Single Chain Variable Fragments Produced in Escherichia coli against Heat-Labile and Heat-Stable Toxins from Enterotoxigenic E. coli.

Directory of Open Access Journals (Sweden)

Christiane Y Ozaki

Full Text Available Diarrhea is a prevalent pathological condition frequently associated to the colonization of the small intestine by enterotoxigenic Escherichia coli (ETEC strains, known to be endemic in developing countries. These strains can produce two enterotoxins associated with the manifestation of clinical symptoms that can be used to detect these pathogens. Although several detection tests have been developed, minimally equipped laboratories are still in need of simple and cost-effective methods. With the aim to contribute to the development of such diagnostic approaches, we describe here two mouse hybridoma-derived single chain fragment variable (scFv that were produced in E. coli against enterotoxins of ETEC strains.Recombinant scFv were developed against ETEC heat-labile toxin (LT and heat-stable toxin (ST, from previously isolated hybridoma clones. This work reports their design, construction, molecular and functional characterization against LT and ST toxins. Both antibody fragments were able to recognize the cell-interacting toxins by immunofluorescence, the purified toxins by ELISA and also LT-, ST- and LT/ST-producing ETEC strains.The developed recombinant scFvs against LT and ST constitute promising starting point for simple and cost-effective ETEC diagnosis.

Secretion of an immunoreactive single-chain variable fragment antibody against mouse interleukin 6 by Lactococcus lactis.

Science.gov (United States)

Shigemori, Suguru; Ihara, Masaki; Sato, Takashi; Yamamoto, Yoshinari; Nigar, Shireen; Ogita, Tasuku; Shimosato, Takeshi

2017-01-01

Interleukin 6 (IL-6) is an important pathogenic factor in development of various inflammatory and autoimmune diseases and cancer. Blocking antibodies against molecules associated with IL-6/IL-6 receptor signaling are an attractive candidate for the prevention or therapy of these diseases. In this study, we developed a genetically modified strain of Lactococcus lactis secreting a single-chain variable fragment antibody against mouse IL-6 (IL6scFv). An IL6scFv-secretion vector was constructed by cloning an IL6scFv gene fragment into a lactococcal secretion plasmid and was electroporated into L. lactis NZ9000 (NZ-IL6scFv). Secretion of recombinant IL6scFv (rIL6scFv) by nisin-induced NZ-IL6scFv was confirmed by western blotting and was optimized by tuning culture conditions. We found that rIL6scFv could bind to commercial recombinant mouse IL-6. This result clearly demonstrated the immunoreactivity of rIL6scFv. This is the first study to engineer a genetically modified strain of lactic acid bacteria (gmLAB) that produces a functional anti-cytokine scFv. Numerous previous studies suggested that mucosal delivery of biomedical proteins using gmLAB is an effective and low-cost way to treat various disorders. Therefore, NZ-IL6scFv may be an attractive tool for the research and development of new IL-6 targeting agents for various inflammatory and autoimmune diseases as well as for cancer.

High production of llama variable heavy-chain antibody fragment (VHH) fused to various reader proteins by Aspergillus oryzae.

Science.gov (United States)

Hisada, Hiromoto; Tsutsumi, Hiroko; Ishida, Hiroki; Hata, Yoji

2013-01-01

Llama variable heavy-chain antibody fragment (VHH) fused to four different reader proteins was produced and secreted in culture medium by Aspergillus oryzae. These fusion proteins consisted of N-terminal reader proteins, VHH, and a C-terminal his-tag sequence which facilitated purification using one-step his-tag affinity chromatography. SDS-PAGE analysis of the deglycosylated purified fusion proteins confirmed that the molecular weight of each corresponded to the expected sum of VHH and the respective reader proteins. The apparent high molecular weight reader protein glucoamylase (GlaB) was found to be suitable for efficient VHH production. The GlaB-VHH-His protein bound its antigen, human chorionic gonadotropin, and was detectable by a new ELISA-based method using a coupled assay with glucoamylase, glucose oxidase, peroxidase, maltose, and 3,3',5,5'-tetramethylbenzidine as substrates. Addition of potassium phosphate to the culture medium induced secretion of 0.61 mg GlaB-VHH-His protein/ml culture medium in 5 days.

Olefin copolymerization via reversible addition-fragmentation chain transfer

NARCIS (Netherlands)

Venkatesh, R.; Staal, B.B.P.; Klumperman, B.

2004-01-01

Successful statistical copolymn. of an a-olefin (1-octene) with an acrylate (Bu acrylate, BA) and with a methacrylate (Me methacrylate, MMA), employing reversible addn.-fragmentation chain transfer (RAFT) mediated polymn. has been accomplished

Isolation and characterization of anti c-met single chain fragment variable (scFv) antibodies.

Science.gov (United States)

Qamsari, Elmira Safaie; Sharifzadeh, Zahra; Bagheri, Salman; Riazi-Rad, Farhad; Younesi, Vahid; Abolhassani, Mohsen; Ghaderi, Sepideh Safaei; Baradaran, Behzad; Somi, Mohammad Hossein; Yousefi, Mehdi

2017-12-01

The receptor tyrosine kinase (RTK) Met is the cell surface receptor for hepatocyte growth factor (HGF) involved in invasive growth programs during embryogenesis and tumorgenesis. There is compelling evidence suggesting important roles for c-Met in colorectal cancer proliferation, migration, invasion, angiogenesis, and survival. Hence, a molecular inhibitor of an extracellular domain of c-Met receptor that blocks c-Met-cell surface interactions could be of great thera-peutic importance. In an attempt to develop molecular inhibitors of c-Met, single chain variable fragment (scFv) phage display libraries Tomlinson I + J against a specific synthetic oligopeptide from the extracellular domain of c-Met receptor were screened; selected scFv were then characterized using various immune techniques. Three c-Met specific scFv (ES1, ES2, and ES3) were selected following five rounds of panning procedures. The scFv showed specific binding to c-Met receptor, and significantly inhibited proliferation responses of a human colorectal carcinoma cell line (HCT-116). Moreover, anti- apoptotic effects of selected scFv antibodies on the HCT-116 cell line were also evaluated using Annexin V/PI assays. The results demonstrated rates of apoptotic cell death of 46.0, 25.5, and 37.8% among these cells were induced by use of ES1, ES2, and ES3, respectively. The results demonstrated ability to successfully isolate/char-acterize specific c-Met scFv that could ultimately have a great therapeutic potential in immuno-therapies against (colorectal) cancers.

Automated main-chain model building by template matching and iterative fragment extension

International Nuclear Information System (INIS)

Terwilliger, Thomas C.

2003-01-01

A method for automated macromolecular main-chain model building is described. An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and β-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and β-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C α positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 Å. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition

Screening for single-chain variable fragment antibodies against multiple Cry1 toxins from an immunized mouse phage display antibody library.

Science.gov (United States)

Dong, Sa; Bo, Zongyi; Zhang, Cunzheng; Feng, Jianguo; Liu, Xianjin

2018-04-01

Single-chain variable fragment (scFv) is a kind of antibody that possess only one chain of the complete antibody while maintaining the antigen-specific binding abilities and can be expressed in prokaryotic system. In this study, scFvs against Cry1 toxins were screened out from an immunized mouse phage displayed antibody library, which was successfully constructed with capacity of 6.25 × 10 7  CFU/mL. Using the mixed and alternative antigen coating strategy and after four rounds of affinity screening, seven positive phage-scFvs against Cry1 toxins were selected and characterized. Among them, clone scFv-3H9 (MG214869) showing relative stable and high binding abilities to six Cry1 toxins was selected for expression and purification. SDS-PAGE indicated that the scFv-3H9 fragments approximately 27 kDa were successfully expressed in Escherichia coli HB2151 strain. The purified scFv-3H9 was used to establish the double antibody sandwich enzyme-linked immunosorbent assay method (DAS-ELISA) for detecting six Cry1 toxins, of which the lowest detectable limits (LOD) and the lowest quantitative limits (LOQ) were 3.14-11.07 and 8.22-39.44 ng mL -1 , respectively, with the correlation coefficient higher than 0.997. The average recoveries of Cry1 toxins from spiked rice leaf samples were ranged from 84 to 95%, with coefficient of variation (CV) less than 8.2%, showing good accuracy for the multi-residue determination of six Cry1 toxins in agricultural samples. This research suggested that the constructed phage display antibody library based on the animal which was immunized with the mixture of several antigens under the same category can be used for the quick and effective screening of generic antibodies.

Automated main-chain model building by template matching and iterative fragment extension.

Science.gov (United States)

Terwilliger, Thomas C

2003-01-01

An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and beta-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and beta-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C(alpha) positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 A. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition.

A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth

Energy Technology Data Exchange (ETDEWEB)

Zhao, Shuli [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Nanjing Affiliated First Hospital, Nanjing Medical University, Nanjing (China); Zhao, Guangfeng; Xie, Hao; Huang, Yahong [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Hou, Yayi [Immunology and Reproductive Biology Laboratory, Medical School & State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing (China)

2012-01-27

Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex){sub 1.3}(DOX){sub 20}. In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers.

A conjugate of an anti-midkine single-chain variable fragment to doxorubicin inhibits tumor growth

International Nuclear Information System (INIS)

Zhao, Shuli; Zhao, Guangfeng; Xie, Hao; Huang, Yahong; Hou, Yayi

2012-01-01

Doxorubicin (DOX) was conjugated to a single-chain variable fragment (scFv) against human midkine (MK), and the conjugate (scFv-DOX) was used to target the chemotherapeutic agent to a mouse solid tumor model in which the tumor cells expressed high levels of human MK. The His-tagged recombinant scFv was expressed in bacteria, purified by metal affinity chromatography, and then conjugated to DOX using oxidative dextran (Dex) as a linker. The molecular formula of this immunoconjugate was scFv(Dex) 1.3 (DOX) 20 . In vitro apoptosis assays showed that the scFv-DOX conjugate was more cytotoxic against MK-transfected human adenocarcinoma cells (BGC823-MK) than untransfected cells (55.3 ± 2.4 vs 22.4 ± 3.8%) for three independent experiments. Nude mice bearing BGC823-MK solid tumors received scFv-DOX or equivalent doses of scFv + DOX for 2 weeks and tumor growth was more effectively inhibited by the scFv-DOX conjugate than by scFv + DOX (51.83% inhibition vs 40.81%). Histological analysis of the tumor tissues revealed that the highest levels of DOX accumulated in tumors from mice treated with scFv-DOX and this resulted in more extensive tumor cell death than in animals treated with the equivalent dose of scFv + DOX. These results show that the scFv-DOX conjugate effectively inhibited tumor growth in vivo and suggest that antigen-specific scFv may be competent drug-carriers

Single chain variable fragment antibodies block aggregation and toxicity induced by familial ALS-linked mutant forms of SOD1.

Science.gov (United States)

Ghadge, Ghanashyam D; Pavlovic, John D; Koduvayur, Sujatha P; Kay, Brian K; Roos, Raymond P

2013-08-01

Approximately 10% of amyotrophic lateral sclerosis (ALS) cases are familial (known as FALS) with an autosomal dominant inheritance pattern, and ~25% of FALS cases are caused by mutations in Cu/Zn superoxide dismutase (SOD1). There is convincing evidence that mutant SOD1 (mtSOD1) kills motor neurons (MNs) because of a gain-of-function toxicity, most likely related to aggregation of mtSOD1. A number of recent reports have suggested that antibodies can be used to treat mtSOD1-induced FALS. To follow up on the use of antibodies as potential therapeutics, we generated single chain fragments of variable region antibodies (scFvs) against SOD1, and then expressed them as 'intrabodies' within a motor neuron cell line. In the present study, we describe isolation of human scFvs that interfere with mtSOD1 in vitro aggregation and toxicity. These scFvs may have therapeutic potential in sporadic ALS, as well as FALS, given that sporadic ALS may also involve abnormalities in the SOD1 protein or activity. Copyright © 2013 Elsevier Inc. All rights reserved.

Improved production and function of llama heavy chain antibody fragments by molecular evolution

NARCIS (Netherlands)

Linden, van der R.H.; Geus, de B.; Frenken, G.J.; Peters, H.; Verrips, C.T.

2000-01-01

The aim of this study was to improve production level of llama heavy chain antibody fragments (V (HH)) in Saccharomyces cerevisiae while retaining functional characteristics. For this purpose, the DNA shuffling technique was used on llama V (HH) fragments specific for the azo-dye reactive red-6. In

Does tropical forest fragmentation increase long-term variability of butterfly communities?

Directory of Open Access Journals (Sweden)

Allison K Leidner

2010-03-01

Full Text Available Habitat fragmentation is a major driver of biodiversity loss. Yet, the overall effects of fragmentation on biodiversity may be obscured by differences in responses among species. These opposing responses to fragmentation may be manifest in higher variability in species richness and abundance (termed hyperdynamism, and in predictable changes in community composition. We tested whether forest fragmentation causes long-term hyperdynamism in butterfly communities, a taxon that naturally displays large variations in species richness and community composition. Using a dataset from an experimentally fragmented landscape in the central Amazon that spanned 11 years, we evaluated the effect of fragmentation on changes in species richness and community composition through time. Overall, adjusted species richness (adjusted for survey duration did not differ between fragmented forest and intact forest. However, spatial and temporal variation of adjusted species richness was significantly higher in fragmented forests relative to intact forest. This variation was associated with changes in butterfly community composition, specifically lower proportions of understory shade species and higher proportions of edge species in fragmented forest. Analysis of rarefied species richness, estimated using indices of butterfly abundance, showed no differences between fragmented and intact forest plots in spatial or temporal variation. These results do not contradict the results from adjusted species richness, but rather suggest that higher variability in butterfly adjusted species richness may be explained by changes in butterfly abundance. Combined, these results indicate that butterfly communities in fragmented tropical forests are more variable than in intact forest, and that the natural variability of butterflies was not a buffer against the effects of fragmentation on community dynamics.

Does Tropical Forest Fragmentation Increase Long-Term Variability of Butterfly Communities?

Science.gov (United States)

Leidner, Allison K.; Haddad, Nick M.; Lovejoy, Thomas E.

2010-01-01

Habitat fragmentation is a major driver of biodiversity loss. Yet, the overall effects of fragmentation on biodiversity may be obscured by differences in responses among species. These opposing responses to fragmentation may be manifest in higher variability in species richness and abundance (termed hyperdynamism), and in predictable changes in community composition. We tested whether forest fragmentation causes long-term hyperdynamism in butterfly communities, a taxon that naturally displays large variations in species richness and community composition. Using a dataset from an experimentally fragmented landscape in the central Amazon that spanned 11 years, we evaluated the effect of fragmentation on changes in species richness and community composition through time. Overall, adjusted species richness (adjusted for survey duration) did not differ between fragmented forest and intact forest. However, spatial and temporal variation of adjusted species richness was significantly higher in fragmented forests relative to intact forest. This variation was associated with changes in butterfly community composition, specifically lower proportions of understory shade species and higher proportions of edge species in fragmented forest. Analysis of rarefied species richness, estimated using indices of butterfly abundance, showed no differences between fragmented and intact forest plots in spatial or temporal variation. These results do not contradict the results from adjusted species richness, but rather suggest that higher variability in butterfly adjusted species richness may be explained by changes in butterfly abundance. Combined, these results indicate that butterfly communities in fragmented tropical forests are more variable than in intact forest, and that the natural variability of butterflies was not a buffer against the effects of fragmentation on community dynamics. PMID:20224772

Optimization of the crystallizability of a single-chain antibody fragment

Czech Academy of Sciences Publication Activity Database

Škerlová, Jana; Král, Vlastimil; Fábry, Milan; Sedláček, Juraj; Veverka, Václav; Řezáčová, Pavlína

2014-01-01

Roč. 70, č. 12 (2014), s. 1701-1706 ISSN 1744-3091 R&D Projects: GA MŠk(CZ) LK11205 Institutional support: RVO:61388963 ; RVO:68378050 Keywords : single-chain antibody fragment * Thermofluor assay * differential scanning fluorimetry * crystallizability optimization * oligomerization * crystallization Subject RIV: CE - Biochemistry Impact factor: 0.527, year: 2014

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Development of an Indirect Competitive Enzyme-Linked Immunosorbent Assay for Glycocholic Acid Based on Chicken Single-Chain Variable Fragment Antibodies.

Science.gov (United States)

Cui, Xiping; Vasylieva, Natalia; Wu, Panpan; Barnych, Bogdan; Yang, Jun; Shen, Ding; He, Qiyi; Gee, Shirley J; Zhao, Suqing; Hammock, Bruce D

2017-10-17

Glycocholic acid (GCA) is an important metabolite of bile acids, whose urine levels are expected to be a specific diagnostic biomarker for hepatocellular carcinoma (HCC). A high-throughput immunoassay for determination of GCA would be of significant advantage and useful for primary diagnosis, surveillance, and early detection of HCC. Single-chain variable fragment (scFv) antibodies have several desirable characteristics and are an attractive alternative to traditional antibodies for the immunoassay. Because chicken antibodies possess single heavy and light variable functional domains, they are an ideal framework for simplified generation of recombinant antibodies for GCA detection. However, chicken scFvs have rarely been used to detect GCA. In this study, a scFv library was generated from chickens immunized with a GCA hapten coupled to bovine serum albumin (BSA), and anti-GCA scFvs were isolated by a phage-displayed method. Compared to the homologous coating antigen, use of a heterologous coating antigen resulted in about an 85-fold improvement in sensitivity of the immunoassay. This assay, under optimized conditions, had a linear range of 0.02-0.18 μg/mL, with an IC 50 of 0.06 μg/mL. The assay showed negligible cross-reactivity with various related bile acids, except for taurocholic acid. The detection of GCA from spiked human urine samples ranged from 86.7% to 123.3%. These results, combined with the advantages of scFv antibodies, indicated that a chicken scFv-based enzyme-linked immunosorbent assay is a suitable method for high-throughput screening of GCA in human urine.

Neutralisation and binding of VHS virus by monovalent antibody fragments

DEFF Research Database (Denmark)

Cupit, P.M.; Lorenzen, Niels; Strachan, G.

2001-01-01

We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...

A single-chain variable fragment intrabody prevents intracellular polymerization of Z α1-antitrypsin while allowing its antiproteinase activity.

Science.gov (United States)

Ordóñez, Adriana; Pérez, Juan; Tan, Lu; Dickens, Jennifer A; Motamedi-Shad, Neda; Irving, James A; Haq, Imran; Ekeowa, Ugo; Marciniak, Stefan J; Miranda, Elena; Lomas, David A

2015-06-01

Mutant Z α1-antitrypsin (E342K) accumulates as polymers within the endoplasmic reticulum (ER) of hepatocytes predisposing to liver disease, whereas low levels of circulating Z α1-antitrypsin lead to emphysema by loss of inhibition of neutrophil elastase. The ideal therapy should prevent polymer formation while preserving inhibitory activity. Here we used mAb technology to identify interactors with Z α1-antitrypsin that comply with both requirements. We report the generation of an mAb (4B12) that blocked α1-antitrypsin polymerization in vitro at a 1:1 molar ratio, causing a small increase of the stoichiometry of inhibition for neutrophil elastase. A single-chain variable fragment (scFv) intrabody was generated based on the sequence of mAb4B12. The expression of scFv4B12 within the ER (scFv4B12KDEL) and along the secretory pathway (scFv4B12) reduced the intracellular polymerization of Z α1-antitrypsin by 60%. The scFv4B12 intrabody also increased the secretion of Z α1-antitrypsin that retained inhibitory activity against neutrophil elastase. MAb4B12 recognized a discontinuous epitope probably located in the region of helices A/C/G/H/I and seems to act by altering protein dynamics rather than binding preferentially to the native state. This novel approach could reveal new target sites for small-molecule intervention that may block the transition to aberrant polymers without compromising the inhibitory activity of Z α1-antitrypsin. © FASEB.

Characterization of a single-chain variable fragment recognizing a linear epitope of aβ: a biotechnical tool for studies on Alzheimer's disease?

Directory of Open Access Journals (Sweden)

Silke Dornieden

Full Text Available Alzheimer's disease (AD is a progressive neurodegenerative disorder with devastating effects. Currently, therapeutic options are limited to symptomatic treatment. For more than a decade, research focused on immunotherapy for the causal treatment of AD. However, clinical trials with active immunization using Aβ encountered severe complications, for example meningoencephalitis. Consequently, attention focused on passive immunization using antibodies. As an alternative to large immunoglobulins (IgGs, Aβ binding single-chain variable fragments (scFvs were used for diagnostic and therapeutic research approaches. scFvs can be expressed in E. coli and may provide improved pharmacokinetic properties like increased blood-brain barrier permeability or reduced side-effects in vivo. In this study, we constructed an scFv from an Aβ binding IgG, designated IC16, which binds the N-terminal region of Aβ (Aβ(1-8. scFv-IC16 was expressed in E. coli, purified and characterized with respect to its interaction with different Aβ species and its influence on Aβ fibril formation. We were able to show that scFv-IC16 strongly influenced the aggregation behavior of Aβ and could be applied as an Aβ detection probe for plaque staining in the brains of transgenic AD model mice. The results indicate potential for therapy and diagnosis of AD.

Nicked apomyoglobin: a noncovalent complex of two polypeptide fragments comprising the entire protein chain.

Science.gov (United States)

Musi, Valeria; Spolaore, Barbara; Picotti, Paola; Zambonin, Marcello; De Filippis, Vincenzo; Fontana, Angelo

2004-05-25

Limited proteolysis of the 153-residue chain of horse apomyoglobin (apoMb) by thermolysin results in the selective cleavage of the peptide bond Pro88-Leu89. The N-terminal (residues 1-88) and C-terminal (residues 89-153) fragments of apoMb were isolated to homogeneity and their conformational and association properties investigated in detail. Far-UV circular dichroism (CD) measurements revealed that both fragments in isolation acquire a high content of helical secondary structure, while near-UV CD indicated the absence of tertiary structure. A 1:1 mixture of the fragments leads to a tight noncovalent protein complex (1-88/89-153, nicked apoMb), characterized by secondary and tertiary structures similar to those of intact apoMb. The apoMb complex binds heme in a nativelike manner, as given by CD measurements in the Soret region. Second-derivative absorption spectra in the 250-300 nm region provided evidence that the degree of exposure of Tyr residues in the nicked species is similar to that of the intact protein at neutral pH. Also, the microenvironment of Trp residues, located in positions 7 and 14 of the 153-residue chain of the protein, is similar in both protein species, as given by fluorescence emission data. Moreover, in analogy to intact apoMb, the nicked protein binds the hydrophobic dye 1-anilinonaphthalene-8-sulfonate (ANS). Taken together, our results indicate that the two proteolytic fragments 1-88 and 89-153 of apoMb adopt partly folded states characterized by sufficiently nativelike conformational features that promote their specific association and mutual stabilization into a nicked protein species much resembling in its structural features intact apoMb. It is suggested that the formation of a noncovalent complex upon fragment complementation can mimic the protein folding process of the entire protein chain, with the difference that the folding of the complementary fragments is an intermolecular process. In particular, this study emphasizes the

Development of a single-chain variable fragment-alkaline phosphatase fusion protein and a sensitive direct competitive chemiluminescent enzyme immunoassay for detection of ractopamine in pork

Energy Technology Data Exchange (ETDEWEB)

Dong Jiexian; Li Zhenfeng; Lei Hongtao; Sun Yuanming [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Ducancel, Frederic [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Xu Zhenlin [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Boulain, Jean-Claude [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Yang Jinyi; Shen Yudong [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Wang Hong, E-mail: gzwhongd@63.com [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China)

2012-07-29

Graphical abstract: Detection model of dc-CLEIA based on anti-RAC scFv-AP fusion protein. Highlights: Black-Right-Pointing-Pointer The scFv-AP fusion protein against ractopamine (RAC) was produced. Black-Right-Pointing-Pointer A dc-CLEIA for RAC was developed based on the purified scFv-AP fusion protein. Black-Right-Pointing-Pointer The sensitivity of dc-CLEIA was 10 times as sensitive as dc-ELISA for RAC. Black-Right-Pointing-Pointer Recovery tests from pork samples were studied. Black-Right-Pointing-Pointer Good accuracy was obtained. - Abstract: A rapid, sensitive chemiluminescent enzyme immunoassay (CLEIA) for ractopamine (RAC) based on a single-chain variable fragment (scFv)-alkaline phosphatase (AP) fusion protein was developed. The scFv gene was prepared by cloning the heavy- and light-chain variable region genes (V{sub H} and V{sub L}) from hybridoma cell line AC2, which secretes antibodies against RAC, and assembling V{sub H} and V{sub L} genes with a linker by means of splicing overlap extension polymerase chain reaction. The resulting scFv gene was inserted into the expression vector pLIP6/GN containing AP to produce the fusion protein in Escherichia coli strain BL21. The purified scFv-AP fusion protein was used to develop a direct competitive CLEIA (dcCLEIA) protocol for detection of RAC. The average concentration required for 50% inhibition of binding and the limit of detection of the assay were 0.25 {+-} 0.03 and 0.02 {+-} 0.004 ng mL{sup -1}, respectively, and the linear response range extended from 0.05 to 1.45 ng mL{sup -1}. The assay was 10 times as sensitive as the corresponding enzyme-linked immunosorbent assay based on the same fusion protein. Cross-reactivity studies showed that the fusion protein did not cross react with RAC analogs. DcCLEIA was used to analyze RAC spiked pork samples, and the validation was confirmed by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS). The results showed a good correlation between

Generation of a Highly Reactive Chicken-Derived Single-Chain Variable Fragment against Fusarium verticillioides by Phage Display

Directory of Open Access Journals (Sweden)

Zu-Quan Hu

2012-06-01

Full Text Available Fusarium verticillioides is the primary causal agent of Fusarium ear and kernel rot in maize, producing fumonisin mycotoxins that are toxic to humans and domestic animals. Rapid detection and monitoring of fumonisin-producing fungi are pivotally important for the prevention of mycotoxins from entering into food/feed products. Chicken-derived single-chain variable fragments (scFvs against cell wall-bound proteins from F. verticillioides were isolated from an immunocompetent phage display library. Comparative phage enzyme-linked immunosorbant assays (ELISAs and sequencing analyses identified four different scFv antibodies with high sensitivity. Soluble antibody ELISAs identified two highly sensitive scFv antibodies, FvCA3 and FvCA4, with the latter being slightly more sensitive. Three-dimensional modeling revealed that the FvCA4 may hold a better overall structure with CDRH3, CDRL1 and CDRL3 centered in the core region of antibody surface compared with that of other scFvs. Immunofluorescence labeling revealed that the binding of FvCA4 antibody was localized to the cell walls of conidiospores and hyphae of F. verticillioides, confirming the specificity of this antibody for a surface target. This scFv antibody was able to detect the fungal mycelium as low as 10⁻² μg/mL and contaminating mycelium at a quantity of 10⁻² mg/g maize. This is the first report that scFv antibodies derived from phage display have a wide application for rapid and accurate detection and monitoring of fumonisin-producing pathogens in agricultural samples.

Generation of human antibody fragments against Streptococcus mutans using a phage display chain shuffling approach

Directory of Open Access Journals (Sweden)

Barth Stefan

2005-01-01

Full Text Available Abstract Background Common oral diseases and dental caries can be prevented effectively by passive immunization. In humans, passive immunotherapy may require the use of humanized or human antibodies to prevent adverse immune responses against murine epitopes. Therefore we generated human single chain and diabody antibody derivatives based on the binding characteristics of the murine monoclonal antibody Guy's 13. The murine form of this antibody has been used successfully to prevent Streptococcus mutans colonization and the development of dental caries in non-human primates, and to prevent bacterial colonization in human clinical trials. Results The antibody derivatives were generated using a chain-shuffling approach based on human antibody variable gene phage-display libraries. Like the parent antibody, these derivatives bound specifically to SAI/II, the surface adhesin of the oral pathogen S. mutans. Conclusions Humanization of murine antibodies can be easily achieved using phage display libraries. The human antibody fragments bind the antigen as well as the causative agent of dental caries. In addition the human diabody derivative is capable of aggregating S. mutans in vitro, making it a useful candidate passive immunotherapeutic agent for oral diseases.

Preparation of nanocomposites by reversible addition-fragmentation chain transfer polymerization from the surface of quantum dots in miniemulsion

NARCIS (Netherlands)

Carvalho Esteves, de A.C.; Hodge, P.; Trindade, T.; Barros-Timmons, A.M.M.V.

2009-01-01

Herein, we report the synthesis of quantum dots (QDs)/polymer nanocomposites by reversible addition-fragmentation chain transfer (RAFT) polymerization in miniemulsions using a grafting from approach. First, the surfaces of CdS and CdSe QDs were functionalized using a chain transfer agent, a

Anti-CTGF single-chain variable fragment dimers inhibit human airway smooth muscle (ASM) cell proliferation by down-regulating p-Akt and p-mTOR levels.

Science.gov (United States)

Gao, Wei; Cai, Liting; Xu, Xudong; Fan, Juxiang; Xue, Xiulei; Yan, Xuejiao; Qu, Qinrong; Wang, Xihua; Zhang, Chen; Wu, Guoqiu

2014-01-01

Connective tissue growth factor (CTGF) contributes to airway smooth muscle (ASM) cell hyperplasia in asthma. Humanized single-chain variable fragment antibody (scFv) was well characterized as a CTGF antagonist in the differentiation of fibroblast into myofibroblast and pulmonary fibrosis in our previous studies. To further improve the bioactivity of scFv, we constructed a plasmid to express scFv-linker-matrilin-6×His fusion proteins that could self-assemble into the scFv dimers by disulfide bonds in matrilin under non-reducing conditions. An immunoreactivity assay demonstrated that the scFv dimer could highly bind to CTGF in a concentration-dependent manner. The MTT and EdU assay results revealed that CTGF (≥10 ng/mL) promoted the proliferation of ASM cells, and this effect was inhibited when the cells were treated with anti-CTGF scFv dimer. The western blot analysis results showed that increased phosphorylation of Akt and mTOR induced by CTGF could be suppressed by this scFv dimer. Based on these findings, anti-CTGF scFv dimer may be a potential agent for the prevention of airway remodeling in asthma.

Reversible addition-fragmentation chain transfer polymerization of 2-chloro-1,3-butadiene

OpenAIRE

Pullan, Nikki; Liu, Max; Topham, Paul D.

2013-01-01

Controlled polymerization of 2-chloro-1,3-butadiene using reversible addition–fragmentation chain transfer (RAFT) polymerization has been demonstrated for the first time. 2-Chloro-1,3-butadiene, more commonly known as chloroprene, has significant industrial relevance as a crosslinked rubber, with uses ranging from adhesives to integral automotive components. However, problems surrounding the inherent toxicity of the lifecycle of the thiourea-vulcanized rubber have led to the need for control ...

Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

International Nuclear Information System (INIS)

Robinson, M.A.

1989-01-01

Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

Diverse responses of species to landscape fragmentation in a simple food chain.

Science.gov (United States)

Liao, Jinbao; Bearup, Daniel; Blasius, Bernd

2017-09-01

Habitat destruction, characterized by habitat loss and fragmentation, is a key driver of species extinction in spatial extended communities. Recently, there has been some progress in the theory of spatial food webs, however to date practically little is known about how habitat configurational fragmentation influences multi-trophic food web dynamics. To explore how habitat fragmentation affects species persistence in food webs, we introduce a modelling framework that describes the site occupancy of species in a tri-trophic system. We assume that species dispersal range increases with trophic level, exploiting pair-approximation techniques to describe the effect of habitat clustering. In accordance with the trophic rank hypothesis, both habitat loss and fragmentation generally cause species extinction, with stronger effects occurring at higher trophic levels. However, species display diverse responses (negative, neutral or positive) to habitat loss and fragmentation separately, depending on their dispersal range and trophic position. Counter-intuitively, prey species may benefit from habitat loss due to a release in top-down control. Similarly, habitat fragmentation has almost no influence on the site occupancy of the intermediate consumer in the tri-trophic system, though it decreases those of both basal species and top predator. Consequently, species' responses to habitat destruction vary as other species become extinct. Our results reiterate the importance of the interplay between bottom-up and top-down control in trophically linked communities, and highlight the complex responses occurring in even a simple food chain. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis

Directory of Open Access Journals (Sweden)

Chi-Hsin Lee

2017-10-01

Full Text Available Russell’s vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs containing 3.4 × 107 and 5.5 × 107 transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.

Single Chain Antibody Fragment against Venom from the Snake Daboia russelii formosensis.

Science.gov (United States)

Lee, Chi-Hsin; Lee, Yu-Ching; Lee, Yueh-Lun; Leu, Sy-Jye; Lin, Liang-Tzung; Chen, Chi-Ching; Chiang, Jen-Ron; Mwale, Pharaoh Fellow; Tsai, Bor-Yu; Hung, Ching-Sheng; Yang, Yi-Yuan

2017-10-27

Russell's vipers containing hemotoxic and neurotoxic venom commonly cause snake envenomation. Horse-derived antivenom is a specific antidote, but its production is expensive and has side effects. Developing a cost-effective and more tolerable therapeutic strategy is favorable. In this study, using glutaraldehyde-attenuated Daboia russelii formosensis (DRF) venom proteins to immunize chickens, polyclonal yolk-immunoglobulin (IgY) antibodies were generated and showed a specific binding affinity. Phage display technology was used to generate two antibody libraries of single-chain variable fragments (scFvs) containing 3.4 × 10⁷ and 5.5 × 10⁷ transformants, respectively. Phage-based ELISA indicated that specific clones were enriched after bio-panning. The nucleotide sequences of scFv-expressing clones were analyzed and classified into six groups in the short linker and four groups in the long linker. These scFv antibodies specifically bound to DRF proteins, but not other venom proteins. Mass spectrometric data suggested that these scFv antibodies may recognize phospholipase A2 RV-4 or RV-7. In vivo studies showed that anti-DRF IgY exhibited complete protective effects and mixed scFv antibodies increased the survival rate and time of mice challenged with a lethal dose of DRF proteins. These antibodies can be potentially applied in a rapid diagnostic method or for treatment in the future.

Effects of Variable Resistance Using Chains on Bench Throw Performance in Trained Rugby Players.

Science.gov (United States)

Godwin, Mark S; Fernandes, John F T; Twist, Craig

2018-04-01

Godwin, MS, Fernandes, JFT, and Twist, C. Effects of variable resistance using chains on bench throw performance in trained rugby players. J Strength Cond Res 32(4): 950-954, 2018-This study sought to determine the effects of variable resistance using chain resistance on bench throw performance. Eight male rugby union players (19.4 ± 2.3 years, 88.8 ± 6.0 kg, 1RM 105.6 ± 17.0 kg) were recruited from a national league team. In a randomized crossover design, participant's performed 3 bench throws at 45% one repetition maximum (1RM) at a constant load (no chains) or a variable load (30% 1RM constant load and 15% 1RM variable load; chains) with 7 days between conditions. For each repetition, the peak and mean velocity, peak power, peak acceleration, and time to peak velocity were recorded. Differences in peak and mean power were very likely trivial and unclear between the chain and no chain conditions, respectively. Possibly greater peak and likely greater mean bar velocity were accompanied by likely to most likely greater bar velocity between 50 and 400 ms from initiation of bench press in the chain condition compared with the no chain condition. Accordingly, bar acceleration was very likely greater in the chain condition compared with the no chain condition. In conclusion, these results show that the inclusion of chain resistance can acutely enhance several variables in the bench press throw and gives support to this type of training.

An unusual cysteine VL87 affects the antibody fragment conformations without interfering with the disulfide bond formation.

Science.gov (United States)

Attallah, Carolina; Aguilar, María Fernanda; Garay, A Sergio; Herrera, Fernando E; Etcheverrigaray, Marina; Oggero, Marcos; Rodrigues, Daniel E

2017-10-01

The Cys residues are almost perfectly conserved in all antibodies. They contribute significantly to the antibody fragment stability. The relevance of two natural contiguous Cys residues of an anti-recombinant human-follicle stimulation hormone (rhFSH) in a format of single-chain variable fragment (scFv) was studied. This scFv contains 5 Cys residues: V H 22 and V H 92 in the variable heavy chain (V H ) and V L 23, V L 87 and V L 88 in the variable light chain (V L ). The influence of two unusual contiguous Cys at positions V L 87 and V L 88 was studied by considering the wild type fragment and mutant variants: V L -C88S, V L -C87S, V L -C87Y. The analysis was carried out using antigen-binding ability measurement by indirect specific ELISA and a detailed molecular modeling that comprises homology methods, long molecular dynamics simulations and docking. We found that V L -C87 affected the antibody fragment stability without interfering with the disulfide bond formation. The effect of mutating the V L -C87 by a usual residue at this position like Tyr caused distant structural changes at the V H region that confers a higher mobility to the V H -CDR2 and V H -CDR3 loops improving the scFv binding to the antigen. Copyright © 2017 Elsevier Ltd. All rights reserved.

Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

International Nuclear Information System (INIS)

Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

1990-01-01

The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

Grafting of Polystyrene Chains at the Edge of Graphene Nanolayers by "Grafting Through" Approach Using Reversible Addition-Fragmentation Chain Transfer Polymerization

Directory of Open Access Journals (Sweden)

Hossein Roghani-Mamaqani

2017-09-01

Full Text Available Edge-functionalized graphene nanolayers with polystyrene chains were prepared by a “grafting through” reversible addition-fragmentation chain transfer (RAFT polymerization. For this purpose, double-bond containing modifier (MD was prepared. After edge-functionalization of graphene oxide (GO by two different amounts of MD and preparation of modified graphenes (LFG and HFG, RAFT polymerization of styrene was applied for preparation of functionalized GO with different densities of polystyrene chains. Fourier transform infrared spectroscopy showed that MD and polystyrene chains were grafted at the edge of GO. Gas chromatography showed that conversion decreased by the addition of modified GO content and also grafting density of MD. Number-average molecular weight and polydispersity index of polystyrene chains were derived from gel permeation chromatography. Increase of modified graphene content results in a decrease in molecular weight of attached polystyrene chains and also an increase in their PDI value. Increase of grafting density of MD results in decrease of molecular weight of polystyrene chains with no considerable variation in PDI value. Thermogravimetric analysis results showed that char residue is about 45.1 and 46.8% for LFG and HFG, respectively. The content of degradation ascribed to polystyrene increased with increase of grafting density of MD and decreased with increase of modified graphene content. X-ray diffraction results were used for evaluation of interlayer spacing of graphene layers after functionalization process and also study of nanocomposites structure. The results of scanning electron microscopy and transmission electron microscopy show that graphene layers with high clarity turned to opaque layers with lots of creases by oxidation and attachment of polystyrene chains.

Binding of HIV-1 gp41-directed neutralizing and non-neutralizing fragment antibody binding domain (Fab and single chain variable fragment (ScFv antibodies to the ectodomain of gp41 in the pre-hairpin and six-helix bundle conformations.

Directory of Open Access Journals (Sweden)

John M Louis

Full Text Available We previously reported a series of antibodies, in fragment antigen binding domain (Fab formats, selected from a human non-immune phage library, directed against the internal trimeric coiled-coil of the N-heptad repeat (N-HR of HIV-1 gp41. Broadly neutralizing antibodies from that series bind to both the fully exposed N-HR trimer, representing the pre-hairpin intermediate state of gp41, and to partially-exposed N-HR helices within the context of the gp41 six-helix bundle. While the affinities of the Fabs for pre-hairpin intermediate mimetics vary by only 2 to 20-fold between neutralizing and non-neutralizing antibodies, differences in inhibition of viral entry exceed three orders of magnitude. Here we compare the binding of neutralizing (8066 and non-neutralizing (8062 antibodies, differing in only four positions within the CDR-H2 binding loop, in Fab and single chain variable fragment (ScFv formats, to several pre-hairpin intermediate and six-helix bundle constructs of gp41. Residues 56 and 58 of the mini-antibodies are shown to be crucial for neutralization activity. There is a large differential (≥ 150-fold in binding affinity between neutralizing and non-neutralizing antibodies to the six-helix bundle of gp41 and binding to the six-helix bundle does not involve displacement of the outer C-terminal helices of the bundle. The binding stoichiometry is one six-helix bundle to one Fab or three ScFvs. We postulate that neutralization by the 8066 antibody is achieved by binding to a continuum of states along the fusion pathway from the pre-hairpin intermediate all the way to the formation of the six-helix bundle, but prior to irreversible fusion between viral and cellular membranes.

A 19-kDa C-terminal tryptic fragment of the α chain of Na/K-ATPase is essential for occlusion and transport of cations

International Nuclear Information System (INIS)

Karlish, S.J.D.; Goldshleger, R.; Stein, W.D.

1990-01-01

Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the α chain, a largely intact β chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the α chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein

A 19-kDa C-terminal tryptic fragment of the. alpha. chain of Na/K-ATPase is essential for occlusion and transport of cations

Energy Technology Data Exchange (ETDEWEB)

Karlish, S.J.D.; Goldshleger, R. (Weizmann Institute of Science, Rehovot (Israel)); Stein, W.D. (Hebrew Univ. Jerusalem (Israel))

1990-06-01

Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the {alpha} chain, a largely intact {beta} chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the {alpha} chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein.

