibility with Linked Open Data for Supply Chain Risk Analysis

    NARCIS (Netherlands)

    Hofman, W.J.

    2011-01-01

    Current customs applications are declaration based to support the various customs procedures based on (inter)national laws and regulations. To be able to perform a proper supply chain risk analysis, customs requires to have all data in supply chains. The current declaration procedures are not suffic

  2. Detection of herpesviral sequences in tissues of green turtles with fibropapilloma by polymerase chain reaction.

    Science.gov (United States)

    Lu, Y; Wang, Y; Yu, Q; Aguirre, A A; Balazs, G H; Nerurkar, V R; Yanagihara, R

    2000-01-01

    An alpha-herpesvirus has been associated recently with green turtle fibropapilloma (FP). To further clarify the role of this newfound green turtle herpesvirus (GTHV) in the pathogenesis of FP, various normal-appearing tissues and organs (including skin, eye, brain, heart, liver, spleen, intestine, lung, kidney, nerve, gonad, tongue, gall bladder, urinary bladder, thyroid and peripheral blood mononuclear cells (PBMC) from blood) and tumor tissues from 19 green turtles (Chelonia mydas) with FP, and tissues from three green turtles without FP, collected during 1997 to 1999 in the Hawaiian Islands, were tested for GTHV sequences by nested polymerase chain reaction (PCR), using GTHV-specific oligonuclotide primers. GTHV sequences were detected in all tumors (51/51) and most tissues (133/167) of tumored turtles. By contrast, such sequences were undetectable in tissues (0/28) of three non-tumored turtles. Analysis of GTHV sequences detected in different tissues and tumors revealed a low degree of genetic diversity (green turtles and its absence in tissues of non-tumored turtles, argues for an etiologic role in FP.

  3. Design, construction, and validation of a modular library of sequence diversity standards for polymerase chain reaction.

    Science.gov (United States)

    Baum, Paul D; Young, Jennifer J; Zhang, Qianjun; Kasakow, Zeljka; McCune, Joseph M

    2011-04-01

    Methods to measure the sequence diversity of polymerase chain reaction (PCR)-amplified DNA lack standards for use as assay calibrators and controls. Here we present a general and economical method for developing customizable DNA standards of known sequence diversity. Standards ranging from 1 to 25,000 sequences were generated by directional ligation of oligonucleotide "words" of standard length and GC content and then amplified by PCR. The sequence accuracy and diversity of the library were validated using AmpliCot analysis (DNA hybridization kinetics) and Illumina sequencing. The library has the following features: (i) pools containing tens of thousands of sequences can be generated from the ligation of relatively few commercially synthesized short oligonucleotides; (ii) each sequence differs from all others in the library at a minimum of three nucleotide positions, permitting discrimination between different sequences by either sequencing or hybridization; (iii) all sequences have identical length, GC content, and melting temperature; (iv) the identity of each standard can be verified by restriction digestion; and (v) once made, the ends of the library may be cleaved and replaced with sequences to match any PCR primer pair. These standards should greatly improve the accuracy and reproducibility of sequence diversity measurements.

  4. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Souza, M T; Carvalho-Zilse, G A

    2014-01-01

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  5. Sequencing of simple sequence repeat anchored polymerase chain reaction amplification products of Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2002-01-01

    Full Text Available Simple sequence repeat anchored polymerase chain reaction amplification (SSR-PCR is a genetic typing technique based on primers anchored at the 5' or 3' ends of microsatellites, at high primer annealing temperatures. This technique has already been used in studies of genetic variability of several organisms, using different primer designs. In order to conduct a detailed study of the SSR-PCR genomic targets, we cloned and sequenced 20 unique amplification products of two commonly used primers, CAA(CT6 and (CA8RY, using Biomphalaria glabrata genomic DNA as template. The sequences obtained were novel B. glabrata genomic sequences. It was observed that 15 clones contained microsatellites between priming sites. Out of 40 clones, seven contained complex sequence repetitions. One of the repeats that appeared in six of the amplified fragments generated a single band in Southern analysis, indicating that the sequence was not widespread in the genome. Most of the annealing sites for the CAA(CT6 primer contained only the six repeats found within the primer sequence. In conclusion, SSR-PCR is a useful genotyping technique. However, the premise of the SSR-PCR technique, verified with the CAA(CT6 primer, could not be supported since the amplification products did not result necessarily from microsatellite loci amplification.

  6. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction.

    Science.gov (United States)

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham

    2002-08-01

    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  7. Development and application of polymerase chain reaction test for detection of Conidiobolus lamprauges

    Directory of Open Access Journals (Sweden)

    Marcelo M. Silveira

    2013-12-01

    Full Text Available Conidiobolomycosis is a granulomatous disease caused by the fungus Conidiobolus spp. in humans and animals. Traditional technique for diagnosis of the disease is isolation of the agent associated with the presence of typical clinical signs and pathological conditions. The aim of this study was to describe the development of a specific polymerase chain reaction (PCR test for Conidiobolus lamprauges to detect the fungus in clinical samples. Samples from suspected animals were collected and submitted to isolation, histopathological analysis and amplification by PCR. DNA from tissues was subjected to PCR with fungi universal primers 18S rDNA gene, and specific primers were designed based on the same gene in C. lamprauges that generated products of about 540 bp and 222 bp respectively. The culture was positive in 26.6% of clinical samples. The PCR technique for C. lamprauges showed amplification of DNA from fresh tissues (80% and paraffin sections (44.4%. In conclusion, the PCR technique described here demonstrated a high sensitivity and specificity for detection of fungal DNA in tissue samples, providing a tool for the rapid diagnosis of C. lamprauges.

  8. Use of neuropathological tissue for molecular genetic studies: parameters affecting DNA extraction and polymerase chain reaction.

    Science.gov (United States)

    Kösel, S; Graeber, M B

    1994-01-01

    Nuclear and mitochondrial DNA were extracted from gray matter of human cerebral cortex which had either been formalin-fixed and embedded into paraffin or stored in formalin for up to 26 years. Extraction conditions were optimized for proteinase K digestion, i.e., enzyme concentration, digestion temperature and incubation time. Using the polymerase chain reaction (PCR), DNA was successfully amplified from archival material and sequenced employing a direct nonradioactive cycle sequencing protocol. In general, tissue embedded into paraffin following brief fixation in formalin gave good quantitative results, i.e., up to 1 microgram DNA/mg tissue were extracted. This yield was at least one order of magnitude higher than that obtained with tissue stored in formalin. However, paraffin-embedded neuropathological material was found to contain an as-yet-unidentified PCR inhibitor, and a deleterious effect of long-term fixation in unbuffered low-grade formalin was clearly detectable. Importantly, both paraffin-embedded tissue blocks and human brain that had been stored in formalin for many years yielded DNA sufficient for qualitative analysis. The implications of these findings for the use of neuropathological material in molecular genetic studies are discussed.

  9. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Directory of Open Access Journals (Sweden)

    Lei Zhang

    2014-01-01

    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  10. Polymerase chain reaction-based screening for the ceftriaxone-resistant Neisseria gonorrhoeae F89 strain.

    Science.gov (United States)

    Goire, N; Lahra, M M; Ohnishi, M; Hogan, T; Liminios, A E; Nissen, M D; Sloots, T P; Whiley, D M

    2013-04-04

    Emergence and spread of Neisseria gonorrhoeae resistant to extended spectrum cephalosporins is a major problem threatening treatment of gonorrhoea and is further highlighted by the recent report of a second ceftriaxone-resistant N. gonorrhoeae strain (F89) in Europe, initially observed in France and subsequently identified in Spain. N. gonorrhoeae antimicrobial resistance (AMR) surveillance has acquired new importance and molecular tools have the potential to enhance bacterial culture-based methods. In this study, we established a polymerase chain reaction (PCR) protocol for direct detection of the F89 strain. A key component of this screening protocol was the development of a hybridisation probe-based melting curve analysis assay (mosaic501-hybPCR) to detect the presence of an A501P substitution on the N. gonorrhoeae mosaic penicillin binding protein 2 (PBP2) sequence, an important characteristic of the F89 strain. The mosaic501-hybPCR was evaluated using plasmid-derived positive controls (n=3) and characterised gonococcal (n=33) and non-gonococcal (n=58) isolates. The protocol was then applied to 159 clinical specimens from Sydney, Australia, collected during the first half of the year 2012 that were N. gonorrhoeae PCR-positive. Overall, the results indicate that the PCR-based protocol is suitable for direct detection of the N. gonorrhoeae F89 strain in non-cultured clinical samples. It therefore provides an additional tool to aid investigations into the potential spread of F89 strain throughout Europe and elsewhere.

  11. Legendre Analysis of Hadronic Reactions

    CERN Document Server

    Azimov, Ya I

    2016-01-01

    Expansions over Legendre functions are suggested as a model-independent way of compact presentation of modern precise and high-statistics data for two-hadron reactions. Some properties of the expansions are described.

  12. Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Conventional methods for the diagnosis of tubercolosis based on microscopic examination and in vitro culture is both time consuming and tedious. Molecular methods of diagnosis have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determined the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. An aliquot of each specimen were kept for analysis by in vitro amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. All specimens were analysed in quintriplicate, with 2 samples unspiked and 3 sampled spiked with M. tuberculosis. Appropriate positive and negative controls were included in all essays. Following amplification, the specimens were analysed by agarose gel electrophoresis (AGE). All specimens were further subject to hybridization studies using a specific radiolabelled probe. The sensitivity of the amplification assay coupled with visualization of the amplified targets using eithidium bromide staining was found to be about 1 fg of DNA. A total of 40 smear positive specimens were analyzed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive by PCR/hybridization analysis. (author). 13 refs, 1 tab

  13. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain

    2010-02-01

    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  14. Polymerase chain reaction-based molecular diagnosis of cutaneous infections in dermatopathology.

    Science.gov (United States)

    Swick, Brian L

    2012-12-01

    Conventional methods, including microscopy, culture, and serologic studies, are a mainstay in the diagnosis of cutaneous infection. However, owing to limitations associated with these techniques, such as low sensitivity for standard microscopy and in the case of culture delay in diagnosis, polymerase chain-reaction based molecular techniques have taken on an expanding role in the diagnosis of infectious processes in dermatopathology. In particular, these assays are a useful adjunct in the diagnosis of cutaneous tuberculosis, atypical mycobacterial infection, leprosy, Lyme disease, syphilis, rickettsioses, leishmaniasis, and some fungal and viral infections. Already in the case of tuberculosis and atypical mycobacterial infection, standardized polymerase chain-reaction assays are commonly used for diagnostic purposes. With time, additional molecular-based techniques will decrease in cost and gain increased standardization, thus delivering rapid diagnostic confirmation for many difficult-to-diagnose cutaneous infections from standard formalin-fixed paraffin-embedded tissue specimens.

  15. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples.

    Science.gov (United States)

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal

    2008-07-01

    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  16. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin

    2011-01-01

    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  17. Cyclic polyesters prepared by poly(oxypropylene oxymaloyl ring-chain reactions

    Directory of Open Access Journals (Sweden)

    2007-01-01

    Full Text Available The synthesis of cyclic polyesters of poly(oxypropylene oxymaloyl from a ring-chain reaction was carried out at 40°C with 'Maghnite' an acid exchanged montmorillonite as acid solid ecocatalyst (Mag–H+. 'Maghnite' is already used as catalyst for polymerization of many vinylic and heterocyclic monomers [1]. The effect of amount of catalyst on yield and molecular weight of polymer was studied.A typical reaction product was analyzed by gel permeation chromatography (GPC as well as by nuclear magnetic resonance spectroscopy (1H-NMR and the existence of cyclic species was proven.

  18. Digital polymerase chain reaction in an array of femtoliter polydimethylsiloxane microreactors.

    Science.gov (United States)

    Men, Yongfan; Fu, Yusi; Chen, Zitian; Sims, Peter A; Greenleaf, William J; Huang, Yanyi

    2012-05-15

    We developed a simple, compact microfluidic device to perform high dynamic-range digital polymerase chain reaction (dPCR) in an array of isolated 36-femtoliter microreactors. The density of the microreactors exceeded 20000/mm(2). This device, made from polydimethylsiloxane (PDMS), allows the samples to be loaded into all microreactors simultaneously. The microreactors are completely sealed through the deformation of a PDMS membrane. The small volume of the microreactors ensures a compact device with high reaction efficiency and low reagent and sample consumption. Future potential applications of this platform include multicolor dPCR and massively parallel dPCR for next generation sequencing library preparation. PMID:22482776

  19. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  20. STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Honcharova S.Y.

    2015-08-01

    Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

  1. Exploiting the tetrazine-norbornene reaction for single polymer chain collapse.

    Science.gov (United States)

    Hansell, Claire F; Lu, Annhelen; Patterson, Joseph P; O'Reilly, Rachel K

    2014-04-21

    Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and (1)H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated.

  2. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti

    OpenAIRE

    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.

    1996-01-01

    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  3. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.

    Science.gov (United States)

    Matsuda, Kazuyuki; Honda, Takayuki

    2015-01-01

    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  4. Preliminary evaluation of the ligase chain reaction for specific detection of Neisseria gonorrhoeae.

    OpenAIRE

    Birkenmeyer, L; Armstrong, A S

    1992-01-01

    Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the ...

  5. A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Ali, A; Reynolds, D L

    1999-01-01

    A reverse transcription-polymerase chain reaction assay was developed for the detection of avian pneumovirus (Colorado strain) (APV-Col). The specific primers were designed from the published sequence of the matrix protein gene of APV-Col. The primers amplified a product of 631 nucleotides from APV-Col. The assay identified only APV-Col and did not react with Newcastle disease virus and infectious bronchitis virus.

  6. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng

    2015-05-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  7. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  8. 聚合酶链反应在检测阴道细菌中的临床应用分析%Analysis of Clinical Application of Polymerase Chain Reaction in Detection of Vaginal Bacteria

    Institute of Scientific and Technical Information of China (English)

    周发为

    2014-01-01

    目的:研究聚合酶链反应在检测阴道细菌中的临床应用。方法患有细菌性阴道炎的妇女,为感染组(n=80);对照组为在我院进行健康体检的妇女(n=81),分别用实时荧光定量PCR方法与革兰染色方法检测阴道分泌物中的加德纳菌,比较两种方法加德纳菌的检出情况。结果对80例感染组和81例对照组采样革兰染色法检测,阳性率分别为73.75%和7.4%;用PCR荧光定量法对2组进行检测,阳性率分别为93.75%和8.64%。 PCR荧光定量检测与革兰染色法检测研究组与对照组研究对象加德纳菌阳性率,2种方法检测结果差异均有统计学意义(χ2=115.7, P<0.001;χ2=73.6, P<0.001)。在细菌性阴道炎患者中检测加德纳菌,将荧光定量PCR和革兰染色法检测结果进行比较,荧光定量PCR检测阳性率显著高于培养法(χ2=11.76, P<0.001)。结论实时荧光定量PCR方法检测加德纳菌的准确性高、方法简单易操作,可满足临床诊断细菌性阴道炎的需要,值得在临床上推广应用。%Objective To study the clinical application of the polymerase chain reaction in detection of vaginal bacteria. Meth-ods Women with bacterial vaginosis were taken as the infected group (n=80), and the women who received health checkup at our hospital were taken as a control group ( n=81 ) , gardnerella in vaginal secretions was respectively detected by the method of fluores-cence quantitative polymerase chain reaction ( PCR) as well as Gram staining method, and then the detection results of gardnerella ob-tained by the two methods were compared. Results 80 cases from the infected group and 81 from the control group were sampled and detected by Gram staining, and the result showed that the positive rates were 73. 75% and 7. 4 %, respectively, the two groups were detected by PCR, and the result showed that the positive rates were 93. 75% and 8. 64% respectively. Gardnerella positive rates of the subjects of the infected

  9. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  10. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) Larvae in Wetlands, Western Kenya: Confirmation by Polymerase Chain Reaction Method

    OpenAIRE

    Ohba, Shin-ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; SONYE, GORGE; Minakawa, Noboru; Takagi, Masahiro

    2010-01-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%)....

  11. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in Wetlands, Western Kenya: Confirmation by polymerase chain reaction method

    OpenAIRE

    Ohba, Shin-ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; SONYE, GORGE; Minakawa, Noboru; Takagi, Masahiro

    2010-01-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%)....

  12. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Jong Gyun Ahn

    2012-11-01

    Full Text Available &lt;B&gt;Purpose:&lt;/B&gt; Methods for quick and reliable detection of &lt;I&gt;Streptococcus pneumoniae&lt;/I&gt; are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving &lt;I&gt;S. pneumoniae -positive&lt;/i&gt; results. &lt;B&gt;Methods:&lt;/B&gt; Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. &lt;B&gt;Results:&lt;/B&gt; Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. &lt;B&gt;Conclusion:&lt;/B&gt; As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  13. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie;

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  14. Multiplex polymerase chain reaction-based prognostic models in diffuse large B-cell lymphoma patients treated with R-CHOP

    DEFF Research Database (Denmark)

    Green, Tina M; Jensen, Andreas K; Holst, René;

    2016-01-01

    We present a multiplex analysis for genes known to have prognostic value in an attempt to design a clinically useful classification model in patients with diffuse large B-cell lymphoma (DLBCL). Real-time polymerase chain reaction was used to measure transcript levels of 28 relevant genes in 194 de...

  15. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C2H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH3; and ammonia, which produces NH2. In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  16. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  17. Comprehensive cosmographic analysis by Markov chain method

    International Nuclear Information System (INIS)

    We study the possibility of extracting model independent information about the dynamics of the Universe by using cosmography. We intend to explore it systematically, to learn about its limitations and its real possibilities. Here we are sticking to the series expansion approach on which cosmography is based. We apply it to different data sets: Supernovae type Ia (SNeIa), Hubble parameter extracted from differential galaxy ages, gamma ray bursts, and the baryon acoustic oscillations data. We go beyond past results in the literature extending the series expansion up to the fourth order in the scale factor, which implies the analysis of the deceleration q0, the jerk j0, and the snap s0. We use the Markov chain Monte Carlo method (MCMC) to analyze the data statistically. We also try to relate direct results from cosmography to dark energy (DE) dynamical models parametrized by the Chevallier-Polarski-Linder model, extracting clues about the matter content and the dark energy parameters. The main results are: (a) even if relying on a mathematical approximate assumption such as the scale factor series expansion in terms of time, cosmography can be extremely useful in assessing dynamical properties of the Universe; (b) the deceleration parameter clearly confirms the present acceleration phase; (c) the MCMC method can help giving narrower constraints in parameter estimation, in particular for higher order cosmographic parameters (the jerk and the snap), with respect to the literature; and (d) both the estimation of the jerk and the DE parameters reflect the possibility of a deviation from the ΛCDM cosmological model.

  18. Comparison of nasopharyngeal culture, polymerase chain reaction (PCR) and serological test for diagnosis of pertussis.

    Science.gov (United States)

    Cengiz, Ali Bülent; Yildirim, Inci; Ceyhan, Mehmet; Seçmeer, Gülten; Gür, Deniz; Kara, Ateş

    2009-01-01

    This prospective study, which was designed to compare nasopharyngeal culture, polymerase chain reaction (PCR) and serology in the diagnosis of pertussis, covered 35 children aged between 0 and 16 who were admitted to Hacettepe University Ihsan Doğramaci Children's Hospital between 1 March 2005 and 31 August 2006 with coughing for 7 days or longer, paroxysmal cough of any duration, or cough with inspiratory whoop and/or vomiting (or apnea) after coughs. The demographic data and vaccination history of the patients were recorded. During the initial examination, samples were taken from the posterior nasopharynx for Bordetella pertussis (B. pertussis) culture and PCR analysis. In order to determine antibody positivity and antibody levels against B. pertussis antigens, serum samples were taken during the initial examination (acute phase) and two weeks later (convalescent phase). In the first serum sample, immunoglobulin M (IgM) was determined against pertussis toxin. In the first and second samples, IgA and IgG antibodies were evaluated against pertussis toxin and filamentous hemagglutinin. Culture yielded negative results in all of the patients. PCR was positive in two cases (5.7%). In the PCR-positive patients, IgM, IgA and IgG type anti-pertussis antibodies were found to be positive in the first serum samples, and IgA and IgG antibodies were found to be positive in the second serum samples. Therefore, it was considered that serology could be as sensitive as PCR when type IgM, IgA and IgG antibodies were found to be positive against a minimum of two antigens of B. pertussis. In conclusion, both PCR and serologic tests--if evaluating all types of antibodies to a minimum of two antigens of B. pertussis obtained in both acute and convalescent sera--could be more sensitive than culture in the diagnosis of pertussis.