Recombinant fragment of an antibody tailored for direct radioiodination

Czech Academy of Sciences Publication Activity Database

Sedláček, Juraj; Fábry, Milan; Sieglová, Irena; Král, Vlastimil; Uhnáková, Bronislava; Mudra, M.; Kronrád, L.; Sawicka, A.; Mikolajczak, R.; Řezáčová, Pavlína

2012-01-01

Roč. 55, č. 1 (2012), s. 52-56 ISSN 0362-4803 R&D Projects: GA MPO 2A-2TP1/076; GA MŠk 1M0505 Institutional research plan: CEZ:AV0Z50520514 Keywords : I125 labelling * single-chain antibody variable fragment * tyrosine-rich polypeptide segment * fusion protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.240, year: 2012

Packing motifs as predictors of the propensity of antibody fragments to crystallize

Science.gov (United States)

Edmundson, Allen B.; DeWitt, Christina R.; Goldsteen, Benjamin Z.; Ramsland, Paul A.

1999-01-01

A recurring theme in the crystallization of antibody fragments in our laboratory has been a packing pattern involving formation of intermolecular, antiparallel β-pleated sheets across two-fold axes. The most common motif is the antiparallel stacking of constant (C) domains of light (L) chain dimers or Fab molecules. Here, cross-molecule six-stranded sheets are produced by hydrogen-bonding interactions of three-residue polypeptide segments (triads), in the i, i+2 and i+4 positions of the final strands (designated 3-3) of the three-chain layers from two adjacent molecules. In the variable (V) domains the triads are supplied by the first strands (4-1) of the four-chain layers and the resulting cross-molecule sheets contain eight strands. The latter type of packing is more likely to be seen in crystals of Fv fragments (V domains only) than in those of L chain dimers or Fabs. Amongst the triads from either the V or C domains, there are on average four sets of backbone carbonyl and amide groups within hydrogen bonding distance (chain dimers, Fab and Fvs are likely to crystallize in these packing patterns.

Variable context Markov chains for HIV protease cleavage site prediction.

Science.gov (United States)

Oğul, Hasan

2009-06-01

Deciphering the knowledge of HIV protease specificity and developing computational tools for detecting its cleavage sites in protein polypeptide chain are very desirable for designing efficient and specific chemical inhibitors to prevent acquired immunodeficiency syndrome. In this study, we developed a generative model based on a generalization of variable order Markov chains (VOMC) for peptide sequences and adapted the model for prediction of their cleavability by certain proteases. The new method, called variable context Markov chains (VCMC), attempts to identify the context equivalence based on the evolutionary similarities between individual amino acids. It was applied for HIV-1 protease cleavage site prediction problem and shown to outperform existing methods in terms of prediction accuracy on a common dataset. In general, the method is a promising tool for prediction of cleavage sites of all proteases and encouraged to be used for any kind of peptide classification problem as well.

An efficient method for isolating antibody fragments against small peptides by antibody phage display

DEFF Research Database (Denmark)

Duan, Zhi; Siegumfeldt, Henrik

2010-01-01

We generated monoclonal scFv (single chain variable fragment) antibodies from an antibody phage display library towards three small synthetic peptides derived from the sequence of s1-casein. Key difficulties for selection of scFv-phages against small peptides were addressed. Small peptides do....... The scFvs were sequenced and characterized, and specificity was characterized by ELISA. The methods developed in this study are universally applicable for antibody phage display to efficiently produce antibody fragments against small peptides....

Falling chains as variable-mass systems: theoretical model and experimental analysis

International Nuclear Information System (INIS)

De Sousa, Célia A; Costa, Pedro; Gordo, Paulo M

2012-01-01

In this paper, we revisit, theoretically and experimentally, the fall of a folded U-chain and of a pile-chain. The model calculation implies the division of the whole system into two subsystems of variable mass, allowing us to explore the role of tensional contact forces at the boundary of the subsystems. This justifies, for instance, that the folded U-chain falls faster than the acceleration due to the gravitational force. This result, which matches quite well with the experimental data independently of the type of chain, implies that the falling chain is well described by energy conservation. We verify that these conclusions are not observed for the pile-chain motion. (paper)

Expression, production and renaturation of a functional single-chain ...

African Journals Online (AJOL)

The single-chain variable antibody fragment (scFv) against human intercellular adhesion molecule-1 (ICAM-1) was expressed at a high level in Escherichia coli as inclusion bodies. We attempted to refold the scFv by ion-exchange chromatography (IEC), dialysis and dilution. The results show that the column ...

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

Science.gov (United States)

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

Functionalization of vertically aligned carbon nanotubes with polystyrene via surface initiated reversible addition fragmentation chain transfer polymerization

Energy Technology Data Exchange (ETDEWEB)

Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G. [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA, 5001 (Australia)

2012-01-15

Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated 'grafting-from' process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.

Functionalization of vertically aligned carbon nanotubes with polystyrene via surface initiated reversible addition fragmentation chain transfer polymerization

International Nuclear Information System (INIS)

Macdonald, Thomas; Gibson, Christopher T.; Constantopoulos, Kristina; Shapter, Joseph G.; Ellis, Amanda V.

2012-01-01

Here we demonstrate the covalent attachment of vertically aligned (VA) acid treated single-walled carbon nanotubes (SWCNTs) onto a silicon substrate via dicyclohexylcarbodiimide (DCC) coupling chemistry. Subsequently, the pendant carboxyl moieties on the sidewalls of the VA-SWCNTs were derivatized to acyl chlorides, and then finally to bis(dithioester) moieties using a magnesium chloride dithiobenzoate salt. The bis(dithioester) moieties were then successfully shown to act as a chain transfer agent (CTA) in the reversible addition fragmentation chain transfer (RAFT) polymerization of styrene in a surface initiated “grafting-from” process from the VA-SWCNT surface. Atomic force microscopy (AFM) verified vertical alignment of the SWCNTs and the maintenance thereof throughout the synthesis process. Finally, Raman scattering spectroscopy and AFM confirmed polystyrene functionalization.

Designer genes. Recombinant antibody fragments for biological imaging

Energy Technology Data Exchange (ETDEWEB)

Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology

2000-09-01

Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering

Designer genes. Recombinant antibody fragments for biological imaging

International Nuclear Information System (INIS)

Wu, A.M.; Yazaki, P.J.

2000-01-01

Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

Isolation and expression of recombinant antibody fragments to the biological warfare pathogen Brucella melitensis.

Science.gov (United States)

Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George

2003-05-01

Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.

HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

DEFF Research Database (Denmark)

Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

1992-01-01

We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

Microbial platform technology for recombinant antibody fragment production: A review.

Science.gov (United States)

Gupta, Sanjeev Kumar; Shukla, Pratyoosh

2017-02-01

Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.

Carprofen-imprinted monolith prepared by reversible addition-fragmentation chain transfer polymerization in room temperature ionic liquids.

Science.gov (United States)

Ban, Lu; Han, Xu; Wang, Xian-Hua; Huang, Yan-Ping; Liu, Zhao-Sheng

2013-10-01

To obtain fast separation, ionic liquids were used as porogens first in combination with reversible addition-fragmentation chain transfer (RAFT) polymerization to prepare a new type of molecularly imprinted polymer (MIP) monolith. The imprinted monolithic column was synthesized using a mixture of carprofen (template), 4-vinylpyridine, ethylene glycol dimethacrylate, [BMIM]BF4, and chain transfer agent (CTA). Some polymerization factors, such as template-monomer molar ratio, the degree of crosslinking, the composition of the porogen, and the content of CTA, on the column efficiency and imprinting effect of the resulting MIP monolith were systematically investigated. Affinity screening of structurally similar compounds with the template can be achieved in 200 s on the MIP monolith due to high column efficiency (up to 12,070 plates/m) and good column permeability. Recognition mechanism of the imprinted monolith was also investigated.

Recent habitat fragmentation caused by major roads leads to reduction of gene flow and loss of genetic variability in ground beetles.

Science.gov (United States)

Keller, Irene; Largiadèr, Carlo R

2003-02-22

Although habitat fragmentation is suspected to jeopardize the long-term survival of many species, few data are available on its impact on the genetic variability of invertebrates. We assess the genetic population structure of the flightless ground beetle Carabus violaceus L., 1758 in a Swiss forest, which is divided into several fragments by a highway and two main roads. Eight samples were collected from different forest fragments and analysed at six microsatellite loci. The largest genetic differentiation was observed between samples separated by roads and in particular by the highway. The number of roads between sites explained 44% of the variance in pairwise F(ST) estimates, whereas the age of the road and the geographical distance between locations were not significant factors. Furthermore, a comparison of allelic richness showed that the genetic variability in a small forest fragment isolated by the highway was significantly lower than in the rest of the study area. These findings strongly support the hypothesis that large roads are absolute barriers to gene flow in C. violaceus, which may lead to a loss of genetic variability in fragmented populations.

Generation of a rabbit single-chain fragment variable (scFv) antibody for specific detection of Bradyrhizobium sp. DOA9 in both free-living and bacteroid forms.

Science.gov (United States)

Vu, Nguyen Xuan; Pruksametanan, Natcha; Srila, Witsanu; Yuttavanichakul, Watcharin; Teamtisong, Kamonluck; Teaumroong, Neung; Boonkerd, Nantakorn; Tittabutr, Panlada; Yamabhai, Montarop

2017-01-01

A simple and reliable method for the detection of specific nitrogen-fixing bacteria in both free-living and bacteroid forms is essential for the development and application of biofertilizer. Traditionally, a polyclonal antibody generated from an immunized rabbit was used for detection. However, the disadvantages of using a polyclonal antibody include limited supply and cross-reactivity to related bacterial strains. This is the first report on the application of phage display technology for the generation of a rabbit recombinant monoclonal antibody for specific detection and monitoring of nitrogen-fixing bacteria in both free-living form and in plant nodules. Bradyrhizobium sp. DOA9, a broad host range soil bacteria, originally isolated from the root nodules of Aeschynomene americana in Thailand was used as a model in this study. A recombinant single-chain fragment variable (scFv) antibody library was constructed from the spleen of a rabbit immunized with DOA9. After three rounds of biopanning, one specific phage-displayed scFv antibody, designated bDOA9rb8, was identified. Specific binding of this antibody was confirmed by phage enzyme-linked immunosorbent assay (phage ELISA). The phage antibody could bind specifically to DOA9 in both free-living cells (pure culture) and bacteroids inside plant nodules. In addition to phage ELISA, specific and robust immunofluorescence staining of both free-living and bacteroid forms could also be observed by confocal-immunofluorescence imaging, without cross-reactivity with other tested bradyrhizobial strains. Moreover, specific binding of free scFv to DOA9 was also demonstrated by ELISA. This recombinant antibody can also be used for the study of the molecular mechanism of plant-microbe interactions in the future.

Synthesis of butyl acrylate-styrene block copolymers in emulsion by reversible addition-fragmentation chain transfer : effect of surfactant migration upon film formation

NARCIS (Netherlands)

Monteiro, M.J.; Sjöberg, M.; Göttgens, C.M.; Vlist, van der J.

2000-01-01

The synthesis of block copolymers in an environmentally friendly medium was carried out in emulsion polymerizations through the reversible addition-fragmentation chain transfer process, using a transfer active xanthate (MADIX) agent, under batch and starved-feed conditions. First, ab initio

The association of heavy and light chain variable domains in antibodies: implications for antigen specificity.

KAUST Repository

Chailyan, Anna

2011-06-28

The antigen-binding site of immunoglobulins is formed by six regions, three from the light and three from the heavy chain variable domains, which, on association of the two chains, form the conventional antigen-binding site of the antibody. The mode of interaction between the heavy and light chain variable domains affects the relative position of the antigen-binding loops and therefore has an effect on the overall conformation of the binding site. In this article, we analyze the structure of the interface between the heavy and light chain variable domains and show that there are essentially two different modes for their interaction that can be identified by the presence of key amino acids in specific positions of the antibody sequences. We also show that the different packing modes are related to the type of recognized antigen.

Completion of autobuilt protein models using a database of protein fragments

International Nuclear Information System (INIS)

Cowtan, Kevin

2012-01-01

Two developments in the process of automated protein model building in the Buccaneer software are described: the use of a database of protein fragments in improving the model completeness and the assembly of disconnected chain fragments into complete molecules. Two developments in the process of automated protein model building in the Buccaneer software are presented. A general-purpose library for protein fragments of arbitrary size is described, with a highly optimized search method allowing the use of a larger database than in previous work. The problem of assembling an autobuilt model into complete chains is discussed. This involves the assembly of disconnected chain fragments into complete molecules and the use of the database of protein fragments in improving the model completeness. Assembly of fragments into molecules is a standard step in existing model-building software, but the methods have not received detailed discussion in the literature

Baxter Q-operator and separation of variables for the open SL(2, R) spin chain

International Nuclear Information System (INIS)

Derkachov, Sergey E.; Korchemsky, Gregory P.; Manashov, Alexander N.

2003-01-01

We construct the Baxter Q-operator and the representation of the Separated Variables (SoV) for the homogeneous open SL(2, R) spin chain. Applying the diagrammatical approach, we calculate Sklyanin's integration measure in the separated variables and obtain the solution to the spectral problem for the model in terms of the eigenvalues of the Q-operator. We show that the transition kernel to the SoV representation is factorized into the product of certain operators each depending on a single separated variable. As a consequence, it has a universal pyramid-like form that has been already observed for vari- ous quantum integrable models such as periodic Toda chain, closed SL(2, R) and SL(2, C) spin chains. (author)

Distribution of nuclear charge and angular momentum in chains 132-137, 99, and 102 of thermal neutron fission of 235U at various kinetic energies and charge states of the fragments

International Nuclear Information System (INIS)

Denschlag, H.O.; Braun, H.; Wolfsberg, K.

1979-01-01

The fission product yields of the members of the decay chains 132 to 137, 99, and 102 in 235 U(n/sub th/,f) were measured at various kinetic energies and ionic charge states of the fragments using the mass separator for unslowed fission products LOHENGRIN. The results are discussed with respect to four aspects: A preferential formation of neutron rich chain members found at high kinetic energy of the fragments is predominantly due to decreasing prompt neutron evaporation. A particularly large effect in chain 132 is attributed to the double shell closure in Sn-132. The persistence of an even-odd pairing effect in the yields throughout the range of kinetic energies studied leads to the conclusion that the high internal excitation energy of the fragments is tied up mainly in the form of collective energy (e.g., deformation energy) rather than single particle excitation. Generally, the yield distribution at constant kinetic energy is invariant with respect to the ionic charge state of the isotopes separated. Deviations from this behavior found in chains 99, 102, 133, and 136 are interpreted as being due to Auger events following a converted transition in the decay of ns-isomers taking place in the vacuum of the separator. A pronounced variation of the independent formation ratio of single isomeric states with the kinetic energy of the fragments is providing direct information on the controversial topic of the change of angular momentum of fission fragments as a function of deformation (scission distance). 34 references

Who controls the logistics emissions? Challenges in making fragmented supply chains environmentally sustainable from logistics service providers’ perspective

DEFF Research Database (Denmark)

Abbasi, Maisam; Sternberg, Henrik; Nilsson, Fredrik

2014-01-01

that impact the cost and time requirements from customers of logistics services are not yet a reality. Research limitations/implications (if applicable) This paper implies that LSP sustainability cannot be investigated in isolation if a company does not manage proprietary resources. Practical implications (if......Purpose The purpose of this article is to explore the environmental impact of Logistics Service Provider (LSP) activities in the light of increased customer attention and fragmentation of the industry. It also explores to what extent the LSPs can actually monitor the environmental impact...... of logistics activities in the supply chain? Design/methodology/approach The methodology of this paper is a literature review, a qualitative interview survey, and three case studies. A framework on sustainability challenges in supply chains derived from the literature is used to structure and analyze...

Selection and characterization of naturally occurring single-domain (IgNAR) antibody fragments from immunized sharks by phage display.

Science.gov (United States)

Dooley, Helen; Flajnik, Martin F; Porter, Andrew J

2003-09-01

The novel immunoglobulin isotype novel antigen receptor (IgNAR) is found in cartilaginous fish and is composed of a heavy-chain homodimer that does not associate with light chains. The variable regions of IgNAR function as independent domains similar to those found in the heavy-chain immunoglobulins of Camelids. Here, we describe the successful cloning and generation of a phage-displayed, single-domain library based upon the variable domain of IgNAR. Selection of such a library generated from nurse sharks (Ginglymostoma cirratum) immunized with the model antigen hen egg-white lysozyme (HEL) enabled the successful isolation of intact antigen-specific binders matured in vivo. The selected variable domains were shown to be functionally expressed in Escherichia coli, extremely stable, and bind to antigen specifically with an affinity in the nanomolar range. This approach can therefore be considered as an alternative route for the isolation of minimal antigen-binding fragments with favorable characteristics.

Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

International Nuclear Information System (INIS)

Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

1995-06-01

MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

Modelling antibody side chain conformations using heuristic database search.

Science.gov (United States)

Ritchie, D W; Kemp, G J

1997-01-01

We have developed a knowledge-based system which models the side chain conformations of residues in the variable domains of antibody Fv fragments. The system is written in Prolog and uses an object-oriented database of aligned antibody structures in conjunction with a side chain rotamer library. The antibody database provides 3-dimensional clusters of side chain conformations which can be copied en masse into the model structure. The object-oriented database architecture facilitates a navigational style of database access, necessary to assemble side chains clusters. Around 60% of the model is built using side chain clusters and this eliminates much of the combinatorial complexity associated with many other side chain placement algorithms. Construction and placement of side chain clusters is guided by a heuristic cost function based on a simple model of side chain packing interactions. Even with a simple model, we find that a large proportion of side chain conformations are modelled accurately. We expect our approach could be used with other homologous protein families, in addition to antibodies, both to improve the quality of model structures and to give a "smart start" to the side chain placement problem.

Gamma-irradiation of homodeoxyoligonucleotides 32P-labelled at one end: computer simulation of the chain length distribution of the radioactive fragments

International Nuclear Information System (INIS)

Teoule, R.; Duplaa, A.M.

1987-01-01

Electrophoresis on polyacrylamide gels of the fragments resulting from γ-irradiation of single-stranded oligodeoxyribonucleotides labelled at their 5'- or 3'-end proved a potent tool for analysis of the radiation-induced chain breakage of DNA. Owing to the fact that the oligonucleotide may be ruptured at more than one site, counting of the electrophoresis bands must be corrected and it is necessary to assess the influence of the cleavage position on the band intensities. A complicating factor is the inhomogeneity of the system due to the presence of the four bases A, T, C and G. To circumvent this problem, the homooligodeoxyribonucleotides (dA) 15 , (dC) 15 , (dT) 15 were used as experimental probes. They were γ-irradiated in solution, heated in alkali and resulting fragments separated by gel electrophoresis. A computer simulation of band intensities was compiled based on the general assumption that the chain breakage is homogeneous. Experimental results obtained from the homooligodeoxyribonucleotides labelled at either the 5' or the 3'-end are in excellent agreement with theoretical calculations. Abacus giving the gel band intensities (percentage) against the nucleotide positions and the remaining intensity of the original oligonucleotide have been obtained. (author)

Baculovirus display of functional antibody Fab fragments.

Science.gov (United States)

Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

2015-08-01

The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

On the fragmentation of biomolecules: fragmentation of alanine dipeptide along the polypeptide chain

DEFF Research Database (Denmark)

Solov'yov, Ilia; Yakubovich, Alexander; Solov'yov, Andrey

2006-01-01

The interaction potential between amino acids in alanine dipeptide has been studied for the first time taking into account exact molecular geometry. Ab initio calculation has been performed in the framework of density functional theory taking into account all electrons in the system. The fragment...

Controlled radical copolymerization of styrene and maleic anhydride and the synthesis of novel polyolefin-based block copolymers by reversible addition-fragmentation chain-transfer (RAFT) polymerization

NARCIS (Netherlands)

Brouwer, de J.A.M.; Schellekens, M.A.J.; Klumperman, B.; Monteiro, M.J.; German, A.L.

2000-01-01

Reversible addn.-fragmentation chain transfer (RAFT) was applied to the copolymn. of styrene and maleic anhydride. The product had a low polydispersity and a predetd. molar mass. Novel, well-defined polyolefin-based block copolymers were prepd. with a macromol. RAFT agent prepd. from a com.

Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

DEFF Research Database (Denmark)

Høgdall, Estrid; Vuust, Jens; Lind, Peter

2000-01-01

of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

A novel method for in Situ detection of hydrolyzable casein fragments in a cheese matrix by antibody phage display technique and CLSM

DEFF Research Database (Denmark)

Duan, Zhi; Brüggemann, Dagmar Adeline; Siegumfeldt, Henrik

2009-01-01

three small synthetic peptides of the alpha(s1)-casein sequence. These peptides traverse enzymatic cleavage sites of casein during cheese ripening. The specificity of the generated anti-peptide antibodies was determined by ELISA and Western blot. Finally, an immunofluorescent labeling protocol......A novel method to monitor in situ hydrolyzable casein fragments during cheese ripening by using immunofluorescent labeling and confocal laser scanning microscopy (CLSM) was developed. Monoclonal single chain variable fragments of antibody (scFvs) were generated by antibody phage display toward...

DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

Science.gov (United States)

Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

2011-07-15

The study of the transmission of leprosy is particularly difficult since the causative agent, Mycobacterium leprae, cannot be cultured in the laboratory. The only sources of the bacteria are leprosy patients, and experimentally infected armadillos and nude mice. Thus, many of the methods used in modern epidemiology are not available for the study of leprosy. Despite an extensive global drug treatment program for leprosy implemented by the WHO, leprosy remains endemic in many countries with approximately 250,000 new cases each year. The entire M. leprae genome has been mapped and many loci have been identified that have repeated segments of 2 or more base pairs (called micro- and minisatellites). Clinical strains of M. leprae may vary in the number of tandem repeated segments (short tandem repeats, STR) at many of these loci. Variable number tandem repeat (VNTR) analysis has been used to distinguish different strains of the leprosy bacilli. Some of the loci appear to be more stable than others, showing less variation in repeat numbers, while others seem to change more rapidly, sometimes in the same patient. While the variability of certain VNTRs has brought up questions regarding their suitability for strain typing, the emerging data suggest that analyzing multiple loci, which are diverse in their stability, can be used as a valuable epidemiological tool. Multiple locus VNTR analysis (MLVA) has been used to study leprosy evolution and transmission in several countries including China, Malawi, the Philippines, and Brazil. MLVA involves multiple steps. First, bacterial DNA is extracted along with host tissue DNA from clinical biopsies or slit skin smears (SSS). The desired loci are then amplified from the extracted DNA via polymerase chain reaction (PCR). Fluorescently-labeled primers for 4-5 different loci are used per reaction, with 18 loci being amplified in a total of four reactions. The PCR products may be subjected to agarose gel electrophoresis to verify the

[Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].

Science.gov (United States)

Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan

2017-03-01

Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.

Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

Science.gov (United States)

Denisov, E. T.; Shestakov, A. F.

2018-05-01

Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

Current fragmentation in deep inelastic scattering

International Nuclear Information System (INIS)

Hamer, C.J.

1975-04-01

It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)

Fragmentation kinetics of a Morse oscillator chain under tension

International Nuclear Information System (INIS)

Stember, Joseph N.; Ezra, Gregory S.

2007-01-01

The bond dissociation kinetics of tethered atomic (Morse potential) chains under tensile stress is studied. Both RRKM (fully anharmonic, Monte Carlo) and RRK (harmonic appproximation) theory are applied to predict bond dissociation rate constants as a function of energy and tensile force. For chains with N ≥ 3 atoms a hybrid statistical theory is used involving a harmonic approximation for motion in the transition state for bond dissociation. For chains with N = 2-5 atoms, while the RRK approximation significantly overestimates the dissociation rate constant, the fully anharmonic RRKM rate is quite close to simulation results. For the N = 2 chain, a novel approach to the extraction of decay rate constants based on the classical spectral theorem is implemented. Good agreement between the RRKM and dynamical rate constants is obtained for N = 2 despite the fact that the reactant phase space contains a significant fraction of relatively short-lived trajectories

Anomalous nuclear fragments

International Nuclear Information System (INIS)

Karmanov, V.A.

1983-01-01

Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

Fast local fragment chaining using sum-of-pair gap costs

DEFF Research Database (Denmark)

Otto, Christian; Hoffmann, Steve; Gorodkin, Jan

2011-01-01

, and rank the fragments to improve the specificity. Results: Here we present a fast and flexible fragment chainer that for the first time also supports a sum-of-pair gap cost model. This model has proven to achieve a higher accuracy and sensitivity in its own field of application. Due to a highly time...... alignment heuristics alone. By providing both the linear and the sum-of-pair gap cost model, a wider range of application can be covered. The software clasp is available at http://www.bioinf.uni-leipzig.de/Software/clasp/....

Synthesis of the C(18)-C(34) fragment of amphidinolide C and the C(18)-C(29) fragment of amphidinolide F.

Science.gov (United States)

Roy, Sudeshna; Spilling, Christopher D

2010-11-19

A convergent synthesis of the C(18)-C(34) fragment of amphidinolide C and the C(18)-C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization, and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with l-selectride to give the fragments of amphidinolide C and F.

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.

Science.gov (United States)

Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B

2016-11-25

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.

Fission fragment angular momentum

International Nuclear Information System (INIS)

Frenne, D. De

1991-01-01

Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

The Buccaneer software for automated model building. 1. Tracing protein chains.

Science.gov (United States)

Cowtan, Kevin

2006-09-01

A new technique for the automated tracing of protein chains in experimental electron-density maps is described. The technique relies on the repeated application of an oriented electron-density likelihood target function to identify likely C(alpha) positions. This function is applied both in the location of a few promising ;seed' positions in the map and to grow those initial C(alpha) positions into extended chain fragments. Techniques for assembling the chain fragments into an initial chain trace are discussed.

Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

Science.gov (United States)

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2014-10-01

Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

Science.gov (United States)

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-10-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

Science.gov (United States)

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.

Modular Construction of Large Non-Immune Human Antibody Phage-Display Libraries from Variable Heavy and Light Chain Gene Cassettes.

Science.gov (United States)

Lee, Nam-Kyung; Bidlingmaier, Scott; Su, Yang; Liu, Bin

2018-01-01

Monoclonal antibodies and antibody-derived therapeutics have emerged as a rapidly growing class of biological drugs for the treatment of cancer, autoimmunity, infection, and neurological diseases. To support the development of human antibodies, various display techniques based on antibody gene repertoires have been constructed over the last two decades. In particular, scFv-antibody phage display has been extensively utilized to select lead antibodies against a variety of target antigens. To construct a scFv phage display that enables efficient antibody discovery, and optimization, it is desirable to develop a system that allows modular assembly of highly diverse variable heavy chain and light chain (Vκ and Vλ) repertoires. Here, we describe modular construction of large non-immune human antibody phage-display libraries built on variable gene cassettes from heavy chain and light chain repertoires (Vκ- and Vλ-light can be made into independent cassettes). We describe utility of such libraries in antibody discovery and optimization through chain shuffling.

Stability of llama heavy chain antibody fragments under extreme conditions

NARCIS (Netherlands)

Dolk, E.

2004-01-01

Camelids have next to their normal antibodies, a unique subset of antibodies lacking light chains. The resulting single binding domain, VHH, of these heavy chain antibodies consequently have unique properties. A high stability is one of these properties, which was investigated in this thesis. The

Lack of a 5.9 kDa peptide C-terminal fragment of fibrinogen α chain precedes fibrosis progression in patients with liver disease.

Directory of Open Access Journals (Sweden)

Santiago Marfà

Full Text Available Early detection of fibrosis progression is of major relevance for the diagnosis and management of patients with liver disease. This study was designed to find non-invasive biomarkers for fibrosis in a clinical context where this process occurs rapidly, HCV-positive patients who underwent liver transplantation (LT. We analyzed 93 LT patients with HCV recurrence, 41 non-LT patients with liver disease showing a fibrosis stage F≥1 and 9 patients without HCV recurrence who received antiviral treatment before LT, as control group. Blood obtained from 16 healthy subjects was also analyzed. Serum samples were fractionated by ion exchange chromatography and their proteomic profile was analyzed by SELDI-TOF-MS. Characterization of the peptide of interest was performed by ion chromatography and electrophoresis, followed by tandem mass spectrometry identification. Marked differences were observed between the serum proteome profile of LT patients with early fibrosis recurrence and non-recurrent LT patients. A robust peak intensity located at 5905 m/z was the distinguishing feature of non-recurrent LT patients. However, the same peak was barely detected in recurrent LT patients. Similar results were found when comparing samples of healthy subjects with those of non-LT fibrotic patients, indicating that our findings were not related to either LT or HCV infection. Using tandem mass-spectrometry, we identified the protein peak as a C-terminal fragment of the fibrinogen α chain. Cell culture experiments demonstrated that TGF-β reduces α-fibrinogen mRNA expression and 5905 m/z peak intensity in HepG2 cells, suggesting that TGF-β activity regulates the circulating levels of this protein fragment. In conclusion, we identified a 5.9 kDa C-terminal fragment of the fibrinogen α chain as an early serum biomarker of fibrogenic processes in patients with liver disease.

Cloning and expression of cell wall acid invertase gene fragment ...

African Journals Online (AJOL)

A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

Cloning and molecular characterization of the cDNAs encoding the variable regions of an anti-CD20 monoclonal antibody.

Science.gov (United States)

Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili

2017-01-01

CD20-based targeting of B-cells in hematologic malignancies and autoimmune disorders is associated with outstanding clinical outcomes. Isolation and characterization of VH and VL cDNAs encoding the variable regions of the heavy and light chains of monoclonal antibodies (MAb) is necessary to produce next generation MAbs and their derivatives such as bispecific antibodies (bsAb) and single-chain variable fragments (scFv). This study was aimed at cloning and characterization of the VH and VL cDNAs from a hybridoma cell line producing an anti-CD20 MAb. VH and VL fragments were amplified, cloned and characterized. Furthermore, amino acid sequences of VH, VL and corresponding complementarity-determining regions (CDR) were determined and compared with those of four approved MAbs including Rituximab (RTX), Ibritumomab tiuxetan, Ofatumumab and GA101. The cloned VH and VL cDNAs were found to be functional and follow a consensus pattern. Amino acid sequences corresponding to the VH and VL fragments also indicated noticeable homologies to those of RTX and Ibritumomab. Furthermore, amino acid sequences of the relating CDRs had remarkable similarities to their counterparts in RTX and Ibritumomab. Successful recovery of VH and VL fragments encourages the development of novel CD20 targeting bsAbs, scFvs, antibody conjugates and T-cells armed with chimeric antigen receptors.

Synthesis of the C(18)–C(34) Fragment of Amphidinolide C and the C(18)–C(29) Fragment of Amphidinolide F

Science.gov (United States)

Roy, Sudeshna; Spilling, Christopher D.

2010-01-01

A convergent synthesis of the C(18)–C(34) fragment of amphidinolide C and the C(18)–C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with L-selectride to give the fragments of amphidinolide C and F. PMID:21028791

Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

R Mirnejad

2011-01-01

Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

Highly efficient reversible addition-fragmentation chain-transfer polymerization in ethanol/water via flow chemistry

Energy Technology Data Exchange (ETDEWEB)

Ye, Piaoran [Case Western Reserve Univ., Cleveland, OH (United States); Cao, Peng -Fei [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Su, Zhe [Case Western Reserve Univ., Cleveland, OH (United States); Advincula, Rigoberto [Case Western Reserve Univ., Cleveland, OH (United States)

2017-03-23

Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR), and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L^–1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.

Classification of decays involving variable decay chains with convolutional architectures

CERN Multimedia

CERN. Geneva

2018-01-01

Vidyo contribution We present a technique to perform classification of decays that exhibit decay chains involving a variable number of particles, which include a broad class of $B$ meson decays sensitive to new physics. The utility of such decays as a probe of the Standard Model is dependent upon accurate determination of the decay rate, which is challenged by the combinatorial background arising in high-multiplicity decay modes. In our model, each particle in the decay event is represented as a fixed-dimensional vector of feature attributes, forming an $n \\times k$ representation of the event, where $n$ is the number of particles in the event and $k$ is the dimensionality of the feature vector. A convolutional architecture is used to capture dependencies between the embedded particle representations and perform the final classification. The proposed model performs outperforms standard machine learning approaches based on Monte Carlo studies across a range of variable final-state decays with the Belle II det...

Scale-up of the Reversible Addition-Fragmentation Chain Transfer (RAFT Polymerization Using Continuous Flow Processing

Directory of Open Access Journals (Sweden)

Nenad Micic

2014-01-01

Full Text Available A controlled radical polymerization process using the Reversible Addition-Fragmentation Chain Transfer (RAFT approach was scaled up by a factor of 100 from a small laboratory scale of 5 mL to a preparative scale of 500 mL, using batch and continuous flow processing. The batch polymerizations were carried out in a series of different glass vessels, using either magnetic or overhead stirring, and different modes of heating: Microwave irradiation or conductive heating in an oil bath. The continuous process was conducted in a prototype tubular flow reactor, consisting of 6 mm ID stainless steel tubing, fitted with static mixers. Both reactor types were tested for polymerizations of the acid functional monomers acrylic acid and 2-acrylamido-2-methylpropane-1-sulfonic acid in water at 80 °C with reaction times of 30 to 40 min. By monitoring the temperature during the exothermic polymerization process, it was observed that the type and size of reactor had a significant influence on the temperature profile of the reaction.

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Richard Atherton

2013-06-01

Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Caldeira Roberta Lima

1998-01-01

Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

Geographic Variability and Anti-Staphylococcal Activity of the Chrysophaentins and Their Synthetic Fragments

Directory of Open Access Journals (Sweden)

Jared T. Hammill

2012-05-01

Full Text Available Drug-resistant Staphylococcus aureus is a continuing public health concern, both in the hospital and community settings. Antibacterial compounds that possess novel structural scaffolds and are effective against multiple S. aureus strains, including current drug-resistant ones, are needed. Previously, we have described the chrysophaentins, a family of bisdiarylbutene macrocycles from the chrysophyte alga Chrysophaeum taylori that inhibit the growth of S. aureus and methicillin-resistant S. aureus (MRSA. In this study we have analyzed the geographic variability of chrysophaentin production in C. taylori located at different sites on the island of St. John, U.S. Virgin Islands, and identified two new linear chrysophaentin analogs, E2 and E3. In addition, we have expanded the structure activity relationship through synthesis of fragments comprising conserved portions of the chrysophaentins, and determined the antimicrobial activity of natural chrysophaentins and their synthetic analogs against five diverse S. aureus strains. We find that the chrysophaentins show similar activity against all S. aureus strains, regardless of their drug sensitivity profiles. The synthetic chrysophaentin fragments indeed mimic the natural compounds in their spectrum of antibacterial activity, and therefore represent logical starting points for future medicinal chemistry studies of the natural products and their analogs.

Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

Directory of Open Access Journals (Sweden)

Caldeira Roberta L

2000-01-01

Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

Self-assembly of block copolymer micelles: synthesis via reversible addition-fragmentation chain transfer polymerization and aqueous solution properties.

Science.gov (United States)

Mya, Khine Y; Lin, Esther M J; Gudipati, Chakravarthy S; Gose, Halima B A S; He, Chaobin

2010-07-22

Poly(hexafluorobutyl methacrylate) (PHFBMA) homopolymer was synthesized by reversible addition-fragmentation chain transfer (RAFT)-mediated living radical polymerization in the presence of cyano-2-propyl dithiobenzoate (CPDB) RAFT agent. A block copolymer of PHFBMA-poly(propylene glycol acrylate) (PHFBMA-b-PPGA) with dangling poly(propylene glycol) (PPG) side chains was then synthesized by using CPDB-terminated PHFBMA as a macro-RAFT agent. The amphiphilic properties and self-assembly of PHFBMA-b-PPGA block copolymer in aqueous solution were investigated by dynamic and static light scattering (DLS and SLS) studies, in combination with fluorescence spectroscopy and transmission electron microscopy (TEM). Although PPG shows moderately hydrophilic character, the formation of nanosize polymeric micelles was confirmed by fluorescence and TEM studies. The low value of the critical aggregation concentration exhibited that the tendency for the formation of copolymer aggregates in aqueous solution was very high due to the strong hydrophobicity of the PHFBMA(145)-b-PPGA(33) block copolymer. The combination of DLS and SLS measurements revealed the existence of micellar aggregates in aqueous solution with an association number of approximately 40 +/- 7 for block copolymer micelles. It was also found in TEM observation that there are 40-50 micelles accumulated into one aggregate and these micelles are loosely packed inside the aggregate.

The association of heavy and light chain variable domains in antibodies: implications for antigen specificity.

KAUST Repository

Chailyan, Anna; Marcatili, Paolo; Tramontano, Anna

2011-01-01

of interaction between the heavy and light chain variable domains affects the relative position of the antigen-binding loops and therefore has an effect on the overall conformation of the binding site. In this article, we analyze the structure of the interface

Cultivation of Pichia pastoris carrying the scFv anti LDL (- antibody fragment. Effect of preculture carbon source

Directory of Open Access Journals (Sweden)

Cesar Andres Diaz Arias

Full Text Available Abstract Antibodies and antibody fragments are nowadays among the most important biotechnological products, and Pichia pastoris is one of the most important vectors to produce them as well as other recombinant proteins. The conditions to effectively cultivate a P. pastoris strain previously genetically modified to produce the single-chain variable fragment anti low density lipoprotein (- under the control of the alcohol oxidase promoter have been investigated in this study. In particular, it was evaluated if, and eventually how, the carbon source (glucose or glycerol used in the preculture preceding cryopreservation in 20% glycerol influences both cell and antibody fragment productions either in flasks or in bioreactor. Although in flasks the volumetric productivity of the antibody fragment secreted by cells precultured, cryopreserved and reactivated in glycerol was 42.9% higher compared with cells precultured in glucose, the use of glycerol in bioreactor led to a remarkable shortening of the lag phase, thereby increasing it by no less than thrice compared to flasks. These results are quite promising in comparison with those reported in the literature for possible future industrial applications of this cultivation, taking into account that the overall process time was reduced by around 8 h.

Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

Science.gov (United States)

McMeel, O M; Hoey, E M; Ferguson, A

2001-01-01

The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

Altered phenotypic expression of immunoglobulin heavy-chain variable-region (VH) genes in Alicia rabbits probably reflects a small deletion in the VH genes closest to the joining region.

Science.gov (United States)

Allegrucci, M; Newman, B A; Young-Cooper, G O; Alexander, C B; Meier, D; Kelus, A S; Mage, R G

1990-07-01

Rabbits of the Alicia strain have a mutation (ali) that segregates with the immunoglobulin heavy-chain (lgh) locus and has a cis effect upon the expression of heavy-chain variable-region (VH) genes encoding the a2 allotype. In heterozygous a1/ali or a3/ali rabbits, serum immunoglobulins are almost entirely the products of the normal a1 or a3 allele and only traces of a2 immunoglobulin are detectable. Adult homozygous ali/ali rabbits likewise have normal immunoglobulin levels resulting from increased production of a-negative immunoglobulins and some residual ability to produce the a2 allotype. By contrast, the majority of the immunoglobulins of wild-type a2 rabbits are a2-positive and only a small percentage are a-negative. Genomic DNAs from homozygous mutant and wild-type animals were indistinguishable by Southern analyses using a variety of restriction enzyme digests and lgh probes. However, when digests with infrequently cutting enzymes were analyzed by transverse alternating-field electrophoresis, the ali DNA fragments were 10-15 kilobases smaller than the wild type. These fragments hybridized to probes both for VH and for a region of DNA a few kilobases downstream of the VH genes nearest the joining region. We suggest that this relatively small deletion affects a segment containing 3' VH genes with important regulatory functions, the loss of which leads to the ali phenotype. These results, and the fact that the 3' VH genes rearrange early in B-cell development, indicate that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression.

Culture impact in construction supply chain management

OpenAIRE

Tzortzatou, E. P.

2008-01-01

Awareness of cultural differences in construction supply chains is of fundamental importance because only through a thorough understanding of the manifestations of culture can fragmented supply chains be appropriately integrated into cohesive and collaborating teams which enhance project performance Hence the concept of cultural alignment with the project supply chain is introduced in order for long-term collaborative relationships based on trust, co ordination and mutual benefit to be establ...

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments

International Nuclear Information System (INIS)

Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.

2016-01-01

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying

Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

Science.gov (United States)

Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

2015-07-01

The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

Supplemental Dietary Inulin of Variable Chain Lengths Alters Intestinal Bacterial Populations in Young Pigs123

Science.gov (United States)

Patterson, Jannine K.; Yasuda, Koji; Welch, Ross M.; Miller, Dennis D.; Lei, Xin Gen

2010-01-01

Previously, we showed that supplementation of diets with short-chain inulin (P95), long-chain inulin (HP), and a 50:50 mixture of both (Synergy 1) improved body iron status and altered expression of the genes involved in iron homeostasis and inflammation in young pigs. However, the effects of these 3 types of inulin on intestinal bacteria remain unknown. Applying terminal restriction fragment length polymorphism analysis, we determined the abundances of luminal and adherent bacterial populations from 6 segments of the small and large intestines of pigs (n = 4 for each group) fed an iron-deficient basal diet (BD) or the BD supplemented with 4% of P95, Synergy 1, or HP for 5 wk. Compared with BD, all 3 types of inulin enhanced (P inulin on bacterial populations in the lumen contents were found. Meanwhile, all 3 types of inulin suppressed the less desirable bacteria Clostridium spp. and members of the Enterobacteriaceae in the lumen and mucosa of various gut segments. Our findings suggest that the ability of dietary inulin to alter intestinal bacterial populations may partially account for its iron bioavailability-promoting effect and possibly other health benefits. PMID:20980641

Construction and expression of a functional monoclonal antibody SZ-51 specific for GMP-140 chimeric fab fragment in Escherichia coli

International Nuclear Information System (INIS)

Gu Jianming; Zhang Xiaomin; Xia Lijun; Wan Haiying; Liu Yue; Li Peixia; Ruan Changgeng

1996-04-01

The variable region cDNAs of a monoclonal antibody SZ-51 specific for α-granule membrane protein (GMP-140) on the surface of activated human platelets were spliced with the constant region cDNA of the heavy chain CH1 and light chain k of human Ig G by means of the gene recombination techniques. The above recombinant gene was amplified by the polymerase chain reaction (PCR). The expression vector of phage plasmid pHEN1 SZ-51 Fab/Hu was constructed. The pHEN1-51 Fab/Hu was introduced into non-suppressor E. coli HB2151. The amount of expression of SZ-51 chimeric Fab/Hu measured by quantitative ELISA was about 500 μg/L. Western blot demonstrated that the SZ-51 chimeric Fab fragment could specifically bind to GMP-140. (2 figs.)

New construction of eigenstates and separation of variables for SU( N) quantum spin chains

Science.gov (United States)

Gromov, Nikolay; Levkovich-Maslyuk, Fedor; Sizov, Grigory

2017-09-01

We conjecture a new way to construct eigenstates of integrable XXX quantum spin chains with SU( N) symmetry. The states are built by repeatedly acting on the vacuum with a single operator B good( u) evaluated at the Bethe roots. Our proposal serves as a compact alternative to the usual nested algebraic Bethe ansatz. Furthermore, the roots of this operator give the separated variables of the model, explicitly generalizing Sklyanin's approach to the SU( N) case. We present many tests of the conjecture and prove it in several special cases. We focus on rational spin chains with fundamental representation at each site, but expect many of the results to be valid more generally.

Porous silicon biosensor for detection of variable domain of heavy-chain of HCAb antibody

Science.gov (United States)

Zhang, Hong-yan; Lü, Xiao-yi; Jia, Zhen-hong; Li, Jiang-wei; Zhang, Fu-chun

2012-03-01

In this paper, we produce porous silicon (PSi) by electrochemical etching, and it is the first time to evaluate the performance of label-free porous silicon biosensor for detection of variable domain of heavy chain of heavy-chain antibody (VHH). The binding of hen egg white lysozyme (HEWL) and VHH causes a red shift in the reflection spectrum of the biosensor. The red shift is proportional to the VHH concentration in the range from 14 g·ml-1 to 30 g·ml-1 with a detection limit of 0.648 ng·ml-1. The research is useful for the development of label-free biosensor applied in the rapid and sensitive determination of small molecules.

Polyurea with luminophor fragments in polymer chain: synthesis and spectral properties

Science.gov (United States)

Novikova, Tamara S.; Barashkov, Nikolay N.; Sakhno, Tamara V.

2003-12-01

A series of aliphatic polyureas with chromophore moieties in the polymer chain, such as 7-amino-2(4"-aminophenyl)benzoxazole, have been prepared. The absorption and fluorescence spectra of these polymers as well as corresponding chromophore-containing model urea (product of condensation of 7-amino-2(4"-amino-2"-hydroxyphenyl)benzoxazole and phenylisocyanate) were studied and compared. It was found that the special feature of the model compound and polyureas is the large value of Stokes shift due to the presence of a hydroxy group in the ortho-position to the nitrogen atom of the benzoxazole ring. The model of the excited-state proton transfer in molecules containing fragments of 2-(2"-hydroxyphenyl)benzoxazole has been used for the description of bathochromic shift in emission spectra of polymer solutions and films. According to this model, the proton remains predominantly on the phenol oxygen while in the ground state (enol form). Upon UV excitation, in the first excited singlet state, the phenol is a considerably stronger acid and the nitrogen is a stronger base. Thus, the proton is transferred from the oxygen site to the nitrogen site, and the isomer formed (S"1*) is more stable than the isomer before proton transfer (S1*) S"1* can be then regarded as a vibrationally excited form of S1*. Then the molecule de-excites to the ground state, emitting a photon. In the ground state the enol form is again the more stable form and the proton will then transfer back to the oxygen. S"o is also a vibrationally excited state of So. Because of this process the absorption and fluorescence spectra of model urea and polyureas do not intersect and the value of Stokes shift is about 6000 cm-1.

Determination of allergen specificity by heavy chains in grass pollen allergen-specific IgE antibodies.

Science.gov (United States)

Gadermaier, Elisabeth; Flicker, Sabine; Lupinek, Christian; Steinberger, Peter; Valenta, Rudolf

2013-04-01

Affinity and clonality of allergen-specific IgE antibodies are important determinants for the magnitude of IgE-mediated allergic inflammation. We sought to analyze the contribution of heavy and light chains of human allergen-specific IgE antibodies for allergen specificity and to test whether promiscuous pairing of heavy and light chains with different allergen specificity allows binding and might affect affinity. Ten IgE Fabs specific for 3 non-cross-reactive major timothy grass pollen allergens (Phl p 1, Phl p 2, and Phl p 5) obtained by means of combinatorial cloning from patients with grass pollen allergy were used to construct stable recombinant single chain variable fragments (ScFvs) representing the original Fabs and shuffled ScFvs in which heavy chains were recombined with light chains from IgE Fabs with specificity for other allergens by using the pCANTAB 5 E expression system. Possible ancestor genes for the heavy chain and light chain variable region-encoding genes were determined by using sequence comparison with the ImMunoGeneTics database, and their chromosomal locations were determined. Recombinant ScFvs were tested for allergen specificity and epitope recognition by means of direct and sandwich ELISA, and affinity by using surface plasmon resonance experiments. The shuffling experiments demonstrate that promiscuous pairing of heavy and light chains is possible and maintains allergen specificity, which is mainly determined by the heavy chains. ScFvs consisting of different heavy and light chains exhibited different affinities and even epitope specificity for the corresponding allergen. Our results indicate that allergen specificity of allergen-specific IgE is mainly determined by the heavy chains. Different heavy and light chain pairings in allergen-specific IgE antibodies affect affinity and epitope specificity and thus might influence clinical reactivity to allergens. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by

Using Variable-Length Aligned Fragment Pairs and an Improved Transition Function for Flexible Protein Structure Alignment.

Science.gov (United States)

Cao, Hu; Lu, Yonggang

2017-01-01

With the rapid growth of known protein 3D structures in number, how to efficiently compare protein structures becomes an essential and challenging problem in computational structural biology. At present, many protein structure alignment methods have been developed. Among all these methods, flexible structure alignment methods are shown to be superior to rigid structure alignment methods in identifying structure similarities between proteins, which have gone through conformational changes. It is also found that the methods based on aligned fragment pairs (AFPs) have a special advantage over other approaches in balancing global structure similarities and local structure similarities. Accordingly, we propose a new flexible protein structure alignment method based on variable-length AFPs. Compared with other methods, the proposed method possesses three main advantages. First, it is based on variable-length AFPs. The length of each AFP is separately determined to maximally represent a local similar structure fragment, which reduces the number of AFPs. Second, it uses local coordinate systems, which simplify the computation at each step of the expansion of AFPs during the AFP identification. Third, it decreases the number of twists by rewarding the situation where nonconsecutive AFPs share the same transformation in the alignment, which is realized by dynamic programming with an improved transition function. The experimental data show that compared with FlexProt, FATCAT, and FlexSnap, the proposed method can achieve comparable results by introducing fewer twists. Meanwhile, it can generate results similar to those of the FATCAT method in much less running time due to the reduced number of AFPs.

Kinetic analysis of a monoclonal therapeutic antibody and its single-chain homolog by surface plasmon resonance.

Science.gov (United States)

Patel, Rekha; Andrien, Bruce A

2010-01-01

Monoclonal antibodies (mAbs) and antibody fragments have become an emerging class of therapeutics since 1986. Their versatility enables them to be engineered for optimal efficiency and decreased immunogenicity, and the path to market has been set by recent regulatory approvals. One of the initial criteria for success of any protein or antibody therapeutic is to understand its binding characteristics to the target antigen. Surface plasmon resonance (SPR) has been widely used and is an important tool for ligand-antigen binding characterization. In this work, the binding kinetics of a recombinant mAb and its single-chain antibody homolog, single-chain variable fragment (scFv), was analyzed by SPR. These two proteins target the same antigen. The binding kinetics of the mAb (bivalent antibody) and scFv (monovalent scFv) for this antigen was analyzed along with an assessment of the thermodynamics of the binding interactions. Alternative binding configurations were investigated to evaluate potential experimental bias because theoretically experimental binding configuration should have no impact on binding kinetics. Self-association binding kinetics in the proteins' respective formulation solutions and antigen epitope mapping were also evaluated. Functional characterization of monoclonal and single-chain antibodies has become just as important as structural characterization in the biotechnology field.

SCEDS: protein fragments for molecular replacement in Phaser

Energy Technology Data Exchange (ETDEWEB)

McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)

2013-11-01

Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.

SCEDS: protein fragments for molecular replacement in Phaser

International Nuclear Information System (INIS)

McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.

2013-01-01

Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser

Targeting nanodisks via a single chain variable antibody - Apolipoprotein chimera

International Nuclear Information System (INIS)

Iovannisci, David M.; Beckstead, Jennifer A.; Ryan, Robert O.

2009-01-01

Nanodisks (ND) are nanometer scale complexes of phospholipid and apolipoprotein that have been shown to function as drug delivery vehicles. ND harboring significant quantities of the antifungal agent, amphotericin B, or the bioactive isoprenoid, all trans retinoic acid, have been generated and characterized. As currently formulated, ND possess limited targeting capability. In this study, we constructed a single chain variable antibody (scFv).apolipoprotein chimera and assessed the ability of this fusion protein to form ND and recognize the antigen to which the scFv is directed. Data obtained revealed that α-vimentin scFv.apolipoprotein A-I is functional in ND formation and antigen recognition, opening the door to the use of such chimeras in targeting drug-enriched ND to specific tissues.

Estimation of the reaction efficiency in polymerase chain reaction

NARCIS (Netherlands)

Lalam, N.

2006-01-01

Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

Beta-scission of side-chain alkoxyl radicals on peptides and proteins results in the loss of side-chains as aldehydes and ketones

DEFF Research Database (Denmark)

Headlam, Henrietta A; Davies, Michael Jonathan

2002-01-01

Exposure of proteins to radicals in the presence of O(2) results in side-chain oxidation and backbone fragmentation; the interrelationship between these processes is not fully understood. Recently, initial attack on Ala side-chains was shown to give alpha-carbon radicals (and hence backbone cleav...

Gallstone fragmentation by control electrohydraulic lithotripsy

International Nuclear Information System (INIS)

Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

1989-01-01

The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

Science.gov (United States)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

2017-01-18

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

Directory of Open Access Journals (Sweden)

Pooja H. Gupta

2015-05-01

Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

The production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi

NARCIS (Netherlands)

Joosten, V.; Lokman, C.; Hondel, C.A.M.J.J. van den; Punt, P.J.

2003-01-01

In this review we will focus on the current status and views concerning the production of antibody fragments and antibody fusion proteins by yeasts and filamentous fungi. We will focus on single-chain antibody fragment production (scFv and VHH) by these lower eukaryotes and the possible applications

Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

Directory of Open Access Journals (Sweden)

Kush Shrivastava

2015-10-01

Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

Nanobodies and Nanobody-Based Human Heavy Chain Antibodies As Antitumor Therapeutics

Directory of Open Access Journals (Sweden)

Peter Bannas

2017-11-01

Full Text Available Monoclonal antibodies have revolutionized cancer therapy. However, delivery to tumor cells in vivo is hampered by the large size (150 kDa of conventional antibodies. The minimal target recognition module of a conventional antibody is composed of two non-covalently associated variable domains (VH and VL. The proper orientation of these domains is mediated by their hydrophobic interface and is stabilized by their linkage to disulfide-linked constant domains (CH1 and CL. VH and VL domains can be fused via a genetic linker into a single-chain variable fragment (scFv. scFv modules in turn can be fused to one another, e.g., to generate a bispecific T-cell engager, or they can be fused in various orientations to antibody hinge and Fc domains to generate bi- and multispecific antibodies. However, the inherent hydrophobic interaction of VH and VL domains limits the stability and solubility of engineered antibodies, often causing aggregation and/or mispairing of V-domains. Nanobodies (15 kDa and nanobody-based human heavy chain antibodies (75 kDa can overcome these limitations. Camelids naturally produce antibodies composed only of heavy chains in which the target recognition module is composed of a single variable domain (VHH or Nb. Advantageous features of nanobodies include their small size, high solubility, high stability, and excellent tissue penetration in vivo. Nanobodies can readily be linked genetically to Fc-domains, other nanobodies, peptide tags, or toxins and can be conjugated chemically at a specific site to drugs, radionuclides, photosensitizers, and nanoparticles. These properties make them particularly suited for specific and efficient targeting of tumors in vivo. Chimeric nanobody-heavy chain antibodies combine advantageous features of nanobodies and human Fc domains in about half the size of a conventional antibody. In this review, we discuss recent developments and perspectives for applications of nanobodies and nanobody

Nanobodies and Nanobody-Based Human Heavy Chain Antibodies As Antitumor Therapeutics.

Science.gov (United States)

Bannas, Peter; Hambach, Julia; Koch-Nolte, Friedrich

2017-01-01

Monoclonal antibodies have revolutionized cancer therapy. However, delivery to tumor cells in vivo is hampered by the large size (150 kDa) of conventional antibodies. The minimal target recognition module of a conventional antibody is composed of two non-covalently associated variable domains (VH and VL). The proper orientation of these domains is mediated by their hydrophobic interface and is stabilized by their linkage to disulfide-linked constant domains (CH1 and CL). VH and VL domains can be fused via a genetic linker into a single-chain variable fragment (scFv). scFv modules in turn can be fused to one another, e.g., to generate a bispecific T-cell engager, or they can be fused in various orientations to antibody hinge and Fc domains to generate bi- and multispecific antibodies. However, the inherent hydrophobic interaction of VH and VL domains limits the stability and solubility of engineered antibodies, often causing aggregation and/or mispairing of V-domains. Nanobodies (15 kDa) and nanobody-based human heavy chain antibodies (75 kDa) can overcome these limitations. Camelids naturally produce antibodies composed only of heavy chains in which the target recognition module is composed of a single variable domain (VHH or Nb). Advantageous features of nanobodies include their small size, high solubility, high stability, and excellent tissue penetration in vivo . Nanobodies can readily be linked genetically to Fc-domains, other nanobodies, peptide tags, or toxins and can be conjugated chemically at a specific site to drugs, radionuclides, photosensitizers, and nanoparticles. These properties make them particularly suited for specific and efficient targeting of tumors in vivo . Chimeric nanobody-heavy chain antibodies combine advantageous features of nanobodies and human Fc domains in about half the size of a conventional antibody. In this review, we discuss recent developments and perspectives for applications of nanobodies and nanobody-based human heavy

Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Azzedine Bounamous

2014-07-01

Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

A simple and robust approach to immobilization of antibody fragments.

Science.gov (United States)

Ikonomova, Svetlana P; He, Ziming; Karlsson, Amy J

2016-08-01

Antibody fragments, such as the single-chain variable fragment (scFv), have much potential in research and diagnostics because of their antigen-binding ability similar to a full-sized antibody and their ease of production in microorganisms. Some applications of antibody fragments require immobilization on a surface, and we have established a simple immobilization method that is based on the biotin-streptavidin interaction and does not require a separate purification step. We genetically fused two biotinylation tags-the biotin carboxyl carrier protein (BCCP) or the AviTag minimal sequence-to six different scFvs (scFv13R4, scFvD10, scFv26-10, scFv3, scFv5, and scFv12) for site-specific biotinylation in vivo by endogenous biotin ligases produced by Escherichia coli. The biotinylated scFvs were immobilized onto streptavidin-coated plates directly from cell lysates, and immobilization was detected through enzyme-linked immunosorbent assays. All scFvs fusions were successfully immobilized, and scFvs biotinylated via the BCCP tag tended to immobilize better than those biotinylated via the AviTag, even when biotinylation efficiency was improved with the biotin ligase BirA. The ability of immobilized scFvs to bind antigens was confirmed using scFv13R4 and scFvD10 with their respective targets β-galactosidase and bacteriophage lambda head protein D (gpD). The immobilized scFv13R4 bound to β-galactosidase at the same level for both biotinylation tags when the surface was saturated with the scFv, and immobilized scFvs retained their functionality for at least 100days after immobilization. The simplicity and robustness of our method make it a promising approach for future applications that require antibody fragment immobilization. Copyright © 2016 Elsevier B.V. All rights reserved.

Structural differences between glycosylated, disulfide-linked heterodimeric Knob-into-Hole Fc fragment and its homodimeric Knob-Knob and Hole-Hole side products.

Science.gov (United States)

Kuglstatter, A; Stihle, M; Neumann, C; Müller, C; Schaefer, W; Klein, C; Benz, J

2017-09-01

An increasing number of bispecific therapeutic antibodies are progressing through clinical development. The Knob-into-Hole (KiH) technology uses complementary mutations in the CH3 region of the antibody Fc fragment to achieve heavy chain heterodimerization. Here we describe the X-ray crystal structures of glycosylated and disulfide-engineered heterodimeric KiH Fc fragment and its homodimeric Knob-Knob and Hole-Hole side products. The heterodimer structure confirms the KiH design principle and supports the hypothesis that glycosylation stabilizes a closed Fc conformation. Both homodimer structures show parallel Fc fragment architectures, in contrast to recently reported crystal structures of the corresponding aglycosylated Fc fragments which in the absence of disulfide mutations show an unexpected antiparallel arrangement. The glycosylated Knob-Knob Fc fragment is destabilized as indicated by variability in the relative orientation of its CH3 domains. The glycosylated Hole-Hole Fc fragment shows an unexpected intermolecular disulfide bond via the introduced Y349C Hole mutation which results in a large CH3 domain shift and a new CH3-CH3 interface. The crystal structures of glycosylated, disulfide-linked KiH Fc fragment and its Knob-Knob and Hole-Hole side products reported here will facilitate further design of highly efficient antibody heterodimerization strategies. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

An analysis of the variables that provide a supply chain with sustainable competitiveness An analysis of the variables that provide a supply chain with sustainable competitiveness Análisis de las variables que proporcionan una competitividad sostenible de la cadena de suministro

Directory of Open Access Journals (Sweden)

José A.D. Machuca

2012-04-01

Full Text Available Purpose: An agile, adaptable and aligned (Triple A supply chain (SC would seem to be key to obtaining sustainable competitive advantages. Little previous research has been done into the topic, however, and there are even discrepancies on the conceptual level. For this reason this study aims to propose a reference framework to determine the dimensions and factors that define agility, adaptability and alignment in the SC and to facilitate both the evaluation of its state by managers and researchers with respect to these variables and also the development of empirical research that determines its impact on performance.Design/methodology: A systematic literature review was carried out of specialist Operations Management, Logistics, Management and Supply Chain Management journals using the ProQuest (Abi/Inform Global database. The articles retrieved were examined and those that were relevant for this study were selected. Using these, a qualitative analysis was done that led to the proposed goal being achieved. Findings: This study sets out the definitions, dimensions and factors of the three variables and groups them together for the first time, thus providing a solid conceptual frame. Although the number of articles that analyse one or other of the variables is growing, it is still low. Agility is the variable on which most research has been done, while adaptability is the least analysed.Research limitations/implications: A theoretical reference framework is proposed for the Triple A in the SC based on earlier studies which do not discuss the joint effect of three variables, as a result of which there is no tested theoretical base. The model will be analysed empirically in future research.Originality/value: The lack of papers on agility, adaptability and alignment in the supply chain and the lack of a consensus regarding the dimensions and factors to define them reveal a need for studies such as this. Normal 0 21 false false false Microsoft

Non-surface activity and micellization behavior of cationic amphiphilic block copolymer synthesized by reversible addition-fragmentation chain transfer process.

Science.gov (United States)

Ghosh, Arjun; Yusa, Shin-ichi; Matsuoka, Hideki; Saruwatari, Yoshiyuki

2011-08-02

Cationic amphiphilic diblock copolymers of poly(n-butylacrylate)-b-poly(3-(methacryloylamino)propyl)trimethylammonium chloride) (PBA-b-PMAPTAC) with various hydrophobic and hydrophilic chain lengths were synthesized by a reversible addition-fragmentation chain transfer (RAFT) process. Their molecular characteristics such as surface activity/nonactivity were investigated by surface tension measurements and foam formation observation. Their micelle formation behavior and micelle structure were investigated by fluorescence probe technique, static and dynamic light scattering (SLS and DLS), etc., as a function of hydrophilic and hydrophobic chain lengths. The block copolymers were found to be non-surface active because the surface tension of the aqueous solutions did not change with increasing polymer concentration. Critical micelle concentration (cmc) of the polymers could be determined by fluorescence and SLS measurements, which means that these polymers form micelles in bulk solution, although they were non-surface active. Above the cmc, the large blue shift of the emission maximum of N-phenyl-1-naphthylamine (NPN) probe and the low micropolarity value of the pyrene probe in polymer solution indicate the core of the micelle is nonpolar in nature. Also, the high value of the relative intensity of the NPN probe and the fluorescence anisotropy of the 1,6-diphenyl-1,3,5-hexatriene (DPH) probe indicated that the core of the micelle is highly viscous in nature. DLS was used to measure the average hydrodynamic radii and size distribution of the copolymer micelles. The copolymer with the longest PBA block had the poorest water solubility and consequently formed micelles with larger size while having a lower cmc. The "non-surface activity" was confirmed for cationic amphiphilic diblock copolymers in addition to anionic ones studied previously, indicating the universality of non-surface activity nature.

Linear and nonlinear relationships between biodegradation potential and molecular descriptors/fragments for organic pollutants and a theoretical interpretation

International Nuclear Information System (INIS)

He, Jia; Qin, Weichao; Zhang, Xujia; Wen, Yang; Su, Limin; Zhao, Yuanhui

2013-01-01

Prediction of the biodegradability of organic pollutants is an ecologically desirable and economically feasible tool for estimating the environmental fate of chemicals. In this paper, linear and nonlinear relationships between biological oxygen demand (BOD) and molecular descriptors/fragments have been investigated for 1130 organic chemicals. Significant relationships have been observed between the simple molecular descriptors and %BOD for some homologous compounds, but not for the whole set of compounds. Electronic parameters, such as E HOMO and E LUMO , are the dominant factors affecting the biodegradability for some homologous chemicals. However, other descriptors, such as molecular weight, acid dissociation constant and polarity still have a significant impact on the biodegradation. The best global model for %BOD prediction is that developed from a chain-based fragmentation scheme. At the same time, the theoretical relationship between %BOD and molecular descriptors/fragments has been investigated, based on a first-order kinetic process. The %BOD is nonlinearly, rather than linearly, related to the descriptors. The coefficients of determination can be significantly improved by using nonlinear models for the homologous compounds and the whole data set. After analysing 1130 ready and not ready biodegradable compounds using 23 simple descriptors and various fragmentation schemes, it was revealed that biodegradation could be well predicted from a chain-based fragmentation scheme, a decision tree and a %BOD model. The models were capable of separating NRB and RB with an overall accuracy of 87.2%, 83.0% and 82.5%, respectively. The best classification model developed was a chain-based model but it used 155 fragments. The simplest model was a decision tree which only used 10 structural fragments. The effect of structures on the biodegradation has been analysed and the biodegradation pathway and mechanisms have been discussed based on activating and inactivating

Aptamers, antibody scFv, and antibody Fab' fragments: An overview and comparison of three of the most versatile biosensor biorecognition elements.

Science.gov (United States)

Crivianu-Gaita, Victor; Thompson, Michael

2016-11-15

The choice of biosensing elements is crucial for the development of the optimal biosensor. Three of the most versatile biosensing elements are antibody single-chain Fv fragments (scFv), antibody fragment-antigen binding (Fab') units, and aptamers. This article provides an overview of these three biorecognition elements with respects to their synthesis/engineering, various immobilization techniques, and examples of their use in biosensors. Furthermore, the final section of the review compares and contrasts their characteristics (time/cost of development, ease and variability of immobilization, affinity, stability) illustrating their advantages and disadvantages. Overall, scFv fragments are found to display the highest customizability (i.e. addition of functional groups, immobilizing peptides, etc.) due to recombinant synthesis techniques. If time and cost are an issue in the development of the biosensor, Fab' fragments should be chosen as they are relatively cheap and can be developed quickly from whole antibodies (several days). However, if there are sufficient funds and time is not a factor, aptamers should be utilized as they display the greatest affinity towards their target analytes and are extremely stable (excellent biosensor regenerability). Copyright © 2016 Elsevier B.V. All rights reserved.

Cell surface expression of single chain antibodies with applications to imaging of gene expression in vivo

International Nuclear Information System (INIS)

Northrop, Jeffrey P.; Bednarski, Mark; Li, King C.; Barbieri, Susan O.; Lu, Amy T.; Nguyen, Dee; Varadarajan, John; Osen, Maureen; Star-Lack, Josh

2003-01-01

Imaging of gene expression in vivo has many potential uses for biomedical research and drug discovery, ranging from the study of gene regulation and cancer to the non-invasive assessment of gene therapies. To streamline the development of imaging marker gene technologies for nuclear medicine, we propose a new approach to the design of reporter/probe pairs wherein the reporter is a cell surface-expressed single chain antibody variable fragment that has been raised against a low molecular weight imaging probe with optimized pharmacokinetic properties. Proof of concept of the approach was achieved using a single chain antibody variable fragment that binds with high affinity to fluorescein and an imaging probe consisting of fluorescein isothiocyanate coupled to the chelator diethylene triamine penta-acetic acid labeled with the gamma-emitter 111 In. We demonstrate specific high-affinity binding of this probe to the cell surface-expressed reporter in vitro and assess the in vivo biodistribution of the probe both in wild-type mice and in mice harboring tumor xenografts expressing the reporter. Specific uptake of the probe by, and in vivo imaging of, tumors expressing the reporter are shown. Since ScFvs with high affinities can be raised to almost any protein or small molecule, the proposed methodology may offer a new flexibility in the design of imaging tracer/reporter pairs wherein both probe pharmacokinetics and binding affinities can be readily optimized. (orig.)

SCit: web tools for protein side chain conformation analysis

OpenAIRE

Gautier, R.; Camproux, A.-C.; Tufféry, P.

2004-01-01

SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each...

SCit: web tools for protein side chain conformation analysis.

Science.gov (United States)

Gautier, R; Camproux, A-C; Tufféry, P

2004-07-01

SCit is a web server providing services for protein side chain conformation analysis and side chain positioning. Specific services use the dependence of the side chain conformations on the local backbone conformation, which is described using a structural alphabet that describes the conformation of fragments of four-residue length in a limited library of structural prototypes. Based on this concept, SCit uses sets of rotameric conformations dependent on the local backbone conformation of each protein for side chain positioning and the identification of side chains with unlikely conformations. The SCit web server is accessible at http://bioserv.rpbs.jussieu.fr/SCit.

Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

DEFF Research Database (Denmark)

Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

2000-01-01

The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...

Chain-end modification of living anionic polybutadiene with diphenylethylenes and styrenes

NARCIS (Netherlands)

Donkers, E.H.D.; Willemse, R.X.E.; Klumperman, B.

2005-01-01

The first step in the transformation of poly(butadienyl)lithium into a macromolecular atom transfer radical polymerization initiator or reversible addition-fragmentation chain transfer agent is the modification of the anionic chain end into a suitable leaving/reinitiating group. We have investigated

The influence of ionizing radiation on the structure of Ca-ATPase hydrophobic fragment of skeletal muscle sarcoplasmic reticulum

International Nuclear Information System (INIS)

Vojtsitskij, V.M.; Fedorov, A.N.; Lugovskoj, Eh.B.; Derzskaya, S.G.; Khizhnyak, S.V.; Kurskij, M.D.; Kucherenko, N.E.

1990-01-01

Early (1 and 24 h) after X-irradiation with a dose of 0.21 C/kg changes occurred in the acceptibility of the polypeptide chain parts of sarcoplasmic reticulum Ca-ATPase for the effect of trypsin. The analysis of the results of studying the structural and functional properties of a hydrophobic fragment of this enzyme in the control and after irradiation permitted to define the part of the Ca-ATPase polypeptide chain that provided ion selectivity of the fragment

Constant region of a kappa III immunoglobulin light chain as a major AL-amyloid protein

DEFF Research Database (Denmark)

Engvig, J P; Olsen, K E; Gislefoss, R E

1998-01-01

AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein and the correspond......AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein...... and the corresponding AL protein as a kappa III immunoglobulin light chain from material of a patient with systemic AL-amyloidosis presenting as a local inguinal tumour. The two proteins showed some unique features. The major part of the AL amyloid fibril protein consisted of C-terminal fragments of the Bence......-Jones protein. Furthermore, both the Bence-Jones protein and the AL protein were glycosylated, with possibly a glycosylation in the constant part of the light chain....

Properties, production and applications of camelid single-domain antibody fragments

NARCIS (Netherlands)

Harmsen, M.M.; Haard, de H.J.

2007-01-01

Camelids produce functional antibodies devoid of light chains of which the single N-terminal domain is fully capable of antigen binding. These single-domain antibody fragments (VHHs or Nanobodies®) have several advantages for biotechnological applications. They are well expressed in microorganisms

Rapid isolation of IgNAR variable single-domain antibody fragments from a shark synthetic library.

Science.gov (United States)

Shao, Cui-Ying; Secombes, Chris J; Porter, Andrew J

2007-01-01

The immunoglobulin isotype IgNAR (Novel Antigen Receptor) was discovered in the serum of the nurse shark (Ginglymostoma cirratum) and wobbegong shark (Orectolobus maculates) as a homodimer of two protein chains, each composed of a single variable domain (V) domain and five constant domains. The IgNAR variable domain contains an intact antigen-binding site and functions as an independent domain able to react to antigen with both high specificity and affinity. Here we describe the successful construction of a synthetic phage-displayed library based upon a single anti-lysozyme clone HEL-5A7 scaffold, which was previously selected from an immune IgNAR variable domain library. The complementarity-determining region 3 (CDR3) loop of this clone was varied in both length and composition and the derived library was used to pan against two model proteins, lysozyme and leptin. A single anti-lysozyme clone (Ly-X20) and anti-leptin clone (Lep-12E1) were selected for further study. Both clones were shown to be functionally expressed in Escherichia coli, extremely thermostable and bind to corresponding antigens specifically. The results here demonstrate that a synthetic IgNAR variable domain library based on a single framework scaffold can be used as a route to generate antigen binders quickly, easily and without the need of immunization.

Characterization of Lipid A Variants by Energy-Resolved Mass Spectrometry: Impact of Acyl Chains

Science.gov (United States)

Crittenden, Christopher M.; Akin, Lucas D.; Morrison, Lindsay J.; Trent, M. Stephen; Brodbelt, Jennifer S.

2017-06-01

Lipid A molecules consist of a diglucosamine sugar core with a number of appended acyl chains that vary in their length and connectivity. Because of the challenging nature of characterizing these molecules and differentiating between isomeric species, an energy-resolved MS/MS strategy was undertaken to track the fragmentation trends and map genealogies of product ions originating from consecutive cleavages of acyl chains. Generalizations were developed based on the number and locations of the primary and secondary acyl chains as well as variations in preferential cleavages arising from the location of the phosphate groups. Secondary acyl chain cleavage occurs most readily for lipid A species at the 3' position, followed by primary acyl chain fragmentation at both the 3' and 3 positions. In the instances of bisphosphorylated lipid A variants, phosphate loss occurs readily in conjunction with the most favorable primary and secondary acyl chain cleavages. [Figure not available: see fulltext.

Projectile rapidity dependence in target fragmentation

International Nuclear Information System (INIS)

Haustein, P.E.; Cumming, J.B.; Hseuh, H.C.

1979-01-01

The thick-target, thick-catcher technique was used to determine mean kinetic properties of selected products of the fragmentation of Cu by 1 H, 4 He, and 12 C ions (180 to 28,000 MeV/amu). Momentum transfer, as inferred from F/B ratios, is ovserved to occur most efficiently for the lower velocity projectiles. Recoil properties of target fragments vary strongly with product mass, but show only a weak dependence on projectile type. The projectile's rapidity is shown to be a useful variable for quantitative intercomparison of different reactions. These results indicate that E/sub proj//A/sub proj/ is the dominant parameter which governs the mean recoil behavior of target fragments. 20 references

Heart Rate Fragmentation: A Symbolic Dynamical Approach

Directory of Open Access Journals (Sweden)

Madalena D. Costa

2017-11-01

Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to

Global Value Chain Indicators: Application to the Italian Sectors - Gli indicatori della global value chain: un’applicazione ai settori italiani

OpenAIRE

Ricotta, Fernanda

2010-01-01

In this paper the extent of international fragmentation of production in Italian manufacturing industries for the years 1985, 1995 and 2000 is assessed with different indicators. The objective is to determine where fragmentation is most prevalent and to provide a description of the key characteristics of those sectors. The paper first presents a survey of global value chain indicators and how these have been used in the economic literature. The second part supplies empirical evidence on the g...

Plasmon-Polariton Properties in Metallic Nanosphere Chains

Directory of Open Access Journals (Sweden)

Witold Aleksander Jacak

2015-06-01

Full Text Available The propagation of collective wave type plasmonic excitations along infinite chains of metallic nanospheres has been analyzed, including near-, medium- and far-field contributions to the plasmon dipole interaction with all retardation effects taken into account. It is proven that there exist weakly-damped self-modes of plasmon-polaritons in the chain for which the propagation range is limited by relatively small Ohmic losses only. In this regime, the Lorentz friction irradiation losses on each nanosphere in the chain are ideally compensated by the energy income from the rest of the chain. The completely undamped collective waves were identified in the case of the presence of persistent external excitation of some fragment of the chain. The obtained characteristics of these excitations fit the experimental observations well.

Efficient production of antibody Fab fragment by transient gene expression in insect cells.

Science.gov (United States)

Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

2017-08-01

Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Anticoagulant and calcium-binding properties of high molecular weight derivatives of human fibrinogen, produced by plasmin (fragments X)

NARCIS (Netherlands)

Nieuwenhuizen, W.; Gravesen, M.

1981-01-01

Early plasmin degradation products (X fragments) of human fibrinogen were prepared in the presence of calcium-ions or EGTA, and purified on Sepharose 6B-CL. X fragments were characterized with respect to amino-terminal amino acids, polypeptide-chain composition, anticlotting properties and

Characterization of a recombinant humanized anti-cocaine monoclonal antibody and its Fab fragment.

Science.gov (United States)

Kirley, Terence L; Norman, Andrew B

2015-01-01

Variations of post-translational modifications are important for stability and in vivo behavior of therapeutic antibodies. A recombinant humanized anti-cocaine monoclonal antibody (h2E2) was characterized for heterogeneity of N-linked glycosylation and disulfide bonds. In addition, charge heterogeneity, which is partially due to the presence or absence of C-terminal lysine on the heavy chains, was examined. For cocaine overdose therapy, Fab fragments may be therapeutic, and thus, a simplified method of generation, purification, and characterization of the Fab fragment generated by Endoproteinase Lys-C digestion was devised. Both the intact h2E2 antibody and purified Fab fragments were analyzed for their affinities for cocaine and 2 of its metabolites, benzoylecgonine and cocaethylene, by fluorescence quenching of intrinsic antibody tyrosine and tryptophan fluorescence resulting from binding of these drugs. Binding constants obtained from fluorescence quenching measurements are in agreement with recently published radioligand and ELISA binding assays. The dissociation constants determined for the h2E2 monoclonal and its Fab fragment are approximately 1, 5, and 20 nM for cocaethylene, cocaine, and benzoylecgonine, respectively. Tryptophan fluorescence quenching (emission at 330 nm) was measured after either excitation of tyrosine and tryptophan (280 nm) or selective excitation of tryptophan alone (295 nm). More accurate binding constants are obtained using tryptophan selective excitation at 295 nm, likely due to interfering absorption of cocaine and metabolites at 280 nm. These quenching results are consistent with multiple tryptophan and tyrosine residues in or near the predicted binding location of cocaine in a previously published 3-D model of this antibody's variable region.

Tumour targeting with monovalent fragments of anti-neuroblastoma antibody chCE7

International Nuclear Information System (INIS)

Carrel, F.; Novak-Hofer, I.; Ruch, C.; Zimmermann, K.; Amstutz, H.

1997-01-01

The in vitro and in vivo behaviour of the monovalent single chain (scFv) and Fab-fragments derived from anti-neuroblastoma antibody chCE7 is reported. When comparing tumour uptake and -retention of radioactivity of 67 Cu-labelled monovalent chCE7 with divalent chCE7 F(ab') 2 the advantage of the radiocopper label over the radioiodine label was more pronounced with the divalent (internalising) F(ab') 2 fragments. (author) 1 fig., 1 ref

Plug and Play Firms in the TNCs' Virtual Value Chain

Directory of Open Access Journals (Sweden)

Teresa Pakulska

2016-04-01

Full Text Available Growing virtualisation of the value chain appears to be an expression of implementation of ICT solutions in international business represented by TNCs. This creates new opportunities for cooperation within the value chain and its composition. The growing importance in this area can be attributed to companies integrating the value chain, known as plug and play. Their integration into the value creation chain gives a new dimension to TNCs' strategic choices from the fragmentation of activity and its integration on an international scale point of view.

Process and data fragmentation-oriented enterprise network integration with collaboration modelling and collaboration agents

Science.gov (United States)

Li, Qing; Wang, Ze-yuan; Cao, Zhi-chao; Du, Rui-yang; Luo, Hao

2015-08-01

With the process of globalisation and the development of management models and information technology, enterprise cooperation and collaboration has developed from intra-enterprise integration, outsourcing and inter-enterprise integration, and supply chain management, to virtual enterprises and enterprise networks. Some midfielder enterprises begin to serve for different supply chains. Therefore, they combine related supply chains into a complex enterprise network. The main challenges for enterprise network's integration and collaboration are business process and data fragmentation beyond organisational boundaries. This paper reviews the requirements of enterprise network's integration and collaboration, as well as the development of new information technologies. Based on service-oriented architecture (SOA), collaboration modelling and collaboration agents are introduced to solve problems of collaborative management for service convergence under the condition of process and data fragmentation. A model-driven methodology is developed to design and deploy the integrating framework. An industrial experiment is designed and implemented to illustrate the usage of developed technologies in this paper.

Alignment-free Transcriptomic and Metatranscriptomic Comparison Using Sequencing Signatures with Variable Length Markov Chains.

Science.gov (United States)

Liao, Weinan; Ren, Jie; Wang, Kun; Wang, Shun; Zeng, Feng; Wang, Ying; Sun, Fengzhu

2016-11-23

The comparison between microbial sequencing data is critical to understand the dynamics of microbial communities. The alignment-based tools analyzing metagenomic datasets require reference sequences and read alignments. The available alignment-free dissimilarity approaches model the background sequences with Fixed Order Markov Chain (FOMC) yielding promising results for the comparison of microbial communities. However, in FOMC, the number of parameters grows exponentially with the increase of the order of Markov Chain (MC). Under a fixed high order of MC, the parameters might not be accurately estimated owing to the limitation of sequencing depth. In our study, we investigate an alternative to FOMC to model background sequences with the data-driven Variable Length Markov Chain (VLMC) in metatranscriptomic data. The VLMC originally designed for long sequences was extended to apply to high-throughput sequencing reads and the strategies to estimate the corresponding parameters were developed. The flexible number of parameters in VLMC avoids estimating the vast number of parameters of high-order MC under limited sequencing depth. Different from the manual selection in FOMC, VLMC determines the MC order adaptively. Several beta diversity measures based on VLMC were applied to compare the bacterial RNA-Seq and metatranscriptomic datasets. Experiments show that VLMC outperforms FOMC to model the background sequences in transcriptomic and metatranscriptomic samples. A software pipeline is available at https://d2vlmc.codeplex.com.

Evaluation of radioiodinated and radiocopper labeled monovalent fragments of monoclonal antibody chCE7 for targeting of neuroblastoma

International Nuclear Information System (INIS)

Carrel, Francois; Amstutz, Hanspeter; Novak-Hofer, Ilse; Schubiger, P. August

1997-01-01

Monovalent fragments of antineuroblastoma antibody mAb chCE7 were evaluated for their in vitro and in vivo tumor cell binding properties. Single chain fragments were constructed from the variable region genes cloned from hybridoma cells, expressed in E.coli and purified by metal chelate affinity chromatography. Radioiodinated CE7-scFv fragments were found to bind with high affinity (K d ∼10 -9 M) to target cells in vitro but formed aggregates at 37 deg. C, and bound to serum proteins in vitro and in vivo. Circular Dichroism spectra revealed the protein to be in a conformationally altered form and no permanent 'refolding' could be achieved. In contrast, chCE7-Fab fragments were found to bind to target tumor cells with similar affinity than the parent mAb chCE7 (K d ∼10 -10 M), showed no tendency to aggregate and were stable in serum both in vitro and in vivo. Kinetics of association and dissociation of radioiodinated scFv and Fab fragments were found to be rapid. Radioiodination with the Iodogen method led to impaired immunoreactivity which was found to further increase the off- rates of radioiodinated fragments from tumor cells. Radioiodination with the Bolton-Hunter reagent as well as labeling of chCE7-Fab fragments with 67 Cu via the macrocyclic CPTA ligand led to fully immunoreactive Fab fragments. Radioiodinated and radiocopper labeled monovalent CE7 fragments did not internalize into target tumor cells as the parent mAb and its F(ab') 2 fragment. A comparison of the biodistribution in tumor bearing nude mice of the radiocopper labeled monovalent, non internalizing Fab fragments with the internalizing divalent F(ab') 2 fragments showed in both cases high levels of radioactivity in the kidneys. Concerning tumor uptake, radioactivity from both internalizing and non internalizing fragments remained associated with tumor tissue for longer times than in case of the corresponding radioiodinated fragments. When compared with the radioiodinated forms, tumor uptake

A guide to the synthesis of block copolymers using reversible-addition fragmentation chain transfer (RAFT) polymerization.