  19. Organic produce Value Chain Analysis (OF0344)

    OpenAIRE

    Simons, David

    2005-01-01

    Growth in the Organic food market has been rapid in recent years. According to the soil association, retail sales of organic food are now worth £1.2 billion – an 11% increase on the previous year. Organic Supply Chains have developed to serve different routes to the consumer. Some chains are simple and involve direct supply to the consumer through, for example, box schemes and farmer’s markets. However in the main greater complexity is involved. Some 75% of organic food is sold through t...

  20. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus.

    Science.gov (United States)

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A

    2011-01-01

    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  1. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wei-Ping Qian; Li-Ka Shing; Yue-Qiu Tan; Ying Chen; Ying Peng; Zhi Li; Guang-Xiu Lu; Marie C. Lin; Hsiang-Fu Kung; Ming-Ling He

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen.METHODS: Hepatitis B viral DNA was isolated from HBV carriers' semen and sera using phenol extraction method and QTAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction.RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5×107 and 1.67×107 copies of HBV DNA per mL in two HBV infected patients' sera, while 2.L4×105 and 3.02×105 copies of HBV DNA per mL in the semen.CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen.

  2. Quantitative timed analysis of interactive Markov chains

    NARCIS (Netherlands)

    Guck, Dennis; Han, Tingting; Katoen, Joost-Pieter; Neuhausser, M.

    2012-01-01

    This paper presents new algorithms and accompanying tool support for analyzing interactive Markov chains (IMCs), a stochastic timed 1 1/2-player game in which delays are exponentially distributed. IMCs are compositional and act as semantic model for engineering formalisms such as AADL and dynamic fa

  3. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    1993-01-01

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  4. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline;

    2015-01-01

    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma...

  5. Agricultural Value Chains in Developing Countries; a Framework for Analysis

    NARCIS (Netherlands)

    Trienekens, J.H.

    2011-01-01

    The paper presents a framework for developing country value chain analysis made up of three components. The first consists of identifying major constraints for value chain upgrading: market access restrictions, weak infrastructures, lacking resources and institutional voids. In the second component

  6. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail: dianping.tang@fzu.edu.cn

    2013-06-14

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  7. Genome editing. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations.

    Science.gov (United States)

    Gantz, Valentino M; Bier, Ethan

    2015-04-24

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype, whereas individuals homozygous for two copies of the allele will display a mutant phenotype. We have developed a method called the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome-editing system for generating autocatalytic mutations, to produce homozygous loss-of-function mutations. In Drosophila, we found that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome, thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  8. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Miagostovich Marize Pereira

    1997-01-01

    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  9. A polymerase chain reaction protocol for the detection of various geographical isolates of white spot virus.

    Science.gov (United States)

    Tapay, L M; Nadala, E C; Loh, P C

    1999-09-01

    Polymerase chain reaction (PCR) primers were designed based on the sequence of a cloned fragment of the white spot virus (WSV) genome and were used to detect at least four geographic isolates of WSV from both experimentally- and naturally-infected shrimp. In addition to high specificity, the one-step and two-step PCR protocols were determined to have sensitivities of 10-100 pg and 100 femtograms respectively. The two-step PCR protocol is recommended as a very sensitive and specific alternative protocol to Western blot assay for the detection of WSV.

  10. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.

    OpenAIRE

    Patou, G.; Pillay, D.; Myint, S; Pattison, J.

    1993-01-01

    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  11. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    OpenAIRE

    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini

    2008-01-01

    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  12. Preparative isolation of polymerase chain reaction products using mixed-mode chromatography.

    Science.gov (United States)

    Matos, T; Silva, G; Queiroz, J A; Bülow, L

    2015-11-15

    The polymerase chain reaction (PCR) has become one of the most useful techniques in molecular biology laboratories around the world. The purification of the target DNA product is often challenging, however, and most users are restricted to employing available commercial kits. The recent developments in mixed-mode chromatography have shown higher selectivity for a variety of nucleic acid-containing samples. Capto Adhere is a mixed-mode chromatography resin that offers a high-selectivity ligand and is here applied for the purification of amplified DNAs from PCR mixtures in a 10-min single step, with yields above 95%, high linearity, and high precision for different concentrations.

  13. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  14. Development and validation of a Myxoma virus real-time polymerase chain reaction assay

    OpenAIRE

    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  15. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    Science.gov (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  16. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.

    OpenAIRE

    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W

    1992-01-01

    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  17. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    Science.gov (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  18. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    OpenAIRE

    Liang Gaofeng; Ma Chao; Zhu Yanliang; Li Shuchun; Shao Youhua; Wang Yong; Xiao Zhongdang

    2010-01-01

    Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase ...

  19. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction

    OpenAIRE

    Alexandrakis, G.; JALALI, S; Gloor, P

    1998-01-01

    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In o...

  20. A Novel Nested Polymerase Chain Reaction (n-PCR) Assay for Identifying Sorghum nitidum

    OpenAIRE

    Wei, Shasha; Zhirui DENG; Liping YIN; Yi, Jianping; Renqi WU; Qin CHEN

    2011-01-01

    This work developed a novel nested polymerase chain reaction (n-PCR) assay to identify Sorghum nitidum (S. nitidum). It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band ...

  1. Specific detection of the toxic shock syndrome toxin-1 gene using the polymerase chain reaction.

    Science.gov (United States)

    Jaulhac, B; Prevost, G; Piemont, Y

    1991-08-01

    A rapid and specific assay for toxic shock syndrome toxin-1 gene (tst gene) detection in Staphylococcus aureus was developed using the polymerase chain reaction. A two-primer set and an oligonucleotide detection probe were synthesized. After 40 cycles of amplification, detection of a 160-bp amplified DNA fragment was carried out by agarose gel electrophoresis and Southern blot hybridization. This assay was sensitive since it was able to detect 1-10 bacteria. It was also specific since no amplification was documented with DNAs from enterotoxigenic S. aureus or Gram-negative bacteria devoid of the tst gene.

  2. Identifiability of parameters and behaviour of MCMC chains: a case study using the reaction norm model.

    Science.gov (United States)

    Shariati, M M; Korsgaard, I R; Sorensen, D

    2009-04-01

    Markov chain Monte Carlo (MCMC) enables fitting complex hierarchical models that may adequately reflect the process of data generation. Some of these models may contain more parameters than can be uniquely inferred from the distribution of the data, causing non-identifiability. The reaction norm model with unknown covariates (RNUC) is a model in which unknown environmental effects can be inferred jointly with the remaining parameters. The problem of identifiability of parameters at the level of the likelihood and the associated behaviour of MCMC chains were discussed using the RNUC as an example. It was shown theoretically that when environmental effects (covariates) are considered as random effects, estimable functions of the fixed effects, (co)variance components and genetic effects are identifiable as well as the environmental effects. When the environmental effects are treated as fixed and there are other fixed factors in the model, the contrasts involving environmental effects, the variance of environmental sensitivities (genetic slopes) and the residual variance are the only identifiable parameters. These different identifiability scenarios were generated by changing the formulation of the model and the structure of the data and the models were then implemented via MCMC. The output of MCMC sampling schemes was interpreted in the light of the theoretical findings. The erratic behaviour of the MCMC chains was shown to be associated with identifiability problems in the likelihood, despite propriety of posterior distributions, achieved by arbitrarily chosen uniform (bounded) priors. In some cases, very long chains were needed before the pattern of behaviour of the chain may signal the existence of problems. The paper serves as a warning concerning the implementation of complex models where identifiability problems can be difficult to detect a priori. We conclude that it would be good practice to experiment with a proposed model and to understand its features

  3. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain...

  4. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  5. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  6. Amplification refractory mutation system polymerase chain reaction versus optimized polymerase chain reaction restriction-fragment length polymorphism for apolipoprotein E genotyping of majorly depressed patients.

    Science.gov (United States)

    You, Hongmin; Chen, Jin; Zhou, Jingjing; Huang, Hua; Pan, Junxi; Wang, Ziye; Lv, Lin; Zhang, Lujun; Li, Juan; Qin, Bin; Yang, Yongtao; Xie, Peng

    2015-11-01

    Major depressive disorder (MDD) is a prevalent, debilitating mood disorder that has been associated with several genetic polymorphisms. One such polymorphism, namely that of apolipoprotein E (APOE), has three allelic forms (ε2, ε3 and ε4) that encode for six unique isoforms of the APOE protein. A growing number of techniques have been developed for APOE genotyping; however, not all polymerase chain reaction (PCR)‑based genotyping techniques are equally accurate or cost‑effective. In order to find a more accurate and cost‑effective APOE genotyping method for MDD screening in large populations, the present study comparatively evaluated two genotyping methods, amplification refractory mutation system PCR (ARMS‑PCR) and optimized PCR restriction‑fragment length polymorphism (PCR‑RFLP), in blood samples taken from a population of 708 MDD patients. Although either of the two methods were able to detect all six unique APOE genotypes, comparisons of the two methods with Sanger sequencing demonstrated that ARMS‑PCR (94%) was significantly more accurate than optimized PCR‑RFLP (82%). ARMS‑PCR should prove useful in quickly verifying ambiguous results obtained by other APOE genotyping methods and can be cost-effectively performed in the setting of a small laboratory or a population-based screening program.

  7. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  8. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  9. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......) x s(-1)) > backbone amides (10-10(-3) M(-1) x s(-1)) > Gln(0.03 M(-1) x s(-1)) approximately Asn (0.03 M(-1) x s(-1)). The rate constants for reaction of HOCl with backbone amides (peptide bonds) vary by 4 orders of magnitude with uncharged peptide bonds reacting more readily with HOCl than those...

  10. Development of a polymerase chain reaction assay for species identification of goose and mule duck in foie gras products.

    Science.gov (United States)

    Rodrı X0301 Guez, Miguel A; Garcı X0301 A, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martı X0301 N, Rosario

    2003-12-01

    Polymerase chain reaction amplification of a conserved region of the α-actin gene has been used for the specific identification of goose (Anser anser) and mule duck (Anas platyrhynchos×Cairina moschata) foie gras. Universal primers were used for the amplification of a DNA fragment containing three introns and four exons of the α-actin gene in goose and mule duck. Sequence analysis of the amplified fragments was necessary for the design of forward species-specific primers in the goose and mule duck α-actin genes. The use of species-specific forward primers, together with a reverse universal primer, produced amplicons of different length, allowing clear identification of goose and mule duck foie gras samples. Analysis of experimental mixtures demonstrated that 1% of duck can be easily detected in goose foie gras using the PCR method developed here. This genetic marker can be very useful for the accurate identification of these two species in foie gras products.

  11. Evaluation of reference genes for quantitative polymerase chain reaction across life cycle stages and tissue types of Tribolium castaneum.

    Science.gov (United States)

    Toutges, Michelle J; Hartzer, Kris; Lord, Jeffrey; Oppert, Brenda

    2010-08-25

    The genome of the genetic model for coleopteran insects, Tribolium castaneum, is now available for downstream applications. To facilitate gene expression studies in T. castaneum, genes were evaluated for suitability as normalizers in comparisons across tissues and/or developmental stages. In less diverse samples, such as comparisons within developmental stages or tissue only, normalizers for mRNA were more stable and consistent. Overall, the genes for ribosomal proteins rps6, rpl13a, rps3, and rps18 were the most stable normalizers for broad scale gene expression analysis in T. castaneum. However, their stability ranking was dependent upon the instrument as well as the analysis program. These data emphasize the need to optimize normalizers used in all real-time polymerase chain reaction experiments specifically for the experimental conditions and thermocycler and to carefully evaluate data generated by computational algorithms.

  12. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.

    2009-01-01

    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  13. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction.

    Science.gov (United States)

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin

    2008-01-01

    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems. PMID:17904730

  14. Scenario analysis for supply chain integration in container shipping

    OpenAIRE

    Lam, J.S.L.; Van de Voorde, E.

    2011-01-01

    Competition in the business world nowadays is largely between supply chains, rather than individual players only. The same situation exists in container shipping. The study looks into container shipping from an integrated perspective and investigates the nature and level of supply chain integration in container shipping. Based on empirical examinations of the world's top 30 container shipping lines, a scenario analysis is conducted. The paper aims to present the scenario analysis for examinin...

  15. Markov Chains as Tools for Jazz Improvisation Analysis

    OpenAIRE

    Franz, David Matthew

    1998-01-01

    This thesis describes an exploratory application of a statistical analysis and modeling technique (Markov chains) for the modeling of jazz improvisation with the intended subobjective of providing increased insight into an improviser's style and creativity through the postulation of quantitative measures of style and creativity based on the constructed Markovian analysis techniques. Using Visual Basic programming language, Markov chains of orders one to three are created using transcriptio...

  16. Markov Chain Analysis of Musical Dice Games

    Science.gov (United States)

    Volchenkov, D.; Dawin, J. R.

    2012-07-01

    A system for using dice to compose music randomly is known as the musical dice game. The discrete time MIDI models of 804 pieces of classical music written by 29 composers have been encoded into the transition matrices and studied by Markov chains. Contrary to human languages, entropy dominates over redundancy, in the musical dice games based on the compositions of classical music. The maximum complexity is achieved on the blocks consisting of just a few notes (8 notes, for the musical dice games generated over Bach's compositions). First passage times to notes can be used to resolve tonality and feature a composer.

  17. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene.

    Science.gov (United States)

    Brakstad, O G; Aasbakk, K; Maeland, J A

    1992-07-01

    Synthetic oligonucleotide primers of 21 and 24 bases, respectively, were used in the polymerase chain reaction (PCR) to amplify a sequence of the nuc gene, which encodes the thermostable nuclease of Staphylococcus aureus. A DNA fragment of approximately 270 bp was amplified from lysed S. aureus cells or isolated DNA. The PCR product was detected by agarose gel electrophoresis or Southern blot analysis by using a 33-mer internal nuc gene hybridization probe. With S. aureus cells the lower detection limit was less than 10 CFU, and with the isolated target the lower detection limit was 0.69 pg of DNA. The primers recognized 90 of 90 reference or clinical S. aureus strains. Amplification was not recorded when 80 strains representing 16 other staphylococcal species were tested or when 20 strains representing 9 different nonstaphylococcal species were tested. Some of the non-S. aureus staphylococci produced thermostable nucleases but were PCR negative. The PCR product was generated when in vitro-cultured S. aureus was used to prepare simulated clinical specimens of blood, urine, cerebrospinal fluid, or synovial fluid. No PCR product was generated when the sterile body fluids were tested. However, the sensitivity of the PCR was reduced when S. aureus in blood or urine was tested in comparison with that when bacteria in saline were tested. With the bacteria in blood, the detection limit of the PCR was 10(3) CFU. A positive PCR result was recorded when a limited number of clinical samples from wounds verified to be infected with S. aureus were tested, while the PCR product was not detected in materials from infections caused by other bacteria. Generation of PCR products was not affected by exposure of S. aureus to bactericidal agents, including cloxacillin and gentamicin, prior to testing, but was affected by exposure to UV radiation. The PCR for amplification of the nuc gene has potential for the rapid diagnosis of S. aureus infections by direct testing of clinical

  18. ISOLASI Campylobacter DARI KARKAS AYAM MENGGUNAKAN METODE KONVENSIONAL DAN POLYMERASE CHAIN REACTIONS [Isolation of Campylobacter from Poultry Carcasses using Conventional and Polymerase Chain Reaction Methods

    Directory of Open Access Journals (Sweden)

    Surachmi Setiyaningsih2

    2013-06-01

    Full Text Available Campylobacter jejuni and Campylobacter coli are two spesies of Campylobacter sp. frequently found as pathogenic bacteria causing human gastrointestinal infections. Contaminated chicken carcasses have been reported as the source of human campylobacteriosis. In this study, Campylobacter were isolated from chicken carcasses sold in traditional markets and supermarkets. In traditional markets, chicken carcasses are sold without proper packaging or in an open space and stored at room temperature (25-30°C for prolonged period allowing pathogenic bacteria to grow. While at supermarkets, chicken carcasses are openly displayed or enclosed in plastic wrappings and stored in a refrigerator (4-8°C. A total of 298 samples of chicken carcasses from traditional markets and supermarkets in the area of DKI Jakarta, West Java (Bogor and Sukabumi and Central Java (Kudus and Demak were collected. Isolation and identification using conventional and Polymerase Chain Reactions (PCR methods were done to determine the prevalence of C. jejuni and C. coli contamination in poultry. The results showed that chicken carcasses sold in the sampling area, both traditional markets and supermarkets, were contaminated with C. jejuni and C. coli. The contamination rate of Campylobacter sp. in chicken carcasses sold in supermarkets, were 14.1% by conventional methods and 29.5% by PCR. This was higher than those in traditional markets, i.e. 5.7 and 12.1%, respectively. It is also confirmed that the prevalence for contamination of C. jejuni was higher than C. coli in 298 samples, i.e. 16.1% and 3.7% by conventional method and 23.5% and 18.1% by PCR method respectively.

  19. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction.

    Science.gov (United States)

    Chen, Ruey-Shyang; Tsay, Jwu-Guh; Huang, Yu-Fen; Chiou, Robin Y Y

    2002-05-01

    The Aspergillus flavus group covers species of A. flavus and Aspergillus parasiticus as aflatoxin producers and Aspergillus oryzae and Aspergillus sojae as koji molds. Genetic similarity among these species is high, and aflatoxin production of a culture may be affected by cultivation conditions and substrate composition. Therefore, a polymerase chain reaction (PCR)-mediated method of detecting the aflatoxin-synthesizing genes to indicate the degree of risk a genotype has of being a phenotypic producer was demonstrated. In this study, 19 strains of the A. flavus group, including A. flavus, A. parasiticus, A. oryzae, A. sojae, and one Aspergillus niger, were subjected to PCR testing in an attempt to detect four genes, encoding for norsolorinic acid reductase (nor-1), versicolorin A dehydrogenase (ver-1), sterigmatocystin O-methyltransferase (omt-1), and a regulatory protein (apa-2), involved in aflatoxin biosynthesis. Concurrently, the strains were cultivated in yeast-malt (YM) broth for aflatoxin detection. Fifteen strains were shown to possess the four target DNA fragments. With regard to aflatoxigenicity, all seven aflatoxigenic strains possessed the four DNA fragments, and five strains bearing less than the four DNA fragments did not produce aflatoxin. When peanut kernels were artificially contaminated with A. parasiticus and A. niger for 7 days, the contaminant DNA was extractable from a piece of cotyledon (ca. 100 mg), and when subjected to multiplex PCR testing using the four pairs of primers coding for the above genes, they were successfully detected. The target DNA fragments were detected in the kernels infected with A. parasiticus, and none was detected in the sound (uninoculated) kernels or in the kernels infected with A. niger.

  20. A taxonomy of integral reaction path analysis

    Energy Technology Data Exchange (ETDEWEB)

    Grcar, Joseph F.; Day, Marcus S.; Bell, John B.

    2004-12-23

    W. C. Gardiner observed that achieving understanding through combustion modeling is limited by the ability to recognize the implications of what has been computed and to draw conclusions about the elementary steps underlying the reaction mechanism. This difficulty can be overcome in part by making better use of reaction path analysis in the context of multidimensional flame simulations. Following a survey of current practice, an integral reaction flux is formulated in terms of conserved scalars that can be calculated in a fully automated way. Conditional analyses are then introduced, and a taxonomy for bidirectional path analysis is explored. Many examples illustrate the resulting path analysis and uncover some new results about nonpremixed methane-air laminar jets.