Science.gov (United States)

Keddie, Daniel J

2014-01-21

The discovery of reversible-deactivation radical polymerization (RDRP) has provided an avenue for the synthesis of a vast array of polymers with a rich variety of functionality and architecture. The preparation of block copolymers has received significant focus in this burgeoning research field, due to their diverse properties and potential in a wide range of research environments. This tutorial review will address the important concepts behind the design and synthesis of block copolymers using reversible addition-fragmentation chain transfer (RAFT) polymerization. RAFT polymerization is arguably the most versatile of the RDRP methods due to its compatibility with a wide range of functional monomers and reaction media along with its relative ease of use. With an ever increasing array of researchers that possess a variety of backgrounds now turning to RDRP, and RAFT in particular, to prepare their required polymeric materials, it is pertinent to discuss the important points which enable the preparation of high purity functional block copolymers with targeted molar mass and narrow molar mass distribution using RAFT polymerization. The key principles of appropriate RAFT agent selection, the order of monomer addition in block synthesis and potential issues with maintaining high end-group fidelity are addressed. Additionally, techniques which allow block copolymers to be accessed using a combination of RAFT polymerization and complementary techniques are touched upon.

Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

Science.gov (United States)

Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

2016-07-29

A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

Science.gov (United States)

Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

1998-02-01

A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

In Vitro Comparison of Holmium Lasers: Evidence for Shorter Fragmentation Time and Decreased Retropulsion Using a Modern Variable-pulse Laser.

Science.gov (United States)

Bell, John Roger; Penniston, Kristina L; Nakada, Stephen Y

2017-09-01

To compare the performance of variable- and fixed-pulse lasers on stone phantoms in vitro. Seven-millimeter stone phantoms were made to simulate calcium oxalate monohydrate stones using BegoStone plus. The in vitro setting was created with a clear polyvinyl chloride tube. For each trial, a stone phantom was placed at the open end of the tubing. The Cook Rhapsody H-30 variable-pulse laser was tested on both long- and short-pulse settings and was compared to the Dornier H-20 fixed-pulse laser; 5 trials were conducted for each trial arm. Fragmentation was accomplished with the use of a flexible ureteroscope and a 273-micron holmium laser fiber using settings of 1 J × 12 Hz. The treatment time (in minute) for complete fragmentation was recorded as was the total retropulsion distance (in centimeter) during treatment. Laser fibers were standardized for all repetitions. The treatment time was significantly shorter with the H-30 vs the H-20 laser (14.3 ± 2.5 vs 33.1 ± 8.9 minutes, P = .008). There was no difference between the treatment times using the long vs short pulse widths of the H-30 laser (14.4 ± 3.4 vs 14.3 ± 1.7 minutes, P = .93). Retropulsion differed by laser type and pulse width, H-30 long pulse (15.8 ± 5.7 cm), H-30 short pulse (54.8 ± 7.1 cm), and H-20 (33.2 ± 12.5 cm) (P laser fragmented stone phantoms in half the time of the H-20 laser regardless of the pulse width. Retropulsion effects differed between the lasers, with the H-30 causing the least retropulsion. Longer pulse widths result in less stone retropulsion. Copyright © 2017 Elsevier Inc. All rights reserved.

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

Science.gov (United States)

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

Atrazine analysis using an amperometric immunosensor based on single-chain antibody fragments and regeneration-free multi-calibrant measurement

International Nuclear Information System (INIS)

Grennan, Kathleen; Strachan, Gillian; Porter, Andrew J.; Killard, Anthony J.; Smyth, Malcolm R.

2003-01-01

This work describes the development of an electrochemical immunosensor for the analysis of atrazine using recombinant single-chain antibody (scAb) fragments. The sensors are based on carbon paste screen-printed electrodes incorporating the conducting polymer polyaniline (PANI)/poly(vinylsulphonic acid) (PVSA), which enables direct mediatorless coupling to take place between the redox centres of antigen-labelled horseradish peroxidase (HRP) and the electrode surface. Competitive immunoassays can be performed in real-time using this separation-free system. Analytical measurements based on the pseudo-linear relationship between the slope of a real-time amperometric signal and the concentration of analyte, yield a novel immunosensor set-up capable of regenerationless amperometric analysis. Multiple, sequential measurements of standards and samples can be performed on a single scAb-modified surface in a matter of minutes. No separation of bound and unbound species was necessary prior to detection. The system is capable of measuring atrazine to a detection limit of 0.1 ppb (0.1 μg l -1 ). This system offers the potential for rapid, cost-effective immunosensing for the analysis of samples of environmental, medical and pharmaceutical significance

Differentiating chondroitin sulfate glycosaminoglycans using collision-induced dissociation; uronic acid cross-ring diagnostic fragments in a single stage of tandem mass spectrometry.

Science.gov (United States)

Kailemia, Muchena J; Patel, Anish B; Johnson, Dane T; Li, Lingyun; Linhardt, Robert J; Amster, I Jonathan

2015-01-01

The stereochemistry of the hexuronic acid residues of the structure of glycosaminoglycans (GAGs) is a key feature that affects their interactions with proteins and other biological functions. Electron based tandem mass spectrometry methods, in particular electron detachment dissociation (EDD), have been able to distinguish glucuronic acid (GlcA) from iduronic acid (IdoA) residues in some heparan sulfate tetrasaccharides by producing epimer-specific fragments. Similarly, the relative abundance of glycosidic fragment ions produced by collision-induced dissociation (CID) or EDD has been shown to correlate with the type of hexuronic acid present in chondroitin sulfate GAGs. The present work examines the effect of charge state and degree of sodium cationization on the CID fragmentation products that can be used to distinguish GlcA and IdoA containing chondroitin sulfate A and dermatan sulfate chains. The cross-ring fragments (2,4)A(n) and (0,2)X(n) formed within the hexuronic acid residues are highly preferential for chains containing GlcA, distinguishing it from IdoA. The diagnostic capability of the fragments requires the selection of a molecular ion and fragment ions with specific ionization characteristics, namely charge state and number of ionizable protons. The ions with the appropriate characteristics display diagnostic properties for all the chondroitin sulfate and dermatan sulfate chains (degree of polymerization of 4-10) studied.

The use of a cocktail of single chain Fv antibody fragments to improve the in vitro and in vivo targeting of melanoma

International Nuclear Information System (INIS)

Pacifico, M.D.; Pearl, R.A.; Kupsch, J.M.

2006-01-01

Radio scintigraphy using single chain antibody fragments (scFvs) offers a potenti al means of early detection of melanoma metastases. However, previous studies have shown suboptimal levels of tumour localization and nonspecific background accumulation which may be due to antigen heterogeneity. We aimed to improve tumour localization by using a cocktail of different scFvs targeting different epitopes on melanoma cells. We have previously developed three scFvs against distinct and highly tumour-specific melanoma cell-surface antigens by chain shuffling and antibody phage selection on melanoma cells. Three scFvs, RAFT3, B3 and B4 were labeled with 1 25I odine and tested both individually and as a cocktail in a nude mouse xenograft model far human melanoma. Results demonstrated improved tumour localization in vivo when compared to the individual scFvs. Tumour uptake of the cocktail at l hour was 24.220% ID/g (injected dose/gram) compared with 2.854%, 2.263% and 1.355% far B4, RAFT3 and B3, respectively, when injected individually. In addition, the cocktail exhibited significantly superior tumour to normal tissue ratios far muscle and spleen (p<0.05). A combination or cocktail of scFv clones may have an advantage aver individual scFvs far melanoma targeting in patients because of heterogeneity in the expression of different epitopes of antigens on melanoma cells

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

Directory of Open Access Journals (Sweden)

Zhao Jianjun

2011-02-01

Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats

DEFF Research Database (Denmark)

Kastern, W.; Dyrberg, T.; Scholler, J.

1984-01-01

DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...

Chain-loaded variable resistance warm-up improves free-weight maximal back squat performance.

Science.gov (United States)

Mina, Minas A; Blazevich, Anthony J; Giakas, Giannis; Seitz, Laurent B; Kay, Anthony D

2016-11-01

The acute influence of chain-loaded variable resistance exercise on subsequent free-weight one-repetition maximum (1-RM) back squat performance was examined in 16 recreationally active men. The participants performed either a free-weight resistance (FWR) or chain-loaded resistance (CLR) back squat warm-up at 85% 1-RM on two separate occasions. After a 5-min rest, the participants attempted a free-weight 1-RM back squat; if successful, subsequent 5% load additions were made until participants failed to complete the lift. During the 1-RM trials, 3D knee joint kinematics and knee extensor and flexor electromyograms (EMG) were recorded simultaneously. Significantly greater 1-RM (6.2 ± 5.0%; p  .05) was found in concentric EMG, eccentric or concentric knee angular velocity, or peak knee flexion angle. Performing a CLR warm-up enhanced subsequent free-weight 1-RM performance without changes in knee flexion angle or eccentric and concentric knee angular velocities; thus a real 1-RM increase was achieved as the mechanics of the lift were not altered. These results are indicative of a potentiating effect of CLR in a warm-up, which may benefit athletes in tasks where high-level strength is required.

Bird diversity along a gradient of fragmented habitats of the Cerrado.

Science.gov (United States)

Jesus, Shayana DE; Pedro, Wagner A; Bispo, Arthur A

2018-01-01

Understanding the factors that affect biodiversity is of central interest to ecology, and essential to species conservation and ecosystems management. We sampled bird communities in 17 forest fragments in the Cerrado biome, the Central-West region of Brazil. We aimed to know the communities structure pattern and the influence of geographical distance and environmental variables on them, along a gradient of fragmented habitats at both local and landscape scales. Eight structural variables of the fragments served as an environmental distance measurement at the local scale while five metrics served as an environmental distance measurement at the landscape scale. Species presence-absence data were used to calculate the dissimilarity index. Beta diversity was calculated using three indices (βsim, βnes and βsor), representing the spatial species turnover, nestedness and total beta diversity, respectively. Spatial species turnover was the predominant pattern in the structure of the communities. Variations in beta diversity were explained only by the environmental variables of the landscape with spatial configuration being more important than the composition. This fact indicates that, in Cerrado of Goiás avian communities structure, deterministic ecological processes associated to differences in species responses to landscape fragmentation are more important than stochastic processes driven by species dispersal.

Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing.

NARCIS (Netherlands)

Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van

2013-01-01

BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard

Generation of single domain antibody fragments derived from camelids and generation of manifold constructs.

Science.gov (United States)

Vincke, Cécile; Gutiérrez, Carlos; Wernery, Ulrich; Devoogdt, Nick; Hassanzadeh-Ghassabeh, Gholamreza; Muyldermans, Serge

2012-01-01

Immunizing a camelid (camels and llamas) with soluble, properly folded proteins raises an affinity-matured immune response in the unique camelid heavy-chain only antibodies (HCAbs). The peripheral blood lymphocytes of the immunized animal are used to clone the antigen-binding antibody fragment from the HCAbs in a phage display vector. A representative aliquot of the library of these antigen-binding fragments is used to retrieve single domain antigen-specific binders by successive rounds of panning. These single domain antibody fragments are cloned in tandem to generate manifold constructs (bivalent, biparatopic or bispecific constructs) to increase their functional affinity, to increase specificity, or to connect two independent antigen molecules.

Supply Chain Management In Construction Revealed

OpenAIRE

Dr. Ghaith Al-Werikat

2017-01-01

The construction supply chain plays a major role in the construction market competition. Construction supply chain management assists enterprises by helping to improve competitiveness increase profits and have more control over the different factors and variables within the project. This paper discusses the construction supply chain characteristics challenges and problems supply chains encounter and the benefits of an integrated supply chain in the construction sector.

Generation of “LYmph Node Derived Antibody Libraries” (LYNDAL) for selecting fully human antibody fragments with therapeutic potential.

Science.gov (United States)

Diebolder, Philipp; Keller, Armin; Haase, Stephanie; Schlegelmilch, Anne; Kiefer, Jonathan D; Karimi, Tamana; Weber, Tobias; Moldenhauer, Gerhard; Kehm, Roland; Eis-Hübinger, Anna M; Jäger, Dirk; Federspil, Philippe A; Herold-Mende, Christel; Dyckhoff, Gerhard; Kontermann, Roland E; Arndt, Michaela A E; Krauss, Jürgen

2014-01-01

The development of efficient strategies for generating fully human monoclonal antibodies with unique functional properties that are exploitable for tailored therapeutic interventions remains a major challenge in the antibody technology field. Here, we present a methodology for recovering such antibodies from antigen-encountered human B cell repertoires. As the source for variable antibody genes, we cloned immunoglobulin G (IgG)-derived B cell repertoires from lymph nodes of 20 individuals undergoing surgery for head and neck cancer. Sequence analysis of unselected “LYmph Node Derived Antibody Libraries” (LYNDAL) revealed a naturally occurring distribution pattern of rearranged antibody sequences, representing all known variable gene families and most functional germline sequences. To demonstrate the feasibility for selecting antibodies with therapeutic potential from these repertoires, seven LYNDAL from donors with high serum titers against herpes simplex virus (HSV) were panned on recombinant glycoprotein B of HSV-1. Screening for specific binders delivered 34 single-chain variable fragments (scFvs) with unique sequences. Sequence analysis revealed extensive somatic hypermutation of enriched clones as a result of affinity maturation. Binding of scFvs to common glycoprotein B variants from HSV-1 and HSV-2 strains was highly specific, and the majority of analyzed antibody fragments bound to the target antigen with nanomolar affinity. From eight scFvs with HSV-neutralizing capacity in vitro,the most potent antibody neutralized 50% HSV-2 at 4.5 nM as a dimeric (scFv)2. We anticipate our approach to be useful for recovering fully human antibodies with therapeutic potential.

Fuel fragmentation data review and separate effects testing

International Nuclear Information System (INIS)

Yueh, Ken. H.; Snis, N.; Mitchell, D.; Munoz-Reja, C.

2014-01-01

A simple alternative test has been developed to study the fuel fragmentation process at loss of coolant accident (LOCA) temperatures. The new test heats a short section of fuel, approximately two pellets worth of material, in a tube furnace open to air. An axial slit is cut in the test sample cladding to reduce radial restraint and to simulate ballooned condition. The tube furnace allows the fuel fragmentation process be observed during the experiment. The test was developed as a simple alternative so large number of tests could be conducted quickly and efficiently to identify key variables that influence fuel fragmentation and to zeroing on the fuel fragmentation burn-up threshold. Several tests were conducted, using fuel materials from fuel rods that were used in earlier integral tests to benchmark and validate the test technique. High burn-up fuel materials known to be above the fragmentation threshold was used to evaluate the fragmentation process as a function of temperature. Even with an axial slit and both ends open, no significant fuel detachment/release was detected until above 750°C. Additional tests were conducted with fuel materials at burn-ups closer to the fuel fragmentation burn-up threshold. Results from these tests indicate a minor power history effect on the fuel fragmentation burn-up threshold. An evaluation of available literature and data generated from this work suggest a fuel fragmentation burn-up threshold between 70 and 75 GWd/MTU. (author)

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

Science.gov (United States)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

International fragmentation af produktionen og vertikal disintegration af styringsformer i produktionskæderne

DEFF Research Database (Denmark)

Refslund, Bjarke

Stigende international økonomisk integration har betydet en stigende fragmentering af produktionen, hvor store dele udføres i forskellige lande. Dertil kommer en stigende disintegration af vertikale styringsformer i produktions-værdikæder (Global Value Chains). Dette konferencepaper diskutere...

Threshold Switching Induced by Controllable Fragmentation in Silver Nanowire Networks.

Science.gov (United States)

Wan, Tao; Pan, Ying; Du, Haiwei; Qu, Bo; Yi, Jiabao; Chu, Dewei

2018-01-24

Silver nanowire (Ag NW) networks have been widely studied because of a great potential in various electronic devices. However, nanowires usually undergo a fragmentation process at elevated temperatures due to the Rayleigh instability that is a result of reduction of surface/interface energy. In this case, the nanowires become completely insulating due to the formation of randomly distributed Ag particles with a large distance and further applications are hindered. Herein, we demonstrate a novel concept based on the combination of ultraviolet/ozone irradiation and a low-temperature annealing process to effectively utilize and control the fragmentation behavior to realize the resistive switching performances. In contrast to the conventional fragmentation, the designed Ag/AgO x interface facilitates a unique morphology of short nanorod-like segments or chains of tiny Ag nanoparticles with a very small spacing distance, providing conduction paths for achieving the tunneling process between the isolated fragments under the electric field. On the basis of this specific morphology, the Ag NW network has a tunable resistance and shows volatile threshold switching characteristics with a high selectivity, which is the ON/OFF current ratio in selector devices. Our concept exploits a new function of Ag NW network, i.e., resistive switching, which can be developed by designing a controllable fragmentation.

Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

NARCIS (Netherlands)

Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick

2013-01-01

In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of

Structure of antigenetic determinants in the amino-terminal region of bovine fibrinogen Aα chain

International Nuclear Information System (INIS)

Tanswell, P.; Reiter, H.; Timpl, R.

1978-01-01

A radioimmunoassay was developed for peptide F-CB1α from the amino of bovine fibrinogen Aα chain, isolated after reduction and carboxymethylation of the multichain disulfide-linked cyanogen bromide peptide F-CB1. Seven out of twelve different rabbit antisera produced against fibrinogen, peptide F-CB1 or Aα chain showed distinct binding to 125 I-labelled F-CB1α. Thrombin cleavage of F-CB1α yielded two fragments: fibrinopeptide A (residues 1-19) and the carboxy-terminal fragment Th2 (residues 20-54). Antisera could be classified into three groups according to whether they recognized antigenic determinants on fibrinopeptide A, on peptide Th2 or as they showed diminished reactions with both fragments. Only little or no cross-reaction was observed with the amino-terminal cyanogen bromide peptides of Bβ and γ chain. Proteolytic fragments of fibrinopeptide A were isolated and tested for inhibitory activity with two antisera. One antiserum contained anitbodies binding selectively to the amino-terminal sequence (residues 4-11) and did not cross-react with human fibrinopeptide A. Another antiserum showed a specific binding restricted to the carboxy-terminal sequence (residues 11-18) and cross-reacted completely with human fibrinopeptide A. These results correlate well with the primary structures of the two fibrinopeptides. The antigenic activity of the peptide fragment Th2 was localized on a 15-residue tryptic peptide derived from the central portion of the sequence. These and further data indicate that at least six different antigenic determinants are present in peptide F-CB1α. (orig.) 891 AJ [de

Supply Chain Management In Construction Revealed

Directory of Open Access Journals (Sweden)

Dr. Ghaith Al-Werikat

2017-03-01

Full Text Available The construction supply chain plays a major role in the construction market competition. Construction supply chain management assists enterprises by helping to improve competitiveness increase profits and have more control over the different factors and variables within the project. This paper discusses the construction supply chain characteristics challenges and problems supply chains encounter and the benefits of an integrated supply chain in the construction sector.

Immunoglobulin diversification in B cell malignancies: internal splicing of heavy chain variable region as a by-product of somatic hypermutation

NARCIS (Netherlands)

Bende, R. J.; Aarts, W. M.; Pals, S. T.; van Noesel, C. J. M.

2002-01-01

In this study we describe alternative splicing of somatically mutated immunoglobulin (Ig) variable heavy chain (V-H) genes in three distinct primary B cell non-Hodgkin's lymphomas (B-NHL). In two V4-34 expressing lymphomas, ie a post-germinal center type B cell chronic lymphocytic leukemia (B-CLL)

Shark Variable New Antigen Receptor (VNAR Single Domain Antibody Fragments: Stability and Diagnostic Applications

Directory of Open Access Journals (Sweden)

Stewart Nuttall

2013-01-01

Full Text Available The single variable new antigen receptor domain antibody fragments (VNARs derived from shark immunoglobulin new antigen receptor antibodies (IgNARs represent some of the smallest known immunoglobulin-based protein scaffolds. As single domains, they demonstrate favorable size and cryptic epitope recognition properties, making them attractive in diagnosis and therapy of numerous disease states. Here, we examine the stability of VNAR domains with a focus on a family of VNARs specific for apical membrane antigen 1 (AMA-1 from Plasmodium falciparum. The VNARs are compared to traditional monoclonal antibodies (mAbs in liquid, lyophilized and immobilized nitrocellulose formats. When maintained in various formats at 45 °C, VNARs have improved stability compared to mAbs for periods of up to four weeks. Using circular dichroism spectroscopy we demonstrate that VNAR domains are able to refold following heating to 80 °C. We also demonstrate that VNAR domains are stable during incubation under potential in vivo conditions such as stomach acid, but not to the protease rich environment of murine stomach scrapings. Taken together, our results demonstrate the suitability of shark VNAR domains for various diagnostic platforms and related applications.

Cloning, bacterial expression and crystallization of Fv antibody fragments

Science.gov (United States)

E´, Jean-Luc; Boulot, Ginette; Chitarra, V´ronique; Riottot, Marie-Madeleine; Souchon, H´le`ne; Houdusse, Anne; Bentley, Graham A.; Narayana Bhat, T.; Spinelli, Silvia; Poljak, Roberto J.

1992-08-01

The variable Fv fragments of antibodies, cloned in recombinant plasmids, can be expressed in bacteria as functional proteins having immunochemical properties which are very similar or identical with those of the corresponding parts of the parent eukaryotic antibodies. They offer new possibilities for the study of antibody-antigen interactions since the crystals of Fv fragments and of their complexes with antigen reported here diffract X-rays to a higher resolution that those obtained with the cognate Fab fragments. The Fv approach should facilitate the structural study of the combining site of antibodies and the further characterization of antigen-antibody interactions by site-directed mutagenesis experiments.

Application of a GIS-BIOLOCO tool for the design and assessment of biomass delivery chains

NARCIS (Netherlands)

Geijzendorffer, I.R.; Annevelink, E.; Elbersen, B.S.; Smidt, R.A.; Mol, de R.M.

2008-01-01

The spatial fragmentation of different biomass sources in one or more regions makes design and assessment of sustainable biomass delivery chains rather complicated. This paper presents a GIS tool that supports the design and facilitates a sustainability assessment of biomass delivery chains at a

Genetic recombination within the human T-cell receptor α-chain gene complex

International Nuclear Information System (INIS)

Robinson, M.A.; Kindt, T.J.

1987-01-01

Genetic analyses of the human T-cell receptor (TCR) α-chain genes indicate that recombination events may occur frequently within this gene complex. Examination of the inheritance of restriction fragment length polymorphisms (RFLP) detected by using probes for constant or variable region gene segments made it possible to assign TCRα haplotypes to the 16 parents and 43 offspring of eight families studied. A total of six RFLP, three for the constant region and three for variable region segments, were examined in the present studies. Most enzyme and probe combinations tested revealed no polymorphism and those finally selected for the study showed limited polymorphism in that only two or, in one case, three allelic forms of the gene were seen. In spite of limited variability at this level, extensive heterogeneity was observed for the combinations of markers present in haplotypes, suggesting that frequent recombination events have occurred. Most strikingly, multiple combinations of RFLP occurring in close proximity of the TCRα constant region gene were observed in this study. A high recombination frequency for the TCRα gene complex is further supported by the observation that two children, one in each of two families, inherited recombinant TCRα haplotypes

An Enumerative Combinatorics Model for Fragmentation Patterns in RNA Sequencing Provides Insights into Nonuniformity of the Expected Fragment Starting-Point and Coverage Profile.

Science.gov (United States)

Prakash, Celine; Haeseler, Arndt Von

2017-03-01

RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.

Equilibrium and stochastic resonance in finite chains of noisy bistable elements

International Nuclear Information System (INIS)

Morillo, Manuel; Gomez-Ordonez, Jose; Casado, Jose Manuel

2010-01-01

Graphical abstract: We analyze the dependence of the equilibrium distribution of a collective variable of a chain on relevant parameters including the chain size and its connectivity. We also analyze the stochastic resonance effect of the same variable. - Abstract: Using numerical simulations, we analyze equilibrium properties of finite chains of coupled noisy bistable units and their response to weak time periodic forces. Finite chains with global as well as local (nearest neighbors) coupling are considered. We focus on the study of a collective variable defined as the arithmetic mean of the variables characterizing each element of the chain. By contrast with the case of infinite size chains, where the coexistence of several equilibrium distributions for the same values of parameters is possible, for finite chains just a single equilibrium distribution exists for given values of the parameters. We demonstrate that, regardless of the chain connectivity, there exist transition lines separating regions in parameter space where the equilibrium distribution function is either monomodal or multimodal. The location of the transition line depends on the chain connectivity and the size of the system. For driven chains, the response of the system shows stochastic resonant effects. For the two types of chains considered, both the power spectral amplification and the signal-to-noise ratio of the collective variable are analyzed as the noise strength, the coupling parameter and the number of bistable units in the system are varied. Compared with the effects observed in single unit systems, the collective variable shows a strong enhancement of the stochastic resonance effects.

Comparative study of IS6110 restriction fragment length polymorphism and variable-number tandem-repeat typing of Mycobacterium tuberculosis isolates in the Netherlands, based on a 5-year nationwide survey

NARCIS (Netherlands)

de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick

2013-01-01

In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

NARCIS (Netherlands)

Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van

2013-01-01

In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

Preparation of the Fv fragment from a short-chain mouse IgG2a anti-dansyl monoclonal antibody and use of selectively deuterated Fv analogues for two-dimensional 1H NMR analyses fo the antigen-antibody interactions

International Nuclear Information System (INIS)

Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji

1991-01-01

The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C H 1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides 1 H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2'-H and Tyr C3',5'-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed

Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis

Science.gov (United States)

Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.

2018-04-01

Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).

Thermally conductive, electrically insulating and melt-processable polystyrene/boron nitride nanocomposites prepared by in situ reversible addition fragmentation chain transfer polymerization

International Nuclear Information System (INIS)

Huang, Xingyi; Wang, Shen; Zhu, Ming; Yang, Ke; Jiang, Pingkai; Bando, Yoshio; Golberg, Dmitri; Zhi, Chunyi

2015-01-01

Thermally conductive and electrically insulating polymer/boron nitride (BN) nanocomposites are highly attractive for various applications in many thermal management fields. However, so far most of the preparation methods for polymer/BN nanocomposites have usually caused difficulties in the material post processing. Here, an in situ grafting approach is designed to fabricate thermally conductive, electrically insulating and post-melt processable polystyrene (PS)/BN nanosphere (BNNS) nanocomposites by initiating styrene (St) on the surface functionalized BNNSs via reversible addition fragmentation chain transfer polymerization. The nanocomposites exhibit significantly enhanced thermal conductivity. For example, at a St/BN feeding ratio of 5:1, an enhancement ratio of 1375% is achieved in comparison with pure PS. Moreover, the dielectric properties of the nanocomposites show a desirable weak dependence on frequency, and the dielectric loss tangent of the nanocomposites remains at a very low level. More importantly, the nanocomposites can be subjected to multiple melt processing to form different shapes. Our method can become a universal approach to prepare thermally conductive, electrically insulating and melt-processable polymer nanocomposites with diverse monomers and nanofillers. (paper)

The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

International Nuclear Information System (INIS)

Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

2007-01-01

Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

Antiretroviral procurement and supply chain management.

Science.gov (United States)

Ripin, David J; Jamieson, David; Meyers, Amy; Warty, Umesh; Dain, Mary; Khamsi, Cyril

2014-01-01

Procurement, the country-level process of ordering antiretrovirals (ARVs), and supply chain management, the mechanism by which they are delivered to health-care facilities, are critical processes required to move ARVs from manufacturers to patients. To provide a glimpse into the ARV procurement and supply chain, the following pages provide an overview of the primary stakeholders, principal operating models, and policies and regulations involved in ARV procurement. Also presented are key challenges that need to be addressed to ensure that the supply chain is not a barrier to the goal of universal coverage. This article will cover the steps necessary to order and distribute ARVs, including different models of delivery, key stakeholders involved, strategic considerations that vary depending on context and policies affecting them. The single drug examples given illustrate the complications inherent in fragmented supply and demand-driven models of procurement and supply chain management, and suggest tools for navigating these hurdles that will ultimately result in more secure and reliable ARV provision. Understanding the dynamics of ARV supply chain is important for the global health community, both to ensure full and efficient treatment of persons living with HIV as well as to inform the supply chain decisions for other public health products.

A probabilistic fragment-based protein structure prediction algorithm.

Directory of Open Access Journals (Sweden)

David Simoncini

Full Text Available Conformational sampling is one of the bottlenecks in fragment-based protein structure prediction approaches. They generally start with a coarse-grained optimization where mainchain atoms and centroids of side chains are considered, followed by a fine-grained optimization with an all-atom representation of proteins. It is during this coarse-grained phase that fragment-based methods sample intensely the conformational space. If the native-like region is sampled more, the accuracy of the final all-atom predictions may be improved accordingly. In this work we present EdaFold, a new method for fragment-based protein structure prediction based on an Estimation of Distribution Algorithm. Fragment-based approaches build protein models by assembling short fragments from known protein structures. Whereas the probability mass functions over the fragment libraries are uniform in the usual case, we propose an algorithm that learns from previously generated decoys and steers the search toward native-like regions. A comparison with Rosetta AbInitio protocol shows that EdaFold is able to generate models with lower energies and to enhance the percentage of near-native coarse-grained decoys on a benchmark of [Formula: see text] proteins. The best coarse-grained models produced by both methods were refined into all-atom models and used in molecular replacement. All atom decoys produced out of EdaFold's decoy set reach high enough accuracy to solve the crystallographic phase problem by molecular replacement for some test proteins. EdaFold showed a higher success rate in molecular replacement when compared to Rosetta. Our study suggests that improving low resolution coarse-grained decoys allows computational methods to avoid subsequent sampling issues during all-atom refinement and to produce better all-atom models. EdaFold can be downloaded from http://www.riken.jp/zhangiru/software.html [corrected].

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

Chemical variability along the value chains of turmeric (Curcuma longa): a comparison of nuclear magnetic resonance spectroscopy and high performance thin layer chromatography.

Science.gov (United States)

Booker, Anthony; Frommenwiler, Debora; Johnston, Deborah; Umealajekwu, Chinenye; Reich, Eike; Heinrich, Michael

2014-03-14

Herbal medicine value chains have generally been overlooked compared with food commodities. Not surprisingly, revenue generation tends to be weighted towards the end of the chain and consequently the farmers and producers are the lowest paid beneficiaries. Value chains have an impact both on the livelihood of producers and on the composition and quality of products commonly sold locally and globally and consequently on the consumers. In order to understand the impact of value chains on the composition of products, we studied the production conditions for turmeric (Curcuma longa) and the metabolomic composition of products derived from it. We aimed at integrating these two components in order to gain a better understanding of the effect of different value chains on the livelihoods of some producers. This interdisciplinary project uses a mixed methods approach. Case studies were undertaken on two separate sites in India. Data was initially gathered on herbal medicine value chains by means of semi-structured interviews and non-participant observations. Samples were collected from locations in India, Europe and the USA and analysed using (1)H NMR spectroscopy coupled with multivariate analysis software and with high performance thin layer chromatography (HPTLC). We investigate medicinal plant value chains and interpret the impact different value chains have on some aspects of the livelihoods of producers in India and, for the first time, analytically assess the chemical variability and quality implications that different value chains may have on the products available to end users in Europe. There are benefits to farmers that belonged to an integrated chain and the resulting products were subject to a higher standard of processing and storage. By using analytical methods, including HPTLC and (1)H NMR spectroscopy, it has been possible to correlate some variations in product composition for selected producers and identify strengths and weaknesses of some types of value

Occurrence of C-Terminal Residue Exclusion in Peptide Fragmentation by ESI and MALDI Tandem Mass Spectrometry

Science.gov (United States)

Dupré, Mathieu; Cantel, Sonia; Martinez, Jean; Enjalbal, Christine

2012-02-01

By screening a data set of 392 synthetic peptides MS/MS spectra, we found that a known C-terminal rearrangement was unexpectedly frequently occurring from monoprotonated molecular ions in both ESI and MALDI tandem mass spectrometry upon low and high energy collision activated dissociations with QqTOF and TOF/TOF mass analyzer configuration, respectively. Any residue localized at the C-terminal carboxylic acid end, even a basic one, was lost, provided that a basic amino acid such arginine and to a lesser extent histidine and lysine was present in the sequence leading to a fragment ion, usually depicted as (bn-1 + H2O) ion, corresponding to a shortened non-scrambled peptide chain. Far from being an epiphenomenon, such a residue exclusion from the peptide chain C-terminal extremity gave a fragment ion that was the base peak of the MS/MS spectrum in certain cases. Within the frame of the mobile proton model, the ionizing proton being sequestered onto the basic amino acid side chain, it is known that the charge directed fragmentation mechanism involved the C-terminal carboxylic acid function forming an anhydride intermediate structure. The same mechanism was also demonstrated from cationized peptides. To confirm such assessment, we have prepared some of the peptides that displayed such C-terminal residue exclusion as a C-terminal backbone amide. As expected in this peptide amide series, the production of truncated chains was completely suppressed. Besides, multiply charged molecular ions of all peptides recorded in ESI mass spectrometry did not undergo such fragmentation validating that any mobile ionizing proton will prevent such a competitive C-terminal backbone rearrangement. Among all well-known nondirect sequence fragment ions issued from non specific loss of neutral molecules (mainly H2O and NH3) and multiple backbone amide ruptures (b-type internal ions), the described C-terminal residue exclusion is highly identifiable giving raise to a single fragment ion in

Quantifying Short-Chain Chlorinated Paraffin Congener Groups

NARCIS (Netherlands)

Yuan, Bo; Bogdal, Christian; Berger, Urs; MacLeod, Matthew; Gebbink, Wouter A.; Alsberg, Tomas; Wit, de Cynthia A.

2017-01-01

Accurate quantification of short-chain chlorinated paraffins (SCCPs) poses an exceptional challenge to analytical chemists. SCCPs are complex mixtures of chlorinated alkanes with variable chain length and chlorination level; congeners with a fixed chain length (n) and number of chlorines (m) are

Supply Chain Management Practices in Toy Supply Chains

DEFF Research Database (Denmark)

Arlbjørn, Jan Stentoft; Johansen, J.; Wong, C. Y.

2005-01-01

Purpose - Innovative products usually experience highly unpredictable and variable demand. This is especially valid for the volatile and seasonal toy industry, which produces high obsolete inventory, lost sales and markdown. In such a volatile industry, what supply chain management (SCM) practices...... (traditional mass-production or push-models). These low-responsive practices in the toy supply chain are not caused only by slow knowledge diffusion. SCM know-how is not yet capable of managing such levels of volatility and seasonality. Therefore, explanations of these theoretical gaps and what new theories...... are required for such extreme volatility and seasonality are proposed. Originality/value - It reveals actual SCM practices in a volatile and seasonal supply chain, such that theoretical and practical gaps are identified. Also, it proposes a model to match manufacturing SCM-practices with retailer SCM-practices....

Preparation of the Fv fragment from a short-chain mouse IgG2a anti-dansyl monoclonal antibody and use of selectively deuterated Fv analogues for two-dimensional sup 1 H NMR analyses fo the antigen-antibody interactions

Energy Technology Data Exchange (ETDEWEB)

Takahashi, Hideo; Igarashi, Takako; Shimada, Ichio; Arata, Yoji (Univ. of Tokyo (Japan))

1991-03-19

The Fv fragment, a univalent antigen-binding unit with a molecular weight of 25,000, has successfully been prepared in high yield by limited proteolysis with clostripain of a short-chain mouse IgG2a anti-dansyl monoclonal antibody in which the entire C{sub H}1 domain is deleted. The Fv fragment obtained is stable at room temperature and retains its full antigen-binding capability. It has been shown that selective deuterium labeling of the Fv fragment, which is half the size of the Fab fragment, provides {sup 1}H NMR spectral data at a sufficient resolution for a detailed structural analysis of the antigen-combining site. NOESY spectra of an Fv analogue, in which all aromatic protons except for His C2{prime}-H and Tyr C3{prime},5{prime}-H had been deuterated, were measured in the presence of varying amounts of dansyl-L-lysine. On the basis of the NOESY data obtained, it was possible to assign all the ring proton resonances for the dansly group that is bound to the Fv fragment. It was also possible to obtain information about His and Tyr residues of the Fv fragment in the absence and presence of the antigen. On the basis of the NMR data obtained, the authors have shown that at least two Tyr residues along with one of the amide groups are directly involved in antigen binding. The mode of interaction of the dansyl ring with these residues in the Fv fragment has briefly been discussed.

On low frequency dynamics of CuO finite chains in YBa2Cu3O7-δ type high-tc superconductors

International Nuclear Information System (INIS)

Stasyuk, I.V.; Kotsur, S.S.; Ivankiv, A.L.; Dublenich, Yu.I.

1992-01-01

A problem of vibration spectrum of a crystal, featuring availability of sublattices with sufficient anharmonicity of single-ion potential is considered. Dynamics of Cu (1) O (1) finite chains in YBa 2 Cu 3 O 7-δ type crystals is studies on the basis of pseudo-spin model. Dependences of chains vibration spectra with small number of fragments on theory parameters are obtained. It is shown that in low-energy spectrum part there is a transition (from the main state), which energy decreases with increase of chain fragments number. Intensities of vibration transitions between the levels are calculated

Implications of discontinuous elevation gradients on fragmentation and restoration in patterned wetlands

Science.gov (United States)

Zweig, Christa L.; Reichert, Brian E.; Kitchens, Wiley M.

2011-01-01

Large wetlands around the world face the possibility of degradation, not only from complete conversion, but also from subtle changes in their structure and function. While fragmentation and isolation of wetlands within heterogeneous landscapes has received much attention, the disruption of spatial patterns/processes within large wetland systems and the resulting fragmentation of community components are less well documented. A greater understanding of pattern/process relationships and landscape gradients, and what occurs when they are altered, could help avoid undesirable consequences of restoration actions. The objective of this study is to determine the amount of fragmentation of sawgrass ridges due to artificial impoundment of water and how that may be differentially affected by spatial position relative to north and south levees. We also introduce groundbreaking evidence of landscape-level discontinuous elevation gradients within WCA3AS by comparing generalized linear and generalized additive models. These relatively abrupt breaks in elevation may have non-linear effects on hydrology and vegetation communities and would be crucial in restoration considerations. Modeling suggests there are abrupt breaks in elevation as a function of northing (Y-coordinate). Fragmentation indices indicate that fragmentation is a function of elevation and easting (X-coordinate), and that fragmentation has increased from 1988-2002. When landscapes change and the changes are compounded by non-linear landscape variables that are described herein, the maintenance processes change with them, creating a degraded feedback loop that alters the system's response to structuring variables and diminishes our ability to predict the effects of restoration projects or climate change. Only when these landscape variables and linkages are clearly defined can we predict the response to potential perturbations and apply the knowledge to other landscape-level wetland systems in need of future

Surface molecular imprinting onto fluorescein-coated magnetic nanoparticlesvia reversible addition fragmentation chain transfer polymerization: A facile three-in-one system for recognition and separation of endocrine disrupting chemicals

Science.gov (United States)

Li, Ying; Dong, Cunku; Chu, Jia; Qi, Jingyao; Li, Xin

2011-01-01

In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals.In this study, we present a general protocol for the making of surface-imprinted magnetic fluorescence beads viareversible addition-fragmentation chain transfer polymerization. The resulting composites were characterized by X-ray diffraction analysis, transmission electron microscopy, scanning electron microscopy, fluorescence spectroscopy, Fourier transform infrared spectroscopy, and energy dispersive spectroscopy. The as-synthesized beads exhibited homogeneous polymer films (thickness of about 5.7 nm), spherical shape, high fluorescence intensity and magnetic property (Magnetization (Ms) = 3.67 emu g-1). The hybrids bind the original template 17β-estradiol with an appreciable selectivity over structurally related compounds. In addition, the resulting hybrids performed without obvious deterioration after five repeated cycles. This study therefore demonstrates the potential of molecularly imprinted polymers for the recognition and separation of endocrine disrupting chemicals. Electronic

Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

International Nuclear Information System (INIS)

Zhu Shoupeng; Xiao Dong; Han Xiaofeng

1997-01-01

The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

Induced refolding of a temperature denatured llama heavy-chain antibody fragment by its antigen

NARCIS (Netherlands)

Dolk, E.; Vliet, C. van; Perez, J.M.J.; Vriend, G.; Darbon, H.; Ferrat, G.; Cambillau, C.; Frenken, L.G.J.; Verrips, T.

2005-01-01

In a previous study we have shown that llama VHH antibody fragments are able to bind their antigen after a heat shock of 90°C, in contrast to the murine monoclonal antibodies. However, the molecular mechanism by which antibody:antigen interaction occurs under these extreme conditions remains

Density functional theory fragment descriptors to quantify the reactivity of a molecular family: application to amino acids.

Science.gov (United States)

Senet, P; Aparicio, F

2007-04-14

By using the exact density functional theory, one demonstrates that the value of the local electronic softness of a molecular fragment is directly related to the polarization charge (Coulomb hole) induced by a test electron removed (or added) from (at) the fragment. Our finding generalizes to a chemical group a formal relation between these molecular descriptors recently obtained for an atom in a molecule using an approximate atomistic model [P. Senet and M. Yang, J. Chem. Sci. 117, 411 (2005)]. In addition, a practical ab initio computational scheme of the Coulomb hole and related local descriptors of reactivity of a molecular family having in common a similar fragment is presented. As a blind test, the method is applied to the lateral chains of the 20 isolated amino acids. One demonstrates that the local softness of the lateral chain is a quantitative measure of the similarity of the amino acids. It predicts the separation of amino acids in different biochemical groups (aliphatic, basic, acidic, sulfur contained, and aromatic). The present approach may find applications in quantitative structure activity relationship methodology.

Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins

Science.gov (United States)

de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin

2016-01-01

Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

OpenAIRE

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-01-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

Probing conformational states of glutaryl-CoA dehydrogenase by fragment screening

Energy Technology Data Exchange (ETDEWEB)

Begley, Darren W.; Davies, Douglas R.; Hartley, Robert C.; Hewitt, Stephen N.; Rychel, Amanda L.; Myler, Peter J.; Van Voorhis, Wesley C.; Staker, Bart L.; Stewart, Lance J. (Emerald)

2014-10-02

Glutaric acidemia type 1 is an inherited metabolic disorder which can cause macrocephaly, muscular rigidity, spastic paralysis and other progressive movement disorders in humans. The defects in glutaryl-CoA dehydrogenase (GCDH) associated with this disease are thought to increase holoenzyme instability and reduce cofactor binding. Here, the first structural analysis of a GCDH enzyme in the absence of the cofactor flavin adenine dinucleotide (FAD) is reported. The apo structure of GCDH from Burkholderia pseudomallei reveals a loss of secondary structure and increased disorder in the FAD-binding pocket relative to the ternary complex of the highly homologous human GCDH. After conducting a fragment-based screen, four small molecules were identified which bind to GCDH from B. pseudomallei. Complex structures were determined for these fragments, which cause backbone and side-chain perturbations to key active-site residues. Structural insights from this investigation highlight differences from apo GCDH and the utility of small-molecular fragments as chemical probes for capturing alternative conformational states of preformed protein crystals.

Direct access to dithiobenzoate RAFT agent fragmentation rate coefficients by ESR spin-trapping.

Science.gov (United States)

Ranieri, Kayte; Delaittre, Guillaume; Barner-Kowollik, Christopher; Junkers, Thomas

2014-12-01

The β-scission rate coefficient of tert-butyl radicals fragmenting off the intermediate resulting from their addition to tert-butyl dithiobenzoate-a reversible addition-fragmentation chain transfer (RAFT) agent-is estimated via the recently introduced electron spin resonance (ESR)-trapping methodology as a function of temperature. The newly introduced ESR-trapping methodology is critically evaluated and found to be reliable. At 20 °C, a fragmentation rate coefficient of close to 0.042 s(-1) is observed, whereas the activation parameters for the fragmentation reaction-determined for the first time-read EA = 82 ± 13.3 kJ mol(-1) and A = (1.4 ± 0.25) × 10(13) s(-1) . The ESR spin-trapping methodology thus efficiently probes the stability of the RAFT adduct radical under conditions relevant for the pre-equilibrium of the RAFT process. It particularly indicates that stable RAFT adduct radicals are indeed formed in early stages of the RAFT poly-merization, at least when dithiobenzoates are employed as controlling agents as stipulated by the so-called slow fragmentation theory. By design of the methodology, the obtained fragmentation rate coefficients represent an upper limit. The ESR spin-trapping methodology is thus seen as a suitable tool for evaluating the fragmentation rate coefficients of a wide range of RAFT adduct radicals. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

Science.gov (United States)

Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

1990-01-01

The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

Response of the agile antechinus to habitat edge, configuration and condition in fragmented forest.

Directory of Open Access Journals (Sweden)

Christopher P Johnstone

Full Text Available Habitat fragmentation and degradation seriously threaten native animal communities. We studied the response of a small marsupial, the agile antechinus Antechinus agilis, to several environmental variables in anthropogenically fragmented Eucalyptus forest in south-east Australia. Agile antechinus were captured more in microhabitats dominated by woody debris than in other microhabitats. Relative abundances of both sexes were positively correlated with fragment core area. Male and female mass-size residuals were smaller in larger fragments. A health status indicator, haemoglobin-haematocrit residuals (HHR, did not vary as a function of any environmental variable in females, but male HHR indicated better health where sites' microhabitats were dominated by shrubs, woody debris and trees other than Eucalyptus. Females were trapped less often in edge than interior fragment habitat and their physiological stress level, indicated by the neutrophil/lymphocyte ratio in peripheral blood, was higher where fragments had a greater proportion of edge habitat. The latter trend was potentially due to lymphopoenia resulting from stress hormone-mediated leukocyte trafficking. Using multiple indicators of population condition and health status facilitates a comprehensive examination of the effects of anthropogenic disturbances, such as habitat fragmentation and degradation, on native vertebrates. Male agile antechinus' health responded negatively to habitat degradation, whilst females responded negatively to the proportion of edge habitat. The health and condition indicators used could be employed to identify conservation strategies that would make habitat fragments less stressful for this or similar native, small mammals.

Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

Science.gov (United States)

Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

2013-05-30

Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

Genetic consequences of forest fragmentation for a highly specialized arboreal mammal--the edible dormouse.

Directory of Open Access Journals (Sweden)

Joanna Fietz

Full Text Available Habitat loss and fragmentation represent the most serious extinction threats for many species and have been demonstrated to be especially detrimental for mammals. Particularly, highly specialized species with low dispersal abilities will encounter a high risk of extinction in fragmented landscapes. Here we studied the edible dormouse (Glis glis, a small arboreal mammal that is distributed throughout Central Europe, where forests are mostly fragmented at different spatial scales. The aim of this study was to investigate the effect of habitat fragmentation on genetic population structures using the example of edible dormouse populations inhabiting forest fragments in south western Germany. We genotyped 380 adult individuals captured between 2001 and 2009 in four different forest fragments and one large continuous forest using 14 species-specific microsatellites. We hypothesised, that populations in small forest patches have a lower genetic diversity and are more isolated compared to populations living in continuous forests. In accordance with our expectations we found that dormice inhabiting forest fragments were isolated from each other. Furthermore, their genetic population structure was more unstable over the study period than in the large continuous forest. Even though we could not detect lower genetic variability within individuals inhabiting forest fragments, strong genetic isolation and an overall high risk to mate with close relatives might be precursors to a reduced genetic variability and the onset of inbreeding depression. Results of this study highlight that connectivity among habitat fragments can already be strongly hampered before genetic erosion within small and isolated populations becomes evident.

Agricultural matrices affect ground ant assemblage composition inside forest fragments.

Directory of Open Access Journals (Sweden)

Diego Santana Assis

Full Text Available The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates; sugarcane (3; and pasture (3. At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart. Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.

Agricultural matrices affect ground ant assemblage composition inside forest fragments.

Science.gov (United States)

Assis, Diego Santana; Dos Santos, Iracenir Andrade; Ramos, Flavio Nunes; Barrios-Rojas, Katty Elena; Majer, Jonathan David; Vilela, Evaldo Ferreira

2018-01-01

The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices) on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates); sugarcane (3); and pasture (3). At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart). Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.

Effects of Variable Production Rate and Time-Dependent Holding Cost for Complementary Products in Supply Chain Model

Directory of Open Access Journals (Sweden)

Mitali Sarkar

2017-01-01

Full Text Available Recently, a major trend is going to redesign a production system by controlling or making variable the production rate within some fixed interval to maintain the optimal level. This strategy is more effective when the holding cost is time-dependent as it is interrelated with holding duration of products and rate of production. An effort is made to make a supply chain model (SCM to show the joint effect of variable production rate and time-varying holding cost for specific type of complementary products, where those products are made by two different manufacturers and a common retailer makes them bundle and sells bundles to end customers. Demand of each product is specified by stochastic reservation prices with a known potential market size. Those players of the SCM are considered with unequal power. Stackelberg game approach is employed to obtain global optimum solution of the model. An illustrative numerical example, graphical representation, and managerial insights are given to illustrate the model. Results prove that variable production rate and time-dependent holding cost save more than existing literature.

Spatial- and Time-Correlated Detection of Fission Fragments

Directory of Open Access Journals (Sweden)

Platkevic M.

2012-02-01

Full Text Available With the goal to measure angular correlations of fission fragments in rare fission decay (e.g. ternary and quaternary fission, a multi-detector coincidence system based on two and up to four position sensitive pixel detectors Timepix has been built. In addition to the high granularity, wide dynamic range and per pixel signal threshold, these devices are equipped with per pixel energy and time sensitivity providing more information (position, energy, time, enhances particle-type identification and selectivity of event-by-event detection. Operation of the device with the integrated USB 2.0 based readout interface FITPix and the control and data acquisition software tool Pixelman enables online visualization and flexible/adjustable operation for a different type of experiments. Spatially correlated fission fragments can be thus registered in coincidence. Similarly triggered measurements are performed using an integrated spectrometric module with analogue signal chain electronics. The current status of development together with demonstration of the technique with a 252Cf source is presented.

OECD Skills Outlook 2017: Skills and Global Value Chains

Science.gov (United States)

OECD Publishing, 2017

2017-01-01

Since the 1990s, the world has entered a new phase of globalisation. Information and communication technology, trade liberalisation and lower transport costs have enabled firms and countries to fragment the production process into global value chains (GVCs). Many products are now designed in one country and assembled in another country from parts…

Monoclonal antibody fragment removal mediated by mixed mode resins.

Science.gov (United States)

O'Connor, Ellen; Aspelund, Matthew; Bartnik, Frank; Berge, Mark; Coughlin, Kelly; Kambarami, Mutsa; Spencer, David; Yan, Huiming; Wang, William

2017-05-26

Efforts to increase monoclonal antibody expression in cell culture can result in the presence of fragmented species requiring removal in downstream processing. Capto adhere, HEA Hypercel, and PPA Hypercel anion exchange/hydrophobic interaction mixed mode resins were evaluated for their fragment removal capabilities and found to separate large hinge IgG1 antibody fragment (LHF) from monomer. Removal of greater than 75% of LHF population occurred at pH 8 and low conductivity. The mechanism of fragment removal was investigated in two series of experiments. The first experimental series consisted of comparison to chromatographic behavior on corresponding single mode resins. Both single mode anion exchange and hydrophobic interaction resins failed to separate LHF. The second experimental series studied the impact of phase modifiers, ethylene glycol, urea, and arginine on the mixed mode mediated removal. The addition of ethylene glycol decreased LHF removal by half. Further decreases in LHF separation were seen upon incubation with urea and arginine. Therefore, it was discovered that the purification is the result of a mixed mode phenomena dominated by hydrophobic interaction and hydrogen bonding effects. The site of interaction between the LHF and mixed mode resin was determined by chemical labeling of lysine residues with sulfo-NHS acetate. The labeling identified the antibody hinge and light chain regions as mediating the fragment separation. Sequence analysis showed that under separation conditions, a hydrophobic proline patch and hydrogen bonding serine and threonine residues mediate the hinge interaction with the Capto adhere ligand. Additionally, a case study is presented detailing the optimization of fragment removal using Capto adhere resin to achieve purity and yield targets in a manufacturing facility. This study demonstrated that mixed mode resins can be readily integrated into commercial antibody platform processes when additional chromatographic abilities

Fragmentation of molecular ions in slow electron collisions

International Nuclear Information System (INIS)

Novotny, Steffen

2008-01-01

The fragmentation of positively charged hydrogen molecular ions by the capture of slow electrons, the so called dissociative recombination (DR), has been investigated in storage ring experiments at the TSR, Heidelberg, where an unique twin-electron-beam arrangement was combined with high resolution fragment imaging detection. Provided with well directed cold electrons the fragmentation kinematics were measured down to meV collision energies where pronounced rovibrational Feshbach resonances appear in the DR cross section. For thermally excited HD + the fragmentation angle and the kinetic energy release were studied at variable precisely controlled electron collision energies on a dense energy grid from 10 to 80 meV. The anisotropy described for the first time by Legendre polynomials higher 2 nd order and the extracted rotational state contributions were found to vary on a likewise narrow energy scale as the rotationally averaged DR rate coefficient. Ro-vibrationally resolved DR experiments were performed on H 2 + produced in distinct internal excitations by a novel ion source. Both the low-energy DR rate as well as the fragmentation dynamics at selected resonances were measured individually in the lowest two vibrational and first three excited rotational states. State-specific DR rates and angular dependences are reported. (orig.)

Fragmentation of molecular ions in slow electron collisions

Energy Technology Data Exchange (ETDEWEB)

Novotny, Steffen

2008-06-25

The fragmentation of positively charged hydrogen molecular ions by the capture of slow electrons, the so called dissociative recombination (DR), has been investigated in storage ring experiments at the TSR, Heidelberg, where an unique twin-electron-beam arrangement was combined with high resolution fragment imaging detection. Provided with well directed cold electrons the fragmentation kinematics were measured down to meV collision energies where pronounced rovibrational Feshbach resonances appear in the DR cross section. For thermally excited HD{sup +} the fragmentation angle and the kinetic energy release were studied at variable precisely controlled electron collision energies on a dense energy grid from 10 to 80 meV. The anisotropy described for the first time by Legendre polynomials higher 2{sup nd} order and the extracted rotational state contributions were found to vary on a likewise narrow energy scale as the rotationally averaged DR rate coefficient. Ro-vibrationally resolved DR experiments were performed on H{sub 2}{sup +} produced in distinct internal excitations by a novel ion source. Both the low-energy DR rate as well as the fragmentation dynamics at selected resonances were measured individually in the lowest two vibrational and first three excited rotational states. State-specific DR rates and angular dependences are reported. (orig.)

Identification of special fragments containing the 5' end of polivirus RNA after ribonuclease III digestion

Energy Technology Data Exchange (ETDEWEB)

Harris, T.J.R.; Dunn, J.J.; Wimmer, E.

1978-11-01

The small protein (VPg) covalently linked to the 5' end of the poliovirus Type 1 (PV-1) RNA has been labeled in vitro with /sup 125/I usingthe Bolton and Hunter reagent. The RNA is not degraded under the conditions used and nearly all the label enters VPg and not the polynucleotide chain. When this /sup 125/I-labeled RNA is cleaved with RNase III at low monovalent salt concentrations, one major /sup 125/I-labeled fragment, approximately 100 nucleotides long, is produced. The corresponding fragment from similar digests of /sup 32/P-labeled RNA has also been identified. The /sup 32/P-labeled fragment changes electrophoretic mobility after protease treatment indicating that it contains VPg. Furthermore, the RNase T1 oligonucleotide known to be at the 5' terminus of poliovirus RNA is found in T1 digests of the purified fragment. These results confirm that the fragment is derived from the 5' end of the RNA. This fragment will be useful in studies concerning the initiation of protein synthesis during poliovirus infection.

Collision-Induced Dissociation of Deprotonated Peptides. Relative Abundance of Side-Chain Neutral Losses, Residue-Specific Product Ions, and Comparison with Protonated Peptides.

Science.gov (United States)

Liang, Yuxue; Neta, Pedatsur; Yang, Xiaoyu; Stein, Stephen E

2018-03-01

High-accuracy MS/MS spectra of deprotonated ions of 390 dipeptides and 137 peptides with three to six residues are studied. Many amino acid residues undergo neutral losses from their side chains. The most abundant is the loss of acetaldehyde from threonine. The abundance of losses from the side chains of other amino acids is estimated relative to that of threonine. While some amino acids lose the whole side chain, others lose only part of it, and some exhibit two or more different losses. Side-chain neutral losses are less abundant in the spectra of protonated peptides, being significant mainly for methionine and arginine. In addition to the neutral losses, many amino acid residues in deprotonated peptides produce specific negative ions after peptide bond cleavage. An expanded list of fragment ions from protonated peptides is also presented and compared with those of deprotonated peptides. Fragment ions are mostly different for these two cases. These lists of fragments are used to annotate peptide mass spectral libraries and to aid in the confirmation of specific amino acids in peptides. Graphical Abstract ᅟ.

Genetics of Euglossini bees (Hymenoptera in fragments of the Atlantic Forest in the region of Viçosa, MG

Directory of Open Access Journals (Sweden)

A. M. Waldschmidt

Full Text Available With uncontrolled deforestation, forest fragments remain, which in most cases are in different stages of regeneration and present isolated populations. In the present study we analyzed the genetic patterns of Eulaema nigrita populations in seven Atlantic Forest fragments of different sizes and successional stages in the region of Viçosa, MG. This was done by RAPD molecular markers. We observed that the area of the fragments had no effect on the genetic variability of E. nigrita in the direction predicted by meta-population models. Medium-sized well-preserved woods presented the lowest variability, whereas large and small woods were statistically identical. The evidence supports the notion that rural areas present greater dispersal among fragments, implying greater similarity between the populations of fragments located in rural areas when compared to fragments in urban areas.

Construction and sequencing analysis of scFv antibody fragment derived from monoclonal antibody against norfloxacin (Nor155

Directory of Open Access Journals (Sweden)

J. Mala

2017-06-01

Full Text Available Norfloxacin belongs to the group of fluoroquinolone antibiotics which has been approved for treatment in animals. However, its residues in animal products can pose adverse side effects to consumer. Therefore, detection of the residue in different food matrices must be concerned. In this study, a single chain variable fragment (scFv that recognizes norfloxacin antibiotic was constructed. The cDNA was synthesized from total RNA of hybridoma cells against norfloxacin. Genes encoding VH and VL regions of monoclonal antibody against norfloxacin (Nor155 were amplified and size of VH and VL fragments was 402 bp and 363 bp, respectively. The scFv of Nor155 was constructed by an addition of (Gly4Ser3 as a linker between VH and VL regions and subcloned into pPICZαA, an expression vector of Pichia pastoris. The sequence of scFv Nor155 (GenBank No. AJG06891.1 was confirmed by sequencing analysis. The complementarity determining regions (CDR I, II, and III of VH and VL were specified by Kabat method. The obtained recombinant plasmid will be useful for production of scFv antibody against norfloxacin in P. pastoris and further engineer scFv antibody against fluoroquinolone antibiotics.

Transverse energy production in the target fragmentation region in 16O-nucleus reactions at 60 and 200 A GeV

International Nuclear Information System (INIS)

Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Plasil, F.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Kristiansson, P.; Loehner, H.; Obenshain, F.E.; Sorensen, S.P.; Poskanzer, A.M.; Ritter, H.G.; Siemiarczuk, T.

1989-07-01

Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 AGeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the Multi-Chain Fragmentation Model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)

Transverse energy production in the target fragmentation region in 16O-nucleus reactions at 60 and 200 A GeV

International Nuclear Information System (INIS)

Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Saini, S.; Sorensen, S.P.; Tincknell, M.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Jacobs, P.; Poskanzer, A.M.; Ritter, H.G.; Kristiansson, P.

1990-01-01

Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 A GeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the multi-chain fragmentation model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)

Cumulative protons in 12C fragmentation at intermediate energy

International Nuclear Information System (INIS)

Abramov, B.M.; Alekseev, P.N.; Borodin, Y.A.; Bulychjov, S.A.; Dukhovskoi, I.A.; Khanov, A.I.; Krutenkova, A.P.; Kulikov, V.V.; Martemianov, M.A.; Matsuk, M.A.; Turdakina, E.N.

2014-01-01

In the FRAGM experiment at heavy ion accelerator complex TWAC-ITEP, the proton yields at an angle 3.5 degrees have been measured in fragmentation of carbon ions at T 0 equals 0.3, 0.6, 0.95 and 2.0 GeV/nucleon on beryllium target. The data are presented as invariant proton yields on cumulative variable x in the range 0.9 < x < 2.4. Proton spectra cover six orders of invariant cross section magnitude. They have been analyzed in the framework of quark cluster fragmentation model. Fragmentation functions of quark- gluon string model are used. The probabilities of the existence of multi-quark clusters in carbon nuclei are estimated to be 8 - 12% for six-quark clusters and 0.2 - 0.6% for nine- quark clusters. (authors)

Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

Science.gov (United States)

Barbara, D J; Morton, A; Spence, N J; Miller, A

1995-09-01

Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

Jet fragmentation

International Nuclear Information System (INIS)

Saxon, D.H.

1985-10-01

The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

Science.gov (United States)

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

Hemoglobin variants as models for investigation of dissociation of intact polypeptide chains by ESI tandem mass spectrometry

International Nuclear Information System (INIS)

Light, K.J.; Loo, J.A.; Edmonds, C.G.; Smith, R.D.

1991-06-01

Electrospray ionization mass spectroscopy (ESI-MS) is rapidly becoming a practical biochemical tool for peptide and protein sequence analysis. The utility of ESI-MS is through use of Collisionally Activated Dissociation (ESI-CAD-MS). Human hemoglobin (Hb, ∼62 kDa) consists of four polypeptide chains and a prosthetic heme group. There are over 400 Hb variants, characterized by amino acid substitutions in either the alpha or beta polypeptide chains. We investigated ESI-CAD-MS as a tool for rapidly analyzing amino acid substitutions, using eight Hb beta chain variants. The approximate location of the modification can be deduced from comparison of the CAD mass spectra and observance of the mass shifts of the fragment ion containing the substitution. Fragmentation occurs preferentially at the amino terminus of proline residues. For most substitutions, differences in CAD mass spectra were not seen. 2 figs

Nature of defects produced on thymine fragment by gamma irradiation of DNA

International Nuclear Information System (INIS)

Teoule, R.; Bonicel, A.

1975-01-01

A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

Drivers of close supply chain collaboration: one size fits all?

NARCIS (Netherlands)

de Leeuw, S.L.J.M.; Fransoo, J.C.

2009-01-01

Purpose - The purpose of this paper is to investigate the antecedents of close supply chain collaboration and to develop a multi-variable conceptual model of factors that drive the need for close supply chain collaboration. Design/methodology/approach - A multi-variable conceptual model is developed

Acoustic cavitation as a mechanism of fragmentation of hot molten droplets in in cool liquids

International Nuclear Information System (INIS)

Kazimi, M.; Watson, C.; Lanning, D.; Rohsenow, W.; Todreas, N.

1976-11-01

A mechanism that explains several of the observations of fragmentation of hot molten drops in coolants is presented. The mechanism relates the fragmentation to the development of acoustic cavitation and subsequent bubble growth within the molten material. The cavitation is assumed due to the severe pressure excursions calculated within the hot material as a result of the pressure pulses accompanying coolant vaporization at the sphere surface. The growth of the cavitation vapor nuclei inside the hot drop is shown to be influenced by the subsequent long duration surface pressure pulses. The variation of the amplitude of these surface pulses with experimental variables is shown to exhibit the same trends with these variables as does the variation in extent of fragmentation

Halogeno-substituted 2-aminobenzoic acid derivatives for negative ion fragmentation studies of N-linked carbohydrates.

Science.gov (United States)

Harvey, David J

2005-01-01

Negative ion electrospray mass spectra of high-mannose N-linked glycans derivatised with 2-aminobenzoic acids and ionised from solutions containing ammonium hydroxide gave prominent [M-H](-) ions accompanied by weaker [M-2H](2-) ions. Fragmentation of both types of ions gave prominent singly charged glycosidic cleavage ions containing the derivatised reducing terminus and ions from the non-reducing terminus that appeared to be products of cross-ring cleavages. Differentiation of these two groups of ions was conveniently achieved in a single spectrum by use of chloro- or bromo-substituted benzoic acids in order to label ions containing the derivative with an atom with a distinctive isotope pattern. Fragmentation of the doubly charged ions gave more abundant fragments, both singly and doubly charged, than did fragmentation of the singly charged ions, but information of chain branching was masked by the appearance of prominent ions produced by internal cleavages. Copyright (c) 2005 John Wiley & Sons, Ltd.

Antibody Heavy Chain Variable Domains of Different Germline Gene Origins Diversify through Different Paths

Directory of Open Access Journals (Sweden)

Ufuk Kirik

2017-11-01

Full Text Available B cells produce antibodies, key effector molecules in health and disease. They mature their properties, including their affinity for antigen, through hypermutation events; processes that involve, e.g., base substitution, codon insertion and deletion, often in association with an isotype switch. Investigations of antibody evolution define modes whereby particular antibody responses are able to form, and such studies provide insight important for instance for development of efficient vaccines. Antibody evolution is also used in vitro for the design of antibodies with improved properties. To better understand the basic concepts of antibody evolution, we analyzed the mutational paths, both in terms of amino acid substitution and insertions and deletions, taken by antibodies of the IgG isotype. The analysis focused on the evolution of the heavy chain variable domain of sets of antibodies, each with an origin in 1 of 11 different germline genes representing six human heavy chain germline gene subgroups. Investigated genes were isolated from cells of human bone marrow, a major site of antibody production, and characterized by next-generation sequencing and an in-house bioinformatics pipeline. Apart from substitutions within the complementarity determining regions, multiple framework residues including those in protein cores were targets of extensive diversification. Diversity, both in terms of substitutions, and insertions and deletions, in antibodies is focused to different positions in the sequence in a germline gene-unique manner. Altogether, our findings create a framework for understanding patterns of evolution of antibodies from defined germline genes.

Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens

NARCIS (Netherlands)

de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.

1993-01-01

The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent

Production of Active Nonglycosylated Recombinant B-Chain of Type-2 Ribosome-Inactivating Protein from Viscum articulatum and Its Biological Effects on Peripheral Blood Mononuclear Cells

Directory of Open Access Journals (Sweden)

Tzu-Li Lu

2011-01-01

Full Text Available Type-2 ribosome-inactivating proteins, composed of a toxic A-chain and lectin-like B-chain, display various biological functions, including cytotoxicity and immunomodulation. We here cloned the lectin-like B-chain encoding fragment of a newly identified type-2 RIP gene, articulatin gene, from Viscum articulatum, into a bacterial expression vector to obtain nonglycosylated recombinant protein expressed in inclusion bodies. After purification and protein refolding, soluble refolded recombinant articulatin B-chain (rATB showed lectin activity specific toward galactoside moiety and was stably maintained while stored in low ionic strength solution. Despite lacking glycosylation, rATB actively bound leukocytes with preferential binding to monocytes and in vitro stimulated PBMCs to release cytokines without obvious cytotoxicity. These results implicated such a B-chain fragment as a potential immunomodulator.

Drivers of close supply chain collaboration : one size fits all?

NARCIS (Netherlands)

Leeuw, de S.L.J.M.; Fransoo, J.C.

2009-01-01

Purpose – The purpose of this paper is to investigate the antecedents of close supply chain collaboration and to develop a multi-variable conceptual model of factors that drive the need for close supply chain collaboration. Design/methodology/approach – A multi-variable conceptual model is developed

Supramolecular Nanoparticles via Single-Chain Folding Driven by Ferrous Ions.

Science.gov (United States)

Wang, Fei; Pu, Hongting; Jin, Ming; Wan, Decheng

2016-02-01

Single-chain nanoparticles can be obtained via single-chain folding assisted by intramolecular crosslinking reversibly or irreversibly. Single-chain folding is also an efficient route to simulate biomacromolecules. In present study, poly(N-hydroxyethylacrylamide-co-4'-(propoxy urethane ethyl acrylate)-2,2':6',2''-terpyridine) (P(HEAm-co-EMA-Tpy)) is synthesized via reversible addition fragmentation chain transfer polymerization. Single-chain folding and intramolecular crosslinking of P(HEAm-co-EMA-Tpy) are achieved via metal coordination chemistry. The intramolecular interaction is characterized on ultraviolet/visible spectrophotometer (UV-vis spectroscopy), proton nuclear magnetic resonance ((1)H NMR), and differential scanning calorimetry (DSC). The supramolecular crosslinking mediated by Fe(2+) plays an important role in the intramolecular collapsing of the single-chain and the formation of the nanoparticles. The size and morphology of the nanoparticles can be controlled reversibly via metal coordination chemistry, which can be characterized by dynamic light scattering (DLS), transmission electron microscope (TEM), and atomic force microscope (AFM). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hydrogen-exchange kinetics of the indole NH proton of the buried tryptophan in the constant fragment of the immunoglobulin light chain

International Nuclear Information System (INIS)

Kawata, Y.; Goto, Y.; Hamaguchi, K.; Hayashi, F.; Kobayashi, Y.; Kyogoku, Y.

1988-01-01

The constant fragment of the immunoglobulin light chain (type λ) has two trytophyl residues at positions 150 and 187. Trp-150 is buried in the interior, and Trp-187 lies on the surface of the molecule. The hydrogen-deuterium exchange kinetics of the indole NH proton Trp-150 were studied at various pH values at 25 0 C by 1 H nuclear magnetic resonance. Exchange rates were approximately first order in hydroxyl ion dependence above pH 8, were relatively independent of pH between pH 7 and 8, and decreased below pH 7. On the assumption that the exchange above pH 8 proceeds through local fluctuations of the protein molecule, the exchange rates between pH 7 and 8 through global unfolding were estimated. The exchange rate constant within this pH range at 25 0 C thus estimated was consistent with that of the global unfolding of the constant fragment under the same conditions as those reported previously. The activation energy for the exchange process at pH 7.8 was the same as that for the unfolding process by 2 M guanidine hydrochloride. The exchange rates of backbone NH protons were almost the same as that of the indole NH proton of Trp-150 at pH 7.l. These observations also indicated that the exchange between pH 7 and 8 occurs through global unfolding of the protein molecule and is rate-limited by the unfolding. At around pH 9, on the other hand, the activation energy for the exchange process of the indole NH proton of Trp-150 was smaller than that for the unfolding process, and the exchange rates differed according to the different signals of backbone NH protons. These findings together with the pH dependence of the rate constant indicated that exchange due to local fluctuations is predominant above pH 8

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

Science.gov (United States)

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

Science.gov (United States)

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Variability in dose estimates associated with the food-chain transport and ingestion of selected radionuclides

International Nuclear Information System (INIS)

Hoffman, F.O.; Gardner, R.H.; Eckerman, K.F.

1982-06-01

Dose predictions for the ingestion of 90 Sr and 137 Cs, using aquatic and terrestrial food chain transport models similar to those in the Nuclear Regulatory Commission's Regulatory Guide 1.109, are evaluated through estimating the variability of model parameters and determining the effect of this variability on model output. The variability in the predicted dose equivalent is determined using analytical and numerical procedures. In addition, a detailed discussion is included on 90 Sr dosimetry. The overall estimates of uncertainty are most relevant to conditions where site-specific data is unavailable and when model structure and parameter estimates are unbiased. Based on the comparisons performed in this report, it is concluded that the use of the generic default parameters in Regulatory Guide 1.109 will usually produce conservative dose estimates that exceed the 90th percentile of the predicted distribution of dose equivalents. An exception is the meat pathway for 137 Cs, in which use of generic default values results in a dose estimate at the 24th percentile. Among the terrestrial pathways of exposure, the non-leafy vegetable pathway is the most important for 90 Sr. For 90 Sr, the parameters for soil retention, soil-to-plant transfer, and internal dosimetry contribute most significantly to the variability in the predicted dose for the combined exposure to all terrestrial pathways. For 137 Cs, the meat transfer coefficient the mass interception factor for pasture forage, and the ingestion dose factor are the most important parameters. The freshwater finfish bioaccumulation factor is the most important parameter for the dose prediction of 90 Sr and 137 Cs transported over the water-fish-man pathway

Analysing global value chains using input-output economics : proceed with care

NARCIS (Netherlands)

Nomaler, Z.O.; Verspagen, B.

2014-01-01

Input-output economics has become a popular tool to analyse the international fragmentation of value chains, especially now that several multi-regional tables that cover large parts of the global economy have become available. It has been argued that these tables, when analysed with the help of the

Analysing global value chains using input-output economics: Proceed with care

NARCIS (Netherlands)

Nomaler, Ö.; Verspagen, B.

2014-01-01

Input-output economics has become a popular tool to analyse the international fragmentation of value chains, especially now that several multi-regional tables that cover large parts of the global economy have become available. It has been argued that these tables, when analysed with the help of the

Design and Generation of Humanized Single-chain Fv Derived from Mouse Hybridoma for Potential Targeting Application.

Science.gov (United States)

Khantasup, Kannika; Chantima, Warangkana; Sangma, Chak; Poomputsa, Kanokwan; Dharakul, Tararaj

2015-12-01

Single-chain variable antibody fragments (scFvs) are attractive candidates for targeted immunotherapy in several human diseases. In this study, a concise humanization strategy combined with an optimized production method for humanizing scFvs was successfully employed. Two antibody clones, one directed against the hemagglutinin of H5N1 influenza virus, the other against EpCAM, a cancer biomarker, were used to demonstrate the validity of the method. Heavy chain (VH) and light chain (VL) variable regions of immunoglobulin genes from mouse hybridoma cells were sequenced and subjected to the construction of mouse scFv 3-D structure. Based on in silico modeling, the humanized version of the scFv was designed via complementarity-determining region (CDR) grafting with the retention of mouse framework region (FR) residues identified by primary sequence analysis. Root-mean-square deviation (RMSD) value between mouse and humanized scFv structures was calculated to evaluate the preservation of CDR conformation. Mouse and humanized scFv genes were then constructed and expressed in Escherichia coli. Using this method, we successfully generated humanized scFvs that retained the targeting activity of their respective mouse scFv counterparts. In addition, the humanized scFvs were engineered with a C-terminal cysteine residue (hscFv-C) for site-directed conjugation for use in future targeting applications. The hscFv-C expression was extensively optimized to improve protein production yield. The protocol yielded a 20-fold increase in production of hscFv-Cs in E. coli periplasm. The strategy described in this study may be applicable in the humanization of other antibodies derived from mouse hybridoma.

Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

Science.gov (United States)

Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

2018-03-01

It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

RAFT Miniemulsion Polymerization of MMA with Cumyl Dithiobenzoate as Chain Transfer Agent

Institute of Scientific and Technical Information of China (English)

Tian Ying GUO; Dong Lin TANG; Jing Wei ZHU; Mou Dao SONG; Bang Hua ZHANG

2006-01-01

Reversible addition-fragmentation transfer (RAFT) miniemulsion polymerizations for PMMA with cumyl dithiobenzoate (CDB) as a chain transfer agent (CTA) has been carried out.Higher temperature made the polymerization much faster and the PDI remained below 1.20, when the temperature was upon 70 ℃.

Large explosive basaltic eruptions at Katla volcano, Iceland: Fragmentation, grain size and eruption dynamics

Science.gov (United States)

Schmith, Johanne; Höskuldsson, Ármann; Holm, Paul Martin; Larsen, Guðrún

2018-04-01

Katla volcano in Iceland produces hazardous large explosive basaltic eruptions on a regular basis, but very little quantitative data for future hazard assessments exist. Here details on fragmentation mechanism and eruption dynamics are derived from a study of deposit stratigraphy with detailed granulometry and grain morphology analysis, granulometric modeling, componentry and the new quantitative regularity index model of fragmentation mechanism. We show that magma/water interaction is important in the ash generation process, but to a variable extent. By investigating the large explosive basaltic eruptions from 1755 and 1625, we document that eruptions of similar size and magma geochemistry can have very different fragmentation dynamics. Our models show that fragmentation in the 1755 eruption was a combination of magmatic degassing and magma/water-interaction with the most magma/water-interaction at the beginning of the eruption. The fragmentation of the 1625 eruption was initially also a combination of both magmatic and phreatomagmatic processes, but magma/water-interaction diminished progressively during the later stages of the eruption. However, intense magma/water interaction was reintroduced during the final stages of the eruption dominating the fine fragmentation at the end. This detailed study of fragmentation changes documents that subglacial eruptions have highly variable interaction with the melt water showing that the amount and access to melt water changes significantly during eruptions. While it is often difficult to reconstruct the progression of eruptions that have no quantitative observational record, this study shows that integrating field observations and granulometry with the new regularity index can form a coherent model of eruption evolution.

The Effect of Allylic Sulfide-Mediated IrreversibleAddition-Fragment Chain Transfer on the EmulsionPolymerization Kinetics of Styrene

Directory of Open Access Journals (Sweden)

Li An

2015-09-01

Full Text Available The effect of the irreversible addition-fragment chain transfer agent, butyl(2-phenylallylsulfane (BPAS, on the course of the emulsion polymerization of styrene and on the product molecular weight was investigated. The emulsion polymerizations were performed using various amounts of sodium dodecyl sulfate (SDS as the surfactant and potassium peroxodisulfate (KPS as the initiator. The relationships between the rates of polymerization (\\(R_{p} \\ and the number of particles per volume (\\(N_{c} \\ with respect to the concentrations of KPS, SDS, and BPAS were found to be \\(R_{p} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.29} \\, \\(N_{c} \\propto \\left\\lbrack KPS \\right\\rbrack^{0.26} \\,\\(R_{p} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.68} \\, \\(N_{c} \\propto \\left\\lbrack SDS \\right\\rbrack^{0.72} \\, and \\(R_{p} \\propto \\left\\lbrack BPAS \\right\\rbrack^{- 0.73} \\ . The obtained relationships can be attributed to the exit of the leaving group radicals on BPAS from the polymer particles. The experimental values of the average number of radicals per particle (\\(\\overset{\\_}{n} \\ were strongly dependent on the BPAS concentration and were in good agreement with the theoretical values (\\({\\overset{\\_}{n}}_{theo} \\ from model calculations. The number-average molecular weight (\\(\\overset{\\_}{M_{n}} \\ can be controlled by BPAS over nearly the entire conversion range, which is also in agreement with the mathematical model. In addition, the transfer rate coefficient (\\(k_{tr} \\ of BPAS can be estimated as 326 L/mol/s at 70 \\(^\\circ\\C. Moreover, similar good results were found for the tested redox reactions at 30 \\(^\\circ\\C.

Mycobacterium avium restriction fragment lenght polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains

Directory of Open Access Journals (Sweden)

Patrícia Carvalho de Sequeira

2005-11-01

Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

A recombinant, fully human monoclonal antibody with antitumor activity constructed from phage-displayed antibody fragments

NARCIS (Netherlands)

Huls, GA; Heijnen, IAFM; Cuomo, ME; Koningsberger, JC; Boel, E; de Vries, ARV; Loyson, SAJ; Helfrich, W; Henegouwen, GPV; van Meijer, M; de Kruif, J; Logtenberg, T

A single-chain Fv antibody fragment specific for the tumor-associated Ep-CAM molecule was isolated from a semisynthetic phage display library and converted into an intact, fully human IgG1 monoclonal antibody (huMab), The purified huMab had an affinity of 5 nM and effectively mediated tumor cell

Universal elements of fragmentation

International Nuclear Information System (INIS)

Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

2010-01-01

A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

Jet mass dependence of fragmentation in positron-proton collisions

Energy Technology Data Exchange (ETDEWEB)

Urmossy, K. [Shandong University, School of Physics and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Jinan, Shandong (China)

2017-02-15

We propose the characterization of fragmentation functions by the energy fraction x a hadron takes away from the energy of the jet measured in the frame co-moving with the jet. Besides, we propose the usage of the jet mass as the fragmentation scale Q. We show that these two Lorentz-invariant variables emerge naturally in a microcanonical ensemble with conserved four-momentum. Then, we construct a statistical hadronisation model, in which, two features of the hadronic final states in various high-energy reactions (power law spectra and negative-binomial multiplicity distributions) can be connected simply. Finally, we analyse the scale dependence of the parameters of the model (power of the spectrum and mean energy per hadron) in the φ{sup 3} theory. Fitting fragmentation functions in diffractive positron-proton collisions, we obtain a prediction for the jet mass dependence of the hadron multiplicity distribution inside jets. (orig.)

ABCB1 genetic variability and methadone dosage requirements in opioid-dependent individuals.

Science.gov (United States)

Coller, Janet K; Barratt, Daniel T; Dahlen, Karianne; Loennechen, Morten H; Somogyi, Andrew A

2006-12-01

The most common treatment for opioid dependence is substitution therapy with another opioid such as methadone. The methadone dosage is individualized but highly variable, and program retention rates are low due in part to nonoptimal dosing resulting in withdrawal symptoms and further heroin craving and use. Methadone is a substrate for the P-glycoprotein transporter, encoded by the ABCB1 gene, which regulates central nervous system exposure. This retrospective study aimed to investigate the influence of ABCB1 genetic variability on methadone dose requirements. Genomic deoxyribonucleic acid was isolated from opioid-dependent subjects (n = 60) and non-opioid-dependent control subjects (n = 60), and polymerase chain reaction-restriction fragment length polymorphism and allele-specific polymerase chain reaction were used to determine the presence of single nucleotide polymorphisms at positions 61, 1199, 1236, 2677, and 3435. ABCB1 haplotypes were inferred with PHASE software (version 2.1). There were no significant differences in the allele or genotype frequencies of the individual single nucleotide polymorphisms or haplotypes between the 2 populations. ABCB1 genetic variability influenced daily methadone dose requirements, such that subjects carrying 2 copies of the wild-type haplotype required higher doses compared with those with 1 copy and those with no copies (98.3 +/- 10.4, 58.6 +/- 20.9, and 55.4 +/- 26.1 mg/d, respectively; P = .029). In addition, carriers of the AGCTT haplotype required significantly lower doses than noncarriers (38.0 +/- 16.8 and 61.3 +/- 24.6 mg/d, respectively; P = .04). Although ABCB1 genetic variability is not related to the development of opioid dependence, identification of variant haplotypes may, after larger prospective studies have been performed, provide clinicians with a tool for methadone dosage individualization.