  1. Dynamics of interfacial reactions between O(3 P) atoms and long-chain liquid hydrocarbons

    Science.gov (United States)

    Allan, Mhairi; Bagot, Paul A. J.; Köhler, Sven P. K.; Reed, Stewart K.; Westacott, Robin E.; Costen, Matthew L.; McKendrick, Kenneth G.

    2007-09-01

    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O(3P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  2. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Directory of Open Access Journals (Sweden)

    Mohammad Soleimani

    2010-01-01

    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  3. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  4. Modeling methodology for supply chain synthesis and disruption analysis

    Science.gov (United States)

    Wu, Teresa; Blackhurst, Jennifer

    2004-11-01

    The concept of an integrated or synthesized supply chain is a strategy for managing today's globalized and customer driven supply chains in order to better meet customer demands. Synthesizing individual entities into an integrated supply chain can be a challenging task due to a variety of factors including conflicting objectives, mismatched incentives and constraints of the individual entities. Furthermore, understanding the effects of disruptions occurring at any point in the system is difficult when working toward synthesizing supply chain operations. Therefore, the goal of this research is to present a modeling methodology to manage the synthesis of a supply chain by linking hierarchical levels of the system and to model and analyze disruptions in the integrated supply chain. The contribution of this research is threefold: (1) supply chain systems can be modeled hierarchically (2) the performance of synthesized supply chain system can be evaluated quantitatively (3) reachability analysis is used to evaluate the system performance and verify whether a specific state is reachable, allowing the user to understand the extent of effects of a disruption.

  5. Analysis of a complex shape chain plate using Transmission Photoelasticity

    Science.gov (United States)

    Dasari, N.; Ramesh, K.

    2010-06-01

    fixture was used to load the model during stress freezing in the furnace. The integrated fringe pattern of the offset chain plate is shown in Figure 2. Slices are cut in the offset zone to understand the nature of the stress distribution. A Simple photoelastic analysis of this has revealed a wealth of information to take suitable decision on the design of such plates taking into account the constraints in manufacturing.

  6. The analysis of Al-based alloys by calorimetry: quantitative analysis of reactions and reaction kinetics

    OpenAIRE

    Starink, M.J.

    2004-01-01

    Differential scanning calorimetry (DSC) and isothermal calorimetry have been applied extensively to the analysis of light metals, especially Al based alloys. Isothermal calorimetry and differential scanning calorimetry are used for analysis of solid state reactions, such as precipitation, homogenisation, devitrivication and recrystallisation; and solid–liquid reactions, such as incipient melting and solidification, are studied by differential scanning calorimetry. In producing repeatable calo...

  7. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    Science.gov (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  8. Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis.

    Directory of Open Access Journals (Sweden)

    Melissa K Gregory

    Full Text Available BACKGROUND: Δ6-Desaturase (Fads2 is widely regarded as rate-limiting in the conversion of dietary α-linolenic acid (18:3n-3; ALA to the long-chain omega-3 polyunsaturated fatty acid docosahexaenoic acid (22:6n-3; DHA. However, increasing dietary ALA or the direct Fads2 product, stearidonic acid (18:4n-3; SDA, increases tissue levels of eicosapentaenoic acid (20:5n-3; EPA and docosapentaenoic acid (22:5n-3; DPA, but not DHA. These observations suggest that one or more control points must exist beyond ALA metabolism by Fads2. One possible control point is a second reaction involving Fads2 itself, since this enzyme catalyses desaturation of 24:5n-3 to 24:6n-3, as well as ALA to SDA. However, metabolism of EPA and DPA both require elongation reactions. This study examined the activities of two elongase enzymes as well as the second reaction of Fads2 in order to concentrate on the metabolism of EPA to DHA. METHODOLOGY/PRINCIPAL FINDINGS: The substrate selectivities, competitive substrate interactions and dose response curves of the rat elongases, Elovl2 and Elovl5 were determined after expression of the enzymes in yeast. The competitive substrate interactions for rat Fads2 were also examined. Rat Elovl2 was active with C(20 and C(22 polyunsaturated fatty acids and this single enzyme catalysed the sequential elongation reactions of EPA→DPA→24:5n-3. The second reaction DPA→24:5n-3 appeared to be saturated at substrate concentrations not saturating for the first reaction EPA→DPA. ALA dose-dependently inhibited Fads2 conversion of 24:5n-3 to 24:6n-3. CONCLUSIONS: The competition between ALA and 24:5n-3 for Fads2 may explain the decrease in DHA levels observed after certain intakes of dietary ALA have been exceeded. In addition, the apparent saturation of the second Elovl2 reaction, DPA→24:5n-3, provides further explanations for the accumulation of DPA when ALA, SDA or EPA is provided in the diet. This study suggests that Elovl2 will be

  9. Identification of goose, mule duck, chicken, turkey, and swine in foie gras by species-specific polymerase chain reaction.

    Science.gov (United States)

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martín, Rosario

    2003-03-12

    A specific Polymerase Chain Reaction (PCR) has been developed for the identification of goose (Anser anser), mule duck (Anas platyrhynchos x Cairina moschata), chicken (Gallus gallus), turkey (Meleagris gallopavo), and swine (Sus scrofa domesticus) in foie gras. A forward common primer was designed on a conserved DNA sequence in the mitochondrial 12S ribosomal RNA gene (rRNA), and reverse primers were designed to hybridize on species-specific DNA sequences of each species considered. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose, mule duck, chicken, turkey, and swine in foie gras. Analysis of experimental mixtures demonstrated that the detection limit of the assay was approximately 1% for each species analyzed. This genetic marker can be very useful for the accurate identification of these species, avoiding mislabeling or fraudulent species substitution in foie gras.

  10. IDENTIFICATION OF MYCOBACTERIUM GENAVENSE IN A DIANA MONKEY (CERCOPITHECUS DIANA) BY POLYMERASE CHAIN REACTION AND HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY.

    Science.gov (United States)

    Kelly, Kathleen M; Wack, Allison N; Bradway, Dan; Simons, Brian W; Bronson, Ellen; Osterhout, Gerard; Parrish, Nicole M; Montali, Richard J

    2015-06-01

    A 25-yr-old Diana monkey (Cercopithecus diana) with a 1.5-yr history of chronic colitis and diarrhea was found to have disseminated granulomatous disease with intralesional acid fast bacilli. Bacilli were identified as Mycobacterium genavense by polymerase chain reaction, sequencing of the 16S-23S ribosomal RNA intergenic spacer (ITS) gene, and mycolic acid analysis by high-performance liquid chromatography. Mycobacterium genavense is a common cause of mycobacteriosis in free-ranging and captive birds. In addition, recognition of opportunistic infection in human immunodeficiency virus-positive patients is increasing. Disease manifestations of M. genavense are similar to Mycobacterium avium complex (MAC) and include fever, wasting, and diarrhea with disseminated disease. Similar clinical signs and lesions were observed in this monkey. Mycobacterium genavense should be considered as a differential for disseminated mycobacterial disease in nonhuman primates as this agent can mimic MAC and related mycobacteria.

  11. A new measurement approach of ionizing radiation in irradiated trout (Oncorhynchus mykiss) by Randomly Polymorphic DNA-Polymerase Chain Reaction.

    Science.gov (United States)

    Şakalar, Ergün; Mol, Sühendan

    2016-05-01

    Trout (Oncorhynchus mykiss) were irradiated at doses of 0.250, 0.500, 1, 3, 5, 7 and 9 kGy in gamma cell. DNAs were extracted from the irradiated samples before and after storage. 1ERP primers were designed, and RAPD-PCR (Randomly Polymorphic DNA-Polymerase Chain Reaction) was applied to make randomly amplifications on the DNA of the irradiated samples. Agarose gel profiles of irradiated fish were obtained to determine change of band profiles. In addition, DNA fragmentation occurring in each dose was determined by comet assay for the verification of methodology developed in this study. The molecular methodology was developed to estimate ionizing radiation (IR) level in irradiated fish. This methodology allows the analysis of the trout irradiated up to the dose limit of around 0.5 kGy and stored for a period of three months. PMID:27407216

  12. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis.

    Science.gov (United States)

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da

    2013-01-01

    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  13. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations

    Science.gov (United States)

    Gantz, Valentino M.; Bier, Ethan

    2015-01-01

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype while individuals homozygous for two copies of the allele will display a mutant phenotype. Here, we develop a method that we refer to as the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome editing system for generating autocatalytic mutations to generate homozygous loss-of-function mutations. We demonstrate in Drosophila that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  14. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  15. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Directory of Open Access Journals (Sweden)

    Seiki Kuramitsu

    2013-03-01

    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  16. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra

    2016-08-01

    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  17. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi

    2014-12-01

    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  18. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou

    2008-01-01

    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  19. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  20. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    Science.gov (United States)

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  1. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  2. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  3. A Novel Nested Polymerase Chain Reaction (n-PCR Assay for Identifying Sorghum nitidum

    Directory of Open Access Journals (Sweden)

    Shasha WEI

    2011-11-01

    Full Text Available This work developed a novel nested polymerase chain reaction (n-PCR assay to identify Sorghum nitidum (S. nitidum. It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band at ~873 bp in gel spectra, while other relatives, including Sorghum halepense, Sorghum almum, Sorghum bicolor, Sorghum propinum and Sorghum sudanse exhibited negative amplifications. This assay was able to specifically identify S. nitidum fast and effectively, which could be applied widely in field inspection, agriculture production and plant protection.

  4. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  5. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  6. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  7. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane

    2003-04-01

    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  8. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  9. Treponema pallidum and Haemophilus ducreyi DNA detection by A Multi-Nested Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    郑和平; SylviaBruisten; 何玉山; 黄进梅; 吴兴中

    2004-01-01

    Objectives: To develop a multi-nested polymerase chain reaction in an assay to detect early Treponema pallidum and Haemophilus ducreyi DNA in the swabs of genital ulcers. Methods: Four pairs of outer and inner primers, specific to the basic membrane protein gene of Treponema pallidum and to the 16s rRNA gene of H ducreyi were synthesized. The multi-nested PCR was developed and applied to detect Treponema pallidum and Haemophilus dicreyi in clinical swabs. Result: The two samples of standard strains of Haemophilus ducreyi and one Treponema pallidum were amplified and showed 309-bp rRNA gene of Haemophilus ducreyi and 506-bp DNA of Treponema palidum, respectively. Out of 51 samples of genital ulcer detected, 29 showed Treponemapallidum positive product and noHaemophilus ducreyi DNA was found. Conclusion: The multi-nested PCR for Treponema pallidum and Haemophilus ducreyi could be useful for early detection and distinguishing diagnosis between syphilis and chancroid.

  10. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications.

    Science.gov (United States)

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav

    2004-02-01

    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  11. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  12. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Directory of Open Access Journals (Sweden)

    Liang Gaofeng

    2011-01-01

    Full Text Available Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR. Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA. The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  13. DNA Polymer Brush Patterning through Photocontrollable Surface-Initiated DNA Hybridization Chain Reaction.

    Science.gov (United States)

    Huang, Fujian; Zhou, Xiang; Yao, Dongbao; Xiao, Shiyan; Liang, Haojun

    2015-11-18

    The fabrication of DNA polymer brushes with spatial resolution onto a solid surface is a crucial step for biochip research and related applications, cell-free gene expression study, and even artificial cell fabrication. Here, for the first time, a DNA polymer brush patterning method is reported based on the photoactivation of an ortho-nitrobenzyl linker-embedded DNA hairpin structure and a subsequent surface-initiated DNA hybridization chain reaction (HCR). Inert DNA hairpins are exposed to ultraviolet light irradiation to generate DNA duplexes with two active sticky ends (toeholds) in a programmable manner. These activated DNA duplexes can initiate DNA HCR to generate multifunctional patterned DNA polymer brushes with complex geometrical shapes. Different multifunctional DNA polymer brush patterns can be fabricated on certain areas of the same solid surface using this method. Moreover, the patterned DNA brush surface can be used to capture target molecules in a desired manner.

  14. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang

    2006-01-01

    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  15. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  16. Variance-reduced simulation of lattice discrete-time Markov chains with applications in reaction networks

    Science.gov (United States)

    Maginnis, P. A.; West, M.; Dullerud, G. E.

    2016-10-01

    We propose an algorithm to accelerate Monte Carlo simulation for a broad class of stochastic processes. Specifically, the class of countable-state, discrete-time Markov chains driven by additive Poisson noise, or lattice discrete-time Markov chains. In particular, this class includes simulation of reaction networks via the tau-leaping algorithm. To produce the speedup, we simulate pairs of fair-draw trajectories that are negatively correlated. Thus, when averaged, these paths produce an unbiased Monte Carlo estimator that has reduced variance and, therefore, reduced error. Numerical results for three example systems included in this work demonstrate two to four orders of magnitude reduction of mean-square error. The numerical examples were chosen to illustrate different application areas and levels of system complexity. The areas are: gene expression (affine state-dependent rates), aerosol particle coagulation with emission and human immunodeficiency virus infection (both with nonlinear state-dependent rates). Our algorithm views the system dynamics as a "black-box", i.e., we only require control of pseudorandom number generator inputs. As a result, typical codes can be retrofitted with our algorithm using only minor changes. We prove several analytical results. Among these, we characterize the relationship of covariances between paths in the general nonlinear state-dependent intensity rates case, and we prove variance reduction of mean estimators in the special case of affine intensity rates.

  17. The use of polymerase chain reaction for early diagnosis of tuberculosis in Mycobacterium tuberculosis culture

    Directory of Open Access Journals (Sweden)

    M. Chagas

    2010-06-01

    Full Text Available Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7% and specificity (60% were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

  18. Estimation and Preparation of the Hypervariable Regions I/II Templates for Mitochondrial DNA Typing From Human Bones and Teeth Remains Using Singleplex Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Le, Thien Ngoc; Van Phan, Hieu; Dang, Anh Tuan Mai; Nguyen, Vy Thuy

    2016-09-01

    A method was designed for estimating and sequencing of mitochondrial DNA (mtDNA) that effectively and more quickly provides a complete mtDNA profile. In this context, we have developed this novel strategy for typing mtDNA from 10 bones and teeth remains (3 months to 44 years). The quantification of mtDNA was achieved by singleplex real-time polymerase chain reaction of the hypervariable region I fragment (445 bp) and hypervariable region II fragment (617 bp). Combined with the melting curve analysis, we have determined as little as 10 pg of mtDNA template that is suitable for sequence analysis. Furthermore, quantitative polymerase chain reaction products were directly used for following step of mtDNA typing by Sanger sequencing. This method allows the profile to be completely provided for faster human identification. PMID:27356010

  19. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: ruark@126.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: zhouximi@yahoo.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)

    2012-03-09

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  20. Improved Polymerase Chain Reaction-restriction Fragment Length Polymorphism Genotyping of Toxic Pufferfish by Liquid Chromatography/Mass Spectrometry.

    Science.gov (United States)

    Miyaguchi, Hajime

    2016-09-20

    An improved version of a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for genotyping toxic pufferfish species by liquid chromatography/electrospray ionization mass spectrometry (LC/ESI-MS) is described. DNA extraction is carried out using a silica membrane-based DNA extraction kit. After the PCR amplification using a detergent-free PCR buffer, restriction enzymes are added to the solution without purifying the reaction solution. A reverse-phase silica monolith column and a Fourier transform high resolution mass spectrometer having a modified Kingdon trap analyzer are employed for separation and detection, respectively. The mobile phase, consisting of 400 mM 1,1,1,3,3,3-hexafluoro-2-propanol, 15 mM triethylamine (pH 7.9) and methanol, is delivered at a flow rate of 0.4 ml/min. The cycle time for LC/ESI-MS analysis is 8 min including equilibration of the column. Deconvolution software having an isotope distribution model of the oligonucleotide is used to calculate the corresponding monoisotopic mass from the mass spectrum. For analysis of oligonucleotides (range 26-79 nucleotides), mass accuracy was 0.62 ± 0.74 ppm (n = 280) and excellent accuracy and precision were sustained for 180 hr without use of a lock mass standard.

  1. Improved Polymerase Chain Reaction-restriction Fragment Length Polymorphism Genotyping of Toxic Pufferfish by Liquid Chromatography/Mass Spectrometry.

    Science.gov (United States)

    Miyaguchi, Hajime

    2016-01-01

    An improved version of a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for genotyping toxic pufferfish species by liquid chromatography/electrospray ionization mass spectrometry (LC/ESI-MS) is described. DNA extraction is carried out using a silica membrane-based DNA extraction kit. After the PCR amplification using a detergent-free PCR buffer, restriction enzymes are added to the solution without purifying the reaction solution. A reverse-phase silica monolith column and a Fourier transform high resolution mass spectrometer having a modified Kingdon trap analyzer are employed for separation and detection, respectively. The mobile phase, consisting of 400 mM 1,1,1,3,3,3-hexafluoro-2-propanol, 15 mM triethylamine (pH 7.9) and methanol, is delivered at a flow rate of 0.4 ml/min. The cycle time for LC/ESI-MS analysis is 8 min including equilibration of the column. Deconvolution software having an isotope distribution model of the oligonucleotide is used to calculate the corresponding monoisotopic mass from the mass spectrum. For analysis of oligonucleotides (range 26-79 nucleotides), mass accuracy was 0.62 ± 0.74 ppm (n = 280) and excellent accuracy and precision were sustained for 180 hr without use of a lock mass standard. PMID:27684516

  2. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    Science.gov (United States)

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis.

  3. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    Science.gov (United States)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  4. Continuous reaction performances of benzene alkylation with long chain olefins catalyzed by ionic liquid

    Institute of Scientific and Technical Information of China (English)

    Congzhen QIAO; Chengyue LI

    2008-01-01

    Based on a compulsive mixing-reacting-sepa-rating-recycling small experimental setup,the continuous reaction performances of benzene alkylation with long chain olefins catalyzed by [BMIM]Cl-AlCl3 ionic liquid were investigated. Three different situations including normal continuous operation mode (reagent materials), sidetrack feeding from different axial positions along the static mixing reactor (reagent materials) and normal con-tinuous alkylation using industrial paraffin and olefins materials were examined. Even under the relatively hype-critical reaction conditions, the single pass conversion of pure 1-dodecene could reach to nearly 100.0%, and the selectivity of 2-phenyl isomer was higher than 37.7%. Although the positions along the reactor for sidetrack feeding were different, the 100.0% single pass conversion of 1-dodecene was also attained before the outlet of the reactor. The refined industrial olefins as raw material could meet with the requirements of continuous alkyla-tion. The influences of impurities such as di-olefins and non-benzene aromatics on the catalytic activity and stability should be studied further.

  5. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    Science.gov (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  6. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  7. Complex Network Characteristics and Invulnerability Simulating Analysis of Supply Chain

    Directory of Open Access Journals (Sweden)

    Hui-Huang Chen

    2012-03-01

    Full Text Available To study the characteristics of the complex supply chain, a invulnerability analysis method based on the complex network theory is proposed. The topological structure and dynamic characteristics of the complex supply chain network were analyzed. The fact was found that the network is with general characteristics of the complex network, and with the characteristics of small-world network and scale-free network. A simulation experiment was made on the invulnerability of the supply chain network in different attack modes, of which the outcome demonstrates that the supply chain network is not only with the robustness in random failure, but also with the vulnerability to deliberate assault. In addition, the outcome also shows the network reliability depends on the stability of critical nodes (i.e. core enterprises. As a result, it is vital to ensure this kind of enterprise operating normally and efficiently.