Conformational changes in fragments D and double-D from human fibrin(ogen) upon binding the peptide ligand Gly-His-Arg-Pro-amide.

Science.gov (United States)

Everse, S J; Spraggon, G; Veerapandian, L; Doolittle, R F

1999-03-09

The structure of fragment double-D from human fibrin has been solved in the presence and absence of the peptide ligands that simulate the two knobs exposed by the removal of fibrinopeptides A and B, respectively. All told, six crystal structures have been determined, three of which are reported here for the first time: namely, fragments D and double-D with the peptide GHRPam alone and double-D in the absence of any peptide ligand. Comparison of the structures has revealed a series of conformational changes that are brought about by the various knob-hole interactions. Of greatest interest is a moveable "flap" of two negatively charged amino acids (Glubeta397 and Aspbeta398) whose side chains are pinned back to the coiled coil with a calcium atom bridge until GHRPam occupies the beta-chain pocket. Additionally, in the absence of the peptide ligand GPRPam, GHRPam binds to the gamma-chain pocket, a new calcium-binding site being formed concomitantly.

Causes of fragmented crystals in ignimbrites: a case study of the Cardones ignimbrite, Northern Chile

Science.gov (United States)

van Zalinge, M. E.; Cashman, K. V.; Sparks, R. S. J.

2018-03-01

Broken crystals have been documented in many large-volume caldera-forming ignimbrites and can help to understand the role of crystal fragmentation in both eruption and compaction processes, the latter generally overlooked in the literature. This study investigates the origin of fragmented crystals in the > 1260 km3, crystal-rich Cardones ignimbrites located in the Central Andes. Observations of fragmented crystals in non-welded pumice clasts indicate that primary fragmentation includes extensive crystal breakage and an associated ca. 5 vol% expansion of individual crystals while preserving their original shapes. These observations are consistent with the hypothesis that crystals fragment in a brittle response to rapid decompression associated with the eruption. Additionally, we observe that the extent of crystal fragmentation increases with increasing stratigraphic depth in the ignimbrite, recording secondary crystal fragmentation during welding and compaction. Secondary crystal fragmentation aids welding and compaction in two ways. First, enhanced crystal fragmentation at crystal-crystal contacts accommodates compaction along the principal axis of stress. Second, rotation and displacement of individual crystal fragments enhances lateral flow in the direction(s) of least principal stress. This process increases crystal aspect ratios and forms textures that resemble mantled porphyroclasts in shear zones, indicating lateral flow adds to processes of compaction and welding alongside bubble collapse. In the Cardones ignimbrite, secondary fragmentation commences at depths of 175-250 m (lithostatic pressures 4-6 MPa), and is modulated by both the overlying crystal load and the time spent above the glass transition temperature. Under these conditions, the existence of force-chains can produce stresses at crystal-crystal contacts of a few times the lithostatic pressure. We suggest that documenting crystal textures, in addition to conventional welding parameters, can

Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

Science.gov (United States)

Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

1996-01-01

For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

Demand management in Multi-Stage Distribution Chain

NARCIS (Netherlands)

de Kok, T.; Janssen, F.B.S.L.P.

1996-01-01

In this paper we discuss demand management problems in a multi-stage distribution chain.We focus on distribution chains where demand processes have high variability due to a few large customer orders.We give a possible explanation, and suggest two simple procedures that help to smooth demand.It is

Tropical food chains: Governance regimes for quality management

NARCIS (Netherlands)

Ruben, R.; Boekel, van M.A.J.S.; Tilburg, van A.; Trienekens, J.H.

2007-01-01

International supply chains of vulnerable tropical food products face major problems in the fields of quality performance and coordination between supply chain partners. Degradation and variability of quality, segmentation of supply networks and scattered production by smallholder producers could

Controlled fragmentation

International Nuclear Information System (INIS)

Arnold, Werner

2002-01-01

Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

Dependence of the product chain-length on detergents for long-chain E-polyprenyl diphosphate synthases

Science.gov (United States)

Pan, Jian-Jung; Ramamoorthy, Gurusankar; Poulter, C. Dale

2013-01-01

Long-chain E-polyprenyl diphosphate synthases (E-PDS) catalyze repetitive addition of isopentenyl diphosphate (IPP) to the growing prenyl chain of an allylic diphosphate. The polyprenyl diphosphate products are required for the biosynthesis of ubiquinones and menaquinones required for electron transport during oxidative phosphorylation to generate ATP. In vitro, the long-chain PDSs require addition of phospholipids or detergents to the assay buffer to enhance product release and maintain efficient turnover. During preliminary assays of product chain-length with anionic, zwitterionic, and non-ionic detergents, we discovered considerable variability. Examination of a series of non-ionic PEG detergents with several long-chain E-PDSs from different organisms revealed that in vitro incubations with nonaethylene glycol monododecyl ether or Triton X-100 typically gave chain lengths that corresponded to those of the isoprenoid moieties in respiratory quinones synthesized in vivo. In contrast incubations in buffer with n-butanol, CHAPS, DMSO, n-octyl-β-glucopyranoside, or β-cyclodextrin or in buffer without detergent typically proceeded more slowly and gave a broad range of chain lengths. PMID:23802587

The Importance of Maize Management on Dung Beetle Communities in Atlantic Forest Fragments.

Directory of Open Access Journals (Sweden)

Renata Calixto Campos

Full Text Available Dung beetle community structures changes due to the effects of destruction, fragmentation, isolation and decrease in tropical forest area, and therefore are considered ecological indicators. In order to assess the influence of type of maize cultivated and associated maize management on dung beetle communities in Atlantic Forest fragments surrounded by conventional and transgenic maize were evaluated 40 Atlantic Forest fragments of different sizes, 20 surrounded by GM maize and 20 surrounded by conventional maize, in February 2013 and 2014 in Southern Brazil. After applying a sampling protocol in each fragment (10 pitfall traps baited with human feces or carrion exposed for 48 h, a total of 3454 individuals from 44 species were captured: 1142 individuals from 38 species in GM maize surrounded fragments, and 2312 from 42 species in conventional maize surrounded fragments. Differences in dung beetle communities were found between GM and conventional maize communities. As expected for fragmented areas, the covariance analysis showed a greater species richness in larger fragments under both conditions; however species richness was greater in fragments surrounded by conventional maize. Dung beetle structure in the forest fragments was explained by environmental variables, fragment area, spatial distance and also type of maize (transgenic or conventional associated with maize management techniques. In Southern Brazil's scenario, the use of GM maize combined with associated agricultural management may be accelerating the loss of diversity in Atlantic Forest areas, and consequently, important ecosystem services provided by dung beetles may be lost.

The Importance of Maize Management on Dung Beetle Communities in Atlantic Forest Fragments.

Science.gov (United States)

Campos, Renata Calixto; Hernández, Malva Isabel Medina

2015-01-01

Dung beetle community structures changes due to the effects of destruction, fragmentation, isolation and decrease in tropical forest area, and therefore are considered ecological indicators. In order to assess the influence of type of maize cultivated and associated maize management on dung beetle communities in Atlantic Forest fragments surrounded by conventional and transgenic maize were evaluated 40 Atlantic Forest fragments of different sizes, 20 surrounded by GM maize and 20 surrounded by conventional maize, in February 2013 and 2014 in Southern Brazil. After applying a sampling protocol in each fragment (10 pitfall traps baited with human feces or carrion exposed for 48 h), a total of 3454 individuals from 44 species were captured: 1142 individuals from 38 species in GM maize surrounded fragments, and 2312 from 42 species in conventional maize surrounded fragments. Differences in dung beetle communities were found between GM and conventional maize communities. As expected for fragmented areas, the covariance analysis showed a greater species richness in larger fragments under both conditions; however species richness was greater in fragments surrounded by conventional maize. Dung beetle structure in the forest fragments was explained by environmental variables, fragment area, spatial distance and also type of maize (transgenic or conventional) associated with maize management techniques. In Southern Brazil's scenario, the use of GM maize combined with associated agricultural management may be accelerating the loss of diversity in Atlantic Forest areas, and consequently, important ecosystem services provided by dung beetles may be lost.

Fragment profiling of low molecular weight heparins using reversed phase ion pair liquid chromatography-electrospray mass spectrometry.

Science.gov (United States)

Xu, Xiaohui; Li, Daoyuan; Chi, Lequan; Du, Xuzhao; Bai, Xue; Chi, Lianli

2015-04-30

Low molecular weight heparins (LMWHs) are linear and highly charged carbohydrate polymers prepared by chemical or enzymatic depolymerization of heparin. Compared to unfractionated heparin (UFH), LMWHs are prevalently used as clinical anticoagulant drugs due to their lower side effects and better bioavailability. The work presented herein provides a rapid and powerful fragment mapping method for structural characterization of LMWHs. The chain fragments of two types of LMWHs, enoxaparin and nadroparin, were generated by controlled enzymatic digestion with each of heparinase I (Hep I, Enzyme Commission (EC) # 4.2.2.7), heparinase II (Hep II, no EC # assigned) and heparinase III (Hep III, EC # 4.2.2.8). Reversed phase ion pair high performance liquid chromatography (RPIP-HPLC) coupled with electrospray ion trap time-of-flight mass spectrometry (ESI-IT-TOF-MS) was used to profile the oligosaccharide chains ranging from disaccharides to decasaccharides. A database containing all theoretical structural compositions was established to assist the mass spectra interpretation. The six digests derived by three enzymes from two types of LMWHs exhibited distinguishable fingerprinting patterns. And a total of 94 enoxaparin fragments and 109 nadroparin fragments were detected and identified. Besides the common LMWH oligosaccharides, many components containing characteristic LMWH structures such as saturated L-idopyranosuronic acid, 2,5-anhydro-D-mannitol, 1,6-anhydro-D-aminopyranose, as well as odd number oligosaccharides were also revealed. Quantitative comparison of major components derived from innovator and generic nadroparin products was presented. This approach to profile LMWHs' fragments offers a highly reproducible, high resolution and information-rich tool for evaluating the quality of this category of anticoagulant drugs or comparing structural similarities among samples from various sources. Copyright © 2015 Elsevier Ltd. All rights reserved.

Fragmentation cross sections outside the limiting-fragmentation regime

CERN Document Server

Sümmerer, K

2003-01-01

The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

Development of human antibody fragments using antibody phage display for the detection and diagnosis of Venezuelan equine encephalitis virus (VEEV

Directory of Open Access Journals (Sweden)

Hust Michael

2008-09-01

Full Text Available Abstract Background Venezuelan equine encephalitis virus (VEEV belongs to the Alphavirus group. Several species of this family are also pathogenic to humans and are recognized as potential agents of biological warfare and terrorism. The objective of this work was the generation of recombinant antibodies for the detection of VEEV after a potential bioterrorism assault or an natural outbreak of VEEV. Results In this work, human anti-VEEV single chain Fragments variable (scFv were isolated for the first time from a human naïve antibody gene library using optimized selection processes. In total eleven different scFvs were identified and their immunological specificity was assessed. The specific detection of the VEEV strains TC83, H12/93 and 230 by the selected antibody fragments was proved. Active as well as formalin inactivated virus particles were recognized by the selected antibody fragments which could be also used for Western blot analysis of VEEV proteins and immunohistochemistry of VEEV infected cells. The anti-VEEV scFv phage clones did not show any cross-reactivity with Alphavirus species of the Western equine encephalitis virus (WEEV and Eastern equine encephalitis virus (EEEV antigenic complex, nor did they react with Chikungunya virus (CHIKV, if they were used as detection reagent. Conclusion For the first time, this study describes the selection of antibodies against a human pathogenic virus from a human naïve scFv antibody gene library using complete, active virus particles as antigen. The broad and sensitive applicability of scFv-presenting phage for the immunological detection and diagnosis of Alphavirus species was demonstrated. The selected antibody fragments will improve the fast identification of VEEV in case of a biological warfare or terroristic attack or a natural outbreak.

An Auxiliary Variable Method for Markov Chain Monte Carlo Algorithms in High Dimension

Directory of Open Access Journals (Sweden)

Yosra Marnissi

2018-02-01

Full Text Available In this paper, we are interested in Bayesian inverse problems where either the data fidelity term or the prior distribution is Gaussian or driven from a hierarchical Gaussian model. Generally, Markov chain Monte Carlo (MCMC algorithms allow us to generate sets of samples that are employed to infer some relevant parameters of the underlying distributions. However, when the parameter space is high-dimensional, the performance of stochastic sampling algorithms is very sensitive to existing dependencies between parameters. In particular, this problem arises when one aims to sample from a high-dimensional Gaussian distribution whose covariance matrix does not present a simple structure. Another challenge is the design of Metropolis–Hastings proposals that make use of information about the local geometry of the target density in order to speed up the convergence and improve mixing properties in the parameter space, while not being too computationally expensive. These two contexts are mainly related to the presence of two heterogeneous sources of dependencies stemming either from the prior or the likelihood in the sense that the related covariance matrices cannot be diagonalized in the same basis. In this work, we address these two issues. Our contribution consists of adding auxiliary variables to the model in order to dissociate the two sources of dependencies. In the new augmented space, only one source of correlation remains directly related to the target parameters, the other sources of correlations being captured by the auxiliary variables. Experiments are conducted on two practical image restoration problems—namely the recovery of multichannel blurred images embedded in Gaussian noise and the recovery of signal corrupted by a mixed Gaussian noise. Experimental results indicate that adding the proposed auxiliary variables makes the sampling problem simpler since the new conditional distribution no longer contains highly heterogeneous

Universality of fragment shapes.

Science.gov (United States)

Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

2015-03-16

The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

Selection of diethylstilbestrol-specific single-chain antibodies from a non-immunized mouse ribosome display library.

Directory of Open Access Journals (Sweden)

Yanan Sun

Full Text Available Single chain variable fragments (scFvs against diethylstilbestrol (DES were selected from the splenocytes of non-immunized mice by ribosome display technology. A naive library was constructed and engineered to allow in vitro transcription and translation using an E. coli lysate system. Alternating selection in solution and immobilization in microtiter wells was used to pan mRNA-ribosome-antibody (ARM complexes. After seven rounds of ribosome display, the expression vector pTIG-TRX containing the selected specific scFv DNAs were transformed into Escherichia coli BL21 (DE3 for expression. Twenty-six positive clones were screened and five clones had high antibody affinity and specificity to DES as evidenced by indirect competitive ELISA. Sequence analysis showed that these five DES-specific scFvs had different amino acid sequences, but the CDRs were highly similar. Surface plasmon resonance (SPR analysis was used to determine binding kinetics of one clone (30-1. The measured K(D was 3.79 µM. These results indicate that ribosome display technology can be used to efficiently isolate hapten-specific antibody (Ab fragments from a naive library; this study provides a methodological framework for the development of novel immunoassays for multiple environmental pollutants with low molecular weight detection using recombinant antibodies.

An efficient algorithm to perform local concerted movements of a chain molecule.

Directory of Open Access Journals (Sweden)

Stefano Zamuner

Full Text Available The devising of efficient concerted rotation moves that modify only selected local portions of chain molecules is a long studied problem. Possible applications range from speeding the uncorrelated sampling of polymeric dense systems to loop reconstruction and structure refinement in protein modeling. Here, we propose and validate, on a few pedagogical examples, a novel numerical strategy that generalizes the notion of concerted rotation. The usage of the Denavit-Hartenberg parameters for chain description allows all possible choices for the subset of degrees of freedom to be modified in the move. They can be arbitrarily distributed along the chain and can be distanced between consecutive monomers as well. The efficiency of the methodology capitalizes on the inherent geometrical structure of the manifold defined by all chain configurations compatible with the fixed degrees of freedom. The chain portion to be moved is first opened along a direction chosen in the tangent space to the manifold, and then closed in the orthogonal space. As a consequence, in Monte Carlo simulations detailed balance is easily enforced without the need of using Jacobian reweighting. Moreover, the relative fluctuations of the degrees of freedom involved in the move can be easily tuned. We show different applications: the manifold of possible configurations is explored in a very efficient way for a protein fragment and for a cyclic molecule; the "local backbone volume", related to the volume spanned by the manifold, reproduces the mobility profile of all-α helical proteins; the refinement of small protein fragments with different secondary structures is addressed. The presented results suggest our methodology as a valuable exploration and sampling tool in the context of bio-molecular simulations.

The composite supply chain efficiency model: A case study of the Sishen-Saldanha supply chain

Directory of Open Access Journals (Sweden)

Leila L. Goedhals-Gerber

2016-01-01

Full Text Available As South Africa strives to be a major force in global markets, it is essential that South African supply chains achieve and maintain a competitive advantage. One approach to achieving this is to ensure that South African supply chains maximise their levels of efficiency. Consequently, the efficiency levels of South Africa’s supply chains must be evaluated. The objective of this article is to propose a model that can assist South African industries in becoming internationally competitive by providing them with a tool for evaluating their levels of efficiency both as individual firms and as a component in an overall supply chain. The Composite Supply Chain Efficiency Model (CSCEM was developed to measure supply chain efficiency across supply chains using variables identified as problem areas experienced by South African supply chains. The CSCEM is tested in this article using the Sishen-Saldanda iron ore supply chain as a case study. The results indicate that all three links or nodes along the Sishen-Saldanha iron ore supply chain performed well. The average efficiency of the rail leg was 97.34%, while the average efficiency of the mine and the port were 97% and 95.44%, respectively. The results also show that the CSCEM can be used by South African firms to measure their levels of supply chain efficiency. This article concludes with the benefits of the CSCEM.

Magnetization processes in quantum spin chains with regularly alternating intersite interactions

International Nuclear Information System (INIS)

Derzhko, O.

2001-01-01

We consider the dependence of magnetization on field at zero temperature for spin-1/2 chains in which intersite interactions regularly vary from site to site with period p. In the limiting case, where the smallest value of the intersite interactions tends to zero, the chain splits into noninteracting identical fragments of p sites and the dependence of magnetization on field can be examined rigorously. We comment on the influence of an anisotropy in the inter spin interaction on the magnetization profiles. Finally, we show how the case of a nonzero smallest value of the intersite interactions can be considered

Fixed capacity and variable member grouping assignment of orthogonal variable spreading factor code tree for code division multiple access networks

Directory of Open Access Journals (Sweden)

Vipin Balyan

2014-08-01

Full Text Available Orthogonal variable spreading factor codes are used in the downlink to maintain the orthogonality between different channels and are used to handle new calls arriving in the system. A period of operation leads to fragmentation of vacant codes. This leads to code blocking problem. The assignment scheme proposed in this paper is not affected by fragmentation, as the fragmentation is generated by the scheme itself. In this scheme, the code tree is divided into groups whose capacity is fixed and numbers of members (codes are variable. A group with maximum number of busy members is used for assignment, this leads to fragmentation of busy groups around code tree and compactness within group. The proposed scheme is well evaluated and compared with other schemes using parameters like code blocking probability and call establishment delay. Through simulations it has been demonstrated that the proposed scheme not only adequately reduces code blocking probability, but also requires significantly less time before assignment to locate a vacant code for assignment, which makes it suitable for the real-time calls.

Synthesis of Thermally Switchable Chromatographic Materials with Immobilized Ti4+ for Enrichment of Phosphopeptides by Reversible Addition Fragmentation Chain Transfer Polymerization

Science.gov (United States)

Wang, Di; Cao, Zhihan; Pang, Xinzhu; Deng, Yulin; Li, Bo; Dai, Rongji

2018-01-01

Reversible phosphorylation of proteins is one of the most crucial types of post-translational modifications (PTMs). And it shows significant work in diversified biological processes. However, the separation technology of phosphorylated peptides is still an analytical challenge in phosphoproteomics, because phosphopeptides are alway in low stoichiometry. Thus, enrichment of phosphopeptides before detection is indispensable. In this study, a novel temperature regulated separation protocol was developed. Silica@p (NIPAAm-co-IPPA)-Ti4+, a new Ti(IV)-IMAC (Immobilized Metal Affinity chromatography) materials was synthesized by reversible addition fragmentation chain transfer polymerization (RAFT). By the unique thermally responsive properties of poly(N-isopropylacrylamide) (PNIPAAm), the captured phosphorylated peptides could be released by changing temperature only without applying any other eluant which could damage the phosphopeptides. We employed isopropanol phosphonic acid (IPPA) as an IMAC ligand for the immobilization of Ti(IV) which could increase the specific adsorption of phosphopeptides. The enrichment and release properties were examined by treatment with pyridoxal 5’-phosphate (PLP) and casein phosphopeptides (CPP). Two phosphorylated compounds above have temperature-stimulated binding to Ti4+. Finally, silica@p (NIPAAm-co-IPPA)-Ti4+ was successfully employed in pretreatment of phosphopeptides in a tryptic digest of a-casein and human serum albumin (HSA). The results indicated a great potential of this new temperature-responsive material in phosphoproteomics study.

HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

DEFF Research Database (Denmark)

Hviid, T V; Madsen, H O; Morling, N

1992-01-01

endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

Do fragmented landholdings have higher production costs? Evidence from rice farmers in Northeastern Jiangxi province, P.R. China

NARCIS (Netherlands)

Tan, S.; Heerink, N.; Kruseman, G.; Qu, F.

2008-01-01

Land fragmentation is generally seen as an obstacle to agricultural productivity improvements, but it can also facilitate labor smoothing and risk diversification. In this paper we examine the impact of land fragmentation on the variable production costs of rice farmers in three villages in Jiangxi

Nuclear fragmentation

International Nuclear Information System (INIS)

Chung, K.C.

1989-01-01

An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

Heavy chain only antibodies

DEFF Research Database (Denmark)

Moghimi, Seyed Moein; Rahbarizadeh, Fatemeh; Ahmadvand, Davoud

2013-01-01

Unlike conventional antibodies, heavy chain only antibodies derived from camel contain a single variable domain (VHH) and two constant domains (CH2 and CH3). Cloned and isolated VHHs possess unique properties that enable them to excel conventional therapeutic antibodies and their smaller antigen...

Applying Markov Chains for NDVI Time Series Forecasting of Latvian Regions

Directory of Open Access Journals (Sweden)

Stepchenko Arthur

2015-12-01

Full Text Available Time series of earth observation based estimates of vegetation inform about variations in vegetation at the scale of Latvia. A vegetation index is an indicator that describes the amount of chlorophyll (the green mass and shows the relative density and health of vegetation. NDVI index is an important variable for vegetation forecasting and management of various problems, such as climate change monitoring, energy usage monitoring, managing the consumption of natural resources, agricultural productivity monitoring, drought monitoring and forest fire detection. In this paper, we make a one-step-ahead prediction of 7-daily time series of NDVI index using Markov chains. The choice of a Markov chain is due to the fact that a Markov chain is a sequence of random variables where each variable is located in some state. And a Markov chain contains probabilities of moving from one state to other.

Fv-clasp: An Artificially Designed Small Antibody Fragment with Improved Production Compatibility, Stability, and Crystallizability.

Science.gov (United States)

Arimori, Takao; Kitago, Yu; Umitsu, Masataka; Fujii, Yuki; Asaki, Ryoko; Tamura-Kawakami, Keiko; Takagi, Junichi

2017-10-03

Antibody fragments are frequently used as a "crystallization chaperone" to aid structural analysis of complex macromolecules that are otherwise crystallization resistant, but conventional fragment formats have not been designed for this particular application. By fusing an anti-parallel coiled-coil structure derived from the SARAH domain of human Mst1 kinase to the variable region of an antibody, we succeeded in creating a novel chimeric antibody fragment of ∼37 kDa, termed "Fv-clasp," which exhibits excellent crystallization compatibility while maintaining the binding ability of the original IgG molecule. The "clasp" and the engineered disulfide bond at the bottom of the Fv suppressed the internal mobility of the fragment and shielded hydrophobic residues, likely contributing to the high heat stability and the crystallizability of the Fv-clasp. Finally, Fv-clasp antibodies showed superior "chaperoning" activity over conventional Fab fragments, and facilitated the structure determination of an ectodomain fragment of integrin α6β1. Copyright © 2017 Elsevier Ltd. All rights reserved.

Extraction of Fragmentation Functions from Charged Kaon and Pion Production at COMPASS

CERN Document Server

Panknin, Regine Antje

Quark helicity distributions can be accessed by measuring spin asymmetries in polarised deep-inelastic scattering, but for a full flavour separation the precise knowledge of quark fragmentation functions is essential. Those can only be inf erred from experimental data, and are still poorly determined today. The few existing para metrisations of fragmentation functions are derived from world data (mainly on electron-positron annihilation), and often differ considerably, most notably for strange quarks. This thesis presents an independent evaluation of fragmentation functions from deep- inelastic scattering data recorded at the COMPASS experiment. A method of extraction was developed, based on the relation between hadron multiplicities, r h ( x, z ), unpolarised parton distribution functions, q ( x ), and quark fragmentation functions into hadrons, D h d ( z ). (In this work x stands for the Bjorken scaling variable, and z for the fraction of the quark momentum that is transferred to the pro duced hadron.) Mult...

Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Targeted Multiplex Imaging Mass Spectrometry with Single Chain Fragment Variable (scfv) Recombinant Antibodies

Science.gov (United States)

Thiery, Gwendoline; Mernaugh, Ray L.; Yan, Heping; Spraggins, Jeffrey M.; Yang, Junhai; Parl, Fritz F.; Caprioli, Richard M.

2012-10-01

Recombinant scfv antibodies specific for CYP1A1 and CYP1B1 P450 enzymes were combined with targeted imaging mass spectrometry to simultaneously detect the P450 enzymes present in archived, paraffin-embedded, human breast cancer tissue sections. By using CYP1A1 and CYP1B1 specific scfv, each coupled to a unique reporter molecule (i.e., a mass tag) it was possible to simultaneously detect multiple antigens within a single tissue sample with high sensitivity and specificity using mass spectrometry. The capability of imaging multiple antigens at the same time is a significant advance that overcomes technical barriers encountered when using present day approaches to develop assays that can simultaneously detect more than a single antigen in the same tissue sample.

Measuring the influence of industry sector membership on supply chain disruption reporting.

Science.gov (United States)

Alcantara, Patrick

2015-01-01

The global Supply Chain Resilience Survey by the Business Continuity Institute and Zurich Insurance is a comprehensive study on the state of supply chains in different organisations worldwide. As a benchmarking tool, it also contains data about business continuity arrangements in place to ensure supply chain resilience. Given this study's historically qualitative approach to reporting, this paper aims to introduce quantitative analysis. In this paper, responses that report membership in Standard Industrial Classification 2007 industry sectors from the 2013 Supply Chain Resilience Survey were disaggregated and related to supply chain disruption reporting. A chi-square test of independence reveals that membership in a particular industry sector influences reporting of supply chain disruption. Nonetheless, the relationship between these variables is weak. This study demonstrates interesting differences between industry sectors in terms of supply chain resilience. Further research is required in terms of other variables in order to provide granularity and relevant findings to supply chain planners.

BstXI RFLP in the human inter-alpha-trypsin inhibitor light chain gene

Energy Technology Data Exchange (ETDEWEB)

Leveillard, T; Bourguignon, J; Sesbouee, R; Hanauer, A; Salier, J P; Diarra-Mehrpour, M; Martin, J P

1988-03-25

The 1.2 kb EcoRI/SmaI fragment of lambdaHuLITI2 was used as probe. lambdaHuLITI2 is a full length cDNA clone coding for human inter-alpha-trypsin inhibitor light chain isolated from immunochemical screening of a lambdagt11 library. Its sequence coding for HI-30 and alpha-1-microglobulin is in agreement. BstXI identifies five invariant bands at 5.0 kb, 2.3 kb, 1.5 kb, 1.1 kb, and 0.7 kb and a diallelic polymorphism with DNA fragments at 2.0 kb or 1.7 kb.

String fragmentation; La fragmentation des cordes

Energy Technology Data Exchange (ETDEWEB)

Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

1997-10-01

The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

Generating and Purifying Fab Fragments from Human and Mouse IgG Using the Bacterial Enzymes IdeS, SpeB and Kgp.

Science.gov (United States)

Sjögren, Jonathan; Andersson, Linda; Mejàre, Malin; Olsson, Fredrik

2017-01-01

Fab fragments are valuable research tools in various areas of science including applications in imaging, binding studies, removal of Fc-mediated effector functions, mass spectrometry, infection biology, and many others. The enzymatic tools for the generation of Fab fragments have been discovered through basic research within the field of molecular bacterial pathogenesis. Today, these enzymes are widely applied as research tools and in this chapter, we describe methodologies based on bacterial enzymes to generate Fab fragments from both human and mouse IgG. For all human IgG subclasses, the IdeS enzyme from Streptococcus pyogenes has been applied to generate F(ab')2 fragments that subsequently can be reduced under mild conditions to generate a homogenous pool of Fab' fragments. The enzyme Kgp from Porphyromonas gingivalis has been applied to generate intact Fab fragments from human IgG1 and the Fab fragments can be purified using a CH1-specific affinity resin. The SpeB protease, also from S. pyogenes, is able to digest mouse IgGs and has been applied to digest antibodies and Fab fragments can be purified on light chain affinity resins. In this chapter, we describe methodologies that can be used to obtain Fab fragments from human and mouse IgG using bacterial proteases.

European pork chains : diversity and quality challenges in consumer-oriented production and distribution

NARCIS (Netherlands)

Trienekens, J.H.; Petersen, B.; Wognum, P.M.; Brinkmann, D.

2009-01-01

In this book the results are presented of a comprehensive inventory of pork chains that has been conducted through expert interviews and in-depth case studies. The main focus of the book is on how well diverse and fragmented supply in the European pork sector matches differentiating demands for pork

Supply-chain trade and labor market outcomes : The case of the 2004 European Union enlargement

NARCIS (Netherlands)

Kaplan, Lennart C.; Kohl, Tristan; Martínez-Zarzoso, Inmaculada

2018-01-01

The structure of international trade is increasingly characterized by fragmentation of production processes and trade policy. Yet, how trade policy affects supply-chain trade is largely unexplored territory. This paper shows how the accession of 10 Central and Eastern European Countries (CEECs) to

Facilitators and Inhibitors of Supply Chain Innovation-prospects for Supply Chain Managment in the Irish Grocery Sector

OpenAIRE

Keegan, Joan; O'Callaghan, Edmund; Wilcox, Mary

2001-01-01

Supply chain management is one of the most significant strategic challenges currently facing the Irish grocery sector. The UK grocery market with its emphasis on composite deliveries via regional distribution centres is extremely sophisticated; the Irish grocery sector, however, is in the embryonic stage of implementing central distribution. The potential to develop innovative supply chain systems is mediated by both national logistic-related variables and company characteristics. In additio...

Revealing the Supramolecular Nature of Side-Chain Terpyridine-Functionalized Polymer Networks

Directory of Open Access Journals (Sweden)

Jérémy Brassinne

2015-01-01

Full Text Available Nowadays, finely controlling the mechanical properties of polymeric materials is possible by incorporating supramolecular motifs into their architecture. In this context, the synthesis of a side-chain terpyridine-functionalized poly(2-(dimethylaminoethyl methacrylate is reported via reversible addition-fragmentation chain transfer polymerization. By addition of transition metal ions, concentrated aqueous solutions of this polymer turn into metallo-supramolecular hydrogels whose dynamic mechanical properties are investigated by rotational rheometry. Hence, the possibility for the material to relax mechanical constrains via dissociation of transient cross-links is brought into light. In addition, the complex phenomena occurring under large oscillatory shear are interpreted in the context of transient networks.

The transverse momentum dependence of quark fragmentation functions from cascade models

International Nuclear Information System (INIS)

Groot, E.H. de; Engels, J.

1979-01-01

A covariant generalization of the onedimensional cascade model for quark fragmentation functions is presented, so as to include the transverse momentum behaviour and the possibility to produce different particles at different vertices along the chain. In the scaling limit the exact solution is given, if the primordial function is of the type αZsup(α-1). T(pT). For the more general case of factorizing primordial functions an analytic expression for the seagull effect is derived, which turns out to be independent of the function T(pT). (orig.) [de

Influence of joint direction and position of explosive charge on fragmentation

International Nuclear Information System (INIS)

Hafsaoui, Abdellah; Talhi, Korichi

2009-01-01

Although researchers have realized varying degrees of success in small-scale physical in situ testing, most will agree that the greatest uncertainty stems from the uncontrollable field variables. Given the diverse nature of field conditions encountered, there exists no reliable and proven method of predicting fragmentation. Due to the lack of adequate field controls, it is unlikely that a universal physical model will ever be developed for all blasting. This paper presents the results of a test conducted at the Hadjar Essoud quarry to investigate the problems associated with the discontinuities in the rock, which are among the factors causing the reduction of the resistance of the rocks to the explosive. Nevertheless, the distance between the joints, their dip and strike, and the position of the detonator play a significant role in the final fragmentation of the rock. In this work, we studied the role of the abovementioned factors on models of limestone rock of 150 X 375 X 450 mm. Accurate measurement of blast, fragmentation is important in mining and quarrying operations, in monitoring blasts, and optimizing their design. We shall use the Kuznetsov-Rammler method to measure fragmentation. It shows great potential as a practical aid to predict and control the quality of the fragmented material in the Hadjar Essoud quarry. (author)

Studying multifragmentation dynamics at intermediate energies using two-fragment correlations

International Nuclear Information System (INIS)

Sangster, T.C.; Britt, H.C.; Namboodiri, M.N.

1993-01-01

One of the most challenging topics in Nuclear Physics is the multifragmentation at moderate excitation energies in large nuclear systems. Although the idea that multifragmentation is analogous to a liquid-gas like phase transition is not new, it has only been recently that highly exclusive experimental measurements have been coupled with sophisticated theoretical models like QMD and BUU/VUU to explore reaction dynamics and the process of fragment formation. Indeed, much of what is known about multifragmentation has resulted from the study of complex correlations present in both the experimental data and theoretical calculations. One of the most crucial questions in the ongoing debate concerning the liquid-gas analogy is the differentiation between simultaneous and sequential fragment emission. Clearly, the phase transition analogy breaks down if fragments are emitted sequentially as in an evaporative process. There have been a number of two-fragment correlation results published recently (including those presented in this paper) which attempt to put limits on the emission timescale using three-body Coulomb trajectory calculations with explicit emission times for sequential decays from a fixed source density. These results have been generally consistent and indicate that intermediate mass fragment (IMF) emission is nearly simultaneous in medium energy heavy ion collisions. Only very recently have calculations been performed which approach this question from the other extreme: simultaneous emission from a variable density source. When considered together, these results argue favorably for a simultaneous multifragmentation. In this paper the authors present comprehensive results on two-fragment correlations for heavy systems at intermediate energies

Quantifying Short-Chain Chlorinated Paraffin Congener Groups.

Science.gov (United States)

Yuan, Bo; Bogdal, Christian; Berger, Urs; MacLeod, Matthew; Gebbink, Wouter A; Alsberg, Tomas; de Wit, Cynthia A

2017-09-19

Accurate quantification of short-chain chlorinated paraffins (SCCPs) poses an exceptional challenge to analytical chemists. SCCPs are complex mixtures of chlorinated alkanes with variable chain length and chlorination level; congeners with a fixed chain length (n) and number of chlorines (m) are referred to as a "congener group" C n Cl m . Recently, we resolved individual C n Cl m by mathematically deconvolving soft ionization high-resolution mass spectra of SCCP mixtures. Here we extend the method to quantifying C n Cl m by introducing C n Cl m specific response factors (RFs) that are calculated from 17 SCCP chain-length standards with a single carbon chain length and variable chlorination level. The signal pattern of each standard is measured on APCI-QTOF-MS. RFs of each C n Cl m are obtained by pairwise optimization of the normal distribution's fit to the signal patterns of the 17 chain-length standards. The method was verified by quantifying SCCP technical mixtures and spiked environmental samples with accuracies of 82-123% and 76-109%, respectively. The absolute differences between calculated and manufacturer-reported chlorination degrees were -0.9 to 1.0%Cl for SCCP mixtures of 49-71%Cl. The quantification method has been replicated with ECNI magnetic sector MS and ECNI-Q-Orbitrap-MS. C n Cl m concentrations determined with the three instruments were highly correlated (R 2 > 0.90) with each other.

Azimuthal Anisotropies in Nuclear Fragmentation

International Nuclear Information System (INIS)

Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

2002-01-01

The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

Sequence determinants of human microsatellite variability

Directory of Open Access Journals (Sweden)

Jakobsson Mattias

2009-12-01

Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

Energy Technology Data Exchange (ETDEWEB)

Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

2016-11-15

The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

Science.gov (United States)

Gouge, Michael F.

2011-01-01

Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

Political fragmentation and widening disparities in African-American and white mortality, 1972-1988.

Science.gov (United States)

Kim, Yonsu; Bruckner, Tim A

2016-12-01

During the 1970s and 1980s in the U.S., population movement, urban sprawl and urban governance reform led to a proliferation of local, autonomous jurisdictions. Prior literature examines how this creation of local governments, also referred to as political fragmentation, contributes to economic growth and social inequality. We examine the impact of political fragmentation on health equity by testing the hypothesis that the mortality disparity between whites and African-Americans varies positively with political fragmentation. We retrieved mortality data from the multiple cause-of-death file and calculated total number of local governments per 1000 residents in a county to measure the degree of political fragmentation. We focused on 226 U.S. counties with population size greater than 200,000 and restricted the analysis to four distinct periods with overlapping government and mortality data (1972-73, 1977-78, 1982-83, and 1987-88). We applied generalized estimating equation methods that permit analysis of clustered data over time. Methods also controlled for the age structure of the population, reductions in mortality over time, and confounding by county-level sociodemographic variables. Adjusted coefficients of fragmentation are positive and statistically significant for both whites (coef: 2.60, SE: 0.60, p politically fragmented urban counties and/or time periods. From 1972 to 1988, political fragmentation in large urban counties moves positively with the racial/ethnic gap in mortality between whites and African-Americans. We discuss intervening mechanisms through which political fragmentation may disproportionately affect mortality among African-Americans.

Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

DEFF Research Database (Denmark)

Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

2000-01-01

The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21(T) showed reaction...

Fragment capture device

Science.gov (United States)

Payne, Lloyd R.; Cole, David L.

2010-03-30

A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

Equilibrium simulations of proteins using molecular fragment replacement and NMR chemical shifts.

Science.gov (United States)

Boomsma, Wouter; Tian, Pengfei; Frellsen, Jes; Ferkinghoff-Borg, Jesper; Hamelryck, Thomas; Lindorff-Larsen, Kresten; Vendruscolo, Michele

2014-09-23

Methods of protein structure determination based on NMR chemical shifts are becoming increasingly common. The most widely used approaches adopt the molecular fragment replacement strategy, in which structural fragments are repeatedly reassembled into different complete conformations in molecular simulations. Although these approaches are effective in generating individual structures consistent with the chemical shift data, they do not enable the sampling of the conformational space of proteins with correct statistical weights. Here, we present a method of molecular fragment replacement that makes it possible to perform equilibrium simulations of proteins, and hence to determine their free energy landscapes. This strategy is based on the encoding of the chemical shift information in a probabilistic model in Markov chain Monte Carlo simulations. First, we demonstrate that with this approach it is possible to fold proteins to their native states starting from extended structures. Second, we show that the method satisfies the detailed balance condition and hence it can be used to carry out an equilibrium sampling from the Boltzmann distribution corresponding to the force field used in the simulations. Third, by comparing the results of simulations carried out with and without chemical shift restraints we describe quantitatively the effects that these restraints have on the free energy landscapes of proteins. Taken together, these results demonstrate that the molecular fragment replacement strategy can be used in combination with chemical shift information to characterize not only the native structures of proteins but also their conformational fluctuations.

Discrete variable theory of triatomic photodissociation

International Nuclear Information System (INIS)

Heather, R.W.; Light, J.C.

1983-01-01

The coupled equations describing the photodissociation process are expressed in the discrete variable representation (DVR) in which the coupled equations are labeled by quadrature points rather than by internal basis functions. A large reduction in the dimensionality of the coupled equations can be realized since the spatially localized bound state nuclear wave function vanishes at most of the quadrature points, making only certain orientations of the fragments important in the region of strong interaction (small separation). The discrete variable theory of photodissociation is applied to the model dissociation of bent HCN in which the CN fragment is treated as a rigid rotor. The truncated DVR rotational distributions are compared with the exact close coupled rotational distributions, and excellent agreement with greatly reduced dimensionality of the equations is found

Motivators to Adopt Green Supply Chain Initiatives

OpenAIRE

Amarpreet S. Kohli; Ellen Hawkins

2015-01-01

There are several factors that drive organizations to consider implementing green supply chain (GSC) initiatives. This paper refines an instrument to empirically test the significance of the following drivers for participation in GSC initiatives: Government Regulation, Buyer/Supply Chain Influence, Internal Readiness, Competitive Advantage, and Corporate Social Responsibility. Corporate Social Responsibility emerged as the most significant variable that effected the decision making of the org...

SUPPLY CHAIN RISKS: LITERATURE REVIEW AND A NEW CATEGORIZATION

OpenAIRE

Er Kara, Merve; Oktay Fırat, Seniye Ümit

2017-01-01

Identification of risks is the first step to build a resilient and sustainable supply chain and develop proactive risk management strategies. Supply chains contain numerous risks with different forms, probabilities and impacts. Supply chain risks have a multi-dimensional nature and can result from a wide variety of sources including demand and supply variability, poor performing suppliers, price fluctuations, dynamic consumer markets, global economic uncertainty, and even unexpected events su...

Review of Coconut “Lethal Yellowing” type diseases Diversity, variability and diagnosis

Directory of Open Access Journals (Sweden)

Dollet Michel

2009-03-01

Full Text Available Coconut palms (Cocos nucifera L. can be affected by several types of Lethal Yellowing (LY diseases worldwide. Some of the syndromes are caused by phytoplasmas, small bacteria that are impossible to detect by light microscopy. Amplification of a given gene of the phytoplasmas by polymerase chain reaction (PCR is the most convenient diagnosis method. The problem is that there are at least 28 “groups” of phytoplasmas and only one pair of primers -P1/P7- commonly used for PCR. As these primers belong to a very conserved gene, false positives are frequent. Consequently, alternative primers specific to one “strain” (or subgroup have to be used, such as LY-F/LY-R for the Caribbean LY, Rohde primers for LD Tanzania. Such specific primers are sometimes restrictive. Indeed, there is variability within each strain and the sequence of the primers has to be adapted to that variability. There are at least five LY subgroups. The subgroups can only be identified by restriction fragment length polymorphism or sequencing. In Africa, two subgroups of LY phytoplasmas have been identified so far.

The Vulnerability of Rice Value Chains in Sub-Saharan Africa: A Review

Directory of Open Access Journals (Sweden)

Fanen Terdoo

2016-09-01

Full Text Available Rice is one of the most important food crops in sub-Saharan Africa. Climate change, variability, and economic globalization threatens to disrupt rice value chains across the subcontinent, undermining their important role in economic development, food security, and poverty reduction. This paper maps existing research on the vulnerability of rice value chains, synthesizes the evidence and the risks posed by climate change and economic globalization, and discusses agriculture and rural development policies and their relevance for the vulnerability of rice value chains in sub-Saharan Africa. Important avenues for future research are identified. These include the impacts of multiple, simultaneous pressures on rice value chains, the effects of climate change and variability on parts of the value chain other than production, and the forms and extent to which different development policies hinder or enhance the resilience of rice value chains in the face of climatic and other pressures.

Multivariate statistics application in development of blast fragmentation charts for different rock formations in quarries

Directory of Open Access Journals (Sweden)

Birol Elevli

2012-12-01

Full Text Available Rock fragmentation is considered to be one of the most important aspects of quarrying because of its direct effect on the costsof drilling, which include blasting, loading, hauling and crushing. Thus, it is essential to consider fragmentation size in blasting design.Fragmentation depends on many variables, such as rock properties, geological structures, and blasting parameters. Although empiricalmodels for the estimation of the size distribution of rock fragmentation have been developed by considering these parameters,no complete empirical prediction model for fragmentation exists since rock properties and geological structures vary from site to site.However, these models regard rock properties as constant. In this study, a step–wise multiple linear regression analysis has beencarried out to determine the degree of dominance of various influencing parameters on fragmentation and to develop a fragmentationprediction model. The results showed that the rock mass properties, burden width and specific charge are the main parameters affectingfragmentation. The relations among those parameters were used to develop guideline charts to determine blast layouts for desiredfragmentation on the basis of rock characteristics.

Low Mass MS/MS Fragments of Protonated Amino Acids Used for Distinction of Their 13C- Isotopomers in Metabolic Studies

Science.gov (United States)

Ma, Xin; Dagan, Shai; Somogyi, Árpád; Wysocki, Vicki H.; Scaraffia, Patricia Y.

2013-04-01

Glu, Gln, Pro, and Ala are the main amino acids involved in ammonia detoxification in mosquitoes. In order to develop a tandem mass spectrometry method (MS2) to monitor each carbon of the above isotopically-labeled 13C-amino acids for metabolic studies, the compositions and origins of atoms in fragments of the protonated amino acid should be first elucidated. Thus, various electrospray (ESI)-based MS2 tools were employed to study the fragmentation of these unlabeled and isotopically-labeled amino acids and better understand their dissociation pathways. A broad range of fragments, including previously-undescribed low m/z fragments was revealed. The formulae of the fragments (from m/z 130 down to m/z 27) were confirmed by their accurate masses. The structures and conformations of the larger fragments of Glu were also explored by ion mobility mass spectrometry (IM-MS) and gas-phase hydrogen/deuterium exchange (HDX) experiments. It was found that some low m/z fragments ( m/z 27-30) are common to Glu, Gln, Pro, and Ala. The origins of carbons in these small fragments are discussed and additional collision induced dissociation (CID) MS2 fragmentation pathways are proposed for them. It was also found that small fragments (≤ m/z 84) of protonated, methylated Glu, and methylated Gln are the same as those of the underivatized Glu and Gln. Taken together, the new approach of utilizing low m/z fragments can be applied to distinguish, identify, and quantify 13C-amino acids labeled at various positions, either in the backbone or side chain.

Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

Directory of Open Access Journals (Sweden)

S. C. Oukouomi Noutchie

2014-01-01

Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

Land fragmentation and production diversification

NARCIS (Netherlands)

Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

2018-01-01

We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

α-decay chain and associated cluster emission from neutron deficient 237Cf nucleus

International Nuclear Information System (INIS)

Jain, Deepika; Sharma, Manoj K.

2015-01-01

We have studied the α-decay chain of 237 Cf nucleus, which has been observed in the 3n evaporation channel when the semi-magic projectile 36 S strikes on 204 Pbv nucleus. The calculations are carried out by using preformed cluster model (PCM), with choices of spherical and quadruple deformation with in cold optimum orientation approach. The calculated half-lives of α-decay chain find relatively in nice agreement with experimental data for the deformed fragmentation approach. Along with α emission, the possibility of heavier clusters is also worked out and corresponding half-lives are predicted. (author)

A tactical supply chain planning model with multiple flexibility options

DEFF Research Database (Denmark)

Esmaeilikia, Masoud; Fahimnia, Behnam; Sarkis, Joeseph

2016-01-01

Supply chain flexibility is widely recognized as an approach to manage uncertainty. Uncertainty in the supply chain may arise from a number of sources such as demand and supply interruptions and lead time variability. A tactical supply chain planning model with multiple flexibility options...... incorporated in sourcing, manufacturing and logistics functions can be used for the analysis of flexibility adjustment in an existing supply chain. This paper develops such a tactical supply chain planning model incorporating a realistic range of flexibility options. A novel solution method is designed...

Chain of care development in Sweden: results of a national study

Directory of Open Access Journals (Sweden)

Bengt Åhgren

2003-10-01

Full Text Available Chains of Care are today an important counterbalance to the ever-increasing fragmentation of Swedish health care, and the ongoing development work has high priority. Improved quality of care is the most important reason for developing Chains of Care. Despite support in the form of goals and activity plans, seven of ten county councils are uncertain whether they have been quite successful in the development work. Strong departmentalisation of responsibilities between different medical professions and departments, types of responsibilities and power still remaining in the vertical organisation structure, together with limited participation from the local authorities, are some of the most commonly mentioned reasons for the lack of success. Even though there is hesitation regarding the development work up to today, all county councils will continue developing Chains of Care. The main reason is, as was the case with Chain of Care development up to today, to improve quality of care. Although one of the main purposes is to make health care more patient-focused, patients in general seem to have limited impact on the development work. Therefore, the challenge is to design Chains of Care which regards patients as partners, and not objects.

Fragmentation processes in nuclear reactions

International Nuclear Information System (INIS)

Legrain, R.

1984-08-01

Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

Engineering electronic states of periodic and quasiperiodic chains by buckling

Science.gov (United States)

Mukherjee, Amrita; Nandy, Atanu; Chakrabarti, Arunava

2017-07-01

The spectrum of spinless, non-interacting electrons on a linear chain that is buckled in a non-uniform, quasiperiodic manner is investigated within a tight binding formalism. We have addressed two specific cases, viz., a perfectly periodic chain wrinkled in a quasiperiodic Fibonacci pattern, and a quasiperiodic Fibonacci chain, where the buckling also takes place in a Fibonacci pattern. The buckling brings distant neighbors in the parent chain to close proximity, which is simulated by a tunnel hopping amplitude. It is seen that, in the perfectly ordered case, increasing the strength of the tunnel hopping (that is, bending the segments more) absolutely continuous density of states is retained towards the edges of the band, while the central portion becomes fragmented and host subbands of narrowing widths containing extended, current carrying states, and multiple isolated bound states formed as a result of the bending. A switching ;on; and ;off; of the electronic transmission can thus be engineered by buckling. On the other hand, in the second example of a quasiperiodic Fibonacci chain, imparting a quasiperiodic buckling is found to generate continuous subband(s) destroying the usual multifractality of the energy spectrum. We present exact results based on a real space renormalization group analysis, that is corroborated by explicit calculation of the two terminal electronic transport.

Spin chains and Gustafson's integrals

International Nuclear Information System (INIS)

Derkachov, S.E; Manashov, A.N.; Regensburg Univ.

2016-12-01

The Gustafson's integrals are the multidimensional generalization of the classical Mellin-Barnes integrals. We show that some of these integrals arise from relations between matrix elements in the Sklyanin's representation of Separated Variables in the spin chain models. We also present several new integrals.

Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

Science.gov (United States)

Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

2015-06-01

A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

Effects of the fragmentation models on the determination of αsub(S) in e+e- annihilation

International Nuclear Information System (INIS)

Lavagne, Y.

1982-06-01

Jet phenomenology is presented and quantum chromodynamic notions necessary to this study comprehension are given. Device is described, together with data acquisition and different steps of hadronic event selection. Three jet topology events are selected from presented variables and methods. Two models with different fragmentation processes are used to determine αsub(S). Results for each model are gathered and display the fragmentation process influence on αsub(S) value [fr

Supply chain risk management enablers - A framework development through systematic review of the literature from 2000 to 2015

OpenAIRE

Kilubi, I.; Haasis, H.-D.

2015-01-01

The present paper delivers a robust and systematic literature review (SLR) on supply chain risk management (SCRM) with the purpose to a) review and analyse the literature concerning definitions and research methodologies applied, to b) develop a classificatory framework which clusters existing enablers on SCRM, and to c) examine the linkage between SCRM and performance. The findings reveal that not only is SCRM loosely defined, but that there are various fragmented supply chain risks enablers...

Fragment-based drug design.

Science.gov (United States)

Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

2011-01-01

Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

Effect of including decay chains on predictions of equilibrium-type terrestrial food chain models

International Nuclear Information System (INIS)

Kirchner, G.

1990-01-01

Equilibrium-type food chain models are commonly used for assessing the radiological impact to man from environmental releases of radionuclides. Usually these do not take into account build-up of radioactive decay products during environmental transport. This may be a potential source of underprediction. For estimating consequences of this simplification, the equations of an internationally recognised terrestrial food chain model have been extended to include decay chains of variable length. Example calculations show that for releases from light water reactors as expected both during routine operation and in the case of severe accidents, the build-up of decay products during environmental transport is generally of minor importance. However, a considerable number of radionuclides of potential radiological significance have been identified which show marked contributions of decay products to calculated contamination of human food and resulting radiation dose rates. (author)

Fragment informatics and computational fragment-based drug design: an overview and update.

Science.gov (United States)

Sheng, Chunquan; Zhang, Wannian

2013-05-01

Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

Primary structure of the hemoglobin alpha-chain of rose-ringed parakeet (Psittacula krameri).

Science.gov (United States)

Islam, A; Beg, O U; Persson, B; Zaidi, Z H; Jörnvall, H

1988-10-01

The structure of the hemoglobin alpha-chain of Rose-ringed Parakeet was determined by sequence degradations of the intact subunit, the CNBr fragments, and peptides obtained by digestion with staphylococcal Glu-specific protease and trypsin. Using this analysis, the complete alpha-chain structure of 21 avian species is known, permitting comparisons of the protein structure and of avian relationships. The structure exhibits differences from previously established avian alpha-chains at a total of 61 positions, five of which have residues unique to those of the parakeet (Ser-12, Gly-65, Ser-67, Ala-121, and Leu-134). The analysis defines hemoglobin variation within an additional avian order (Psittaciformes), demonstrates distant patterns for evaluation of relationships within other avian orders, and lends support to taxonomic conclusions from molecular data.

Medicinal chemistry inspired fragment-based drug discovery.

Science.gov (United States)

Lanter, James; Zhang, Xuqing; Sui, Zhihua

2011-01-01

Lead generation can be a very challenging phase of the drug discovery process. The two principal methods for this stage of research are blind screening and rational design. Among the rational or semirational design approaches, fragment-based drug discovery (FBDD) has emerged as a useful tool for the generation of lead structures. It is particularly powerful as a complement to high-throughput screening approaches when the latter failed to yield viable hits for further development. Engagement of medicinal chemists early in the process can accelerate the progression of FBDD efforts by incorporating drug-friendly properties in the earliest stages of the design process. Medium-chain acyl-CoA synthetase 2b and ketohexokinase are chosen as examples to illustrate the importance of close collaboration of medicinal chemists, crystallography, and modeling. Copyright © 2011 Elsevier Inc. All rights reserved.

Logistic indicators measurement in two assembly operations feeded by supply-chains

Directory of Open Access Journals (Sweden)

Thiago Morais Menezes

2008-07-01

Full Text Available This paper presents a methodology for the measurement of logistic indicators. The methodology was applied in two cases: a shoewear assembling manufacture and a air conditioning assembling operation, both feeded by supply-chains. The study of the assembling operation can be useful in synchronizing the supply-chain and reducing variability in order arrivals by forming an assembly buffer. The methodology applies quantitative and graphic analysis to evaluate leadtime, inventory, performance and buffer. The first case was an exploration of the model, testing and refine its quantitative part. The second case, more extended, studied, in quantitative and graphically modes, two serial processes: standard assembling of items delivered by a supply-chain and customized services. The case was discussed and the implications analyzed. With the so calculated indicators, we suggest inventory reduction in assembling and increase in customization, so the total leadtime can also be reduced. Key words:, Logistic indicators, Queues in manufacture, Manufacturing Control; Variability in Supply Chains, Supply Chain management.

Prognostics for Steam Generator Tube Rupture using Markov Chain model

International Nuclear Information System (INIS)

Kim, Gibeom; Heo, Gyunyoung; Kim, Hyeonmin

2016-01-01

This paper will describe the prognostics method for evaluating and forecasting the ageing effect and demonstrate the procedure of prognostics for the Steam Generator Tube Rupture (SGTR) accident. Authors will propose the data-driven method so called MCMC (Markov Chain Monte Carlo) which is preferred to the physical-model method in terms of flexibility and availability. Degradation data is represented as growth of burst probability over time. Markov chain model is performed based on transition probability of state. And the state must be discrete variable. Therefore, burst probability that is continuous variable have to be changed into discrete variable to apply Markov chain model to the degradation data. The Markov chain model which is one of prognostics methods was described and the pilot demonstration for a SGTR accident was performed as a case study. The Markov chain model is strong since it is possible to be performed without physical models as long as enough data are available. However, in the case of the discrete Markov chain used in this study, there must be loss of information while the given data is discretized and assigned to the finite number of states. In this process, original information might not be reflected on prediction sufficiently. This should be noted as the limitation of discrete models. Now we will be studying on other prognostics methods such as GPM (General Path Model) which is also data-driven method as well as the particle filer which belongs to physical-model method and conducting comparison analysis

Baryon production and the centrality dependence of limiting fragmentation in heavy ion collision

International Nuclear Information System (INIS)

Mondal, M.M.; Chattopadhyay, S.

2006-01-01

In experiments with the relativistic heavy ion collisions the primary goals is to study the particle distribution in pseudorapidity variable. From the study of the distribution information of the collision mechanism such as the study of hypothesis of limiting fragmentation can be made

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

Science.gov (United States)

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

Science.gov (United States)

Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

2014-08-30

The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

Contribution of components of Green Supply Chain Execution-Supply Loops in Green Supply Chain Performance measurement-A Pilot Empirical Study of the Indian Automobile Manufacturing Sector

OpenAIRE

Mohd. Asif Gandhi

2017-01-01

This paper is one of the several extensions of the research works done by [5]. Green Supply Chain Practices have been known to have an impact on Green Supply Chain Performance [5].This paper tests empirically through a pilot study of the Indian Automobile Manufacturing Sector, the contribution of the three variables constituting the construct Green Supply Chain Execution-Supply Loops in Green Supply Chain Performance measurement. Also the paper establishes the reliability of the questionnaire...

Knowledge-based Fragment Binding Prediction

Science.gov (United States)

Tang, Grace W.; Altman, Russ B.

2014-01-01

Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

Genetic variability of broodstocks of restocking programs in Brazil

Directory of Open Access Journals (Sweden)

Nelson Lopera-Barrero

2015-09-01

Full Text Available Objective. The aim of this study was evaluate the genetic diversity of the following broodstocks: piapara (Leporinus elongatus, dourado (Salminus brasiliensis, jundiá (Rhamdia quelen and cachara (Pseudoplatystoma fasciatum already useful for restocking programs in the Paranapanema, Iguaçu and Paraná Brazilian Rivers. Materials and methods. Samples from the caudal fin of 122 fish were analyzed. DNA was extracted by NaCl protocol. PCR products were separated by a horizontal agarose gel electrophoresis. The fragments were visualized by staining with ethidium bromide. Results. The amplification of 25 primers generated different fragments in studied species that allowed characterizing 440 fragments of 100-2900 bp. High percentage of polymorphic fragments (66.67 to 86.29, Shannon index (0.365 to 0.486 and genetic diversity of Nei (0.248 to 0.331 were detected. Conclusions. The level of genetic variability in the broodstocks was adequate for allowing their use in restocking programs in the studied Rivers. However, periodical monitoring studies of genetic variability in these stocks, the mating system, reproductive system and general management must be made to guarantee the preservation of wild populations.

On Darboux-integrable semi-discrete chains

International Nuclear Information System (INIS)

Habibullin, Ismagil; Sakieva, Alfia; Zheltukhina, Natalya

2010-01-01

A differential-difference equation d/dx t (n+1,x) = f(x,t(n,x),t(n+1,x),d/dx t (n,x)) with unknown t(n, x) depending on the continuous and discrete variables x and n is studied. We call an equation of such kind Darboux integrable if there exist two functions (called integrals) F and I of a finite number of dynamical variables such that D x F = 0 and DI = I, where D x is the operator of total differentiation with respect to x and D is the shift operator: Dp(n) = p(n + 1). It is proved that the integrals can be brought to some canonical form. A method of construction of an explicit formula for a general solution to Darboux-integrable chains is discussed and such solutions are found for a class of chains.

Supply chain integration framework using literature review

OpenAIRE

Alfalla-Luque, Rafaela; Medina-Lopez, Carmen; Dey, Prasanta K.

2013-01-01

Definitions and measures of supply chain integration (SCI) are diverse. More empirical research, with clear definition and appropriate measures are needed. The purpose of this article is to identify dimensions and variables for SCI and develop an integrated framework to facilitate this. A literature review of the relevant academic papers in international journals in Logistics, Supply Chain Management and Operations Management for the period 1995-2009 has been undertaken. This study reveals th...

Coagulation–fragmentation for a finite number of particles and application to telomere clustering in the yeast nucleus

International Nuclear Information System (INIS)

Hozé, Nathanaël; Holcman, David

2012-01-01

We develop a coagulation–fragmentation model to study a system composed of a small number of stochastic objects moving in a confined domain, that can aggregate upon binding to form local clusters of arbitrary sizes. A cluster can also dissociate into two subclusters with a uniform probability. To study the statistics of clusters, we combine a Markov chain analysis with a partition number approach. Interestingly, we obtain explicit formulas for the size and the number of clusters in terms of hypergeometric functions. Finally, we apply our analysis to study the statistical physics of telomeres (ends of chromosomes) clustering in the yeast nucleus and show that the diffusion–coagulation–fragmentation process can predict the organization of telomeres. -- Highlights: ► We develop a coagulation–fragmentation model to study a system composed of a small number of stochastic particles. ► The stochastic objects are moving in a confined domain. ► We apply our analysis to study the statistical physics of telomeres (ends of chromosomes) clustering in the yeast nucleus. ► We show that the diffusion–coagulation–fragmentation process can predict the organization of telomeres in yeast.

Structural and biophysical characterization of an epitope-specific engineered Fab fragment and complexation with membrane proteins: implications for co-crystallization.

Science.gov (United States)

Johnson, Jennifer L; Entzminger, Kevin C; Hyun, Jeongmin; Kalyoncu, Sibel; Heaner, David P; Morales, Ivan A; Sheppard, Aly; Gumbart, James C; Maynard, Jennifer A; Lieberman, Raquel L

2015-04-01

Crystallization chaperones are attracting increasing interest as a route to crystal growth and structure elucidation of difficult targets such as membrane proteins. While strategies to date have typically employed protein-specific chaperones, a peptide-specific chaperone to crystallize multiple cognate peptide epitope-containing client proteins is envisioned. This would eliminate the target-specific chaperone-production step and streamline the co-crystallization process. Previously, protein engineering and directed evolution were used to generate a single-chain variable (scFv) antibody fragment with affinity for the peptide sequence EYMPME (scFv/EE). This report details the conversion of scFv/EE to an anti-EE Fab format (Fab/EE) followed by its biophysical characterization. The addition of constant chains increased the overall stability and had a negligible impact on the antigen affinity. The 2.0 Å resolution crystal structure of Fab/EE reveals contacts with larger surface areas than those of scFv/EE. Surface plasmon resonance, an enzyme-linked immunosorbent assay, and size-exclusion chromatography were used to assess Fab/EE binding to EE-tagged soluble and membrane test proteins: namely, the β-barrel outer membrane protein intimin and α-helical A2a G protein-coupled receptor (A2aR). Molecular-dynamics simulation of the intimin constructs with and without Fab/EE provides insight into the energetic complexities of the co-crystallization approach.

Enhancement of antitumor activity by using a fully human gene encoding a single-chain fragmented antibody specific for carcinoembryonic antigen

Directory of Open Access Journals (Sweden)

Shibaguchi H

2017-08-01

Full Text Available Hirotomo Shibaguchi,1,* Naixiang Luo,1,* Naoto Shirasu,1,* Motomu Kuroki,2 Masahide Kuroki1 1Department of Biochemistry, Faculty of Medicine, Fukuoka University, Fukuoka, Japan; 2School of Nursing, Faculty of Medicine, Fukuoka University, Fukuoka, Japan *These authors equally contributed to this work Abstract: Human leukocyte antigen and/or costimulatory molecules are frequently lacking in metastatic tumor cells, and thus tumor cells are able to escape from the immune system. Although lymphocytes with a chimeric antigen receptor (CAR is a promising approach for overcoming this challenge in cancer immunotherapy, administration of modified T cells alone often demonstrates little efficacy in patients. Therefore, in order to enhance the antitumor activity of immune cells in the cancer microenvironment, we used lymphocytes expressing CAR in combination with a fusion protein of IL-2 that contained the single-chain fragmented antibody (scFv specific for the carcinoembryonic antigen. Among a series of CAR constructs, with or without a spacer and the intracellular domain of CD28, the CAR construct containing CD8α, CD28, and CD3ζ most effectively activated and expressed INF-γ in CAR-bearing T cells. Furthermore, in comparison with free IL-2, the combination of peripheral blood mononuclear cells expressing CAR and the fusion protein containing IL-2 significantly enhanced the antitumor activity against MKN-45 cells, a human gastric cancer cell line. In conclusion, this novel combination therapy of CAR and a fusion protein consisting of a functional cytokine and a fully human scFv may be a promising approach for adoptive cancer immunotherapy. Keywords: chimeric antigen receptor, fusion protein, human scFv, CEA, combination therapy

Scaling invariance of spherical projectile fragmentation upon high-velocity impact on a thin continuous shield

Energy Technology Data Exchange (ETDEWEB)

Myagkov, N. N., E-mail: nn-myagkov@mail.ru [Russian Academy of Sciences, Institute of Applied Mechanics (Russian Federation)

2017-01-15

The problem of aluminum projectile fragmentation upon high-velocity impact on a thin aluminum shield is considered. A distinctive feature of this description is that the fragmentation has been numerically simulated using the complete system of equations of deformed solid mechanics by a method of smoothed particle hydrodynamics in three-dimensional setting. The transition from damage to fragmentation is analyzed and scaling relations are derived in terms of the impact velocity (V), ratio of shield thickness to projectile diameter (h/D), and ultimate strength (σ{sub p}) in the criterion of projectile and shield fracture. Analysis shows that the critical impact velocity V{sub c} (separating the damage and fragmentation regions) is a power function of σ{sub p} and h/D. In the supercritical region (V > V{sub c}), the weight-average fragment mass asymptotically tends to a power function of the impact velocity with exponent independent of h/D and σ{sub p}. Mean cumulative fragment mass distributions at the critical point are scale-invariant with respect to parameters h/D and σ{sub p}. Average masses of the largest fragments are also scale-invariant at V > V{sub c}, but only with respect to variable parameter σ{sub p}.

Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

Science.gov (United States)

Lirman

2000-08-23

Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

Science.gov (United States)

Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

2016-01-01

Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

Fractal statistics of brittle fragmentation

Directory of Open Access Journals (Sweden)

M. Davydova

2013-04-01

Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

Flexibility evaluation of multiechelon supply chains.

Science.gov (United States)

Almeida, João Flávio de Freitas; Conceição, Samuel Vieira; Pinto, Luiz Ricardo; de Camargo, Ricardo Saraiva; Júnior, Gilberto de Miranda

2018-01-01

Multiechelon supply chains are complex logistics systems that require flexibility and coordination at a tactical level to cope with environmental uncertainties in an efficient and effective manner. To cope with these challenges, mathematical programming models are developed to evaluate supply chain flexibility. However, under uncertainty, supply chain models become complex and the scope of flexibility analysis is generally reduced. This paper presents a unified approach that can evaluate the flexibility of a four-echelon supply chain via a robust stochastic programming model. The model simultaneously considers the plans of multiple business divisions such as marketing, logistics, manufacturing, and procurement, whose goals are often conflicting. A numerical example with deterministic parameters is presented to introduce the analysis, and then, the model stochastic parameters are considered to evaluate flexibility. The results of the analysis on supply, manufacturing, and distribution flexibility are presented. Tradeoff analysis of demand variability and service levels is also carried out. The proposed approach facilitates the adoption of different management styles, thus improving supply chain resilience. The model can be extended to contexts pertaining to supply chain disruptions; for example, the model can be used to explore operation strategies when subtle events disrupt supply, manufacturing, or distribution.

Geospatial analysis of forest fragmentation in Uttara Kannada District, India

Directory of Open Access Journals (Sweden)

Ramachandra T V

2016-04-01

Full Text Available Background: Landscapes consist of heterogeneous interacting dynamic elements with complex ecological, economic and cultural attributes. These complex interactions help in the sustenance of natural resources through bio-geochemical and hydrological cycling. The ecosystem functions are altered with changes in the landscape structure. Fragmentation of large contiguous forests to small and isolated forest patches either by natural phenomena or anthropogenic activities leads to drastic changes in forest patch sizes, shape, connectivity and internal heterogeneity, which restrict the movement leading to inbreeding among Meta populations with extirpation of species. Methods: Landscape dynamics are assessed through land use analysis by way of remote sensing data acquired at different time periods. Forest fragmentation is assessed at the pixel level through computation of two indicators, i.e., Pf (the ratio of pixels that are forested to the total non-water pixels in the window and Pff (the proportion of all adjacent (cardinal directions only pixel pairs that include at least one forest pixel, for which both pixels are forested. Results: Uttara Kannada District has the distinction of having the highest forest cover in Karnataka State, India. This region has been experiencing changes in its forest cover and consequent alterations in functional abilities of its ecosystem. Temporal land use analyses show the trend of deforestation, evident from the reduction of evergreen - semi evergreen forest cover from 57.31 % (1979 to 32.08 % (2013 Forest fragmentation at the landscape level shows a decline of interior forests 64.42 % (1979 to 25.62 % (2013 and transition of non-forest categories such as crop land, plantations and built-up areas, amounting now to 47.29 %. PCA prioritized geophysical and socio variables responsible for changes in the landscape structure at local levels. Conclusion: Terrestrial forest ecosystems in Uttara Kannada District of Central

A Four-Type Decision-Variable MINLP Model for a Supply Chain Network Design

Directory of Open Access Journals (Sweden)

M. M. Monteiro

2010-01-01

Full Text Available We propose a mixed integer nonlinear programming model for the design of a one-period planning horizon supply chain with integrated and flexible decisions on location of plants and of warehouses, on levels of production and of inventory, and on transportation models, considering stochastic demand and the ABC classification for finished goods, which is an NP-hard industrial engineering optimization problem. Furthermore, computational implementation of the proposed model is presented through the direct application of the outer approximation algorithm on some randomly generated supply chain data.

Chameleon fragmentation

Energy Technology Data Exchange (ETDEWEB)

Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

2014-02-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

Chameleon fragmentation

International Nuclear Information System (INIS)

Brax, Philippe; Upadhye, Amol

2014-01-01

A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

Dynameomics: Data-driven methods and models for utilizing large-scale protein structure repositories for improving fragment-based loop prediction

Science.gov (United States)

Rysavy, Steven J; Beck, David AC; Daggett, Valerie

2014-01-01

Protein function is intimately linked to protein structure and dynamics yet experimentally determined structures frequently omit regions within a protein due to indeterminate data, which is often due protein dynamics. We propose that atomistic molecular dynamics simulations provide a diverse sampling of biologically relevant structures for these missing segments (and beyond) to improve structural modeling and structure prediction. Here we make use of the Dynameomics data warehouse, which contains simulations of representatives of essentially all known protein folds. We developed novel computational methods to efficiently identify, rank and retrieve small peptide structures, or fragments, from this database. We also created a novel data model to analyze and compare large repositories of structural data, such as contained within the Protein Data Bank and the Dynameomics data warehouse. Our evaluation compares these structural repositories for improving loop predictions and analyzes the utility of our methods and models. Using a standard set of loop structures, containing 510 loops, 30 for each loop length from 4 to 20 residues, we find that the inclusion of Dynameomics structures in fragment-based methods improves the quality of the loop predictions without being dependent on sequence homology. Depending on loop length, ∼25–75% of the best predictions came from the Dynameomics set, resulting in lower main chain root-mean-square deviations for all fragment lengths using the combined fragment library. We also provide specific cases where Dynameomics fragments provide better predictions for NMR loop structures than fragments from crystal structures. Online access to these fragment libraries is available at http://www.dynameomics.org/fragments. PMID:25142412

Dynameomics: data-driven methods and models for utilizing large-scale protein structure repositories for improving fragment-based loop prediction.

Science.gov (United States)

Rysavy, Steven J; Beck, David A C; Daggett, Valerie

2014-11-01

Protein function is intimately linked to protein structure and dynamics yet experimentally determined structures frequently omit regions within a protein due to indeterminate data, which is often due protein dynamics. We propose that atomistic molecular dynamics simulations provide a diverse sampling of biologically relevant structures for these missing segments (and beyond) to improve structural modeling and structure prediction. Here we make use of the Dynameomics data warehouse, which contains simulations of representatives of essentially all known protein folds. We developed novel computational methods to efficiently identify, rank and retrieve small peptide structures, or fragments, from this database. We also created a novel data model to analyze and compare large repositories of structural data, such as contained within the Protein Data Bank and the Dynameomics data warehouse. Our evaluation compares these structural repositories for improving loop predictions and analyzes the utility of our methods and models. Using a standard set of loop structures, containing 510 loops, 30 for each loop length from 4 to 20 residues, we find that the inclusion of Dynameomics structures in fragment-based methods improves the quality of the loop predictions without being dependent on sequence homology. Depending on loop length, ∼ 25-75% of the best predictions came from the Dynameomics set, resulting in lower main chain root-mean-square deviations for all fragment lengths using the combined fragment library. We also provide specific cases where Dynameomics fragments provide better predictions for NMR loop structures than fragments from crystal structures. Online access to these fragment libraries is available at http://www.dynameomics.org/fragments. © 2014 The Protein Society.

Fragmentation, Fusion, and Genetic Homogeneity in a Calcareous Sponge (Porifera, Calcarea).

Science.gov (United States)

Padua, André; Leocorny, Pedro; Custódio, Márcio Reis; Klautau, Michelle

2016-06-01

Sessile marine invertebrates living on hard substrata usually present strategies such as size variations, longer life spans, fragmentation and fusion to occupy and compete for space. Calcareous sponges are usually small and short-lived, and some species are known to undergo frequent fragmentation and fusion events. However, whether fusion occurs only between genetically identical individuals remains unclear. We investigated the occurrence of chimaeras in the calcareous sponge Clathrina aurea by following the dynamics of fragmentation and fusion of 66 individuals in the field for up to 18 months and determined size variations and the life span of each individual. Microsatellites were used to determine whether fusion events occur among genetically different individuals. Growth and shrinkage of individuals were frequently observed, showing that size cannot be associated with age in C. aurea. The life span of the species ranged from 1 to 16 months (mean: 4.7 months). Short life spans and variable growth rates have been observed in other species of the class Calcarea. Fragmentation and fusion events were observed, but fusion events always occurred between genetically identical individuals, as has been suggested by graft experiments in adult Demospongiae and other Calcarea. These results suggest that at least C. aurea adults may have some mechanism to avoid chimaerism. © 2016 Wiley Periodicals, Inc.

Supply chains in global production

Directory of Open Access Journals (Sweden)

Anatolii Mazaraki

2017-10-01

Full Text Available Introduction. Analyzing the current processes of global sales and sales interaction over the past two decades shows that the world’s system of exchanges has undergone significant changes that have been caused by a multitude of factors. The formation of a complex model of global production, determined by the peculiarities of the transformation of individual economies’ growth models, the specifics of their industrialization and the forms of development of their national production business, its institutional and market-wise restructuring and the degree of inclusion in the system of international division of labor. The change in the level and depth of the specialization of individual countries in the field of production and sale of products, in turn, has accelerated the overcoming of economic distance (which is measured by the cost of transport and information services. Based on the above, namely, within the framework of forming a new model of global production, the issue of studying the role and value of supply chains in this model is made relevant. Aim and tasks. The purpose of the article is to study the modern transformation of supply chains within the global production system. The findings will allow to determine what exactly needs to be done in the direction of further redeveloping the regulatory tools of global supply chain management. Research results. The article presents the results of studying the transformation of supply chains’ role in global production. It is determined that taking into account the existing specificity of industrialization and fragmentation of national production, as well as the rapid spread of the results of scientific and technological progress in the world economy, there is a need for a more thorough study of this change. As a result of analyzing open source statistical data, a conclusion was reached regarding the transition from the competition of individual business entities to the competition of global

Edge-effect interactions in fragmented and patchy landscapes.

Science.gov (United States)

Porensky, Lauren M; Young, Truman P

2013-06-01

Ecological edges are increasingly recognized as drivers of landscape patterns and ecosystem processes. In fragmented and patchy landscapes (e.g., a fragmented forest or a savanna with scattered termite mounds), edges can become so numerous that their effects pervade the entire landscape. Results of recent studies in such landscapes show that edge effects can be altered by the presence or proximity of other nearby edges. We considered the theoretical significance of edge-effect interactions, illustrated various landscape configurations that support them and reviewed existing research on this topic. Results of studies from a variety of locations and ecosystem types show that edge-effect interactions can have significant consequences for ecosystems and conservation, including higher tree mortality rates in tropical rainforest fragments, reduced bird densities in grassland fragments, and bush encroachment and reduced wildlife densities in a tropical savanna. To clarify this underappreciated concept and synthesize existing work, we devised a conceptual framework for edge-effect interactions. We first worked to reduce terminological confusion by clarifying differences among terms such as edge intersection and edge interaction. For cases in which nearby edge effects interact, we proposed three possible forms of interaction: strengthening (presence of a second edge causes stronger edge effects), weakening (presence of a second edge causes weaker edge effects), and emergent (edge effects change completely in the presence of a second edge). By clarifying terms and concepts, this framework enables more precise descriptions of edge-effect interactions and facilitates comparisons of results among disparate study systems and response variables. A better understanding of edge-effect interactions will pave the way for more appropriate modeling, conservation, and management in complex landscapes. © 2013 Society for Conservation Biology.

Renormalization group for centrosymmetric gauge transformations of the dynamic motion for a Markov-ordered polymer chain

International Nuclear Information System (INIS)

Mikhailov, I.D.; Zhuravskii, L.V.

1987-01-01

A method is proposed for calculating the vibrational-state density averaged over all configurations for a polymer chain with Markov disorder. The method is based on using a group of centrally symmetric gauge transformations that reduce the dynamic matrix for along polymer chain to renormalized dynamic matrices for short fragments. The short-range order is incorporated exactly in the averaging procedure, while the long-range order is incorporated in the self-consistent field approximation. Results are given for a simple skeletal model for a polymer containing tacticity deviations of Markov type

Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

Science.gov (United States)

Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

2015-01-01

Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

Philips Electronics synchronizes its supply chain to end the bullwhip effect

NARCIS (Netherlands)

Kok, de A.G.; Janssen, F.B.S.L.P.; van Doremalen, J.B.M.; Wachem, van E.; Clerkx, M.J.R.; Peeters, W.

2005-01-01

Demand variability increases as one moves up a supply chain. The demand for finished products is less variable than for subassemblies, which is less variable than for individual components. This phenomenon is known as the bullwhip or Forrester effect. It increases inventory unnecessarily and makes

Optimal resource allocation to survival and reproduction in parasitic wasps foraging in fragmented habitats.

Directory of Open Access Journals (Sweden)

Eric Wajnberg

Full Text Available Expansion and intensification of human land use represents the major cause of habitat fragmentation. Such fragmentation can have dramatic consequences on species richness and trophic interactions within food webs. Although the associated ecological consequences have been studied by several authors, the evolutionary effects on interacting species have received little research attention. Using a genetic algorithm, we quantified how habitat fragmentation and environmental variability affect the optimal reproductive strategies of parasitic wasps foraging for hosts. As observed in real animal species, the model is based on the existence of a negative trade-off between survival and reproduction resulting from competitive allocation of resources to either somatic maintenance or egg production. We also asked to what degree plasticity along this trade-off would be optimal, when plasticity is costly. We found that habitat fragmentation can indeed have strong effects on the reproductive strategies adopted by parasitoids. With increasing habitat fragmentation animals should invest in greater longevity with lower fecundity; yet, especially in unpredictable environments, some level of phenotypic plasticity should be selected for. Other consequences in terms of learning ability of foraging animals were also observed. The evolutionary consequences of these results are discussed.

Structural repertoire of immunoglobulin λ light chains

KAUST Repository

Chailyan, Anna

2011-03-01

The immunoglobulin λ isotype is present in nearly all vertebrates and plays an important role in the human immune system. Despite its importance, few systematic studies have been performed to analyze the structural conformation of its variable regions, contrary to what is the case for κ and heavy chains. We show here that an analysis of the structures of λ chains allows the definition of a discrete set of recurring conformations (canonical structures) of their hypervariable loops and, most importantly, the identification of sequence constraints that can be used to predict their structure. We also show that the structural repertoire of λ chains is different and more varied than that of the κ chains, consistently with the current view of the involvement of the two major light-chain families in complementary strategies of the immune system to ensure a fine tuning between diversity and stability in antigen recognition. © 2011 Wiley-Liss, Inc.

Structural repertoire of immunoglobulin λ light chains

KAUST Repository

Chailyan, Anna; Marcatili, Paolo; Cirillo, Davide; Tramontano, Anna

2011-01-01

The immunoglobulin λ isotype is present in nearly all vertebrates and plays an important role in the human immune system. Despite its importance, few systematic studies have been performed to analyze the structural conformation of its variable regions, contrary to what is the case for κ and heavy chains. We show here that an analysis of the structures of λ chains allows the definition of a discrete set of recurring conformations (canonical structures) of their hypervariable loops and, most importantly, the identification of sequence constraints that can be used to predict their structure. We also show that the structural repertoire of λ chains is different and more varied than that of the κ chains, consistently with the current view of the involvement of the two major light-chain families in complementary strategies of the immune system to ensure a fine tuning between diversity and stability in antigen recognition. © 2011 Wiley-Liss, Inc.

Universality of projectile fragmentation model

International Nuclear Information System (INIS)

Chaudhuri, G.; Mallik, S.; Das Gupta, S.

2012-01-01

Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

Effective use of product quality information in food supply chain logistics

NARCIS (Netherlands)

Rijpkema, W.A.

2014-01-01

Food supply chains have inherent characteristics, such as variability in product quality and quality decay, which put specific demands on logistics decision making. Furthermore, food supply chain organization and control has changed significantly in the past decades by factors such as scale

Effects of habitat fragmentation on the Eurasian badger (Meles meles subpopulations in Denmark

Directory of Open Access Journals (Sweden)

Cino Pertoldi

2001-09-01

Full Text Available Abstract Genetic variation in five populations of the Eurasian badger from Denmark was screened, using the hyper-variable minisatellite DNA probe 33.15. Very low genetic variability was found within populations. This lack of variability could be related to the fragmentation of the Danish landscape which reduces the effective population size of local populations and the gene flow between different subpopulations. The present paper discusses the possibility of managing the Danish badger subpopulations as a metapopulation.

Human antibody fragments specific for Bothrops jararacussu venom reduce the toxicity of other Bothrops sp. venoms.