  8. Detection of hepatitis C virus sequences in sera with controversial serology by nested polymerase chain reaction.

    Science.gov (United States)

    Lazizi, Y; Elfassi, E; Pillot, J

    1992-04-01

    The specificity of first-generation enzyme-linked immunosorbent assays (ELIAs) for antibody detection in individuals with hepatitis C virus (HCV) infection has been questioned in some pathological situations. We observed a surprisingly high prevalence of anti-HCV antibodies in alcoholic patients, and thus, false-positive reactions in anti-HCV tests were strongly suspected. The introduction of new epitopes, particularly a core protein, C22 (second-generation tests), seems to increase the sensitivity of anti-HCV detection. In order to study the specificity of the second-generation tests, 60 serum samples from alcoholic patients found to be positive by the first-generation anti-HCV ELISA (Ortho) were reexamined by a second-generation anti-HCV enzyme immunoassay (Abbott) and a recombinant immunoblot assay (RIBA II; Chiron). Fifteen serum samples gave contradictory results when they were tested by the two assays. We performed nested polymerase chain reactions (PCRs) to confirm that the discrepancies that we observed could be due to the presence of low levels of anti-HCV antibodies, which were detected by a more sensitive test, or to unspecific positive reactions. Nested PCR revealed the presence of HCV RNA sequences in all anti-HCV-positive sera or sera that were weakly positive by ELISA. Anti-HCV positive by RIBA II was always correlated with the presence of viral RNA in serum, but HCV RNA was detected in RIBA II-negative sera. These results indicate that the specificity of the second-generation tests is an important improvement but that an HCV infection can still persist without detectable antibodies. PCR remains the reference assay to clear up controversial serology results and to detect HCV infection in patients with no anti-HCV-detectable immune response. PMID:1315339

  9. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction.

    Science.gov (United States)

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su

    2012-01-01

    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time. PMID:22079620

  10. Probing chain-end functionalization reactions in living anionic polymerization via matrix-assisted laser desorption ionization time-of-flight mass spectrometry

    Science.gov (United States)

    Arnould, Mark A.; Polce, Michael J.; Quirk, Roderic P.; Wesdemiotis, Chrys

    2004-11-01

    Matrix-assisted laser desorption ionization (MALDI) time-of-flight (TOF) mass spectrometry (MS) is applied to examine the products arising upon the preparation of chain-end functional polymers via living anionic polymerization techniques. Both post-polymerization functionalizations as well as the use of functionalized initiators are investigated. MALDI-TOF MS is shown to be a sensitive probe for the qualitative analysis of the major and minor oligomers from novel functionalization reactions whose mechanisms are not yet well established. The method is particularly valuable for the identification of the end groups of the minor, and often unexpected, distributions that may be undetectable by other analytical means. Complete characterization of all oligomers generated during functionalization reactions provides an essential tool to the synthetic chemist for understanding the corresponding mechanisms. This insight is necessary for selecting alternative routes or making modifications to the reaction conditions. It is demonstrated that MALDI-TOF MS can convey quantitative information about the yields of the chain-end groups introduced during functionalization. From the cases presented it is evident that post-polymerization reactions allow for better control of chain-end functionality and molecular weight than functionalization with the limited number of currently available protected functionalized initiators.

  11. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    Science.gov (United States)

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination.

  12. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load

    OpenAIRE

    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY

    1998-01-01

    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  13. The neutrino interaction analysis chain in OPERA

    CERN Document Server

    Rescigno, Regina

    Abstract Th e aim of the OPERA experiment i s to provide a “smoking - gun” proof of neutrino oscillation s, through the detecti on of the appearance signal of ν τ ’s in an initially pure ν μ beam. The beam is produced at CERN, 732 Km fa r from the detector , which is located underground in t he Gran Sasso laboratory. The evidence of the appearance signal will be provided by the detection of the daughter particles produced in the decay of the τ lepton. A micro - metric spatial resolution is needed in order to measure a nd study the topology of the ν τ - induced events. With this goal, n uclear emulsions, the highest resolution tracking detector , were chosen to be the core of the OPERA apparatus. The analysis of the large amount of nuclear emulsions used in the OPERA experime n t has required the development of a new generation of fast automatic mi croscopes , featuring a scanning speed more than one order of magnitude hi g h er th...

  14. VALUE CHAIN ANALYSIS (ANALISIS RANTAI NILAI ) UNTUK KEUNGGULAN KOMPETITIF MELALUI KEUNGGULAN BIAYA

    OpenAIRE

    Sipayung, Friska

    2010-01-01

    Value Chain Analysis is a valueable analytical tool to understand activities and provide information on company position in the value in the form of product and service value. Value Chain Analysis can be classified in to analysis related to outside parties such as supplier linkages and customer linkages and the company’s value chain analysis. The Value Chain Analysis helps the company to indentify a company position and analyze activities in value chain and to reduce or eliminate activities t...

  15. Estimation of the diagnostic accuracy of the glyco-C and US9 gene-based polymerase chain reaction technique for the detection of bovine Herpesvirus type 5 DNA in decomposed brain suspension from a slaughter house using Bayesian analysis, Brazil.

    Science.gov (United States)

    Cardoso, Tereza Cristina; Antello, Talita Fontes; Vieira, Flávia Volpato; Machado, Saulo Tarso Zacarias; Nogueira, Adriana Hellmeister de Campos

    2012-03-01

    Brazil represents the greatest beef producer among tropical countries, and the major obstacle for meat international trade is sanitary problems especially closely related to viral encephalitis. The goal of this study was to estimate the accuracy of the glycol and US9 gene-based polymerase chain reactions (PCRs) for the detection of bovine Herpesvirus type 5 (BoHV-5) from decomposed brain samples (n = 95). For this purpose, a latent-class (bayesian) approach was used. Sensitivity (Se) was estimated to be 70% (95% probability interval, 40-80) and specificity (Sp) 100% in the statistical analysis for both PCRs used. Accordingly, a minimum of ≥40% of the calves was estimated to harbor BoHV-5 DNA even after 72 h of decomposition at room temperature. It was concluded that US9 gene-based PCR could also be considered a cost-effective alternative in sanitary programmers. However, given the importance of veterinary diagnoses, PCR-positive samples should be further confirmed through in vitro isolation and/or sequencing. PMID:21786161

  16. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-04-01

    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  17. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  18. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  19. Identification of related DNA sequences in Borrelia burgdorferi and two strains of Leptospira interrogans by using polymerase chain reaction.

    OpenAIRE

    Kron, M A; Gupta, A; Mackenzie, C. D.

    1991-01-01

    The suitability of a polymerase chain reaction assay for Borrelia burgdorferi in epidemiological studies of infected tick populations was evaluated by using 28 strains of Leptospira interrogans and lysates of fixed adult Ixodes tick tissues. Two false positives representing leptospires were differentiated from B. burgdorferi by using an oligonucleotide probe.

  20. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...

  1. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    Science.gov (United States)

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  2. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR...

  3. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  4. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;

    2014-01-01

    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  5. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...

  6. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    Science.gov (United States)

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  7. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    Science.gov (United States)

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  8. Modeling the Manipulation of Natural Populations by the Mutagenic Chain Reaction.

    Science.gov (United States)

    Unckless, Robert L; Messer, Philipp W; Connallon, Tim; Clark, Andrew G

    2015-10-01

    The use of recombinant genetic technologies for population manipulation has mostly remained an abstract idea due to the lack of a suitable means to drive novel gene constructs to high frequency in populations. Recently Gantz and Bier showed that the use of CRISPR/Cas9 technology could provide an artificial drive mechanism, the so-called mutagenic chain reaction (MCR), which could lead to rapid fixation of even a deleterious introduced allele. We establish the near equivalence of this system to other gene drive models and review the results of simple models showing that, when there is a fitness cost to the MCR allele, an internal equilibrium may exist that is usually unstable. In this case, introductions must be at a frequency above this critical point for the successful invasion of the MCR allele. We obtain estimates of fixation and invasion probabilities for the appropriate scenarios. Finally, we discuss how polymorphism in natural populations may introduce sources of natural resistance to MCR invasion. These modeling results have important implications for application of MCR in natural populations. PMID:26232409

  9. [The applications of thermostable ligase chain reaction in facilitating DNA recombination].

    Science.gov (United States)

    Xiangda, Zhou; Xiao, Song; Cong, Huai; Haiyan, Sun; Hongyan, Chen; Daru, Lu

    2016-02-01

    The traditional Type Ⅱ restriction enzyme-based method is restricted by the purification steps, and therefore, cannot be applied to specific DNA assembly in chaotic system. To solve this problem, Thermostable Ligase Chain Reaction (TLCR) was introduced in the process of DNA assembly and capture. This technique combines the feature of thermostable DNA ligase and sequence specific oligo ligation template, "Helper", to achieve specific assembly of target fragments and exponential increase of products in multiple thermocyclings. Two plasmid construction experiments were carried out in order to test the feasibility and practical performance of TLCR. One was that, TLCR was used to specifically capture a 1.5 kb fragment into vector from an unpurified chaotic system which contained 7 different sizes of fragments. The results showed that the capturing accuracy was around 80%, which proved the feasibility and accuracy of using TLCR to specific assembly of DNA fragments in a complicated mixed system. In the other experiment, TLCR was used to capture two fragments (total length was 27 kb) from Hind Ⅲ digestion of Lambda genome into vector by order. The results also showed an accuracy of around 80%. As demonstrated in the results, TLCR can simplify the process of DNA recombination experiments and is suitable for the assembly of multiple and large DNA fragments. This technique can provide convenience to biological experiments.

  10. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Science.gov (United States)

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  11. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Laure F Pittet

    Full Text Available Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR. In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old, formerly diagnosed as Bordetella pertussis (IS481+. No B. holmesii (IS481+, IS1001-, hIS1001+ was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  12. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini

    2013-12-01

    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  13. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader

    Science.gov (United States)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng

    2007-11-01

    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  14. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Science.gov (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  15. Improving Nuclear Safety of Fast Reactors by Slowing Down Fission Chain Reaction

    Directory of Open Access Journals (Sweden)

    G. G. Kulikov

    2014-01-01

    Full Text Available Light materials with small atomic mass (light or heavy water, graphite, and so on are usually used as a neutron reflector and moderator. The present paper proposes using a new, heavy element as neutron moderator and reflector, namely, “radiogenic lead” with dominant content of isotope 208Pb. Radiogenic lead is a stable natural lead. This isotope is characterized by extremely low micro cross-section of radiative neutron capture (~0.23 mb for thermal neutrons, which is smaller than graphite and deuterium cross-sections. The reflector-converter for a fast reactor core is the structure capable of transforming some part of prompt neutrons leaked from the core into the reflected neutrons with properties similar to those of delayed neutrons, that is, sufficiently large contribution to reactivity at the level of effective fraction of delayed neutrons and relatively long lifetime, comparable with lifetimes of radionuclides-emitters of delayed neutrons. It is evaluated that the use of radiogenic lead makes it possible to slow down the chain fission reaction on prompt neutrons in the fast reactor. This can improve the fast reactor safety and reduce some requirements to the technologies used to fabricate fuel for the fast reactor.

  16. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Directory of Open Access Journals (Sweden)

    Parvin Hassanzadeh

    2012-03-01

    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  17. Human papillomavirus infection in lung vs. oral squamous cell carcinomas: a polymerase chain reaction study.

    Science.gov (United States)

    Halimi, M; Morshedi Asl, S

    2011-06-01

    The role of Human Papillomavirus (HPV) has been suspected in pathogenesis of various malignancies; however, the available data are not conclusive. This study aimed to determine and compare the frequency of HPV infection in oral and lung Squamous Cell Carcinoma (SCC) by a sensitive method. Sixty specimens of oral and lung SCC (30 cases each one) were reevaluated in Tabriz Imam Reza Centre in a 24 month period. Following genomic DNA extract, the Polymerase Chain Reaction (PCR) amplification was performed in presence of specific MY11 and MY09 primers for HPV infection. Three cervical specimens and a combination of PCR solution lacking DNA plus healthy persons' DNA samples were employed as positive and negative controls, respectively. The oral group was significantly older than the lung group (68.90 vs. 56.67 y, p infection in the oral and lung groups were comparable (20 vs. 10%, respectively; p = 0.47). Majority of patients with HPV infection were older than 60 years (88.9%) or male (88.9%). In the oral group, all these cases were well differentiated and the majority was of lower lip origin (83.3%). In the lung group, 66.7% of these specimens were moderately differentiated and the origin was bronchus in all cases. In conclusion, the rate of HPV infection in lung and oral SCC samples is rather lower than the previous reports in the literature. This rate is apparently higher in the oral than the lung SCC specimens. PMID:22235505

  18. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

    Science.gov (United States)

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

    2010-03-01

    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  19. Salmonellae in fish feces analyzed by in situ hybridization and quantitative polymerase chain reaction.

    Science.gov (United States)

    Sha, Qiong; Forstner, Michael R J; Bonner, Timothy H; Hahn, Dittmar

    2013-09-01

    The potential of fish to transfer salmonellae from heterogeneous aquatic biofilms into feces was assessed in controlled aquarium studies with Suckermouth Catfish Hypostomus plecostomus and with biofilms inoculated with salmonellae. Neither the presence of catfish nor inoculation with salmonellae had detectable effects on the abundance of the microbial community. Densities of the microbial community were about 10(5) cells/mL in the water during a 1-week period, whereas densities of the microbial community increased 10-fold (10(6) to 10(7) cells/mg) in catfish feces during the same period. Salmonellae were detected by both quantitative polymerase chain reaction (qPCR) and situ hybridization in water samples immediately after inoculation, in numbers of about 10(4) cells/mL, representing up to 20% of the cells of the microbial community. Numbers decreased by three orders of magnitude within the first 3 d of the study, which represented only 0.01% of the community, and became undetectable after day 5. In catfish feces, numbers of Salmonella initially increased to up to 6% of the cells of the community but then declined. These results suggest that Salmonella are not biomagnified during gut passage, and thus, fish only provide a means for the translocation of this pathogen.

  20. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    Science.gov (United States)

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  1. Improved Multiplex Polymerase Chain Reaction for Rapid Staphylococcus Aureus Detection in Meat and Milk Matrices

    Directory of Open Access Journals (Sweden)

    Šramková Zuzana

    2016-06-01

    Full Text Available Staphylococcal food poisoning represents one of the most frequently occurring intoxications, caused by staphylococcal enterotoxins (SE-s and staphylococcal enterotoxin-like proteins (SEl-s. Therefore, there is a need for rapid, sensitive and specific detection method for this human pathogen and its toxin genes in food matrices. The present work is focused on Staphylococcus aureus detection by a nonaplex polymerase chain reaction, which targets the 23S rRNA gene for identification of S. aureus at the species level, genes for classical SE-s (SEA, SEC, SED, new SE-s (SEH, SEI, SEl-s (SEK, SEL and tsst-1 gene (toxic shock syndrome toxin. Primers were properly designed to avoid undesirable interactions and to create a reliably identifiable profile of amplicons when visualized in agarose gel. According to obtained results, this approach is able to reach the detection sensitivity of 12 colony forming units from milk and meat matrices without prior culturing and DNA extraction.

  2. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2014-10-01

    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  3. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Directory of Open Access Journals (Sweden)

    Mari Tuyama

    2008-03-01

    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  4. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Science.gov (United States)

    Costa, Daniela Camargos; Madureira, Ana Paula; Amaral, Lara Cotta; Sanchez, Bruno Antônio Marinho; Gomes, Luciano Teixeira; Fontes, Cor Jésus Fernandes; Limongi, Jean Ezequiel; Brito, Cristiana Ferreira Alves de; Carvalho, Luzia Helena

    2014-02-01

    The polymerase chain reaction (PCR)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  5. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications

    Science.gov (United States)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.

    2015-12-01

    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  6. Laboratory reporting accuracy of polymerase chain reaction testing for avian polyomavirus.

    Science.gov (United States)

    Fitzgerald, Brenna; Olsen, Geoff; Speer, Brian

    2013-03-01

    Polymerase chain reaction (PCR) assays are available for detection of birds infected with avian polyomavirus (APV). Several laboratories offer this diagnostic assay in the United States, but little information is available regarding assay sensitivity, specificity, and accuracy. In this study, known APV-positive and APV-negative samples (each n = 10, 5 undiluted and 5 diluted) were sent to 5 commercial laboratories. A significant difference in reporting accuracy was found among laboratories, most notably for dilute APV-positive samples. Two out of 5 laboratories provided 100% accurate results, 1 had an accuracy of 90%, and 2 reported 80% and 75% accuracy, respectively. The accuracies of the last 2 laboratories were negatively affected by test sensitivities of 60% and 50%, respectively. These findings show that although accurate results were reported by most laboratories, both false-positive and false-negative results were reported by at least 3 laboratories, and false-negative results reported for dilute APV-positive samples predominated. These study findings illustrate a need for veterinary diagnostic laboratories to institute improved voluntary quality control measures.

  7. Genital infection caused by Entamoeba histolytica confirmed by polymerase chain reaction analyses.

    Science.gov (United States)

    Asano, Hiroshi; Kaneuchi, Masanori; Furuta, Itsuko; Yamaya, Yukie; Hatanaka, Kanako C; Takeda, Mahito; Matsuno, Yoshihiro; Sakuragi, Noriaki

    2014-05-01

    Entamoeba histolytica is estimated to infect approximately 1% of the global population. In Japan, the prevalence of amebic dysentery has been increasing, with more than 800 patients newly diagnosed annually. However, genital infection with E. histolytica is uncommon even in endemic areas. We present a case of vaginitis caused by E. histolytica. A 50-year-old Japanese woman without history of overseas travel presented to a nearby clinic with increased vaginal discharge. She had hemorrhagic erosion at the uterine cervix with yellowish vaginal discharge, and was referred to our hospital for exclusion of malignancy. Cervical cytology revealed periodic acid-Schiff-positive protozoa not aggregating around squamous cells, and thus amebic vaginitis was suspected. We performed polymerase chain reaction (PCR) analyses and identified E. histolytica. The vaginitis was treated with metronidazole, and the disappearance of amebic protozoa was confirmed by cytology and PCR. Therefore, it may be important to obtain early diagnosis by cervical cytology and PCR.

  8. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  9. Polymerase chain reaction and real-time PCR for diagnosing of Leishmania infantum chagasi in dogs.

    Science.gov (United States)

    Ramos, Rafael Antonio do Nascimento; Ramos, Carlos Alberto do Nascimento; Jusi, Márcia Mariza Gomes; de Araújo, Flábio Ribeiro; Machado, Rosangela Zacarias; Faustino, Maria Aparecida da Glória; Alves, Leucio Câmara

    2012-01-01

    The importance of dogs as a reservoir for Leishmania infantumchagasi in urban environments has stimulated numerous studies assessing diagnostic techniques. When performed properly, such procedures are an important step in preventing leishmaniasis in humans. Molecular methods have become prominent for this purpose. The aim of the present study was to determine the performance of the polymerase chain reaction (PCR) and real-time PCR (qPCR) for diagnosing of canine visceral leishmaniasis (CVL) using different biological samples. For this, 35 dogs from an area endemic for CVL were used. Bone marrow aspirate and lymph node and spleen fragments from these dogs were used for the molecular diagnosis. In the present study, qPCR was able to detect a greater number of positive animals than seen with PCR. Among the different biological samples used, there was no significant difference in L. infantumchagasi DNA detection between PCR and qPCR. However, considering that lymph nodes are easy to acquire, these can be considered to be the best samples for making molecular diagnoses of L. infantum chagasi infection.

  10. DETECTION OF PATHOGENS CAUSING GENITAL ULCER DISEASE BY MULTIPLEX POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    Ai-ying Liu; Ming-jun Jiang; Yue-ping Yin; Jiang-fang Sun

    2005-01-01

    Objective To establish a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of pathogens causing genital ulcer disease (GUD).Methods Based on the gene-specific region of the following pathogens: Chlamydia trachomatis ompl/ompb, herpes simplex virus (HSV) DNA polymerase, Treponema pallidum tpp47, Haemophilus ducreyi 16s rRNA, four sets of primers were designed and an M-PCR assay was developed to detect four pathogens in one test. The assay was evaluated with diagnostic result of golden standard for each pathogen.Results Of the 51 clinical samples, M-PCR showed slightly higher positive rate (47.1%) of HSV than cell culture (23.6%).Meanwhile, the positive rate of T. p allidum detected by M-PCR and dark-field microscopy was 19.6% ( 10/51) and 15.7% (8/51),respectively. Only one sample was positive for H. ducreyiand no sample was positive for C. trachomatis detected by both M-PCR assay and culture.Conclusion This primary study indicated that M-PCR assay can simultaneously and rapidly detect the four etiologic pathogens causing GUD.

  11. Diagnosis of Streptococcus pneumoniae meningitis by polymerase chain reaction amplification of the gene for pneumolysin

    Directory of Open Access Journals (Sweden)

    Juliana de A Matos

    2006-08-01

    Full Text Available Diagnosis of bacterial meningitis has long been based on classical methods of Gram stain, serological tests, and culture of cerebrospinal fluid (CSF. The performance of these methods, especially culture and direct smear, is thwarted by failure to detect bacteria following administration of antimicrobial agents and reluctance to performance lumbar punctures at admission. Indeed, patients with meningitis frequently receive antibiotics orally or by injection before the diagnosis is suspected or established. Thus an alternative method has become necessary to help clinicians and epidemiologists to management and control of bacterial meningitis. We evaluate the application of a polymerase chain reaction-based (PCR assay for amplification of pneumolysin gene (ply to diagnosis of Streptococcus pneumoniae meningitis. The PCR assay sensitivity for CSF was 96% (95% confidence interval, CI, 90-99% compared to a sensitivity of 59% for culture (95% CI 49-69%, 66% for Gram stain (95% CI 56-74%, and 78% for latex agglutination test (95% CI 69-86%; PCR specificity was 100% (95% CI 83-100%. PCR results were available within 4 h of the start of the assay. This molecular approach proved to be reliable and useful to identify this bacterium compared with other classical laboratory methods for identification of bacterial meningitis pathogens.

  12. Molecular probes and the polymerase chain reaction for detection and typing of Leishmania species in Mexico.

    Science.gov (United States)

    Monroy-Ostria, Amalia; Sanchez-Tejeda, Gustavo

    2002-04-01

    Leishmaniasis in Mexico is a public health problem because all the clinical forms have been recorded in most Mexican states. We studied patients showing clinical symptoms of any form of leishmaniasis, from several endemic areas. Bone marrow samples, aspirates or skin biopsies were taken and deoxyribonucleic acid (DNA) was extracted and amplified by the polymerase chain reaction (PCR) with universal primers AJS1 and DeB8, specific for the Leishmania subgenus Leishmania. The PCR products were then hybridized by dot- or Southern blotting and probed with probe 9.2, specific for the L. mexicana complex. If hybridization did not occur, the DNA was amplified with primers D1 and D2, specific for members of the L. donovani complex, and PCR products were hybridized with probe B4Rsa, also specific for the L. donovani complex. DNA was also amplified with primers B1 and B2, specific for the subgenus Viannia, and the PCR products were hybridized with probe B18, specific for the L. braziliensis complex. It was found that in Tabasco and Veracruz, Mexico, localized cutaneous leishmaniasis (LCL) is caused by infection with members of the L. mexicana complex, whereas in the states of Nayarit and Campeche it was due to infection with the L. mexicana and/or L. braziliensis complexes. Visceral leishmaniasis was caused by L. (L.) chagasi, mainly in the states of Chiapas and Guerrero, and by L. (L.) mexicana in one immunocompromised patient from Tabasco.

  13. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan

    2014-02-01

    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  14. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    Science.gov (United States)

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  15. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  16. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  17. Detection of helicobacter pylori in benign laryngeal lesions by polymerase chain reaction: a cross sectional study

    Directory of Open Access Journals (Sweden)

    Izadi Farzad

    2012-04-01

    Full Text Available Abstract Background Although Helicobacter Pylori (HP was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR. By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR. Methods The samples were taken from 55 patients with benign laryngeal lesions and frozen in −20°C. One milliliter (ml of lysis buffer was added to 100 mg (mg of each sample and the tube was placed in 56°C overnight. Then DNA extraction was carried out. Results To find HP DNA, in-house PCR was performed that revealed 5 positive results among 55 patients with benign laryngeal lesions. Of them, 3 were polyp, 1 was nodule and 1 was papilloma. Conclusion Although the number of positive results was not a lot in this study, it was in contrast with previous studies which could not find any HP tracks in benign laryngeal lesions by other methods. More studies about the prevalence of HP in benign laryngeal lesions improve judging about the effect of this infection on benign laryngeal lesions.

  18. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying

    2007-01-01

    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  19. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  20. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2007-01-23

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  1. BORRELIA BURGDORFERI DNA IN BIOLOGICAL SAMPLES FROM PATIENTS WITH SARCOIDOSIS USING THE POLYMERASE CHAIN REACTION TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈

    1995-01-01

    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  2. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  3. Hepatitis C virus-polymerase chain reaction of routinely processed liver biopsies.

    Science.gov (United States)

    el-Batanony, M H; Savage, K; Jacobs, R; el-Refaie, A O; Squadrito, G G; Brown, D; Saleh, S M; Raouf, A A; Amer, K M; Dusheiko, G M

    1994-08-01

    The aim of the study was to evaluate the specificity and sensitivity of detection of hepatitis C virus (HCV)-RNA in formalin-fixed paraffin-embedded (FFPE) liver biopsies by polymerase chain reaction (PCR). Routinely processed FFPE diagnostic needle liver biopsies as well as stored serum samples from 43 patients with liver disease were tested for HCV-RNA by reverse transcription-nested PCR using the same sets of primers and following strict anticontamination measures. Twenty-nine cases were positive and 14 were negative for serum HCV-RNA. Tissue HCV-RNA was detected in 17 out of the 29 serum HCV-RNA-positive cases but not in any of the 14 serum HCV-RNA-negative cases. Compared to serum-PCR, tissue-PCR was 100% specific, 58.6% sensitive, and 72% efficient. HCV-RNA was detected more frequently in biopsies stored for less than 1 year, than in those stored for more than 1 year (P = 0.046). In biopsies stored for up to 1 year detection of HCV-RNA by PCR was 81.8% sensitive and 90.9% efficient. Short ( 0.5 cm) ones. It is concluded that following strict anticontamination measures, HCV-RNA detection by PCR in routinely fixed, processed, and stored diagnostic liver biopsies provides a valuable adjunct to diagnosis of HCV infection. In this study, this option was free from contamination problems, even though routine batch histological processing schedules were used. PMID:7964648

  4. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    Institute of Scientific and Technical Information of China (English)

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan

    2002-01-01

    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  5. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Directory of Open Access Journals (Sweden)

    Daniela Camargos Costa

    2014-02-01

    Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  6. Polymerase chain reaction with lesion scrapping for the diagnosis of human American tegumentary leishmaniasis

    Directory of Open Access Journals (Sweden)

    Eneide Aparecida Sabaini Venazzi

    2006-06-01

    Full Text Available The objective of this work was to compare the polymerase chain reaction (PCR using lesion scrapping with other conventional techniques for the diagnosis of the American tegumentary leishmaniasis (ATL. For this, patients with cutaneous lesions suspected to be ATL were studied. The DNA was amplified with the MP1L/MP3H primers. From the 156 studied patients, 79 (50.6% presented positive parasite direct search (PD, 81 (51.9% had positive Montenegro skin test (MST, and 90 (57.7% presented PD and/or MST positive. The PCR was positive in all of the positive-PD patients (100% sensitivity, in 91.1% of the positive PD and/or MST patients, and in 27.3% of the patients that presented negative PD and positive MST. The PCR positivity was similar to the PD (P = 0.2482 and inferior to the MST (P = 0.0455, and to the PD/MST association (P = 0.0133. The high PCR sensitivity, and positivity in those cases where the PD was negative, highlights the importance of this technique as an auxiliary tool for the diagnosis of ATL.

  7. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Gleichweit, Christoph; Amende, Max; Bauer, Udo; Schernich, Stefan; Höfert, Oliver; Lorenz, Michael P. A.; Zhao, Wei; Bachmann, Philipp; Papp, Christian, E-mail: christian.papp@fau.de [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Müller, Michael; Koch, Marcus [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Wasserscheid, Peter [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Libuda, Jörg; Steinrück, Hans-Peter [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany)

    2014-05-28

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H{sub 12}-NEC), dodecahydro-N-propylcarbazole (H{sub 12}-NPC), and dodecahydro-N-butylcarbazole (H{sub 12}-NBC), on Pt(111) and on Al{sub 2}O{sub 3}-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al{sub 2}O{sub 3}, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC.

  8. Analysis of the presence of pathogens which predict the risk of disease at peri-implant sites through polymerase chain reaction (PCR) Análise por reação em cadeia da polimerase (PCR) da presença de patógenos preditores de risco em sítios periimplantares

    OpenAIRE

    Joely Ângela de Oliveira Leitão; José Luiz De Lorenzo; Mario Julio Avila-Campos; Wilson Roberto Sendyk

    2005-01-01

    The presence of DNA of Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, and Prevotella intermedia in the peri-implant sulcus samples of 19 partially edentulous patients was analyzed by polymerase chain reaction (PCR) and related to the depth of the peri-implant sulcus, bleeding on probing, and probable risk of disease. Ten of those patients presented a history of periodontal disease and nine of those did not. The DNA amplification of these pathogens was observed in seven sample...

  9. The Dynamics of Repeat Migration: A Markov Chain Analysis

    OpenAIRE

    Zimmermann, Klaus F.; Amelie F. Constant

    2003-01-01

    While the literature has established that there is substantial and highly selective return migration, the growing importance of repeat migration has been largely ignored. Using Markov chain analysis, this paper provides a modeling framework for repeated moves of migrants between the host and home countries. The Markov transition matrix between the states in two consecutive periods is parameterized and estimated using a logit specification and a large panel data with 14 waves. The analysis for...

  10. A Subjective Risk Analysis Approach of Container Supply Chains

    Institute of Scientific and Technical Information of China (English)

    Zai-Li Yang; Jin Wang; Steve Bonsall; Jian-Bo Yang; Quan-Gen Fang

    2005-01-01

    After the 9/11 terrorism attacks, the lock-out of the American West Ports in 2002 and the breakout of SARS disease in 2003 have further focused mind of both the public and industrialists to take effective and timely measures for assessing and controlling the risks related to container supply chains (CSCs). However, due to the complexity of the risks in the chains, conventional quantitative risk assessment (QRA) methods may not be capable of providing sufficient safety management information, as achieving such a functionality requires enabling the possibility of conducting risk analysis in view of the challenges and uncertainties posed by the unavailability and incompleteness of historical failure data. Combing the fuzzy set theory (FST) and an evidential reasoning (ER) approach, the paper presents a subjective method to deal with the vulnerability-based risks, which are more ubiquitous and uncertain than the traditional hazard-based ones in the chains.

  11. Kinematics of roller chain drives - Exact and approximate analysis

    DEFF Research Database (Denmark)

    Fuglede, Niels; Thomsen, Jon Juel

    2016-01-01

    An exact and approximate kinematic analysis of a roller chain drive modeled as a four-bar mechanism is presented. The span connects the sprockets such that they rotate in the same direction, and the sprocket size, number of teeth, and shaft center distance can be arbitrary. The driven sprocket...... angular position, velocity and acceleration, as well as span length, are calculated and their (discontinuous) variation with driver angular position and main design parameters is illustrated. Kinematic predictions for the chain span motion are compared to results of multibody simulation, and there is seen...... to be very good agreement. All together this gives new insights into the characteristics of chain drive kinematics and the influence of main design parameters....

  12. Antimicrobial efficacy of different root canal sealers by using real-time polymerase chain reaction: An ex vivo study

    Directory of Open Access Journals (Sweden)

    R Gnana Seelan

    2015-01-01

    Full Text Available Background: Root canal sealers help to minimize leakage, provides antimicrobial activity to reduce the possibility of residual bacteria, and to resolve periapical lesion. Aim: To compare five different root canal sealers against Enterococcus faecalis in an infected root canal model by using real-time polymerase chain reaction (RT-PCR. Settings and Design: Sixty human mandibular premolars were sectioned to standardize a uniform length of 14 mm. Fifty microliters of the inoculum containing E. faecalis were transferred into each microcentrifuge tube (n = 60. The samples were divided into six groups Tubli-Seal, Apexit Plus, Fillapex, AH Plus, RoekoSeal, and Positive control, respectively. Materials and Methods: Five groups after the incubation with the microorganism E. faecalis were coated with different root canal sealers and obturated using F3 ProTaper Gutta-percha point. The dentinal shavings were collected and analyzed for RT-PCR. Statistical Analysis: The mean difference between six groups was calculated using analysis of variance and post-hoc test. Results: The highest antibacterial activity was achieved with Tubli-Seal (1938.13 DNA in pictogram [pg] and least by RoekoSeal (3034.54 DNA in pg. Conclusion: The maximum antimicrobial activity was achieved AH Plus and Tubli-Seal. RT-PCR can be used as a valuable and accurate tool for testing antimicrobial activity.

  13. [The detection of minimal residual disease in patients with chronic B-cell lymphatic leukemia using patient-specified polymerase chain reaction].

    Science.gov (United States)

    Sidorova, Iu V; Sorokina, T V; Biderman, B V; Nikulina, E E; Kisilichina, D G; Naumova, E V; Pochtar', M E; Lugovskaia, S A; Ivanova, V L; Kovaleva, L G; Ptushkin, V V; Nikitin, E A; Sudarikov, A B

    2011-12-01

    The new effective protocols of treatment of chronic B-cell lymphatic leukemia, including purine analogs and monoclonal antibodies, provide robust remissions under this disease. Accordingly, the requirements to remission quality assessment are changed too. In particular the assessment of minimal residual disease is obligatory. To assess minimal residual disease in terms of quantity in case of chronic B-cell lymphatic leukemia the technique of polymerase chain reaction was applied in real time with patient-specific primers from the area of V-D-J combinations of genes of heavy chain of immunoglobulin. The study included samples from 60 patients suffering of chronic B-cell lymphatic leukemia. In 15 of them (25%), it was impossible to apply neither the sequence analysis of genes of heavy chain of immunoglobulin nor the fitting of patient-specific primer. The results of quantitative determination of minimal residual disease were obtained in 45 patients (55 tests). The minimal residual disease was detected in 30 of 55 samples (54.5%) and was not detected in 25 of 55 samples (45.5%). At the same time, the quantitative determination of minimal residual disease was implemented in regard to the initial level of neoplastic cells. The method sensitivity qualified by serial dilutions, consisted 10(-5) or 1 neoplastic cell to 100 000 normal cells. The comparative analysis was applied to the results of determination of minimal residual disease using two methods -polymerase chain reaction in real time using patient-specified primers and four-color flow cytofluometry. The determination of minimal residual disease with both methods was implemented in 37 patients (45 tests). The results of both methods matched in 93.3% (42 tests out of 45) with maximal disparity of one degree. Then Spearman factor consisted 0.87 (p polymerase chain reaction in real time. Therefore, the detection of minimal residual disease under chronic B-cell lymphatic leukemia using the method of polymerase chain

  14. Stereoselective synthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-ulose via autoxidation reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Hong-Min; ZHANG Fuyi; TAO Jing-Chao

    2004-01-01

    Many different approaches for synthesis of branched chain sugars have beenestablished,1 because they are very useful intermediates for synthesis of other non-sugar chiralmolecules, and usually occur in nature. Branched chain glycosidulose can be used for construction offive- and six-membered carbocyclic rings to which two chiral carbons of sugar are incorporated byintramolecular aldol condensation and Robinson annulation,2 Therefore they are useful in thesynthesis of natural products which consist of annulated carbohydrates or where a highlyfunctionalised enantiomerically pure cyclopentane or cyclohexane is required. Also, this type ofbranched chain sugar can be considered as the synthons of monoterpenoid natural products of theiridoid class which have the cyclopentan-(c)-pyran structure. In view of the importance of branchedchain glycosiduloses, it is desirable to have a general, convenient methodology to their synthesis.However, none of the literature methods was reported on their synthesis by a nuclephilic addition toa partially protected glycosidulose, due to the fact that these glycosiduloses are very difficult tosynthesize selectively and unstable;3 and what is more, one-step synthesis branched chainglycosidulose using this method is almost impossible.In this paper, we report on a general, convenient method for stereoselective syntheses of2,2-bis(C-branched-chain)glucopyranosid-3-uloses by the new reaction of 1 with various activemethylene compounds. The generality of this method was examined in detail. The optimumtemperature was 18-25℃. The solvent DMF was better than the others. In all cases he yields werehigher than 60%.All the 2,2-bis(C-branched-chain)glucopyranosid-3-uloses were characterized by X-raycrystallographic analyses. In addition, the important iintermediate in this reaction was isolated,which is the product of autoxidation of 1 at C-3 position. Thus the reaction mechanism for thesynthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-uloses

  15. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  16. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio

    2010-11-01

    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  17. Use of pooled samples for the detection of Salmonella in feces by polymerase chain reaction.

    Science.gov (United States)

    Singer, Randall S; Cooke, Cara L; Maddox, Carol W; Isaacson, Richard E; Wallace, Richard L

    2006-07-01

    Many epidemiological studies of Salmonella rely on conventional bacteriological culture methods to detect Salmonella in fecal samples. These culture-based methods are inefficient for epidemiological studies in populations with a low prevalence of Salmonella. The objective of this study was to optimize a protocol that uses pooled Salmonella enrichment broth cultures of bovine feces and polymerase chain reaction (PCR) for the detection of the invA gene of Salmonella in feces. In one field trial, 196 animals were sampled, and all samples were tested by culture, invA PCR on individual samples, invA PCR on pools of 5 samples, and BAX PCR on individual samples. All assays showed a high agreement on individual samples (kappa > or = 0.75). The invA PCR was run on each of 40 pools and detected 19 of 22 culture-positive pools. In another field trial, 152 samples were taken from 4 dairies, and the invA PCR was performed on pools of 5 samples in addition to bacteriological culture of individual samples. Salmonella was detected in 5 of the 32 pools (7 total positive samples) by both PCR and culture. One pool was PCR-positive but culture-negative. Pooling did not dramatically affect the performance of the invA PCR; most of the culture-positive samples were detected, including all of the samples when there were 4 or more Salmonella colonies on the agar plate. Based on these field trials, invA PCR on pooled samples appears to be an efficient method of Salmonella detection as long as Salmonella loads are not extremely low.

  18. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    Science.gov (United States)

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures.

  19. Use of polymerase chain reaction in the diagnosis of Whipple's disease.

    Science.gov (United States)

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi

    2015-12-01

    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight.

  20. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Directory of Open Access Journals (Sweden)

    Grace Q. Chen

    2010-01-01

    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.

  1. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis].

    Science.gov (United States)

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P

    2013-06-01

    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; P3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients.

  2. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine

    Directory of Open Access Journals (Sweden)

    K.R. Caleffi

    2012-02-01

    Full Text Available Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT and dapsone, rifampicin and clofazimine for borderline (BB and lepromatous (LL forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73 of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306. In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386. PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033. Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  3. Biosynthetic enhancement of the detection of bacteria by the polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Julie S Do

    Full Text Available Molecular viability testing (MVT was previously reported to specifically detect viable bacterial cells in complex samples. In MVT, brief nutritional stimulation induces viable cells, but not non-viable cells, to produce abundant amounts of species-specific ribosomal RNA precursors (pre-rRNA. Quantitative polymerase chain reaction (qPCR is used to quantify specific pre-rRNAs in a stimulated aliquot relative to a non-stimulated control. In addition to excluding background signal from non-viable cells and from free DNA, we report here that MVT increases the analytical sensitivity of qPCR when detecting viable cells. Side-by-side limit-of-detection comparisons showed that MVT is 5-fold to >10-fold more sensitive than standard (static DNA-targeted qPCR when detecting diverse bacterial pathogens (Aeromonas hydrophila, Acinetobacter baumannii, Listeria monocytogenes, Mycobacterium avium, and Staphylococcus aureus in serum, milk, and tap water. Sensitivity enhancement may come from the elevated copy number of pre-rRNA relative to genomic DNA, and also from the ratiometric measurement which reduces ambiguity associated with weak or borderline signals. We also report that MVT eliminates false positive signals from bacteria that have been inactivated by moderately elevated temperatures (pasteurization, a condition that can confound widely-used cellular integrity tests that utilize membrane-impermeant compounds such as propidium iodide (PI or propidium monoazide (PMA to differentiate viable from inactivated bacteria. MVT enables the sensitive and specific detection of very small numbers of viable bacteria in complex matrices.

  4. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    V Makeshkumar

    2014-01-01

    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  5. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

    Directory of Open Access Journals (Sweden)

    Clemencia Ovalle Bracho

    2007-08-01

    Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

  6. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    Science.gov (United States)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  7. Equilibrium analysis of trip chains in congested networks

    OpenAIRE

    Heydecker, B.

    2004-01-01

    In this paper, we develop a model of travel in a chain of trips joining several locations througha congested network. We develop a microscopic analysis of individual benefits obtained byspending time at each of the locations and costs incurred through travel between them. This iscombined with a macroscopic equilibrium model of travel during congested peak periods toshow how individuals? travel choices are influenced by the congestion that result fromcorresponding choices made by others. We sh...

  8. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  9. Automation and integration of polymerase chain reaction with capillary electrophoresis for high throughput genotyping and disease diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, N.

    1999-02-12

    Genotyping is to detect specific loci in the human genome. These loci provide important information for forensic testing, construction of genetic linkage maps, gene related disease diagnosis and pharmacogenetic research. Genotyping is becoming more and more popular after these loci can be easily amplified by polymerase chain reaction (PCR). Capillary electrophoresis has its unique advantages for DNA analysis due to its fast heat dissipation and ease of automation. Four projects are described in which genotyping is performed by capillary electrophoresis emphasizing different aspects. First, the author demonstrates a principle to determine the genotype based on capillary electrophoresis system. VNTR polymorphism in the human D1S80 locus was studied. Second, the separation of four short tandem repeat (STR) loci vWF, THO1, TPOX and CSF1PO (CTTv) by using poly(ethylene oxide) (PEO) was studied in achieving high resolution and preventing rehybridization of the DNA fragments. Separation under denaturing, non-denaturing conditions and at elevated temperature was discussed. Third, a 250 {micro}m i.d., 365 {micro}m o.d. fused silica capillary was used as the microreactor for PCR. Fourth, direct PCR from blood was studied to simplify the sample preparation for genotyping to minimum.

  10. Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sundaran S. Tinky

    2015-04-01

    Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

  11. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    Directory of Open Access Journals (Sweden)

    T. M. Nabeel Muhammad

    2015-01-01

    Full Text Available Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasal swabs were tested by PCR. Results: PCR analysis showed 56 positives (71.7% for infectious coryza out of total 78 samples tested. Of 56 infra orbital sinus swabs tested, 47 were positive (83.9% and 9 nasal swabs (40.9% out of 22 tested had given positive results for infectious coryza. Samples collected from birds at acute stage of disease and samples collected before treatment with antibiotics were given better results on PCR. Conclusion: For preventing the economic losses associated with the disease, an early, accurate and rapid diagnosis is essential. PCR is a rapid and highly sensitive diagnostic technique which can substitute conventional cultural examination.

  12. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    International Nuclear Information System (INIS)

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  13. Babesia bovis and B. bigemina DNA detected in cattle and ticks from Zimbabwe by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    I. Smeenk

    2000-07-01

    Full Text Available From blood collected from 94 cattle at 12 locations in the eastern and northeastern areas of Zimbabwe, DNA was extracted and analysed by polymerase chain reaction with primers previously reported to be specific for Babesia bigemina and Babesia bovis. Overall, DNA of Babesia bigemina was detected in the blood of 33/94 (35 % cattle and DNA from B. bovis was detected in 27/58 (47 % of cattle. The prevalence of DNA of B. bigemina was significantly higher in young animals (<2 years (23/46 than in animals over 2 years of age (10/48; (chi2 = 8.77; P < 0.01 %. Although tick sampling was not thorough, Boophilus decoloratus could be collected at 7/9 sites sampled and Boophilus microplus at 4/9 sites. Of the 20 B. decoloratus allowed to oviposit before PCR analysis, 1 (5 % contained DNA that could be amplified with primers for B. bigemina while 12 (60 % were positive with primers for B. bovis. Of the B. microplus allowed to oviposit, 11/16 (69 % were positive for B. bovis DNAby PCR and 2/16 (12 % were positive for B. bigemina.

  14. Quantitation of mule duck in goose foie gras using TaqMan real-time Polymerase Chain Reaction.

    Science.gov (United States)

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Hernández, Pablo E; Martín, Rosario

    2004-03-24

    A real-time quantitative Polymerase Chain Reaction (PCR) method has been developed for the quantitation of mule duck (Anas platyrhynchos x Cairina moschata) in binary duck/goose foie gras mixtures. The method combines the use of real-time PCR with duck-specific and endogenous control "duck + goose" primers to measure duck content and total foie gras content, respectively. Both PCR systems (duck-specific and duck + goose) were designed on the mitochondrial 12S ribosomal RNA gene (rRNA). The duck-specific system amplifies a 96 bp fragment from duck DNA, whereas the duck + goose system amplifies a 120 bp fragment from duck and goose DNA. The method measures PCR product accumulation through a FAM-labeled fluorogenic probe (TaqMan). The C(t) (threshold cycle) values obtained from the duck + goose system are used to normalize the ones obtained from the duck-specific system. Analysis of experimental duck/goose foie gras binary mixtures demonstrated the suitability of the assay for the detection and quantitation of duck in the range of 1-25%. This genetic marker can be very useful to avoid mislabeling or fraudulent species substitution of goose by duck in foie gras.

  15. Prenatal diagnosis of Down syndrome using cell-free fetal DNA in amniotic fluid by quantitative fluorescent polymersase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wu Dan; Chi Hongbin; Shao Minjie; Wu Yao; Jin Hongyan; Wu Baiyan; Qiao Jie

    2014-01-01

    Backgroud Amniotic fluid (AF) supernatant contains cell-free fetal DNA (cffDNA) fragments.This study attempted to take advantage of cffDNA as a new material for prenatal diagnosis,which could be combined with simple quantitative fluorescent polymerase chain reaction (QF-PCR) to provide an ancillary method for the prenatal diagnosis of trisomy 21 syndrome.Methods AF supernatant samples were obtained from 27 women carrying euploid fetuses and 28 women carrying aneuploid fetuses with known cytogenetic karyotypes.Peripheral blood samples of the parents were collected at the same time.Short tandem repeat (STR) fragments on chromosome 21 were amplified by QF-PCR.Fetal condition and the parental source of the extra chromosome could be determined by the STR peaks.Results The sensitivity of the assay for the aneuploid was 93% (26/28; confidence interval,CI:77%-98%) and the specificity was 100% (26/26; CI:88%-100%).The determination rate of the origin of the extra chromosome was 69%.The sensitivity and the specificity of the assay in the euploid were 100% (27/27).Conclusions Trisomy 21 can be prenatally diagnosed by the QF-PCR method in AF supernatant.This karyotype analysis method greatly reduces the requirement for the specimen size.It will be a benefit for early amniocentesis and could avoid pregnancy complications.The method may become an ancillary method for prenatal diagnosis of trisomy 21.

  16. Multiplex Reverse Transcription-Polymerase Chain Reaction for Simultaneous Screening of 29 Chromosomal Translocation in Hematologic Malignancies

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Multiplex reverse transcription-polymerase chain reaction (M-RT-PCR) has been proved to possess great clinical potential for simultaneous screening of 29 chromosomal translocations in acute leukemia. To evaluate the clinical value of M-RT-PCR in hematologic malignancies, bone marrow samples from 90 patients with various hematologic malignancies, including 25 acute myeloge nous leukemia (AML), 22 acute lymphoblastic leukemia (ALL), 27 chronic myelogenous leukemia (CML), 4 myeloproliferative diseases (MPD), 3 chronic lymphoblastic leukemia (CLL), 3 and 1 malignant histocytosis (MH) were subjected to both M-RT-PCR and chromosome karyotypic analysis. Some of cases were subjected to follow-up examination of M-RT-PCR during the period of ukemia. In our hand, 12 of 29chromosomal translocation transcripts including TEL/PDGFR, DEK/CAN, MLL/AF6, AML1/ETO,F9, BCR/ABL, MLL/MLL, PML/RARα, TLS/ERG, E2A/HLF, EVIl and HOXI1 were detected in 57 cases (63.3 %) of the 90 samples, which were in consistence with the results of karyore, M-RT-PCR had also shown good clinical relevance when used as an approach to detect minimal residual leukemia. We concluded that M-RT-PCR could be used as an effiy in the initial diagnosis of hematologic malignancies but also in subsequent monitor of minimal residual leukemia.

  17. High-throughput vector-borne disease environmental surveillance by polymerase chain reaction according to international accreditation requirements.

    Science.gov (United States)

    Soehnlen, Marty K; Crimmins, Stephen L; Clugston, Andrew S; Gruhn, Nina; Gomez, Carlos J; Cross, Michael E; Statham, Charles N

    2014-01-01

    Although vector-borne diseases are specific to the region of the host, there is a necessity for surveillance or reference laboratories to perform standardized, high-throughput testing capable of meeting the needs of a changing military environment and response efforts. The development of standardized, high-throughput, semiquantitative real-time and reverse transcription real-time polymerase chain reaction (PCR) methods allows for the timely dissemination of data to interested parties while providing a platform in which long-term sample storage is possible for the testing of new pathogens of interest using a historical perspective. PCR testing allows for the analysis of multiple pathogens from the same sample, thus reducing the workload of entomologists in the field and increasing the ability to determine if a pathogen has spread beyond traditionally defined locations. US Army Public Health Command Region-Europe (USAPHCR-Europe) Laboratory Sciences (LS) has standardized tests for 9 pathogens at multiple life stages. All tests are currently under international accreditation standards. Using these PCR methods and laboratory model, which have universal Department of Defense application, the USAPHCR-Europe LS will generate quality data that is scientifically sound and legally defensible to support force health protection for the US military in both deployed and garrison environments.

  18. Polymerase chain reaction-restriction fragment length polymorphism method for differentiation of uropathogenic specific protein gene types.

    Science.gov (United States)

    Lai, Yun Mei; Zaw, Myo Thura; Shamsudin, Shamsul Bahari; Lin, Zaw

    2016-08-01

    The putative pathogenicity island (PAI) containing the uropathogenic specific protein (usp) gene and three small open reading frames (orfU1, orfU2, and orfU3) encoding 98, 97, and 96 amino acid proteins is widely distributed among uropathogenic Escherichia coli (UPEC) strains. This PAI was designated as PAIusp. Sequencing analysis of PAIusp has revealed that the usp gene can be divided into two types - uspI and uspII - based on sequence variation at the 3' terminal region and the number and position of orfUs differ from strain to strain. Based on usp gene types and orfU sequential patterns, PAIusp can be divided into four subtypes. Subtyping of PAIusp is a useful method to characterize UPEC strains. In this study, we developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to differentiate usp gene types. This method could correctly identify the usp gene type in usp-positive UPEC strains in our laboratory.

  19. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    P. D. Luka

    2014-10-01

    Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.

  20. Identification of mosquito-borne flavivirus sequences using universal primers and reverse transcription/polymerase chain reaction.

    Science.gov (United States)

    Pierre, V; Drouet, M T; Deubel, V

    1994-01-01

    A reverse transcription/polymerase chain reaction (RT/PCR) protocol for the rapid detection and identification of flaviviruses was developed using a set of universal oligonucleotide primers. These primers correspond to sequences in the 3' non-coding region and in the NS5 gene which are highly conserved among the mosquito-borne flaviviruses. The sequences of the resulting amplified products were analysed for dengue 1, dengue 2, dengue 3, dengue 4, Japanese encephalitis, West Nile, yellow fever and Zika viruses, and compared with the published sequences of other flaviviruses. The 291-297 nucleotides corresponding to the C-terminus of NS5 gene showed 56 to 76% similarity, whereas the 3' non-coding region (190 to 421 nucleotides) showed only 20 to 36% similarity. Genetic classification of the Zika virus supported its traditional serological grouping. Recombinant plasmids containing the flavivirus sequences were used in a nucleic acid hybridization test to identify the RT/PCR products derived from viral RNA extracted from experimentally infected mosquitoes. The plasmids were dotted on a strip of nitrocellulose membrane and incubated with the RT/PCR product labelled with digoxigenin during the PCR step. This is a valuable method for the rapid and specific identification of mosquito-borne flaviviruses in biological specimens and for subsequent sequence analysis.

  1. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. PMID:23541117

  2. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  3. Molecular characterization of Trichinella genotypes by inter-simple sequence repeat polymerase chain reaction (ISSR-PCR).

    Science.gov (United States)

    Fonseca-Salamanca, F; Nogal-Ruiz, J J; Benito, C; Camachot, M V; Martínez-Fernández, A R

    2006-06-01

    A bulk analysis of inter-simple sequence repeat-polymerase chain reaction (ISSR-PCR) provides a quick, reliable, and highly informative system for DNA banding patterns that permit species identification. The present study evaluates the applicability of this system to Trichinella species identification. After a single amplification carried out on a single larva with the primer 816([CA]nRY) under high stringency conditions, which provide high reproducibility, we were able to identify by consistent banding patterns 5 sibling species: Trichinella spiralis (ISS48), 2 Trichinella britovi isolates (ISS11 and ISS86), Trichinella murrelli (ISS35), Trichinella nativa (ISS71), Trichinella nelsoni (ISS29); 3 additional Trichinella genotypes: T8 (ISS149), T9 (ISS408 and ISS409), and T6 (ISS34); and the nonencapsulated species Trichinella pseudospiralis (ISS13). Moreover, 33 new Trichinella isolates from 2 zoogeographical regions were unequivocally identified. All Trichinella isolates have shown an identical pattern with those produced by the reference strain. According to these data, we have demonstrated that ISSR-PCR is a robust technique that emerges as a useful new application for the molecular identification of Trichinella isolates in epidemiological studies. PMID:16884006

  4. Processing of long-stored archival cervical smears for human papillomavirus detection by the polymerase chain reaction.

    Science.gov (United States)

    de Roda Husman, A M; Snijders, P J; Stel, H V; van den Brule, A J; Meijer, C J; Walboomers, J M

    1995-08-01

    The efficiency of a freeze-thaw method, a proteinase K/Tween 20 lysis method and a guanidinium isothiocyanate/silica beads method for DNA extraction from fixed and Papanicolaou-stained cells from the cervical cancer cell line Siha was measured by beta-globin polymerase chain reaction (PCR). The GTC/silica beads method, which appeared superior, revealed a human papillomavirus (HPV) general primer-mediated PCR sensitivity of 50-500 copies of HPV 16 per sample using dilutions of fixed and stained Siha cells. Application to archival cervical smears (n = 116) revealed that the yield and size of amplifiable DNA decreases with storage time. The longer the storage time, the more repetitions of the whole procedure, including the lysis step, were required to extract sufficient amplifiable DNA. In this way, an overall beta-globin PCR positivity for 98% of the smears was reached. Further analysis revealed that a maximum size of 200 bp could be amplified from smears stored for up to 9 years. The method was validated by demonstrating by PCR the same HPV types in archival smears and corresponding cervical biopsies of cervical cancer patients. In conclusion, the GTC/silica beads method appears suitable to process archival cervical smears for HPV detection by PCR. provided that stepwise adjustments are made until beta-globin PCR positivity is obtained and primers are chosen which amplify a maximum of about 200 bp.

  5. Investigation on natural diets of larval marine animals using peptide nucleic acid-directed polymerase chain reaction clamping.

    Science.gov (United States)

    Chow, Seinen; Suzuki, Sayaka; Matsunaga, Tadashi; Lavery, Shane; Jeffs, Andrew; Takeyama, Haruko

    2011-04-01

    The stomach contents of the larvae of marine animals are usually very small in quantity and amorphous, especially in invertebrates, making morphological methods of identification very difficult. Nucleotide sequence analysis using polymerase chain reaction (PCR) is a likely approach, but the large quantity of larval (host) DNA present may mask subtle signals from the prey genome. We have adopted peptide nucleic acid (PNA)-directed PCR clamping to selectively inhibit amplification of host DNA for this purpose. The Japanese spiny lobster (Panulirus japonicus) and eel (Anguilla japonica) were used as model host and prey organisms, respectively. A lobster-specific PNA oligomer (20 bases) was designed to anneal to the sequence at the junction of the 18 S rDNA gene and the internal transcribed spacer 1 (ITS1) of the lobster. PCR using eukaryote universal primers for amplifying the ITS1 region used in conjunction with the lobster-specific PNA on a mixed DNA template of lobster and eel demonstrated successful inhibition of lobster ITS1 amplification while allowing efficient amplification of eel ITS1. This method was then applied to wild-caught lobster larvae of P. japonicus and P. longipes bispinosus collected around Ryukyu Archipelago, Japan. ITS1 sequences of a wide variety of animals (Ctenophora, Cnidaria, Crustacea, Teleostei, Mollusca, and Chaetognatha) were detected. PMID:20535520

  6. Polymerase chain reaction for the evaluation of Schistosoma mansoni infection in two low endemicity areas of Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Gabriel Costa de Carvalho

    2012-11-01

    Full Text Available This study aimed to evaluate the occurrence of schistosomiasis in areas with low endemicity using polymerase chain reaction (PCR as a diagnostic method. We analysed faecal samples from 219 individuals residing in Piau and Coronel Pacheco, state of Minas Gerais, Brazil, using a single faecal sample from each individual and two slides of the Kato-Katz technique as a gold standard. Fifteen out of the 219 samples were positive with both methods of diagnosis. One sample was diagnosed as positive by the Kato-Katz technique only and 61 were diagnosed only by PCR. The positivity rates were 7.3% with the Kato-Katz method and 34.7% with PCR. When both techniques were assumed to have 100% specificity and positive individuals were identified by both methods, the sensitivity of the Kato-Katz method was 20.8% and the PCR sensitivity was 98.7%. The Kappa index between the two techniques was 0.234, suggesting weak agreement. The assessment of a single faecal sample by PCR detected more cases of infection than the analysis of one sample with two slides using the Kato-Katz technique, suggesting that PCR can be a useful diagnostic tool, particularly in areas with low endemicity.

  7. Novel assay of competitively differentiated polymerase chain reaction for screening point mutation of hepatitis B virus

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Xue-Juan Chen; Jian-Guo Li; Lin Gu; Yang-Su Huang; Zhi-Liang Gao

    2003-01-01

    AIM: Point mutation, one of the commonest gene mutations,is the most important molecular pathogenesis of cancer and chronic infection. The commonest methods for detection of point mutation are based on polymerase chain reaction (PCR). These techniques, however, cannot be used in large scale screening since they are neither accurate nor simple.For this reason, this study established a novel method of competitively differentiated PCR (CD-PCR) for screening point mutation in clinical practice.METHODS: Two competitively differentiated primers for mutant-type and wild-type templates respectively with an identically complemented region in 3′ end except for last 2base pairs and a different non-complemented region in 5′end were designed. Thus, competitive amplification might be carried out at a lower annealing temperature at first, and then differentiated amplification at a higher annealing temperature when primers could not combine with initial templates. The amplification was performed in one-tube.The products of CD-PCR were detected using microplate hybridization assay. CD-PCR was evaluated by detecting G1896A variant of hepatitis B virus (HBV) in form of recombinant plasmids and in sera from patients with hepatitis B, and compared with allele-specific PCR (AS-PCR) and competitive AS-PCR.RESULTS: CD-PCR was successfully established. It could clearly distinguish wild-type and mutant-type plasmid DNA of G1896A variant when the amount of plasmid DNA was between 102-108copies/reaction, while for AS-PCR and competitive AS-PCR, the DNA amount was between 102-104copies/reaction. CD-PCR could detect one copy of G1896A variant among 10-100 copies of wild-type plasmid DNA. The specificity of CD-PCR was higher than those of AS-PCR and competitive AS-PCR in the detection of HBV G1896A variant in sera from patients with hepatitis B. CD-PCR was independent of the amount of HBV DNA in serum. HBV G1896A variant was more often found in HBeAg (-) patients with a lower level of

  8. Chain extension and branching of poly(L-lactic acid produced by reaction with a DGEBA-based epoxy resin

    Directory of Open Access Journals (Sweden)

    2007-11-01

    Full Text Available Dicarboxylated poly(L-lactic acid (PLLA was synthesized by reacting succinic anhydride with L-lactic acid prepolymer prepared by melt polycondensation. PLLA and epoxy resin based on diglycidyl ether of bisphenol A (DGEBA copolymers were prepared by chain extension of dicarboxylated PLLA with DGEBA. Infrared spectra confirmed the formation of dicarboxylated PLLA and PLLA/DGEBA copolymer. Influences of reaction temperature, reaction time, and the amount of DGEBA on the molecular weight and gel content of PLLA/DGEBA copolymer were studied. The viscosity average molecular weight of PLLA/DGEBA copolymer reached 87 900 when reaction temperature, reaction time, and mol ratio of dicarboxylated PLLA to DGEBA is 150°C, 30 min, and 1:1 respectively, while gel content of PLLA/DGEBA copolymer is almost zero.

  9. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.;

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The...... selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  10. Application of the Charlesby model to the radiation-induced chain reaction cross-linking of oxirane functionalised polymers

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, Julian J. E-mail: julian.j.murphy@awe.co.uk; Jones, Richard G

    2001-01-01

    A range of copolymers containing styrene and epoxystyrene, when formulated with a photo-acid generator, undergo a cross-linking reaction by a chain reaction mechanism when exposed to high-energy radiation in an electron beam lithographic writing machine. The sensitivities of the formulations are shown to correlate with a simple kinetic model for the radiation chemistry of the system. Deductions about the nature of the cross-linking species have been made by comparing the behaviour of the epoxystyrene system with that observed for an epoxy novolac. (author)

  11. Modelling and analysis of workflow for lean supply chains

    Science.gov (United States)

    Ma, Jinping; Wang, Kanliang; Xu, Lida

    2011-11-01

    Cross-organisational workflow systems are a component of enterprise information systems which support collaborative business process among organisations in supply chain. Currently, the majority of workflow systems is developed in perspectives of information modelling without considering actual requirements of supply chain management. In this article, we focus on the modelling and analysis of the cross-organisational workflow systems in the context of lean supply chain (LSC) using Petri nets. First, the article describes the assumed conditions of cross-organisation workflow net according to the idea of LSC and then discusses the standardisation of collaborating business process between organisations in the context of LSC. Second, the concept of labelled time Petri nets (LTPNs) is defined through combining labelled Petri nets with time Petri nets, and the concept of labelled time workflow nets (LTWNs) is also defined based on LTPNs. Cross-organisational labelled time workflow nets (CLTWNs) is then defined based on LTWNs. Third, the article proposes the notion of OR-silent CLTWNS and a verifying approach to the soundness of LTWNs and CLTWNs. Finally, this article illustrates how to use the proposed method by a simple example. The purpose of this research is to establish a formal method of modelling and analysis of workflow systems for LSC. This study initiates a new perspective of research on cross-organisational workflow management and promotes operation management of LSC in real world settings.

  12. Modeling Value Chain Analysis of Distance Education using UML

    Science.gov (United States)

    Acharya, Anal; Mukherjee, Soumen

    2010-10-01

    Distance education continues to grow as a methodology for the delivery of course content in higher education in India as well as abroad. To manage this growing demand and to provide certain flexibility, there must be certain strategic planning about the use of ICT tools. Value chain analysis is a framework for breaking down the sequence of business functions into a set of activities through which utility could be added to service. Thus it can help to determine the competitive advantage that is enjoyed by an institute. To implement these business functions certain visual representation is required. UML allows for this representation by using a set of structural and behavioral diagrams. In this paper, the first section defines a framework for value chain analysis and highlights its advantages. The second section gives a brief overview of related work in this field. The third section gives a brief discussion on distance education. The fourth section very briefly introduces UML. The fifth section models value chain of distance education using UML. Finally we discuss the limitations and the problems posed in this domain.

  13. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura

    2016-06-01

    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  14. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    OpenAIRE

    T. M. Nabeel Muhammad; Sreedevi, B.

    2015-01-01

    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasa...

  15. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction

    OpenAIRE

    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.

    2009-01-01

    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  16. Rapid Detection/pathotyping of Newcastle disease virus isolates in clinical samples using real time polymerase chain reaction assay

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Abdul Wajid, Muhammad Wasim, Tahir Yaqub, Shafqat F Rehmani, Tasra Bibi, Nadia Mukhtar, Javed Muhammad, Umar Bacha, Suliman Qadir Afridi, Muhammad Nauman Zahid, Zia u ddin, Muhammad Zubair Shabbir, Kamran Abbas & Muneer Ahmad ### Abstract In the present protocol we describe the real time reverse transcription polymerase chain reaction (rRT-PCR) assay for the rapid detection/pathotyping of Newcastle disease virus (NDV) isoaltes in clinical samples. Fusion gene and matrix ...

  17. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    OpenAIRE

    Camila Ximenes; Eduardo Brandão; Paula Oliveira; Abraham Rocha; Tamisa Rego; Rafael Medeiros; Ana Aguiar-Santos; João Ferraz; Christian Reis; Paulo Araujo; Luiz Carvalho; Melo, Fabio L

    2014-01-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuche...

  18. Polymerase chain reaction as a succesful biotechnological application. Ways we use PCR in the fields of bioinformatics forensics and genetics

    OpenAIRE

    Λάζαρη, Σπυριδούλα

    2011-01-01

    Molecular genetics use molecular methods that amplify specific fragments of DNA. Today, the molecular techniques which were developed for amplification and detection of specific sequences of nucleic acids helped in a great deal to understand the structure of many diseases. Polymerase chain reaction or PCR is a technique that is used for isolation and amplification of a specific sequence of DNA. PCR is an in vitro method that exploits the in vivo procedure of replication of DNA. DNA polyme...

  19. Fite-Faraco staining in combination with multiplex polymerase chain reaction: A new approach to leprosy diagnosis

    OpenAIRE

    Abu Hena Hasanoor Reja; Nibir Biswas; Supratik Biswas; Sarbani Dasgupta; Imran Hussain Chowdhury; Surajita Banerjee; Tapas Chakraborty; Pijush Kumar Dutta; Basudev Bhattacharya

    2013-01-01

    Background: Leprosy is not always an easy disease to diagnose, and patients can remain undiagnosed for longtime, not only at the peripheral clinics but also even at places with higher medical facilities, so, there is an urgent need for rapid and definitive modalities for leprosy diagnosis. This prospective study evaluates the ability of Fite-Faraco staining (FF staining) and multiplex polymerase chain reaction (PCR) over hematoxylin and eosin staining (H and E staining) and Ziehl-Neelsen stai...

  20. Allele-specific duplex polymerase chain reaction to differentiate Mycobacterium abscessus subspecies and to detect highly clarithromycin-resistant isolates.

    Science.gov (United States)

    Kim, H Y; Lee, S Y; Kim, B J; Kook, Y H

    2016-01-01

    On the basis of the structural differences of erm, we used a duplex polymerase chain reaction (PCR) to differentiate Mycobacterium abscessus subsp. abscessus and subsp. massiliense isolates and to detect the point mutations of 23S rRNA gene that confer a high level of resistance to clarithromycin. Subsp. massiliense strains occupying almost half of the clinical isolates can be simply identified, and their clarithromycin susceptibility can be rapidly determined. PMID:27514964

  1. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.

    OpenAIRE

    Lunkenheimer, K; Hufert, F. T.; Schmitz, H.

    1990-01-01

    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specim...

  2. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    OpenAIRE

    Diaz, R S; Sabino, E. C.

    1998-01-01

    For certain applications of the polymerase chain reaction (PCR), it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq) DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We use...

  3. Viral etiology of respiratory infections in children in southwestern Saudi Arabia using multiplex reverse-transcriptase polymerase chain reaction

    OpenAIRE

    Al-Ayed, Mohamed S.; Asaad, Ahmed M; Qureshi, Mohamed A.; Ameen, Mohammed S.

    2014-01-01

    Objectives: To investigate 15 respiratory viruses in children with acute respiratory tract infections (ARTIs) using multiplex reverse-transcriptase polymerase chain reaction (RT-PCR), and to analyze the clinical and epidemiological features of these viruses. Methods: In a cross-sectional study, 135 children, ≤5 years of age who presented with ARTIs in Najran Maternity and Children Hospital, Najran, Saudi Arabia between October 2012 and July 2013 were included. The clinical and sociodemographi...

  4. Pilot Study of COBAS PCR and Ligase Chain Reaction for Detection of Rectal Infections Due to Chlamydia trachomatis

    OpenAIRE

    Matthew R Golden; Astete, Sabina G.; Galvan, Rosa; Lucchetti, Aldo; Sanchez, Jorge; Celum, Connie L.; Whittington, William L. H.; Stamm, Walter E.; Holmes, King K.; Totten, Patricia A.

    2003-01-01

    We tested rectal specimens from men who have sex with men for Chlamydia trachomatis by using COBAS PCR (Roche Diagnostics) and ligase chain reaction LCR (Abbott laboratories) and compared three PCR specimen-processing procedures. Chlamydiae were detected by one or more procedures in 22 of 186 specimens. All three PCR tests were positive for 17 specimens, all of which also tested positive by LCR.

  5. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade

    2013-01-01

    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  6. Identifying Innovative Interventions to Promote Healthy Eating Using Consumption-Oriented Food Supply Chain Analysis

    OpenAIRE

    Hawkes, Corinna, ed.

    2009-01-01

    The mapping and analysis of supply chains is a technique increasingly used to address problems in the food system. Yet such supply chain management has not yet been applied as a means of encouraging healthier diets. Moreover, most policies recommended to promote healthy eating focus on the consumer end of the chain. This article proposes a consumption-oriented food supply chain analysis to identify the changes needed in the food supply chain to create a healthier food environment, measured in...

  7. Profit Analysis and Supply Chain Planning Model for Closed-Loop Supply Chain in Fashion Industry

    Directory of Open Access Journals (Sweden)

    Jisoo Oh

    2014-12-01

    Full Text Available In recent decades, due to market growth and use of synthetic fiber, the fashion industry faces a rapid increase of CO2 emission throughout the production cycle and raises environmental issues in recovery processing. This study proposes a closed-loop supply chain (CLSC structure in fashion industry and develops its planning model as multi-objective mixed integer linear programming to find an optimal trade-off between CLSC profit and CO2 emission. The planning model is associated with the profit analysis of each member in CLSC to find the optimal price of products on CLSC network. The model determines optimal production, transportation, and inventory quantities on CLSC network. The proposed models are validated using numerical experiments and sensitivity analyses, and from the results some managerial insights are addressed.

  8. Global Carbon Fiber Composites Supply Chain Competitiveness Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Das. Sujit; Warren, Josh; West, Devin; Schexnayder, Susan M.

    2016-05-11

    This study identifies key opportunities in the carbon fiber supply chain where the United States Department of Energy's Office of Energy Efficiency and Renewable Energy resources and investments can help the United States achieve or maintain a competitive advantage. The report focuses on four application areas--wind energy, aerospace, automotive, and pressure vessels--that top the list of industries using carbon fiber and carbon fiber reinforced polymers and are also particularly relevant to EERE's mission. For each of the four application areas, the report addresses the supply and demand trends within that sector, supply chain, and costs of carbon fiber and components, all contributing to a competitiveness assessment that addresses the United States' role in future industry growth. This report was prepared by researchers at Oak Ridge National Laboratory and the University of Tennessee for the Clean Energy Manufacturing Analysis Center.

  9. Global Carbon Fiber Composites Supply Chain Competitiveness Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Das, Sujit [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Warren, Josh [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); West, Devin [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Schexnayder, Susan M. [Univ. of Tennessee, Knoxville, TN (United States)

    2016-05-01

    This study identifies key opportunities in the carbon fiber supply chain where the United States Department of Energy's Office of Energy Efficiency and Renewable Energy resources and investments can help the United States achieve or maintain a competitive advantage. The report focuses on four application areas--wind energy, aerospace, automotive, and pressure vessels--that top the list of industries using carbon fiber and carbon fiber reinforced polymers and are also particularly relevant to EERE's mission. For each of the four application areas, the report addresses the supply and demand trends within that sector, supply chain, and costs of carbon fiber and components, all contributing to a competitiveness assessment that addresses the United States' role in future industry growth. This report was prepared by researchers at Oak Ridge National Laboratory and the University of Tennessee for the Clean Energy Manufacturing Analysis Center.

  10. Fresh fish distribution chains: An analysis of three Danish and three Australian chains

    DEFF Research Database (Denmark)

    Frederiksen, Marco Thorup; Bremner, Allan

    2001-01-01

    . Traceability is a most important issue in the high value product chains in Australia. No information technology methods, were in evidence. In the Danish chains, nearly all traceability was lost after the collector/auction stage and the only evaluation of quality parameters was by inspection.......Information on traceability was gathered for three domestic Danish fish chains typical of the current trading practices in fresh seafood and for three chains exporting products from Australia to Japan. The same standard questionnaires, coupled with personal interviews, were used in all six chains...

  11. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S

    2015-09-01

    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  12. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    Science.gov (United States)

    Thabit, Abrar K; Nicolau, David P

    2016-01-01

    Background Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated. Aim We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day), length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting. Methods Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest. Results The most common ribotypes were 027 (38%), 014/020 (21%), and 106/174 (21%). Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2). The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively). Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6). Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters), although the degree of nausea/vomiting did not differ between the three groups (P=0.3). A serum creatinine level ≥1.5 times the premorbid level was seen in only three patients, each infected with a different ribotype. Conclusion Although these data provide a baseline assessment of outcomes to aid in the design of future studies, the diversity of C. difficile ribotypes within the population must be considered, and additional work with other ribotypes

  13. [Comparison of direct microscopy, culture and polymerase chain reaction methods for the diagnosis of cutaneous leishmaniasis].

    Science.gov (United States)

    Ertabaklar, Hatice; Özlem Çalışkan, Serçin; Boduç, Erengül; Ertuğ, Sema

    2015-01-01

    Cutaneous leishmaniasis (CL) is an endemic disease especially in Southeastern Anatolia of Turkey and recently shows a trend for spread to other regions of the country including the Aegean region. The diagnosis of CL is based on combined evaluation of epidemiological data with the clinical symptoms and laboratory findings. Direct microscopic examination and culture methods are mainly used in the routine diagnosis of CL, while molecular methods are mainly used for research. The aim of this study was to detect the presence of Leishmania spp. in samples obtained from CL-suspected patients by using direct microscopy, culture and polymerase chain reaction (PCR) methods and to compare the results. A total of 55 patients who were admitted to Parasitology Laboratory of Adnan Menderes University Hospital, Aydin (located at Aegean region in Turkey), between 2012-2014 were included in the study. Smear preparations from the skin lesions of cases were fixed and stained with Giemsa, and the presence of amastigote forms were evaluated by direct microscopy. NNN medium was used for the cultivation of samples. Total genomic DNA of Leishmania from the samples were extracted with a commercial kit (NucleoSpin Tissue(®) Kit, Macherey-Nagel, Germany) and PCR was performed by using 13A and 13B primers to amplify the 116 base pair fragment of Leishmania spp. specific kinetoplast DNA. Amastigotes were observed in 29 (53%) of the 55 samples by direct microscopy, promastigotes were detected among 34 (62%) samples in culture, and parasite-specific amplicons were revealed in 30 (55%) samples by PCR. All assays were positive in 24 patients while in 18 patients all of the tests yielded negative results. Thirty-seven (67%) out of 55 cases were diagnosed as CL when reactivity in at least one of these three methods were considered as positive. Accordingly the positivity rates of the methods were 78.4% (29/37) for direct microscopy, 92% (34/37) for culture and 81.1% (30/37) for PCR in CL

  14. Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications.

    Science.gov (United States)

    Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai

    2013-11-19

    Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA

  15. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    Directory of Open Access Journals (Sweden)

    Thabit AK

    2016-06-01

    Full Text Available Abrar K Thabit,1,2 David P Nicolau1,3 1Center for Anti-Infective Research and Development, Hartford Hospital, Hartford, CT, USA; 2Faculty of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia; 3Division of Infectious Diseases, Hartford Hospital, Hartford, CT, USA Background: Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated.Aim: We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day, length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting.Methods: Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest.Results: The most common ribotypes were 027 (38%, 014/020 (21%, and 106/174 (21%. Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2. The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively. Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6. Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters, although the degree of nausea/vomiting did not differ between the three groups (P=0.3. A serum creatinine level ≥1.5 times the premorbid level was seen in only three

  16. Detection of food hazards in foods: comparison of real time polymerase chain reaction and cultural methods

    Directory of Open Access Journals (Sweden)

    Paolo Bonilauri

    2016-01-01

    Full Text Available Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples

  17. Reaction kinetic analysis of reactor surveillance data

    Energy Technology Data Exchange (ETDEWEB)

    Yoshiie, T., E-mail: yoshiie@rri.kyoto-u.ac.jp [Research Reactor Institute, Kyoto University, Kumatori-cho, Sennan-gun, Osaka-fu 590-0494 (Japan); Sato, K.; Xu, Q. [Research Reactor Institute, Kyoto University, Kumatori-cho, Sennan-gun, Osaka-fu 590-0494 (Japan); Nagai, Y. [The Oarai Center, Institute for Materials Research, Tohoku University, Oarai, Ibaraki 311-1313 (Japan)

    2015-06-01

    In reactor pressure vessel surveillance data, it was found that the concentration of matrix defects was very low even after nearly 40 years of operation, though a large number of precipitates existed. In this paper, defect structures obtained from surveillance data of A533B (high Cu concentration) were simulated using reaction kinetic analysis with 11 rate equations. The coefficients used in the equations were quite different from those obtained by fitting a Fe-0.6 wt%Cu alloy irradiated by the Kyoto University Reactor. The difference was mainly caused by alloying elements in A533B, and the effect of alloying elements was extracted. The same code was applied to low-Cu A533B irradiated with high irradiation damage rate, and the formation of voids was correctly simulated.

  18. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms.

    Science.gov (United States)

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

    2016-03-01

    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The

  19. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    Science.gov (United States)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  20. STUDY ON CO-CURING REACTION IN CHAIN PROLONGED BISMALEIMIDE-UNSATURATED POLYMER RESIN SYSTEM

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The curing process of chemical reacton between flexible unsaturated polymer resin and diphenylmethane bismaleimides which have been chain-prolonged by diaminodiphenylmethane is presented, also the kinetics parameters and curing technology are investigated.

  1. Nested polymerase chain reaction study of 53 cases with Turner`s syndrome: Is cytogenetically undetected Y mosaicism common?

    Energy Technology Data Exchange (ETDEWEB)

    Binder, G.; Koch, A.; Ranke, M.B. [Univ. Children`s Hospital, Tuebingen (Germany)

    1995-12-01

    Turner`s syndrome patients with Y mosaicism face a high risk of developing gonadoblastoma. Cytogenetic analysis can fail to detect rare cells bearing a normal or structurally abnormal Y chromosome (low level Y mosaicism). We screened 53 individuals with Turner`s syndrome for presence of sex-determining region Y (SRY), the testis-specific protein, Y encoded, gene, and the Y centromeric DYZ3 repeat using nested polymerase chain reaction (PCR). Thirty girls (57%) had the 45,X karyotype, determined through standard analysis of blood lymphocytes. The remaining 23 girls (43%) were mosaics and/or had structural abnormalities in 1 X-chromosome. Genomic DNA from blood leukocytes was amplified using 2 rounds of PCR. This method was sensitive enough to detect 0.0001% male DNA on a female background. None of 53 Turner`s syndrome cases was positive for Y-specific loci after the first round of PCR. After the second round, 2 of 53 Turner`s syndrome cases were positive for SRY mapping to the distal short arm of chromosome Y. In 1 SRY-positive subject, the karyotype was 45,X, and in the other, it was 46,Xi(Xq). None of 53 Turner`s syndrome individuals, including the 2 SRY-positive subjects, were positive for the testis-specific protein, Y encoded, gene on the proximal short arm of chromosome Y or the centromeric DYZ3 repeat. These data exclude low level Y mosaicism in almost all Turner`s syndrome cases tested. 35 refs., 3 figs., 1 tab.

  2. In vitro evaluation of five different herbal extracts as an antimicrobial endodontic irrigant using real time quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Thilla S Vinothkumar

    2013-01-01

    Full Text Available Context: Sodium hypochlorite is the most commonly used irrigant but it has disadvantage like high cytotoxicity. So there is a need to find an alternative to 5.25% Sodium hypochlorite against microorganism Enterococcus faecalis and Candida albicans. Literature has shown that these 5 extracts namely Terminalia chebula, Myristica frangrans, Aloe barbadensis, Curcuma longa and Azadaricta indica has good properties which can be used as a potential endodontic irrigant. Aims: To evaluate the antimicrobial efficacy of various herbal extracts namely Curcuma longa (CL, Azadiracta indica (AI, Aloe barbadensis (AV, Myristica fragrans (MF and Terminalia chebula (TC as endodontic irrigant against Enterococcus faecalis and Candida albicans using real-time quantitative polymerase chain reaction (qPCR. Materials and Methods: Eighty-four teeth were extracted and suspended with Enterococcus faecalis and Candida albicans. A preliminary study was first performed to determine the minimum inhibitory concentration of extracts. The irrigating groups were divided into five herbal groups and 2 control groups. After irrigating the teeth the remaining microbial load was determined using qPCR. Statistical Analysis Used: Statistical analysis was performed using Oneway Anova/Kruskal-Wallis test with post-hoc Tukey′s HSD and was statistically significant ( P < 0.05. Results: It was shown that Neem was highly efficient to 5.25% NaOCl in reducing Enterococcus faecalis and Candida albicans within the root canals when compared with other extracts. Conclusions: Neem leaf extract has a significant antimicrobial efficacy against Enterococcus faecalis and Candida albicans compared to 5.25% sodium hypochlorite.

  3. Structural analysis of the carbohydrate chains of glycoproteins by 500-MHz 1H-NMR spectroscopy

    International Nuclear Information System (INIS)

    This thesis deals with the structural analysis by 500-MHz 1H-NMR spectroscopy of carbohydrate chains obtained from glycoproteins. In the chapters 1 to 6 the structural analysis of N-glycosidically linked carbohydrate chains is described. The chapters 7 to 10 describe the structural analysis of O-glycosidically linked carbohydrate chains. 381 refs.; 44 figs.; 24 tabs.; 7 schemes

  4. Analysis of environmental and economic aspects of international pellet supply chains

    Energy Technology Data Exchange (ETDEWEB)

    Ehrig, Rita

    2014-01-17

    Biomass plays a key role to achieve the EU's 20-20-20 energy and climate targets. Because of rising European demand and limited domestic resources, the EU relies on worldwide imports. Given this framework, the present thesis explores the influences on wood pellet supply chains considering different environmental policies, price risks and the effect of torrefaction pretreatment. The examinations refer to three real case studies for pellet trade from Australia, Canada, and Russia to Europe. In the first investigation, the efficiency of co-firing imported wood pellets in terms of CO{sub 2} savings and related subsidy schemes is analysed. Scenarios show that co-firing biomass is efficient to contribute to the EU energy targets. Though, policy makers could use these instruments more effective when directing sourcing decision towards options with even less environmental impacts. The second analysis explores the influence of statistically derived price risks on total supply chain economics. It is shown that price risks can effect strong fluctuations in the short term, which seriously affect the profitability of individual trade routes. Securing the supply chain is mainly based on individual producer-buyer agreements, personal branch experiences and fast reactions on the subsidy system. Systematic evaluation of supply chains could contribute to a more reliable market and thus foster investment decisions. In the last investigation, the economic and environmental performance of potential torrefaction-based supply chains is assessed. As a result, torrefaction-based supply chains turn out to be a certain alternative to conventional ones. Though, still huge research efforts and industrial demonstration are required to make torrefied biomass a real alternative on the market.

  5. A LCA Based Biofuel Supply Chain Analysis Framework

    Institute of Scientific and Technical Information of China (English)

    刘喆轩; 邱彤; 陈丙珍

    2014-01-01

    This paper presents a life cycle assessment (LCA) based biofuel supply chain (SC) analysis framework which enables the study of economic, energy and environmental (3E) performances by using multi-objective opti-mization. The economic objective is measured by the total annual profit, the energy objective is measured by the average fossil energy (FE) inputs per MJ biofuel and the environmental objective is measured by greenhouse gas (GHG) emissions per MJ biofuel. A multi-objective linear fractional programming (MOLFP) model with multi-conversion pathways is formulated based on the framework and is solved by using theε-constraint method. The MOLFP prob-lem is turned into a mixed integer linear programming (MILP) problem by setting up the total annual profit as the optimization objective and the average FE inputs per MJ biofuel and GHG emissions per MJ biofuel as constraints. In the case study, this model is used to design an experimental biofuel supply chain in China. A set of the weekly Pareto optimal solutions is obtained. Each non-inferior solution indicates the optimal locations and the amount of biomass produced, locations and capacities of conversion factories, locations and amount of biofuel being supplied in final markets and the flow of mass through the supply chain network (SCN). As the model reveals trade-offs among 3E criteria, we think the framework can be a good support tool of decision for the design of biofuel SC.

  6. Decomposition of ozone in water in the presence of organic solutes acting as promoters and inhibitors of radical chain reactions

    Energy Technology Data Exchange (ETDEWEB)

    Staehelin, J.; Hoigne, J.

    1985-12-01

    The decomposition of aqueous ozone is generally due to a chain reaction involving .OH radicals. Many organic solutes (impurities) can react with .OH to yield .O/sub 2//sup -/ upon addition of O/sub 2/. .O/sub 2//sup -/ transfers its electron to a further ozone molecule in a rather selective reaction. The ozonide anion (.O/sub 3//sup -/) formed immediately decomposes into a further .OH radical. Compounds that convert .OH radicals into ozone-selective .O/sub 2//sup -/, therefore, act as promoters of the chain reaction. The efficiencies of different .OH to .O/sub 2//sup -/ converters (e.g., formic acid, primary and secondary alcohols (including sugars), glyoxylic acid, and humic acids) are tested in the presence of other .OH radical scavengers that do not primarily produce .O/sub 2//sup -/ (carbonate, aliphatic alkyl compounds, and tert-butyl alcohol). The derived reaction kinetics allows one to qualitatively interpret the variation of the lifetime of O/sub 3/ found in model solutions and even in natural waters and during drinking water treatment.

  7. Stiffness Analysis Of Multi-Chain Parallel Robotic Systems

    CERN Document Server

    Pashkevich, Anatoly; Chablat, Damien; Wenger, Philippe

    2009-01-01

    The paper presents a new stiffness modelling method for multi-chain parallel robotic manipulators with flexible links and compliant actuating joints. In contrast to other works, the method involves a FEA-based link stiffness evaluation and employs a new solution strategy of the kinetostatic equations, which allows computing the stiffness matrix for singular postures and to take into account influence of the external forces. The advantages of the developed technique are confirmed by application examples, which deal with stiffness analysis of a parallel manipulator of the Orthoglide family

  8. Stiffness Analysis Of Multi-Chain Parallel Robotic Systems

    CERN Document Server

    Pashkevich, Anatoly; Wenger, Philippe

    2008-01-01

    The paper presents a new stiffness modelling method for multi-chain parallel robotic manipulators with flexible links and compliant actuating joints. In contrast to other works, the method involves a FEA-based link stiffness evaluation and employs a new solution strategy of the kinetostatic equations, which allows computing the stiffness matrix for singular postures and to take into account influence of the internal forces. The advantages of the developed technique are confirmed by application examples, which deal with stiffness analysis of the Orthoglide manipulator.

  9. Evaluating Investments For Services: A Value Chain Analysis Framework

    Directory of Open Access Journals (Sweden)

    Narcyz Roztocki

    2011-05-01

    Full Text Available This paper presents a framework based on value chain analysis to evaluate investments for services. The rationale for this approach is that to properly evaluate the benefits of any services investments, the value and cost interactions resulting from different business processes or activities need to be considered. To achieve reliable cost estimations, the framework employs a costing system, which integrates activity-based costing with the economic value added performance measure. The proposed framework is illustrated using a hypothetical case of an information technology investment in a car repair shop.

  10. Analysis of dynein intermediate chains, light intermediate chains and light chains in a cohort of hereditary peripheral neuropathies.

    Science.gov (United States)

    Tey, Shelisa; Ahmad-Annuar, Azlina; Drew, Alexander P; Shahrizaila, Nortina; Nicholson, Garth A; Kennerson, Marina L

    2014-10-01

    The cytoplasmic dynein heavy chain (DYNC1H1) gene has been increasingly associated with neurodegenerative disorders including axonal Charcot-Marie-Tooth disease (CMT2), intellectual disability and malformations of cortical development. In addition, evidence from mouse models (Loa, catabolite repressor-activator (Cra) and Sprawling (Swl)) has shown that mutations in Dync1h1 cause a range of neurodegenerative phenotypes with motor and sensory neuron involvement. In this current study, we examined the possible contribution of other cytoplasmic dynein subunits that bind to DYNC1H1 as a cause of inherited peripheral neuropathy. We focused on screening the cytoplasmic dynein intermediate, light intermediate and light chain genes in a cohort of families with inherited peripheral neuropathies. Nine genes were screened and ten variants were detected, but none was identified as pathogenic, indicating that cytoplasmic dynein intermediate, light intermediate and light chains are not a cause of neuropathy in our cohort.

  11. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms.

    Science.gov (United States)

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

    2016-03-01

    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The

  12. Reaction path analysis of sodium-water chemical reaction field using laser diagnostics

    International Nuclear Information System (INIS)

    In a sodium-cooled fast reactor (SFR), liquid sodium is used as a heat transfer fluid because of its excellent heat transport capability. On the other hand, it has strong chemical reactivity with water vapor. One of the design basis accidents of the SFR is the water leakage into the liquid sodium flow by a breach of heat transfer tubes. Therefore, the study on sodium-water chemical reactions is of importance for security reasons. This study aims to clarify the gas phase sodium-water reaction path and reaction products. Na, Na2, H2O, and reaction products in the counter-flow sodium-water reaction field were measured using laser diagnostics such as Raman scattering and photo-fragmentation. The main product in the sodium-water reaction was determined to be NaOH and its reaction path was discussed using Na-H2O elementally reaction analysis. (author)

  13. The CMS analysis chain in a distributed environment

    International Nuclear Information System (INIS)

    The CMS collaboration is undertaking a big effort to define the analysis model and to develop software tools with the purpose of analysing several millions of simulated and real data events by a large number of people in many geographically distributed sites. From the computing point of view, one of the most complex issues when doing remote analysis is the data discovery and access. Some software tools were developed in order to move data, make them available to the full international community and validate them for the subsequent analysis. The batch analysis processing is performed with workload management tools developed on purpose, which are mainly responsible for the job preparation and the job submission. The job monitoring and the output management are implemented as the last part of the analysis chain. Grid tools provided by the LCG project are evaluated to gain access to the data and the resources by providing a user friendly interface to the physicists submitting the analysis jobs. An overview of the current implementation and of the interactions between the previous components of the CMS analysis system is presented in this work

  14. Rapid detection of clarithromycin resistant Helicobacter pylori strains in Spanish patients by polymerase chain reaction-restriction fragment length polymorphism

    Science.gov (United States)

    Agudo, Sonia; Pérez-Pérez, Guillermo; Alarcón, Teresa; López-Brea, Manuel

    2014-01-01

    Introduction The aim of this study was to characterize the mutations types present in the 23S rRNA gene related to H. pylori clarithromycin-resistance strains in Spain and evaluate a novel PCR-RFLP method for detection of the most frequent point mutation in our population. Methods Gastric biopsies were obtained by endoscopy from patients with gastric symptoms. H. pylori was cultured according to standard microbiological procedures and clarithromycin resistance was determined by E-test. DNA extraction was performed by NucliSens platform with the NucliSens magnetic extraction reagents (bioMérieux) according to the manufacturer instructions. Analyses for point mutations in 23S rRNA gene strains were performed by sequence analysis of amplified polymerase chain reaction products. Restriction fragment length polymorphism was performed using BsaI enzyme to detect restriction sites that correspond to the mutation (A2143G). Result We found 42 out of 118 (35.6%) strains resistant to clarithromycin by E-test. E-test results were confirmed for the presence of point mutation in 34 (88.1%) of these strains. Mutation A2143G was found in 85.3% of the strains. Analyses with the restriction enzyme BsaI was able to confirm the presence of A2143G mutation. There were 8 H. pylori strains resistant to clarithromycin by E-test but without any point mutation in the 23 rRNA gene. Conclusion We conclude that PCR-RFLP is a reliable method to detect clarithromycin-resistance H. pylori strains in countries with a high prevalence of clarithromycin-resistance as Spain It may be useful before choosing regimens of H. pylori eradication. PMID:21412667

  15. Influence of Pichia pastoris cellular material on polymerase chain reaction performance as a synthetic biology standard for genome monitoring.

    Science.gov (United States)

    Templar, Alexander; Woodhouse, Stefan; Keshavarz-Moore, Eli; Nesbeth, Darren N

    2016-08-01

    Advances in synthetic genomics are now well underway in yeasts due to the low cost of synthetic DNA. These new capabilities also bring greater need for quantitating the presence, loss and rearrangement of loci within synthetic yeast genomes. Methods for achieving this will ideally; i) be robust to industrial settings, ii) adhere to a global standard and iii) be sufficiently rapid to enable at-line monitoring during cell growth. The methylotrophic yeast Pichia pastoris (P. pastoris) is increasingly used for industrial production of biotherapeutic proteins so we sought to answer the following questions for this particular yeast species. Is time-consuming DNA purification necessary to obtain accurate end-point polymerase chain reaction (e-pPCR) and quantitative PCR (qPCR) data? Can the novel linear regression of efficiency qPCR method (LRE qPCR), which has properties desirable in a synthetic biology standard, match the accuracy of conventional qPCR? Does cell cultivation scale influence PCR performance? To answer these questions we performed e-pPCR and qPCR in the presence and absence of cellular material disrupted by a mild 30s sonication procedure. The e-pPCR limit of detection (LOD) for a genomic target locus was 50pg (4.91×10(3) copies) of purified genomic DNA (gDNA) but the presence of cellular material reduced this sensitivity sixfold to 300pg gDNA (2.95×10(4) copies). LRE qPCR matched the accuracy of a conventional standard curve qPCR method. The presence of material from bioreactor cultivation of up to OD600=80 did not significantly compromise the accuracy of LRE qPCR. We conclude that a simple and rapid cell disruption step is sufficient to render P. pastoris samples of up to OD600=80 amenable to analysis using LRE qPCR which we propose as a synthetic biology standard. PMID:27211507

  16. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    Directory of Open Access Journals (Sweden)

    Mahmood Shishegar

    2011-12-01

    Full Text Available Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2% of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%. Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensi-tivity profile in our geographic area.

  17. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    Science.gov (United States)

    Shishegar, Mahmood; Faramarzi, Abolhasan; Kazemi, Tayyebe; Bayat, Akbar; Motamedifar, Mohammad

    2011-01-01

    Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR) assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2%) of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%). Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensitivity profile in our geographic area. PMID:23115412

  18. Quantitative Detection of Interleukin 8 Gene Expression in Lung Cancer by Real-time Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    JianzhongSu; QianggangDong; JinsuHuang; GuoliangBao

    2004-01-01

    OBJECTIVE To develop a method for absolute quantification of interleukin 8 (IL-8) mRNA by using real-time polymerase chain reaction (PCR). METHODS The IL-8 mRNA and protein expression in 2 human lung cancer cell lines, H460 and A549, were evaluated by real-time PCR and ELISA. The IL-8 mRNA expression in 9 cases of normal lung tissue and 44 cases of non-small cell lung cancer (NSCLC) were examined. RESULTS The IL-8 mRNA copy number in a given sample can be measured by real-time PCR. The gene expression of IL-8 is correlated with its protein secretion. The normalized value of IL-8 expression was 4.87+1.69 (copies/104 GAPDH copies) in normal lung tissue and 17.04±23.96 in NSCLC, respectively. The difference between these two groups is statistically significant (P=0.002). Using 9.74 and 19.48 as cut-off points for positive expression and overexpression of IL-8, 52.3%(23/44cases) of NSCLC were found to express an increased level of IL-8, among which 29.5% (13/44cases) were defined as positive expression and 22.7% (10/44cases) as overexpression. Statistical analysis indicated that IL-8 overexpression was significantly increased in female cancers, squamous carcinoma, and in late stages of disease (P<0.05). CONCLUSION The IL-8 gene expression can be determined by a real-time PCR technique. IL-8 overexpression is correlated with gender, histopathology and stages of the disease.

  19. Multiplex time-reducing quantitative polymerase chain reaction assay for determination of telomere length in blood and tissue DNA.

    Science.gov (United States)

    Jiao, Jingjing; Kang, Jing X; Tan, Rui; Wang, Jingdong; Zhang, Yu

    2012-04-01

    In this paper we describe a multiplex time-reducing quantitative polymerase chain reaction (qPCR) method for determination of telomere length. This multiplex qPCR assay enables two pairs of primers to simultaneously amplify telomere and single copy gene (albumin) templates, thus reducing analysis time and labor compared with the previously established singleplex assay. The chemical composition of the master mix and primers for the telomere and albumin were systematically optimized. The thermal cycling program was designed to ensure complete separation of the melting processes of the telomere and albumin. Semi-log standard curves of DNA concentration versus cycle threshold (C (t)) were established, with a linear relationship over an 81-fold DNA concentration range. The well-performed intra-assay (RSD range 2.4-4.7%) and inter-assay (RSD range: 3.1-5.0%) reproducibility were demonstrated to ensure measurement stability. Using wild-type, Lewis lung carcinoma and H22 liver carcinoma C57BL/6 mouse models, significantly different telomere lengths among different DNA samples were not observed in wild-type mice. However, the relative telomere lengths of the tumor DNA in the two strains of tumor-bearing mice were significantly shorter than the lengths in the surrounding non-tumor DNA of tumor-bearing mice and the tissue DNA of wild-type mice. These results suggest that the shortening of telomere lengths may be regarded as an important indicator for cancer control and prevention. Quantification of telomere lengths was further confirmed by the traditional Southern blotting method. This method could be successfully used to reduce the time needed for rapid, precise measurement of telomere lengths in biological samples.

  20. A Theoretical Investigation on the Reaction Mechanism of the C9H+ 12·Side-chain Decomposition

    Institute of Scientific and Technical Information of China (English)

    CHENG,Xueli; ZHAO,Yanyun; LI,Feng; ZHANG,Dongsheng

    2009-01-01

    n-Phenylpropane cation C9H+·12 serves as a prototype to investigate the reaction mechanisms of alkylbenzene cations.The decomposition reactions of C9H+·12 system have been studied extensively at the B3LYP/6-311 + + G**level with Gaussian 98 program package.All reaction channels were fully investigated with the vibrational mode analysis to confirm the transition states and with electron population analysis to discuss the electron redistribution,and to elucidate the reaction mechanism.The reaction mechanism shows that there is a non-barrier channel of C9H+·12→C7H+7+C2H·5,which is thermodynamically most favorable.