Science.gov (United States)

Roncolato, Eduardo Crosara; Pucca, Manuela Berto; Funayama, Jaqueline Carlos; Bertolini, Thaís Barboza; Campos, Lucas Benício; Barbosa, José Elpidio

2013-01-01

Approximately 20,000 snakebites are registered each year in Brazil. The classical treatment for venomous snakebite involves the administration of sera obtained from immunized horses. Moreover, the production and care of horses is costly, and the use of heterologous sera can cause hypersensitivity reactions. The production of human antibody fragments by phage display technology is seen as a means of overcoming some of these disadvantages. The studies here attempted to test human monoclonal antibodies specific to Bothrops jararacussu against other Bothrops sp. venoms, using the Griffin.1 library of human single-chain fragment-variable (scFv) phage antibodies. Using the Griffin.1 phage antibody library, this laboratory previously produced scFvs capable of inhibiting the phospholipase and myotoxic activities of Bothrops jararacussu venom. The structural and functional similarities of the various forms of phospholipase A2 (PLA₂) in Bothrops venom served as the basis for the present study wherein the effectiveness of those same scFvs were evaluated against B. jararaca, B. neuwiedi, and B. moojeni venoms. Each clone was found to recognize all three Bothrops venoms, and purified scFvs partially inhibited their in vitro phospholipase activity. In vivo assays demonstrated that the scFv clone P2B7 reduced myotoxicity and increased the survival of animals that received the test venoms. The results here indicate that the scFv P2B7 is a candidate for inclusion in a mixture of specific antibodies to produce a human anti-bothropic sera. This data demonstrates that the human scFv P2B7 represents an alternative therapeutic approach to heterologous anti-bothropic sera available today.

Effects of Habitat Structure and Fragmentation on Diversity and Abundance of Primates in Tropical Deciduous Forests in Bolivia.

Science.gov (United States)

Pyritz, Lennart W; Büntge, Anna B S; Herzog, Sebastian K; Kessler, Michael

2010-10-01

Habitat structure and anthropogenic disturbance are known to affect primate diversity and abundance. However, researchers have focused on lowland rain forests, whereas endangered deciduous forests have been neglected. We aimed to investigate the relationships between primate diversity and abundance and habitat parameters in 10 deciduous forest fragments southeast of Santa Cruz, Bolivia. We obtained primate data via line-transect surveys and visual and acoustic observations. In addition, we assessed the vegetation structure (canopy height, understory density), size, isolation time, and surrounding forest area of the fragments. We interpreted our results in the context of the historical distribution data for primates in the area before fragmentation and interviews with local people. We detected 5 of the 8 historically observed primate species: Alouatta caraya, Aotus azarae boliviensis, Callithrix melanura, Callicebus donacophilus, and Cebus libidinosus juruanus. Total species number and detection rates decreased with understory density. Detection rates also negatively correlated with forest areas in the surroundings of a fragment, which may be due to variables not assessed, i.e., fragment shape, distance to nearest town. Observations for Alouatta and Aotus were too few to conduct further statistics. Cebus and Callicebus were present in 90% and 70% of the sites, respectively, and their density did not correlate with any of the habitat variables assessed, signaling high ecological plasticity and adaptability to anthropogenic impact in these species. Detections of Callithrix were higher in areas with low forest strata. Our study provides baseline data for future fragmentation studies in Neotropical dry deciduous forests and sets a base for specific conservation measures.

Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

Science.gov (United States)

Dubinets, Nikita; Slipchenko, Lyudmila V

2017-07-20

Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

Abundance and fragmentation patterns of the ecosystem engineer Lithophyllum byssoides (Lamarck) Foslie along the Iberian Peninsula Atlantic coast. Conservation and management implications

Science.gov (United States)

Veiga, Puri; Rubal, Marcos; Cacabelos, Eva; Moreira, Juan; Sousa-Pinto, Isabel

2013-10-01

The crustose calcareous red macroalgae Lithophyllum byssoides (Lamarck) Foslie is a common ecosystem engineer along the Atlantic and Mediterranean coast of the Iberian Peninsula. This species is threatened by several anthropogenic impacts acting at different spatial scales, such as pollution or global warming. The aim of this study is to identify scales of spatial variation in the abundance and fragmentation patterns of L. byssoides along the Atlantic coast of the Iberian Peninsula. For this aim we used a hierarchical sampling design considering four spatial scales (from metres to 100s of kilometres). Results of the present study indicated no significant variability among regions investigated whereas significant variability was found at the scales of shore and site in spatial patterns of abundance and fragmentation of L. byssoides. Variance components were higher at the spatial scale of shore for abundance and fragmentation of L. byssoides with the only exception of percentage cover and thus, processes acting at the scale of 10s of kilometres seem to be more relevant in shaping the spatial variability both in abundance and fragmentation of L. byssoides. These results provided quantitative estimates of abundance and fragmentation of L. byssoides at the Atlantic coast of the Iberian Peninsula establishing the observational basis for future assessment, monitoring and experimental investigations to identify the processes and anthropogenic impacts affecting L. byssoides populations. Finally we have also identified percentage cover and patch density as the best variables for long-term monitoring programs aimed to detect future anthropogenic impacts on L. byssoides. Therefore, our results have important implications for conservation and management of this valuable ecosystem engineer along the Atlantic coast of the Iberian Peninsula.

Robust Object Tracking Using Valid Fragments Selection.

Science.gov (United States)

Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

Self-organized criticality in fragmenting

DEFF Research Database (Denmark)

Oddershede, L.; Dimon, P.; Bohr, J.

1993-01-01

The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

Energy production using fission fragment rockets

International Nuclear Information System (INIS)

Chapline, G.; Matsuda, Y.

1991-08-01

Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

Flexibility evaluation of multiechelon supply chains.

Directory of Open Access Journals (Sweden)

João Flávio de Freitas Almeida

Full Text Available Multiechelon supply chains are complex logistics systems that require flexibility and coordination at a tactical level to cope with environmental uncertainties in an efficient and effective manner. To cope with these challenges, mathematical programming models are developed to evaluate supply chain flexibility. However, under uncertainty, supply chain models become complex and the scope of flexibility analysis is generally reduced. This paper presents a unified approach that can evaluate the flexibility of a four-echelon supply chain via a robust stochastic programming model. The model simultaneously considers the plans of multiple business divisions such as marketing, logistics, manufacturing, and procurement, whose goals are often conflicting. A numerical example with deterministic parameters is presented to introduce the analysis, and then, the model stochastic parameters are considered to evaluate flexibility. The results of the analysis on supply, manufacturing, and distribution flexibility are presented. Tradeoff analysis of demand variability and service levels is also carried out. The proposed approach facilitates the adoption of different management styles, thus improving supply chain resilience. The model can be extended to contexts pertaining to supply chain disruptions; for example, the model can be used to explore operation strategies when subtle events disrupt supply, manufacturing, or distribution.

Fragmentation of relativistic nuclei

International Nuclear Information System (INIS)

Cork, B.

1975-06-01

Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

Energy Technology Data Exchange (ETDEWEB)

Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1965-07-01

This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

Thermodynamics of the fuel fragmentation gas

International Nuclear Information System (INIS)

Perez, R.B.; Alsmiller, R.G. Jr.

1977-01-01

In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

Molecular identification of Candida species isolated from cases of neonatal candidemia using polymerase chain reaction-restriction fragment length polymorphism in a tertiary care hospital

Directory of Open Access Journals (Sweden)

Akeela Fatima

2017-01-01

Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.

The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

Science.gov (United States)

Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

2013-01-01

In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

Effective use of product quality information in food supply chain logistics

OpenAIRE

Rijpkema, W.A.

2014-01-01

Food supply chains have inherent characteristics, such as variability in product quality and quality decay, which put specific demands on logistics decision making. Furthermore, food supply chain organization and control has changed significantly in the past decades by factors such as scale intensification and globalization. In practice, these characteristics and developments frequently lead to supply chain problems, such as high levels of product waste, product quality problems, and high lo...

Models of fragmentation with composite power laws

Science.gov (United States)

Tavassoli, Z.; Rodgers, G. J.

1999-06-01

Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

Identification and characterization of a thermally cleaved fragment of monoclonal antibody-A detected by sodium dodecyl sulfate-capillary gel electrophoresis.

Science.gov (United States)

Kubota, Kei; Kobayashi, Naoki; Yabuta, Masayuki; Ohara, Motomu; Naito, Toyohiro; Kubo, Takuya; Otsuka, Koji

2017-06-05

This report describes a novel, comprehensive approach to identifying a fragment peak of monoclonal antibody-A (mAb-A), detected by sodium dodecyl sulfate-capillary gel electrophoresis (SDS-cGE). The fragment migrated close to the internal standard (10kDa marker) of SDS-cGE and increased about 0.5% under a 25°C condition for 6 months. Generally, identification of fragments observed in SDS-cGE is challenging to carry out due to the difficulty of collecting analytical amounts of fractionations from the capillary. In this study, in-gel digestion peptide mapping and reversed phase liquid chromatography-mass spectrometry (RPLC-MS) were employed to elucidate the structure of the fragment. In addition, a Gelfree 8100 fractionation system was newly introduced to collect the fragment and the fraction was applied to the structural analysis of a mAb for the first time. These three analytical methods showed comparable results, proving that the fragment was a fraction of heavy chain HC1-104. The fragment contained complementarity determining regions (CDRs), which are significant to antigen binding, and thus would affect the efficacy of mAb-A. In addition, SDS-cGE without the 10kDa marker was demonstrated to clarify the increased amount of the fragment, and the experiment revealed that the fragment increases 0.2% per year in storage at 5°C. The combination of the three analytical methodologies successfully identified the impurity peak detected by SDS-cGE, providing information critical to assuring the quality and stability of the biotherapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.

Kinetics of fragmentation-annihilation processes

OpenAIRE

Filipe, JAN; Rodgers, GJ

1996-01-01

We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

Fission fragment spins and spectroscopy

International Nuclear Information System (INIS)

Durell, J.L.

1988-01-01

Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

Discrete-Choice Modeling Of Non-Working Women’s Trip-Chaining Activity Based

Science.gov (United States)

Hayati, Amelia; Pradono; Purboyo, Heru; Maryati, Sri

2018-05-01

Start The urban developments of technology and economics are now changing the lifestyles of the urban societies. It is also changing their travel demand to meet their movement needs. Nowadays, urban women, especially in Bandung, West Java, have a high demand for their daily travel and tend to increase. They have the ease of accessibility to personal modes of transportation and freedom to go anywhere to meet their personal and family needs. This also happens to non-working women or as housewives in the city of Bandung. More than 50% of women’s mobility is outside the home, in the term of trip-chaining, from leaving to returning home in one day. It is based on their complex activities in order to meet the needs of family and home care. While less than 60% of male’s mobility is outdoors, it is a simple trip-chaining or only has a single trip. The trip-chaining has significant differences between non-working women and working-men. This illustrates the pattern of Mom and Dad’s mobility in a family with an activity-based approach for the same purpose, i.e. family welfare. This study explains how complex the trip-chaining of non-working urban women and as housewives, with an activity-based approach done outdoors in a week. Socio-economic and household demographic variables serve as the basis for measuring the independent variables affecting family welfare, as well as the variables of type, time and duration of activities performed by unemployed housewives. This study aims to examine the interrelationships between activity variables, especially the time of activity and travel, and socio-economic of household variables that can generate the complexity of women’s daily travel. Discrete Choice Modeling developed by Ben-Akiva, Chandra Bhat, etc., is used in this study to illustrate the relationship between activity and socio-economic demographic variables based on primary survey data in Bandung, West Java for 466 unemployed housewives. The results of the regression, by

[Environmental variability and physiological responses from Polylepis cuadrijuga (Rosaceae) in a fragmented environment in the Páramo de la Rusia (Colombia].

Science.gov (United States)

Ramos, Carolina; Buitrago, Sindy P; Pulido, Karen L; Vanegas, Leidy J

2013-03-01

Polylepis cuadrijuga is an endemic woody species from the Colombian Eastern range, being the only tree species with capacity to live on mountainous environments beyond 4 000m of altitude. Grazing and agriculture have transformed at least 30% of the Guantiva-La Rusia region, turning continuous extensions of high Andean forest in a fragmented landscape, and P cuadrijuga remnants have become smaller and more isolated. The aim of this study was to establish the environmental differences between a matrix of grazing pastures and the interior of fragments, to evaluate the physiological responses of P cuadrijuga and determining the edge effect. Air temperature and humidity, soil water holding capacity and photosynthetic active radiation, were measured along two 50X2m transects from the matrix toward the center of fragment. Six trees inside the transects were chosen in each one of three sites (matrix, edge and interior) to measure the index chlorophyll content and to sample leaves to assess the leaf area, leaf biomass, specific leaf area, anatomy, health condition and pubescence. Results showed significantly differences between the matrix and the interior and intermediate conditions in the edge. Radiation, temperature and air desiccation were higher in the matrix than in the interior, submitting P cuadrijuga trees to a stressing environment, where they presented stratification of epidermis and palisade parenchyma, and a higher leaf area, leaf thickness, chlorophyll content and pubescence than in the interior of fragments. All these physiological traits allow avoiding the photoxidation and damages by freezing or desiccation to which trees are exposed in a grazing pasture matrix. Nevertheless, there was a higher frequency of healthy leaves in the interior of fragments, showing that high irradiations and extreme air temperature and humidity reach adversely affect to P cuadrijuga. Individuals in the edge had ecophysiological traits similar to the matrix ones, which confirm an

Blocking of proteolytic processing and deletion of glycosaminoglycan side chain of mouse DMP1 by substituting critical amino acid residues.

Science.gov (United States)

Peng, Tao; Huang, Bingzhen; Sun, Yao; Lu, Yongbo; Bonewald, Lynda; Chen, Shuo; Butler, William T; Feng, Jerry Q; D'Souza, Rena N; Qin, Chunlin

2009-01-01

Dentin matrix protein 1 (DMP1) is present in the extracellular matrix (ECM) of dentin and bone as processed NH(2)- and COOH-terminal fragments, resulting from proteolytic cleavage at the NH(2) termini of 4 aspartic acid residues during rat DMP1 processing. One cleavage site residue, Asp(181) (corresponding to Asp(197) of mouse DMP1), and its flanking region are highly conserved across species. We speculate that cleavage at the NH(2) terminus of Asp(197) of mouse DMP1 represents an initial, first-step scission in the whole cascade of proteolytic processing. To test if Asp(197) is critical for initiating the proteolytic processing of mouse DMP1, we substituted Asp(197) with Ala(197) by mutating the corresponding nucleotides of mouse cDNA that encode this amino acid residue. This mutant DMP1 cDNA was cloned into a pcDNA3.1 vector. Data from transfection experiments indicated that this single substitution blocked the proteolytic processing of mouse DMP1 in HEK-293 cells, indicating that cleavage at the NH(2) terminus of Asp(197) is essential for exposing other cleavage sites for the conversion of DMP1 to its fragments. The NH(2)-terminal fragment of DMP1 occurs as a proteoglycan form (DMP1-PG) that contains a glycosaminoglycan (GAG) chain. Previously, we showed that a GAG chain is linked to Ser(74) in rat DMP1 (Ser(89) in mouse DMP1). To confirm that mouse DMP1-PG possesses a single GAG chain attached to Ser(89), we substituted Ser(89) by Gly(89). Data from transfection analysis indicated that this substitution completely prevented formation of the GAG-containing form, confirming that DMP1-PG contains a single GAG chain attached to Ser(89) in mouse DMP1. Copyright 2008 S. Karger AG, Basel.

Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

OpenAIRE

İLHAK, O. İrfan; ARSLAN, Ali

2014-01-01

The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

Supply chain performance: the role of regional markets

Directory of Open Access Journals (Sweden)

Ali Ghasemi

2015-05-01

Full Text Available This paper investigates the role of exports in the regional markets on the performance of supply chain. The study first determines critical variables affecting exports for entering into the regional markets and then measures the effects of these variables on the effectiveness of supply chain performance. The study uses two questionnaires, one for measuring the effects of various factors on export development and the other for measuring supply chain performance in Likert scale. Cronbach alpha for the mentioned questionnaires were calculated as 0.84 and 0.78, respectively. The population of the survey includes all small and medium enterprises active in city of Tehran, Iran and the study selects a sample of 250 people as a sample size. Using factor analysis, the study has determined seven factors including product development, government support, strategic orientation, customer satisfaction, competitive pressures, organizational capability and distribution strategies for entry into regional markets. In addition, the implementation of structural equation modeling has disclosed that product development and distribution strategies maintained the highest impact on export activities.

Fragmentation of atomic clusters: A theoretical study

International Nuclear Information System (INIS)

Lopez, M.J.; Jellinek, J.

1994-01-01

Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

Assessing responsiveness of a volatile and seasonal supply chain

DEFF Research Database (Denmark)

Wong, Chee Yew; Arlbjørn, Jan Stentoft; Hvolby, Hans Henrik

2006-01-01

‘‘market responsive’’ and ‘‘physically efficient’’ supply chains constitutes the backbone of this assessment. Four risk-influencing determinants—forecast uncertainty, demand variability, contribution margin, and time window of delivery are found suitable to assess the responsiveness of the toy supply chain......This paper describes a structural approach to assess the responsiveness of a volatile and seasonal supply chain. It is based on a case study in an international toy company. Fisher’s (Harvard Bus. Rev. 75(2) (1997) 105–117) Model of ‘‘innovative’’ and ‘‘functional’’ products and the corresponding...... with volatility, and to design for a responsive supply chain. These findings have also enabled the extension of Fisher’s Model to volatile supply chains. This new product differentiation model adds a physically responsive supply chain for ‘‘intermediate’’ products into the Fisher’s Model....

Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

Directory of Open Access Journals (Sweden)

Tuti Susanti Legiastuti

2013-04-01

Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

QUEIMAP: a computer routine for punctual analysis of a nuclear fuel depletion with accumulation of fission fragments

International Nuclear Information System (INIS)

Couto, R.T.

1990-01-01

QUEIMAP is a computer routine for burnup calculation, composed of five FORTRAN-77 subroutines. Its objective is to solve depletion equation of four radionuclides conversion chain, U238, U235, Th232, as well as fission fragments equations. In this paper the burnup is considered punctual and evolutioned under cross section. It presents the solution algorithms employed by QUEIMAP, the validation of its results and the way of use it. (M.I.)

DNA fragmentation in spermatozoa

DEFF Research Database (Denmark)

Rex, A S; Aagaard, J.; Fedder, J

2017-01-01

Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

Photon-hadron fragmentation: theoretical situation

International Nuclear Information System (INIS)

Peschanski, R.

1983-07-01

Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

PENGARUH MEDIASI KEPERCAYAAN PADA HUBUNGAN ANTARA KOLABORASI SUPPLY CHAIN DAN KINERJA OPERASI

Directory of Open Access Journals (Sweden)

Amak M. Yaqoub

2012-01-01

Full Text Available This study aims to investigate the mediating role of interorganizational trust on the relationship between supply chain collaboration and operation performance. Supply chain collaboration measured using second order variables; information sharing, incentive alignment, and decision synchronization. Hypotheses testing using SmartPLS confirm positive relationship between supply chain collaboration and interorganizational trust as well as interorganizational trust and operations performance. The direct relationship between supply chain collaboration and operation performance was not significant. These support the mediating role of interorganizational trust.

Measurement of charm fragmentation in DIS at HERA

Energy Technology Data Exchange (ETDEWEB)

Rurikova, Z.

2006-04-15

The charm fragmentation function has been studied in deep inelastic ep collisions with the H1 detector at HERA. The data were analyzed in the kinematic range given by the photon virtuality 2variables sensitive to fragmentation, z{sub hem} and z{sub jet}, was measured in the D{sup *}-meson visible range de ned by cuts on pseudorapidity vertical stroke {eta}(D{sup *}) vertical stroke <1.5 and transverse momentum 1.53 GeV was required in the latter case. Both distributions were used to extract the parameters of the nonperturbative Peterson and Kartvelishvili fragmentation functions for the Monte Carlo models RAPGAP/PYTHIA and CASCADE/PYTHIA and for the next-to-leading-order massive QCD calculation HVQDIS. (orig.)

Study of multifragmentation: contribution of reduced velocity correlations between particles and fragments; Etude de la multifragmentation: apport des correlations en vitesse reduite entre particules et fragments

Energy Technology Data Exchange (ETDEWEB)

Le Fevre, A. [Paris-7 Univ., 75 (France)

1997-05-14

This work is focused on the study of fragment and light particle production mechanisms in the multifragmentation process of hot nuclei, which are formed in the central collisions of Xe+Sn at 50 MeV/u. The experiment has been performed with the INDRA multidetector. The central collision events, selected via the flow angle variable, exhibit the presence of a heavy (Z=90) and highly excited (E{sup *}=12.5 MeV/u) isotropic emission source. The comparison of the data with a statistical multifragmentation model (MMMC) and a dynamical model (BNV) makes us conclude that the multifragmentation can only be explained in the frame of a relatively cold process, around 6 MeV/u of thermal excitation energy, preceded by a primary emission stage of the expanding source, during which nearly one third of the excitation energy is dissipated. In addition, it appears that the fragment energy spectra are not explained by a purely thermal process, and that one has to put forward an expansion collective motion, of 2 MeV/u of energy, following the compression of the compound system. In order to precise the existence of a two-step particle emission (primary and secondary), we have developed and applied an original method of reduced velocity correlations between particles and fragments. It has allowed us to underline two distinct origins for the particle production: one corresponding to secondary emissions, coming from the fragments, and the other one, associated with emissions which occur prior to the fragment production. At last, it has allowed us, also to bring out a hierarchy in the emission time in the decay process, with respect to the particle type. (author) 90 refs.

Secretory signal peptide modification for optimized antibody-fragment expression-secretion in Leishmania tarentolae

Directory of Open Access Journals (Sweden)

Klatt Stephan

2012-07-01

Full Text Available Abstract Background Secretory signal peptides (SPs are well-known sequence motifs targeting proteins for translocation across the endoplasmic reticulum membrane. After passing through the secretory pathway, most proteins are secreted to the environment. Here, we describe the modification of an expression vector containing the SP from secreted acid phosphatase 1 (SAP1 of Leishmania mexicana for optimized protein expression-secretion in the eukaryotic parasite Leishmania tarentolae with regard to recombinant antibody fragments. For experimental design the online tool SignalP was used, which predicts the presence and location of SPs and their cleavage sites in polypeptides. To evaluate the signal peptide cleavage site as well as changes of expression, SPs were N-terminally linked to single-chain Fragment variables (scFv’s. The ability of L. tarentolae to express complex eukaryotic proteins with highly diverse post-translational modifications and its easy bacteria-like handling, makes the parasite a promising expression system for secretory proteins. Results We generated four vectors with different SP-sequence modifications based on in-silico analyses with SignalP in respect to cleavage probability and location, named pLTEX-2 to pLTEX-5. To evaluate their functionality, we cloned four individual scFv-fragments into the vectors and transfected all 16 constructs into L. tarentolae. Independently from the expressed scFv, pLTEX-5 derived constructs showed the highest expression rate, followed by pLTEX-4 and pLTEX-2, whereas only low amounts of protein could be obtained from pLTEX-3 clones, indicating dysfunction of the SP. Next, we analysed the SP cleavage sites by Edman degradation. For pLTEX-2, -4, and -5 derived scFv’s, the results corresponded to in-silico predictions, whereas pLTEX-3 derived scFv’s contained one additional amino-acid (AA. Conclusions The obtained results demonstrate the importance of SP-sequence optimization for efficient

Monte Carlo simulation as a tool to predict blasting fragmentation based on the Kuz Ram model

Science.gov (United States)

Morin, Mario A.; Ficarazzo, Francesco

2006-04-01

Rock fragmentation is considered the most important aspect of production blasting because of its direct effects on the costs of drilling and blasting and on the economics of the subsequent operations of loading, hauling and crushing. Over the past three decades, significant progress has been made in the development of new technologies for blasting applications. These technologies include increasingly sophisticated computer models for blast design and blast performance prediction. Rock fragmentation depends on many variables such as rock mass properties, site geology, in situ fracturing and blasting parameters and as such has no complete theoretical solution for its prediction. However, empirical models for the estimation of size distribution of rock fragments have been developed. In this study, a blast fragmentation Monte Carlo-based simulator, based on the Kuz-Ram fragmentation model, has been developed to predict the entire fragmentation size distribution, taking into account intact and joints rock properties, the type and properties of explosives and the drilling pattern. Results produced by this simulator were quite favorable when compared with real fragmentation data obtained from a blast quarry. It is anticipated that the use of Monte Carlo simulation will increase our understanding of the effects of rock mass and explosive properties on the rock fragmentation by blasting, as well as increase our confidence in these empirical models. This understanding will translate into improvements in blasting operations, its corresponding costs and the overall economics of open pit mines and rock quarries.

Application of the Solid-Phase Julia–Lythgoe Olefination in Vitamin D Side-Chain Construction

Directory of Open Access Journals (Sweden)

Pierre J. De Clercq

2006-08-01

Full Text Available An example of the Julia–Lythgoe attachment of the vitamin D side chain to a solid-phase linked Inhoffen–Lythgoe diol derived CD-ring fragment is reported.

Recent progress on perturbative QCD fragmentation functions

International Nuclear Information System (INIS)

Cheung, K.

1995-05-01

The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

Fragmentation and flow in central collisions

International Nuclear Information System (INIS)

Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

1987-01-01

Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

Long-term effects of fragmentation and fragment properties on bird species richness in Hawaiian forests

Science.gov (United States)

David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda

2010-01-01

Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...

Mass spectrometry for fragment screening.

Science.gov (United States)

Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

2017-11-08

Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Universal odd-even staggering in isotopic fragmentation and spallation cross sections of neutron-rich fragments

Science.gov (United States)

Mei, B.; Tu, X. L.; Wang, M.

2018-04-01

An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.

Bilinear forms and soliton solutions for a fourth-order variable-coefficient nonlinear Schrödinger equation in an inhomogeneous Heisenberg ferromagnetic spin chain or an alpha helical protein

Energy Technology Data Exchange (ETDEWEB)

Yang, Jin-Wei; Gao, Yi-Tian, E-mail: gaoyt163@163.com; Wang, Qi-Min; Su, Chuan-Qi; Feng, Yu-Jie; Yu, Xin

2016-01-15

In this paper, a fourth-order variable-coefficient nonlinear Schrödinger equation is studied, which might describe a one-dimensional continuum anisotropic Heisenberg ferromagnetic spin chain with the octuple–dipole interaction or an alpha helical protein with higher-order excitations and interactions under continuum approximation. With the aid of auxiliary function, we derive the bilinear forms and corresponding constraints on the variable coefficients. Via the symbolic computation, we obtain the Lax pair, infinitely many conservation laws, one-, two- and three-soliton solutions. We discuss the influence of the variable coefficients on the solitons. With different choices of the variable coefficients, we obtain the parabolic, cubic, and periodic solitons, respectively. We analyse the head-on and overtaking interactions between/among the two and three solitons. Interactions between a bound state and a single soliton are displayed with different choices of variable coefficients. We also derive the quasi-periodic formulae for the three cases of the bound states.

Exploration Supply Chain Simulation

Science.gov (United States)

2008-01-01

The Exploration Supply Chain Simulation project was chartered by the NASA Exploration Systems Mission Directorate to develop a software tool, with proper data, to quantitatively analyze supply chains for future program planning. This tool is a discrete-event simulation that uses the basic supply chain concepts of planning, sourcing, making, delivering, and returning. This supply chain perspective is combined with other discrete or continuous simulation factors. Discrete resource events (such as launch or delivery reviews) are represented as organizational functional units. Continuous resources (such as civil service or contractor program functions) are defined as enabling functional units. Concepts of fixed and variable costs are included in the model to allow the discrete events to interact with cost calculations. The definition file is intrinsic to the model, but a blank start can be initiated at any time. The current definition file is an Orion Ares I crew launch vehicle. Parameters stretch from Kennedy Space Center across and into other program entities (Michaud Assembly Facility, Aliant Techsystems, Stennis Space Center, Johnson Space Center, etc.) though these will only gain detail as the file continues to evolve. The Orion Ares I file definition in the tool continues to evolve, and analysis from this tool is expected in 2008. This is the first application of such business-driven modeling to a NASA/government-- aerospace contractor endeavor.

Proximal and Distal Predictors of the Spider Monkey's Stress Levels in Fragmented Landscapes.

Directory of Open Access Journals (Sweden)

José D Ordóñez-Gómez

Full Text Available The rapid loss, fragmentation and degradation of tropical forests threaten the survival of many animal species. However, the way in which these phenomena affect animal health has been poorly explored, thus limiting the design of appropriate conservation strategies. To address this, here we identified using linear mixed models the effect of proximal (diet, activity pattern, hunting and logging and distal (sum of the basal areas of fruiting-tree species [SBAFS], landscape forest cover and degree of forest fragmentation variables over fecal glucocorticoid metabolite (fGCM levels-hormones associated with animal health and fitness-of six groups of spider monkeys (Ateles geoffroyi inhabiting six landscapes with different spatial structures in Mexico. Proximal variables showed a stronger predictive power over fGCMs than distal. In this sense, increases in travel time, the occurrence of hunting, and reductions in rest time and fruit consumption resulted in higher fGCM levels. Regarding distal variables, increases in SBAFS were negatively related to fGCM levels, thus suggesting that food scarcity increases stress hormone levels. Nevertheless, contrary to theoretical expectations, spider monkeys living in smaller tracts of forest spent less time travelling, but the same time feeding on fruit as those in more forested areas. The lower net energy return associated with this combination of factors would explain why, contrary to theoretical expectations, increased forest cover was associated with increased levels of fGCMs in these groups. Our study shows that, at least in the short term, spider monkeys in fragmented landscapes do not always present higher levels of stress hormones compared to those inhabiting continuous forest, and the importance of preserving fruit sources and controlling hunting for reducing the levels of stress hormones in free ranging spider monkeys.

The binding parameters of radiolabelled monoclonal F (ab')2 and Fab' fragments relative to immunoglobulin G in reactions with surface-bound antigens

International Nuclear Information System (INIS)

Fjeld, J.G.; Nustad, K.; Michaelsen, T.E.

1992-01-01

The binding parameters of iodine-125-labelled intact monoclonal immunoglobulin G (IgG), F(ab') 2 and Fab' fragments were compared. The study was carried out with the two monoclonal antibodies (MoAbs) K13 and K16 specific for human Ig light chains κ and λ, respectively. When testing the 125 I-MoAbs against monodisperse polymer particles coated with the specific antigens, the K a for the F(ab') 2 fragments were similar to that for IgG, while the K a for the Fab' fragments were reduced to 10%-20% of that for IgG. The number N of effective target sites revealed with Fab' was higher than with F(ab') and IgG, presumably because less surface area is occupied by the small Fab' molecules. The immunoreactive fraction F ranged according to IgG>F(ab') 2 >Fab'. The explanation of the moderate difference between the K a of the monoclonal Fab' and the divalent IgG and F(ab') 2 was that the divalent molecules were not divalently attached to the particles. When testing the same antibody preparations against humanlymphoma cells producing Ig with light chains κ or λ, the binding results were less reliable than when particles were utilised, presumably due to antigen shedding. Different MoAbs vary in their loss of immunoreactivity due to enzymatic degradation and the radiolabelling procedure. The preparation of the radiolabelled fragments should therefore be optimized for each MoAb, and evaluation is necessary before injection. Artificial targets with a low leakage of antigen, like the monodisperse polymer particles here applied, are recommended for the in vitro evaluation of the immunoreactivity of labelled MoAb preparations. (orig.)

Classic metapopulations are rare among common beetle species from a naturally fragmented landscape.

Science.gov (United States)

Driscoll, Don A; Kirkpatrick, Jamie B; McQuillan, Peter B; Bonham, Kevin J

2010-01-01

1. The general importance of metacommunity and metapopulation theories is poorly understood because few studies have examined responses of the suite of species that occupy the same fragmented landscape. In this study, we examined the importance of spatial ecological theories using a large-scale, naturally fragmented landscape. 2. We measured the occurrence and abundance of 44 common beetle species in 31 natural rainforest fragments in Tasmania, Australia. We tested for an effect on beetle distribution of geographic variables (patch area, patch isolation and amount of surrounding habitat) and of environmental variables based on plant species, after first accounting for spatial autocorrelation using principal coordinates of neighbour matrices. The environmental variables described a productivity gradient and a post-fire succession from eucalypt-dominated forest to late-successional rainforest. 3. Few species had distributions consistent with a metapopulation. However, the amount of surrounding habitat and patch isolation influenced the occurrence or abundance of 30% of beetle species, implying that dispersal into or out of patches was an important process. 4. Three species showed a distribution that could arise by interactions with dominant competitors or predators with higher occurrence in small patches. 5. Environmental effects were more commonly observed than spatial effects. Twenty-three per cent of species showed evidence of habitat-driven, deterministic metapopulations. Furthermore, almost half of the species were influenced by the plant succession or productivity gradient, including effects at the within-patch, patch and regional scales. The beetle succession involved an increase in the frequency of many species, and the addition of new species, with little evidence of species turnover. Niche-related ecological theory such as the species-sorting metacommunity theory was therefore the most broadly applicable concept. 6. We conclude that classic and source

Primitive-path statistics of entangled polymers: mapping multi-chain simulations onto single-chain mean-field models

International Nuclear Information System (INIS)

Steenbakkers, Rudi J A; Schieber, Jay D; Tzoumanekas, Christos; Li, Ying; Liu, Wing Kam; Kröger, Martin

2014-01-01

We present a method to map the full equilibrium distribution of the primitive-path (PP) length, obtained from multi-chain simulations of polymer melts, onto a single-chain mean-field ‘target’ model. Most previous works used the Doi–Edwards tube model as a target. However, the average number of monomers per PP segment, obtained from multi-chain PP networks, has consistently shown a discrepancy of a factor of two with respect to tube-model estimates. Part of the problem is that the tube model neglects fluctuations in the lengths of PP segments, the number of entanglements per chain and the distribution of monomers among PP segments, while all these fluctuations are observed in multi-chain simulations. Here we use a recently proposed slip-link model, which includes fluctuations in all these variables as well as in the spatial positions of the entanglements. This turns out to be essential to obtain qualitative and quantitative agreement with the equilibrium PP-length distribution obtained from multi-chain simulations. By fitting this distribution, we are able to determine two of the three parameters of the model, which govern its equilibrium properties. This mapping is executed for four different linear polymers and for different molecular weights. The two parameters are found to depend on chemistry, but not on molecular weight. The model predicts a constant plateau modulus minus a correction inversely proportional to molecular weight. The value for well-entangled chains, with the parameters determined ab initio, lies in the range of experimental data for the materials investigated. (paper)

Physics of projectile fragments

International Nuclear Information System (INIS)

Minamisono, Tadanori

1982-01-01

This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

[Edge effect on lichen's distribution and chlorophyll content, in fragments of Polylepis quadrijuga (Rosaceae) in Páramo de la Rusia (Boyacá-Colombia)].

Science.gov (United States)

Pulido Herrera, Karen; Ramos Montaño, Carolina

2016-12-01

The ecosystems fragmentation is one of the anthropic phenomena with highest impact at global level and the edge effect causes that only the fragments interior conserve their original biotic and abiotic characteristics. Lichens are organisms especially susceptible to environmental variability, what could be useful for bio-indication of edge effect. In this work, we evaluated the edge effect in two fragments of Polylepis quadrijuga in the Páramo de la Rusia (Boyacá-Colombia) to determine if there is an edge effect on distribution of lichens associated to P. quadrijuga and their chlorophyll content. We used three transects of 70 m across the matrix-edge-interior gradient in each fragment. We chose nine phorophytes per transect to measure the environmental variables: photosynthetically active radiation, relative humidity and air temperature, and the biological variables: richness and cover per species. Besides, we employed the species that were present in all the three zones of the gradient to quantify the content of chlorophylls a and b, and determine if there are changes in the ratio of chlorophylls a/b that could suggest physiological plasticity as a response to the edge effect. Our results showed that fragment 2 had a higher edge exposition because of its high relation perimeter/area, allowing to an environmental homogenization and lose of biodiversity in relation with fragment 1. Overall, we found 55 differentially distributed species in relation with the fragments and the matrix-edge-interior gradient. The interior of fragment 1 was the most conserved zone, harboring a composition different in more than 40 % to the composition of any other zone. We classified the lichens according with their habits: gelatinous, fruticose, crusty or foliose, but we did not find any relationship between the habit distribution and the edge effect. Six species of wide distribution showed changes in the chlorophyll content along the matrix-edge-interior gradient, what is an evidence

MRI of displaced meniscal fragments

International Nuclear Information System (INIS)

Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

2012-01-01

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

MRI of displaced meniscal fragments

Energy Technology Data Exchange (ETDEWEB)

Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

2012-01-15

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

Dimensional crossover in fragmentation

Science.gov (United States)

Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

2000-11-01

Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

Global chain properties of an all l-α-eicosapeptide with a secondary α-helix and its all retro d-inverso-α-eicosapeptide estimated through the modeling of their CZE-determined electrophoretic mobilities.

Science.gov (United States)

Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B

2014-03-01

Several global chain properties of relatively long peptides composed of 20 amino acid residues are estimated through the modeling of their experimental effective electrophoretic mobilities determined by CZE for 2 chains, they do not present similar global conformations in the whole range of pH studied. These peptides may also differ in the quality of BGE components chain interactions depending on the pH value. Three Peptide 1 fragments (Peptides 3, 4, and 5) are also analyzed in this framework with the following purposes: (i) visualization of the effects of initial and final strands at each side of the α-helix on the global chain conformations of Peptide 1 at different pHs and (ii) analysis of global chain conformations of Peptides 1 and 2, and Peptide 1 fragments in relation to their pI values. Also, the peptide maximum and minimum hydrations predicted by the model, compatible with experimental effective electrophoretic mobilities at different pHs, are quantified and discussed, and needs for further research concerning chain hydration are proposed. It is shown that CZE is a useful analytical tool for peptidomimetic designs and purposes. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Residue-Specific Side-Chain Polymorphisms via Particle Belief Propagation.

Science.gov (United States)

Ghoraie, Laleh Soltan; Burkowski, Forbes; Li, Shuai Cheng; Zhu, Mu

2014-01-01

Protein side chains populate diverse conformational ensembles in crystals. Despite much evidence that there is widespread conformational polymorphism in protein side chains, most of the X-ray crystallography data are modeled by single conformations in the Protein Data Bank. The ability to extract or to predict these conformational polymorphisms is of crucial importance, as it facilitates deeper understanding of protein dynamics and functionality. In this paper, we describe a computational strategy capable of predicting side-chain polymorphisms. Our approach extends a particular class of algorithms for side-chain prediction by modeling the side-chain dihedral angles more appropriately as continuous rather than discrete variables. Employing a new inferential technique known as particle belief propagation, we predict residue-specific distributions that encode information about side-chain polymorphisms. Our predicted polymorphisms are in relatively close agreement with results from a state-of-the-art approach based on X-ray crystallography data, which characterizes the conformational polymorphisms of side chains using electron density information, and has successfully discovered previously unmodeled conformations.

Study of the shape of fragmentation events in central collisions

International Nuclear Information System (INIS)

Nguyen, A.D.; Durand, D.; Bocage, F.; Bougault, R.; Brou, R.; Colin, J; Cussol, D.; Genouin-Duhamel, E.; Gulminelli, F.; Lecolley, J.F.; Lefort, T.; Le Neindre, N.; Lopez, O.; Louvel, M.; Peter, J.; Steckmeyer, J.C.; Tamain, B.; Vient, E.

1997-01-01

The study of the most central collisions resulting in the fragmentation of nuclear systems requires a precise as highly possible knowledge of the space-time configuration of matter. Particularly, it is important to be able to define the event shapes in order to estimate the equilibrium degree reached by the system in the moment of its breakup. To do that, an tensor analysis was developed end applied to data from INDRA for the system Xe + Sn at 50 MeV/u. The obtained results were compared with the predictions of the SIMON generator. The analysis indicates a quasi-sphericity of the fragmentation source. This result is a convincing evidence in favor of formation of a highly excited system in equilibrium the life-time of which is long enough to relax the shape degrees of freedom as well as the internal freedom degrees. A comparison between the experimental results corresponding to the Xe + Sn central collisions at 50 MeV/u and the predictions of a SIMON calculation for different shapes of the fragmenting source is presented as a function of the variables D and C, which are linear combinations of the eigenvalues of the tensor of the moments used for characterisation of the event shape

Habitat fragmentation impacts mobility in a common and widespread woodland butterfly: do sexes respond differently?

Directory of Open Access Journals (Sweden)

Bergerot Benjamin

2012-04-01

Full Text Available Abstract Background Theory predicts a nonlinear response of dispersal evolution to habitat fragmentation. First, dispersal will be favoured in line with both decreasing area of habitat patches and increasing inter-patch distances. Next, once these inter-patch distances exceed a critical threshold, dispersal will be counter-selected, unless essential resources no longer co-occur in compact patches but are differently scattered; colonization of empty habitat patches or rescue of declining populations are then increasingly overruled by dispersal costs like mortality risks and loss of time and energy. However, to date, most empirical studies mainly document an increase of dispersal associated with habitat fragmentation. We analyzed dispersal kernels for males and females of the common, widespread woodland butterfly Pararge aegeria in highly fragmented landscape, and for males in landscapes that differed in their degree of habitat fragmentation. Results The male and female probabilities of moving were considerably lower in the highly fragmented landscapes compared to the male probability of moving in fragmented agricultural and deciduous oak woodland landscapes. We also investigated whether, and to what extent, daily dispersal distance in the highly fragmented landscape was influenced by a set of landscape variables for both males and females, including distance to the nearest woodland, area of the nearest woodland, patch area and abundance of individuals in the patch. We found that daily movement distance decreased with increasing distance to the nearest woodland in both males and females. Daily distances flown by males were related to the area of the woodland capture site, whereas no such effect was observed for females. Conclusion Overall, mobility was strongly reduced in the highly fragmented landscape, and varied considerably among landscapes with different spatial resource distributions. We interpret the results relative to different cost

Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction