Membrane assisted liquid-liquid extraction of cerium

International Nuclear Information System (INIS)

Soldenhoff, K.M.

2000-02-01

Membrane assisted liquid-liquid extraction of cerium was investigated, with emphasis placed on the study of the reaction chemistry and the kinetics of non-dispersive solvent extraction and stripping with microporous membranes. A bulk liquid membrane process was developed for the purification of cerium(IV) from sulfate solutions containing other rare earth elements. The cerium process was studied in both a flat sheet contained liquid membrane configuration and with hollow fibre contactors. Di-2-ethylhexyl phosphoric acid (DEHPA) was identified as a suitable extractant for cerium(IV) from sulfuric acid solution, with due consideration of factors such as extraction ability, resistance to degradation, solvent selectivity and potential for sulfate transfer into a strip solution. A detailed study of the extraction of cerium(IV) with DEHPA defined the extraction reaction chemistry. The Ce/DEHPA/sulfate system was also investigated with a flat sheet bulk liquid membrane configuration, using both sulfuric and hydrochloric acid as receiver solutions. These tests identified that hydrophobic membranes provide better mass transfer for extraction and hydrophilic membranes are better for stripping. The presence of an impurity, mono 2-ethylhexyl phosphoric acid (MEHPA), was found to have a dramatic accelerating effect on the rate of the chemical extraction reaction. This was attributed to its higher interfacial activity and population compared to DEHPA, and the fact that MEHPA was also found to be an active carrier for cerium(IV). The mass transfer rate of membrane assisted extraction and stripping of cerium, using hydrophobic and hydrophilic microporous membranes, respectively, was investigated using a modified Lewis-type cell. It was quantitatively demonstrated that the extraction process was mainly controlled by membrane diffusion and the stripping process was controlled by the chemical reaction rate, with membrane diffusion becoming important at low distribution coefficients

Obtainment of cerium dioxide for use as spectrochemical standard

International Nuclear Information System (INIS)

Silva Queiroz, C.A. da; Hespanhol, E.C.B.; Abrao, A.

1992-01-01

This paper describes a simple method for cerium separation and purification. Cerium is previously precipitated with N H 3 /air/H 2 O 2 system in a mixed chlorides solution obtained from Brazilian monazite treatment. The cerium fraction as cerium chloride is run down throughout a strong cationic resin bed and then the rare earth impurities separation is done by elution of the resin with separation ammonium salt of EDTA. None retainer ion is used in the purification technique by ion exchange. (author)

Selected cerium phase diagrams

International Nuclear Information System (INIS)

Gschneidner, K.A. Jr.; Verkade, M.E.

1974-09-01

A compilation of cerium alloy phase equilibria data based on the most reliable information available is presented. The binary systems selected are those of cerium with each of the following twenty nine elements which might be commonly found in steels: Al, Sb, As, Bi, Ca, C, Cr, Co, Nb, Cu, Fe, Pb, Mg, Mn, Mo, Ni, N, O, P, Se, Si, Ag, S, Te, Sn, Ti, W, and Zn. A brief discussion, a summary of crystal lattice parameters where applicable, and a list of references is included for each element surveyed. (U.S.)

Novel in situ coordinated cerium salt/acrylonitrile-butadiene rubber composite

International Nuclear Information System (INIS)

Han, Jianjun; Lu, Haifeng; Zhang, Jie; Feng, Shengyu

2012-01-01

A novel rubber composite of acrylonitrile-butadiene rubber (NBR) filled with cerium salt particles was vulcanized via in situ coordination for the first time. The resulting materials exhibit good mechanical properties. Curing characteristics analysis, differential scanning calorimetry, X-ray photoelectron spectroscopy, tensile testing, and an equilibrium swelling method were used for the characterization of the composite. The results in this paper indicate that the composite is a kind of elastomer based on the in situ coordination crosslinking interactions between the nitrile groups (–CN) of NBR and cerium ions. The mechanical properties of vulcanized cerium salt/ NBR rubber are altered when changing the sorts of cerium salt. Moreover, these materials show good irradiation resistance because of the introduction of the cerium salt. -- Highlights: ► Cerium salts were firstly used to vulcanize the acrylonitrile-butadiene rubber. ► Cerium salts act as not only crosslink agents but also reinforcing fillers in the matrix. ► These materials show good irradiation resistance and mechanical properties at same time.

Two-phase titration of cerium(3) by permanganate

International Nuclear Information System (INIS)

Lazarev, A.I.; Lazareva, V.I.; Gerko, V.V.

1986-01-01

Reaction of cerium (3) and permanganate was investigated at a room temperature depending on PH, concentrations of pyrophosphate, cerium (3), tetraphenylphosphonium and foreign compounds. Selective method of two-phase titration determination of cerium (3) by permanganate without using silver compounds, preliminary separation of chlorides, nitrates, was developed. The method was tested using alloys based on iron, nickel, REE, copper, cobalt (S r ≤0.008). Correctness is proved with method of standard additives

Novel in situ coordinated cerium salt/acrylonitrile-butadiene rubber composite

Energy Technology Data Exchange (ETDEWEB)

Han, Jianjun [Key Laboratory of Special Functional Aggregated Materials, Ministry of Education, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Lu, Haifeng, E-mail: lhf@sdu.edu.cn [Key Laboratory of Special Functional Aggregated Materials, Ministry of Education, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Zhang, Jie [Key Laboratory of Special Functional Aggregated Materials, Ministry of Education, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Feng, Shengyu, E-mail: fsy@sdu.edu.cn [Key Laboratory of Special Functional Aggregated Materials, Ministry of Education, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2012-09-14

A novel rubber composite of acrylonitrile-butadiene rubber (NBR) filled with cerium salt particles was vulcanized via in situ coordination for the first time. The resulting materials exhibit good mechanical properties. Curing characteristics analysis, differential scanning calorimetry, X-ray photoelectron spectroscopy, tensile testing, and an equilibrium swelling method were used for the characterization of the composite. The results in this paper indicate that the composite is a kind of elastomer based on the in situ coordination crosslinking interactions between the nitrile groups (-CN) of NBR and cerium ions. The mechanical properties of vulcanized cerium salt/ NBR rubber are altered when changing the sorts of cerium salt. Moreover, these materials show good irradiation resistance because of the introduction of the cerium salt. -- Highlights: Black-Right-Pointing-Pointer Cerium salts were firstly used to vulcanize the acrylonitrile-butadiene rubber. Black-Right-Pointing-Pointer Cerium salts act as not only crosslink agents but also reinforcing fillers in the matrix. Black-Right-Pointing-Pointer These materials show good irradiation resistance and mechanical properties at same time.

Preparation of cerium oxide for lens polishing powder

International Nuclear Information System (INIS)

Injarean, Uthaiwan; Rodthongkom, Chouvana; Pichestapong, Pipat; Changkrurng, Kalaya

2003-10-01

Cerium is an element of rare earth group which is called lanthanide series. It is found in the ores like monazite and xenotime which are the tailings of tin mines in the south of Thailand. Cerium is used mostly as lens polishing powder besides the applications in other industries. In this study, cerium extracted from monazite ore breakdown by alkaline process was used for the preparation of lens polishing powder. Cerium hydroxide cake from the process was dissolved by hydrochloric acid and precipitated with oxalic acid. The oxalate precipitate then was calcined to oxide powder and its particle size was measured. Precipitation conditions being studied are concentration of feed cerium chloride solution, concentration of oxalic acid used for the precipitation, concentration of sulfuric acid used as precipitation control reagent and the precipitation temperature. It was found that the appropriate precipitation conditions yielded the fine oxide powder with particle size about 12μm. The oxide powder can be ground to the size of 1-3 μm which is suitable for making lens polishing powder

Bordoni relaxation and magnetic transformation in cerium and cerium-lanthanum alloys

Energy Technology Data Exchange (ETDEWEB)

Postnikov, V S; Polner, G L; Sharshakov, I M

1975-11-01

The internal friction in pure cerium and cerium-base alloys with 2.5 and 12 weight percent of lanthanum added at temperature ranging from 4.2 deg up to 77/sup 0/K is described. Amplitude-independent internal friction has been measured with an inverse torsion pendulum with a specimen oscillation frequency of 1-30 hz in vacuum not less than 1.10/sup -5/ torr. A temperature of the specimen has been determined with a capacitance-type sensor and a gas gage. A curve showing the dependence of internal friction upon a temperature of pure cerium has two distinct peaks; the first at 12.5/sup 0/K, the second at 45/sup 0/K. The 12.5/sup 0/K peak is accounted for by a transition of antiferromagnetic ..beta..-Ce into a paramagnetic state. The 45/sup 0/K peak is a Bordoni maximum. The paper describes an influence of additions, specimen oscillation frequency variations, deformation and annealing upon the peak behavor. Added lanthanum reduces not only a peak temperature but a height as well. Studies of the 45/sup 0/K peak have shown that its temperature location depends upon the specimen oscillation frequency. As the frequency increases the peak tends to a range of high temperatures which confirms its relaxation nature.

Dissolution properties of cerium dibutylphosphate corrosion inhibitors

NARCIS (Netherlands)

Soestbergen, van M.; Erich, S.J.F.; Huinink, H.P.; Adan, O.C.G.

2013-01-01

The corrosion inhibitor cerium dibutylphosphate, Ce(dbp)3, prevents corrosion by cerium and dbp deposition at the alkaline cathode and acidic anode respectively. The pH dependent Ce(dbp)3 solubility seems to play an essential role in the inhibition degree. We found that Ce(dbp)3 scarcely dissolves

Fundamental aspects of regenerative cerium oxide nanoparticles and their applications in nanobiotechnology

Science.gov (United States)

Patil, Swanand D.

Cerium oxide has been used extensively for various applications over the past two decades. The use of cerium oxide nanoparticles is beneficial in present applications and can open avenues for future applications. The present study utilizes the microemulsion technique to synthesize uniformly distributed cerium oxide nanoparticles. The same technique was also used to synthesize cerium oxide nanoparticles doped with trivalent elements (La and Nd). The fundamental study of cerium oxide nanoparticles identified variations in properties as a function of particle size and also due to doping with trivalent elements (La and Nd). It was found that the lattice parameter of cerium oxide nanoparticles increases with decrease in particle size. Also Raman allowed mode shift to lower energies and the peak at 464 cm-1 becomes broader and asymmetric. The size dependent changes in cerium oxide were correlated to increase in oxygen vacancy concentration in the cerium oxide lattice. The doping of cerium oxide nanoparticles with trivalent elements introduces more oxygen vacancies and expands the cerium oxide lattice further (in addition to the lattice expansion due to the size effect). The lattice expansion is greater for La-doped cerium oxide nanoparticles compared to Nd-doping due to the larger ionic radius of La compared to Nd, the lattice expansion is directly proportional to the dopant concentration. The synthesized cerium oxide nanoparticles were used to develop an electrochemical biosensor of hydrogen peroxide (H2O2). The sensor was useful to detect H2O2 concentrations as low as 1muM in water. Also the preliminary testing of the sensor on tomato stem and leaf extracts indicated that the sensor can be used in practical applications such as plant physiological studies etc. The nanomolar concentrations of cerium oxide nanoparticles were also found to be useful in decreasing ROS (reactive oxygen species) mediated cellular damages in various in vitro cell cultures. Cerium oxide

Cerium-modified Aurivillius-type sodium lanthanum bismuth titanate with enhanced piezoactivities

International Nuclear Information System (INIS)

Wang Chunming; Zhao Liang; Wang Jinfeng; Zheng Limei; Du Juan; Zhao Minglei; Wang Chunlei

2009-01-01

The electrical, piezoelectric and dielectric properties of cerium-modified Aurivillius-type sodium lanthanum bismuth titanate (Na 0.5 La 0.5 Bi 4 Ti 4 O 15 , NLBT) ceramics were investigated. It was found the piezoelectric activities of NLBT ceramics were significantly improved by cerium modification. The piezoelectric coefficient d 33 and Curie temperature T c for the 0.50 wt.% cerium-modified NLBT were found to be 29 pC/N and 573 deg. C, respectively. The reasons for piezoelectric activities improvement by cerium modification were given. A small dielectric abnormity was observed in NLBT ceramics, which can be suppressed by cerium modification.

Specific Features of the Response of Cerium to Pulsed Actions

Science.gov (United States)

Atroshenko, S. A.; Zubareva, A. N.; Morozov, V. A.; Savenkov, G. G.; Utkin, A. V.

2018-02-01

Experimental studies of cerium at high rates and nanosecond durations of action have been performed. The isomorphic phase transition was studied upon shock compression. The spall strength of cerium has been determined. Cerium demonstrates anomalous compressibility upon dynamic loading. Stress waves dampen under action of a high-current electron beam due to the energy dissipation during fragmentation and twinning.

A contribution to the radiologic findings in cerium pneumoconiosis

International Nuclear Information System (INIS)

Hecht, F.M.; Wesch, H.; Deutsches Krebsforschungszentrum, Heidelberg

1980-01-01

Report on a 69 year old man, who had been employed as photographer in the printing industry and who had been exposed to Cerium for 40 years. The chest X-ray which was performed 9 years after the end of the exposure displayes striate densities of the lungs, which must be considered as a late stage of Cerium-pneumoconiosis. The changes which were found fulfill the code 't 1/0 RO, RM, RU, LO, LM, LU, p 0/1 RO, RM, LO, LM, em, tbu' according to the 'ILO U/C 1971 classification of pneumoconiosis'. The diagnosis could be substantiated by measureing Cerium in the lung parenchyma qualitatively and quantitatively using neutrone activating analysis. The radiolgic findings of the Cerium pneumoconiosis are discussed. (orig.) [de

Electronic state of cerium-based catalysts studied by spectroscopic methods (XPS, XAS)

International Nuclear Information System (INIS)

Le Normand, F.; Bernhardt, P.; Hilaire, L.; Kili, K.; Maire, G.; Krill, G.

1987-01-01

X-ray Photoelectron Spectroscopy (XPS) of the 3d core level of cerium and X-ray Absorption Spectroscopy (XAS) of the L III absorption edge of cerium have been used to study Pd/CeO 2 , Pd-Ce/γAl 2 O 3 and Ce/γAl 2 O 3 catalysts. The oxidation state of cerium was found to decrease with decreasing amounts of cerium on the surface. It was quite close to III for very low contents of cerium (2-3%). For higher cerium contents the oxidation state was nearer to IV but differences between the two methods were found, owing to the fact that XAS is a volume sensitive probe. The oxidation state of cerium was also lower for Pd-Ce/γAl 2 O 3 than for Ce/γAl 2 O 3 , suggesting the formation of Ce III OCl, chlorine coming from the precursor salt of palladium. 15 refs.; 5 figs.; 1 table

Adsorption of Some Hazardous Radionuclides on Cerium(IV) Antimonate

International Nuclear Information System (INIS)

Aly, H.F.; Zakaria, E.S.; Shady, S.A.; El-Naggar, I.M.

1999-01-01

Cerium(IV) antimonate had been prepared by the dropwise addition of 0.6 M antimony pentachloride and 0.6 M cerium ammonium nitrate solutions by a molar radio of Ce/Sb 0.75. Exchange isotherms for H +/ Co 2+ , H +/ Cs +, H +/ Zn 2+ , H +/ Sr 2+ and H +/ Eu 3+ have been determined at 25, 40 and 60 degree. Besides it was proved that europium is physically adsorbed while zinc, strontium, cobalt and cesium are chemically adsorbed. Moreover, the heat of adsorption of zinc, strontium, cobalt and cesium on cerium(IV) antimonate had been calculated and indicated that cerium(IV) antimonate is of endothermic behaviour towards these ions. Also the distribution coefficients of these ions were determined and it was found that the selectivity in the order: Eu 3+ >Sr 2+ > Cs +> Na +

Metabolism of cerium 144 in rat. Distribution - elimination - dosimetry

International Nuclear Information System (INIS)

Remy, Jacques

1959-01-01

This academic report concerns a study during which cerium 144 has been intravenously injected to three-month old rats under the form of cerium chloride in aqueous solution with pH of 9,5. Rats have then been sacrificed at different times after the injection, and organ or tissue samplings have been performed to study the isotope distribution in their bodies. This allowed the calculation of internal irradiation doses locally received by the animal, and also to identify critical organs with respect to cerium 144. Thus, until the twentieth day after injection, liver is the critical organ. After, it is the skeleton, for the rest of the animal's life. The bone internal irradiation is the highest danger for an internal cerium 144 contamination, due to threats on body hematopoietic functions [fr

Investigation of AA2024-T3 surfaces modified by cerium compounds: A localized approach

International Nuclear Information System (INIS)

Paussa, L.; Andreatta, F.; De Felicis, D.; Bemporad, E.; Fedrizzi, L.

2014-01-01

Highlights: •The precipitation of cerium compounds occurs on the entire AA2024-T3 surface. •The matrix is less involved in the cerium precipitation. •Cerium intensely precipitates on Mg-rich IM particles. •The electrochemical behavior of Mg-rich IM particles influences the mechanism of cerium precipitation. -- Abstract: The precipitation of cerium compounds on polished AA2024-T3 surfaces was investigated following an electrochemical and microstructural localized approach. It was found that cerium precipitation occurs on the entire surface covering intermetallic particles and the matrix as well. The matrix is the region where the precipitation of cerium is less favoured. The highest amount of cerium was observed on magnesium-rich intermetallic particles. The localized analyses suggest that precipitation of cerium on magnesium-rich intermetallic particles could happen following two mechanisms: the former based on a potential reversal of the intermetallic particles and the latter due to a partial magnesium dissolution

Electrochemical redox processes involving soluble cerium species

International Nuclear Information System (INIS)

Arenas, L.F.; Ponce de León, C.; Walsh, F.C.

2016-01-01

Highlights: • The relevance of cerium in laboratory and industrial electrochemistry is considered. • The history of fundamental electrochemical studies and applications is considered. • The chemistry, redox thermodynamics and electrode kinetics of cerium are summarised. • The uses of cerium ions in synthesis, energy storage, analysis and environmental treatment are illustrated. • Research needs and development perspectives are discussed. - Abstract: Anodic oxidation of cerous ions and cathodic reduction of ceric ions, in aqueous acidic solutions, play an important role in electrochemical processes at laboratory and industrial scale. Ceric ions, which have been used for oxidation of organic wastes and off-gases in environmental treatment, are a well-established oxidant for indirect organic synthesis and specialised cleaning processes, including oxide film removal from tanks and process pipework in nuclear decontamination. They also provide a classical reagent for chemical analysis in the laboratory. The reversible oxidation of cerous ions is an important reaction in the positive compartment of various redox flow batteries during charge and discharge cycling. A knowledge of the thermodynamics and kinetics of the redox reaction is critical to an understanding of the role of cerium redox species in these applications. Suitable choices of electrode material (metal or ceramic; coated or uncoated), geometry/structure (2-or 3-dimensional) and electrolyte flow conditions (hence an acceptable mass transport rate) are critical to achieving effective electrocatalysis, a high performance and a long lifetime. This review considers the electrochemistry of soluble cerium species and their diverse uses in electrochemical technology, especially for redox flow batteries and mediated electrochemical oxidation.

Lattice dynamics of α-cerium

International Nuclear Information System (INIS)

Smith, G.S.

1985-01-01

The lattice dynamics of the fcc α-phase of cerium metal was investigated using inelastic neutron scattering techniques. This phase of cerium is an example of a mixed-valent system. Various physical properties of α-Ce suggest that there may be coupling between the phonons and the f d transitions associated with the mixed valence phenomenon. These measurements of the dispersion curves provide important information about the electron-phonon interaction in this phase of cerium. These studies were not performed in the past because single crystals of α-Ce were not available. We were able to prepare a single α-Ce crystal using a high temperature, high pressure technique. The sample was of sufficient size for inelastic neutron scattering experiments, but the measurements were complicated because of the large mosaic spread (approx.7.0 0 ) of the crystal. It was possible, however, to obtain a set of dispersion curves along the [00zeta], [zeta,zeta,0], and [zeta,zeta,zeta] symmetry directions. Comparison of the dispersion curves with those of fcc γ-Ce indicate that the branches exhibit anomalous features that may be related to the mixed-valence effects

Systems of cerium(3) nitrate-dimethyl amine nitrate-water and cerium(3) nitrate-dimethyl amine nitrate-water

International Nuclear Information System (INIS)

Mininkov, N.E.; Zhuravlev, E.F.

1976-01-01

Solubility of solid phases in the systems cerium(3)nitrate-water-dimethyl amine nitrate and cerium(3)nitrate-water-dimethyl amine nitrate has been st ed by the method of isothermal sections at 25 and 50 deo. C. It has been shown that one anhydrous compound is formed in each system with a ratio of cerium(3) nitrate to amine nitrate 1:5. The compounds formed in the systems have been separated from the corresponding solutions and studied by microcrystalloscopic, X-ray phase, thermal and infrared spectroscopic methods. On the basis of spectroscopic studies the following formula has been assigned to the compound: [(CH 3 ) 2 NH 2 + ] 5 x[Ce(NO 3 ) 8 ]. The thermal analysis of the compound has shown that its melting point is 106 deg C. The solubility isotherms in the system Ce(NO 3 ) 3 -H 2 O-(C 2 H 5 ) 2 NHxHNO 3 consist of three branches which intersect in two eutonic points

Method of cerium separation from other lanthanides and yttrium

International Nuclear Information System (INIS)

Tran, Duc Hiep; Mostecky, J.

1988-01-01

Cerium is separated from a suspension produced during the aerial oxidation process. The suspension is subject to a cyclic process of two-stage fractional dissolution. Following the first dissolution, almost all cerium remains undissolved while 95% of the other lanthanides pass into the solution. The filtrate of the second stage of dissolution containing about 5% of ceriumm is returned for oxidation with the next batch of hydroxide mixed concentrate. Following oxidation, the two-stage fractional dissolution is repeated. This cycling provides quantitative cerium separation from other rare earth elements. (E.S.)

Characterization of platinized and unplatinized cerium dioxide and other cerium containing catalyst supports

International Nuclear Information System (INIS)

Daniel, D.W.

1984-01-01

The adsorption of CO on platinized cerium dioxide has been investigated by FTIR (Fourier Transform Infrared Spectroscopy). Four active surface sites and two adsorption geometries were found for the oxidized catalyst. Although the metallic sites and both geometries, linear and bridged, were retained upon reduction the two cationic sites were not. During stepwise desorption, CO dissociates leaving behind adsorbed carbon inhibiting readsorption. At elevated temperatures CeO 2 oxidizes Pt. The large decrease in CO adsorption resulting from high temperature reduction was reversed by reoxidation. XPS (X-ray Photoelectron Spectroscopy) data provided no evidence of encapsulation and XRD (X-ray Diffraction) showed the retention of a constant particle size. The results were interpreted as electronic metal-support interaction. The addition of H 2 or D 2 to adsorbed CO at 25 0 C caused spillover of the CO onto the support and a decrease in CO band frequency. When O 2 was added to preadsorbed CO a new band associated with oxygen and CO coadsorbed on a single Pt atom appeared. Carbon dioxide dissociation at room temperature is proposed to occur via a Langmuir-Hinshelwood mechanism. CO adsorption on platinized titania, silica, ceria/titania, ceria/silica, and cerium titanate has also been studied by the same techniques. The adsorption/desorption behavior of the cerium/titania and the single oxide systems paralleled that of Pt/CeO 2

Stepwise hydrochloric acid extraction of monazite hydroxides for the recovery of cerium lean rare earths, cerium, uranium and thorium

International Nuclear Information System (INIS)

Swaminathan, T.V.; Nair, V.R.; John, C.V.

1988-01-01

Monazite sand is normally processed by the caustic soda route to produce mixed rare earth chloride, thorium hydroxide and trisodium phosphate. Bulk of the mixed rare earth chloride is used for the preparation of FC catalysts. Recently some of the catalyst producers have shown preference to cerium depleted (lanthanum enriched) rare earth chloride rather than the natural rare earth chloride obtained from monazite. Therefore, a process for producing cerium depleted rare earth chloride, cerium, thorium and uranium from rare earth + thorium hydroxide obtained by treating monazite, based on stepwise hydrochloric acid extraction, was developed in the authors laboratory. The process involves drying of the mixed rare earth-thorium hydroxide cake obtained by monazite-caustic soda process followed by stepwise extraction of the dried cake with hydrochloric acid under specified conditions

Studies on the promotion of nickel—alumina coprecipitated catalysts: III. Cerium oxide

NARCIS (Netherlands)

Lansink Rotgerink, H.G.J.; Slaa, J.C.; van Ommen, J.G.; Ross, J.R.H.

1988-01-01

Three series of cerium-promoted nickel—alumina catalysts with different nickel-to-aluminium ratios each containing different amounts of cerium have been prepared and characterized. The calcination and reduction behaviour were found not to be altered by the presence of cerium. Part of the promoter

Cerium-doped scintillating fused-silica fibers

Science.gov (United States)

Akchurin, N.; Cowden, C.; Damgov, J.; Dragoiu, C.; Dudero, P.; Faulkner, J.; Kunori, S.

2018-04-01

We report on a set of measurements made on (scintillating) cerium-doped fused-silica fibers using high-energy particle beams. These fibers were uniformly embedded in a copper absorber in order to utilize electromagnetic showers as a source of charged particles for generating signals. This new type of cerium-doped fiber potentially offers myriad new applications in calorimeters in high-energy physics, tracking systems, and beam monitoring detectors for future applications. The light yield, pulse shape, attenuation length, and light propagation speeds are given and discussed. Possible future applications are also explored.

Preparation of high-purity cerium nitrate; Preparacao de nitrato de cerio de alta pureza

Energy Technology Data Exchange (ETDEWEB)

Avila, Daniela Moraes; Silva Queiroz, Carlos Alberto da; Santos Mucillo, Eliana Navarro dos [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

1995-12-31

The preparation of high-purity cerium nitrate has been carried out Cerium oxide has been prepared by fractioned precipitation and ionic exchange techniques, using a concentrate with approximately 85% of cerium oxide from NUCLEMON as raw material. Five sequential ion-exchange columns with a retention capacity of 170 g each have been used. The ethylenediamine-tetraacetic acid (EDTA) was used as eluent. The cerium content has been determined by gravimetry and iodometry techniques. The resulting cerium oxide has a purity > 99%. This material was transformed in cerium nitrate to be used as precursor for the preparation of Zirconia-ceria ceramics by the coprecipitation technique. (author) 2 tabs.

Synthesis and crystal kinetics of cerium oxide nanocrystallites prepared by co-precipitation process

International Nuclear Information System (INIS)

Shih, C.J.; Chen, Y.J.; Hon, M.H.

2010-01-01

Cerium oxide nanocrystallites were synthesized at a relatively low temperature using cerium nitrate as starting materials in a water solution by a co-precipitation process. Effect of calcination temperature on the crystallite growth of cerium oxide nano-powders was investigated by X-ray diffraction, transmission electron microscopy and electron diffraction. The crystallization temperature of the cerium oxide powders was estimated to be about 273 K by XRD analysis. When calcined from 473 to 1273 K, the crystallization of the face-centered cubic phase was observed by XRD. The crystallite size of the cerium oxide increased from 10.0 to 43.8 nm with calcining temperature increasing from 673 to 1273 K. The activation energy for growth of cerium oxide nanoparticles was found to be 16.0 kJ mol -1 .

Synthesis and crystal kinetics of cerium oxide nanocrystallites prepared by co-precipitation process

Energy Technology Data Exchange (ETDEWEB)

Shih, C.J., E-mail: cjshih@kmu.edu.tw [Department of Fragrance and Cosmetics Science, Kaohsiung Medical University, 100 Shi-Chuan 1st Road, Kaohsiung 807, Taiwan (China); Chen, Y.J. [Institute of Biomedical Sciences, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hon, M.H. [Department of Materials Science and Engineering, National Cheng Kung University, Tainan 701, Taiwan (China)

2010-05-15

Cerium oxide nanocrystallites were synthesized at a relatively low temperature using cerium nitrate as starting materials in a water solution by a co-precipitation process. Effect of calcination temperature on the crystallite growth of cerium oxide nano-powders was investigated by X-ray diffraction, transmission electron microscopy and electron diffraction. The crystallization temperature of the cerium oxide powders was estimated to be about 273 K by XRD analysis. When calcined from 473 to 1273 K, the crystallization of the face-centered cubic phase was observed by XRD. The crystallite size of the cerium oxide increased from 10.0 to 43.8 nm with calcining temperature increasing from 673 to 1273 K. The activation energy for growth of cerium oxide nanoparticles was found to be 16.0 kJ mol{sup -1}.

Synthesis and characterization of magnesium doped cerium oxide for the fuel cell application

International Nuclear Information System (INIS)

Kumar, Amit; Kumari, Monika; Kumar, Mintu; Kumar, Sacheen; Kumar, Dinesh

2016-01-01

Cerium oxide has attained much attentions in global nanotechnology market due to valuable application for catalytic, fuel additive, and widely as electrolyte in solid oxide fuel cell. Doped cerium oxide has large oxygen vacancies that allow for greater reactivity and faster ion transport. These properties make cerium oxide suitable material for SOFCs application. Cerium oxide electrolyte requires lower operation temperature which shows improvement in processing and the fabrication technique. In our work, we synthesized magnesium doped cerium oxide by the co-precipitation method. With the magnesium doping catalytic reactivity of CeO_2 was increased. Synthesized nanoparticle were characterized by the XRD and UV absorption techniques.

Thin film ionic conductors based on cerium oxide

International Nuclear Information System (INIS)

Haridoss, P.; Hellstrom, E.; Garzon, F.H.; Brown, D.R.; Hawley, M.

1994-01-01

Fluorite and perovskite structure cerium oxide based ceramics are a class of materials that may exhibit good oxygen ion and/or protonic conductivity. The authors have successfully deposited thin films of these materials on a variety of substrates. Interesting orientation relationships were noticed between cerium oxide films and strontium titanate bi-crystal substrates. Near lattice site coincidence theory has been used to study these relationships

Antimicrobial cerium ion-chitosan crosslinked alginate biopolymer films: A novel and potential wound dressing.

Science.gov (United States)

Kaygusuz, Hakan; Torlak, Emrah; Akın-Evingür, Gülşen; Özen, İlhan; von Klitzing, Regine; Erim, F Bedia

2017-12-01

Wound dressings require good antiseptic properties, mechanical strength and, more trustably, natural material ingredients. Antimicrobial properties of cerium ions and chitosan are known and alginate based wound dressings are commercially available. In this study, the advantages of these materials were combined and alginate films were crosslinked with cerium(III) solution and chitosan added cerium(III) solution. Films were characterized by Fourier transform infrared spectroscopy (FTIR), light transmittance, scanning electron microscopy (SEM), swelling experiments, water vapor transmittance tests, and mechanical stretching tests. The antibacterial and physical properties of the films were compared with those of conventional calcium alginate films. Both cerium ion crosslinked and cerium ion-chitosan crosslinked alginate films gained antibacterial activity against Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus) bacteria. Cerium alginate-chitosan films showed high resistance to being deformed elastically. Results show that cerium alginate-chitosan films can be flexible, ultraviolet-protecting, and antibacterial wound dressings. Copyright © 2017 Elsevier B.V. All rights reserved.

Casting Characteristics of High Cerium Content Aluminum Alloys

Energy Technology Data Exchange (ETDEWEB)

Weiss, D; Rios, O R; Sims, Z C; McCall, S K; Ott, R T

2017-09-05

This paper compares the castability of the near eutectic aluminum-cerium alloy system to the aluminum-silicon and aluminum-copper systems. The alloys are compared based on die filling capability, feeding characteristics and tendency to hot tear in both sand cast and permanent mold applications. The castability ranking of the binary Al–Ce systems is as good as the aluminum-silicon system with some deterioration as additional alloying elements are added. In alloy systems that use cerium in combination with common aluminum alloying elements such as silicon, magnesium and/or copper, the casting characteristics are generally better than the aluminum-copper system. In general, production systems for melting, de-gassing and other processing of aluminum-silicon or aluminum-copper alloys can be used without modification for conventional casting of aluminum-cerium alloys.

Effect of adduct formation on valent state of cerium in its ν-diketonates

International Nuclear Information System (INIS)

Spitsyn, V.I.; Martynenko, L.I.; Pechurova, N.I.; Snezhko, N.I.; Murav'eva, I.A.; Anufrieva, S.I.

1982-01-01

Physicochemical investigation of the system cerium (III, IV)-ν-diketone-additional ligand shows that ν-diketonate ability to adduct formation decreases in the series tenoyltrifluoro-acetonate > acetylacetonate > dibenzoylmethanate > benzoylmethanate. Adduct formation of the cerium (III, IV) ν-diketonates stabilizes cerium in trivalent condition, while oxidation degree 4+ is stable in tetrakis-ν-diketonates. The additional ligands are arranged in the series: tributhylphosphate < trioctyl-phosphineoxide < triphenylphosphineoxide < α, α'-dipyridyl < o-phenanthroline by the effect on cerium (III) stabilization in its ν-diketonates

Effect of adduct formation on valent state of cerium in its. beta. -diketonates

Energy Technology Data Exchange (ETDEWEB)

Spitsyn, V.I.; Martynenko, L.I.; Pechurova, N.I.; Snezhko, N.I.; Murav' eva, I.A.; Anufrieva, S.I. (Moskovskij Gosudarstvennyj Univ. (USSR))

1982-04-01

Physicochemical investigation of the system cerium (III, IV)-..beta..-diketone-additional ligand shows that ..beta..-diketonate ability to adduct formation decreases in the series tenoyltrifluoro-acetonate > acetylacetonate > dibenzoylmethanate > benzoylmethanate. Adduct formation of the cerium (III, IV) ..beta..-diketonates stabilizes cerium in trivalent condition, while oxidation degree 4+ is stable in tetrakis-..beta..-diketonates. The additional ligands are arranged in the series: tributhylphosphate < trioctyl-phosphineoxide < triphenylphosphineoxide < ..cap alpha.., ..cap alpha..'-dipyridyl < o-phenanthroline by the effect on cerium (III) stabilization in its ..beta..-diketonates.

Tuning Reactivity and Electronic Properties through Ligand Reorganization within a Cerium Heterobimetallic Framework

Energy Technology Data Exchange (ETDEWEB)

Robinson, Jerome R.; Gordon, Zachary; Booth, Corwin H.; Carroll, Patrick J.; Walsh, Patrick J.; Schelter, Eric J.

2014-06-24

Cerium compounds have played vital roles in organic, inorganic, and materials chemistry due to their reversible redox chemistry between trivalent and tetravalent oxidation states. However, attempts to rationally access molecular cerium complexes in both oxidation states have been frustrated by unpredictable reactivity in cerium(III) oxidation chemistry. Such oxidation reactions are limited by steric saturation at the metal ion, which can result in high energy activation barriers for electron transfer. An alternative approach has been realized using a rare earth/alkali metal/1,1'-BINOLate (REMB) heterobimetallic framework, which uses redox-inactive metals within the secondary coordination sphere to control ligand reorganization. The rational syntheses of functionalized cerium(IV) products and a mechanistic examination of the role of ligand reorganization in cerium(III) oxidation are presented.

Comparison of Titration ICP and XRF Spectrometry Methods in Determination of Cerium in Lens Polishing Powder

International Nuclear Information System (INIS)

Ninlaphruk, Sumalee; Pichestapong, Pipat; Mungpayabal, Harinate; Jiyavaranant, Thitima; Srisukho, Supapan; Chaisai, Prapassurn

2004-10-01

Three analytical methods in determination of cerium in cerium oxide separated from monazite ore for producing lens polishing powder were compared. These methods are titration ICP and XRF spectrometry techniques. The cerium oxide sample with estimated 45% cerium content needed to be digested and converted into solution before the analysis. The analytical results shown significantly no difference between each method. However, the titration method was found to be more convenient and suitable for quality control in the production of cerium oxide as it does not require standard cerium and the complicated analytical instruments

Direct growth of cerium oxide nanorods on diverse substrates for superhydrophobicity and corrosion resistance

International Nuclear Information System (INIS)

Cho, Young Jun; Jang, Hanmin; Lee, Kwan-Soo; Kim, Dong Rip

2015-01-01

Graphical abstract: - Highlights: • Cerium oxide nanorods were uniformly grown on diverse substrates. • Changes in growth conditions led to morphology evolution of cerium oxide nanostructures. • The grown cerium oxide nanostructures were single or poly crystalline. • Direct growth of cerium oxide nanorods made the diverse substrates superhydrophobic and anti-corrosive without any surface modifiers. - Abstract: Superhydrophobic surfaces with anti-corrosion properties have attracted great interest in many industrial fields, particularly to enhance the thermal performance of offshore applications such as heat exchangers, pipelines, power plants, and platform structures. Nanostructures with hydrophobic materials have been widely utilized to realize superhydrophobicity of surfaces, and cerium oxide has been highlighted due to its good corrosion resistive and intrinsically hydrophobic properties. However, few studies of direct growth of cerium oxide nanostructures on diverse substrates have been reported. Herein we report a facile hydrothermal method to directly grow cerium oxide nanorods on diverse substrates, such as aluminum alloy, stainless steel, titanium, and silicon. Diverse substrates with cerium oxide nanorods exhibited superhydrophobicity with no hydrophobic modifiers on their surfaces, and showed good corrosion resistive properties in corrosive medium. We believe our method could pave the way for realization of scalable and sustainable corrosion resistive superhydrophobic surfaces in many industrial fields

Direct growth of cerium oxide nanorods on diverse substrates for superhydrophobicity and corrosion resistance

Energy Technology Data Exchange (ETDEWEB)

Cho, Young Jun; Jang, Hanmin; Lee, Kwan-Soo [School of Mechanical Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of); Kim, Dong Rip, E-mail: dongrip@hanyang.ac.kr [School of Mechanical Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of); Institute of Nano Science and Technology, Hanyang University, Seoul 133-791 (Korea, Republic of)

2015-06-15

Graphical abstract: - Highlights: • Cerium oxide nanorods were uniformly grown on diverse substrates. • Changes in growth conditions led to morphology evolution of cerium oxide nanostructures. • The grown cerium oxide nanostructures were single or poly crystalline. • Direct growth of cerium oxide nanorods made the diverse substrates superhydrophobic and anti-corrosive without any surface modifiers. - Abstract: Superhydrophobic surfaces with anti-corrosion properties have attracted great interest in many industrial fields, particularly to enhance the thermal performance of offshore applications such as heat exchangers, pipelines, power plants, and platform structures. Nanostructures with hydrophobic materials have been widely utilized to realize superhydrophobicity of surfaces, and cerium oxide has been highlighted due to its good corrosion resistive and intrinsically hydrophobic properties. However, few studies of direct growth of cerium oxide nanostructures on diverse substrates have been reported. Herein we report a facile hydrothermal method to directly grow cerium oxide nanorods on diverse substrates, such as aluminum alloy, stainless steel, titanium, and silicon. Diverse substrates with cerium oxide nanorods exhibited superhydrophobicity with no hydrophobic modifiers on their surfaces, and showed good corrosion resistive properties in corrosive medium. We believe our method could pave the way for realization of scalable and sustainable corrosion resistive superhydrophobic surfaces in many industrial fields.

Dielectric parameters of blood plasma of rats treated with cerium-144 and external irradiation

International Nuclear Information System (INIS)

Hadzhidekova, E.; Kiradzhiev, G.; Paskalev, Z.; Miloslavov, V.

1988-01-01

Investigation was carried out of the dielectric parameters of blood plasma of male Wistar rats treated with cerium 144 in doses of 370 kBq/animal and external gamma irradiation in doses of 200 cGy and 400 cGy. The radioactive cerium was introduced intraperitoneally 1 h after the external irradiation with dose rate of 1,6 cGy/sec. The permittivity ε, the time of relaxation τ and the coefficient of Debaye κ of plasma protein molecules were determined at the 1st, 3rd, 10th, 15th, and 30th days after treatement for frequence ranges of 1,4, 2,2, 3,6 and 6 MHz. At the same terms the content of cerium 144 was measured in the organs of predilectional accumulation of cerium. It was established that the treatment only with cerium lead to most essential changes of dielectric parameters at frequence of 3,6 MHz. The external irradiation didn't influence essentially the kinetics of absorbed cerium. In combination of both radiation factors the action of cerium was predominant

Critical indices for reversible gamma-alpha phase transformation in metallic cerium

Science.gov (United States)

Soldatova, E. D.; Tkachenko, T. B.

1980-08-01

Critical indices for cerium have been determined within the framework of the pseudobinary solution theory along the phase equilibrium curve, the critical isotherm, and the critical isobar. The results obtained verify the validity of relationships proposed by Rushbrook (1963), Griffiths (1965), and Coopersmith (1968). It is concluded that reversible gamma-alpha transformation in metallic cerium is a critical-type transformation, and cerium has a critical point on the phase diagram similar to the critical point of the liquid-vapor system.

Characterization of microstructure and catalytic of cerium oxide obtained by colloidal solution

International Nuclear Information System (INIS)

Senisse, C.A.L.; Bergmann, C.P.; Alves, A.K.

2012-01-01

This study investigated to obtain particles of cerium oxide, for use as catalysts for the combustion of methane using the technique of through polymeric colloidal solution. Obtaining the colloidal system is based on hydrolysis of salts such as cerium acetylacetonate, cerium nitrate in the presence of additives such as polyvinylbutyral (PVB), polyvinylpyrrolidone (PVP) and polyvinyl acetate (PVA), at concentrations of 5, 10 and 15% in aqueous or alcoholic medium. These solutions containing ions of interest were subjected to a heat treatment at 650° C for 30 minutes, with heating rate of 2 ° C/ min. After heat treatment, the fibers were characterized according to their morphology, surface area, crystallinity, weight loss and catalytic activity. Samples obtained from cerium acetylacetonate were more reactive than the cerium nitrate to the combustion of methane, as showed greater conversions and higher temperatures reached during the process, which is of utmost importance since the combustion catalytic methane is used for generating thermal energy. After the reaction with methane, the samples underwent significant change in surface area, probably due to the intensity of combustion reactions of the nitrate and the generation of heat involved in this reaction, which gave rise to coarse particles. During the combustion process using the obtained from particles of cerium acetylacetonate, there was the release of large quantities of nitrogen compared to the results of assays with the particles obtained with cerium nitrate. (author)

Nanoparticulate cerium dioxide and cerium dioxide-titanium dioxide composite thin films on glass by aerosol assisted chemical vapour deposition

International Nuclear Information System (INIS)

Qureshi, Uzma; Dunnill, Charles W.; Parkin, Ivan P.

2009-01-01

Two series of composite thin films were deposited on glass by aerosol assisted chemical vapour deposition (AACVD)-nanoparticulate cerium dioxide and nanoparticulate cerium dioxide embedded in a titanium dioxide matrix. The films were analysed by a range of techniques including UV-visible absorption spectroscopy, X-ray diffraction, scanning electron microscopy and energy dispersive analysis by X-rays. The AACVD prepared films showed the functional properties of photocatalysis and super-hydrophilicity. The CeO 2 nanoparticle thin films displaying photocatalysis and photo-induced hydrophilicity almost comparable to that of anatase titania.

Berkelium (4) and cerium (4) extraction with tertiary amines

International Nuclear Information System (INIS)

Milyukova, M.S.; Malikov, D.A.; Myasoedov, B.V.

1978-01-01

Oxidation of indicator quantities of berkelium and cerium by a mixture of silver nitrate and ammonium persulfate in the solutions of nitric and sulfuric acid has been examined. The stability of the elements in a tetravalent state and their extraction by the solutions of ternary amines have been investigated. It has been established that berkelium and cerium oxidation under these conditions occurs under the effect of ions of divalent silver which is formed owing to oxidation of monovalent silver by peroxide sulfate ions. The following supposition has been put forward: a difference in the behaviour of tetravalent berkelium and cerium during their extraction by ternary amines is explained by their different stability in this state, but not by the formation of complex compounds with nitrate ions

Separation of cerium and fractionation of rare earths from mixed chlorides

International Nuclear Information System (INIS)

Silva Queiroz, C.A. da; Sood, S.P.; Abrao, A.

1982-01-01

The separation of cerium from rare earths chlorides solutions by precipitation with hydrogen peroxide/air/dil. ammonium hydroxide; purification of cerium; fractionation by ion exchange and analytical control of the process are presented. (A.R.H.) [pt

22 CFR 146.310 - Recruitment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.310 Section 146.310 Foreign... Recruitment Prohibited § 146.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 146.300 through 146.310 apply shall not discriminate on the basis of sex in the recruitment and admission...

Two-phase titration of cerium(III) by permanganate

International Nuclear Information System (INIS)

Lazarev, A.I.; Lazareva, V.I.; Gerko, V.V.

1987-01-01

This paper presents a method for the two-phase titrimetric determination of cerium(III) with permanganate which does not require an expenditure of sugar and preliminary removal of chlorides and nitrates. The interaction of cerium(III) with permanganate at room temperature was studied as a function of the pH, the concentration of pyrophosphate, tetraphenylphosphonium (TPP), permanganate, and extraneous compounds, the rate of titration, and the time of stay of the solution in air before titration. The investigations were conducted according to the following methodology: water, solution of cerium(III) pyrophosphate, and TPP were introduced into an Erlenmeyer flask with a side branch near the bottom for clearer observation of the color of the chloroform phase. The authors established the given pH value, poured the water into a volume of 50 ml, and added chloroform. The result was titrated with permanganate solutions of various concentrations until a violet color appeared in the chloroform phase

Processing and Characterization of Sol-Gel Cerium Oxide Microspheres

Energy Technology Data Exchange (ETDEWEB)

McClure, Zachary D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Padilla Cintron, Cristina [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

2016-09-27

Of interest to space exploration and power generation, Radioisotope Thermoelectric Generators (RTGs) can provide long-term power to remote electronic systems without the need for refueling or replacement. Plutonium-238 (Pu-238) remains one of the more promising materials for thermoelectric power generation due to its high power density, long half-life, and low gamma emissions. Traditional methods for processing Pu-238 include ball milling irregular precipitated powders before pressing and sintering into a dense pellet. The resulting submicron particulates of Pu-238 quickly accumulate and contaminate glove boxes. An alternative and dust-free method for Pu-238 processing is internal gelation via sol-gel techniques. Sol-gel methodology creates monodisperse and uniform microspheres that can be packed and pressed into a pellet. For this study cerium oxide microspheres were produced as a surrogate to Pu-238. The similar electronic orbitals between cerium and plutonium make cerium an ideal choice for non-radioactive work. Before the microspheres can be sintered and pressed they must be washed to remove the processing oil and any unreacted substituents. An investigation was performed on the washing step to find an appropriate wash solution that reduced waste and flammable risk. Cerium oxide microspheres were processed, washed, and characterized to determine the effectiveness of the new wash solution.

Cerium; crystal structure and position in the periodic table.

Science.gov (United States)

Johansson, Börje; Luo, Wei; Li, Sa; Ahuja, Rajeev

2014-09-17

The properties of the cerium metal have intrigued physicists and chemists for many decades. In particular a lot of attention has been directed towards its high pressure behavior, where an isostructural volume collapse (γ phase → α phase) has been observed. Two main models of the electronic aspect of this transformation have been proposed; one where the 4f electron undergoes a change from being localized into an itinerant metallic state, and one where the focus is on the interaction between the 4f electron and the conduction electrons, often referred to as the Kondo volume collapse model. However, over the years it has been repeatedly questioned whether the cerium collapse really is isostructural. Most recently, detailed experiments have been able to remove this worrisome uncertainty. Therefore the isostructural aspect of the α-γ transition has now to be seriously addressed in the theoretical modeling, something which has been very much neglected. A study of this fundamental characteristic of the cerium volume collapse is made in present paper and we show that the localized [rlhar2 ] delocalized 4f electron picture provides an adequate description of this unique behavior. This agreement makes it possible to suggest that an appropriate crossroad position for cerium in The Periodic Table.

Cerium oxide and platinum nanoparticles protect cells from oxidant-mediated apoptosis

International Nuclear Information System (INIS)

Clark, Andrea; Zhu Aiping; Sun Kai; Petty, Howard R.

2011-01-01

Catalytic nanoparticles represent a potential clinical approach to replace or correct aberrant enzymatic activities in patients. Several diseases, including many blinding eye diseases, are promoted by excessive oxidant stress due to reactive oxygen species (ROS). Cerium oxide and platinum nanoparticles represent two potentially therapeutic nanoparticles that de-toxify ROS. In the present study, we directly compare these two classes of catalytic nanoparticles. Cerium oxide and platinum nanoparticles were found to be 16 ± 2.4 and 1.9 ± 0.2 nm in diameter, respectively. Using surface plasmon-enhanced microscopy, we find that these nanoparticles associate with cells. Furthermore, cerium oxide and platinum nanoparticles demonstrated superoxide dismutase catalytic activity, but did not promote hemolytic or cytolytic pathways in living cells. Importantly, both cerium oxide and platinum nanoparticles reduce oxidant-mediated apoptosis in target cells as judged by the activation of caspase 3. The ability to diminish apoptosis may contribute to maintaining healthy tissues.

Thermal Treatment of Cerium Oxide and Its Properties: Adsorption Ability versus Degradation Efficiency

Directory of Open Access Journals (Sweden)

Pavel Janoš

2014-01-01

Full Text Available Cerium oxide belongs to the most important heterogeneous catalysts, but its applicability as so-called reactive sorbent for the degradation of toxic chemicals was only recently discovered. For these purposes, cerium oxide is prepared by precipitation of insoluble cerium salts (carbonates with a subsequent thermal decomposition. Properties of cerium oxide prepared from the carbonate precursor are strongly affected by the temperature during the calcination. Main physicochemical properties of cerium oxide (specific surface area, crystallinity, and surface chemistry were examined in dependence on the calcination temperature. As the adsorptive properties of CeO2 are undoubtedly of great importance in the abovementioned applications, the adsorption ability was studied using an azo dye Acid Orange 7 (AO7 as a model compound. The highest sorption efficiency towards AO7 exhibited sorbents prepared at temperatures below 700°C, which was attributed mainly to the presence of hydroxyl groups on the oxide surface. A strong correlation was found between an adsorption efficiency of cerium oxides and their degradation efficiency for organophosphate pesticide parathion methyl. The >Ce–OH groups on the sorbent surface are responsible for the dye binding by the surface-complexation mechanism, and probably also for the nucleophilic cleavage of the P–O–aryl bond in the pesticide molecule.

An Economic Model and Experiments to Understand Aluminum-Cerium Alloy Recycling

Science.gov (United States)

Iyer, Ananth V.; Lim, Heejong; Rios, Orlando; Sims, Zachary; Weiss, David

2018-04-01

We provide an economic model to understand the impact of adoption, sorting and pricing of scrap on the recycling of a new aluminum-cerium (AlCe) alloy for use in engine blocks in the automobile industry. The goal of the laboratory portion of this study is to investigate possible effects of cerium contamination on well-established aluminum recycling streams. Our methodology includes three components: (1) focused data gathering from industry supply chain participants, (2) experimental data through laboratory experiments to understand the impact of cerium on existing alloys and (3) an economic model to understand pricing incentives on a recycler's separation of AlCe engine blocks.

Extraction-differential-photometric method to determine rare earths of cerium subgroup

International Nuclear Information System (INIS)

Askerov, D.N.; Gusejnov, I.K.; Melikov, A.A.

1985-01-01

The extraction - photometric method to determine great quantities of rare earths of the cerium subgroup as a complex with antipyrine A and diphenylguanidine is developed. Isobutyl and n-butyl alcohols are used as extractants. It is established that proportional dependence between relative optical density and concentration of rare earths of the cerium subgroup in the solution takes place in the concentration interval of 10.3-14.7 μg of rare earths in 1 ml of the solution. Determination error is+-1.12%. The technique is used to determine rare earths of the cerium subgroup in rare earth oxides of a mixed composition, as well as in monozite and loparite

Spectrophotometric determination of cerium with methylthymol blue in the presence of oxalate and cyanide as masking agents

Energy Technology Data Exchange (ETDEWEB)

Cabrera-Martin, A; Izquierdo-Hornillos, R; Quejido-Cabezas, A J; Peral-Fernandez, J L [Universidad Complutense de Madrid (Spain). Facultad de Ciencias Quimicas

1983-04-01

The spectrophotometric determination of cerium can be carried out by several methods, which involve either the formation of complexes of cerium(III) and cerium(IV) or the oxidation of suitable reagents by cerium(IV) and further measuring the intensity of the colour of the oxidised matter. The latter methods show a lack of selectivity and low sensitivity owing to the nature of the redox reaction. The methods that involve the formation of complexes have also been shown to have low selectivity and sensitivity. However, the most useful methods are those based on the complexes of cerium(III) with Xylenol Orange and Methylthymol Blue (MTB), but they are affected by many interferences. In this work the reaction of cerium(III) with MTB in the presence of oxalate and cyanide ions was studied at pH 10.2, which improves the sensitivity and the selectivity of the determination of cerium.

Inhibition of pH fronts in corrosion cells due to the formation of cerium hydroxide

NARCIS (Netherlands)

Soestbergen, M. van; Erich, S.J.F.; Huinink, H.P.; Adan, O.C.G.

2013-01-01

The effect of cerium-based corrosion inhibitors on the pH front between the alkaline cathode and acidic anode in corrosion cells has been studied. The cerium component of these inhibitors can affect the pH front since it precipitates in an alkaline environment as cerium hydroxide, which is important

Solvent extraction of cerium (III) with high molecular weight amines

International Nuclear Information System (INIS)

Chatterjee, A.; Basu, S.

1992-01-01

The use of high molecular weight amines in the extraction of cerium (III) as EDTA complex from neutral aqueous medium is reported. The extraction condition was optimised from the study of effects of several variables like concentration of amine and EDTA pH nature of diluents etc. The method has been applied for the determination of cerium in few mineral samples. (author). 7 refs., 5 tabs

Study of cerium diffusion in undoped lithium-6 enriched glass with Rutherford backscattering spectrometry

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xiaodong, E-mail: xzhang39@utk.edu [Department of Nuclear Engineering, University of Tennessee, TN 37996 (United States); Moore, Michael E.; Lee, Kyung-Min; Lukosi, Eric D. [Department of Nuclear Engineering, University of Tennessee, TN 37996 (United States); Hayward, Jason P. [Department of Nuclear Engineering, University of Tennessee, TN 37996 (United States); Oak Ridge National Lab, Oak Ridge, TN 37831 (United States)

2016-07-01

Undoped lithium-6 enriched glasses coated with pure cerium (99.9%) with a gold protection layer on top were heated at three different temperatures (500, 550, and 600 °C) for varied durations (1, 2, and 4 h). Diffusion profiles of cerium in such glasses were obtained with the conventional Rutherford backscattering technique. Through fitting the diffusion profiles with the thin-film solution of Fick’s second law, diffusion coefficients of cerium with different annealing temperatures and durations were solved. Then, the activation energy of cerium for the diffusion process in the studied glasses was found to be 114 kJ/mol with the Arrhenius equation.

Optical properties of cerium oxide (CeO2) nanoparticles synthesized by hydroxide mediated method

Science.gov (United States)

Ali, Mawlood Maajal; Mahdi, Hadeel Salih; Parveen, Azra; Azam, Ameer

2018-05-01

The nanoparticles of cerium oxide have been successfully synthesized by hydroxide mediated method, using cerium nitrate and sodium hydroxide as precursors. The microstructural properties were analyzed by X-ray diffraction technique (XRD). The X-ray diffraction results show that the cerium oxide nanoparticles were in cubic structure. The optical absorption spectra of cerium oxide were recorded by UV-VIS spectrophotometer in the range of 320 to 600 nm and photoluminescence spectra in the range of 400-540 nm and have been presented. The energy band gap was determined by Tauc relationship. The crystallite size was determined from Debye-Scherer equation and came out to be 6.4 nm.

Study of cerium diffusion in undoped lithium-6 enriched glass with Rutherford backscattering spectrometry

Science.gov (United States)

Zhang, Xiaodong; Moore, Michael E.; Lee, Kyung-Min; Lukosi, Eric D.; Hayward, Jason P.

2016-07-01

Undoped lithium-6 enriched glasses coated with pure cerium (99.9%) with a gold protection layer on top were heated at three different temperatures (500, 550, and 600 °C) for varied durations (1, 2, and 4 h). Diffusion profiles of cerium in such glasses were obtained with the conventional Rutherford backscattering technique. Through fitting the diffusion profiles with the thin-film solution of Fick's second law, diffusion coefficients of cerium with different annealing temperatures and durations were solved. Then, the activation energy of cerium for the diffusion process in the studied glasses was found to be 114 kJ/mol with the Arrhenius equation.

Study of phase transitions in cerium in shock-wave experiments

Directory of Open Access Journals (Sweden)

Zhernokletov M.V.

2015-01-01

Full Text Available Cerium has a complex phase diagram that is explained by the presence of structure phase transitions. Planar gauges were used in various combinations in experiments for determination of sound velocity dependence on pressure in cerium by the technique of PVDF gauge. The data of time dependence on pressure profiles with use of x(t diagrams and the D(u relation for cerium allowed the definition of the Lagrangian velocity of the unloading wave CLagr and the Eulerian velocity CEul by taking into account the compression σ. These results accords with data obtained by using the technique of VISAR and a manganin-based gauge, and calculated pressure dependence of isentropic sound velocity according to the VNIITF EOS. Metallography analysis of post-experimental samples did not find any changes in a phase composition.

The solvent extraction of cerium from sulphate solution - mini plant trials

International Nuclear Information System (INIS)

Soldenhoff, K.; Wilkins, D.; Ring, R.

1998-01-01

Full text: The Mt. Weld deposit in Western Australia has a complex rare earth mineralisation. The rare earth phosphate minerals, which include monazite, are amenable to conventional caustic cracking followed by hydrochloric acid dissolution of the trivalent rare earths. The presence of the mineral cerianite in the ore, which is unaffected by the alkali attack, results in rejection of a considerable proportion of the cerium to the acid leach residue. The recovery of cerium from a sulphate solution, resulting from the processing of such a residue, is the subject of the current paper. The liquor treated by solvent extraction contained 63 g L -1 rare earths and the cerium to total rare earth ratio was 75%. Other impurities, including Fe and Th, totalled 2000 ppm. A solvent mixture of commercially available extractants in a low aromatic content diluent was used to extract Ce 4+ selectively over the trivalent rare earths. Partial co-extraction of Fe and Th occurred but it was found that these elements were not easily stripped and therefore selective back extraction of cerium was possible. The cerium was stripped from the organic phase by hydrochloric acid and hydrogen peroxide. In continuous counter-current trials two extraction stages and three strip stages were used. In order to produce two grades of strip liquor, stripping was divided into two circuits. The first strip circuit consisting of a single stage, contained proportionally more of the trivalent rare earths. The second strip circuit, consisting of two stages, removed the remaining cerium with proportionally less of the rare earths. A bleed solvent stream was treated for removal of impurities to prevent build-up in the solvent. In the continuous counter current trials, 95% Ce 4+ extraction was achieved and the Ce to total rare earth ratio was upgraded to > 99%

47 CFR 80.146 - [Reserved

Science.gov (United States)

2010-10-01

... MARITIME SERVICES Operating Requirements and Procedures Shipboard General Purpose Watches § 80.146 [Reserved] ... 47 Telecommunication 5 2010-10-01 2010-10-01 false [Reserved] 80.146 Section 80.146...

Spectrofluorimetric determination of cerium by flow injection analysis

International Nuclear Information System (INIS)

Liu Shaorong; Meng Jian; Liu Wenhua

1990-01-01

A spectrofluorimetric method for the determination of cerium (λ ex/em:251/365 nm) in hydrochloric acid solution by flow injection analysis is presented. It has well developed the normal spectrofluorimetric method for determination of cerium and has made: 1, the determination procedure shortened; 2, the determination speed increased to about 180 samples per hour; 3, the determination range widened to 0.05-100.0 ppm CeO 2 , abouot two times as wide as the normal spectrofluorimetric method; and 4, the relative standard deviation lessened (about 0.47% for 0.1 ppm CeO 2 , n = 13)

Environmental Geochemistry of Cerium: Applications and Toxicology of Cerium Oxide Nanoparticles

Directory of Open Access Journals (Sweden)

Jessica T. Dahle

2015-01-01

Full Text Available Cerium is the most abundant of rare-earth metals found in the Earth’s crust. Several Ce-carbonate, -phosphate, -silicate, and -(hydroxide minerals have been historically mined and processed for pharmaceutical uses and industrial applications. Of all Ce minerals, cerium dioxide has received much attention in the global nanotechnology market due to their useful applications for catalysts, fuel cells, and fuel additives. A recent mass flow modeling study predicted that a major source of CeO2 nanoparticles from industrial processing plants (e.g., electronics and optics manufactures is likely to reach the terrestrial environment such as landfills and soils. The environmental fate of CeO2 nanoparticles is highly dependent on its physcochemical properties in low temperature geochemical environment. Though there are needs in improving the analytical method in detecting/quantifying CeO2 nanoparticles in different environmental media, it is clear that aquatic and terrestrial organisms have been exposed to CeO2 NPs, potentially yielding in negative impact on human and ecosystem health. Interestingly, there has been contradicting reports about the toxicological effects of CeO2 nanoparticles, acting as either an antioxidant or reactive oxygen species production-inducing agent. This poses a challenge in future regulations for the CeO2 nanoparticle application and the risk assessment in the environment.

Electrorefining of Cerium in LiCl-KCl Molten Salts

International Nuclear Information System (INIS)

Campbell-Kelly, R.P.; Paget, T.J.

2010-01-01

Electrorefining of cerium from cerium-gallium alloys has been demonstrated in lithium chloride-potassium chloride salts at temperatures below 500 deg. C, with excellent current efficiencies and high product yields. These experiments are being carried out as non-active trials for a process for the purification of impure actinide metals. The results reported show anodic current efficiencies consistently close to 100%, and in several experiments complete oxidation of the cerium in the feed occurred. The cathodic product is hard and metallic, and incorporates a significant amount of salt into its structure. The product can be consolidated into a dense, pure metal by melting under calcium chloride at 850 deg. C. The yield of this consolidation step varies between 16 and 75%, seeming to depend on the total mass of metal being consolidated and the quality of inert atmosphere. A small-scale electrochemical cell has been demonstrated which will be used in initial active experiments. (authors)

Corrosion resistance of flaky aluminum pigment coated with cerium oxides/hydroxides in chloride and acidic electrolytes

International Nuclear Information System (INIS)

Niroumandrad, S.; Rostami, M.; Ramezanzadeh, B.

2015-01-01

Graphical abstract: - Highlights: • Flaky aluminum pigments were modified with cerium nitrate salt. • pH value of 3.0 was chosen as the optimized pH for the cerium solution. • Corrosion resistance of the pigment significantly increased after modification. • Alkaline pre-treatment prior to modification affected the cerium layer performance. - Abstract: The objective of this study was to enhance the corrosion resistance of lamellar aluminum pigment through surface treatment by cerium oxides/hydroxides. The surface composition of the pigments was studied by energy-dispersive spectroscopy (EDS) and X-ray photoelectron spectroscopy (XPS). The corrosion resistance of the pigment was evaluated by conventional hydrogen evolution measurements in acidic solution and electrochemical impedance spectroscopy (EIS) in 3.5% NaCl solution. Results showed that the Ce-rich coating composed of Ce 2 O 3 and CeO 2 was precipitated on the pigment surface after immersion in the cerium solution. The corrosion resistance of pigment was significantly enhanced after modification with cerium layer.

Corrosion resistance of flaky aluminum pigment coated with cerium oxides/hydroxides in chloride and acidic electrolytes

Energy Technology Data Exchange (ETDEWEB)

Niroumandrad, S. [Institute for Color Science and Technology (ICST), PO 16765-654, Tehran (Iran, Islamic Republic of); Rostami, M. [Department of Nanomaterials and Nanocoatings, Institute for Color Science and Technology (ICST), PO 16765-654, Tehran (Iran, Islamic Republic of); Ramezanzadeh, B., E-mail: ramezanzadeh-bh@icrc.ac.ir [Department of Surface Coatings and Corrosion, Institute for Color Science and Technology (ICST), PO 16765-654, Tehran (Iran, Islamic Republic of)

2015-12-01

Graphical abstract: - Highlights: • Flaky aluminum pigments were modified with cerium nitrate salt. • pH value of 3.0 was chosen as the optimized pH for the cerium solution. • Corrosion resistance of the pigment significantly increased after modification. • Alkaline pre-treatment prior to modification affected the cerium layer performance. - Abstract: The objective of this study was to enhance the corrosion resistance of lamellar aluminum pigment through surface treatment by cerium oxides/hydroxides. The surface composition of the pigments was studied by energy-dispersive spectroscopy (EDS) and X-ray photoelectron spectroscopy (XPS). The corrosion resistance of the pigment was evaluated by conventional hydrogen evolution measurements in acidic solution and electrochemical impedance spectroscopy (EIS) in 3.5% NaCl solution. Results showed that the Ce-rich coating composed of Ce{sub 2}O{sub 3} and CeO{sub 2} was precipitated on the pigment surface after immersion in the cerium solution. The corrosion resistance of pigment was significantly enhanced after modification with cerium layer.

The developments and challenges of cerium half-cell in zinc–cerium redox flow battery for energy storage

International Nuclear Information System (INIS)

Xie, Zhipeng; Liu, Qingchao; Chang, Zhiwen; Zhang, Xinbo

2013-01-01

Zinc–cerium redox flow batteries (ZCBs) are emerging as a very promising new technology with the potential to store a large amount of energy economically and efficiently, thanking to its highest thermodynamic open-circuit cell voltage among all the currently studied aqueous redox flow batteries. However, there are numerous scientific and technical challenges that must be overcome if this alluring promise is to turn into reality, from designing the battery structure, to optimizing the electrolyte compositions and elucidating the complex chemical reactions that occur during charge and discharge. This review article is the first summary of the most significant developments and challenges of cerium half-cell and the current understanding of their chemistry. We are certain that this review will be of great interest to audience over a broad range, especially in fields of energy storage, electrochemistry, and chemical engineering

Molecular and physiological responses to titanium dioxide and cerium oxide nanoparticles in Arabidopsis

Science.gov (United States)

- Changes in tissue transcriptomes and productivity of Arabidopsis thaliana were investigated during exposure of plants to two widely-used engineered metal oxide nanoparticles, titanium dioxide (nano-titanium) and cerium dioxide (nano-cerium). Microarray analyses confirmed that e...

Electrochemical reduction of cerium oxide into metal

Energy Technology Data Exchange (ETDEWEB)

Claux, Benoit [CEA, Valduc, F-21120 Is-sur-Tille (France); Universite de Grenoble, LEPMI-ENSEEG, 1130 rue de la Piscine, BP75, F-38402 St Martin d' Heres Cedex (France); Serp, Jerome, E-mail: jerome.serp@cea.f [CEA, Valduc, F-21120 Is-sur-Tille (France); Fouletier, Jacques [Universite de Grenoble, LEPMI-ENSEEG, 1130 rue de la Piscine, BP75, F-38402 St Martin d' Heres Cedex (France)

2011-02-28

The Fray Farthing and Chen (FFC) and Ono and Suzuki (OS) processes were developed for the reduction of titanium oxide to titanium metal by electrolysis in high temperature molten alkali chloride salts. The possible transposition to CeO{sub 2} reduction is considered in this study. Present work clarifies, by electro-analytical techniques, the reduction pathway leading to the metal. The reduction of CeO{sub 2} into metal was feasible via an indirect mechanism. Electrolyses on 10 g of CeO{sub 2} were carried out to evaluate the electrochemical process efficiency. Ca metal is electrodeposited at the cathode from CaCl{sub 2}-KCl solvent and reacts chemically with ceria to form not only metallic cerium, but also cerium oxychloride.

Energy-dispersive X-ray fluorescence analysis of cerium in ferrosilicon

International Nuclear Information System (INIS)

Marbec, E.R.

1987-01-01

The cerium was determined in ferrosilicon samples by energy-dispersive X-ray fluorescence techniques (XRF) techniques, with a secondary target of gadolinium. The methods employed were: comparison and linear regression with reference materials with cerium concentration between 0.4 and 1.0%. The samples were prepared in the form of pellets and the analytical results are reported as an average of five determinations with a confidence limits at 95% probability. (Author) [es

Analysis of the effects of cerium on calcium ion in the protoplasts of ...

African Journals Online (AJOL)

Administrator

2011-09-12

Sep 12, 2011 ... African Journal of Biotechnology Vol. 10(52), pp. ... Paper. Analysis of the effects of cerium on calcium ion in the .... plasma membrane (Zeng et al., 2003). Recently .... cerium on vegetable growth of wheat (Triticum aestivum L.).

Study on the uranium-cerium extraction and his application to the treatment of irradiated uranium

International Nuclear Information System (INIS)

Lobao, Afonso dos Santos Tome

1979-01-01

It was made a study on the behavior of uranium and cerium(IV) extraction, using the latter element as a plutonium simulator in a flowsheet of the treatment of irradiated uranium. Cerium(IV) was used under the same conditions as a plutonium in the Purex process because the admitted similar properties. An experimental work was initiated to determine the equilibrium curves of uranium, under the following conditions: concentration of 1 to 20 g U/1 and acidity varying from 1 to 5M in HNO 3 . Other parameters studied were the volumetric ratio of the phases and the influence of the concentration of TBP (tri-n-butyl phosphate). To guarantee the cerium(IV) extraction, the diluent (varsol) was previously treated with 10% potassium dichromate in perchloric acid, potassium permanganate in 1M sulphuric acid and concentrated sulphuric acid at 70 deg to eliminate reducing compounds. The results obtained for cerium extraction, allowed a better understanding of its behavior in solution. The results permitted to conclude that the decontamination for cerium are very high in the first Purex extraction cycle. The easy as cerium(IV) is reduced to the trivalent state contributes a great deal to its decontamination. (author)

Influences of the main anodic electroplating parameters on cerium oxide films

Energy Technology Data Exchange (ETDEWEB)

Yang, Yang; Yang, Yumeng; Du, Xiaoqing; Chen, Yu [Department of Chemistry, Zhejiang University, Hangzhou 310027, Zhejiang (China); Zhang, Zhao, E-mail: eaglezzy@zjuem.zju.edu.cn [Department of Chemistry, Zhejiang University, Hangzhou 310027, Zhejiang (China); Zhang, Jianqing [Department of Chemistry, Zhejiang University, Hangzhou 310027, Zhejiang (China); State Key Laboratory for Corrosion and Protection of Metals, Shenyang 110016 (China)

2014-06-01

Cerium oxide thin films were fabricated onto 316 L stainless steel via a potentiostatically anodic electrodeposition approach in the solutions containing cerium(III) nitrate (0.05 M), ammonia acetate (0.1 M) and ethanol (10% V/V). The electrochemical behaviors and deposition parameters (applied potential, bath temperature, dissolving O{sub 2} and bath pH) have been investigated. Results show that, the electrochemical oxidation of Ce{sup 3+} goes through one electrochemical step, which is under charge transfer control. The optimum applied potential for film deposition is 0.8 V. Bath temperature plays a significant effect on the deposition rate, composition (different colors of the film) and surface morphology of the deposits. Due to the hydrolysis of Ce{sup 3+}, cerous hydroxide is facility to form when the bath temperature is higher than 60 °C. The electroplating bath pH is another key role for the anodic deposition of cerium oxide thin films, and the best bath pH is around 6.20. N{sub 2} or O{sub 2} purged into the bath will result in film porosities and O{sub 2} favors cerium oxide particles and film generation.

Growth and characterization of Sm3+ doped cerium oxalate single crystals

Directory of Open Access Journals (Sweden)

Minu Mary C

2016-07-01

Full Text Available Single crystals of Sm3+ doped cerium oxalate decahydrate were synthesized using single diffusion gel technique and the conditions influencing the size, morphology, nucleation density and quality of the crystals were optimized. Highly transparent single crystals of average size 3 mm × 2 mm × 1 mm with well-defined hexagonal morphology were grown during a time period of two weeks. X-ray powder diffraction analysis revealed that the grown crystals crystallize in the monoclinic system with space group P21/c as identical with the pure cerium oxalate. The various functional groups of the oxalate ligand and the water of crystallization were identified by Fourier transform infrared spectroscopy. The photoluminescence spectrum of the Sm3+ doped cerium oxalate indicated that the Sm3+ ions are optically active in the cerium oxalate matrix. The crystal has a strong and efficient orange red emission with a wavelength peak at 595 nm and hence can be effectively used for optical amplification. Microhardness measurements of the crystal revealed that they belong to the soft material category.

7 CFR 1955.146 - Advertising.

Science.gov (United States)

2010-01-01

... 7 Agriculture 14 2010-01-01 2009-01-01 true Advertising. 1955.146 Section 1955.146 Agriculture... REGULATIONS (CONTINUED) PROPERTY MANAGEMENT Disposal of Inventory Property General § 1955.146 Advertising. (a... real estate brokers, it is the servicing official's responsibility to ensure adequate advertising of...

Synthesis, characterization and antibacterial activity of hybrid chitosan-cerium oxide nanoparticles: As a bionanomaterials.

Science.gov (United States)

Senthilkumar, R P; Bhuvaneshwari, V; Ranjithkumar, R; Sathiyavimal, S; Malayaman, V; Chandarshekar, B

2017-11-01

The hybrid chitosan cerium oxide nanoparticles were prepared for the first time by green chemistry approach using plant leaf extract. The intense peak observed around 292nm in the UV-vis spectrum indicate the formation of cerium oxide nanoparticles. The XRD pattern revealed that the hybrid chitosan-cerium oxide nanoparticles have a polycrystalline structure with cubic fluorite phase. The FTIR spectrum of prepared samples showed the formation of Ce-O bonds and chitosan main chains COC and CO. The FESEM image of hybrid chitosan cerium oxide nanoparticles revealed that the particles are spherical in shape with grains size varying from 23.12nm to 89.91nm. EDAX analysis confirmed the presence of Ce, O, C and N elements in the prepared sample. TEM images showed that the prepared hybrid chitosan-cerium oxide nanoparticles are predominantly uniform in size and most of the particles are spherical in shape with less agglomeration and the particles size varies from 3.61nm to 24.40nm. The prepared chitosan cerium oxide nanoparticles of 50μL concentration showed good antibacterial properties against test pathogens, which was confirmed by the FESEM analysis. The prepared small particle size facilitate that these hybrid ChiCO 2 NPs could effectively be used in biomedical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Oxochloroalkoxide of the Cerium (IV and Titanium (IV as oxides precursor

Directory of Open Access Journals (Sweden)

Machado Luiz Carlos

2002-01-01

Full Text Available The Cerium (IV and Titanium (IV oxides mixture (CeO2-3TiO2 was prepared by thermal treatment of the oxochloroisopropoxide of Cerium (IV and Titanium (IV. The chemical route utilizing the Cerium (III chloride alcoholic complex and Titanium (IV isopropoxide is presented. The compound Ce5Ti15Cl16O30 (iOPr4(OH-Et15 was characterized by elemental analysis, FTIR and TG/DTG. The X-ray diffraction patterns of the oxides resulting from the thermal decomposition of the precursor at 1000 degreesC for 36 h indicated the formation of cubic cerianite (a = 5.417Å and tetragonal rutile (a = 4.592Å and (c = 2.962 Å, with apparent crystallite sizes around 38 and 55nm, respectively.

22 CFR 146.510 - Recruitment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.510 Section 146.510 Foreign... Education Programs or Activities Prohibited § 146.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees...

22 CFR 146.500 - Employment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 146.500 Section 146.500 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 146.500 Employment. (a) General. (1) No person shall, on the...

24 CFR 146.35 - Mediation.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Mediation. 146.35 Section 146.35... ASSISTANCE Investigation, Settlement, and Enforcement Procedures § 146.35 Mediation. (a) HUD shall refer to the Federal Mediation and Conciliation Service, a mediation agency designated by the Secretary of...

Procedure for the separation of cerium from crude phosphates and rare earth concentrates

International Nuclear Information System (INIS)

Richter, H.; Koenig, O.; Schmitt, A.; Grauss, H.; Freitag, S.

1986-01-01

The invention has to do with a procedure for the separation of cerium from crude phosphates and rare earth phosphate concentrates originating from the partial neutralization of nitric crude phosphate decomposition solutions. It is aimed at the cerium separation from the raw material at an early stage of reprocessing without preceding elimination of other components and impurities. The rare earth phosphate concentrates or crude phosphates are dissolved in nitric acid, the Ce 3+ is oxidized with potassium permanganate or magnanese(IV) hydroxide, and cerium(IV) phosphate is precipitated as pure substance by decreasing the acidity of the solution

22 CFR 146.540 - Advertising.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 146.540 Section 146.540 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Education Programs or Activities Prohibited § 146.540 Advertising. A recipient shall not in any advertising...

22 CFR 146.405 - Housing.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 146.405 Section 146.405 Foreign... Activities Prohibited § 146.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...

Oxidative stress induced by cerium oxide nanoparticles in cultured BEAS-2B cells

International Nuclear Information System (INIS)

Park, Eun-Jung; Choi, Jinhee; Park, Young-Kwon; Park, Kwangsik

2008-01-01

Cerium oxide nanoparticles of different sizes (15, 25, 30, 45 nm) were prepared by the supercritical synthesis method, and cytotoxicity was evaluated using cultured human lung epithelial cells (BEAS-2B). Exposure of the cultured cells to nanoparticles (5, 10, 20, 40 μg/ml) led to cell death, ROS increase, GSH decrease, and the inductions of oxidative stress-related genes such as heme oxygenase-1, catalase, glutathione S-transferase, and thioredoxin reductase. The increased ROS by cerium oxide nanoparticles triggered the activation of cytosolic caspase-3 and chromatin condensation, which means that cerium oxide nanoparticles exert cytotoxicity by an apoptotic process. Uptake of the nanoparticles to the cultured cells was also tested. It was observed that cerium oxide nanoparticles penetrated into the cytoplasm and located in the peri-region of the nucleus as aggregated particles, which may induce the direct interaction between nanoparticles and cellular molecules to cause adverse cellular responses

Effect of correlation on the band structure of α-cerium

International Nuclear Information System (INIS)

Rao, R.S.; Singh, R.P.

1975-01-01

The electronic band structure of f.c.c. phase of the rare earth metal cerium (α-cerium) has been calculated using a formulation of the crystal potential where correlation also has been included in addition to exchange. The Green's function method of Korringa-Kohn and Rostoker has been used due to obvious advantages in calculation. The calculations indicate that the s-d bands are hybridized with the f-levels but the f-bands are fairly narrow and lie slightly above the Fermi level. The structure of the bands is qualitatively similar to those of calculations by others except for a general shift of the entire set of bands by about 0.1 Ryd. Thd density of states has also been calculated from the bands obtained. The spin susceptibility of α-cerium has also been calculated using the Kohn-Sham method. However, the calculated additional contributions to the band structure values cannot still explain the large experimental values reported in the literature. (author)

Solid-soluted content of cerium in solid solution of sphene

International Nuclear Information System (INIS)

Zhao Wei; Teng Yuancheng; Li Yuxiang; Ren Xuetan; Huang Junjun

2010-01-01

The sphene solid solution was synthesized by solid-state method,with calcium carbonate, silica, titanium dioxide, cerium oxalate and alumina as raw materials. The solid-soluted content of cerium in sphene was researched by means of X-ray diffraction (XRD), backscattering scanning electron microscopy (BSE), energy dispersive spectroscopy (EDS) and so on. The influence of A l3+ ion introduction to sphene on the solid-soluted content of cerium in sphene solid solution was studied. The results indicate that when introducing Al 3+ to sphene as electrovalence compensation, Ce 4+ could be well solidified to Ca 1-x Ce x Ti 1-2x A l2x SiO 5 , and the solid-soluted content is approximately 12.61%. With no electrovalence compensation, Ce 4+ could be solidified to Ca 1-2x Ce x TiSiO 5 , and the solid-soluted content is approximately 10.98%. The appropriate synthesis temperature of sphene solid solution is 1 260 degree C.(authors)

Production of cerium dioxide microspheres by an internal gelation sol–gel method

Energy Technology Data Exchange (ETDEWEB)

Katalenich, Jeffrey A.

2017-03-27

An internal gelation sol-gel technique was used to prepare cerium dioxide microspheres with uniform diameters near 100 µm. In this process, chilled aqueous solutions containing cerium, hexamethylenetetramine (HMTA), and urea are transformed into a solid gel by heat addition and are subsequently washed, dried, and sintered to produce pure cerium dioxide. Cerous nitrate and ceric ammonium nitrate solutions were compared for their usefulness in microsphere production. Gelation experiments were performed with both cerous nitrate and ceric ammonium nitrate to determine desirable concentrations of cerium, HMTA, and urea in feed solutions as well as the necessary quantity of ammonium hydroxide added to cerium solutions. Analysis of the pH before and after sample gelation was found to provide a quantitative metric for optimal parameter selection along with subjective evaluations of gel qualities. The time necessary for chilled solutions to gel upon inserting into a hot water bath was determined for samples with a variety of parameters and also used to determine desirable formulations for microsphere production. A technique for choosing the optimal mixture of ceric ammonium nitrate, HMTA, and urea was determined using gelation experiments and used to produce microspheres by dispersion of the feed solution into heated silicone oil. Gelled spheres were washed to remove excess reactants and reaction products before being dried and sintered. X-ray diffraction of air-dried microspheres, sintered microspheres, and commercial CeO₂ powders indicated that air-dried and sintered spheres were pure CeO₂.

33 CFR 211.146 - Price.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Price. 211.146 Section 211.146 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE REAL ESTATE... Industrial Facilities § 211.146 Price. No conveyance shall be made for a price less than the fair market...

Effects of PEG4000 template on sol-gel synthesis of porous cerium titanate photocatalyst

Science.gov (United States)

Zhang, Wenjie; Tao, Yingjie; Li, Chuanguo

2018-04-01

Porous cerium titanate was synthesized by sol-gel method, using polyethylene glycol (PEG4000) as template agent. Brannerite structured CeTi2O6 in monoclinic system is the major substance formed in the materials. Formation of CeO2 and rutile TiO2 depends on the amount of PEG4000. The addition of PEG4000 leads to production of fine particles in the samples, but it does not apparently affect the band gap energy. Pore volume of the cerium titanate sample continuously increases with rising PEG4000 amount. The sample obtained using 3.5 g PEG4000 has BET surface area of 16.2 m2/g and pore volume of 0.0232 cm3/g. The addition of PEG4000 can obviously promote photocatalytic activity of cerium titanate, which can be proven by both enhanced production of hydroxyl radical and ofloxacin degradation efficiency. As much as 95.2% of the initial ofloxacin molecules are removed from the solution after 50 min of photocatalytic degradation on the cerium titanate obtained using 3.5 g PEG4000, while only 48.4% ofloxacin is removed on cerium titanate obtained without PEG4000.

Analysis of cerium-composite polymer-electrolyte membranes during and after accelerated oxidative-stability test

Science.gov (United States)

Shin, Dongwon; Han, Myungseong; Shul, Yong-Gun; Lee, Hyejin; Bae, Byungchan

2018-02-01

The oxidative stability of membranes constructed from a composite of pristine sulfonated poly(arylene ether sulfone) and cerium was investigated by conducting an accelerated oxidative-stability test at the open-circuit voltage (OCV). The membranes were analyzed in situ through OCV and impedance measurements, cyclic voltammetry, and linear-sweep voltammetry to monitor the electrochemical properties during the stability test. Although the high-frequency resistance of a composite membrane was slightly higher than that of a pristine membrane because of the exchange of protons from the sulfonic acid with cerium ions, the composite membrane maintained its potential for much longer than the pristine membrane. The effect of the cerium ions as radical scavengers was confirmed by analyzing the drain water and chemical structure after operation. These post-operation analyses confirmed that cerium ions improved the oxidative stability of the hydrocarbon-based polymer during fuel-cell operation. It is clear that the cerium-based radical scavengers prevented chemical degradation of the polymer membrane as well as the electrode in terms of hydrogen cross-over, polymer-chain scission, and the electrochemical surface area, while they rarely diffused outward from the membrane.

Immobilization of simulated radioactive soil waste containing cerium by self-propagating high-temperature synthesis

International Nuclear Information System (INIS)

Mao, Xianhe; Qin, Zhigui; Yuan, Xiaoning; Wang, Chunming; Cai, Xinan; Zhao, Weixia; Zhao, Kang; Yang, Ping; Fan, Xiaoling

2013-01-01

A simulated radioactive soil waste containing cerium as an imitator element has been immobilized by a thermite self-propagating high-temperature synthesis (SHS) process. The compositions, structures, and element leaching rates of products with different cerium contents have been characterized. To investigate the influence of iron on the chemical stability of the immobilized products, leaching tests of samples with different iron contents with different leaching solutions were carried out. The results showed that the imitator element cerium mainly forms the crystalline phases CeAl 11 O 18 and Ce 2 SiO 5 . The leaching rate of cerium over a period of 28 days was 10 −5 –10 −6 g/(m 2 day). Iron in the reactants, the reaction products, and the environment has no significant effect on the chemical stability of the immobilized SHS products

Immobilization of simulated radioactive soil waste containing cerium by self-propagating high-temperature synthesis

Science.gov (United States)

Mao, Xianhe; Qin, Zhigui; Yuan, Xiaoning; Wang, Chunming; Cai, Xinan; Zhao, Weixia; Zhao, Kang; Yang, Ping; Fan, Xiaoling

2013-11-01

A simulated radioactive soil waste containing cerium as an imitator element has been immobilized by a thermite self-propagating high-temperature synthesis (SHS) process. The compositions, structures, and element leaching rates of products with different cerium contents have been characterized. To investigate the influence of iron on the chemical stability of the immobilized products, leaching tests of samples with different iron contents with different leaching solutions were carried out. The results showed that the imitator element cerium mainly forms the crystalline phases CeAl11O18 and Ce2SiO5. The leaching rate of cerium over a period of 28 days was 10-5-10-6 g/(m2 day). Iron in the reactants, the reaction products, and the environment has no significant effect on the chemical stability of the immobilized SHS products.

Synthesis of cerium oxide catalysts supported on MCM-41 molecular sieve

International Nuclear Information System (INIS)

Souza, E.L.S.; Barros, T.R.B.; Sousa, B.V. de

2016-01-01

Porous materials have been widely studied as catalysts and catalyst support. The MCM-41 structure is the one that has been most studied because of its application possibilities in chemical processes. This work aimed to obtain and characterize cerium oxide catalysts supported on MCM-41 molecular sieve. The molecular sieve was synthesized by the conventional method with the following molar composition: 1 SiO2: 0.30 CTABr: NH3 11: 144 H2O. Then, 25% w/w cerium was incorporated into the MCM-41 using the wet impregnation process and the material obtained was activated by calcination. From the XRD patterns was confirmed the structure of the molecular sieve, and were identified the cerium oxide phases in its structure. The textural catalysts characteristics were investigated by isotherms of N2 adsorption/desorption (BET method). (author)

Imidazolium ionic liquids as solvents for cerium(IV)-mediated oxidation reactions

OpenAIRE

Mehdi, Hasan; Bodor, Andrea; Lantos, Diana; Horváth, István T; De Vos, Dirk; Binnemans, Koen

2007-01-01

Use of imidazolium ionic liquids as solvents for organic transformations with tetravalent cerium salts as oxidizing agents was evaluated. Good solubility was found for ammonium hexanitratocerate(IV) (ceric ammonium nitrate, CAN) and cerium(IV) triflate in 1-alkyl-3-methylimidazolium triflate ionic liquids. Oxidation of benzyl alcohol to benzaldehyde in 1-ethyl-3-methylimidazolium triflate was studied by in-situ FTIR spectroscopy and 13C NMR spectroscopy on carbon-13-labeled benzyl alcohol. Ca...

Procedure for the separation of cerium from rare earth phosphate mixtures

International Nuclear Information System (INIS)

Richter, H.; Grauss, H.; Schmitt, A.; Schade, H.; Lindeholz, M.; Lorenz, E.; Weickart, J.

1986-01-01

The invention is concerned with a procedure for the separation of cerium from rare earth concentrates originating from the partial neutralization of nitric crude phosphate decomposition solutions without preceding elimination of impurities from the raw material. The rare earth phosphates are treated with an excess of concentrated nitric acid through which the Ce 3+ , contained in the solution, is oxidized to Ce 4+ and precipitated as cerium(IV) phosphate by neutralization with alkalis

Synthesis and structure of cerium nitrosocarbonylcyanmethanid complex

International Nuclear Information System (INIS)

Gerasimenko, H.; Scopenko, V.V.; Kapshuk, A.A.

1998-01-01

Full text: The complex compound [CeL 4 Dy 2 ]Na*2Ac (where L- nitrosocarbonylcyanmethanid, Dy -- dipyridile, Ac - acetone) were synthesised by interaction of cerium chloride and sodium nitrosocarbonylcyanmethanid from acetone solution. After two hours of mixing the dipyridil solution in acetone was added for complex stabilization. After filtration solution was put to desiccator for crystallisation. The complex was studied using IR- and UV-spectroscopy. The structure of the complex was determined using X-ray structure analysis. It was found that the structure of the complex belongs to orthorhombic Pna2(1) syngony with the unit cell parameters 17.010, 16.280 and 16.340Angstroms, respectively. It was found that cerium in the compound was eight co-ordinated. Four nitroso ligands were co-ordinated by bidentate bridge method and two dipyridiles by bidentate-cycle method

Fixation of radioactive cerium-144 on white blood cells. Possibilities for use in physiopathology; Fixation du cerium radioactif ({sup 144}Ce) sur les globules blancs. Possibilites d'emploi en physiopathologie

Energy Technology Data Exchange (ETDEWEB)

Aeberhardt, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1958-07-01

From the study of the means of transport of cerium in the blood of various laboratory animals, after intra-venous injection of {sup 144}Ce-{sup 144}Pr without carrier, we have been able to show up the part played by the white cells in the transport of this fission product during its passage in the blood. This observation has led to the study, in vitro, of the methods of cerium fixation on the white cells, with a view to determining the possibilities of using this property for white cell labelling, the methods used up to the present not being entirely satisfactory. Using the method for the separation of the known constituents of the blood proposed by us in 1956, we have studied the cerium fixation under various conditions: - on suspensions of white cells from the rabbit, - on a suspension of human white cells, - on the white cells in whole from the rabbit. (author) [French] L'etude du mode de transport du cerium dans le sang chez differents animaux de laboratoire, apres injection intra-veineuse de {sup 144}Ce-{sup 144}Pr sans entraineur, nous a permis de mettre en evidence le rale des globules blancs dans le transport de ce produit de fission au cours de son passage dans le sang. Cette constatation nous a conduit a etudier, in vitro, les modalites de la fixation du cerium sur les globules blancs afin de preciser les possibilites d'utilisation de cette propriete pour le marquage des globules blancs, les methodes employees jusqu'ici ne donnant pas entiere satisfaction. Disposant de la methode de separation des elements figures du sang que nous avons proposee en 1956, nous avons etudie la fixation du cerium, dans diverses conditions: - sur des suspensions de globules blancs de lapin, - sur une suspension de globules blancs humains, - sur les globules blancs dans le sang total de lapin. (auteur)

Purification of cerium, neodymium and gadolinium for low background experiments

Directory of Open Access Journals (Sweden)

Boiko R.S.

2014-01-01

Full Text Available Cerium, neodymium and gadolinium contain double beta active isotopes. The most interesting are 150Nd and 160Gd (promising for 0ν2β search, 136Ce (2β+ candidate with one of the highest Q2β. The main problem of compounds containing lanthanide elements is their high radioactive contamination by uranium, radium, actinium and thorium. The new generation 2β experiments require development of methods for a deep purification of lanthanides from the radioactive elements. A combination of physical and chemical methods was applied to purify cerium, neodymium and gadolinium. Liquid-liquid extraction technique was used to remove traces of Th and U from neodymium, gadolinium and for purification of cerium from Th, U, Ra and K. Co-precipitation and recrystallization methods were utilized for further reduction of the impurities. The radioactive contamination of the samples before and after the purification was tested by using ultra-low-background HPGe gamma spectrometry. As a result of the purification procedure the radioactive contamination of gadolinium oxide (a similar purification efficiency was reached also with cerium and neodymium oxides was decreased from 0.12 Bq/kg to 0.007 Bq/kg in 228Th, from 0.04 Bq/kg to <0.006 Bq/kg in 226Ra, and from 0.9 Bq/kg to 0.04 Bq/kg in 40K. The purification methods are much less efficient for chemically very similar radioactive elements like actinium, lanthanum and lutetium.

Investigating the Influence of the Cerium loading in prepared Y zeolite from Iraqi kaolin on its Catalytic Performance

Directory of Open Access Journals (Sweden)

Karim Khalifa Esgair

2018-01-01

Full Text Available In this study, the effects of different loading doses of cerium in the prepared NaY zeolite from Iraqi kaolin were investigated. Al-Duara refinery atmospheric residue fluid catalytic cracking was selected as palpation reaction for testing the catalytic activity of cerium loading NaY zeolite. The insertion of cerium in NaY zeolites has been synthesized by simple ion exchange methods. Three samples of modified zeolite Y have been obtained by replacing the sodium ions in the original sample with cerium and the weight percent added are 0.35, 0.64, and 1.06 respectively. The effects of cerium loading to zeolite Y in different weight percent on the cracking catalysts were studied by employing a laboratory fluidized bed reactor. The experiments have been performed with weight hourly space velocity (WHSV range from 6 to 24 h-1, and the temperature range from 450 to 510 oC. The activity of the catalyst with 1.06 wt% cerium has been shown to be much greater than that of the sample parent NaY. Also it was observed that the addition of the cerium causes an increase in the thermal stability of the zeolite.

Synthesis of cerium oxide (CeO{sub 2}) nanoparticles using simple CO-precipitation method

Energy Technology Data Exchange (ETDEWEB)

Farahmandjou, M.; Zarinkamar, M.; Firoozabadi, T. P., E-mail: farahamndjou@iauvaramin.ac.ir [Islamis Azad University, Varamin-Phisva Branch, Department of Physics, Varamin (Iran, Islamic Republic of)

2016-11-01

Synthesis of cerium oxide (CeO{sub 2}) nanoparticles was studied by new and simple co-precipitation method. The cerium oxide nanoparticles were synthesized using cerium nitrate and potassium carbonate precursors. Their physicochemical properties were characterized by high resolution transmission electron microscopy (HRTEM), scanning electron microscopy (Sem), X-ray diffraction (XRD), energy dispersive spectroscopy (EDS), Fourier transform infrared spectroscopy (Ftir) and UV-Vis spectrophotometer. XRD pattern showed the cubic structure of the cerium oxide nanoparticles. The average particle size of CeO{sub 2} was around 20 nm as estimated by XRD technique and direct HRTEM observations. The surface morphological studies from Sem and Tem depicted spherical particles with formation of clusters. The sharp peaks in Ftir spectrum determined the existence of CeO{sub 2} stretching mode and the absorbance peak of UV-Vis spectrum showed the bandgap energy of 3.26 eV. (Author)

Direct growth of cerium oxide nanorods on diverse substrates for superhydrophobicity and corrosion resistance

Science.gov (United States)

Cho, Young Jun; Jang, Hanmin; Lee, Kwan-Soo; Kim, Dong Rip

2015-06-01

Superhydrophobic surfaces with anti-corrosion properties have attracted great interest in many industrial fields, particularly to enhance the thermal performance of offshore applications such as heat exchangers, pipelines, power plants, and platform structures. Nanostructures with hydrophobic materials have been widely utilized to realize superhydrophobicity of surfaces, and cerium oxide has been highlighted due to its good corrosion resistive and intrinsically hydrophobic properties. However, few studies of direct growth of cerium oxide nanostructures on diverse substrates have been reported. Herein we report a facile hydrothermal method to directly grow cerium oxide nanorods on diverse substrates, such as aluminum alloy, stainless steel, titanium, and silicon. Diverse substrates with cerium oxide nanorods exhibited superhydrophobicity with no hydrophobic modifiers on their surfaces, and showed good corrosion resistive properties in corrosive medium. We believe our method could pave the way for realization of scalable and sustainable corrosion resistive superhydrophobic surfaces in many industrial fields.

Study of the effect of cerium nitrate on AA2024-T3 by means of electrochemical micro-cell technique

International Nuclear Information System (INIS)

Paussa, L.; Andreatta, F.; Rosero Navarro, N.C.; Durán, A.; Fedrizzi, L.

2012-01-01

Highlights: ► We evaluate the cerium nitrate effect on the electrochemical behavior of AA2024-T3. ► We examine how AA2024-T3 microstructure affects cerium precipitation mechanism. ► The entire AA2024-T3 surface is involved in cerium precipitation. ► Anodic and cathodic inhibitions are both provided by cerium precipitation. ► Mg-rich intermetallics are preferential sites for cerium precipitation. - Abstract: This work evaluates the effect of cerium nitrate as corrosion inhibitor for AA2024-T3 in the view of its introduction in sol–gel coatings able to provide self-healing ability. Since it is well established that deposition of Ce species is activated by the local pH increase, the objective of this paper is to investigate the behavior of AA2024-T3 (open circuit potential and polarization curves) in the presence of Ce species in aggressive solutions by means of a local technique, the electrochemical micro-cell. This technique enables the investigation of small areas with resolution in the micrometer range by the use of glass capillaries to define the working electrode area. The micro-cell results clearly displayed that the entire AA2024-T3 area exposed to the cerium-containing electrolyte was involved in the cerium precipitation mechanism. The heterogeneous electrochemical behavior of the microstructure is minimized by the formation of a cerium-containing layer able to protect the metal substrate.

21 CFR 146.141 - Canned orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned orange juice. 146.141 Section 146.141 Food... Beverages § 146.141 Canned orange juice. (a) Canned orange juice is the food prepared from orange juice as specified in § 146.135 or frozen orange juice as specified in § 146.137, or a combination of both, to which...

Determination of trace amounts of cerium in silicate rocks based on its candoluminescence in a calcium oxide based matrix

International Nuclear Information System (INIS)

Belcher, R.; Nasser, T.A.K.; Polo-Diez, L.; Townshend, A.

1977-01-01

A very sensitive method for the determination of cerium (above 10 ng ml -1 ) has been developed (Belcher et al., Analyst;100:415(1975)), based on the measurement of the green candoluminescence produced by cerium in a calcium oxide-calcium sulphate matrix, with sulphuric acid as a coactivator, when the matrix is inserted into a hydrogen-nitrogen-air flame. This paper describes the application of this method to the determination of trace amounts of cerium in rocks. It involves the fusion of the sample with lithium metaborate, and does not require the isolation of cerium from other components of the rock, before measuring the candoluminescence intensity of the cerium. (author)

Methods study of homogeneity and stability test from cerium oxide CRM candidate

International Nuclear Information System (INIS)

Samin; Susanna TS

2016-01-01

The methods study of homogeneity and stability test from cerium oxide CRM candidate has been studied based on ISO 13258 and KAN DP. 01. 34. The purpose of this study was to select the test method homogeneity and stability tough on making CRM cerium oxide. Prepared 10 sub samples of cerium oxide randomly selected types of analytes which represent two compounds, namely CeO_2 and La_2O_3. At 10 sub sample is analyzed CeO_2 and La_2O_3 contents in duplicate with the same analytical methods, by the same analyst, and in the same laboratory. Data analysis results calculated statistically based on ISO 13528 and KAN DP.01.34. According to ISO 13528 Cerium Oxide samples said to be homogeneous if Ss ≤ 0.3 σ and is stable if | Xr – Yr | ≤ 0.3 σ. In this study, the data of homogeneity test obtained CeO_2 is Ss = 2.073 x 10-4 smaller than 0.3 σ (0.5476) and the stability test obtained | Xr - Yr | = 0.225 and the price is < 0.3 σ. Whereas for La_2O_3, the price for homogeneity test obtained Ss = 1.649 x 10-4 smaller than 0.3 σ (0.4865) and test the stability of the price obtained | Xr - Yr | = 0.2185 where the price is < 0.3 σ. Compared with the method from KAN, a sample of cerium oxide has also been homogenized for Fcalc < Ftable and stable, because | Xi - Xhm | < 0.3 x n IQR. Provided that the results of the evaluation homogeneity and stability test from CeO_2 CRM candidate test data were processed using statistical methods ISO 13528 is not significantly different with statistical methods from KAN DP.01.34, which together meet the requirements of a homogeneous and stable. So the test method homogeneity and stability test based on ISO 13528 can be used to make CRM cerium oxide. (author)

Phase segregation in cerium-lanthanum solid solutions

NARCIS (Netherlands)

Belliere, V.; Joorst, G; Stephan, O; de Groot, FMF; Weckhuysen, BM

2006-01-01

Electron energy-loss spectroscopy (EELS) in combination with scanning transmission electron microscopy ( STEM) reveals that the La enrichment at the surface of cerium-lanthanum solid solutions is an averaged effect and that segregation occurs in a mixed oxide phase. This separation occurs within a

Effect of cerium on structure modifications of a hybrid sol–gel coating, its mechanical properties and anti-corrosion behavior

International Nuclear Information System (INIS)

Cambon, Jean-Baptiste; Esteban, Julien; Ansart, Florence; Bonino, Jean-Pierre; Turq, Viviane; Santagneli, S.H.; Santilli, C.V.; Pulcinelli, S.H.

2012-01-01

Highlights: ► New sol–gel routes to replace chromates for corrosion protection of aluminum. ► Effect of cerium concentration on the microstructure of xerogel. ► Electrochemical and mechanical performances of hybrid coating with different cerium contents. ► Good correlation between the different results with an optimal cerium content of 0.01 M. -- Abstract: An organic–inorganic hybrid coating was developed to improve the corrosion resistance of the aluminum alloy AA 2024-T3. Organic and inorganic coatings derived from glycidoxypropyl-trimethoxysilane (GPTMS) and aluminum tri-sec-butoxide Al(O s Bu) 3 , with different cerium contents, were deposited onto aluminum by dip-coating process. Corrosion resistance and mechanical properties were investigated by electrochemical impedance measurements and nano-indentation respectively. An optimal cerium concentration of 0.01 M was evidenced. To correlate and explain the hybrid coating performances in relation to the cerium content, NMR experiments were performed. It has been shown that when the cerium concentration in the hybrid is higher than 0.01 M there are important modifications in the hybrid structure that account for the mechanical properties and anti-corrosion behavior of the sol–gel coating.

Dry sliding wear behaviour of Al-12Si-4Mg alloy with cerium addition

International Nuclear Information System (INIS)

Anasyida, A.S.; Daud, A.R.; Ghazali, M.J.

2010-01-01

The purpose of this work is to understand the effect of cerium addition on wear resistance behaviour of as-cast alloys. Al-12Si-4 Mg alloys with 1-5 wt% cerium addition were prepared using the casting technique. A sliding wear test was carried out under applied loads of 10 N, 30 N and 50 N at a fixed sliding speed of 1 m/s using a pin-on-disc configuration. The wear test was conducted in dry conditions at room temperature of ∼25 o C. Detailed analysis of the microstructure, worn surface, collected debris and microhardness was undertaken in order to investigate the differences between the as-cast alloys with different levels of cerium addition. The addition of 1-5 wt% cerium was found to lead to the precipitation of intermetallic phases (Al-Ce), resulting a needle-like structures. Increasing cerium content up to 2 wt% improved both wear resistance and microhardness of as-cast alloys. Addition of more than 2 wt% cerium, however, led to a decrease in microhardness, resulting in lower wear resistance of the alloys. Moderate wear was observed at all loads, with specific wear rates (K') ranging from 6.82 x 10 -5 with 2 wt% Ce at applied load of 50 N to 21.48 x 10 -5 mm 3 /N m without added Ce at an applied load of 10 N. Based on K' ranges, the as-cast alloys exhibited moderate wear regimes, and the mechanism of wear is a combination of abrasion and adhesion. Alloy containing 2 wt% Ce, with the highest hardness and lowest K' value, showed the greatest wear resistance.

Corrosion electrochemical behaviors of silane coating coated magnesium alloy in NaCl solution containing cerium nitrate

Energy Technology Data Exchange (ETDEWEB)

Luo, F.; Li, Q.; Zhong, X.K.; Gao, H.; Dai, Y.; Chen, F.N. [School of Chemistry and Chemical Engineering, Southwest University Chongqing (China)

2012-02-15

Sol-gel coatings cannot provide adequate corrosion protection for metal/alloys in the corrosive environments due to their high crack-forming potential. This paper demonstrates the possibility to employ cerium nitrate as inhibitor to decrease the corrosion development of sol-gel-based silane coating on the magnesium alloy in NaCl solution. Cerium nitrate was added into the NaCl solution where the silane coating coated magnesium alloy was immersed. Scanning electron microscopy (SEM) was used to examine surface morphology of the silane coating coated magnesium alloy immersed in NaCl solutions doped and undoped with cerium nitrate. The corrosion electrochemical behaviors were investigated using potentiodynamic polarization and electrochemical impedance spectroscopy (EIS) tests. The results showed that the introduction of cerium nitrate into NaCl solution could effectively inhibit the corrosion of the silane coating coated magnesium alloy. Moreover, the influence of concentration of cerium nitrate on the corrosion inhibition and the possible inhibiting mechanism were also discussed in detail. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Effect of cerium substitution on structural and magnetic properties of magnetite nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Padalia, Diwakar, E-mail: Padalia.diwakar@gmail.com [Department of Physics, G.B.Pant University of Agriculture & Technology, Pantnagar, Uttrakhand (India); Johri, U.C. [Department of Physics, G.B.Pant University of Agriculture & Technology, Pantnagar, Uttrakhand (India); Zaidi, M.G.H. [Supercritical Fluid Processing Laboratory, Department of Chemistry, G.B.Pant University of Agriculture & Technology, Pantnagar, Uttrakhand (India)

2016-02-01

The current work presents the synthesis and properties of cerium doped magnetite (Fe{sub 3}O{sub 4}) nanoparticles synthesized by standard chemical co-precipitation method using NH{sub 4}OH as co-precipitating agent. The effects of cerium ion substitution on structural and magnetic properties of magnetite (Fe{sub 3}O{sub 4}) nanoparticles were reported. These materials were characterized by X-ray powder diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and vibrating sample magnetometer (VSM). The cerium content has a significant influence on structural and magnetic properties. The X-ray diffraction study confirmed the formation of single-phase magnetite with space group Fd3m and crystallite size ranging from 39 to 58 nm. The addition of cerium resulted in a reduction of crystallite size and an increase of cell parameters. FTIR measurements confirmed the formation of different samples and suggested that the reduction of Fe{sup +3} to Fe{sup +2} preferred on a site adjacent to Ce{sup +4}. Magnetic measurements revealed that the saturation magnetization (Ms) and remanence (M{sub r}) decreased while the coercivity (H{sub C}) and squareness (M{sub r}/M{sub S}) increased with increasing cerium content. - Highlights: • There is an increase in cell parameters and strain with Ce-content. • Samples show the presence of secondary phase after 1.0% doping level. • Ce-ions prefer octahedral sites and charge neutrality is accompanied by Fe{sup +3} → Fe{sup +2}. • Magnetization decreases due to weakening of the super exchange interactions. • Squareness and coercivity start to increase with Ce content.

Effect of calcination temperature on the crystallite growth of cerium oxide nano-powders prepared by the co-precipitation process

Energy Technology Data Exchange (ETDEWEB)

Chen, Jian-Chih [Department of Orthopaedics, Kaohsiung Medical University Hospital, Kaohsiung 807, Taiwan (China); Chen, Wen-Cheng [School of Dentistry, College of Dental Medicine, Kaohsiung Medical University, Kaohsiung 807, Taiwan (China); Tien, Yin-Chun [Department of Orthopaedics, Kaohsiung Medical University Hospital, Kaohsiung 807, Taiwan (China); Shih, Chi-Jen, E-mail: cjshih@kmu.edu.t [Department of Fragrance and Cosmetics Science, Kaohsiung Medical University, 100 Shi-Chuan1st Road, Kaohsiung 80708, Taiwan (China)

2010-04-30

Cerium oxide nanocrystallites were synthesized by a co-precipitation process at a relatively low temperature, using cerium (III) nitrate as the starting material in a water solution with pH in the range of 8-9. The effect of calcination temperature on the crystallite growth of cerium oxide nano-powders was investigated by X-ray diffraction, transmission electron microscopy and electron diffraction. The crystallization temperature of the cerium oxide powders was estimated to be about 273 K, by XRD analysis. When calcined at temperatures from 473 to 1273 K, face-centered cubic phase crystallization was observed by XRD. The crystallite size of the cerium oxide increased from 12.0 to 48 nm as the calcining temperature increased from 473 to 1273 K, in the pH range 8-9. The activation energy for the growth of cerium oxide nanoparticles was found to have very low values of 17.5 kJ/mol for pH = 8 and 16.0 kJ/mol for pH = 9.

19 CFR 146.26 - System review.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false System review. 146.26 Section 146.26 Customs... (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.26 System review. The operator shall perform an annual internal review of the inventory control and recordkeeping system and...

22 CFR 146.525 - Fringe benefits.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 146.525 Section 146.525... Employment in Education Programs or Activities Prohibited § 146.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital...

Mesoporous cerium oxide nanospheres for the visible-light driven photocatalytic degradation of dyes

Directory of Open Access Journals (Sweden)

Subas K. Muduli

2014-04-01

Full Text Available A facile, solvothermal synthesis of mesoporous cerium oxide nanospheres is reported for the purpose of the photocatalytic degradation of organic dyes and future applications in sustainable energy research. The earth-abundant, relatively affordable, mixed valence cerium oxide sample, which consists of predominantly Ce7O12, has been characterized by powder X-ray diffraction, X-ray photoelectron and UV–vis spectroscopy, and transmission electron microscopy. Together with N2 sorption experiments, the data confirms that the new cerium oxide material is mesoporous and absorbs visible light. The photocatalytic degradation of rhodamin B is investigated with a series of radical scavengers, suggesting that the mechanism of photocatalytic activity under visible-light irradiation involves predominantly hydroxyl radicals as the active species.

Assessement of the effect of Pyrimetin in combined injury with external irradiation and oral cerium-144 incorporation

International Nuclear Information System (INIS)

Kiradzhiev, G.; Khadzhidekova, E.

1985-01-01

The effect of the preparation Pyrimetin on rats, subjected to external irradiation combined with oral cerium 144 incorporation was studied. LD 50/30 of cerium-144 was used as biological criterion. It was shown that by this criterion Pyrimetin essentially abolished the potentiated by external radiation effect of cerium. Probably, the preparation leads to normalization of the gastro-intestinal motor function and the dose loading of the colon

Obtainment of cerium dioxide for use as spectrochemical standard. Obtencao de dioxido de cerio para uso como padrao espectroquimico

Energy Technology Data Exchange (ETDEWEB)

Silva Queiroz, C.A. da; Hespanhol, E C.B.; Abrao, A [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

1992-01-01

This paper describes a simple method for cerium separation and purification. Cerium is previously precipitated with N H{sub 3}/air/H{sub 2} O{sub 2} system in a mixed chlorides solution obtained from Brazilian monazite treatment. The cerium fraction as cerium chloride is run down throughout a strong cationic resin bed and then the rare earth impurities separation is done by elution of the resin with separation ammonium salt of EDTA. None retainer ion is used in the purification technique by ion exchange. (author).

21 CFR 146.140 - Pasteurized orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized orange juice. 146.140 Section 146.140... and Beverages § 146.140 Pasteurized orange juice. (a) Pasteurized orange juice is the food prepared from unfermented juice obtained from mature oranges as specified in § 146.135, to which may be added...

First heats of cerium solution in liquid aluminium, gallium, indium, tin, lead and bismuth

International Nuclear Information System (INIS)

Yamshchikov, L.F.; Lebedev, V.A.; Nichkov, I.F.; Raspopin, S.P.; Shein, V.G.

1983-01-01

Cerium solution heats in liquid alluminium, gallium, indium, tin, lead and bismuth are determined in high temperature mixing calorimeter with an isothermal shell. The statistical analysis carried out proves that values of cerium solution heat in fusible metals obtained by the methods of electric motive forces and calorimety give a satisfactory agreement

19 CFR 146.3 - Customs supervision.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs supervision. 146.3 Section 146.3 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.3 Customs supervision. (a) Assignment of Customs officers. Customs officers will be...

Decontamination of alpha contaminated metallic waste by cerium IV redox process

International Nuclear Information System (INIS)

Shah, J.G.; Dhami, P.S.; Gandhi, P.M.; Wattal, P.K.

2012-01-01

Decontamination of alpha contaminated metallic waste is an important aspect in the management of waste generated during dismantling and decommissioning of nuclear facilities. Present work on cerium redox process targets decontamination of alpha contaminated metallic waste till it qualifies for the non alpha waste category for disposal in near surface disposal facility. Recovery of the alpha radio nuclides and cerium from aqueous secondary waste streams was also studied deploying solvent extraction process and established. The alpha-lean secondary waste stream has been immobilised in cement based matrix for final disposal. (author)

LUMINESCENT PROPERTIES OF SILICATE GLASSES WITH CERIUM IONS AND ANTIMONY

Directory of Open Access Journals (Sweden)

A. M. Klykova

2014-05-01

Full Text Available The paper deals with the results of an experimental study of luminescence excitation spectra and luminescence of silicate glasses containing cerium ions and antimony. The aim of this work was to study the features of the luminescence and the effect of UV irradiation and heat treatment on luminescence and the state of cerium ions and antimony in glass. We investigated glass system Na2O-ZnO-Al2O3-SiO2-NaF-NaBr with additives CeO2 and Sb2O3. Synthesis was carried out in platinum crucibles in the air at 14500C. The samples were polished glass plates with a thickness of 0.5-1 mm. UV irradiation was carried out with a mercury lamp having a wide range of radiation in the spectral range 240-390 nm. It was conducted in a Nabertherm muffle furnaces. Luminescence spectra and excitation spectra were measured using a spectrofluorimeter MPF-44A (PerkinElmer at the room temperature. Measured luminescence spectra were corrected in view of the spectral sensitivity of the photodetector for spectrofluorimeter. Adjustment of the excitation spectra for the spectral dependence of the intensity of the excitation source was not carried out. During the experiments it was found that in silicate glasses Sb3+ ions can exist in two energy states, which corresponds to a different environment with oxygen ions. Heat treatment of these glasses in an oxidizing atmosphere leads to an increase in ion concentration of Sb3+ ions with a greater amount of oxygen in the environment. In glasses containing antimony and cerium ions, ultraviolet irradiation causes a change in the valence of cerium ions and antimony, which is accompanied by luminescence quenching. Subsequent heat treatment of glass leads to the inverse processes and restore luminescence excitation spectra. The study of fluorescent properties of silicate glasses with cerium and antimony ions led to the conclusion of the practical significance of this work. Promising multifunctional materials can be created on the basis of

21 CFR 146.137 - Frozen orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen orange juice. 146.137 Section 146.137 Food... Beverages § 146.137 Frozen orange juice. (a) Frozen orange juice is orange juice as defined in § 146.135, except that it is frozen. (b) The name of the food is “Frozen orange juice”. Such name may be preceded on...

Enhanced hot ductility of a Cr–Mo low alloy steel by rare earth cerium

International Nuclear Information System (INIS)

Jiang, X.; Song, S.-H.

2014-01-01

The hot ductility of a 1Cr–0.5Mo low alloy steel is investigated over a temperature range of 700–1050 °C using a Gleeble thermomechanical simulator in conjunction with various characterization techniques. The steel samples undoped and doped with cerium are heated at 1300 °C for 3 min and then cooled with a rate of 5 K s −1 down to different test temperatures, followed by tensile deformation until fracture. The results show that the hot ductility of the steel, evaluated by the reduction in area, can be substantially enhanced by a minor addition of cerium, especially in the range 800–1000 °C. In the austenite–ferrite dual-phase region, cerium may delay the formation of proeutectoid ferrite layers along austenite grain boundaries, thereby increasing the hot ductility of the steel. In the single austenite region, grain boundary segregation of cerium may increase the grain boundary cohesion, toughening the steel and thus raising the resistance to grain boundary sliding as well as promoting dynamic recrystallization. Consequently, the hot ductility of the steel is enhanced

21 CFR 146.145 - Orange juice from concentrate.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice from concentrate. 146.145 Section 146... Juices and Beverages § 146.145 Orange juice from concentrate. (a) Orange juice from concentrate is the food prepared by mixing water with frozen concentrated orange juice as defined in § 146.146 or with...

Contribution to research on the metabolism of fission product. Studies on the physico-chemical state and the metabolic fate of radio-cerium solution

International Nuclear Information System (INIS)

Aeberhardt, A.

1961-01-01

This paper describes a study of the physico-chemical state of radio-cerium in dilute solutions on the tracer scale, as a function of the pH of the solution. The way in which this radioelement is transported in the blood is studied in vitro and in vivo, with reference to the ionic or colloidal state of the radio-cerium used. The distribution of cerium amongst the various components of the blood is studied by a new method of blood fractionation and by paper electrophoresis. Evidence of a cerium globulin connection is shown in the case of ionic cerium. A study of the initial distribution of radio-cerium in rats, after intravenous administration of ionic or colloidal solutions, shows considerable differences according to the physico-chemical state of the cerium injected. (author) [fr

The effects of cerium doping on the size, morphology, and optical properties of α-hematite nanoparticles for ultraviolet filtration

Energy Technology Data Exchange (ETDEWEB)

Cardillo, Dean [Institute for Superconducting and Electronic Materials, AIIM Facility, University of Wollongong Innovation Campus, Squires Way, North Wollongong, NSW 2500 (Australia); Konstantinov, Konstantin, E-mail: konstan@uow.edu.au [Institute for Superconducting and Electronic Materials, AIIM Facility, University of Wollongong Innovation Campus, Squires Way, North Wollongong, NSW 2500 (Australia); Devers, Thierry [Centre de Recherche sur la Matière Divisée, Institut de Physique, site de Chartres, Université d’Orléans (France)

2013-11-15

Highlights: • Possible application of cerium-doped α-hematite as ultraviolet filter. • Nanoparticles obtained through co-precipitation technique using various cerium doping levels followed by annealing. • Comprehensive materials characterisation utilizing XRD, DSC/TGA, STEM, UV–vis spectroscopy. • Increasing cerium content reduces particle sizing and alters morphology. • Solubility of cerium in hematite seen between 5 and 10% doping, 10% cerium doping greatly enhances attenuation in ultraviolet region and increases optical bandgap. - Abstract: Metal oxide nanoparticles have potential use in energy storage, electrode materials, as catalysts and in the emerging field of nanomedicine. Being able to accurately tailor the desirable properties of these nanoceramic materials, such as particle size, morphology and optical bandgap (E{sub g}) is integral in the feasibility of their use. In this study we investigate the altering of both the structure and physical properties through the doping of hematite (α-Fe{sub 2}O{sub 3}) nanocrystals with cerium at a range of concentrations, synthesised using a one-pot co-precipitation method. This extremely simple synthesis followed by thermal treatment results in stable Fe{sub 2−x}Ce{sub x}O{sub y} nanoceramics resulting from the burning of any unreacted precursors and transformation of goethite-cerium doped nanoparticle intermediate. The inclusion of Ce into the crystal lattice of these α-Fe{sub 2}O{sub 3} nanoparticles causes a significantly large reduction in mean crystalline size and alteration in particle morphology with increasing cerium content. Finally we report an increase optical semiconductor bandgap, along with a substantial increase in the ultraviolet attenuation found for a 10% Ce-doping concentration which shows the potential application of cerium-doped hematite nanocrystals to be used as a pigmented ultraviolet filter for cosmetic products.

Ceria nanoparticles vis-à-vis cerium nitrate as corrosion inhibitors for silica-alumina hybrid sol-gel coating

Energy Technology Data Exchange (ETDEWEB)

Lakshmi, R.V. [Surface Engineering Division, Council of Scientific and Industrial Research – National Aerospace Laboratories, HAL Airport Road, Kodihalli, Bengaluru 560017 (India); Aruna, S.T., E-mail: staruna194@gmail.com [Surface Engineering Division, Council of Scientific and Industrial Research – National Aerospace Laboratories, HAL Airport Road, Kodihalli, Bengaluru 560017 (India); Sampath, S. [Department of Inorganic and Physical Chemistry, Indian Institute of Science, Bengaluru 560012 (India)

2017-01-30

Highlights: • Corrosion protection efficiency comparison of ceria nanoparticles and cerium nitrate. • Silica-alumina hybrid coating exhibited good barrier protection. • Detailed XPS study confirm the hybrid structure and presence of Ce species in coating. • Loss of cerium ions not prevalent in ceria doped coating unlike that of cerium nitrate. • Ceria increased the coating integrity, corrosion inhibition and barrier protection. - Abstract: The present work provides a comparative study on the corrosion protection efficiency of defect free sol-gel hybrid coating containing ceria nanoparticles and cerium nitrate ions as corrosion inhibitors. Less explored organically modified alumina-silica hybrid sol-gel coatings are synthesized from 3-glycidoxypropyltrimethoxysilane and aluminium-tri-sec-butoxide. The microemulsion derived nanoparticles and the hybrid coatings are characterized and compared with coatings containing cerium nitrate. Corrosion inhibiting capability is assessed using electrochemical impedance spectroscopy. Scanning Kelvin probe measurements are also conducted on the coatings for identifying the apparent corrosion prone regions. Detailed X-ray photoelectron spectroscopy (XPS) analysis is carried out to comprehend the bonding and corrosion protection rendered by the hybrid coatings.

Effects of uncoated and citric acid coated cerium oxide nanoparticles, bulk cerium oxide, cerium acetate, and citric acid on tomato plants

International Nuclear Information System (INIS)

Barrios, Ana Cecilia; Rico, Cyren M.; Trujillo-Reyes, Jesica; Medina-Velo, Illya A.; Peralta-Videa, Jose R.; Gardea-Torresdey, Jorge L.

2016-01-01

Little is known about the physiological and biochemical responses of plants exposed to surface modified nanomaterials. In this study, tomato (Solanum lycopersicum L.) plants were cultivated for 210 days in potting soil amended with uncoated and citric acid coated cerium oxide nanoparticles (nCeO_2, CA + nCeO_2) bulk cerium oxide (bCeO_2), and cerium acetate (CeAc). Millipore water (MPW), and citric acid (CA) were used as controls. Physiological and biochemical parameters were measured. At 500 mg/kg, both the uncoated and CA + nCeO_2 increased shoot length by ~ 9 and ~ 13%, respectively, while bCeO_2 and CeAc decreased shoot length by ~ 48 and ~ 26%, respectively, compared with MPW (p ≤ 0.05). Total chlorophyll, chlo-a, and chlo-b were significantly increased by CA + nCeO_2 at 250 mg/kg, but reduced by bCeO_2 at 62.5 mg/kg, compared with MPW. At 250 and 500 mg/kg, nCeO_2 increased Ce in roots by 10 and 7 times, compared to CA + nCeO_2, but none of the treatments affected the Ce concentration in above ground tissues. Neither nCeO_2 nor CA + nCeO_2 affected the homeostasis of nutrient elements in roots, stems, and leaves or catalase and ascorbate peroxidase in leaves. CeAc at 62.5 and 125 mg/kg increased B (81%) and Fe (174%) in roots, while at 250 and 500 mg/kg, increased Ca in stems (84% and 86%, respectively). On the other hand, bCeO_2 at 62.5 increased Zn (152%) but reduced P (80%) in stems. Only nCeO_2 at 62.5 mg/kg produced higher total number of tomatoes, compared with control and the rest of the treatments. The surface coating reduced Ce uptake by roots but did not affect its translocation to the aboveground organs. In addition, there was no clear effect of surface coating on fruit production. To our knowledge, this is the first study comparing the effects of coated and uncoated nCeO_2 on tomato plants. - Highlights: • At 500 mg/kg, coated and bare NPs increased stem length by 13 and 9%, respectively. • Coated NPs at 500 mg/kg increased CAT activity in

Effects of uncoated and citric acid coated cerium oxide nanoparticles, bulk cerium oxide, cerium acetate, and citric acid on tomato plants

Energy Technology Data Exchange (ETDEWEB)

Barrios, Ana Cecilia [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); Rico, Cyren M. [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Trujillo-Reyes, Jesica [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); Medina-Velo, Illya A. [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Peralta-Videa, Jose R. [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); Environmental Science and Engineering Ph.D. Program, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Gardea-Torresdey, Jorge L., E-mail: jgardea@utep.edu [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); Environmental Science and Engineering Ph.D. Program, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States)

2016-09-01

Little is known about the physiological and biochemical responses of plants exposed to surface modified nanomaterials. In this study, tomato (Solanum lycopersicum L.) plants were cultivated for 210 days in potting soil amended with uncoated and citric acid coated cerium oxide nanoparticles (nCeO{sub 2}, CA + nCeO{sub 2}) bulk cerium oxide (bCeO{sub 2}), and cerium acetate (CeAc). Millipore water (MPW), and citric acid (CA) were used as controls. Physiological and biochemical parameters were measured. At 500 mg/kg, both the uncoated and CA + nCeO{sub 2} increased shoot length by ~ 9 and ~ 13%, respectively, while bCeO{sub 2} and CeAc decreased shoot length by ~ 48 and ~ 26%, respectively, compared with MPW (p ≤ 0.05). Total chlorophyll, chlo-a, and chlo-b were significantly increased by CA + nCeO{sub 2} at 250 mg/kg, but reduced by bCeO{sub 2} at 62.5 mg/kg, compared with MPW. At 250 and 500 mg/kg, nCeO{sub 2} increased Ce in roots by 10 and 7 times, compared to CA + nCeO{sub 2}, but none of the treatments affected the Ce concentration in above ground tissues. Neither nCeO{sub 2} nor CA + nCeO{sub 2} affected the homeostasis of nutrient elements in roots, stems, and leaves or catalase and ascorbate peroxidase in leaves. CeAc at 62.5 and 125 mg/kg increased B (81%) and Fe (174%) in roots, while at 250 and 500 mg/kg, increased Ca in stems (84% and 86%, respectively). On the other hand, bCeO{sub 2} at 62.5 increased Zn (152%) but reduced P (80%) in stems. Only nCeO{sub 2} at 62.5 mg/kg produced higher total number of tomatoes, compared with control and the rest of the treatments. The surface coating reduced Ce uptake by roots but did not affect its translocation to the aboveground organs. In addition, there was no clear effect of surface coating on fruit production. To our knowledge, this is the first study comparing the effects of coated and uncoated nCeO{sub 2} on tomato plants. - Highlights: • At 500 mg/kg, coated and bare NPs increased stem length by 13 and 9

Jet formation in cerium metal to examine material strength

Energy Technology Data Exchange (ETDEWEB)

Jensen, B. J., E-mail: bjjensen@lanl.gov; Cherne, F. J.; Prime, M. B.; Yeager, J. D.; Ramos, K. J.; Hooks, D. E.; Cooley, J. C.; Dimonte, G. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Fezzaa, K. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Iverson, A. J.; Carlson, C. A. [National Security Technologies LLC, Los Alamos, New Mexico 87544 (United States)

2015-11-21

Examining the evolution of material properties at extreme conditions advances our understanding of numerous high-pressure phenomena from natural events like meteorite impacts to general solid mechanics and fluid flow behavior. Recent advances in synchrotron diagnostics coupled with dynamic compression platforms have introduced new possibilities for examining in-situ, spatially resolved material response with nanosecond time resolution. In this work, we examined jet formation from a Richtmyer-Meshkov instability in cerium initially shocked into a transient, high-pressure phase, and then released to a low-pressure, higher-temperature state. Cerium's rich phase diagram allows us to study the yield stress following a shock induced solid-solid phase transition. X-ray imaging was used to obtain images of jet formation and evolution with 2–3 μm spatial resolution. From these images, an analytic method was used to estimate the post-shock yield stress, and these results were compared to continuum calculations that incorporated an experimentally validated equation-of-state (EOS) for cerium coupled with a deviatoric strength model. Reasonable agreement was observed between the calculations and the data illustrating the sensitivity of jet formation on the yield stress values. The data and analysis shown here provide insight into material strength during dynamic loading which is expected to aid in the development of strength aware multi-phase EOS required to predict the response of matter at extreme conditions.

Investigation of cerium salt/sulfuric acid anodizing technology for 1420 aluminum alloy

Energy Technology Data Exchange (ETDEWEB)

Di Li; Yue Peng Deng; Bao Lan Guo; Guo Qiang Li [Beijing Univ. of Aeronautics and Astronautics (China). Dept. of Mater. Sci. and Eng.

2000-07-01

In this paper, the effect of cerium addition agent on the property of anodized coating of 1420 Al alloy has been studied by corrosion experiment (immersion test and neutral salt spray test), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and measurement of polarization curves. The result show that only pitting could be observed in all corrosion tests while intergranular corrosion and exfoliation corrosion did not appear on 1420 Al-Li alloys. When organic carboxylic acid S or the cerium (IV) salt was added into sulfuric acid anodizing electrolyte separately, there was no significant improvement in corrosion resistance of anodized film. However, in the case of adding them into sulfuric acid anodizing electrolyte together, the corrosion resistance of anodized film increased greatly owing to synergistic effect. The synergistic effect may relate to the formation of cerium-organic carboxylic acid S complex compound and its effects on film growth and film structure. (orig.)

Charge transfer cross sections for dysprosium and cerium

Energy Technology Data Exchange (ETDEWEB)

Adachi, Hajime; Tamura, Koji; Okazaki, Tetsuji; Shibata, Takemasa [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

1998-06-01

Symmetric resonant charge transfer cross sections between singly ionized ions and the parent atoms were measured for dysprosium and cerium in the impact energy of 200-2000eV. The cross sections were determined from the ratio between the number of ions produced by charge transfer and those in primary ion beam. The primary ion beam was produced by a laser ion source in which their atoms were ionized by laser resonant photo-ionization. The slow ions produced by charge transfer and fast primary ions were detected with Faraday cups. The obtained cross sections were (1.82{+-}0.14) x 10{sup -14} cm{sup 2} for dysprosium and (0.88{+-}0.12) x 10{sup -14} cm{sup 2} for cerium in the above energy range. The difference of these values can mostly be explained by considering the electron configurations of these atoms and ions. (author)

Charge transfer cross sections for dysprosium and cerium

International Nuclear Information System (INIS)

Adachi, Hajime; Tamura, Koji; Okazaki, Tetsuji; Shibata, Takemasa

1998-06-01

Symmetric resonant charge transfer cross sections between singly ionized ions and the parent atoms were measured for dysprosium and cerium in the impact energy of 200-2000eV. The cross sections were determined from the ratio between the number of ions produced by charge transfer and those in primary ion beam. The primary ion beam was produced by a laser ion source in which their atoms were ionized by laser resonant photo-ionization. The slow ions produced by charge transfer and fast primary ions were detected with Faraday cups. The obtained cross sections were (1.82±0.14) x 10 -14 cm 2 for dysprosium and (0.88±0.12) x 10 -14 cm 2 for cerium in the above energy range. The difference of these values can mostly be explained by considering the electron configurations of these atoms and ions. (author)

Exposure, Health and Ecological Effects Review of Engineered Nanoscale Cerium and Cerium Oxide Associated with its Use as a Fuel Additive

Science.gov (United States)

Advances of nanoscale science have produced nanomaterials with unique physical and chemical properties at commercial levels which are now incorporated into over 1000 products. Nanoscale cerium (di) oxide (CeO(2)) has recently gained a wide range of applications which includes coa...

76 FR 31459 - Airworthiness Directives; BAE SYSTEMS (OPERATIONS) LIMITED Model BAe 146 and Avro 146-RJ Airplanes

Science.gov (United States)

2011-06-01

... crack was present at the time of the embodiment of M-D SB 146-32-150, Part B or Part C, it could... inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB) SB.146-32-150. Later, as part of an... optional closing action of EASA AD 2010-0001-E is embodiment of M-D SB 146-32-150 (polishing and shot...

Thermometric titrimetry Studies of the cerium(IV) oxidation of alpha-mercaptocarboxylic acids.

Science.gov (United States)

Alexander, W A; Mash, C J; McAuley, A

1969-04-01

The cerium(IV) oxidation of thioglycollic, thiolactic and thiomalic acids has been examined by thermometric titration. The titration curves indicate stoichiometries of more than 1 mole of cerium(IV) per mole of alpha-thiol, suggesting possible side-reactions. In the presence of methyl acrylate, however, the expected ratio is observed. The overall heat of each reaction has been derived. Only with a titration method of this kind where allowance can be made for side-reactions can the heats of reaction for these systems be measured.

Fabrication of mesoporous cerium dioxide films by cathodic electrodeposition.

Science.gov (United States)

Kim, Young-Soo; Lee, Jin-Kyu; Ahn, Jae-Hoon; Park, Eun-Kyung; Kim, Gil-Pyo; Baeck, Sung-Hyeon

2007-11-01

Mesoporous cerium dioxide (Ceria, CeO2) thin films have been successfully electrodeposited onto ITO-coated glass substrates from an aqueous solution of cerium nitrate using CTAB (Cetyltrimethylammonium Bromide) as a templating agent. The synthesized films underwent detailed characterizations. The crystallinity of synthesized CeO2 film was confirmed by XRD analysis and HR-TEM analysis, and surface morphology was investigated by SEM analysis. The presence of mesoporosity in fabricated films was confirmed by TEM and small angle X-ray analysis. As-synthesized film was observed from XRD analysis and HR-TEM image to have well-crystallized structure of cubic phase CeO2. Transmission electron microscopy and small angle X-ray analysis revealed the presence of uniform mesoporosity with a well-ordered lamellar phase in the CeO2 films electrodeposited with CTAB templating.

Catalysts with Cerium in a Membrane Reactor for the Removal of Formaldehyde Pollutant from Water Effluents

Directory of Open Access Journals (Sweden)

Mirella Gutiérrez-Arzaluz

2016-05-01

Full Text Available We report the synthesis of cerium oxide, cobalt oxide, mixed cerium, and cobalt oxides and a Ce–Co/Al2O3 membrane, which are employed as catalysts for the catalytic wet oxidation (CWO reaction process and the removal of formaldehyde from industrial effluents. Formaldehyde is present in numerous waste streams from the chemical industry in a concentration low enough to make its recovery not economically justified but high enough to create an environmental hazard. Common biological degradation methods do not work for formaldehyde, a highly toxic but refractory, low biodegradability substance. The CWO reaction is a recent, promising alternative that also permits much lower temperature and pressure conditions than other oxidation processes, resulting in economic benefits. The CWO reaction employing Ce- and Co-containing catalysts was carried out inside a slurry batch reactor and a membrane reactor. Experimental results are reported. Next, a mixed Ce–Co oxide film was supported on an γ-alumina membrane used in a catalytic membrane reactor to compare formaldehyde removal between both types of systems. Catalytic materials with cerium and with a relatively large amount of cerium favored the transformation of formaldehyde. Cerium was present as cerianite in the catalytic materials, as indicated by X-ray diffraction patterns.

42 CFR 410.146 - Diabetes outcome measurements.

Science.gov (United States)

2010-10-01

... 42 Public Health 2 2010-10-01 2010-10-01 false Diabetes outcome measurements. 410.146 Section 410.146 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Training and Diabetes Outcome Measurements § 410.146 Diabetes outcome measurements. (a) Information...

Exposure of cerium oxide nanoparticles to kidney bean shows disturbance in the plant defense mechanisms

Energy Technology Data Exchange (ETDEWEB)

Majumdar, Sanghamitra [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Peralta-Videa, Jose R. [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Bandyopadhyay, Susmita [Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Castillo-Michel, Hiram [European Synchrotron Radiation Facility, B.P. 220-38043 Grenoble, Cedex (France); Hernandez-Viezcas, Jose-Angel [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Sahi, Shivendra [Department of Biology, Western Kentucky University, Bowling Green, KY 42101 (United States); Gardea-Torresdey, Jorge L., E-mail: jgardea@utep.edu [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States)

2014-08-15

Graphical abstract: - Highlights: • Kidney bean roots uptake nCeO{sub 2} primarily without biotransformation. • Cerium reached the root vascular tissues through gaps in the Casparian strip. • On longer exposure to high concentration, roots demonstrate stress response. • In leaves, guaiacol peroxidase plays a major role in ROS scavenging. - Abstract: Overwhelming use of engineered nanoparticles demands rapid assessment of their environmental impacts. The transport of cerium oxide nanoparticles (nCeO{sub 2}) in plants and their impact on cellular homeostasis as a function of exposure duration is not well understood. In this study, kidney bean plants were exposed to suspensions of ∼8 ± 1 nm nCeO{sub 2} (62.5 to 500 mg/L) for 15 days in hydroponic conditions. Plant parts were analyzed for cerium accumulation after one, seven, and 15 days of nCeO{sub 2} exposure. The primary indicators of stress like lipid peroxidation, antioxidant enzyme activities, total soluble protein and chlorophyll contents were studied. Cerium in tissues was localized using scanning electron microscopy and synchrotron μ-XRF mapping, and the chemical forms were identified using μ-XANES. In the root epidermis, cerium was primarily shown to exist as nCeO{sub 2}, although a small fraction (12%) was biotransformed to Ce(III) compound. Cerium was found to reach the root vascular tissues and translocate to aerial parts with time. Upon prolonged exposure to 500 mg nCeO{sub 2}/L, the root antioxidant enzyme activities were significantly reduced, simultaneously increasing the root soluble protein by 204%. In addition, leaf's guaiacol peroxidase activity was enhanced with nCeO{sub 2} exposure in order to maintain cellular homeostasis.

Cerium, uranium, and plutonium behavior in glass-bonded sodalite, a ceramic nuclear waste form

International Nuclear Information System (INIS)

Lewis, M. A.; Lexa, D.; Morss, L. R.; Richmann, M. K.

1999-01-01

Glass-bonded sodalite is being developed as a ceramic waste form (CWF) to immobilize radioactive fission products, actinides, and salt residues from electrometallurgical treatment of spent nuclear reactor fuel. The CWF consists of about 75 mass % sodalite, 25 mass % glass, and small amounts of other phases. This paper presents some results and interpretation of physical measurements to characterize the CWF structure, and dissolution tests to measure the release of matrix components and radionuclides from the waste form. Tests have been carried out with specimens of the CWF that contain rare earths at concentrations similar to those expected in the waste form. Parallel tests have been carried out on specimens that have uranium or plutonium as well as the rare earths at concentrations similar to those expected in the waste forms; in these specimens UCl 3 forms UO 2 and PuCl 3 forms PuO 2 . The normalized releases of rare earths in dissolution tests were found to be much lower than those of matrix elements (B, Si, Al, Na). When there is no uranium in the CWF, the release of cerium is two to ten times lower than the release of the other rare earths. The low release of cerium may be due to its tetravalent state in uranium-free CWF. However, when there is uranium in the CWF, the release of cerium is similar to that of the other rare earths. This trivalent behavior of cerium is attributed to charge transfer or covalent interactions among cerium, uranium, and oxygen in (U,Ce)O 2

21 CFR 146.150 - Canned concentrated orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned concentrated orange juice. 146.150 Section... Fruit Juices and Beverages § 146.150 Canned concentrated orange juice. (a) Canned concentrated orange... labeling of ingredients prescribed for frozen concentrated orange juice by § 146.146, except that it is not...

Synthesis and characterization of platinum supported on alumina doped with cerium catalyst

International Nuclear Information System (INIS)

Yusof Abdullah; Abd Fatah Awang Mat; Mohd Ali Sufi; Sarimah Mahat; Razali Kassim; Nurhaslinda Abdullah.

1996-03-01

The synthesis and characterization of gamma-alumina doped with cerium as platinum support for the automobile exhaust catalyst are described. Platinum/alumina/ceria catalyst were prepared by impregnation of hexachloroplatinic acid and sintered at 500 degree Celsius to obtain metal dispersions of 1.0 wt%. Catalyst distribution inside the powder and the effects of the addition of cerium to alumina were analyzed by the scanning electron microscopy (SEM) and x-ray fluorescence spectroscopy (XRF). The results showed that the alumina - supported catalysts contained well dispersion of the noble metal

Cerium fluoride nanoparticles protect cells against oxidative stress

International Nuclear Information System (INIS)

Shcherbakov, Alexander B.; Zholobak, Nadezhda M.; Baranchikov, Alexander E.; Ryabova, Anastasia V.; Ivanov, Vladimir K.

2015-01-01

A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF 3 :Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF 3 nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. - Highlights: • Facile method of CeF 3 and CeF 3 :Tb stable aqueous sols synthesis is proposed. • Naked CeF 3 nanoparticles are shown to be non-toxic and to protect cells from the action of H 2 O 2 . • CeF 3 and CeF 3 :Tb nanoparticles are shown to protect living cells against the vesicular stomatitis virus

Cerium fluoride nanoparticles protect cells against oxidative stress

Energy Technology Data Exchange (ETDEWEB)

Shcherbakov, Alexander B.; Zholobak, Nadezhda M. [Zabolotny Institute of Microbiology and Virology, National Academy of Sciences of Ukraine, Kyiv D0368 (Ukraine); Baranchikov, Alexander E. [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); Ryabova, Anastasia V. [Prokhorov General Physics Institute of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow 115409 (Russian Federation); Ivanov, Vladimir K., E-mail: van@igic.ras.ru [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Tomsk State University, Tomsk 634050 (Russian Federation)

2015-05-01

A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF{sub 3}:Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF{sub 3} nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. - Highlights: • Facile method of CeF{sub 3} and CeF{sub 3}:Tb stable aqueous sols synthesis is proposed. • Naked CeF{sub 3} nanoparticles are shown to be non-toxic and to protect cells from the action of H{sub 2}O{sub 2}. • CeF{sub 3} and CeF{sub 3}:Tb nanoparticles are shown to protect living cells against the vesicular stomatitis virus.

27 CFR 24.146 - Bonds.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Bonds. 24.146 Section 24.146 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE.... (c) Wine vinegar plant bond. The proprietor of a wine vinegar plant who withdraws wine from a bonded...

Reactive removal of 2-chloroethyl ethyl sulfide vapors under visible light irradiation by cerium oxide modified highly porous zirconium (hydr) oxide

Energy Technology Data Exchange (ETDEWEB)

Mitchell, Joshua K.; Arcibar-Orozco, Javier A.; Bandosz, Teresa J., E-mail: tbandosz@ccny.cuny.edu

2016-12-30

Highlights: • Microporous zirconium-cerium (hydr) oxides were synthetized. • Ce presence narrowed the band gap of the materials. • The samples showed a high efficiency for removal of CEES vapors. • 1,2-Bis (ethyl thio) ethane and ethyl vinyl sulfide were the main reaction products. • 5% (Ce/Zr mol) addition of cerium oxide results in the best performing material. - Abstract: Highly porous cerium oxide modified Zr(OH){sub 4} samples were synthesized using a simple one stage urea precipitation method. The amorphicity level of zirconium hydroxide did not change upon addition of cerium oxide particles. A unique aspect of the cerium oxide-modified materials is the presence of both the oxide (CeO{sub 2}) and hydroxide (Zr(OH){sub 4}) phases resulting in a unique microporous structure of the final material. Extensive characterization using various chemical and physical methods revealed significant differences in the surface features. All synthesized materials were microporous and small additions of cerium oxide affected the surface chemistry. These samples were found as effective catalysts for a decontamination of mustard gas surrogate, 2-chloroethyl ethyl sulfide (CEES). Cerium oxide addition significantly decreased the band gap of zirconium hydroxide. Ethyl vinyl sulfide and 1,2-bis (Ethyl thio) ethane were identified as surface reaction products.

The study on preparation of high dispersion and pure cerium dioxide for producing automotive exhaust catalysts

International Nuclear Information System (INIS)

Le Minh Tuan; Nguyen Trong Hung; Nguyen Thanh Chung

2003-01-01

The multi-stage counter-current solvent extraction process using TBP as the solvent has been carried out for purifying cerium and the ammonium carbonate precipitation method has been used to produce the cerium oxide of high dispersion and pure. The flow sheet of extraction system includes 3 extraction stages with O/A = 0.7,2 stripping stages and 4 scrubbing stages with O/A = 5. The condition for ammonium carbonate precipitation, drying and calcination have been investigated and a procedure that seem to be practically suitable to prepare cerium dioxide powder with great specific surface area for producing automotive exhaust catalyst has been proposed. (LMT)

Corrosion resistance of flaky aluminum pigment coated with cerium oxides/hydroxides in chloride and acidic electrolytes

Science.gov (United States)

Niroumandrad, S.; Rostami, M.; Ramezanzadeh, B.

2015-12-01

The objective of this study was to enhance the corrosion resistance of lamellar aluminum pigment through surface treatment by cerium oxides/hydroxides. The surface composition of the pigments was studied by energy-dispersive spectroscopy (EDS) and X-ray photoelectron spectroscopy (XPS). The corrosion resistance of the pigment was evaluated by conventional hydrogen evolution measurements in acidic solution and electrochemical impedance spectroscopy (EIS) in 3.5% NaCl solution. Results showed that the Ce-rich coating composed of Ce2O3 and CeO2 was precipitated on the pigment surface after immersion in the cerium solution. The corrosion resistance of pigment was significantly enhanced after modification with cerium layer.

19 CFR 146.63 - Entry for consumption.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry for consumption. 146.63 Section 146.63... TREASURY (CONTINUED) FOREIGN TRADE ZONES Transfer of Merchandise From a Zone § 146.63 Entry for consumption... status may be entered for consumption from a zone. (b) Zone-restricted merchandise. Merchandise in a zone...

Complex formation of transferrin with tetravalent plutonium and cerium

International Nuclear Information System (INIS)

Subramanian, M.S.; Oomen, I.K.

1981-01-01

Gel filtration experiments with 239 Pu labelled In Vitro bovine serum showed that the metal ion is bound to the transferrin of the serum proteins as in the case of iron labelled serum. This was confirmed by polyacrylamide gel electrophoresis. The ovotransferrin prepared from chicken egg white which was devoid of hemopexin contaminant was found to complex both tetravalent plutonium and cerium giving visible absorption peak at 365 and 435 nm respectively. The binding capacity of ovotransferrin with tetravalent plutonium and cerium, determined by spectrophotometric titration indicates that two metal ions are bound to each protein molecule as in the case of iron. The average molecular weight computed from this binding capacity measurements was found to be 71,000-75,000. The number of protons liberated for each metal ion bound was found to be three as in the case of iron. (author)

Synthesis and ion-exchange properties of cerium(IV) molybdate

Energy Technology Data Exchange (ETDEWEB)

Srivastava, S K; Singh, Raj Pal; Agrawal, Sushma; Kumar, Satish [Roorkee Univ. (India). Dept. of Chemistry

1977-01-01

The synthesis, ion exchange properties, and the separation of a number of cation pairs on the columns of cerium (IV) molybdate is discussed. In order to obtain the product in gel form showing a high exchange capacity and suitable for column operation, preliminary experiments were performed to determine the optimum conditions of precipitation, i.e., the concentration of ceric and molybdate solutions, mixing ratio, pH of precipitation and the order of mixing. Cerium (IV) molybdate, prepared under the optimum conditions of concentration, acidity etc., shows exchange capacity of 0.96 meg per g of exchanger. The sorption of a large number of metal ions has been investigated and the compound shows promising behaviour as cation exchanger. Numerous separations of analytical and radiochemical interest have been performed on the column of this exchanger with great efficiency.

Synthesis and ion-exchange properties of cerium(IV) molybdate

International Nuclear Information System (INIS)

Srivastava, S.K.; Raj Pal Singh; Sushma Agrawal; Satish Kumar

1977-01-01

The synthesis, ion exchange properties, and the separation of a number of cation pairs on the columns of cerium (IV) molybdate is discussed. In order to obtain the product in gel form showing a high exchange capacity and suitable for column operation, preliminary experiments were performed to determine the optimum conditions of precipitation, i.e., the concentration of ceric and molybdate solutions, mixing ratio, pH of precipitation and the order of mixing. Cerium (IV) molybdate, prepared under the optimum conditions of concentration, acidity etc., shows exchange capacity of 0.96 meg per g of exchanger. The sorption of a large number of metal ions has been investigated and the compound shows promising behaviour as cation exchanger. Numerous separations of analytical and radiochemical interest have been performed on the column of this exchanger with great efficiency. (T.G.)

Crystalline cerium(IV) phosphates

International Nuclear Information System (INIS)

Herman, R.G.; Clearfield, A.

1976-01-01

The ion exchange behaviour of seven crystalline cerium(IV) phosphates towards some of the alkali metal cations is described. Only two of the compounds (A and C) possess ion exchange properties in acidic solutions. Four others show some ion exchange characteristics in basic media with some of the alkali cations. Compound G does not behave as an ion exchanger in solutions of pH + , but show very little Na + uptake. Compound E undergoes ion exchange with Na + and Cs + , but not with Li+. Both Li + and Na + are sorbed by compounds A and C. The results are indicative of structures which show steric exclusion phenomena. (author)

Appearance of minimum on the curve of cerium melting

International Nuclear Information System (INIS)

Boguslavskij, Yu.Ya.; Grigor'ev, S.B.

1986-01-01

It is shown by means of simple and obvious thermodynamical considerations that the reduced stability line continues up to the solid phase boundary. The existence of this line causes the appearance of minimum on the fcc cerium melting curve

Study of cerium doped magnetite (Fe 3O 4:Ce)/PMMA nanocomposites

Science.gov (United States)

Padalia, Diwakar; Johri, U. C.; Zaidi, M. G. H.

2012-03-01

The paper presents the synthesis and properties of polymer nanocomposite material based on cerium doped magnetite (Fe 3O 4) as filler material and poly methyl methacrylate (PMMA) as host matrix. The magnetite (Fe 3O 4) particles were synthesized by co-precipitation route using stable ferrous and ferric salts with ammonium hydroxide as precipitating agent. Further, they doped by cerium oxide (CeO 2) non-stoichiometrically. The composite material was fabricated by solvent evaporation method. Here 2.4 GHz microwaves were used to study the effect of microwaves heating on polymerization. The phase and crystal structure is determined by X-ray diffraction (XRD). The average crystallite size of the composites varies from 28 to 35 nm. The chemical structure is confirmed by Fourier transform infrared (FTIR) spectroscopy. The magnetic and thermal properties are investigated by vibrating sample magnetometer (VSM) and differential scanning calorimetry (DSC). The thermal study shows that the microwave heated samples possess higher glass transition temperature ( Tg). The magnetic results suggest that coercivity ( HC) and squareness ( Mr/ Ms) of the loop increases with increasing doping percent of cerium.

Fabrication of Cerium Oxide and Uranium Oxide Microspheres for Space Nuclear Power Applications

Energy Technology Data Exchange (ETDEWEB)

Jeffrey A. Katalenich; Michael R. Hartman; Robert C. O' Brien

2013-02-01

Cerium oxide and uranium oxide microspheres are being produced via an internal gelation sol-gel method to investigate alternative fabrication routes for space nuclear fuels. Depleted uranium and non-radioactive cerium are being utilized as surrogates for plutonium-238 (Pu-238) used in radioisotope thermoelectric generators and for enriched uranium required by nuclear thermal rockets. While current methods used to produce Pu-238 fuels at Los Alamos National Laboratory (LANL) involve the generation of fine powders that pose a respiratory hazard and have a propensity to contaminate glove boxes, the sol-gel route allows for the generation of oxide microsphere fuels through an aqueous route. The sol-gel method does not generate fine powders and may require fewer processing steps than the LANL method with less operator handling. High-quality cerium dioxide microspheres have been fabricated in the desired size range and equipment is being prepared to establish a uranium dioxide microsphere production capability.

21 CFR 146.187 - Canned prune juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned prune juice. 146.187 Section 146.187 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Beverages § 146.187 Canned prune juice. (a) Canned prune juice is the food prepared from a water extract of...

Citric complexes of trivalent cerium and berkelium

International Nuclear Information System (INIS)

Boulhassa, S.

1977-01-01

The extraction by thenoyltrifluoroacetone (TTA) in benzene of trivalent cerium, berkelium and californium, at the indicator scale, hydrolysis and complexation by citric acid of these cations are studied. The radionuclides used were 144 Ce, 249 Bk and 249 Cf respectively γ, β and α emitters. The solvent extraction technique of the elements by TTA in benzene from a perchloric medium at the ionic stength 0.1 was employed. The distribution coefficients D were measured by the γ, β or α radiometry. Cerium and berkelium, which have a comparable redox behavior, show in solution a relatively stable valency IV. Therefore the study by solvent extraction of their trivalent form required the standing up of complete reducing conditions of these elements and their stabilization in solution at the valency III. The thermodynamic data obtained for berkelium and californium contribute to understand the chemistry of these elements and permit to complete the third 'tetrad branch' of 5f elements from Cm 3+ to Es 3+ . This tetrad effect is a manifestation of thermodynamic consequence of the 'nephelauxetic effect'. As for Ce(III), the data confirm the pronounced acid property and may be show no neglected ligand effect for f 1 configuration [fr

Cerium concentrate and mixed rare earth chloride by the oxidative decomposition of bastnaesite in molten sodium hydroxide

International Nuclear Information System (INIS)

Iijima, Toshio; Kato, Kazuhiro; Kuno, Toyohiko; Okuwaki, Akitsugu; Umetsu, Yoshiaki; Okabe, Taijiro

1993-01-01

Bastnaesite was treated in molten NaOH at 623-777 K for 10-60 min under atmosphere. Cerium-(III) in the ore was easily oxidized 95% or more within 30 min to give an oxidation product composed of solid solutions of CeO 2 -rich and CeO 2 -lean phases and Ce-free rare earth oxide phase. Simultaneously fluoride ion was removed 97% or more. Cerium concentrate was prepared from the oxidation product by leaching with 0.1-3 M HCl solution. The yield of cerium concentrate and the CeO 2 content reached 55-57% and 70-72%, respectively. Mixed rare earth chloride is composed of about 90% rare earth chloride and 10% alkaline earth chloride, and the contents of CeCl 3 , LaCl 3 , NdCl 3 , and PrCl 3 are 11.5, 58.5, 14.4, and 5.4%, respectively. The particle size of resulting cerium concentrate was fairly uniform and about 0.1 μm

Synthesis of mesoporous cerium-zirconium mixed oxides by hydrothermal templating method

Institute of Scientific and Technical Information of China (English)

无

2008-01-01

Mesoporous cerium-zirconium mixed oxides were prepared by hydrothermal method using cetyl trimethyl ammonium bromide (CTAB) as template.The effects of amount of template,pH value of solution and hydrothermal temperature on mesostructure of samples were systematically investigated.The final products were characterized by XRD,TEM,FT-IR,and BET.The results indicate that all the cerium-zirconium mixed oxides present a meso-structure.At molar ratio of n(CTAB)/n((Ce)+(Zr))=0.15,pH value of 9,and hydrothermal temperature of 120 ℃,the samples obtained possess a specific surface area of 207.9 m2/g with pore diameter of 3.70 nm and pore volume of 0.19 cm3/g.

Synergism between cerium nitrate and sodium dodecylbenzenesulfonate on corrosion of AA5052 aluminium alloy in 3 wt.% NaCl solution

Energy Technology Data Exchange (ETDEWEB)

Liu, Jie; Wang, Dapeng; Gao, Lixin; Zhang, Daquan, E-mail: zhdq@sh163.net

2016-12-15

Highlights: • Effectively prevent corrosion of AA5052 alloy by using the mixture of cerium nitrate and sodium dodecylbenzenesulfonate. • Synergistic mechanism of the combination of cerium nitrate and sodium dodecylbenzenesulfonate. • Structure of the complex formed between cerium ions and dodecylbenzenesulfonate. • The optimal adsorption model of dodecylbenzenesulfonate on the Al{sub 2}O{sub 3} and CeO{sub 2} surface. - Abstract: The synergistic inhibition effect of rare earth cerium nitrate and sodium dodecylbenzenesulfonate (DBS) on corrosion of AA5052 aluminium alloy in 3 wt.% NaCl solution was investigated by electrochemical impedance spectroscopy (EIS), potentiodynamic polarization curve, scanning electron microscope (SEM) and Fourier transform infrared spectroscopy (FT-IR). The results show that the single cerium nitrate or DBS has a limited inhibition effect against corrosion of AA5052 alloy. The combination cerium ions with DBS produced strong synergistic effect on corrosion inhibition for AA5052 alloy and rendered a negaitve shift of the corrosion potential. The formation of the complex of Al(DBS){sub 3} and Ce(DBS){sub 3} stabilized the passive film of Al{sub 2}O{sub 3} and CeO{sub 2}, retarding both the cathodic and anodic processes of AA5052 alloy corrosion reaction significantly.

Nanostructured sol-gel coatings doped with cerium nitrate as pre-treatments for AA2024-T3

International Nuclear Information System (INIS)

Zheludkevich, M.L.; Serra, R.; Montemor, M.F.; Yasakau, K.A.; Salvado, I.M. Miranda; Ferreira, M.G.S.

2005-01-01

Nanostructured hybrid sol-gel coatings doped with cerium ions were investigated in the present work as pre-treatments for the AA2024-T3 alloy. The sol-gel films have been synthesized from tetraethylorthosilicate (TEOS) and 3-glycidoxypropyltrimethoxysilane (GPTMS) precursors. Additionally the hybrid sol was doped with zirconia nanoparticles prepared from hydrolyzed tetra-n-propoxyzirconium (TPOZ). Cerium nitrate, as corrosion inhibitor, was added into the hybrid matrix or into the oxide nanoparticles. The chemical composition and the structure of the hybrid sol-gel films were studied by XPS (X-ray photoelectron spectroscopy) and AFM (atomic force microscopy), respectively. The evolution of the corrosion protection properties of the sol-gel films was studied by EIS (electrochemical impedance spectroscopy), which can provide quantitative information on the role of the different pre-treatments. Different equivalent circuits, for different stages of the corrosion processes, were used in order to model the coating degradation. The models were supported by SEM (scanning electron microscopy) measurements. The results show that the sol-gel films containing zirconia nanoparticles present improved barrier properties. Doping the hybrid nanostructured sol-gel coatings with cerium nitrate leads to additional improvement of the corrosion protection. The zirconia particles present in the sol-gel matrix seem to act as nanoreservoirs providing a prolonged release of cerium ions. The nanostructured sol-gel films doped with cerium nitrate can be proposed as a potential candidate for substitution of the chromate pre-treatments for AA2024-T3

Effect of cerium oxide addition on electrical properties of ZnO

Energy Technology Data Exchange (ETDEWEB)

Ibrahim, D.M. [National Research Center, Dokki, Giza (Egypt). Dept. of Ceramics; Mounir, M. [Dept. of Physics, Cairo Univ., Giza (Egypt); Mahgoub, A.S. [Cairo Univ., Giza (Egypt). Dept. of Chemistry; Turky, G. [Dept. of Physics, National Research Center, Dokki, Giza (Egypt); El-Desouky, O.A. [Cer. Cleopatra Co., Ramadan City (Egypt)

2002-07-01

Mixtures of ZnO and Ce{sub 6} O{sub 11} as additive were prepared by solid state reaction from the calcined oxides with the following proportions: 0.03, 0.08, 0.1, 0.2 and 0.4 mole. Disc specimens 1.2 cm 5 cm in diameter and 0.3 cm thickness were processed under a force of 70 kN and fired at 1150 C/ 30 minutes. XRD revealed the presence of limited solid solution of cerium in ZnO, as evident from the shift in the peaks [0.03-0.04 A ] up to 0.1 mole addition and remains constant. SEM revealed the presence of inter-granular phase. EDAX showed it to be a mixture of ZnO and Ce{sub 6}O{sub 11}. Also cerium was detected in the ZnO grains confirming the XRD results. RCL circuit was used to measure the capacitance and resistance at different frequencies at room temperature. The dielectric constant and conductivity were calculated. The change in resistivity with temperature was followed up to 523 K. The change in dielectric strength with temperature at spot frequency of 10 kHz is demonstrated. The electrical conductivity was found to increase with the proportion of cerium oxide up to 0.2 mole then decreased. (orig.)

Cerium Modified Pillared Montmorillonite Supported Cobalt Catalysts for Fischer Tropsch Synthesis

International Nuclear Information System (INIS)

Ahmad, N.; Ali, Z.; Abbas, S. M.; Hussain, F.

2015-01-01

Fischer-Tropsch (FT) synthesis was accomplished over Al-pillared Montmorillonite supported 20 wt% Co modified with different weight% of cerium catalysts. These catalysts were prepared by impregnation method while structural characterizations of the prepared samples were performed by XRD, TPR, NH/sub 3/TPD, TGA, BET, XRF and SEM techniques. The Fischer Tropsch reaction was studied in fixed bed micro catalytic reactor at temperature range of 220, 260 and 275 degree C and at different pressure (1, 5 and 10 bars). From the activity results, it was found that by pillaring NaMMT with Al higher catalytic activity and lower methane selectivity of NaMMT was achieved. Furthermore, the results of FT synthesis reaction revealed that cerium incorporation increased the dispersion of Co/sub 3/O/sub 4/ on the surface and consequently resulted in enhanced catalytic activity. Additionally, the C/sub 5/-C/sub 12/ hydrocarbons and methane selectivity increased while C/sub 22+/ hydrocarbons selectivity was decreased over cerium modified catalysts. Higher reaction temperature (>220 degree C) resulted in significant enhancement in CO conversion and methane selectivity. Though, increase in pressure from 1 to 10 bars eventually resulted in increase in C/sub 5+/ hydrocarbons and decrease in methane and C/sub 2/-C/sub 5/ hydrocarbons selectivity. (author)

Influence of agglomeration of cerium oxide nanoparticles and speciation of cerium(III) on short term effects to the green algae Chlamydomonas reinhardtii

Energy Technology Data Exchange (ETDEWEB)

Röhder, Lena A. [Eawag, Swiss Federal Institute of Aquatic Science and Technology, Department of Environmental Toxicology, Dübendorf 8600 (Switzerland); ETH-Zurich, Institute of Biogeochemistry and Pollutant Dynamics, Zürich 8092 (Switzerland); Brandt, Tanja [Eawag, Swiss Federal Institute of Aquatic Science and Technology, Department of Environmental Toxicology, Dübendorf 8600 (Switzerland); Sigg, Laura [Eawag, Swiss Federal Institute of Aquatic Science and Technology, Department of Environmental Toxicology, Dübendorf 8600 (Switzerland); ETH-Zurich, Institute of Biogeochemistry and Pollutant Dynamics, Zürich 8092 (Switzerland); Behra, Renata, E-mail: Renata.behra@eawag.ch [Eawag, Swiss Federal Institute of Aquatic Science and Technology, Department of Environmental Toxicology, Dübendorf 8600 (Switzerland)

2014-07-01

Highlights: • Phosphate-dispersed CeO₂ NP did not affect photosynthetic yield in C. reinhardtii. • Agglomerated CeO₂ NP slightly decreased photosynthetic yield. • Cerium(III) was shown to affect photosynthetic yield and intracellular ROS level. • Slight effects of CeO₂ NP were caused by dissolved Ce³⁺ ions present in suspensions. • Wild type and cell wall free mutant of C. reinhardtii showed the same sensitivity. - Abstract: Cerium oxide nanoparticles (CeO₂ NP) are increasingly used in industrial applications and may be released to the aquatic environment. The fate of CeO₂ NP and effects on algae are largely unknown. In this study, the short term effects of CeO₂ NP in two different agglomeration states on the green algae Chlamydomonas reinhardtii were examined. The role of dissolved cerium(III) on toxicity, its speciation and the dissolution of CeO₂ NP were considered. The role of cell wall of C. reinhardtii as a barrier and its influence on the sensitivity to CeO₂ NP and cerium(III) was evaluated by testing both, the wild type and the cell wall free mutant of C. reinhardtii. Characterization showed that CeO₂ NP had a surface charge of ~0 mV at physiological pH and agglomerated in exposure media. Phosphate stabilized CeO₂ NP at pH 7.5 over 24 h. This effect was exploited to test CeO₂ NP dispersed in phosphate with a mean size of 140 nm and agglomerated in absence of phosphate with a mean size of 2000 nm. The level of dissolved cerium(III) in CeO₂ NP suspensions was very low and between 0.1 and 27 nM in all tested media. Exposure of C. reinhardtii to Ce(NO₃)₃ decreased the photosynthetic yield in a concentration dependent manner with EC₅₀ of 7.5 ± 0.84 μM for wild type and EC₅₀ of 6.3 ± 0.53 μM for the cell wall free mutant. The intracellular level of reactive oxygen species (ROS) increased upon exposure to Ce(NO₃)₃ with effective concentrations similar to those inhibiting photosynthesis. The agglomerated Ce

Extraction of Cerium (IV) Using Di–n-butylsulfoxide in Chloroform ...

African Journals Online (AJOL)

NICO

2015-01-12

Jan 12, 2015 ... Cerium is the most abundant among rare earth metals and is extracted from monazite, allanite and ... Variamine blue, 2,4, dihydroxy benzophenoe benzoic hydrazone, ... thoroughly for colour development. The reagent blank ...

Thermodynamic Studies of the Phase Relationships of Nonstoichiometric Cerium Oxides at Higher Temperatures

DEFF Research Database (Denmark)

Sørensen, Ole Toft

1976-01-01

Partial molar thermodynamic quantities for oxygen in nonstoichiometric cerium oxides were determined by thermogravimetric analysis in CO/CO2 mixtures in the temperature range 900–1400°C. Under these conditions compositions within the range 2.00 greater-or-equal, slanted O/M greater-or-equal, slan......Partial molar thermodynamic quantities for oxygen in nonstoichiometric cerium oxides were determined by thermogravimetric analysis in CO/CO2 mixtures in the temperature range 900–1400°C. Under these conditions compositions within the range 2.00 greater-or-equal, slanted O/M greater...

Determination of Ideal Broth Formulations Needed to Prepare Hydrous Cerium Oxide Microspheres via the Internal Gelation Process

Energy Technology Data Exchange (ETDEWEB)

Collins, Jack Lee [ORNL; Chi, Anthony [ORNL

2009-02-01

A simple test tube methodology was used to determine optimum process parameters for preparing hydrous cerium oxide microspheres via the internal gelation process.1 Broth formulations of cerium ammonium nitrate [(NH4)2Ce(NO3)6], hexamethylenetetramine, and urea were found that can be used to prepare hydrous cerium oxide gel spheres in the temperature range of 60 to 90 C. A few gel-forming runs were made in which microspheres were prepared with some of these formulations to be able to equate the test-tube gelation times to actual gelation times. These preparations confirmed that the test-tube methodology is reliable for determining the ideal broth formulations.

Effect of cerium and thermomechanical processing on microstructure

Indian Academy of Sciences (India)

The effect of cerium content and thermomechanical processing on structure and properties of Fe–10.5 wt.%Al–0.8 wt%C alloy has been investigated. Alloys were prepared by a combination of air induction melting with flux cover (AIMFC) and electroslag remelting (ESR). The ESR ingots were hot-forged and hotrolled at ...

40 CFR 146.2 - Law authorizing these regulations.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Law authorizing these regulations. 146.2 Section 146.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.2 Law...

Using cerium anomaly as an indicator of redox reactions in constructed wetland

Science.gov (United States)

Liang, R.

2013-12-01

The study area, Chiayi County located in southern Taiwan, has highly developed livestock. The surface water has very low dissolved oxygen and high NH4. Under the situation, constructed wetland becomes the most effective and economic choice to treat the wastewater in the natural waterways. Hebao Island free surface constructed wetland started to operate in late 2006. It covers an area of 0.28 km2 and is subdivided into 3 major cells, which are sedimentation cell, 1st aeration cell with rooted plants and 2nd aeration cell with float plants. The water depth of cells ranges from 0.6 m to 1.2 m. The total hydraulic retention time is about a half day. In this study, the water samples were sequentially collected along the flow path. The results of hydrochemical analysis show that the untreated inflow water can be characterized with enriched NH4 (11 ppm), sulfate (6 ppm) and arsenic (50 ppb). The removal efficiency of NH4 in the first two cells is arsenic is still higher than the permissible limits recommended by WHO (10 ppb). The wetland operation should be tuned to take more arsenic away in the future. As demonstrated in the above, oxidation reaction is the most dominant mechanism to remove pollutants from the wastewater; therefore, dissolved oxygen is traditionally considered as an important indicator to evaluate the operation efficiency of wetland. However, it would need longer time to achieve equilibrium state of redox reaction involving dissolved oxygen due to the slower reaction rate. For example, the input water in this study has fairly high dissolved oxygen (5 ppm) but the NH4 content is still high, which indicates a non-equilibrium condition. In this study, the cerium anomaly is alternatively utilized to evaluate the water redox state. The results demonstrate that the input water has the negative cerium anomaly of -0.16. Along the flow path, the cerium negative anomaly does not change in the first two cells and dramatically becomes -0.23 in cell 3. The trend of

Chemoselective reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by various hydride reagents.

Science.gov (United States)

Kim, Eunjeong; Ma, Eunsook

2007-04-01

The chemoselectivity of rigid cyclic alpha,beta-unsaturated carbonyl group on the reducing agents was influenced by the ring size and steric factor. Cholesterol (cholest-5-en-3beta-ol) and dehydroepiandrosterone (DHEA) were oxidized with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone to form 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione. They were reduced with NaBH(4), lithium tri-sec-butylborohydride (l-Selectride), LiAlH(4), 9-borabicyclo[3.3.1]nonane (9-BBN), lithium triethylborohydride (Super-hydride), and BH(3) x (CH(3))(2)S in various conditions, respectively. Reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by NaBH(4) (4 equiv.) produced 4,6-cholestadien-3beta-ol and 4,6-androstadiene-3beta,17beta-diol, respectively. Reduction by l-Selectride (12 equiv.) afforded 4,6-cholestadien-3alpha-ol and 4,6-androstadiene-3alpha,17beta-diol, chemoselectively. Reaction with Super-hydride (12 equiv.) produced 4,6-cholestadien-3-one and 3-oxo-4,6-androstadien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by 9-BBN (14 equiv.) produced 1,4,6-cholestatrien-3alpha-ol, but 1,4,6-androstatriene-3,17-dione was not reacted with 9-BBN in the reaction conditions. Reaction of LiAlH(4) (6 equiv.) formed 4,6-cholestadien-3beta-ol and 3-oxo-1,4,6-androstatrien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by BH(3) x (CH(3))(2)S (11 equiv.) gave cholestane as major compound and unlike reactivity of cholesterol, 1,4,6-androstatriene-3,17-dione by 8 equiv. of BH(3) x (CH(3))(2)S formed 3-oxo-1,4,6-androstatrien-17beta-ol. LiAlH(4) and BH(3) x (CH(3))(2)S showed relatively low chemoselectivity.

Study of cerium doped magnetite (Fe3O4:Ce)/PMMA nanocomposites

International Nuclear Information System (INIS)

Padalia, Diwakar; Johri, U.C.; Zaidi, M.G.H.

2012-01-01

The paper presents the synthesis and properties of polymer nanocomposite material based on cerium doped magnetite (Fe 3 O 4 ) as filler material and poly methyl methacrylate (PMMA) as host matrix. The magnetite (Fe 3 O 4 ) particles were synthesized by co-precipitation route using stable ferrous and ferric salts with ammonium hydroxide as precipitating agent. Further, they doped by cerium oxide (CeO 2 ) non-stoichiometrically. The composite material was fabricated by solvent evaporation method. Here 2.4 GHz microwaves were used to study the effect of microwaves heating on polymerization. The phase and crystal structure is determined by X-ray diffraction (XRD). The average crystallite size of the composites varies from 28 to 35 nm. The chemical structure is confirmed by Fourier transform infrared (FTIR) spectroscopy. The magnetic and thermal properties are investigated by vibrating sample magnetometer (VSM) and differential scanning calorimetry (DSC). The thermal study shows that the microwave heated samples possess higher glass transition temperature (T g ). The magnetic results suggest that coercivity (H C ) and squareness (M r /M s ) of the loop increases with increasing doping percent of cerium.

Thermal decomposition study of uranyl nitrate and cerium hydroxide in a spray dryer

International Nuclear Information System (INIS)

Silva Wildhagen, G.R. da.

1993-05-01

A study, in a spray dryer system based on drying and thermal decomposition of uranyl nitrate solutions aiming the production of uranium trioxide adequate for the use in posterior steps of reduction and hydro fluorination in nuclear fuel cycle; and cerium hydroxide suspensions for the production of cerium oxide with high surface area is presented. Thus, the project and construction of a countercurrent spray dryer was elaborated for capacity of 10 Kg U O 3 /h and 3,5 k Ce O 2 /h. The methodology used in these experiments consisted in the analysis of several parameters (concentration and flow rate of the feed, atomization pressure and inlet temperature of the dryer) over the physical and chemical properties of the products. Using the obtained results, with the help of a mathematical model, it was developed the project of a continuous pilot unity for the production of uranium trioxide or cerium oxide, with capacity of 20 Kg U O 3 /h or 10 Kg Ce O 2 /h, respectively. (author)

Cerium valence change in the solid solutions Ce(Rh1-xRux)Sn

International Nuclear Information System (INIS)

Niehaus, Oliver; Riecken, Jan F.; Winter, Florian; Poettgen, Rainer; Muenster Univ.; Abdala, Paula M.; Chevalier, Bernard

2013-01-01

The solid solutions Ce(Rh 1-x Ru x )Sn were investigated by means of susceptibility measurements, specific heat, electrical resistivity, X-ray absorption spectroscopy (XAS), and 119 Sn Moessbauer spectroscopy. Magnetic measurements as well as XAS data show a cerium valence change in dependence on the ruthenium content. Higher ruthenium content causes an increase from 3.22 to 3.45 at 300 K. Furthermore χ and χ -1 data indicate valence fluctuation for cerium as a function of temperature. For example, Ce(Rh 0.8 Ru 0.2 )Sn exhibits valence fluctuations between 3.42 and 3.32 in the temperature range of 10 to 300 K. This could be proven by using the interconfiguration fluctuation (ICF) model introduced by Sales and Wohlleben. Cerium valence change does not influence the tin atoms as proven by 119 Sn Moessbauer spectroscopy, but it influences the electrical properties. Ce(Rh 0.9 Ru 0.1 )Sn behaves like a typical valence fluctuating compound, and higher ruthenium content causes an increase of the metallic behavior. (orig.)

22 CFR 146.400 - Education programs or activities.

Science.gov (United States)

2010-04-01

... Basis of Sex in Education Programs or Activities Prohibited § 146.400 Education programs or activities... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Education programs or activities. 146.400 Section 146.400 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX...

19 CFR 146.13 - Customs forms and procedures.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs forms and procedures. 146.13 Section 146.13 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.13 Customs forms and procedures...

19 CFR 146.10 - Authority to examine merchandise.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to examine merchandise. 146.10 Section 146.10 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.10 Authority to examine...

Fixation of radioactive cerium-144 on white blood cells. Possibilities for use in physiopathology

International Nuclear Information System (INIS)

Aeberhardt, A.

1958-01-01

From the study of the means of transport of cerium in the blood of various laboratory animals, after intra-venous injection of 144 Ce- 144 Pr without carrier, we have been able to show up the part played by the white cells in the transport of this fission product during its passage in the blood. This observation has led to the study, in vitro, of the methods of cerium fixation on the white cells, with a view to determining the possibilities of using this property for white cell labelling, the methods used up to the present not being entirely satisfactory. Using the method for the separation of the known constituents of the blood proposed by us in 1956, we have studied the cerium fixation under various conditions: - on suspensions of white cells from the rabbit, - on a suspension of human white cells, - on the white cells in whole from the rabbit. (author) [fr

Indirect flow injection determination of N-acetyl-L-cysteine using cerium(IV) and ferroin

International Nuclear Information System (INIS)

Vieira, Heberth Juliano; Fatibello-Filho, Orlando

2005-01-01

An indirect flow injection spectrophotometric procedure is proposed for the determination of N-acetyl-L-cysteine in pharmaceutical formulations. In this system, ferroin ([Fe(II)-(fen) 2 ] 2+ ) in excess, with a strong absorption at 500 nm, is oxidized by cerium(IV) yielding cerium(III) and [Fe(III)-(fen) 2 ] 3+ (colorless), thus producing a baseline. When N-acetyl-L-cysteine solution is introduced into the flow injection system, it reacts with cerium(IV) increasing the analytical signal in proportion to the drug concentration. Under optimal experimental conditions, the linearity of the analytical curve for N-acetyl-L-cysteine ranged from 6.5x10 -6 to 1.3x10 -4 mol L -1 . The detection limit was 5.0x10 -6 mol L -1 and recoveries between 98.0 and 106% were obtained. The sampling frequency was 60 determinations per hour and the RSD was smaller than 1.4% for 2.2x10 -5 mol L -1 N-acetyl-L-cysteine. (author)

Corrosion behaviors in physiological solution of cerium conversion coatings on AZ31 magnesium alloy

International Nuclear Information System (INIS)

Cui Xiufang; Yang Yuyun; Liu Erbao; Jin Guo; Zhong Jinggao; Li Qingfen

2011-01-01

In this paper, a non-toxic Ce-based conversion coating was obtained on the surface of bio-medical AZ31 magnesium alloys. The micro-morphology of the coating prepared with optimal technical parameters and immersed in physiological solution (Hank's solution) in different time was observed by scanning electron microscopy (SEM), composition of the cerium conversion coating and corrosion products in Hank's solution were characterized by X-ray photoelectron spectroscopy (XPS) and energy dispersive spectroscopy (EDS), respectively. In addition, the corrosion property in Hank's solution was studied by electrochemical experiment and immersion test. The results show that the dense Ce-based conversion coating is obtained on the surface of AZ31 magnesium alloys in optimal technical parameters and the conversion coating consists of a mass of trivalent and tetravalent cerium oxides. The cerium conversion coating can provide obvious protection of magnesium alloys and can effectively reduce the degradation speed in Hank's solution. Also the degradation products have little influence on human body.

Cerium-loaded algae exoskeletons for active corrosion protection of coated AA2024-T3

International Nuclear Information System (INIS)

Denissen, Paul J.; Garcia, Santiago J.

2017-01-01

Highlights: •Nanoporous diatom algae exoskeletons allow for local inhibitor loading. •Cerium loaded exoskeletons show diffusion controlled release from coatings. •In-situ opto-electrochemical analysis allows for accurate corrosion evaluation. •Raman spectroscopy allows for precise identification of Ce at IMs in a scribe. •High levels of protection were obtained with the Ce-diatom coatings. -- Abstract: The use of micron sized nanoporous diatom algae exoskeletons for inhibitor storage and sustained corrosion protection of coated aluminium structures upon damage is presented. In this concept the algae exoskeleton allows local inhibitor loading, limits the interaction between the cerium and the epoxy/amine coating and allows for diffusion-controlled release of the inhibitor when needed. The inhibitor release and corrosion protection by loaded exoskeletons was evaluated by UV/Vis spectrometry, a home-built optical-electrochemical setup, and Raman spectroscopy. Although this concept has been proven for a cerium-epoxy-aluminium alloy system the main underlying principle can be extrapolated to other inhibitor-coating-metal systems.

Eucalyptus tolerance mechanisms to lanthanum and cerium: subcellular distribution, antioxidant system and thiol pools.

Science.gov (United States)

Shen, Yichang; Zhang, Shirong; Li, Sen; Xu, Xiaoxun; Jia, Yongxia; Gong, Guoshu

2014-12-01

Guanglin 9 (Eucalyptus grandis × Eucalyptus urophlla) and Eucalyptus grandis 5 are two eucalyptus species which have been found to grow normally in soils contaminated with lanthanum and cerium, but the tolerance mechanisms are not clear yet. In this study, a pot experiment was conducted to investigate the tolerance mechanisms of the eucalyptus to lanthanum and cerium. Cell walls stored 45.40-63.44% of the metals under lanthanum or cerium stress. Peroxidase and catalase activities enhanced with increasing soil La or Ce concentrations up to 200 mg kg(-1), while there were no obvious changes in glutathione and ascorbate concentrations. Non-protein thiols concentrations increased with increasing treatment levels up to 200 mg kg(-1), and then decreased. Phytochelatins concentrations continued to increase under La or Ce stress. Therefore, the two eucalyptus species are La and Ce tolerant plants, and the tolerance mechanisms include cell wall deposition, antioxidant system response, and thiol compound synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Electrolytic technique for the chemical decontamination process with sulfuric acid-cerium (IV) for decommissioning

International Nuclear Information System (INIS)

Wei, Tsong-Yang; Hsieh, Jung-Chun.

1992-01-01

An electrolyzer with an ion-exchange membrane as the separator has been used to study the electrolytic redox reaction of Ce 4+ / Ce 3+ in sulfuric acid solution, which is a reagent for predismantling system decontamination. Influencing factors such as current density, cerium concentration, acidity, electrolyte flow rate, membrane type and electrode material were studied experimentally. The results indicate that the redox can be achieved with high conversion even as the cerium concentration is below 0.005 M. However, the current efficiency strongly depends on the cerium concentration. In addition, the acid content and the electrolyte flow rate show little influence on the redox reaction. Both cation and anion membrane are feasible for this process. Therefore, the operation conditions are widely applicable. Moreover, two different electrode materials, platinized titanium meshes and graphite, were used. The results show that the platinized titanium meshes is preferable to the graphite for higher current efficiency. (author)

Effect of ultrasound on the structural and textural properties of copper-impregnated cerium-modified zirconium-pillared bentonite

International Nuclear Information System (INIS)

Tomul, Fatma

2011-01-01

In this study, the synthesis of zirconium-pillared bentonite modified with cerium was performed via two different methods by the application of conventional and ultrasonic treatments during the intercalation stage. To synthesise copper-impregnated pillared clays by wet impregnation, cerium-modified zirconium-pillared clays were used as supportive materials after being calcined at 300 °C. Ultrasonic treatment significantly decreased the required processing time compared with the conventional treatment of the synthesised pillared bentonites. Chemical analysis confirmed the incorporation of Zr 4+ , Ce 4+ and Cu 2+ species into the pillared bentonites. X-ray diffraction (XRD) patterns of zirconium- and cerium/zirconium-pillared bentonites prepared by conventional treatment show that one large d-spacing above 3.5 nm corresponds to the mesoporous delaminated part, and another small d-spacing above 1.7 nm is indicative of the microporous pillared part. Zirconium- and cerium/zirconium-pillared bentonites prepared via ultrasonic treatment exhibited similar results, with the same high d-spacing but with a second low-intensity d-spacing above 1.9 nm. The delaminated structures of the pillared bentonites synthesised by both methods were conserved after copper impregnation. Nitrogen-adsorption isotherm analysis showed that the textural characteristics of products synthesised by ultrasonic treatment were comparable to those of products synthesised by conventional treatment. Fourier-transform infrared spectroscopy (FTIR) analyses showed the presence of Brønsted- and Lewis-acid sites, and zirconium-pillared clays synthesised by conventional treatment exhibited increased numbers of Brønsted- and Lewis-acid sites after cerium addition and copper impregnation. However, the products synthesised by ultrasonic treatment exhibited an increased number of Brønsted- and Lewis-acid sites after cerium addition, but a decreased number of acid sites after copper impregnation.

19 CFR 146.51 - Customs control of merchandise.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs control of merchandise. 146.51 Section 146.51 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES Handling of Merchandise in a Zone § 146.51 Customs...

Effect of HCl pre-treatment on corrosion resistance of cerium-based conversion coatings on magnesium and magnesium alloys

International Nuclear Information System (INIS)

Brunelli, Katya; Dabala, Manuele; Calliari, Irene; Magrini, Maurizio

2005-01-01

The corrosion protection afforded by a cerium conversion coating, formed by immersion in a solution containing rare earth salt and hydrogen peroxide, on pure magnesium and two magnesium alloys, AZ91 and AM50, has been studied. The effect of HCl pre-treatments on the morphology and on the corrosion resistance of the cerium conversion layer was investigated. A thicker and more homogeneous distribution of the conversion coating was obtained when the sample surface was pre-treated with acid. Higher amounts of cerium on the surface of the pre-treated samples were detected. The cerium conversion coating increased the corrosion resistance of the alloys because it ennobled the corrosion potential and decreased both the anodic and cathodic current. The acid pre-treatment further increased the corrosion resistance of the coated alloys. After five days of immersion in chloride environment the untreated samples showed localized corrosion while the chemical conversion coated samples appeared unaffected

Zirconia dispersion as a toughening agent in alumina - Influence of the cerium oxide

International Nuclear Information System (INIS)

Gritti, Olivier

1987-01-01

The improvement of mechanical properties of alumina can be obtained by fine dispersion of zirconia particles. The addition of cerium oxide as a stabilizer of the tetragonal phase has been examined. Different powder preparations, based on impregnation of the alumina powder by zirconium and cerium precursor salts, have been studied. Parameters, such as properties of alumina powder and cerium oxide content, for the production of reactive powders have been determined by two laboratory processes. The sintering of these powders in air at 1600 deg. C has resulted in dense materials with homogeneous microstructure. The mechanical properties, in particular the biaxial flexure strength and the toughness, have been determined in the temperature range 20 deg. C-900 deg. C. A reinforcement of about 80 pc in comparison with alumina is achieved. The optimal composition is (Al 2 O 3 ) 0.8 (ZrO 2 ) 0.18 (CeO 2 ) 0.02 . In the other hand, powder preparation by spray drying has been chosen for an approach to a larger scale process. The sintered ceramics made with these powders present a double microstructure which does not affect the mechanical properties. The presence of cerium oxide produces the following improvements: - increased mobility of the intergranular zirconia inclusions which results in a faster densification; - stabilization of a tetragonal phase without prohibiting the stress induced transformation; - increase of the critical sizes of the tetragonal → monoclinic transformation; - a large decrease in the transformation kinetic in water at 300 deg. C in comparison with that observed for alumina-zirconia doped with yttrium oxide. (author) [fr

10 CFR 72.146 - Design control.

Science.gov (United States)

2010-01-01

... 10 Energy 2 2010-01-01 2010-01-01 false Design control. 72.146 Section 72.146 Energy NUCLEAR... Design control. (a) The licensee, applicant for a license, certificate holder, and applicant for a CoC... shall establish measures for the identification and control of design interfaces and for coordination...

21 CFR 146.151 - Orange juice for manufacturing.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice for manufacturing. 146.151 Section... Fruit Juices and Beverages § 146.151 Orange juice for manufacturing. (a) Orange juice for manufacturing... from oranges as provided in § 146.135, except that the oranges may deviate from the standards for...

21 CFR 146.152 - Orange juice with preservative.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice with preservative. 146.152 Section... Fruit Juices and Beverages § 146.152 Orange juice with preservative. (a) Orange juice with preservative... of orange juice for manufacturing as provided for in § 146.151, except that a preservative is added...

Soil organic matter influences cerium translocation and physiological processes in kidney bean plants exposed to cerium oxide nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Majumdar, Sanghamitra [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), El Paso, TX (United States); Peralta-Videa, Jose R. [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), El Paso, TX (United States); Trujillo-Reyes, Jesica [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Sun, Youping [Texas AgriLife Research Center at El Paso, Texas A& M University System, 1380 A & M Circle, El Paso, TX 79927 (United States); Barrios, Ana C. [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Niu, Genhua [Texas AgriLife Research Center at El Paso, Texas A& M University System, 1380 A & M Circle, El Paso, TX 79927 (United States); Margez, Juan P. Flores- [Autonomous University of Ciudad Juarez, Departamento de Química y Biología, Instituto de Ciencias Biomédicas, Anillo envolvente PRONAF y Estocolmo, Ciudad Juarez, Chihuahua 32310, México (Mexico); Gardea-Torresdey, Jorge L., E-mail: jgardea@utep.edu [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), El Paso, TX (United States)

2016-11-01

Soil organic matter plays a major role in determining the fate of the engineered nanomaterials (ENMs) in the soil matrix and effects on the residing plants. In this study, kidney bean plants were grown in soils varying in organic matter content and amended with 0–500 mg/kg cerium oxide nanoparticles (nano-CeO{sub 2}) under greenhouse condition. After 52 days of exposure, cerium accumulation in tissues, plant growth and physiological parameters including photosynthetic pigments (chlorophylls and carotenoids), net photosynthesis rate, transpiration rate, and stomatal conductance were recorded. Additionally, catalase and ascorbate peroxidase activities were measured to evaluate oxidative stress in the tissues. The translocation factor of cerium in the nano-CeO{sub 2} exposed plants grown in organic matter enriched soil (OMES) was twice as the plants grown in low organic matter soil (LOMS). Although the leaf cover area increased by 65–111% with increasing nano-CeO{sub 2} concentration in LOMS, the effect on the physiological processes were inconsequential. In OMES leaves, exposure to 62.5–250 mg/kg nano-CeO{sub 2} led to an enhancement in the transpiration rate and stomatal conductance, but to a simultaneous decrease in carotenoid contents by 25–28%. Chlorophyll a in the OMES leaves also decreased by 27 and 18% on exposure to 125 and 250 mg/kg nano-CeO{sub 2}. In addition, catalase activity increased in LOMS stems, and ascorbate peroxidase increased in OMES leaves of nano-CeO{sub 2} exposed plants, with respect to control. Thus, this study provides clear evidence that the properties of the complex soil matrix play decisive roles in determining the fate, bioavailability, and biological transport of ENMs in the environment. - Highlights: • Ce translocation to leaves was facilitated by higher organic matter (OM) in soil. • Lower soil OM increased leaf cover area in nano-CeO{sub 2} exposed plants. • Nano-CeO{sub 2} effects on metabolic processes were more

75 FR 38953 - Airworthiness Directives; BAE Systems (OPERATIONS) LIMITED Model BAe 146 and Avro 146-RJ Airplanes

Science.gov (United States)

2010-07-07

... oleo. The AD also provided an optional terminating action for the repetitive inspections, by embodiment... for the repetitive inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent... inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent accident investigation, the...

Corrosion inhibition of 7000 series aluminium alloys with cerium diphenyl phosphate

Energy Technology Data Exchange (ETDEWEB)

Hill, Julie-Anne [Department of Materials Engineering and Australian Centre of Excellence for Electromaterials Science, Wellington Rd, Monash University, Clayton, Victoria (Australia); Markley, Tracey [Department of Materials Engineering and Australian Centre of Excellence for Electromaterials Science, Wellington Rd, Monash University, Clayton, Victoria (Australia); CSIRO, Division of Materials Science and Technology, Clayton, Victoria (Australia); Forsyth, Maria, E-mail: maria.forsyth@deakin.edu.au [Department of Materials Engineering and Australian Centre of Excellence for Electromaterials Science, Wellington Rd, Monash University, Clayton, Victoria (Australia); Howlett, Patrick C. [Department of Materials Engineering and Australian Centre of Excellence for Electromaterials Science, Wellington Rd, Monash University, Clayton, Victoria (Australia); Hinton, Bruce R.W. [Department of Materials Engineering and Australian Centre of Excellence for Electromaterials Science, Wellington Rd, Monash University, Clayton, Victoria (Australia); Defence Science and Technology Organisation, Melbourne, Victoria (Australia)

2011-02-03

Graphical abstract: Scanning electron micrographs of microtomed surface shows pristine surface free of corrosion related 'mud cracking' inset for an inhibited AA7050 specimen when only 150 ppm Ce(dpp)3 is present in 0.1 M NaCl solution. Display Omitted Research highlights: > The thin film of hydrolysis products of Ce(dpp)3 and aluminium oxide is proposed to cause the inhibition. > The film consists of discrete Ce rich particles and a thin film over the matrix of Ce, P and Al oxides. > Discrete deposition of Ce is specifically influenced by Cu rich intermetallics. - Abstract: Cerium diphenyl phosphate (Ce(dpp){sub 3}) has previously been shown to be a strong corrosion inhibitor for aluminium-copper magnesium alloy AA2024-T3 and AA7075 in chloride solutions. Surface characterisation including SEM and ToF-SIMS coupled with electrochemical impedance spectroscopy (EIS) measurements are used to propose a mechanism of corrosion inhibition which appears to involve the formation of a complex oxide film of aluminium and cerium also incorporating the organophosphate component. The formation of a thin complex film consisting of hydrolysis products of the Ce(dpp){sub 3} compound and aluminium oxide is proposed to lead to the observed inhibition. SEM analysis shows that some intermetallics favour the creation of thicker deposits predominantly containing cerium oxide compounds.

Bioavailability of cerium oxide nanoparticles to Raphanus sativus L. in two soils.

Science.gov (United States)

Zhang, Weilan; Musante, Craig; White, Jason C; Schwab, Paul; Wang, Qiang; Ebbs, Stephen D; Ma, Xingmao

2017-01-01

Cerium oxide nanoparticles (CeO 2 NP) are a common component of many commercial products. Due to the general concerns over the potential toxicity of engineered nanoparticles (ENPs), the phytotoxicity and in planta accumulation of CeO 2 NPs have been broadly investigated. However, most previous studies were conducted in hydroponic systems and with grain crops. For a few studies performed with soil grown plants, the impact of soil properties on the fate and transport of CeO 2 NPs was generally ignored even though numerous previous studies indicate that soil properties play a critical role in the fate and transport of environmental pollutants. The objectives of this study were to evaluate the soil fractionation and bioavailability of CeO 2 NPs to Raphanus sativus L (radish) in two soil types. Our results showed that the silty loam contained slightly higher exchangeable fraction (F1) of cerium element than did loamy sand soil, but significantly lower reducible (F2) and oxidizable (F3) fractions as CeO 2 NPs concentration increased. CeO 2 NPs associated with silicate minerals or the residue fraction (F4) dominated in both soils. The cerium concentration in radish storage root showed linear correlation with the sum of the first three fractions (r 2  = 0.98 and 0.78 for loamy sand and silty loam respectively). However, the cerium content in radish shoots only exhibited strong correlations with F1 (r 2  = 0.97 and 0.89 for loamy sand and silty loam respectively). Overall, the results demonstrated that soil properties are important factors governing the distribution of CeO 2 NPs in soil and subsequent bioavailability to plants. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Coulometric microdetermination of organic compounds with manganese(III) and cerium(IV)

International Nuclear Information System (INIS)

Chateau-Gosselin, M.; Patriarche, G.J.

1977-01-01

The oxidation of compounds such as hydroquinon, p-aminophenol, paracetamol and phenacetin was performed using cerium(IV) and manganese(III) coulometrically electrogenerated. Quantitative results obtained are excellent even at the microscale level. (author)

21 CFR 146.135 - Orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice. 146.135 Section 146.135 Food and....135 Orange juice. (a) Orange juice is the unfermented juice obtained from mature oranges of the... name of the food is “orange juice”. The name “orange juice” may be preceded on the label by the...

Effect of coating parameters on the microstructure of cerium oxide conversion coatings

Energy Technology Data Exchange (ETDEWEB)

Johnson, Benedict Y.; Edington, Joe; O' Keefe, Matthew J

2003-11-25

The microstructure and morphology of cerium oxide conversion coatings prepared under different deposition conditions were characterized by transmission electron microscopy (TEM). The coatings were formed by a spontaneous reaction between a water-based solution containing CeCl{sub 3} and aluminum alloy 7075-T6 substrates. Microstructural characterization was performed to determine the crystallinity of the coatings and to obtain a better understanding of the deposition parameters on coating microstructure. The results of TEM imaging and electron diffraction analysis indicated that the as-deposited coating was composed of nanocrystalline particles of a previously unreported cerium compound. The particles of the coatings produced using glycerol as an additive were found to be much finer than those of the coatings prepared in the absence of glycerol. This indicates that glycerol may act as a grain refiner and/or growth inhibitor during coating deposition. After deposition, the coated panels were treated for 5 min in a phosphate sealing solution. The sealing treatment converted the as-deposited coating into hydrated cerium phosphate. Panels coated from solutions containing no glycerol followed by phosphate sealing performed poorly in salt fog tests. With glycerol addition, the corrosion resistance of the coatings that were phosphate sealed improved considerably, achieving an average passing rate of 85%.

Ultrathin, epitaxial cerium dioxide on silicon

Energy Technology Data Exchange (ETDEWEB)

Flege, Jan Ingo, E-mail: flege@ifp.uni-bremen.de; Kaemena, Björn; Höcker, Jan; Schmidt, Thomas; Falta, Jens [Institute of Solid State Physics, University of Bremen, Otto-Hahn-Allee 1, 28359 Bremen (Germany); Bertram, Florian [Photon Science, Deutsches Elektronensynchrotron (DESY), Notkestraße 85, 22607 Hamburg (Germany); Wollschläger, Joachim [Department of Physics, University of Osnabrück, Barbarastraße 7, 49069 Osnabrück (Germany)

2014-03-31

It is shown that ultrathin, highly ordered, continuous films of cerium dioxide may be prepared on silicon following substrate prepassivation using an atomic layer of chlorine. The as-deposited, few-nanometer-thin Ce{sub 2}O{sub 3} film may very effectively be converted at room temperature to almost fully oxidized CeO{sub 2} by simple exposure to air, as demonstrated by hard X-ray photoemission spectroscopy and X-ray diffraction. This post-oxidation process essentially results in a negligible loss in film crystallinity and interface abruptness.

Evaluation of mechanically treated cerium (IV) oxides as corrosion inhibitors for galvanized steel

Energy Technology Data Exchange (ETDEWEB)

Deflorian, F., E-mail: flavio.deflorian@ing.unitn.it [Department of Materials Engineering and Industrial Technology, University of Trento, Via Mesiano 77, 38123 Trento (Italy); Fedel, M.; Rossi, S. [Department of Materials Engineering and Industrial Technology, University of Trento, Via Mesiano 77, 38123 Trento (Italy); Kamarchik, P. [PPG Industries, Coatings Innovation Center, 4325 Rosanna Drive, Allison Park, PA 15101 (United States)

2011-09-30

The use of cerium salts as corrosion inhibitors for hot dip galvanized steel has been object of a numerous studies in the last few years. The role of cerium ions as corrosion inhibitors was proved: cerium is able to block the cathodic sites of the metal, forming insoluble hydroxides and oxides on the zinc surface. This fact leads to a dramatic decrease of the cathodic current densities and, therefore, to a reduction the overall corrosion processes. On the other hand, the potential of cerium oxides as corrosion inhibitors was also proposed. However, the real effectiveness of this kind of anticorrosive pigments has not been clarified yet. In this work cerium (IV) oxides are considered as corrosion inhibitors for galvanized steel. The corrosion inhibition mechanism of mechanically treated (milled) CeO{sub 2} alone and in combination with milled SiO{sub 2} nanoparticles was investigated. For this purpose milled CeO{sub 2}, CeO{sub 2} and SiO{sub 2} milled together and milled SiO{sub 2} particles were studied as corrosion inhibitors in water solution. Therefore, the different mechanically treated particles were dispersed in 0.1 M NaCl solution to test their effectiveness as corrosion inhibitors for galvanized steel. The galvanized steel was immersed in the different solutions and the corrosion inhibition efficiency of the different particles was measured by means of electrochemical techniques. For this purpose, electrochemical impedance spectroscopy (EIS) measurements were carried out, monitoring the evolution of the corrosion processes occurring at the metal surface with the immersion time in the solution. The effect of the different pigments was also investigated by carrying out anodic and cathodic polarization measurements. The polarization curves were acquired under conditions of varied pH. The experimental measurements suggest that the mechanical treatment performed on the SiO{sub 2} and CeO{sub 2} particles promote the formation of an effective corrosion pigment

EXAFS and XANES analysis of plutonium and cerium edges from titanate ceramics for fissile materials disposal

International Nuclear Information System (INIS)

Fortner, J. A.; Kropf, A. J.; Bakel, A. J.; Hash, M. C.; Aase, S. B.; Buck, E. C.; Chamerlain, D. B.

1999-01-01

We report x-ray absorption near edge structure (XANES) and extended x-ray absorption fine structure (EXAFS) spectra from the plutonium L III edge and XANES from the cerium L II edge in prototype titanate ceramic hosts. The titanate ceramics studied are based upon the hafnium-pyrochlore and zirconolite mineral structures and will serve as an immobilization host for surplus fissile materials, containing as much as 10 weight % fissile plutonium and 20 weight % (natural or depleted) uranium. Three ceramic formulations were studied: one employed cerium as a ''surrogate'' element, replacing both plutonium and uranium in the ceramic matrix, another formulation contained plutonium in a ''baseline'' ceramic formulation, and a third contained plutonium in a formulation representing a high-impurity plutonium stream. The cerium XANES from the surrogate ceramic clearly indicates a mixed III-IV oxidation state for the cerium. In contrast, XANES analysis of the two plutonium-bearing ceramics shows that the plutonium is present almost entirely as Pu(IV) and occupies the calcium site in the zirconolite and pyrochlore phases. The plutonium EXAFS real-space structure shows a strong second-shell peak, clearly distinct from that of PuO 2 , with remarkably little difference in the plutonium crystal chemistry indicated between the baseline and high-impurity formulations

Implementation of a complex multi-phase equation of state for cerium and its correlation with experiment

Energy Technology Data Exchange (ETDEWEB)

Cherne, Frank J [Los Alamos National Laboratory; Jensen, Brian J [Los Alamos National Laboratory; Elkin, Vyacheslav M [VNIITF

2009-01-01

The complexity of cerium combined with its interesting material properties makes it a desirable material to examine dynamically. Characteristics such as the softening of the material before the phase change, low pressure solid-solid phase change, predicted low pressure melt boundary, and the solid-solid critical point add complexity to the construction of its equation of state. Currently, we are incorporating a feedback loop between a theoretical understanding of the material and an experimental understanding. Using a model equation of state for cerium we compare calculated wave profiles with experimental wave profiles for a number of front surface impact (cerium impacting a plated window) experiments. Using the calculated release isentrope we predict the temperature of the observed rarefaction shock. These experiments showed that the release state occurs at different magnitudes, thus allowing us to infer where dynamic {gamma} - {alpha} phase boundary is.

Colloidal stabilization of cerium-gadolinium oxide (CGO) suspensions via rheology

DEFF Research Database (Denmark)

Marani, Debora; Sudireddy, Bhaskar Reddy; Bentzen, Janet Jonna

2015-01-01

colloidally stable state. The method was applied to explore the ability of four commercial dispersants (acidic affine, neutral, basic affine, and polyvinylpyrrolidone (PVP)) to disperse cerium-gadolinium oxide (CGO) in ethanol. Only the acidic affine and the PVP dispersants were found to efficiently disperse...

Gas sensing behaviour of cerium oxide and magnesium aluminate

Indian Academy of Sciences (India)

Gas sensing behaviour of cerium oxide and magnesium aluminate composites ... A lone pairof the electron state was identified from the electro paramagnetic ... carbon monoxide (CO) (at 0.5, 1.0 and 1.5 bar) and ethanol (at 50 and 100 ppm) was ... The magnitude of the temperature varied linearly regardless of the gas ...

CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.

Science.gov (United States)

Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco

2016-10-01

Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.

Exposure and Health Effects Review of Engineered Nanoscale Cerium and Cerium Dioxide Associated with its Use as a Fuel Additive - NOW IN PRINT IN THE JOURNAL

Science.gov (United States)

Advances of nanoscale science have produced nanomaterials with unique physical and chemical properties at commercial levels that are now incorporated into over 1000 products. Nanoscale cerium (di) oxide (Ce02) has recently gained a wide range of applications which includes coatin...

Study of cyclic oxidation for stainless steels AISI 309 T 253 M A, with low additions of cerium

International Nuclear Information System (INIS)

Velazquez F, G.L.; Martinez, M.; Ruiz, A.

1998-01-01

It has been detected that the addition of small amounts (<1%) of the so called 'reactive elements' such as Cerium to Fe-Cr alloys that was utilized in oxidating environment at high temperatures improving its resistance to oxidation under isothermal and cyclic conditions. In this work, it was evaluated the behavior under cyclic oxidation conditions for an austenitic stainless steel at chromium-nickel (253MA) with cerium addition, and comparing it with the AISI 310S austenitic stainless steel. The cyclic oxidation essays consist of five cycles by 24 hours each one, following of a cooling in air until ambient temperature from the temperatures of 850, 900 and 950 Centigrade, registering the gain mass of the specimen at end of each cycle. In order to this were prepared samples with dimensions of 20 mm. x 10 mm. x 1 mm. Later to the oxidation essays was evaluated the morphology of the corrosion products layer by scanning electron microscopy. The present phases were identified by X-ray diffraction and by chemical microanalysis by Dispersive energy (EDAX). The results obtained show that the steel with cerium addition, presents a higher adherence and resistance to the spalling noting that the cerium promotes the casting anchor of the oxides layer to matrix and by reducing the grain size of the layer improving its plasticity. Additionally the cerium promotes the preferential oxidation of the forming elements of protective layers like the chromium. (Author)

Influence of preliminary deformation and phase strengthening on γ reversible α transformation kinetics in cerium under pressure

International Nuclear Information System (INIS)

Larionov, L.V.; Livshits, L.D.; Peresada, G.I.; AN SSSR, Moscow. Inst. Fiziki Zemli)

1985-01-01

Using the methods of piezo- and resistometry the influence of preliminary plastic deformation, phase transformation induced strengthening and heat treatment on kinetics of γ reversible α transformation in cerium is studied. It is shown, that the used methods of preliminary treatment of sample material do not change pressure value of γ → α and α →γ transformation initiation and do not affect hysteresis value, but affect considerably its kinetics. Preliminary plastic deformation and structural strengthening increase the average formation rate of a new phase. According to the data of tensile tests, structural strengthening, apprearing as a result of one cycle of γ → α → γ transformation, increases cerium strength characteristics 6y 30-50% with simultaneous decrease in plasticity. Metallographic studies confirm martensitic character of γ → α → γ transformations in cerium

Photocatalytic action of cerium molybdate and iron-titanium oxide hollow nanospheres on Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Kartsonakis, I. A., E-mail: ikartsonakis@ims.demokritos.gr; Kontogiani, P.; Pappas, G. S.; Kordas, G. [NCSR ' DEMOKRITOS' , Sol-Gel Laboratory, Institute of Advanced Materials, Physicochemical Processes, Nanotechnology and Microsystems (Greece)

2013-06-15

This study is focused on the production of hollow nanospheres that reveal antibacterial action. Cerium molybdate and iron-titanium oxide hollow nanospheres with a diameter of 175 {+-} 15 and 221 {+-} 10 nm, respectively, were synthesized using emulsion polymerization and the sol-gel process. Their morphology characterization was accomplished using scanning electron microscopy. Their antibacterial action was examined on pure culture of Escherichia coli considering the loss of their viability. Both hollow nanospheres presented photocatalytic action after illumination with blue-black light, but those of cerium molybdate also demonstrated photocatalytic action in the dark. Therefore, the produced nanospheres can be used for antibacterial applications.

13 CFR 146.500 - Secretary of Defense.

Science.gov (United States)

2010-01-01

... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Secretary of Defense. 146.500 Section 146.500 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING..., a covered Federal action from the prohibition whenever the Secretary determines, in writing, that...

13 CFR 146.600 - Semi-annual compilation.

Science.gov (United States)

2010-01-01

... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Semi-annual compilation. 146.600 Section 146.600 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING.... (c) Information that involves intelligence matters shall be reported only to the Select Committee on...

Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle.

Science.gov (United States)

Wang, Xing Ping; Luoreng, Zhuo Ma; Zan, Lin Sen; Raza, Sayed Haidar Abbas; Li, Feng; Li, Na; Liu, Shuan

2016-10-01

This study reports a significant up-regulation of bta-miR-146a and bta-miR-146b expression levels in bovine mammary tissues infected with subclinical, clinical and experimental mastitis. Potential target genes are involved in multiple immunological pathways. These results suggest a regulatory function of both miRNAs for the bovine inflammatory response in mammary tissue. Copyright © 2016 Elsevier Ltd. All rights reserved.

Dicty_cDB: AFO146 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available GTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAAXXXXXXXXXXTGTCGAATGTCCAGATTTCCATANA...AAAAA---------- Length of 5' end seq. 141 3' end seq. ID AFO146Z 3' end seq. >AFO146Z.Seq ----------TGTCGAATGTCCAGATTTCCATANA...AAAAAAGTTAAAATTAAATTTGTAAAATCAATTTGTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAA----------TGTCGAATGTCCAGATTTCCATANA

Evaluation of Antiproliferative Potential of Cerium Oxide Nanoparticles on HeLa Human Cervical Tumor Cell

Directory of Open Access Journals (Sweden)

Zoriţa Diaconeasa

2015-05-01

Full Text Available Cerium oxide nanoparticles (CeO2 nanoparticles as nanomaterials have promising biomedical applications. In this paper, the cytotoxicity induced by CONPs human cervical tumor cells was investigated. Cerium oxide nanoparticles were synthesized using the precipitation method. The nanoparticles were found to inhibit the proliferation of HeLa human cervical tumor cells in a dose dependent manner but did not showed to be cytotoxic as analyzed by MTT assay. The administrated treatment decreased the HeLa cell viability cells from 100% to 65% at the dose of 100 μg/mL.

29 CFR 4.146 - Contract obligations after award, generally.

Science.gov (United States)

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Contract obligations after award, generally. 4.146 Section 4.146 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Period of Coverage § 4.146 Contract obligations after...

34 CFR 300.146 - Responsibility of SEA.

Science.gov (United States)

2010-07-01

... special education and related services— (1) In conformance with an IEP that meets the requirements of... 34 Education 2 2010-07-01 2010-07-01 false Responsibility of SEA. 300.146 Section 300.146 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION...

The kinetics of the cerium(IV)-uranium(IV) reaction at low sulfate concentrations

International Nuclear Information System (INIS)

Michaille, P.; Kikindai, T.

1977-01-01

The rate of oxidation of uranium(IV) by cerium(IV) was measured with a stopped-flow spectrophotometer at sulfuric acid concentrations of 2 x 10 -6 to 0.5 M. At a constant hydrogen ion concentration of 0.5 M, the maximum rate constant was observed for 2 x 10 -3 M sulfuric acid; at that concentration, two sulfate ions were involved in the activated complex. The dependence of the rate constant on the hydrogen ion concentration showed that the reaction paths involving one or two sulfate ions also involved one hydroxyl ion, whereas one hydrogen ion was involved in the five sulfate dependent path. Spectrophotometric measurements supported the existence of a hydrolyzed monosulfatocomplex of cerium(IV). (author)

Correlation of the oxidation state of cerium in sol-gel glasses as a function of thermal treatment via optical spectroscopy and XANES studies.

Science.gov (United States)

Assefa, Zerihun; Haire, R G; Caulder, D L; Shuh, D K

2004-07-01

Sol-gel glass matrices containing lanthanides have numerous technological applications and their formation involves several chemical facets. In the case of cerium, its ability to exist in two different oxidation states or in mixed valence state provides additional complexities for the sol-gel process. The oxidation state of cerium present during different facets of preparation of sol-gel glasses, and also as a function of the starting oxidation state of cerium added, were studied both by optical spectroscopy and X-ray absorption near-edge structures (XANES). The findings acquired by each approach were compared. The primary focus was on the redox chemistries associated with sample preparation, gelation, and thermal treatment. When Ce3+ is introduced into the starting sols, the trivalent state normally prevails in the wet and room temperature-dried gels. Heating in air at >100 degrees C can generate a light yellow coloration with partial oxidation to the tetravalent state. Above 200 degrees C and up to approximately 1000 degrees C, cerium is oxidized to its tetravalent state. In contrast, when tetravalent cerium is introduced into the sol, both the wet and room temperature-dried gels lose the yellow-brown color of the initial ceric ammonium nitrate solution. When the sol-gel is heated to 110 degrees C it turns yellowish as the cerium tends to be re-oxidized. The yellow color is believed to represent the effect of oxidation and oligomerization of the cerium-silanol units in the matrix. The luminescence properties are also affected by these changes, the details of which are reported herein.

19 CFR 146.93 - Inventory control and recordkeeping system.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Inventory control and recordkeeping system. 146.93... § 146.93 Inventory control and recordkeeping system. (a) Attribution. All final products removed from or... provided for under § 146.95(b) of this subpart. (3) Other inventory method. An operator may use the FIFO...

Thermal expansion and transformation behavior of cerium and plutonium alloys: an application of the Aptekar-Ponyatovsky regular solution model.

Science.gov (United States)

Lawson, A C; Lashley, J C

2011-09-14

In this paper we apply the Aptekar-Ponyatovsky (AP) regular solution thermodynamic model to the analysis of experimental data for the coefficient of thermal expansion (CTE) and determine the AP model parameters for unalloyed cerium metal, Ce-Th-La alloys, and Pu-Ga alloys. We find that the high temperature CTE of cerium metal follows the predictions of the AP model based on low temperature, high pressure data. For Ce-Th-La alloys we use the AP parameters to track the suppression of the first-order γ-α cerium transition. We show the AP model accounts for the negative CTE observed for Pu-Ga alloys and is equivalent to an earlier invar model. Finally, we apply the AP parameters obtained for Pu-Ga alloys to rationalize the observed δ-α transformation pressures of these alloys. We show that the anomalous values of the Grüneisen and Grüneisen-Anderson parameters are important features of the thermal properties of plutonium. A strong analogy between the properties of plutonium and cerium is confirmed.

New AMS method to measure the atom ratio {sup 146}Sm/{sup 147}Sm for a half-life determination of {sup 146}Sm

Energy Technology Data Exchange (ETDEWEB)

Kinoshita, N. [Tandem Accelerator Complex, Research Facility Center for Science and Technology, University of Tsukuba (Japan); Paul, M., E-mail: paul@vms.huji.ac.il [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Alcorta, M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Bowers, M.; Collon, P. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Deibel, C.M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Joint Institute for Nuclear Astrophysics, Michigan State University, East Lansing, MI 46624 (United States); DiGiovine, B. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Goriely, S. [Universite Libre de Bruxelles, CP-226, Brussels 1050 (Belgium); Greene, J.P.; Henderson, D.J.; Jiang, C.L. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Kashiv, Y. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Kay, B.P.; Lee, H.Y.; Marley, S.T. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Nakanishi, T. [Faculty of Chemistry, Institute of Science and Engineering, Kanazawa University (Japan); Pardo, R.C.; Patel, N.; Rehm, K.E. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Robertson, D. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); and others

2013-01-15

The extinct p-process nuclide {sup 146}Sm (t{sub 1/2} = 103 {+-} 5 Myr) is known to have been present in the Early-Solar System and has been proposed as an astrophysical chronometer. {sup 146}Sm is also intensely used to date meteorite and planetary differentiation processes, enhancing the importance of an accurate knowledge of the {sup 146}Sm half-life. We are engaged in a new determination of the {sup 146}Sm half-life in which the {sup 146}Sm/{sup 147}Sm atom ratio is determined by accelerator mass spectrometry at the ATLAS facility of Argonne National Laboratory. In order to reduce systematic errors in the AMS determination of the {sup 146}Sm/{sup 147}Sm ratios (in the range of 10{sup -7}-10{sup -9}), {sup 146}Sm and {sup 147}Sm ions were alternately counted in the same detector in the focal plane of a gas-filled magnet, respectively in continuous-wave and attenuated mode. Quantitative attenuation is obtained with the 12 MHz pulsed and ns-bunched ATLAS beam by chopping beam pulses with an RF sweeper in a ratio (digitally determined) down to 1:10{sup 6}. The experiments and preliminary results are discussed.

Electrochemical separation of cerium and yttrium in molten chlorides on liquid-metallic electrodes

International Nuclear Information System (INIS)

Yamshchikov, L.F.; Lebedev, V.A.; Nichkov, I.F.

1978-01-01

An estimating calculation of the coefficients of separation of cerium and yttrium in the process of electrolysis in molten salts on liquid electrodes of aluminium, gallium, indium, lead, tin, antimonium and zinc is carried out. The calculation of the separation coefficients was carried out according to the known values of activation coefficients of cerium and yttrium in fusible metals. The electrolysis was carried out at 973 K in the argon air in the cell with an eutectic mixture of NaCl and KCl as an elactrolyte. It is shown that the salten phase is concentrated by yttrium, and the melallic one- by cerium on all the electrodes. The value of the separation coefficient of Ce and Y is considerably high and continuously increases on the fusible metals in the Zn, In, Ga, Al, Pb, Sn, Sb series. The experimental values of the separation coefficients practically coincide with the theoretically calculated ones, testifying to the possibility of the effective separation of elements even in a single-staged possibility of the effective separation of elements even in a single-staged process. An electrolysis of molten salts is not inferior in its selectivity to the universally recognized methods of the fine purification of substances permitting to separate Ce and Y with the Ksub(sep) approximately equal to 10

Study of cerium doped magnetite (Fe{sub 3}O{sub 4}:Ce)/PMMA nanocomposites

Energy Technology Data Exchange (ETDEWEB)

Padalia, Diwakar, E-mail: Padalia.diwakar@gmail.com [Department of Physics, G.B. Pant University of Agriculture and Technology, Pantnagar, Uttrakhand (India); Johri, U.C. [Department of Physics, G.B. Pant University of Agriculture and Technology, Pantnagar, Uttrakhand (India); Zaidi, M.G.H. [Supercritical Fluid Processing Laboratory, Department of Chemistry, G.B. Pant University of Agriculture and Technology, Pantnagar, Uttrakhand (India)

2012-03-01

The paper presents the synthesis and properties of polymer nanocomposite material based on cerium doped magnetite (Fe{sub 3}O{sub 4}) as filler material and poly methyl methacrylate (PMMA) as host matrix. The magnetite (Fe{sub 3}O{sub 4}) particles were synthesized by co-precipitation route using stable ferrous and ferric salts with ammonium hydroxide as precipitating agent. Further, they doped by cerium oxide (CeO{sub 2}) non-stoichiometrically. The composite material was fabricated by solvent evaporation method. Here 2.4 GHz microwaves were used to study the effect of microwaves heating on polymerization. The phase and crystal structure is determined by X-ray diffraction (XRD). The average crystallite size of the composites varies from 28 to 35 nm. The chemical structure is confirmed by Fourier transform infrared (FTIR) spectroscopy. The magnetic and thermal properties are investigated by vibrating sample magnetometer (VSM) and differential scanning calorimetry (DSC). The thermal study shows that the microwave heated samples possess higher glass transition temperature (T{sub g}). The magnetic results suggest that coercivity (H{sub C}) and squareness (M{sub r}/M{sub s}) of the loop increases with increasing doping percent of cerium.

Characterization of composite metal-ceramic of nickel-oxide cerium doped gadolinium

International Nuclear Information System (INIS)

Silva, M.L.A. da; Varela, M.C.R.S.

2016-01-01

Composite nickel doped cerium oxide are used in SOFC anode materials. In this study we evaluated the effect of the presence of gadolinium on the properties of composite nickel and ceria and. The supports were synthesized by sol-gel method. The impregnation with nickel nitrate was taken sequentially, followed by calcination. The materials were characterized by X-ray diffraction, measurement of specific surface area, temperature programmed reduction, Raman spectroscopy. The presence of gadolinium retained the fluorite structure of ceria by forming a solid solution, also not influencing significantly on the specific surface area of the support. On the other hand, there was a decrease in the area catalysts, which can be attributed to sintering of nickel. Furthermore, addition of gadolinium favored the formation of intrinsic and extrinsic vacancies in cerium oxide, which leads to an increase in the ionic conductivity of the solid, desirable property for an SOFC anode catalyst. (author)

Growth of monodisperse nanocrystals of cerium oxide during synthesis and annealing

International Nuclear Information System (INIS)

Ghosh, Swapankumar; Divya, Damodaran; Remani, Kottayilpadi C.; Sreeremya, Thadathil S.

2010-01-01

Monodisperse cerium oxide nanocrystals have been successfully synthesised using simple ammonia precipitation technique from cerium(III) nitrate solution at different temperatures in the range 35-80 o C. The activation energy for growth of CeO 2 nanocrystals during the precipitation is calculated as 11.54 kJ/mol using Arrhenius plot. Average crystal diameter was obtained from XRD analysis, HR-TEM and light scattering (PCS). The analysis of size data from HR-TEM images and PCS clearly indicated the formation of highly crystalline CeO 2 particles in narrow size range. CeO 2 nanocrystals precipitated at 35 o C were further annealed at temperatures in the range 300-700 o C. The activation energy for crystal growth during annealing is also calculated and is close to the reported values. An effort is made to predict the mechanism of crystal growth during the precipitation and annealing.

Molecular absorption spectra of beryllium, cerium, lanthanum, iron, and platinum salts

International Nuclear Information System (INIS)

Daidoji, Hidehiro

1980-01-01

The absorption spectra of some salts of beryllium, cerium, lanthanum, iron and platinum in air-acetylene flame were measured in the wavelength range from 200 to 400 nm. A Hitachi 207 type atomic absorption spectrophotometer was used. A deuterium lamp, a home-made continuous radiation lamp and some hollow cathode lamps were used as light sources. The new molecular absorption spectra of cerium, lanthanum and platinum and the absorption spectra due to Be(OH) 2 , LaO, PtH, FeO and FeCl in 200-400 nm region were obtained. Emission spectra of CeO, LaO and FeOH were also obtained. These molecular absorption bands were estimated as absorption errors of maximum 15 times to the sensitivity of each elements in atomic absorption spectrometry. In addition, spectral line interferences of iron were observed in atomic absorption spectrometry of Zn, Cd, Ni, Cu and Cr. (author)

Preparation and characterization of gelatin/cerium(Ⅲ) film

Institute of Scientific and Technical Information of China (English)

黄崇军; 黄雅钦; 田娜; 童元建; 殷瑞贤

2010-01-01

A novel gelatin film with antibacterial activity was prepared by electrostatic crosslinking using cerium (Ⅲ) nitrate hexahydrate as the crosslinking agent. The structure and properties of the films were investigated by Fourier transform infrared spectra, tensile tests, thermogravimetric analysis, static drop contact angle and disc diffusion method. The results showed that cross-linking could not only improve the thermal and mechanical properties and lower the hydrophilic property of the films, but also make...

Photocatalytic action of cerium molybdate and iron-titanium oxide hollow nanospheres on Escherichia coli

International Nuclear Information System (INIS)

Kartsonakis, I. A.; Kontogiani, P.; Pappas, G. S.; Kordas, G.

2013-01-01

This study is focused on the production of hollow nanospheres that reveal antibacterial action. Cerium molybdate and iron-titanium oxide hollow nanospheres with a diameter of 175 ± 15 and 221 ± 10 nm, respectively, were synthesized using emulsion polymerization and the sol–gel process. Their morphology characterization was accomplished using scanning electron microscopy. Their antibacterial action was examined on pure culture of Escherichia coli considering the loss of their viability. Both hollow nanospheres presented photocatalytic action after illumination with blue–black light, but those of cerium molybdate also demonstrated photocatalytic action in the dark. Therefore, the produced nanospheres can be used for antibacterial applications.

Preparation of Carbon-Platinum-Ceria and Carbon-Platinum-Cerium catalysts and its application in Polymer Electrolyte Fuel Cell: Hydrogen, Methanol, and Ethanol

Science.gov (United States)

Guzman Blas, Rolando Pedro

This thesis is focused on fuel cells using hydrogen, methanol and ethanol as fuel. Also, in the method of preparation of catalytic material for the anode: Supercritical Fluid Deposition (SFD) and impregnation method using ethylenediaminetetraacetic acid (EDTA) as a chelating agent. The first part of the thesis describes the general knowledge about Hydrogen Polymer Exchange Membrane Fuel Cell (HPEMFC),Direct Methanol Fuel Cell (DMFC) and Direct Ethanol Fuel Cell (DEFC), as well as the properties of Cerium and CeO2 (Ceria). The second part of the thesis describes the preparation of catalytic material by Supercritical Fluid Deposition (SFD). SFD was utilized to deposit Pt and ceria simultaneously onto gas diffusion layers. The Pt-ceria catalyst deposited by SFD exhibited higher methanol oxidation activity compared to the platinum catalyst alone. The linear sweep traces of the cathode made for the methanol cross over study indicate that Pt-Ceria/C as the anode catalyst, due to its better activity for methanol, improves the fuel utilization, minimizing the methanol permeation from anode to cathode compartment. The third and fourth parts of the thesis describe the preparation of material catalytic material Carbon-Platinum-Cerium by a simple and cheap impregnation method using EDTA as a chelating agent to form a complex with cerium (III). This preparation method allows the mass production of the material catalysts without additional significant cost. Fuel cell polarization and power curves experiments showed that the Carbon-Platinum-Cerium anode materials exhibited better catalytic activity than the only Vulcan-Pt catalysts for DMFC, DEFC and HPEMFC. In the case of Vulcan-20%Pt-5%w Cerium, this material exhibits better catalytic activity than the Vulcan-20%Pt in DMFC. In the case of Vulcan-40% Pt-doped Cerium, this material exhibits better catalytic activity than the Vulcan-40% Pt in DMFC, DEFC and HPEMFC. Finally, I propose a theory that explains the reason why the

Ab initio molecular dynamics study of the properties of cerium in liquid sodium at 1000 K temperature

Energy Technology Data Exchange (ETDEWEB)

Samin, Adib; Li, Xiang; Zhang, Jinsuo [Nuclear Engineering Program, Department of Mechanical and Aerospace Engineering, The Ohio State University, 201 W 19th Avenue, Columbus, Ohio 43210 (United States); Mariani, R. D. [Idaho National Laboratory, Materials and Fuels Complex, Idaho Falls, Idaho 83415 (United States); Unal, Cetin [Los Alamos National Laboratory, P.O. Box 1663, Los Alamos, New Mexico 87545 (United States)

2015-12-21

For liquid-sodium-cooled fast nuclear reactor systems, it is crucial to understand the behavior of lanthanides and other potential fission products in liquid sodium or other liquid metal solutions such as liquid cesium-sodium. In this study, we focus on lanthanide behavior in liquid sodium. Using ab initio molecular dynamics, we found that the solubility of cerium in liquid sodium at 1000 K was less than 0.78 at. %, and the diffusion coefficient of cerium in liquid sodium was calculated to be 5.57 × 10{sup −9} m{sup 2}/s. Furthermore, it was found that cerium in small amounts may significantly alter the heat capacity of the liquid sodium system. Our results are consistent with the experimental results for similar materials under similar conditions.

Immunohistochemical Expression of MCAM/CD146 in Canine Melanoma.

Science.gov (United States)

Abou Asa, S

2017-07-01

MCAM/CD146 (melanoma cell adhesion molecule/CD146) is a transmembrane immunoglobulin superfamily cell adhesion molecule involved in transendothelial migration and signal transduction. It is expressed in melanoma, squamous cell carcinoma, prostatic, ovarian, cervical and endometrial cancers and promotes tumour growth, angiogenesis and metastasis. Melanoma is the most common malignant oral tumour of dogs and also arises in the skin, nail bed and footpad. The aim of this study was to investigate the immunohistochemical expression of MCAM/CD146 in 51 canine melanomas, including oral, cutaneous and ocular tumours. Seventeen of the 51 (33.3%) cases were negative, eight (15.7%) were weakly positive, seven (13.7%) were moderately positive and 19 (37.3%) were strongly positive. MCAM/CD146 was expressed by both oral and cutaneous melanomas; however, the intensity and the extent of the immunoreactivity was higher in oral (P = 0.009) than in cutaneous tumours (P = 0.058). Most ocular melanomas did not express MCAM/CD146 (P = 0.256). Expression of MCAM/CD146 by canine melanomas may suggest the molecule as a target for treatment, especially in oral melanomas. Copyright © 2017 Elsevier Ltd. All rights reserved.

Performance characteristics of silver cerium vanadate batteries

OpenAIRE

Arof , Abdul; Kamaluddin , Burhanuddin; Radhakrishna , S.

1993-01-01

Stoichiometric ratios of AR grade AgI, Ag2O, V2O5 and CeO2 were melted in a furnace and the melt was rapidly quenched to liquid nitrogen temperature to form a glass. The glassy nature of the sample has been confirmed by powder X-ray diffraction technique. The microstructure and microanalysis studies of the silver cerium vanadate (SCV) have been carried out by scanning electron microscopy (SEM) and energy dispersive analysis of X-rays (EDAX). The SEM micrograph of the as-quenched melt showed c...

Growth of monodisperse nanocrystals of cerium oxide during synthesis and annealing

Energy Technology Data Exchange (ETDEWEB)

Ghosh, Swapankumar, E-mail: swapankumar.ghosh2@mail.dcu.ie; Divya, Damodaran [National Institute for Interdisciplinary Science and Technology (NIIST), Council of Scientific and Industrial Research (CSIR) (India); Remani, Kottayilpadi C. [Sree Neelakanda Government Sanskrit College, Department of Chemistry (India); Sreeremya, Thadathil S. [National Institute for Interdisciplinary Science and Technology (NIIST), Council of Scientific and Industrial Research (CSIR) (India)

2010-06-15

Monodisperse cerium oxide nanocrystals have been successfully synthesised using simple ammonia precipitation technique from cerium(III) nitrate solution at different temperatures in the range 35-80 {sup o}C. The activation energy for growth of CeO{sub 2} nanocrystals during the precipitation is calculated as 11.54 kJ/mol using Arrhenius plot. Average crystal diameter was obtained from XRD analysis, HR-TEM and light scattering (PCS). The analysis of size data from HR-TEM images and PCS clearly indicated the formation of highly crystalline CeO{sub 2} particles in narrow size range. CeO{sub 2} nanocrystals precipitated at 35 {sup o}C were further annealed at temperatures in the range 300-700 {sup o}C. The activation energy for crystal growth during annealing is also calculated and is close to the reported values. An effort is made to predict the mechanism of crystal growth during the precipitation and annealing.

An Auger and XPS survey of cerium active corrosion protection for AA2024-T3 aluminum alloy

Energy Technology Data Exchange (ETDEWEB)

Uhart, A. [IPREM-ECP-UMR CNRS 5254, Université de Pau et des Pays de l' Adour, Technopole Hélioparc, 2 Avenue Président Pierre Angot, 64053 Pau Cedex 09 (France); Ledeuil, J.B. [IPREM-ECP-UMR CNRS 5254, Université de Pau et des Pays de l' Adour, Technopole Hélioparc, 2 Avenue Président Pierre Angot, 64053 Pau Cedex 09 (France); Université de Toulouse, UPS-INP-CNRS, Institut Carnot CIRIMAT, 118 Route de Narbonne, 31062 Toulouse Cedex 09 (France); Gonbeau, D. [IPREM-ECP-UMR CNRS 5254, Université de Pau et des Pays de l' Adour, Technopole Hélioparc, 2 Avenue Président Pierre Angot, 64053 Pau Cedex 09 (France); Dupin, J.C., E-mail: dupin@univ-pau.fr [IPREM-ECP-UMR CNRS 5254, Université de Pau et des Pays de l' Adour, Technopole Hélioparc, 2 Avenue Président Pierre Angot, 64053 Pau Cedex 09 (France); Bonino, J.P.; Ansart, F. [Université de Toulouse, UPS-INP-CNRS, Institut Carnot CIRIMAT, 118 Route de Narbonne, 31062 Toulouse Cedex 09 (France); Esteban, J. [Messier-Bugatti-Dowty, Etablissement de Molsheim, 3, rue Antoine de St Exupéry, 67129 Molsheim (France)

2016-12-30

Graphical abstract: Coupled SAM/SEM survey of cerium inhibitor migration towards corrosion pits in a conversion coating over AA2024-T3 substrate. - Highlights: • XPS evidenced the proximity of the inhibitor with the surface AA2024 alloy. • Cerium conversion coatings with [Ce] = 0.1 M offer the best corrosion resistance. • SAM shown the migration of Ce + III entities towards the corrosion pits or crevices. • High resolution analyses (Auger) connecting the nano-scale order with the chemical distribution.

Cerium chloride stimulated controlled conversion of B-to-Z DNA in self-assembled nanostructures

International Nuclear Information System (INIS)

Bhanjadeo, Madhabi M.; Nayak, Ashok K.; Subudhi, Umakanta

2017-01-01

DNA adopts different conformation not only because of novel base pairs but also while interacting with inorganic or organic compounds. Self-assembled branched DNA (bDNA) structures or DNA origami that change conformation in response to environmental cues hold great promises in sensing and actuation at the nanoscale. Recently, the B-Z transition in DNA is being explored to design various nanomechanical devices. In this communication we have demonstrated that Cerium chloride binds to the phosphate backbone of self-assembled bDNA structure and induce B-to-Z transition at physiological concentration. The mechanism of controlled conversion from right-handed to left-handed has been assayed by various dye binding studies using CD and fluorescence spectroscopy. Three different bDNA structures have been identified to display B-Z transition. This approach provides a rapid and reversible means to change bDNA conformation, which can be used for dynamic and progressive control at the nanoscale. - Highlights: • Cerium-induced B-to-Z DNA transition in self-assembled nanostructures. • Lower melting temperature of Z-DNA than B-DNA confirmed by CD spectroscopy. • Binding mechanism of cerium chloride is explained using fluorescence spectroscopy. • Right-handed to left-handed DNA conformation is also noticed in modified bDNA structure.

Assessment of the abatement of acelsulfame K using cerium doped ZnO as photocatalyst

International Nuclear Information System (INIS)

Calza, P.; Gionco, C.; Giletta, M.; Kalaboka, M.; Sakkas, V.A.; Albanis, T.; Paganini, M.C.

2017-01-01

Highlights: • Hydrothermal synthesis and characterization of Ce doped ZnO. • The abatement of ACE K is assessed in ultrapure water and in river water matrix. • Demonstrated higher degradation activity than P25 under visible light. • The degradation activity is less affected in river water than for P25. - Abstract: In the present study, we investigated the possibility to abate Acesulfame K, a persistent emerging contaminant, in aqueous media using zinc oxide based materials. For this purpose, bare and Ce-doped zinc oxide was prepared via an easy and cheap hydrothermal process using different cerium salts as precursors. Their photocatalytic performance was evaluated in different media, namely ultrapure and river water under both UV–vis and visible light. Commercial TiO_2 P25 was also employed and used as a reference photocatalyst for comparison purposes. The obtained results pointed out that cerium doped zinc oxide composites exhibit higher performance than TiO_2 P25, especially under visible light and in the presence of organic matter, when the activity of the latter is greatly depressed. In particular, ZnO doped with cerium (1%) was the most effective material, and could be a promising alternative to TiO_2 P25, especially in the treatment of natural waters.

Microstructure and electrochemical behavior of cerium conversion coating modified with silane agent on magnesium substrates

Science.gov (United States)

Lei, Li; Shi, Jing; Wang, Xin; Liu, Dan; Xu, Haigang

2016-07-01

The cerium conversion coating with and without different concentrations of silane agent bis-(γ-triethoxysilylpropyl)-tetrasulfide (BTESPT) modification is obtained on magnesium alloys. Detailed properties of the coatings and the role of BTESPT as an additive are studied and followed with careful discussion. The coating morphology, wettability, chemical composition and corrosion resistance are characterized by scanning electronic microscope (SEM), water contact-angle, X-ray photoelectron spectroscopy (XPS), potentiodynamic measurements and electrochemical impedance spectroscopy (EIS). The electrochemical behavior of the coatings is investigated using EIS. The results indicate that the coating morphology and composition can be controlled by changing silane concentration. The combination of cerium ions and silane molecules could promote the formation of more homogenous and higher hydrophobic coating. The coating turns to be more compact and the adhesive strength between the coating and the magnesium substrate are strongly improved with the formation of Sisbnd Osbnd Si and Sisbnd Osbnd M chemical bonds. The optimum corrosion resistance of the coating in the corrosive media is obtained by 25 ml L-1 BTESPT modification. This whole study implies that the cerium conversion coating modified with certain silane agent deserves cautiousness before its application for corrosion resistance.

Preparation and Characterization of Cerium (III Doped Captopril Nanoparticles and Study of their Photoluminescence Properties

Directory of Open Access Journals (Sweden)

Ghamami Shahriar

2016-01-01

Full Text Available In this research Ce3+ doped Captopril nanoparticles (Ce3+ doped CAP-NP were prepared by a cold welding process and have been studied. Captopril may be applied in the treatment of hypertension and some types of congestive heart failure and for preventing kidney failure due to high blood pressure and diabetes. CAP-NP was synthesized by a cold welding process. The cerium nitrate was added at a ratio of 10% and the optical properties have been studied by photoluminescence (PL. The synthesized compounds were characterized by Fourier transform infrared spectroscopy. The size of CAP-NP was calculated by X-ray diffraction (XRD. The size of CAP-NP was in the range of 50 nm. Morphology of surface of synthesized nanoparticles was studied by scanning electron microscopy (SEM. Finally the luminescence properties of undoped and doped CAP-NP were compared. PL spectra from undoped CAP-NP show a strong pack in the range of 546 nm after doped cerium ion into the captopril appeared two bands at 680 and 357 nm, which is ascribed to the well-known 5d–4f emission band of the cerium.

Electron donating and acid-base properties of cerium oxide and its mixed oxides with alumina

International Nuclear Information System (INIS)

Sugunan, S.; Jalaja, J.M.

1994-01-01

The electron donating properties of cerium oxide activated at 300, 500 and 800 degC and of its mixed oxides with alumina were examined based on the adsorption of electron acceptors exhibiting different electron affinities. The surface acidity/basicity of the oxides was determined by titrimetry; the H 0,max values are given. The limit of electron transfer from the oxide surface lies within the region of 1.77 and 2.40 eV in terms of the electron affinity of the electron acceptor. Cerium oxide promotes the electron donor nature of alumina while leaving the limit of electron transfer unchanged. 2 tabs., 4 figs., 13 refs

Nutritional quality assessment of tomato fruits after exposure to uncoated and citric acid coated cerium oxide nanoparticles, bulk cerium oxide, cerium acetate and citric acid.

Science.gov (United States)

Barrios, Ana Cecilia; Medina-Velo, Illya A; Zuverza-Mena, Nubia; Dominguez, Osvaldo E; Peralta-Videa, Jose R; Gardea-Torresdey, Jorge L

2017-01-01

Little is known about the effects of surface modification on the interaction of nanoparticles (NPs) with plants. Tomato (Solanum lycopersicum L.) plants were cultivated in potting soil amended with bare and citric acid coated nanoceria (nCeO 2, nCeO 2 +CA), cerium acetate (CeAc), bulk cerium oxide (bCeO 2 ) and citric acid (CA) at 0-500 mg kg -1 . Fruits were collected year-round until the harvesting time (210 days). Results showed that nCeO 2 +CA at 62.5, 250 and 500 mg kg -1 reduced dry weight by 54, 57, and 64% and total sugar by 84, 78, and 81%. At 62.5, 125, and 500 mg kg -1 nCeO 2 +CA decreased reducing sugar by 63, 75, and 52%, respectively and at 125 mg kg -1 reduced starch by 78%, compared to control. The bCeO 2 at 250 and 500 mg kg -1 , increased reducing sugar by 67 and 58%. In addition, when compared to controls, nCeO 2 at 500 mg kg -1 reduced B (28%), Fe (78%), Mn (33%), and Ca (59%). At 125 mg kg -1 decreased Al by 24%; while nCeO 2 +CA at 125 and 500 mg kg -1 increased B by 33%. On the other hand, bCeO 2 at 62.5 mg kg -1 increased Ca (267%), but at 250 mg kg -1 reduced Cu (52%), Mn (33%), and Mg (58%). Fruit macromolecules were mainly affected by nCeO 2 +CA, while nutritional elements by nCeO 2 ; however, all Ce treatments altered, in some way, the nutritional quality of tomato fruit. To our knowledge, this is the first study comparing effects of uncoated and coated nanoceria on tomato fruit quality. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Cyclic thermochemical process for producing hydrogen using cerium-titanium compounds

Science.gov (United States)

Bamberger, C.E.

A thermochemical cyclic process for producing hydrogen employs the reaction between ceric oxide and titanium dioxide to form cerium titanate and oxygen. The titanate is treated with an alkali metal hydroxide to give hydrogen, ceric oxide, an alkali metal titanate and water. Alkali metal titanate and water are boiled to give titanium dioxide which, along with ceric oxide, is recycled.

Cerium compounds in the fashion of the light actinides

International Nuclear Information System (INIS)

Koelling, D.D.

1984-01-01

Researchers familiar with the light actinides easily recognize in cerium compounds a microcosm of the rich variety of properties seen in the light actinides. The parallelism seen between comparable cerium and actinide compounds strongly suggests that the same physical models are applicable. The most significant is the relative size of the f-orbital. Localization is generally tighter in Ce compounds than uranium compounds, making Ce roughly analogous to Np through Am. A way to see the actinide parallelism is to compare Hill plots. Compounds in the different regions of the plots (representing different physics) are isostructural compounds with the same companion (B) elements. The most common materials exhibiting a direct f-f interaction are the cubic Laves compounds. Accordingly, we have determined the band structures of CeRu 2 , CeRh 2 , CeIr 2 , CeOs 2 , and CeNi 2 . Compounds illustrative of the interaction of f-orbitals with ligand orbitals are the Cu 3 Au structured materials. Materials calculated in this class are CeRh 3 , CePd 3 , and CeSn 3 - the materials of much interest as mixed valent. Although the focus is on the Ce compounds, calculations performed on uranium isomorphs are used to highlight the interesting physics

CD146 positive human dental pulp stem cells promote regeneration of dentin/pulp-like structures.

Science.gov (United States)

Matsui, Mikiko; Kobayashi, Tomoko; Tsutsui, Takeo W

2018-04-01

CD146 and STRO-1 are endothelial biomarkers that are co-expressed on the cellular membranes of blood vessels within human dental pulp tissue. This study characterized the percentage of dentin-like structures produced by CD146-positive (CD146 + ) human dental pulp stem cells (DPSCs), compared with their CD146-negative (CD146 - ) counterparts. DPSC populations were enriched using magnetic-activated cell sorting (MACS), yielding CD146 + and CD146 - cells, as well as mixtures composed of 25% CD146 + cells and 75% CD146 - cells (CD146 +/- ). Cell growth assays indicated that CD146 + cells exhibit an approximate 3-4 h difference in doubling time, compared with CD146 - cells. Cell cycle distributions were determined by flow cytometry analysis. The low percentage of CD146 + cells' DNA content in G 0 /G 1 phase were compared with CD146 - and non-separated cells. In contrast to CD146 - and non-separated cells, prompt mineralization was observed in CD146 + cells. Subsequently, qRT-PCR revealed high mRNA expression of CD146 and Alkaline phosphatase in mineralization-induced CD146 + cells. CD146 + cells were also observed high adipogenic ability by Oil red O staining. Histological examinations revealed an increased area of dentin/pulp-like structures in transplanted CD146 + cells, compared with CD146 - and CD146 +/- cells. Immunohistochemical studies detected dentin matrix protein-1 (DMP1) and dentin sialophosphoprotein (DSPP), as well as human mitochondria, in transplanted DPSCs. Co-expression of CD146 and GFP indicated that CD146 was expressed in transplanted CD146 + cells. CD146 + cells may promote mineralization and generate dentin/pulp-like structures, suggesting a role in self-renewal of stem cells and dental pulp regenerative therapy.

33 CFR 146.120 - Manning of survival craft.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Manning of survival craft. 146.120 Section 146.120 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... craft. The owner, the owner's agent, or the person in charge shall assign a person to each life float...

Far infrared properties of PbTe doped with cerium

International Nuclear Information System (INIS)

Nikolic, P.M.; Koenig, W.; Vujatovic, S.S.; Blagojevic, V.; Lukovic, D.; Savic, S.; Radulovic, K.; Urosevic, D.; Nikolic, M.V.

2007-01-01

Single crystal samples of lead telluride doped with cerium were made using the Bridgman method. Far infrared reflectivity spectra in the temperature range from 10 to 300 K are presented. The experimental data were numerically analyzed using a fitting procedure based on the plasmon-phonon interaction model and optical parameters were determined. Two additional local modes were observed at about 138 and 337 cm -1 . The origin of these local vibrational impurity modes was discussed

22 CFR 146.455 - Textbooks and curricular material.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Textbooks and curricular material. 146.455 Section 146.455 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities...

Selective anodic dissolution of cerium from aluminium alloys under potentiostatic conditions

International Nuclear Information System (INIS)

Gol'dshtejn, S.L.; Raspopin, S.P.; Seleznev, V.D.; Tunin, A.V.; Fedorov, V.A.

1975-01-01

A study was made of selective anodic dissolution of aluminum alloys containing cerium in concentrations from 0.5 to 10% by mass. The electropurification was carried out with the aid of a potentiostatic setup at 700 deg C in atmosphere of purified argon. Liquid aluminum served as the cathode, with chlorine half-cell as reference electrode and the melt of equimolar KCl-NaCl mixture as the electrolyte. The ''current-time'' plots are presented for selective ionization of cerium from aluminum alloys at preset potential values on the installation. For PHIsub(preset)=-2.04 v the current of potentiostatic electrolysis fades out to that of the supporting electrolyte, and the process itself proceeds at a rate that provides maximal extraction of cerium from the alloy (csub9finite)approximately equal to 0.002% by mass) at minimal ionization of the metalsolvent (Δ Msub(Al)approximately equal to 0.2). Alloys containing not less then 1% by mass of Ce exhibit a characteristic abrupt change of the attenuation coefficient apparently owing to nonlinear dependence of unbalance (ΔE) of signals at the input of the potentiostat. The ''ΔE-c'' function for Al alloy containing 0.5% by mass of Ce can be approximated by linear function. In this case the current of potentiostatic electrolysis approaches the value of the limiting diffusion current. To obtain the relationship between the magnitude of the limiting current of Ce ionization and the initial composition of the dissolving alloy, measurements were made under potentiodynamic conditions at a scanning rate of approximately equal to 500 mv/min. The results indicate that isub(intermediate) is directly proportional to csub(initial). It was shown that under the conditions employed, practically complete (csub(finite)<=0.004% by mass) extraction of the electronegative component is possible without noticeable ionization of the metal-solvent

Influence of annealing on texture properties of cerium oxide thin films

International Nuclear Information System (INIS)

Arunkumar, P.; Suresh Babu, K.; Ramaseshan, R.; Dash, S.

2013-01-01

Future power demand needs an energy source with higher efficiency, better power density, clean energy and fuel flexibility. Solid oxide fuel cell (SOFC) is one of the potential sources for future needs. Though the polymer and direct methanol based electrolyte are much suitable, for versatile applications (portable devices) they are having major challenges such as design, platinum based catalyst, lower power density and fuel flexibility (free from hydrocarbons). However, in SOFC the high operating temperature is the only major issue. Operating temperature of SOFC could be reduced by proper selection of electrolyte material which should have minimum ionic conductivity of 0.1 Scm -1 at reduced activation energy. This can be achieved by thin film based doped cerium oxide electrolyte for SOFC, leads to Intermediate Temperature Solid Oxide Fuel Cell (ITSOFC). In the present work, we focus on the synthesis of cerium oxide and 20 mol % samarium doped cerium oxide (SDC) nanoparticles by co-precipitation method and to synthesis thin films of the same. Pellets of those powders were heat treated at different temperatures and used as targets for e-beam evaporation to fabricate thin film based electrolyte. Stoichiometry of both powders and thin films were confirmed by XRF and EPMA. GIXRD profiles of ceria and SDC thin films are shown below and a preferred orientation effect is observed in SDC films. In SDC films the X-ray peaks have a shift towards lower angles, due to the difference in ionic radii of Ce 4+ and Sm 3+ . The band gap of CeO 2 (2.88 eV) from optical absorption technique indicates the presence of Ce 3+ with Ce 4+ , indirectly shows the concentration of oxygen vacancies which is required for the thin film electrolyte

Energy transfer and thermal studies of Pr 3+ doped cerium oxalate ...

Indian Academy of Sciences (India)

The analysis of energy level diagrams of cerium and praseodymium ions indicates that the energy gap between the sensitizer and the activator ions varies in a small range suggesting a possible energy transfer from the Ce3+ to Pr3+. The emission and absorption spectra of these crystals were recorded. The overlapping of ...

Levels in 146Ce and the N = 88 isotones

International Nuclear Information System (INIS)

Gowdy, G.M.; Chrien, R.E.; Chu, Y.Y.

1981-01-01

An investigation of the level structure of 146 Ce following the beta decay of the low-spin isomer of 146 La has been carried out at the ISOL facility TRISTAN at Brookhaven National Laboratory. The half-life for the low spin isomer was found to be 6.0 +- 0.4s. A partial level scheme for 146 Ce below 2 MeV is given. The level energies and some B(E2) values extracted from our data have been compared with IBA-2 calculations done entirely with extrapolated parameters from neighboring Z nuclei in order to check the predictive power of the model. Systematics of the Z = 58 isotopes and N = 88 isotones indicate that although 146 Ce is more deformed than its isotones with Z greater than or equal to 60, the transition to the well-deformed region can probably more correctly be thought to occur after 146 Ce, between N = 88 and N = 90, as it does for Z greater than or equal to 60. The abrupt onset of deformation present in the higher Z isotopes is not seen in the Ce isotopes where the trend is found to be rather smooth throughout

Excited states in 146Sm and 147Sm

International Nuclear Information System (INIS)

Kownacki, J.; Sujkowski, Z.; Hammaren, E.; Liukkonen, E.; Piiparinen, M.; Lindblad, Th.; Ryde, H.

1979-10-01

The sup(144,146)Nd(α,xn) and sup(146,148)Nd( 3 He,xn) reactions with Esub(α) = 20 - 43 MeV and E 3 sub(He) = 19 - 27 MeV are used to investigate excited states in the isotopes 146 Sm and 147 Sm. The experiments involve measurements of singles γ-ray spectra and conversion electron spectra, γ-ray angular distributions and three parameter (E sub(γ)E sub(γ) time) coincidences. From these experiments information is obtained for states with spin up to I = 13 + and I = 27/2 - , respectively, These states are interpeted within the framework of the cluster-vibration model (CVM) as well as the shell model. (author)

Nanoceria and bulk cerium oxide effects on the germination of asplenium adiantum-nigrum spores

Directory of Open Access Journals (Sweden)

Aranzazu Gomez-Garay

2016-12-01

Full Text Available Aim of study: The effect of cerium oxide engineered nanoparticles on the spore germination of the fern. Asplenium adiantum-nigrum. Area of study: France, Britanny Region, Finistére Department, Plougonvelin, in rocks near the sea. Material and methods: Asplenium spores were cultured in vitro on agar medium with Nano-CeO2 (less than 25 nm particle size and bulk-CeO2. The addition of each nano- and bulk particles ranged from 0 to 3000 mg L-1. Observations on rhizoidal and prothallial cells during first stages of gametophyte development were made. The No-Observed-Adverse-Effect concentration (NOAEC and Lowest-Observed-Adverse-Effect-Concentration (LOEC values for spore germination rate data were analyzed.  Main results: Germination was speeded up by 100 to 2000 mg L-1 nanoceria, while bulk cerium oxide had the same effect for 500 to 200 mg L-1 concentrations. Present results showed cellular damage in the protonema while rhizoid cells seemed not to be affected, as growth and membrane integrity remained. Research highlights: Both nanosized and bulk cerium oxide are toxic for the fern Asplenium adiantum-nigrum, although diverse toxicity patterns were shown for both materials. Diverse toxic effects have been observed: chloroplast membrane damage and lysis, cell wall and membrane disruption which leads to cell lysis; and alterations in morphology and development. Keywords: Nanoparticles; rhizoid; prothallus; chloroplast; fern.

Nanoceria and bulk cerium oxide effects on the germination of asplenium adiantum-nigrum spores

Energy Technology Data Exchange (ETDEWEB)

Gomez-Garay, A.; Pintos, B.; Manzanera, J.A.; Prada, C.; Martin, L.; Gabriel y Galan, J.M.

2016-07-01

Aim of the study: The effect of cerium oxide engineered nanoparticles on the spore germination of the fern. Asplenium adiantum-nigrum. Area of study: France, Britanny Region, Finistére Department, Plougonvelin, in rocks near the sea. Material and methods: Asplenium spores were cultured in vitro on agar medium with Nano-CeO2 (less than 25 nm particle size) and bulk-CeO2. The addition of each nano- and bulk particles ranged from 0 to 3000 mg L-1. Observations on rhizoidal and prothallial cells during first stages of gametophyte development were made. The No-Observed-Adverse-Effect concentration (NOAEC) and Lowest-Observed-Adverse-Effect-Concentration (LOEC) values for spore germination rate data were analyzed. Main results: Germination was speeded up by 100 to 2000 mg L-1 nanoceria, while bulk cerium oxide had the same effect for 500 to 200 mg L-1 concentrations. Present results showed cellular damage in the protonema while rhizoid cells seemed not to be affected, as growth and membrane integrity remained. Research highlights: Both nanosized and bulk cerium oxide are toxic for the fern Asplenium adiantum-nigrum, although diverse toxicity patterns were shown for both materials. Diverse toxic effects have been observed: chloroplast membrane damage and lysis, cell wall and membrane disruption which leads to cell lysis; and alterations in morphology and development. (Author)

29 CFR 1990.146 - Issues to be considered in the rulemaking.

Science.gov (United States)

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Issues to be considered in the rulemaking. 1990.146 Section 1990.146 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION... CARCINOGENS Regulation of Potential Occupational Carcinogens § 1990.146 Issues to be considered in the...

Density-functional theory for f-electron systems. The α-γ phase transition in cerium

International Nuclear Information System (INIS)

Casadei, Marco

2013-01-01

Rare earths are technologically important and scientifically highly interesting elements. The description of the volume collapse exhibited by some rare earth metals poses a great challenge to density-functional theory (DFT) since local/semi-local functionals (LDA/GGA) only partially capture the associated phase transitions. In this work this problem is approached by treating all electrons at the same quantum mechanical level, using both hybrid functionals (e.g. PBE0 and HSE06) and exact-exchange plus correlation in the random-phase approximation (EX+cRPA). The performance of recently developed beyond RPA schemes is also assessed. The isostructural α-γ phase transition in cerium is the most studied. The exact exchange contribution in PBE0 and HSE06 is crucial to produce two distinct solutions that can be associated with the α and γ phases. The two solutions emerge in bulk as well as in cluster calculations. Most notable is their presence in the cerium dimer. However, quantitative agreement with the extrapolated phase diagram requires EX+cRPA. So far the EX+cRPA correction can only be applied to cerium clusters and not to the bulk. A cluster of 19 atoms cut from the fcc crystal structure (the same that characterizes the α and γ phases) was therefore determined as representative. (EX+cRPA) rate at PBE0 for Ce 19 provides good agreement with the extrapolated transition pressure to zero temperature. We predict that a pressure induced phase transition should exist at or close to zero. A finite temperature phase diagram can be drawn in reasonable agreement with experiment by adding entropic effects. The cerium neighbors are also studied: lanthanum, which has no f electrons, praseodymium, with three f electrons and a volume collapse, and neodymium, with four f electrons and no volume collapse. Multiple solutions are also present for these f electron elements, confirming the importance of exact-exchange for f electron systems.

Cerium sorption in grounds modified by anti-deflation treatment

International Nuclear Information System (INIS)

Firsova, L.P.; Bogatyrev, I.O.

2001-01-01

Influence of soils and grounds treatment by anti-deflation compositions on the size of the soil particles was studied. Under static conditions sorption of 144 Ce by turf-podsolic soils prior to an after their modification by the anti-deflation reagents, i.e. bitumens and insoluble in water polyelectrolytic complexes, was considered. Degrees of 144 Ce sorption in the soil-solution systems, depending on solutions pH, presence of alkali metal carbonates and cerium concentration, were determined [ru

Far infrared properties of PbTe doped with cerium

Energy Technology Data Exchange (ETDEWEB)

Nikolic, P.M. [Institute of Technical Sciences SASA, Knez Mihailova 35/IV, 11000 Belgrade (Serbia)]. E-mail: nikolic@sanu.ac.yu; Koenig, W. [Max Planck Institut fuer Festkoerperforschung, Heisenbergstrasse 1, 7000 Stuttgart 80 (Germany); Vujatovic, S.S. [Institute of Technical Sciences SASA, Knez Mihailova 35/IV, 11000 Belgrade (Serbia); Blagojevic, V. [Faculty of Electronic Engineering, University of Belgrade, Bulevar Kralja Aleksandra 73, 11000 Belgrade (Serbia); Lukovic, D. [Institute of Technical Sciences SASA, Knez Mihailova 35/IV, 11000 Belgrade (Serbia); Savic, S. [Institute of Technical Sciences SASA, Knez Mihailova 35/IV, 11000 Belgrade (Serbia); Radulovic, K. [Institute of Technical Sciences SASA, Knez Mihailova 35/IV, 11000 Belgrade (Serbia); Urosevic, D. [Mathematical Institute SASA, Knez Mihailova 35/I, 11000 Belgrade (Serbia); Nikolic, M.V. [Center for Multidisciplinary Studies of the University of Belgrade, Kneza Viseslava 1, Belgrade (Serbia)

2007-05-16

Single crystal samples of lead telluride doped with cerium were made using the Bridgman method. Far infrared reflectivity spectra in the temperature range from 10 to 300 K are presented. The experimental data were numerically analyzed using a fitting procedure based on the plasmon-phonon interaction model and optical parameters were determined. Two additional local modes were observed at about 138 and 337 cm{sup -1}. The origin of these local vibrational impurity modes was discussed.

Cerium oxide nanoparticles stimulate proliferation of primary mouse embryonic fibroblasts in vitro

Energy Technology Data Exchange (ETDEWEB)

Popov, Anton L., E-mail: antonpopovleonid@gmail.com [Institute of Theoretical and Experimental Biophysics, Russian Academy of Sciences, Pushchino, Moscow region (Russian Federation); Popova, Nelly R. [Institute of Theoretical and Experimental Biophysics, Russian Academy of Sciences, Pushchino, Moscow region (Russian Federation); Selezneva, Irina I. [Institute of Theoretical and Experimental Biophysics, Russian Academy of Sciences, Pushchino, Moscow region (Russian Federation); Pushchino State Institute of Natural sciences, Pushchino, Moscow region (Russian Federation); Akkizov, Azamat Y. [Kabardino-Balkarian State University, Nalchik (Russian Federation); Ivanov, Vladimir K. [Kurnakov Institute of General and Inorganic Chemistry, Russian Academy of Sciences, Moscow (Russian Federation); National Research Tomsk State University, Tomsk (Russian Federation)

2016-11-01

The increasing application of cell therapy technologies in the treatment of various diseases requires the development of new effective methods for culturing primary cells. The major limitation for the efficient use of autologous cell material is the low rate of cell proliferation. Successful cell therapy requires sufficient amounts of cell material over a short period of time with the preservation of their differentiation and proliferative potential. In this regard, the development of novel, highly efficient stimulators of proliferative activity in stem cells is a truly urgent task. In this paper we have demonstrated that citrate-stabilized cerium oxide nanoparticles (nanoceria) enhance the proliferative activity of primary mouse embryonic fibroblasts in vitro. Cerium oxide nanoparticles stimulate cell proliferation in a wide range of concentrations (10{sup −3} M–10{sup −9} M) through reduction of intracellular levels of reactive oxygen species (ROS) during the lag phase of cell growth and by modulating the expression level of the major antioxidant enzymes. We found the optimal concentration of nanoceria, which provides the greatest acceleration of cell proliferation in vitro, while maintaining the levels of intracellular ROS and mRNA of antioxidant enzymes in the physiological range. Our results confirm that nanocrystalline ceria can be considered as a basis for effective and inexpensive supplements in cell culturing. - Highlights: • Citrate-stabilized cerium oxide nanoparticles are shown to stimulate proliferation of primary embryonic cells in vitro. • Some of mechanisms involved in stimulating of the proliferation by CeO{sub 2} have been uncovered. • The most effective (optimal) concentration of CeO{sub 2} nanoparticles for stimulation of proliferation was determined.

Further results on cerium fluoride crystals

International Nuclear Information System (INIS)

Anderson, S.; Auffray, E.; Aziz, T.; Baccaro, S.; Banerjee, S.; Bareyre, P.; Barone, L.E.; Borgia, B.; Boutet, D.; Burq, J.P.; Chemarin, M.; Chipaux, R.; Dafinei, I.; D'Atanasio, P.; De Notaristefani, F.; Dezillie, B.; Dujardin, C.; Dutta, S.; Faure, J.L.; Fay, J.; Ferrere, D.; Francescangeli, O.; Fuchs, B.A.; Ganguli, S.N.; Gillespie, G.; Goyot, M.; Gupta, S.K.; Gurtu, A.; Heck, J.; Herve, A.; Hillemanns, H.; Holdener, F.; Ille, B.; Joensson, L.; Kierstead, J.; Krenz, W.; Kway, W.; Le Goff, J.M.; Lebeau, M.; Lebrun, P.; Lecoq, P.; Lemoigne, Y.; Loomis, G.; Lubelsmeyer, K.; Madjar, N.; Majni, G.; El Mamouni, H.; Mangla, S.; Mares, J.A.; Martin, J.P.; Mattioli, M.; Mauger, G.J.; Mazumdar, K.; Mengucci, P.; Merlo, J.P.; Moine, B.; Nikl, N.; Pansart, J.P.; Pedrini, C.; Poinsignon, J.; Polak, K.; Raghavan, R.; Rebourgeard, P.; Rinaldi, D.; Rosa, J.; Rosowsky, A.; Sahuc, P.; Samsonov, V.; Sarkar, S.; Schegelski, V.; Schmitz, D.; Schneegans, M.; Seliverstov, D.; Stoll, S.; Sudhakar, K.; Svensson, A.; Tonwar, S.C.; Topa, V.; Vialle, J.P.; Vivargent, M.; Wallraff, W.; Weber, M.J.; Winter, N.; Woody, C.; Wuest, C.R.; Yanovski, V.

1993-01-01

A systematic investigation of the properties of cerium fluoride monocrystals has been performed by the 'Crystal Clear' collaboration in view of a possible use of such crystals for the construction of high precision electromagnetic calorimeters for the future generation of high luminosity accelerators. A large sample of different crystals grown by several producers has been studied. The spectroscopic characteristics, the transmission, luminescence and excitation spectra and the decay time curves are analysed. The light yield of the different crystals is measured with photomultipliers and Si photodiodes and compared to reference standards like BGO and NaI(Tl). The radiation damage behaviour is then presented for γ and neutron irradiations, at different doses and dose rates, including thermal and optical bleaching. (orig.)

Dysregulation of endothelial colony-forming cell function by a negative feedback loop of circulating miR-146a and -146b in cardiovascular disease patients.

Directory of Open Access Journals (Sweden)

Ting-Yu Chang

Full Text Available Functional impairment of endothelial colony-forming cells (ECFCs, a specific cell lineage of endothelial progenitor cells (EPCs is highly associated with the severity of coronary artery disease (CAD, the most common type of cardiovascular disease (CVD. Emerging evidence show that circulating microRNAs (miRNAs in CAD patients' body fluid hold a great potential as biomarkers. However, our knowledge of the role of circulating miRNA in regulating the function of ECFCs and the progression of CAD is still in its infancy. We showed that when ECFCs from healthy volunteers were incubated with conditioned medium or purified exosomes of cultured CAD ECFCs, the secretory factors from CAD ECFCs dysregulated migration and tube formation ability of healthy ECFCs. It is known that exosomes influence the physiology of recipient cells by introducing RNAs including miRNAs. By using small RNA sequencing (smRNA-seq, we deciphered the circulating miRNome in the plasma of healthy individual and CAD patients, and found that the plasma miRNA spectrum from CAD patients was significantly different from that of healthy control. Interestingly, smRNA-seq of both healthy and CAD ECFCs showed that twelve miRNAs that had a higher expression in the plasma of CAD patients also showed higher expression in CAD ECFCs when compared with healthy control. This result suggests that these miRNAs may be involved in the regulation of ECFC functions. For identification of potential mRNA targets of the differentially expressed miRNA in CAD patients, cDNA microarray analysis was performed to identify the angiogenesis-related genes that were down-regulated in CAD ECFCs and Pearson's correlation were used to identify miRNAs that were negatively correlated with the identified angiogenesis-related genes. RT-qPCR analysis of the five miRNAs that negatively correlated with the down-regulated angiogenesis-related genes in plasma and ECFC of CAD patients showed miR-146a-5p and miR-146b-5p up

Cerium and yttrium oxide nanoparticles are neuroprotective

International Nuclear Information System (INIS)

Schubert, David; Dargusch, Richard; Raitano, Joan; Chan, S.-W.

2006-01-01

The responses of cells exposed to nanoparticles have been studied with regard to toxicity, but very little attention has been paid to the possibility that some types of particles can protect cells from various forms of lethal stress. It is shown here that nanoparticles composed of cerium oxide or yttrium oxide protect nerve cells from oxidative stress and that the neuroprotection is independent of particle size. The ceria and yttria nanoparticles act as direct antioxidants to limit the amount of reactive oxygen species required to kill the cells. It follows that this group of nanoparticles could be used to modulate oxidative stress in biological systems

Cerium oxide for the destruction of chemical warfare agents: A comparison of synthetic routes

Czech Academy of Sciences Publication Activity Database

Janos, P.; Henych, Jiří; Pelant, O.; Pilařová, V.; Vrtoch, L.; Kormunda, M.; Mazanec, K.; Štengl, Václav

2016-01-01

Roč. 304, MAR (2016), s. 259-268 ISSN 0304-3894 Institutional support: RVO:61388980 Keywords : Cerium oxide * Chemical warfare agents * Organophosphate compounds * Decontamination Subject RIV: CA - Inorganic Chemistry Impact factor: 6.065, year: 2016

Effect of Thickness on the Morphology and Corrosion Behavior of Cerium-Based Conversion Coatings on AZ31B Magnesium Alloy

Science.gov (United States)

Castano, Carlos E.; Maddela, Surender; O'Keefe, Matthew J.; Wang, Yar-Ming

Cerium-based conversion coatings (CeCCs) were deposited onto AZ31B magnesium alloy substrates using a spontaneous reaction of CeCl3, H2O2 and gelatin in a water-based solution. The coating thickness was adjusted by controlling the immersion time in the deposition solution. Prior to deposition, the AZ31B substrates were treated using an acid pickling in nitric acid and then an alkaline cleaning in sodium metasilicate pentahydrate. After deposition, the coated samples were immersed in a phosphate bath that converted cerium oxide/hydroxide into cerium phosphate. Electrochemical impedance spectroscopy, potentiodynamic polarization and neutral salt spray testing studies indicated that 100 nm thick CeCC had better corrosion performance than 400 nm coatings. Characterization of the CeCCs by transmission electron microscopy (TEM) revealed a three layer structure with different compositions.

40 CFR 146.9 - Criteria for establishing permitting priorities.

Science.gov (United States)

2010-07-01

....9 Criteria for establishing permitting priorities. In determining priorities for setting times for... priorities. 146.9 Section 146.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... (a), (c), (g) or § 144.22(f), the Director shall base these priorities upon consideration of the...

Cerium compounds in the fashion of the light actinides

International Nuclear Information System (INIS)

Koelling, D.D.

1985-01-01

Researchers familiar with the light actinides easily recognize in cerium compounds a microcosm of the rich variety of properties seen in the light actinides. The parallelism seen between comparable cerium and actinide compounds strongly suggests that the same physical models are applicable. The most significant is the relative size of the f-orbital. Localization is generally tighter in Ce compounds than uranium compounds, making Ce roughly analogous to Np through Am. A way to see the actinide parallelism is to compare Hill plots. Compounds in the different regions of the plots (representing different physics) are isostructural compounds with the same companion (B) elements. The most common materials expected to exhibit direct f-f interaction are the cubic Laves compounds. Accordingly, we have determined the band structures of CeRu 2 , CeRh 2 , CeIr 2 , and CeNi 2 . Surprisingly, it was found that an f-d interaction overshadows any direct f-f interaction in these systems. Compounds illustrative of the interaction of f-orbitals with ''ligand'' orbitals are the Cu 3 Au structured materials. Materials calculated in this class are CeRh 3 , CePd 3 , and CeSn 3 - the materials of much interest as ''mixed valent''. Although the focus is on the Ce compounds, calculations performed on uranium isomorphs are used to highlight the interesting physics. (orig.)

Effect of cerium additive and secondary phase analysis on Ag0.5Bi0 ...

Indian Academy of Sciences (India)

Technical University of Madrid (UPM), Madrid 28012, Spain. MS received 27 ... XRD analysis showed the presence of pyrochlore structure and secondary phase when more .... The present work reports the effect of incorporation of cerium in ...

21 CFR 146.154 - Concentrated orange juice with preservative.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated orange juice with preservative complies with the requirements for composition and labeling of optional...

Platinum Catalysts Supported on Ce, Zr, Pr - Oxides in Catalytic Wet Air Oxidation of Acetic Acid

Czech Academy of Sciences Publication Activity Database

Mikulová, Jana; Rossignol, S.; Barbier Jr., J.; Duprez, D.; Kappenstein, C.

2007-01-01

Roč. 146, č. 3 (2007), s. 1248-1253 ISSN 0304-3894 Institutional research plan: CEZ:AV0Z40720504 Keywords : platinum * cerium oxide * carbonate species Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.337, year: 2007

Separation of uranium(V I) from binary solution mixtures with thorium(IV), zirconium(IV) and cerium(III) by foaming

International Nuclear Information System (INIS)

Shakir, K.; Aziz, M.; Benyamin, K.

1992-01-01

Foam separation has been investigated for the removal of uranium(V I), thorium(IV), zirconium(IV) and cerium(III) from dilute aqueous solutions at pH values ranging from about I to about II. Sodium laurel sulphate (Na L S) and acetyl trimethyl ammonium bromide (CTAB), being a strong anionic and a strong cationic surfactants, were used as collectors. The results indicate that Na L S can efficiently remove thorium(IV), zirconium(IV) and cerium(III) but not uranium(V I). CTAB, on the other hand, can successfully float only uranium(V I) and zirconium(IV). These differences in flotation properties of the different cations could be used to establish methods for the separation of uranium(V I) from binary mixtures with thorium(IV), zirconium(IV) or cerium(III). The results are discussed in terms of the hydrolytic behaviour of the tested cations and properties of used collectors.2 fig., 1 tab

Sodium nitrate-cerium nitrate-water ternary system at 25 deg C

International Nuclear Information System (INIS)

Fedorenko, T.P.; Onishchenko, M.K.

1978-01-01

Solubility isotherm of sodium nitrate-cerium nitrate-water system at 25 deg C consists of three crystallization branches of initial salts and double compound of the composition 2NaNO 3 xCe(NO 3 ) 3 x2H 2 O. Sodium nitrate introduced in the solution strengthens complexing. Physico-chemical characteristics are in a good agreement with solubility curve

Effects of ethylenediaminetetraacetic acid (EDTA)and diethylenetriaminepentaacetic acid (DTPA) derivatives on penetration of ytterbium-169 and cerium-144 into the rat offspring

Energy Technology Data Exchange (ETDEWEB)

Baltrukiewicz, Z; Burakowski, T; Derecki, J [Wojskowy Inst. Higieny i Epidemiologii, Warsaw (Poland)

1976-01-01

Penetration of radioactive ytterbum-169 and cerium-144 into fetuses was determined at the end of pregnancy and penetration into the organism of suckling rats was studied during feeding with the milk of exposed mothers when EDTA or DTPA derivatives were being administered. Injection of ytterbum-169 as a complex with EDTA or DTPA or injection of Na/sub 2/Ca EDTA or Na/sub 3/Ca DTPA 1h after administration of cerium-144 to mothers reduced penetration of both radionuclides into offsprings in relation to the animals receiving no complex compounds. It was observed that the action of DTPA was stronger than that of EDTA. Passage of ytterbium with milk and across the placenta was greater than the passage of cerium.

7 CFR 1260.146 - Vacancies.

Science.gov (United States)

2010-01-01

... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Cattlemen's Beef Promotion and Research Board § 1260.146 Vacancies. To fill any...

19 CFR 146.61 - Constructive transfer to Customs territory.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Constructive transfer to Customs territory. 146.61 Section 146.61 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... Constructive transfer to Customs territory. The port director shall accept receipt of any entry in proper form...

Unusual kinetics of poly(ethylene glycol) oxidation with cerium(IV) ions in sulfuric acid medium and implications for copolymer synthesis.

Science.gov (United States)

Szymański, Jan K; Temprano-Coleto, Fernando; Pérez-Mercader, Juan

2015-03-14

The cerium(IV)-alcohol couple in an acidic medium is an example of a redox system capable of initiating free radical polymerization. When the alcohol has a polymeric nature, the outcome of such a process is a block copolymer, a member of a class of compounds possessing many useful properties. The most common polymer with a terminal -OH group is poly(ethylene glycol) (PEG); however, the detailed mechanism of its reaction with cerium(IV) remains underexplored. In this paper, we report our findings for this reaction based on spectrophotometric measurements and kinetic modeling. We find that both the reaction order and the net rate constant for the oxidation process depend strongly on the nature of the acidic medium used. In order to account for the experimental observations, we postulate that protonation of PEG decreases its affinity for some of the cerium(IV)-sulfate complexes formed in the system.

Cerium(III-Selective Membrane Electrode Based on Dibenzo-24-crown-8 as a Neutral Carrier

Directory of Open Access Journals (Sweden)

Susheel K. Mittal

2010-01-01

Full Text Available Cerium(III-selective membrane electrodes have been prepared using dibenzo-24-crown-8 (DB24C8 as an electroactive material. A membrane having a composition: DB24C8 (4.5%, plasticizer (NPOE, 62.5% and PVC (33% gives the best performance. It works well over a wide Ce(III ion-concentration range of 1x10-5 M to 1x10-1 M with a Nernstian slope of 19.0 mV/decade and a detection limit of 3x10-5 M. It has a fast response time of 20 seconds and has an average lifetime of four months. The internal solution concentration does not have a significant effect on the response of the electrode except for a change in intercept of the calibration curves. The working pH range for Ce(III solutions (1x10-2 M and 1x10-3 M is 3.5-8.0. The proposed sensor shows a good selectivity for cerium(III with respect to alkali, alkaline earth, some transition and rare earth metal ions that are normally present along with cerium in its ores. The proposed sensor was investigated in partially non-aqueous media using acetone, methanol and DMSO mixtures with water. The electrode was further used as an indicator electrode for the potentiometric titration of Ce(III solution against oxalic acid solution.

9 CFR 146.33 - Terminology and classification; meat-type chicken slaughter plants.

Science.gov (United States)

2010-01-01

...-type chicken slaughter plants. 146.33 Section 146.33 Animals and Animal Products ANIMAL AND PLANT... PLAN FOR COMMERCIAL POULTRY Special Provisions for Meat-Type Chicken Slaughter Plants § 146.33 Terminology and classification; meat-type chicken slaughter plants. Participating meat-type chicken slaughter...

Cerium intermetallics CeTX. Review III

Energy Technology Data Exchange (ETDEWEB)

Poettgen, Rainer; Janka, Oliver [Muenster Univ. (Germany). Inst. fuer Anorganische und Analytische Chemie; Chevalier, Bernard [Bordeaux Univ., Pessac (France). Inst. de Chimie de la Matiere Condensee de Bordeaux

2016-05-01

The structure-property relationships of CeTX intermetallics with structures other than the ZrNiAl and TiNiSi type are systematically reviewed. These CeTX phases form with electron-poor and electron-rich transition metals (T) and X = Mg, Zn, Cd, Hg, Al, Ga, In, Tl, Si, Ge, Sn, Pb, P, As, Sb, and Bi. The review focusses on the crystal chemistry, the chemical bonding peculiarities, and the magnetic and transport properties. Furthermore {sup 119}Sn Moessbauer spectroscopic data, high-pressure studies, hydrogenation reactions and the formation of solid solutions are reviewed. This paper is the third of a series of four reviews on equiatomic intermetallic cerium compound [Part I: R. Poettgen, B. Chevalier, Z. Naturforsch. 2015, 70b, 289; Part II: R. Poettgen, B. Chevalier, Z. Naturforsch. 2015, 70b, 695].

Mixed mode and sequential oscillations in the cerium-bromate-4-aminophenol photoreaction

Energy Technology Data Exchange (ETDEWEB)

Bell, Jeffrey G.; Wang Jichang [Department of Chemistry and Biochemistry, University of Windsor, Windsor, Ontario N9B 3P4 (Canada)

2013-09-15

Cerium was introduced to the bromate-aminophenol photochemical oscillator to implement coupled autocatalytic feedbacks. Mixed mode and sequential oscillations emerged in the studied system, making it one of the few chemical oscillators known to support consecutive bifurcations in a batch system. The complex reaction behavior showed a strong dependence on the intensity of illumination supplied to the system. Removal of illumination during an oscillatory window affected both the frequency and amplitude of the oscillation but did not fully extinguish them, indicating that the cerium-bromate-4-aminophenol oscillator was photosensitive rather than photo-controlled. A moderate light intensity allowed for a slow evolution of the system, which proved to be critical for the emergence of transient complex oscillations. Variation of individual reaction parameters was carried out, which indicated that the development of complex oscillations occur in a narrow region and a phase diagram in the 4-aminophenol and sulfuric acid plane demonstrated this. Simulations provide strong support that transient complex oscillations observed experimentally arise from the coupling of two autocatalytic cycles.

Microstructure and electrochemical behavior of cerium conversion coating modified with silane agent on magnesium substrates

Energy Technology Data Exchange (ETDEWEB)

Lei, Li; Shi, Jing, E-mail: shijing@ouc.edu.cn; Wang, Xin, E-mail: wangxin.hd@163.com; Liu, Dan; Xu, Haigang

2016-07-15

Graphical abstract: The unmodified coating shows averaged static water contact angles of a little more than 50º, which is clearly hydrophilic for water solutions. With the silane concentration increases, the water contact angles show an increase tendency. Especially, when the silane addition is increased to 25 ml L-1, the coating surface presents a hydrophobic feature, with static water contact angle of more than 110º. - Highlights: • BTESPT modification can effectively improve the uniformity, hydrophobic performance, chemical stability and corrosion inhibition capability of traditional cerium conversion coating. • Si-O-Si linkage builds a robust structure to increase of the coating density. Si−O−Mg bonds strengthen the adhesion between the coating/substrate. • The system modified with 25 ml L{sup −1} BTESPT displays the optimum corrosion protection performance. - Abstract: The cerium conversion coating with and without different concentrations of silane agent bis-(γ-triethoxysilylpropyl)-tetrasulfide (BTESPT) modification is obtained on magnesium alloys. Detailed properties of the coatings and the role of BTESPT as an additive are studied and followed with careful discussion. The coating morphology, wettability, chemical composition and corrosion resistance are characterized by scanning electronic microscope (SEM), water contact-angle, X-ray photoelectron spectroscopy (XPS), potentiodynamic measurements and electrochemical impedance spectroscopy (EIS). The electrochemical behavior of the coatings is investigated using EIS. The results indicate that the coating morphology and composition can be controlled by changing silane concentration. The combination of cerium ions and silane molecules could promote the formation of more homogenous and higher hydrophobic coating. The coating turns to be more compact and the adhesive strength between the coating and the magnesium substrate are strongly improved with the formation of Si−O−Si and Si�

Microstructure and electrochemical behavior of cerium conversion coating modified with silane agent on magnesium substrates

International Nuclear Information System (INIS)

Lei, Li; Shi, Jing; Wang, Xin; Liu, Dan; Xu, Haigang

2016-01-01

Graphical abstract: The unmodified coating shows averaged static water contact angles of a little more than 50º, which is clearly hydrophilic for water solutions. With the silane concentration increases, the water contact angles show an increase tendency. Especially, when the silane addition is increased to 25 ml L-1, the coating surface presents a hydrophobic feature, with static water contact angle of more than 110º. - Highlights: • BTESPT modification can effectively improve the uniformity, hydrophobic performance, chemical stability and corrosion inhibition capability of traditional cerium conversion coating. • Si-O-Si linkage builds a robust structure to increase of the coating density. Si−O−Mg bonds strengthen the adhesion between the coating/substrate. • The system modified with 25 ml L"−"1 BTESPT displays the optimum corrosion protection performance. - Abstract: The cerium conversion coating with and without different concentrations of silane agent bis-(γ-triethoxysilylpropyl)-tetrasulfide (BTESPT) modification is obtained on magnesium alloys. Detailed properties of the coatings and the role of BTESPT as an additive are studied and followed with careful discussion. The coating morphology, wettability, chemical composition and corrosion resistance are characterized by scanning electronic microscope (SEM), water contact-angle, X-ray photoelectron spectroscopy (XPS), potentiodynamic measurements and electrochemical impedance spectroscopy (EIS). The electrochemical behavior of the coatings is investigated using EIS. The results indicate that the coating morphology and composition can be controlled by changing silane concentration. The combination of cerium ions and silane molecules could promote the formation of more homogenous and higher hydrophobic coating. The coating turns to be more compact and the adhesive strength between the coating and the magnesium substrate are strongly improved with the formation of Si−O−Si and Si−O−M chemical

Sorption studies of radionuclides on a modified mesoporous cerium(IV) silicate

International Nuclear Information System (INIS)

Sepehrian, H.; Tarbiat Moallem University, Tehran; Ghannadi-Maragheh, M.; Yavari, R.; Khanchi, A.R.; Waqif-Husain, S.

2008-01-01

Five different samples of a new sorbent, modified mesoporous cerium(IV) silicate have been prepared with various mole ratios of Si/Ce and Cetyltrimethylammonium bromide (CTMABr) as template. XRD, nitrogen sorption, SEM, IR, thermogravimetry and sorption of radionuclides have been studied. Separation of Hg(II)-Th(IV), Hg(II)-Zr(IV) and Rb(I)-Zr(IV) have been developed on columns of this novel sorbent. (author)

22 CFR 146.105 - Definitions.

Science.gov (United States)

2010-04-01

... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.105 Definitions. As used in these Title... financial assistance, or by a recipient, as a condition to becoming a recipient. Designated agency official... education, or an institution of vocational education, as defined in this section. Federal financial...

11 CFR 100.146 - Legal or accounting services to other political committees.

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Legal or accounting services to other political committees. 100.146 Section 100.146 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.146 Legal or accounting services to other...

Synergistic Effect of MiR-146a Mimic and Cetuximab on Hepatocellular Carcinoma Cells

Directory of Open Access Journals (Sweden)

Suning Huang

2014-01-01

Full Text Available Previously, we found that the expression of microRNA-146a (miR-146a was downregulated in hepatocellular carcinoma (HCC formalin-fixed paraffin-embedded (FFPE tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.

Synergistic effect of MiR-146a mimic and cetuximab on hepatocellular carcinoma cells.

Science.gov (United States)

Huang, Suning; He, Rongquan; Rong, Minhua; Dang, Yiwu; Chen, Gang

2014-01-01

Previously, we found that the expression of microRNA-146a (miR-146a) was downregulated in hepatocellular carcinoma (HCC) formalin-fixed paraffin-embedded (FFPE) tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.

Atomic layer deposition of cerium oxide for potential use in diesel soot combustion

Energy Technology Data Exchange (ETDEWEB)

Ivanova, Tatiana V., E-mail: tatiana.ivanova@lut.fi, E-mail: ivanova.tatyana.v@gmail.com; Toivonen, Jenni; Maydannik, Philipp S.; Kääriäinen, Tommi; Sillanpää, Mika [ASTRaL Team, Laboratory of Green Chemistry, School of Engineering Science, Lappeenranta University of Technology, Sammonkatu 12, FI-50130 Mikkeli (Finland); Homola, Tomáš; Cameron, David C. [R& D Centre for Low-Cost Plasma and Nanotechnology Surface Modification, Masaryk University, Kotlářská 267/2, 611 37 Brno (Czech Republic)

2016-05-15

The particulate soot emission from diesel motors has a severe impact on the environment and people's health. The use of catalytic convertors is one of the ways to minimize the emission and decrease the hazard level. In this paper, the activity of cerium oxide for catalytic combustion of diesel soot was studied. Thin films of cerium dioxide were synthesized by atomic layer deposition using tetrakis(2,2,6,6-tetramethyl-3,5-heptanedionato)cerium [Ce(thd){sub 4}] and ozone as precursors. The characteristics of the films were studied as a function of deposition conditions within the reaction temperature range of 180–350 °C. Thickness, crystallinity, elemental composition, and morphology of the CeO{sub 2} films deposited on Si (100) were characterized by ellipsometry, x-ray diffraction, x-ray photoelectron spectroscopy, atomic force microscopy, and field emission scanning electron microscopy, respectively. The growth rate of CeO{sub 2} was observed to be 0.30 Å/cycle at temperatures up to 250 °C with a slight increase to 0.37 Å/cycle at 300 °C. The effect of CeO{sub 2} films grown on stainless steel foil supports on soot combustion was measured with annealing tests. Based on the analysis of these, in catalytic applications, CeO{sub 2} has been shown to be effective in lowering the soot combustion temperature from 600 °C for the uncoated substrates to 370 °C for the CeO{sub 2} coated ones. It was found that the higher deposition temperatures had a positive effect on the catalyst performance.

STUDY OF THE HIGH-SPIN STRUCTURE OF PM-146

NARCIS (Netherlands)

RZACAURBAN, T; DURELL, JL; PHILLIPS, WR; VARLEY, BJ; HESS, CP; PEARSON, CJ; VERMEER, WJ; VIEU, C; DIONISIO, JS; PAUTRAT, M; Urban, W

1995-01-01

Excited states in Pm-146 have been investigated through the Xe-136(N-15,5n) and the Nd-146(d,xn) compound-nucleus reactions. A level scheme extending up to 6.9 MeV of excitation energy and (I = 25HBAR) is proposed. Most of the high-spin levels are interpreted in terms of multi-particle-hole states

19 CFR 146.8 - Seals, authority of operator to break and affix.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Seals, authority of operator to break and affix. 146.8 Section 146.8 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.8 Seals, authority of...

Magnetic and Mössbauer Study of Cerium-Based Reactive Sorbent

Czech Academy of Sciences Publication Activity Database

Jirásková, Yvonna; Buršík, Jiří; Životský, O.; Luňáček, J.; Janos, P.

2017-01-01

Roč. 131, č. 4 (2017), s. 1096-1098 ISSN 0587-4246. [CSMAG 2016 - Czech and Slovak Conference on Magnetism /16./. Košice, 13.06.2016-17.06.2016] R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Cerium-based sorbent * magnetic properties * phase composition * composite Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 0.469, year: 2016

14 CFR 1260.146 - Procurement records.

Science.gov (United States)

2010-01-01

... Higher Education, Hospitals, and Other Non-Profit Organizations Procurement Standards § 1260.146... of competition when competitive bids or offers are not obtained, and (c) Basis for award cost or price. ...

Monte Carlo radiative transfer simulation of a cavity solar reactor for the reduction of cerium oxide

Energy Technology Data Exchange (ETDEWEB)

Villafan-Vidales, H.I.; Arancibia-Bulnes, C.A.; Dehesa-Carrasco, U. [Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico, Privada Xochicalco s/n, Col. Centro, A.P. 34, Temixco, Morelos 62580 (Mexico); Romero-Paredes, H. [Departamento de Ingenieria de Procesos e Hidraulica, Universidad Autonoma Metropolitana-Iztapalapa, Av. San Rafael Atlixco No.186, Col. Vicentina, A.P. 55-534, Mexico D.F 09340 (Mexico)

2009-01-15

Radiative heat transfer in a solar thermochemical reactor for the thermal reduction of cerium oxide is simulated with the Monte Carlo method. The directional characteristics and the power distribution of the concentrated solar radiation that enters the cavity is obtained by carrying out a Monte Carlo ray tracing of a paraboloidal concentrator. It is considered that the reactor contains a gas/particle suspension directly exposed to concentrated solar radiation. The suspension is treated as a non-isothermal, non-gray, absorbing, emitting, and anisotropically scattering medium. The transport coefficients of the particles are obtained from Mie-scattering theory by using the optical properties of cerium oxide. From the simulations, the aperture radius and the particle concentration were optimized to match the characteristics of the considered concentrator. (author)

27 CFR 44.146 - Closing.

Science.gov (United States)

2010-04-01

... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.146 Closing. A closing inventory shall be made by the export warehouse proprietor when he transfers ownership or concludes business. Where the proprietor transfers ownership the closing inventory shall be made...

Association of microRNA 146 with middle ear hyperplasia in pediatric otitis media.

Science.gov (United States)

Samuels, Tina L; Yan, Justin; Khampang, Pawjai; MacKinnon, Alexander; Hong, Wenzhou; Johnston, Nikki; Kerschner, Joseph E

2016-09-01

Toll-like receptor signaling activated by bacterial otitis media pathogens in the middle ear has been shown to play a key role in OM susceptibility, pathogenesis and recovery. Recent studies implicate microRNA 146 (miR-146) in regulation of inflammation via negative feedback of toll-like receptor signaling (TLR) in a wide variety of tissues, however its involvement in otitis media is unknown. Human middle ear epithelial cells were stimulated with proinflammatory cytokines, interleukin 1 beta or tumor necrosis factor alpha, for two to twenty-four hours. Middle ear biopsies were collected from children with otitis media with effusion (n = 20), recurrent otitis media (n = 9), and control subjects undergoing cochlear implantation (n = 10). miR-146a, miR-146b expression was assayed by quantitative PCR (qPCR). Expression of miR-146 targets involved in TLR signaling, IRAK1 and TRAF6, was assayed by qPCR in middle ear biopsies. Middle ear biopsies were cryosectioned and epithelial thickness measured by a certified pathologist. Proinflammatory cytokines induced expression of miR-146 in middle ear epithelial cells in vitro. Middle ear miR-146a and miR-146b expression was elevated in otitis media patients relative to control subjects and correlated with middle ear epithelial thickness. A trend towards inverse correlation was observed between miR-146 and TRAF6 expression in the clinical population. This report is the first to assess miRNA expression in a clinical population with OM. Findings herein suggest miR-146 may play a role in OM. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Transcriptional regulation of miR-146b by C/EBPβ LAP2 in esophageal cancer cells

International Nuclear Information System (INIS)

Li, Junxia; Shan, Fabo; Xiong, Gang; Wang, Ju-Ming; Wang, Wen-Lin; Xu, Xueqing; Bai, Yun

2014-01-01

Highlights: • MiR-146b promotes esophageal cancer cell proliferation. • MiR-146b inhibits esophageal cancer cell apoptosis. • C/EBPβ directly binds to miR-146b promoter conserved region. • MiR-146b is up-regulated by C/EBPβ LAP2 transcriptional activation. - Abstract: Recent clinical study indicated that up-regulation of miR-146b was associated with poor overall survival of patients in esophageal squamous cell carcinoma. However, the underlying mechanism of miR-146b dysregulation remains to be explored. Here we report that miR-146b promotes cell proliferation and inhibits cell apoptosis in esophageal cancer cell lines. Mechanismly, two C/EBPβ binding motifs are located in the miR-146b promoter conserved region. Among the three isoforms of C/EBPβ, C/EBPβ LAP2 positively regulated miR-146b expression and increases miR-146b levels in a dose-dependent manner through transcription activation of miR-146b gene. Together, these results suggest a miR-146b regulatory mechanism involving C/EBPβ, which may contribute to the up-regulation of miR-146b in esophageal squamous cell carcinoma

Extraordinary superconductor with nearly trivalent cerium, CeCu2Si2

International Nuclear Information System (INIS)

Ishikawa, M.; Jaccard, D.; Jorda, J.-L.

1982-01-01

Concentrating on the ternary phase diagram, the authors have performed a complementary investigation on CeCu 2 Si 2 and confirm that the compound containing nearly trivalent cerium ions is a new type of superconductor with Tsub(c) around 0.5 K. The analyses of the upper critical field curve support the description of the compound by heavy fermion quasiparticles. Other particular features of this compound are also presented. (Auth.)

Some observations concerning the direct titration of nitrite with cerium(IV)

International Nuclear Information System (INIS)

Muralikrishna, U.; Subrahmanyam, K.; Suryanarayana, M.V.S.; Krishnamurthy, M.

1983-01-01

Direct titration of nitrite with cerium(IV), with ferroin as indicator, is shown to give satisfactory results if the acidity is kept between 0.033 and 0.055 M at the end-point. Loss of nitrous acid owing to volatilization and decomposition is discussed. From 10 to 60 mg of sodium nitrite can be estimated with a standard deviation of 5 μg and an average error of 0.2%. (author)

Phenotypic and genomic responses to titanium dioxide and cerium oxide nanoparticles in Arabidopsis germinants

Science.gov (United States)

The effects of exposure to two nanoparticles (NPs) -titanium dioxide (nano-titania) and cerium oxide (nano-ceria) at 500 mg NPs L-1 on gene expression and growth in Arabidopsis thaliana germinants were studied using microarrays and phenotype studies. After 12 days post treatment,...

Electrospun cerium-based TiO2 nanofibers for photocatalytic oxidation of elemental mercury in coal combustion flue gas.

Science.gov (United States)

Wang, Lulu; Zhao, Yongchun; Zhang, Junying

2017-10-01

Photocatalytic oxidation is an attractive method for Hg-rich flue gas treatment. In the present study, a novel cerium-based TiO 2 nanofibers was prepared and selected as the catalyst to remove mercury in flue gas. Accordingly, physical/chemical properties of those nanofibers were clarified. The effects of some important parameters, such as calcination temperature, cerium dopant content and different illumination conditions on the removal of Hg 0 using the photocatalysis process were investigated. In addition, the removal mechanism of Hg 0 over cerium-based TiO 2 nanofibers focused on UV irradiation was proposed. The results show that catalyst which was calcined at 400 °C exhibited better performance. The addition of 0.3 wt% Ce into TiO 2 led to the highest removal efficiency at 91% under UV irradiation. As-prepared samples showed promising stability for long-term use in the test. However, the photoluminescence intensity of nanofibers incorporating ceria was significantly lower than TiO 2 , which was attributed to better photoelectron-hole separation. Although UV and O 2 are essential factors, the enhancement of Hg 0 removal is more obviously related to the participation of catalyst. The coexistence of Ce 3+ and Ce 4+ , which leads to the efficient oxidation of Hg 0 , was detected on samples. Hg 2+ is the final product in the reaction of Hg 0 removal. As a consequence, the emissions of Hg 0 from flue gas can be significantly suppressed. These indicate that combining photocatalysis technology with cerium-based TiO 2 nanofibers is a promising strategy for reducing Hg 0 efficiently. Copyright © 2017 Elsevier Ltd. All rights reserved.

Altering properties of cerium oxide thin films by Rh doping

International Nuclear Information System (INIS)

Ševčíková, Klára; Nehasil, Václav; Vorokhta, Mykhailo; Haviar, Stanislav; Matolín, Vladimír

2015-01-01

Highlights: • Thin films of ceria doped by rhodium deposited by RF magnetron sputtering. • Concentration of rhodium has great impact on properties of Rh–CeO x thin films. • Intensive oxygen migration in films with low concentration of rhodium. • Oxygen migration suppressed in films with high amount of Rh dopants. - Abstract: Ceria containing highly dispersed ions of rhodium is a promising material for catalytic applications. The Rh–CeO x thin films with different concentrations of rhodium were deposited by RF magnetron sputtering and were studied by soft and hard X-ray photoelectron spectroscopies, Temperature programmed reaction and X-ray powder diffraction techniques. The sputtered films consist of rhodium–cerium mixed oxide where cerium exhibits a mixed valency of Ce 4+ and Ce 3+ and rhodium occurs in two oxidation states, Rh 3+ and Rh n+ . We show that the concentration of rhodium has a great influence on the chemical composition, structure and reducibility of the Rh–CeO x thin films. The films with low concentrations of rhodium are polycrystalline, while the films with higher amount of Rh dopants are amorphous. The morphology of the films strongly influences the mobility of oxygen in the material. Therefore, varying the concentration of rhodium in Rh–CeO x thin films leads to preparing materials with different properties

EMISSION REDUCTION FROM A DIESEL ENGINE FUELED BY CERIUM OXIDE NANO-ADDITIVES USING SCR WITH DIFFERENT METAL OXIDES COATED CATALYTIC CONVERTER

Directory of Open Access Journals (Sweden)

B. JOTHI THIRUMAL

2015-11-01

Full Text Available This paper reports the results of experimental investigations on the influence of the addition of cerium oxide in nanoparticle form on the major physiochemical properties and the performance of diesel. The fuel is modified by dispersing the catalytic nanoparticle by ultrasonic agitation. The physiochemical properties of sole diesel fuel and modified fuel are tested with ASTM standard procedures. The effects of the additive nanoparticles on the individual fuel properties, the engine performance, and emissions are studied, and the dosing level of the additive is optimized. Cerium oxide acts as an oxygen-donating catalyst and provides oxygen for the oxidation of CO during combustion. The active energy of cerium oxide acts to burn off carbon deposits within the engine cylinder at the wall temperature and prevents the deposition of non-polar compounds on the cylinder wall which results in reduction in HC emission by 56.5%. Furthermore, a low-cost metal oxide coated SCR (selective catalyst reduction, using urea as a reducing agent, along with different types of CC (catalytic converter, has been implemented in the exhaust pipe to reduce NOx. It was observed that a reduction in NOx emission is 50–60%. The tests revealed that cerium oxide nanoparticles can be used as an additive in diesel to improve complete combustion of the fuel and reduce the exhaust emissions significantly.

Micromagnetic simulation of the influence of grain boundary on cerium substituted Nd-Fe-B magnets

Directory of Open Access Journals (Sweden)

D. Liu

2017-05-01

Full Text Available A three-dimensional finite element model was performed to study the magnetization reversal of (CexNd1-x2Fe14B nanocomposite permanent magnets. The influences of volume fraction, width and performance parameters of the grain boundary (GB composition on the coercivity were analyzed by the method of micromagnetic simulation. The calculation results indicate that the structure and chemistry of GB phase play important roles in Nd2Fe14B-based magnets. An abnormal increase in the value of coercivity is found to be connected with the GB phase, approximately when the percentage of doped cerium is between 20% and 30%. While the coercivity decreases directly with the increase in cerium content instead of being abnormal when there is no GB phase in magnets at all or the value of magnetocrystalline anisotropy or exchange integral is too large.

Corrosion of Zn5Al and Zn55Al alloys with cerium, praseodymium and neodymium

International Nuclear Information System (INIS)

Alikhanova, S.D.

2017-01-01

The present work is devoted to corrosion of Zn5Al and Zn55Al alloys with cerium, praseodymium and neodymium. The purpose of present work is elaboration of optimal composition of zinc-aluminium alloys Zn5Al and Zn55Al alloyed by rare-earth metals of cerium subgroup which are used as anode covers for protection of steel from corrosion. Therefore, the regularities of change of corrosion-electrochemical properties in various corrosive mediums have been determined; processes mechanisms of high temperature oxidation of alloys in solid state have been studied; in the products of alloys oxidation their phase components have been defined and their role in the corrosion process have been revealed; the optimal compositions of zinc-aluminium alloys alloyed by rare earth metals, which are protected by two patents of the Republic of Tajikistan have been elaborated.

Protective effects of Curcuma longa against neurobehavioral and neurochemical damage caused by cerium chloride in mice.

Science.gov (United States)

Kadri, Yamina; Nciri, Riadh; Brahmi, Noura; Saidi, Saber; Harrath, Abdel Halim; Alwasel, Saleh; Aldahmash, Waleed; El Feki, Abdelfatteh; Allagui, Mohamed Salah

2018-05-07

Cerium chloride (CeCl 3 ) is considered an environmental pollutant and a potent neurotoxic agent. Medicinal plants have many bioactive compounds that provide protection against damage caused by such pollutants. Curcuma longa is a bioactive compound-rich plant with very important antioxidant properties. To study the preventive and healing effects of Curcuma longa on cerium-damaged mouse brains, we intraperitoneally injected cerium chloride (CeCl 3 , 20 mg/kg BW) along with Curcuma longa extract, administrated by gavage (100 mg/kg BW), into mice for 60 days. We then examined mouse behavior, brain tissue damage, and brain oxidative stress parameters. Our results revealed a significant modification in the behavior of the CeCl 3 -treated mice. In addition, CeCl 3 induced a significant increment in lipid peroxidation, carbonyl protein (PCO), and advanced oxidation protein product levels, as well as a significant reduction in superoxide dismutase (SOD) and glutathione peroxidase (GPx) activities. Acetylcholinesterase (AChE) activity remarkably increased in the brain of CeCl 3 -treated mice. Histopathological observations confirmed these results. Curcuma longa attenuated CeCl 3 -induced oxidative stress and increased the activities of antioxidant enzymes. It also decreased AChE activity in the CeCl 3 -damaged mouse brain that was confirmed by histopathology. In conclusion, this study suggests that Curcuma longa has a neuroprotective effect against CeCl 3 -induced damage in the brain.

The study of interaction of lanthanum-, cerium- and neodymium chlorides with sodium borohydride in pyridine- and tetrahydrofuran medium

International Nuclear Information System (INIS)

Mirsaidov, U.; Rotenberg, T.G.; Dymova, T.N.

1976-01-01

Bis-tetrahydrofurans of lanthanum and neodymium borohydrides and bis-pyridinates of lanthanum, cerium and neodymium borohydrides were obtained by interacting sodium borohydride with lanthanum-, cerium and neodymium chlorides in pyridine and tetrahydrofuran media. All operations involving reagent combination, sampling and phase separation are performed in inert atmosphere using argonvacuum equipment. The reaction in pyridine was virtually instantaneous and accompanied by flocculanet precipitation. The interaction of lanthanum chloride and neodymium chloride with sodium borohydride in tetrahydrofuran (THF) was a slow (23-30 hr) heterophase process. The interaction rate was affected by size reduction of the intial substances, temperature, reagent proportion and mixing rate. The reaction time was twice reduced with boiling tetrahydrofuran

UL146 variability among clinical isolates of Human Cytomegalovirus from Japan

Directory of Open Access Journals (Sweden)

Francisco Aguayo

2010-01-01

Full Text Available Human Cytomegalovirus (HCMV is a herpesvirus associated with serious diseases in immunocompromised subjects. The region between ORF UL133 and UL151 from HCMV, named ULb' is frequently deleted in attenuated AD169 and in highly passaged laboratory strains. However, this region is conserved in low-passaged and more virulent HCMV, like the Toledo strain. The UL146 gene, which is located in the ULb' region, encodes a CXC-chemokine analogue. The diversity of UL146 gene was evaluated among fifty-six clinical isolates of HCMV from Japan. Results show that UL146 gene was successfully amplified by the polymerase chain reaction (PCR in only 17/56 strains (30%, while the success rate for UL145/UL147 gene was 18/56 strains (32%. After DNA sequencing, the 35 amplified strains were classified into 8 groups. When compared, variability of UL146 ranged from 25.1% to 52.9% at the DNA level and from 34.5% to 67% at the amino acid level. Seven groups had the interleukin-8 (IL-8 motif ERL (Glu-Leu-Arg CXC and one group had only the CXC motif, suggesting the absence of the IL-8 function of UL146. In conclusion, we found that UL146 gene of HCMV is hyper-variable in clinical strains from Japan suggesting the possibility of a different function in each sequence group.

CD146/MCAM defines functionality of human bone marrow stromal stem cell populations

DEFF Research Database (Denmark)

Harkness, Linda; Zaher, Walid; Ditzel, Nicholas

2016-01-01

BACKGROUND: Identification of surface markers for prospective isolation of functionally homogenous populations of human skeletal (stromal, mesenchymal) stem cells (hMSCs) is highly relevant for cell therapy protocols. Thus, we examined the possible use of CD146 to subtype a heterogeneous hMSC...... population. METHODS: Using flow cytometry and cell sorting, we isolated two distinct hMSC-CD146(+) and hMSC-CD146(-) cell populations from the telomerized human bone marrow-derived stromal cell line (hMSC-TERT). Cells were examined for differences in their size, shape and texture by using high...... and adipocytes on the basis of gene expression and protein production of lineage-specific markers. In vivo, hMSC-CD146(+) and hMSC-CD146(-) cells formed bone and bone marrow organ when implanted subcutaneously in immune-deficient mice. Bone was enriched in hMSC-CD146(-) cells (12.6 % versus 8.1 %) and bone...

Inhibition of KLF7-Targeting MicroRNA 146b Promotes Sciatic Nerve Regeneration.

Science.gov (United States)

Li, Wen-Yuan; Zhang, Wei-Ting; Cheng, Yong-Xia; Liu, Yan-Cui; Zhai, Feng-Guo; Sun, Ping; Li, Hui-Ting; Deng, Ling-Xiao; Zhu, Xiao-Feng; Wang, Ying

2018-06-01

A previous study has indicated that Krüppel-like factor 7 (KLF7), a transcription factor that stimulates Schwann cell (SC) proliferation and axonal regeneration after peripheral nerve injury, is a promising therapeutic transcription factor in nerve injury. We aimed to identify whether inhibition of microRNA-146b (miR-146b) affected SC proliferation, migration, and myelinated axon regeneration following sciatic nerve injury by regulating its direct target KLF7. SCs were transfected with miRNA lentivirus, miRNA inhibitor lentivirus, or KLF7 siRNA lentivirus in vitro. The expression of miR146b and KLF7, as well as SC proliferation and migration, were subsequently evaluated. In vivo, an acellular nerve allograft (ANA) followed by injection of GFP control vector or a lentiviral vector encoding an miR-146b inhibitor was used to assess the repair potential in a model of sciatic nerve gap. miR-146b directly targeted KLF7 by binding to the 3'-UTR, suppressing KLF7. Up-regulation of miR-146b and KLF7 knockdown significantly reduced the proliferation and migration of SCs, whereas silencing miR-146b resulted in increased proliferation and migration. KLF7 protein was localized in SCs in which miR-146b was expressed in vivo. Similarly, 4 weeks after the ANA, anti-miR-146b increased KLF7 and its target gene nerve growth factor cascade, promoting axonal outgrowth. Closer analysis revealed improved nerve conduction and sciatic function index score, and enhanced expression of neurofilaments, P0 (anti-peripheral myelin), and myelinated axon regeneration. Our findings provide new insight into the regulation of KLF7 by miR-146b during peripheral nerve regeneration and suggest a potential therapeutic strategy for peripheral nerve injury.

Color maps of Arp 146

Science.gov (United States)

Schultz, A. B.; Spight, L. D.; Colegrove, P. T.; Disanti, M. A.; Fink, U.

1990-01-01

Four color maps of Arp 146 are given. The structure and color of the ring galaxy and its companion show evidence of a bridge of material between the companion and the remnant nucleus of the original galaxy now forming the ring. Broad band spatial coverage clearly defines regions of starburst occurrence.

19 CFR 146.23 - Accountability for merchandise in a zone.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Accountability for merchandise in a zone. 146.23 Section 146.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY....23 Accountability for merchandise in a zone. (a) Identification of merchandise—(1) General. A zone...

Synthesis and Characterization of Hybrid Silica-Zirconia Coatings with Cerium Inhibitor on Aluminum 6061

Directory of Open Access Journals (Sweden)

M. Bahrami

2016-12-01

Full Text Available Organic–inorganic hybrid coatings were prepared by sol–gel method and deposited on aluminum alloy 6061. Attenuated Total Reflectance-Fourier Transform Infrared (ATR-FTIR spectroscopy and Scanning Electron Microscopy (SEM were used for structural study of the hybrid coatings. Adhesive strength of sol–gel coatings to the substrate was evaluated quantitatively and qualitatively. Corrosion behavior of the samples was studied by cyclic potentiodynamic and linear polarization tests. Results showed that adhesion strength of the coatings to the substrates was increased with increasing tetrapropoxide of zirconium (TPOZ and cerium content. Corrosion tests showed that corrosion current density of coated samples were decreased three to seven orders of magnitude in comparison with uncoated aluminum alloy 6061. Decreasing in corrosion current density and increasing in polarization resistance was observed by increasing zirconia and cerium content. Unlike the uncoated aluminum alloy 6061, the crack-free coatings did not show pitting tendency. 

Effect of cerium (IV) ions on the anticorrosion properties of siloxane-poly(methyl methacrylate) based film applied on tin coated steel

Energy Technology Data Exchange (ETDEWEB)

Suegama, P.H. [Departamento de Engenharia Quimica, Escola Politecnica, Universidade de Sao Paulo, CP 61548, 05424-970 Sao Paulo, SP (Brazil); Sarmento, V.H.V. [Departamento Fisico-Quimica, Instituto de Quimica, Universidade Estadual Paulista, UNESP, CP 355, 14801-970 Araraquara, SP (Brazil); Montemor, M.F. [ICEMS, Instituto Superior Tecnico, Technical University of Lisbon, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Benedetti, A.V. [Departamento Fisico-Quimica, Instituto de Quimica, Universidade Estadual Paulista, UNESP, CP 355, 14801-970 Araraquara, SP (Brazil); de Melo, H.G.; Aoki, I.V. [Departamento de Engenharia Quimica, Escola Politecnica, Universidade de Sao Paulo, CP 61548, 05424-970 Sao Paulo, SP (Brazil); Santilli, C.V., E-mail: santilli@iq.unesp.b [Departamento Fisico-Quimica, Instituto de Quimica, Universidade Estadual Paulista, UNESP, CP 355, 14801-970 Araraquara, SP (Brazil)

2010-07-15

This work investigates the influence of the addition of cerium (IV) ions on the anticorrosion properties of organic-inorganic hybrid coatings applied to passivated tin coated steel. In order to evaluate the specific effect of cerium (IV) addition on nanostructural features of the organic and inorganic phases of the hybrid coating, the hydrolytic polycondensation of silicon alkoxide and the radical polymerization of the methyl methacrylate (MMA) function were induced separately. The corrosion resistance of the coatings was evaluated by means of linear polarization, Tafel type curves and electrochemical impedance measurements. The impedance results obtained for the hybrid coatings were discussed based on an electrical equivalent circuit used to fit the experimental data. The electrochemical results clearly showed the improvement of the protective properties of the organic-inorganic hybrid coating mainly when the cerium (IV) was added to the organic phase solution precursor, which seemed to be due to the formation of a more uniform and densely reticulated siloxane-PMMA film.

Effect of cerium (IV) ions on the anticorrosion properties of siloxane-poly(methyl methacrylate) based film applied on tin coated steel

International Nuclear Information System (INIS)

Suegama, P.H.; Sarmento, V.H.V.; Montemor, M.F.; Benedetti, A.V.; de Melo, H.G.; Aoki, I.V.; Santilli, C.V.

2010-01-01

This work investigates the influence of the addition of cerium (IV) ions on the anticorrosion properties of organic-inorganic hybrid coatings applied to passivated tin coated steel. In order to evaluate the specific effect of cerium (IV) addition on nanostructural features of the organic and inorganic phases of the hybrid coating, the hydrolytic polycondensation of silicon alkoxide and the radical polymerization of the methyl methacrylate (MMA) function were induced separately. The corrosion resistance of the coatings was evaluated by means of linear polarization, Tafel type curves and electrochemical impedance measurements. The impedance results obtained for the hybrid coatings were discussed based on an electrical equivalent circuit used to fit the experimental data. The electrochemical results clearly showed the improvement of the protective properties of the organic-inorganic hybrid coating mainly when the cerium (IV) was added to the organic phase solution precursor, which seemed to be due to the formation of a more uniform and densely reticulated siloxane-PMMA film.

22 CFR 146.440 - Health and insurance benefits and services.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Health and insurance benefits and services. 146... the Basis of Sex in Education Programs or Activities Prohibited § 146.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...

21 CFR 146.148 - Reduced acid frozen concentrated orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Reduced acid frozen concentrated orange juice. 146... Canned Fruit Juices and Beverages § 146.148 Reduced acid frozen concentrated orange juice. (a) Reduced acid frozen concentrated orange juice is the food that complies with the requirements for composition...

21 CFR 146.3 - Definitions.

Science.gov (United States)

2010-04-01

... CONSUMPTION CANNED FRUIT JUICES General Provisions § 146.3 Definitions. For the purposes of this part: (a) The... hydrolyzed starch. (c) The term dried glucose sirup means the product obtained by drying glucose sirup. (d... following: Unless otherwise provided in a standard, a lot of canned fruits shall be deemed in compliance for...

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

Directory of Open Access Journals (Sweden)

Chong-Tao Du

2018-03-01

Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

Science.gov (United States)

Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

2018-03-26

The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

Study on recovering directly the commercial cerium oxide and total of residue rare earths from Dongpao bastnasite concentrate

International Nuclear Information System (INIS)

Nguyen Trong Hung; Nguyen Thanh Chung; Luu Xuan Dinh

2003-01-01

A technology for decomposition roasting and sequential leaching processes of Dong Pao bastnasite concentrate to recover directly commercial cerium oxide and total of residue rare earth elements from the leaching solution of the roasted product have been investigated. The bastnasite concentrate is initially roasted at temperature range of 600 - 650 degC and for time of 4 hrs in order to decompose and convert the hardly soluble carbonate forms of ore into easily soluble oxide. The roasted solid is then leached with sulfuric acid solution of 6N at 60 degC for 4 hrs to convert rare earths in oxide and fluoride form into rare earth sulfate. The recovery yield of rare earths of these stages is more than 95%. The attention has especially been paid on recovering directly the commercial cerium oxide and total of residue rare earth element from the above leaching solution. Complex ions of CeSO 4 2+ , Ce(SO 4 ) 2 , Ce(SO 4 ) 3 2- and Ce(SO 4 ) 4 4- exist in aqueous solution of cerium (IV) sulfate. Based on the property, the method of ion - sieve with DOWEX cation resin column has been applied to estimating separation of the ceric complex anions from Ln(III). The survey showed that most of the ceric complex anions are separated from total of residue rare earths. The latter which are absorbed in the cation column are recovered by elution of HCl of 4N. The recovery yield of cerium can only be reached 20% but the purity of that is very high, can be reached 99.6%. About 5 kg of CeO 2 of high grade and 5 kg of TREO of commercial specification have been produced. (author)

Tribological characteristics of monodispersed cerium borate nanospheres in biodegradable rapeseed oil lubricant

Energy Technology Data Exchange (ETDEWEB)

Boshui, Chen, E-mail: boshuichen@163.com; Kecheng, Gu; Jianhua, Fang; Jiang, Wu; Jiu, Wang; Nan, Zhang

2015-10-30

Graphical abstract: - Highlights: • Monodispersed stearic acid-capped cerium borate composite nanoparticles were prepared by hydrothermal method. Their morphologies, element compositions, size distributions, crystal and chemical structures, hydrophobic characteristics were also characterized. • The surface-capped cerium borate nanoparticles exhibited excellent dispersing stability in rapeseed oil. As new lubricating additives, they were also outstanding in enhancing friction-reducing and anti-wear capacities of rapeseed oil in biodegradable rapeseed oil. The results presented in this paper would be of important significance for developing green lubricants and lubricant additives. • The prominent tribological performances of SA/CeBO{sub 3} in rapeseed oil were investigated and attributed to the formation of a composite boundary lubrication film mainly composed of lubricous tribochemical species on the tribo-surfaces. - Abstract: Stearic acid-capped cerium borate composite nanoparticles, abbreviated as SA/CeBO{sub 3}, were prepared by hydrothermal method. The morphologies, element compositions, size distributions, crystal and chemical structures, hydrophobic characteristics, of SA/CeBO{sub 3} were characterized by scanning electron microscope, energy dispersive X-ray spectrometer, dynamic laser particle size analyzer, X-ray diffraction, and Fourier transform infrared spectrometer, respectively. The friction and wear performances of SA/CeBO{sub 3} as a lubricating additive in a rapeseed oil were evaluated on a four-ball tribo-tester. The tribochemical characteristics of the worn surfaces were investigated by X-ray photoelectron spectroscopy. The results showed that the hydrophobic SA/CeBO{sub 3} were monodispersed nanospheres with an average diameter of 8 nm, and exhibited excellent dispersing stability in rapeseed oil. Meanwhile, SA/CeBO{sub 3} nanospheres were outstanding in enhancing friction-reducing and anti-wear capacities of rapeseed oil. The prominent

Cerium(III) pivalate [Ce(Piv)3(HPiv)3]2: synthesis, crystal structure, and thermal stability

International Nuclear Information System (INIS)

Khudyakov, M.Yu.; Kuz'mina, N.P.; Pisarevskij, A.P.; Martynenko, L.I.

2002-01-01

Complex [Ce(Piv) 3 (HPiv) 3 ] 2 was prepared by precipitation of cerium(III) nitrate aqueous solution with salt NH 4 (Piv) (HPiv = pivalic acid) and subsequent recrystallization from 5% HPiv solution in hexane. According to data of X-ray diffraction analysis and IR spectroscopy crystal structure of the complex is built of centrally symmetric dimers, in which cerium atoms are bound by four bridge pivalate ligands. Thermal analysis suggests that heating of the complex in nitrogen atmosphere results first in splitting off six HPiv molecules in the range of 90-190 deg C and then in thermolysis of Ce(Piv) 3 formed at 290-450 deg C. Sublimation of Ce(Piv) 3 occurs in the range of 290-350 deg C along with thermolysis during heating in vacuum (0.01 mm Hg), which permits preparing CeO 2 films by the method of chemical precipitation from gaseous phase [ru

Cerium(terbium, erbium)chloride-choline chloride aqueous systems

International Nuclear Information System (INIS)

Gajfutdinova, R.K.; Zhuravlev, E.F.; Bikbaeva, G.G.; Domrachev, V.N.; Vanskova, G.I.

1985-01-01

To clarify the effect of rare earth nature on mutual solubility of rare earth salts and amines the solubility of solid phases in the systems, consisting of choline chloride, water and cerium, terbium, erbium chlorides, has been studied. It is established, that solubility isotherms of all the systems, testify to the formation of new solid phases of the composition: Ce(Tb, Er)xCl 3 x2C 5 H 14 ONClx3H 2 O. Individuality of new solid phases is proved by DTA method, the composition is confirmed by chemical analysis and data of PMR spectra, for choline chloride and its complexes with rare earth chlorides of the given composition PMR and IR spectra are studied

Cerium(III) molybdate nanoparticles: Synthesis, characterization and radionuclides adsorption studies

Energy Technology Data Exchange (ETDEWEB)

Yousefi, Taher, E-mail: Taher_yosefy@yahoo.com [NFCRS, Nuclear Science and Technology Institute, Kargher Ave, Tehran (Iran, Islamic Republic of); Tarbiat Moallem University, Mofatteh Ave, Tehran (Iran, Islamic Republic of); Khanchi, Ali Reza; Ahmadi, Seyed Javad [NFCRS, Nuclear Science and Technology Institute, Kargher Ave, Tehran (Iran, Islamic Republic of); Rofouei, Mohamad Kazem [Tarbiat Moallem University, Mofatteh Ave, Tehran (Iran, Islamic Republic of); Yavari, Ramin; Davarkhah, Reza; Myanji, Behzad [NFCRS, Nuclear Science and Technology Institute, Kargher Ave, Tehran (Iran, Islamic Republic of)

2012-05-15

Highlights: Black-Right-Pointing-Pointer A new inorganic nanoparticles with average size about 40 nm were synthesized by chemical method. Black-Right-Pointing-Pointer The morphology studies reveal existing nanowires among dense nanoparticles. Black-Right-Pointing-Pointer Investigation shows it has high stability in rough media and high affinity for Cs(I), U(VI), and Th(IV). Black-Right-Pointing-Pointer It was used for adsorption of radionuclides and removal of {sup 134}Cs from real sample. Black-Right-Pointing-Pointer These findings are important for evaluating human and environmental risk assessment. - Abstract: Cerium(III) molybdate nanostructure with average size about 40 nm was prepared by adding cerium(III) chloride and ammonium molybdate solutions under varying conditions. The product was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transform infrared (FT-IR), thermogravimetric analysis (TGA) and Brunauere Emmette Teller (BET) techniques. Ion exchange capacity of the sample for potassium ion and distribution coefficients (K{sub d}) for 23 metal ions were determined, the K{sub d} values for Tl(I), Pb(II), Th(IV), U(VI), and Cs(I) ions were found to be sufficiently high for their removal from various effluents. The adsorption behavior of the sample towards Cs(I){sub 134} species were studied. Finally, the binary separation of Dy(III)-U(VI), Sm(III)-Th(IV) and Cs(I)-Rb(I) and removal of Cs(I){sub 134} from the real sample were successfully achieved.

A phosphate-dependent shift in redox state of cerium oxide nanoparticles and its effects on catalytic properties

Energy Technology Data Exchange (ETDEWEB)

Singh, Sanjay; Dosani, Talib; Karakoti, Ajay S.; Kumar, Amit; Seal, Sudipta; Self, William

2011-10-01

Cerium oxide nanoparticles (CeNPs) have shown promise as catalytic antioxidants in cell culture and animal models as both superoxide dismutase and catalase mimetics. The reactivity of the cerium (Ce) atoms at the surface of its oxide particle is critical to such therapeutic properties, yet little is known about the potential for a protein or small molecule corona to form on these materials in vivo. Moreover Ce atoms in these active sites have the potential to interact with small molecule anions, peptides, or sugars when administered in culture or animal models. Several nanomaterials have been shown to alter or aggregate under these conditions, rendering them less useful for biomedical applications. In this work we have studied the change in catalytic properties of CeNPs when exposed to various biologically relevant conditions in vitro. We have found that CeNPs are resistant to broad changes in pH and also not altered by incubation in cell culture medium. However to our surprise phosphate anions significantly altered the characteristics of these nanomaterials and shifted the catalytic behavior due to the binding of phosphate anions to cerium. Given the abundance of phosphate in biological systems in an inorganic form, it is likely that the action of CeNPs as a catalyst may be strongly influenced by the local concentration of phosphate in the cells and/or tissues in which it has been introduced.

Defect states and room temperature ferromagnetism in cerium oxide nanopowders prepared by decomposition of Ce-propionate

DEFF Research Database (Denmark)

Mihalache, V.; Grivel, J. C.; Secu, M.

2018-01-01

. An improvement of ferromagnetism and intensity of defect-related PL emission was observed when annealing the products in which nanocrystalline cerium oxide coexists with Ce - oxicarbonate traces, Ce2O2CO3. The experimental results were explained based on the following considerations: room temperature......Four batches of cerium oxide powders (with nanocrystallite size of 6.9 nm–572 nm) were prepared from four precursor nanopowders by thermal decomposition of Ce-propionate and annealing in air between 250 °C–1200 °C for 10 min–240 min. Ceria formation reactions, structure, vibrational, luminescence...... and magnetic properties were investigated by differential scanning calorimetry, x-ray diffraction, electron microscopy, infrared spectroscopy, photoluminescence and SQUID. All the samples exhibit room temperature ferromagnetism, RTFM, (with coercivity, Hc, of 8 Oe - 121 Oe and saturation magnetization, Ms...

Corrosion behaviour of nanometre sized cerium oxide and titanium oxide incorporated aluminium in NaCl solution

International Nuclear Information System (INIS)

Ashraf, P. Muhamed; Edwin, Leela

2013-01-01

Highlights: ► Corrosion resistant aluminium incorporated with nano oxides of cerium and titanium. ► 0.2% nano CeO 2 and 0.05% nano TiO 2 showed increased corrosion resistance. ► Nano TiO 2 concentration influenced the optimum performance of the material. ► Comparison of Micro and nano CeO 2 and TiO 2 aluminium showed the latter is best. - Abstract: The study highlights the development of an aluminium matrix composite by incorporating mixture of nanometre sized cerium oxide and titanium oxide in pure aluminium and its corrosion resistance in marine environment. The mixed nanometre sized oxides incorporated aluminium exhibited improved microstructure and excellent corrosion resistance. Corrosion resistance depends on the concentration of nanometre sized titanium oxide. Electrochemical characteristics improved several folds in nanometre sized mixed oxides incorporated aluminium than micrometre sized oxides incorporated aluminium.

19 CFR 146.21 - General requirements.

Science.gov (United States)

2010-04-01

... TREASURY (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.21 General requirements. (a) Systems capability. The operator shall maintain either manual or automated inventory control... English language copy of its written inventory control and recordkeeping systems procedures manual in...

Electric dipole transitions for four-times ionized cerium (Ce V)

Energy Technology Data Exchange (ETDEWEB)

Usta, Betül Karaçoban, E-mail: bkaracoban@sakarya.edu.tr; Akgün, Elif, E-mail: elif.akgun@ogr.sakarya.edu.tr; Alparslan, Büşra, E-mail: busra.alparslan1@ogr.sakarya.edu.tr [Physics Department, Sakarya University, 54187, Sakarya (Turkey)

2016-03-25

We have calculated the transition parameters, such as wavelengths, oscillator strengths, and transition probabilities (or rates), for the electric dipole (E1) transitions in four-times ionized cerium (Ce V, Z = 58) by using the multiconfiguration Hartree-Fock method within the framework of Breit-Pauli (MCHF+BP) relativistic corrections and the relativistic Hartree-Fock (HFR) method. The obtained results have been compared with other works available in literature. A discussion of these calculations for Ce V in this study has also been in view of the MCHF+BP and HFR methods.

Identification of the lines in the L emission spectrum of cerium and samarium

International Nuclear Information System (INIS)

Shrivastava, B.D.; Singh, D.

1992-01-01

The occurrence of a line at 2.1556 A in the L emission spectrum of cerium and two lines at 1.6679 and 1.8379 A in the L emission spectrum of samarium, reported many years ago, has remained a puzzle. These have now been identified as EXAFS minima occurring at the L absorption edges of the respective elements. (author)

38 CFR 21.146 - Independent instructor course.

Science.gov (United States)

2010-07-01

.... Chapter 31 Special Rehabilitation Services § 21.146 Independent instructor course. (a) Definition. An... the customary channels leading to employment may not be readily available to a veteran requiring an...

22 CFR 146.120 - Transfers of property.

Science.gov (United States)

2010-04-01

... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.120 Transfers of property... financial assistance to a transferee that operates any education program or activity, and the Federal share...

Brain suppression of AP-1 by inhaled diesel exhaust and reversal by cerium oxide nanoparticles

NARCIS (Netherlands)

Lung, Shyang; Cassee, Flemming R; Gosens, Ilse; Campbell, Arezoo

One of the uses of cerium oxide nanoparticles (nanoceria, CeO2) is as a diesel fuel additive to improve fuel efficiency. Gene/environment interactions are important determinants in the etiology of age-related disorders. Thus, it is possible that individuals on high-fat diet and genetic

Gene-expression changes in cerium chloride-induced injury of mouse hippocampus.

Directory of Open Access Journals (Sweden)

Zhe Cheng

Full Text Available Cerium is widely used in many aspects of modern society, including agriculture, industry and medicine. It has been demonstrated to enter the ecological environment, is then transferred to humans through food chains, and causes toxic actions in several organs including the brain of animals. However, the neurotoxic molecular mechanisms are not clearly understood. In this study, mice were exposed to 0.5, 1, and 2 mg/kg BW cerium chloride (CeCl(3 for 90 consecutive days, and their learning and memory ability as well as hippocampal gene expression profile were investigated. Our findings suggested that exposure to CeCl(3 led to hippocampal lesions, apoptosis, oxidative stress and impairment of spatial recognition memory. Furthermore, microarray data showed marked alterations in the expression of 154 genes involved in learning and memory, immunity and inflammation, signal transduction, apoptosis and response to stress in the 2 mg/kg CeCl(3 exposed hippocampi. Specifically, the significant up-regulation of Axud1, Cdc37, and Ube2v1 caused severe apoptosis, and great suppression of Adcy8, Fos, and Slc5a7 expression led to impairment of mouse cognitive ability. Therefore, Axud1, Cdc37, Ube2v1, Adcy8, Fos, and Slc5a7 may be potential biomarkers of hippocampal toxicity caused by CeCl3 exposure.

Synthesis of cerium oxide catalysts supported on MCM-41 molecular sieve; Sintese de catalisadores de oxido de cerio suportados na peneira molecular MCM-41

Energy Technology Data Exchange (ETDEWEB)

Souza, E.L.S.; Barros, T.R.B.; Sousa, B.V. de, E-mail: emylle.souza@gmail.com [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academica de Engenharia Quimica

2016-07-01

Porous materials have been widely studied as catalysts and catalyst support. The MCM-41 structure is the one that has been most studied because of its application possibilities in chemical processes. This work aimed to obtain and characterize cerium oxide catalysts supported on MCM-41 molecular sieve. The molecular sieve was synthesized by the conventional method with the following molar composition: 1 SiO2: 0.30 CTABr: NH3 11: 144 H2O. Then, 25% w/w cerium was incorporated into the MCM-41 using the wet impregnation process and the material obtained was activated by calcination. From the XRD patterns was confirmed the structure of the molecular sieve, and were identified the cerium oxide phases in its structure. The textural catalysts characteristics were investigated by isotherms of N2 adsorption/desorption (BET method). (author)

21 CFR 146.185 - Pineapple juice.

Science.gov (United States)

2010-04-01

... reconstituted with water suitable for the purpose of maintaining essential composition and quality factors of... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CANNED FRUIT JUICES Requirements for Specific Standardized Canned Fruit Juices and Beverages § 146...

22 CFR 146.115 - Assurance required.

Science.gov (United States)

2010-04-01

... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.115 Assurance required. (a... applications for Federal financial assistance or awards of Federal financial assistance contain, be accompanied... assurance. (b) Duration of obligation. (1) In the case of Federal financial assistance extended to provide...

Assessing Covalency in Cerium and Uranium Hexachlorides: A Correlated Wavefunction and Density Functional Theory Study

Directory of Open Access Journals (Sweden)

Reece Beekmeyer

2015-11-01

Full Text Available The electronic structure of a series of uranium and cerium hexachlorides in a variety of oxidation states was evaluated at both the correlated wavefunction and density functional (DFT levels of theory. Following recent experimental observations of covalency in tetravalent cerium hexachlorides, bonding character was studied using topological and integrated analysis based on the quantum theory of atoms in molecules (QTAIM. This analysis revealed that M–Cl covalency was strongly dependent on oxidation state, with greater covalency found in higher oxidation state complexes. Comparison of M–Cl delocalisation indices revealed a discrepancy between correlated wavefunction and DFT-derived values. Decomposition of these delocalisation indices demonstrated that the origin of this discrepancy lay in ungerade contributions associated with the f-manifold which we suggest is due to self-interaction error inherent to DFT-based methods. By all measures used in this study, extremely similar levels of covalency between complexes of U and Ce in the same oxidation state was found.

ImmunoPET for assessing the differential uptake of a CD146-specific monoclonal antibody in lung cancer

Energy Technology Data Exchange (ETDEWEB)

Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

2016-11-15

Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146

Optical isotype shifts of 146Sm and 151Sm

International Nuclear Information System (INIS)

Eastham, D.A.; Walker, P.M.; Griffith, J.A.R.; Evans, D.E.; England, J.G.; Grant, I.S.

1984-01-01

We have measured the optical isotope shifts of 146 Sm and 151 Sm by laser resonance fluorescence. From these measurements the changes in the mean square nuclear radii are: delta 2 > (A=144 to 146)=0.266(10) fm 2 , and delta 2 > (A=151 to 152)=0.262(10) fm 2 . These results, together with those of the stable isotopes, show that the average nuclear expansion of samarium can be accounted for by the liquid drop model with deformations. (orig.)

Long range ordered alloys modified by addition of niobium and cerium

International Nuclear Information System (INIS)

Liu, C.T.

1987-01-01

A long range ordered alloy composition is described consisting essentially of iron, nickel, cobalt, vanadium and a ductility enhancing metal, having the nominal composition (Fe, Ni,Co)/sub 3/(V,M) where M is the ductility enhancing metal selected from the group Ti, Zr, Hf and mixtures thereof. Effective amounts of creep property enhance elements selected from the group cerium, niobium and mixtures thereof sufficient to enhance creep properties in the resulting alloy without adversely affecting the fabrication of the alloy

The biological effects of subacute inhalation of diesel exhaust following addition of cerium oxide nanoparticles in atherosclerosis-prone mice

International Nuclear Information System (INIS)

Cassee, Flemming R.; Campbell, Arezoo; Boere, A. John F.; McLean, Steven G.; Duffin, Rodger; Krystek, Petra; Gosens, Ilse; Miller, Mark R.

2012-01-01

Background: Cerium oxide (CeO 2 ) nanoparticles improve the burning efficiency of fuel, however, little is known about health impacts of altered emissions from the vehicles. Methods: Atherosclerosis-prone apolipoprotein E knockout (ApoE −/− ) mice were exposed by inhalation to diluted exhaust (1.7 mg/m 3 , 20, 60 or 180 min, 5 day/week, for 4 weeks), from an engine using standard diesel fuel (DE) or the same diesel fuel containing 9 ppm cerium oxide nanoparticles (DCeE). Changes in hematological indices, clinical chemistry, atherosclerotic burden, tissue levels of inflammatory cytokines and pathology of the major organs were assessed. Results: Addition of CeO 2 to fuel resulted in a reduction of the number (30%) and surface area (10%) of the particles in the exhaust, whereas the gaseous co-pollutants were increased (6–8%). There was, however, a trend towards an increased size and complexity of the atherosclerotic plaques following DE exposure, which was not evident in the DCeE group. There were no clear signs of altered hematological or pathological changes induced by either treatment. However, levels of proinflammatory cytokines were modulated in a brain region and liver following DCeE exposure. Conclusions: These results imply that addition of CeO 2 nanoparticles to fuel decreases the number of particles in exhaust and may reduce atherosclerotic burden associated with exposure to standard diesel fuel. From the extensive assessment of biological parameters performed, the only concerning effect of cerium addition was a slightly raised level of cytokines in a region of the central nervous system. Overall, the use of cerium as a fuel additive may be a potentially useful way to limit the health effects of vehicle exhaust. However, further testing is required to ensure that such an approach is not associated with a chronic inflammatory response which may eventually cause long-term health effects.

The biological effects of subacute inhalation of diesel exhaust following addition of cerium oxide nanoparticles in atherosclerosis-prone mice

Energy Technology Data Exchange (ETDEWEB)

Cassee, Flemming R., E-mail: flemming.cassee@rivm.nl [National Institute for Public Health and the Environment, PO box 1, 3720 BA Bilthoven (Netherlands); Campbell, Arezoo, E-mail: acampbell@westernu.edu [Western University of Health Sciences, Pomona, CA (United States); Boere, A. John F., E-mail: john.boere@rivm.nl [National Institute for Public Health and the Environment, PO box 1, 3720 BA Bilthoven (Netherlands); McLean, Steven G., E-mail: smclean1@staffmail.ed.ac.uk [BHF/University Centre for Cardiovascular Sciences, University of Edinburgh, Edinburgh (United Kingdom); Duffin, Rodger, E-mail: Rodger.Duffin@ed.ac.uk [MRC Centre for Inflammation Research, University of Edinburgh, Edinburgh (United Kingdom); Krystek, Petra, E-mail: petra.krystek@philips.com [Philips Innovation Services, Eindhoven (Netherlands); Gosens, Ilse, E-mail: Ilse.gosens@rivm.nl [National Institute for Public Health and the Environment, PO box 1, 3720 BA Bilthoven (Netherlands); Miller, Mark R., E-mail: Mark.Miller@ed.ac.uk [BHF/University Centre for Cardiovascular Sciences, University of Edinburgh, Edinburgh (United Kingdom)

2012-05-15

Background: Cerium oxide (CeO{sub 2}) nanoparticles improve the burning efficiency of fuel, however, little is known about health impacts of altered emissions from the vehicles. Methods: Atherosclerosis-prone apolipoprotein E knockout (ApoE{sup -/-}) mice were exposed by inhalation to diluted exhaust (1.7 mg/m{sup 3}, 20, 60 or 180 min, 5 day/week, for 4 weeks), from an engine using standard diesel fuel (DE) or the same diesel fuel containing 9 ppm cerium oxide nanoparticles (DCeE). Changes in hematological indices, clinical chemistry, atherosclerotic burden, tissue levels of inflammatory cytokines and pathology of the major organs were assessed. Results: Addition of CeO{sub 2} to fuel resulted in a reduction of the number (30%) and surface area (10%) of the particles in the exhaust, whereas the gaseous co-pollutants were increased (6-8%). There was, however, a trend towards an increased size and complexity of the atherosclerotic plaques following DE exposure, which was not evident in the DCeE group. There were no clear signs of altered hematological or pathological changes induced by either treatment. However, levels of proinflammatory cytokines were modulated in a brain region and liver following DCeE exposure. Conclusions: These results imply that addition of CeO{sub 2} nanoparticles to fuel decreases the number of particles in exhaust and may reduce atherosclerotic burden associated with exposure to standard diesel fuel. From the extensive assessment of biological parameters performed, the only concerning effect of cerium addition was a slightly raised level of cytokines in a region of the central nervous system. Overall, the use of cerium as a fuel additive may be a potentially useful way to limit the health effects of vehicle exhaust. However, further testing is required to ensure that such an approach is not associated with a chronic inflammatory response which may eventually cause long-term health effects.

The biological effects of subacute inhalation of diesel exhaust following addition of cerium oxide nanoparticles in atherosclerosis-prone mice.

Science.gov (United States)

Cassee, Flemming R; Campbell, Arezoo; Boere, A John F; McLean, Steven G; Duffin, Rodger; Krystek, Petra; Gosens, Ilse; Miller, Mark R

2012-05-01

Cerium oxide (CeO(2)) nanoparticles improve the burning efficiency of fuel, however, little is known about health impacts of altered emissions from the vehicles. Atherosclerosis-prone apolipoprotein E knockout (ApoE(-/-)) mice were exposed by inhalation to diluted exhaust (1.7 mg/m(3), 20, 60 or 180 min, 5 day/week, for 4 weeks), from an engine using standard diesel fuel (DE) or the same diesel fuel containing 9 ppm cerium oxide nanoparticles (DCeE). Changes in hematological indices, clinical chemistry, atherosclerotic burden, tissue levels of inflammatory cytokines and pathology of the major organs were assessed. Addition of CeO(2) to fuel resulted in a reduction of the number (30%) and surface area (10%) of the particles in the exhaust, whereas the gaseous co-pollutants were increased (6-8%). There was, however, a trend towards an increased size and complexity of the atherosclerotic plaques following DE exposure, which was not evident in the DCeE group. There were no clear signs of altered hematological or pathological changes induced by either treatment. However, levels of proinflammatory cytokines were modulated in a brain region and liver following DCeE exposure. These results imply that addition of CeO(2) nanoparticles to fuel decreases the number of particles in exhaust and may reduce atherosclerotic burden associated with exposure to standard diesel fuel. From the extensive assessment of biological parameters performed, the only concerning effect of cerium addition was a slightly raised level of cytokines in a region of the central nervous system. Overall, the use of cerium as a fuel additive may be a potentially useful way to limit the health effects of vehicle exhaust. However, further testing is required to ensure that such an approach is not associated with a chronic inflammatory response which may eventually cause long-term health effects. Copyright © 2012 Elsevier Inc. All rights reserved.

Development of electrolytic process in molten salt media for light rare-earth metals production. The metallic cerium electrodeposition

International Nuclear Information System (INIS)

Restivo, T.A.G.

1994-01-01

The development of molten salt process and the respective equipment aiming rare-earth metals recovery was described. In the present case, the liquid cerium metal electrodeposition in a molten electrolytes of cerium chloride and an equimolar mixture of sodium and potassium chlorides in temperatures near 800 C was studied. Due the high chemical reactivity of the rare-earth metals in the liquid state and their molten halides, an electrolytic cell was constructed with controlled atmosphere, graphite crucibles and anodes and a tungsten cathode. The electrolytic process variables and characteristics were evaluated upon the current efficiency and metallic product purity. Based on this evaluations, were suggested some alterations on the electrolytic reactor design and upon the process parameters. (author). 90 refs, 37 figs, 20 tabs

Yttrium and lanthanum recovery from low cerium carbonate, yttrium carbonate and yttrium concentrate

International Nuclear Information System (INIS)

Vasconcelos, Mari Estela de

2006-01-01

In this work, separation, enrichment and purification of lanthanum and yttrium were performed using as raw material a commercial low cerium rare earth concentrate named LCC (low cerium carbonate), an yttrium concentrate named 'yttrium carbonate', and a third concentrated known as 'yttrium earths oxide. The first two were industrially produced by the late NUCLEMON - NUCLEBRAS de Monazita e Associados Ltda, using Brazilian monazite. The 'yttrium earths oxide' come from a process for preparation of lanthanum during the course of the experimental work for the present thesis. The following techniques were used: fractional precipitation with urea; fractional leaching of the LCC using ammonium carbonate; precipitation of rare earth peroxycarbonates starting from the rare earth complex carbonates. Once prepared the enriched rare earth fractions the same were refined using the ion exchange chromatography with strong cationic resin without the use of retention ion and elution using the ammonium salt of ethylenediaminetetraacetic acid. With the association of the above mentioned techniques were obtained pure oxides of yttrium (>97,7%), lanthanum (99,9%), gadolinium (96,6%) and samarium (99,9%). The process here developed has technical and economic viability for the installation of a large scale unity. (author)

Synergistic properties of graphitic carbon nitride/cerium molybdate nanocomposites for enhanced photocatalytic activity

Science.gov (United States)

Bhargava, V. S.; Singh, Gajendar; Sharma, Manu

2018-05-01

A polymeric semiconductor (g-C3N4), based nanocomposites have been achieved much attention due to its excellent thermal, chemical stability and suitable band positions for water splitting. g-C3N4 based nanocomposites show good performance in the field of photocatalysis, sensors, Li-ion batteries, supercapacitors and water purification technology. In this work, a series of novel g-C3N4/CeM nano composites were synthesized using a facile one-step ultra-sonication method. X-ray diffraction (XRD) pattern confirms the formation of g-C3N4 and cerium molybdate. The photocatalytic activity of nanocomposites indicated the substantial degradation of Methylene Blue (MB) dye up to 97% over the surface of g-C3N4/CeM under visible light illumination. All the g-C3N4/CeM composites possess higher photocatalytic activity than pure cerium molybdate. The proposed mechanism demonstrated that the different weight ratios of photocatalyst were most likely attributed to a synergistic effect between g-C3N4 and CeM. This approach is very simple, cost effective, and free from any surfactant that makes it valuable catalyst for various future applications.

Thermally stimulated iron oxide transformations and magnetic behaviour of cerium dioxide/iron oxide reactive sorbents

Czech Academy of Sciences Publication Activity Database

Luňáček, J.; Životský, O.; Jirásková, Yvonna; Buršík, Jiří; Janoš, P.

2016-01-01

Roč. 120, OCT (2016), s. 295-303 ISSN 1044-5803 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Oxide -nano-composites * Mössbauer spectroscopy * TEM * Cerium oxide * Magnetic parameters Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.714, year: 2016

Using EIS to analyse samples of Al-Mg alloy AA5083 treated by thermal activation in cerium salt baths

International Nuclear Information System (INIS)

Bethencourt, M.; Botana, F.J.; Cano, M.J.; Marcos, M.; Sanchez-Amaya, J.M.; Gonzalez-Rovira, L.

2008-01-01

This paper describes a study undertaken of the morphological and anticorrosive characteristics of surface layers formed on the Al-Mg alloy AA5083 from solutions of Ce(III), by means of various heat treatments while immersed in baths of cerium salts. SEM/EDS studies have demonstrated the existence of a heterogeneous layer formed by a film of aluminium oxide/hydroxide on the matrix and a series of dispersed islands of cerium deposited on the cathodic intermetallics. With the object of evaluating the degree of protection provided by the layers formed and of characterising the particular contribution of the electrochemical response of the system in NaCl, the results obtained by means of EIS are presented and discussed

10 CFR 1.46 - Office of Nuclear Security and Incident Response.

Science.gov (United States)

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Office of Nuclear Security and Incident Response. 1.46... Headquarters Program Offices § 1.46 Office of Nuclear Security and Incident Response. The Office of Nuclear... evaluation and assessment of technical issues involving security at nuclear facilities, and is the agency...

Soluble CD146, an innovative and non-invasive biomarker of embryo selection for in vitro fertilization.

Directory of Open Access Journals (Sweden)

Sylvie Bouvier

Full Text Available Although progress was made in in vitro fertilization (IVF techniques, the majority of embryos transferred fail to implant. Morphology embryo scoring is the standard procedure for most of IVF centres for choosing the best embryo, but remains limited since even the embryos classified as "top quality" may not implant. As it has been shown that i CD146 is involved in embryo implantation and ii membrane form is shed to generate soluble CD146 (sCD146, we propose that sCD146 in embryo supernatants may constitute a new biomarker of embryo selection. Immunocytochemical staining showed expression of CD146 in early embryo stages and sCD146 was detected by ELISA and Western-blot in embryo supernatants from D2. We retrospectively studied 126 couples who underwent IVF attempt. The embryo culture medium from each transferred embryo (n = 222 was collected for measurement of sCD146 by ELISA. Significantly higher sCD146 concentrations were present in embryo supernatants that did not implant (n = 185 as compared to those that successfully implanted (n = 37 (1310 +/- 1152 pg.mL-1 vs. 845+/- 1173 pg.mL-1, p = 0.024. Sensitivity analysis performed on single embryo transfers (n = 71 confirmed this association (p = 0.0054. The computed ROC curve established that the optimal sCD146 concentration for embryo implantation is under 1164 pg.mL-1 (sensitivity: 76%, specificity: 48%, PPV: 25% and NPV: 92%. Over this sCD146 threshold, the implantation rate was significantly lower (9% with sCD146 levels >1164 pg.ml-1 vs. 22% with sCD146 levels ≤ 1164 pg.mL-1, p = 0.01. Among the embryos preselected by morphologic scoring, sCD146 determination could allow a better selection of the embryo(s, thus improving the success of elective single embryo transfer. This study establishes the proof of concept for the use of sCD146 as a biomarker for IVF by excluding the embryo with the highest sCD146 level. A multicentre prospective study will now be necessary to further establish its use in

microRNA-146a promotes mycobacterial survival in macrophages through suppressing nitric oxide production.

Science.gov (United States)

Li, Miao; Wang, Jinli; Fang, Yimin; Gong, Sitang; Li, Meiyu; Wu, Minhao; Lai, Xiaomin; Zeng, Gucheng; Wang, Yi; Yang, Kun; Huang, Xi

2016-03-30

Macrophages play a crucial role in host innate anti-mycobacterial defense, which is tightly regulated by multiple factors, including microRNAs. Our previous study showed that a panel of microRNAs was markedly up-regulated in macrophages upon mycobacterial infection. Here, we investigated the biological function of miR-146a during mycobacterial infection. miR-146a expression was induced both in vitro and in vivo after Mycobacterium bovis BCG infection. The inducible miR-146a could suppress the inducible nitric oxide (NO) synthase (iNOS) expression and NO generation, thus promoting mycobacterial survival in macrophages. Inhibition of endogenous miR-146a increased NO production and mycobacterial clearance. Moreover, miR-146a attenuated the activation of nuclear factor κB and mitogen-activated protein kinases signaling pathways during BCG infection, which in turn repressed iNOS expression. Mechanistically, miR-146a directly targeted tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) at post-transcriptional level. Silencing TRAF6 decreased iNOS expression and NO production in BCG-infected macrophages, while overexpression of TRAF6 reversed miR-146a-mediated inhibition of NO production and clearance of mycobacteria. Therefore, we demonstrated a novel role of miR-146a in the modulation of host defense against mycobacterial infection by repressing NO production via targeting TRAF6, which may provide a promising therapeutic target for tuberculosis.

Nanoporous cerium oxide thin film for glucose biosensor.

Science.gov (United States)

Saha, Shibu; Arya, Sunil K; Singh, S P; Sreenivas, K; Malhotra, B D; Gupta, Vinay

2009-03-15

Nanoporous cerium oxide (CeO(2)) thin film deposited onto platinum (Pt) coated glass plate using pulsed laser deposition (PLD) has been utilized for immobilization of glucose oxidase (GOx). Atomic force microscopy studies reveal the formation of nanoporous surface morphology of CeO(2) thin film. Response studies carried out using differential pulsed voltammetry (DPV) and optical measurements show that the GOx/CeO(2)/Pt bio-electrode shows linearity in the range of 25-300 mg/dl of glucose concentration. The low value of Michaelis-Menten constant (1.01 mM) indicates enhanced enzyme affinity of GOx to glucose. The observed results show promising application of the nanoporous CeO(2) thin film for glucose sensing application without any surface functionalization or mediator.

40 CFR 146.67 - Operating requirements.

Science.gov (United States)

2010-07-01

... serving as a water supply, place a notice in a newspaper of general circulation. (2) The Director may... 146.67 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED... steps to determine the presence or absence of a leak; and (3) Notify the Director within 24 hours after...

Chemical and structural analyses of subsurface crevices formed during spontaneous deposition of cerium-based conversion coatings

Energy Technology Data Exchange (ETDEWEB)

Heller, Daimon K, E-mail: dkheller@mmm.com; Fahrenholtz, William G., E-mail: billf@mst.edu; O' Keefe, Matthew J., E-mail: mjokeefe@mst.edu

2011-11-15

Subsurface crevices formed during the deposition of cerium-based conversion coatings were analyzed in cross-section to assess the effect of deposition and post-treatment on the structure and chemistry of phases present. An Al-O containing phase, believed to be amorphous Al(OH){sub 3}, was formed in crevices during coating deposition. Analysis by energy dispersive X-ray spectroscopy revealed the presence of up to 1.6 at.% chlorine within the Al-O phase, which was likely a product of soluble chlorides that were present in the coating solution. Cerium was not detected within crevices. After post-treatment in an 85 deg. C aqueous phosphate solution, the chloride concentration was reduced to {<=} 0.30 at.% and electron diffraction of the Al-O phase produced ring patterns, indicating it had crystallized. Some diffraction patterns could be indexed to gibbsite (Al(OH){sub 3}), but others are believed to be a combination of hydrated aluminum hydroxides and/or oxides. Aluminum phosphate was not identified. Separately from its effect on cerium-based conversion coatings, phosphate post-treatment improved the corrosion resistance of Al 2024-T3 substrates by acting to crystallize Al(OH){sub 3} present on interior surfaces of crevices and by reducing the chloride concentration in this phase. - Highlights: {yields} Analysis of subsurface crevices formed during deposition of Ce-based conversion coatings. {yields} Phosphate post-treatment improved corrosion protection in salt spray testing. {yields} Post-treatment affected the composition and structure of regions within crevices. {yields} Crystallized Al(OH){sub 3} within crevices acted as a more effective barrier to chloride ions.

MicroRNA-146a Contributes to SCI Recovery via Regulating TRAF6 and IRAK1 Expression.

Science.gov (United States)

Wei, Jinsong; Wang, Jiafeng; Zhou, Yulan; Yan, Shouquan; Li, Keshen; Lin, Hongsheng

2016-01-01

MicroRNA-146a participates in spinal cord injury (SCI) recovery. Until recently, how miRNA-146a participates in SCI remained unclear. In this study, we tried to explore the roles of miRNA-146a in the recovery of SCI using a rat model. The expression of the probable target genes of miRNA-146a (including IRAK1 and TARF6) as well as proinflammation cytokines were measured until 7 days after surgery in the three groups (sham group, SCI group, and miRNA-146a antagomir injection group). Also, the animals' motivations were estimated using Basso Beattie Bresnahan (BBB) during the whole experiment. A luciferase assay was performed to demonstrate that miRNA-146a could directly target the mRNAs of IRAK1 and TRAF6 . Our experiments indicate that miRNA-146a inhibits proinflammatory cytokine secretion by suppressing IRAK1 and TRAF6 expression in the SCI model. In contrast, miRNA-146a may be upregulated by inflammatory mediators via the IRAK1 / TRAF6 pathway in the spinal cord. As a negative feedback element, miRNA-146a could make sure that the expression of IRAK1 - and TRAF6 -mediated genes was under tight control. Thus, miRNA-146a may serve as a novel therapeutic target for SCI interventions.

New levels and reinvestigation of octupole correlations in {sup 146,147}La

Energy Technology Data Exchange (ETDEWEB)

Wang, E.H.; Zachary, C.J.; Hamilton, J.H.; Ramayya, A.V.; Hwang, J.K.; Liu, S.H.; Brewer, N.T. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lewis, W. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Furman University, Department of Physics, Greenville, SC (United States); Luo, Y.X. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Zhu, S.J. [Tsinghua University, Department of Physics, Beijing (China); Ter-Akopian, G.M.; Oganessian, Yu.Ts. [Joint Institute for Nuclear Research, Dubna (Russian Federation)

2017-12-15

High spin states of neutron-rich {sup 146,147}La have been reinvestigated by γ-γ-γ and γ-γ-γ-γ coincidence data from a {sup 252}Cf spontaneous fission experiment by using Gammasphere. Thirty-two new transitions in {sup 146}La are observed. Two new bands in {sup 146}La have been established. One of them is proposed to be the octupole parity partner of the previously known band. Twenty new transitions in {sup 147}La are observed. The ground state band of {sup 147}La has been established with a proposed 5/2{sup +} band-head. Angular correlation of cascades has been used to study the spins and parities of the states. The B(E1)/B(E2) ratios and dipole moments of bands in {sup 146,} {sup 147}La have been measured. (orig.)

Mechanochemical synthesis and spark plasma sintering of the cerium silicides

Energy Technology Data Exchange (ETDEWEB)

Alanko, Gordon A.; Jaques, Brian; Bateman, Allyssa [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Butt, Darryl P., E-mail: darrylbutt@boisestate.edu [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Center for Advanced Energy Studies, 995 University Boulevard, Idaho Falls, ID 83401 (United States)

2014-12-15

Highlights: • Ce{sub 5}Si{sub 3}, Ce{sub 3}Si{sub 2}, CeSi, CeSi{sub 2−x} and CeSi{sub 2} were mechanochemically synthesized. • Temperature and pressure were monitored to investigate reaction progress. • All syntheses proceeded through a MSR event followed by rapid solid-state diffusion. • Milling time before MSR correlates well with effective heat of formation. • Some synthesized material was densified by spark plasma sintering. - Abstract: The cerium silicides, Ce{sub 5}Si{sub 3}, Ce{sub 3}Si{sub 2}, CeSi, CeSi{sub 2−y}, and CeSi{sub 2−x}, have been prepared from the elements by mechanochemical processing in a planetary ball mill. Preparation of the cerium silicide Ce{sub 5}Si{sub 4} was unsuccessfully attempted and potential reasons for this are discussed. Temperature and pressure of the milling vial were monitored in situ to gain insight into the mechanochemical reaction kinetics, which include a mechanically-induced self-propagating reaction (MSR). Some prepared powders were consolidated by spark plasma sintering to high density. Starting materials, as-milled powders, and consolidated samples were characterized by X-ray diffraction, scanning electron microscopy, and energy dispersive spectroscopy. The results obtained help elucidate key questions in mechanochemical processing of intermetallics, showing first phase formation similar to thin films, MSR ignition times that are composition- and milling speed-dependent, and sensitivity of stable compound formation on the impact pressure. The results demonstrate mechanochemical synthesis as a viable technique for rare earth silicides.

19 CFR 146.7 - Zone changes.

Science.gov (United States)

2010-04-01

... the risk and expense of the operator. The port director may require an accounting of all merchandise.... An operator shall make written application to the port director for approval of an alteration of an... accompanied by the supporting document requirements specified in § 146.6, as applicable. The port director may...

A new oxidimetric reagent: potassium dichromate in a strong phosphoric acid medium--VII. Photometric titration of vanadium(IV) and of cerium(III) alone and in mixtures with iroN(II).

Science.gov (United States)

Rao, G G; Rao, P K

1967-01-01

Vanadium(IV) can be accurately titrated with potassium dichromate in media containing phosphoric acid of 3-12M concentration: the change in absorption of vanadium(IV) is followed in the region 660 mmicro using a red filter. It is more convenient to carry out the titration in 3M phosphoric acid because at higher concentrations chloride, nitrate, cerium(III) and manganese(II) may interfere. Photoelcetric titration is more convenient than potentiometric because the former can be made in a 3M phosphoric acid medium, whereas the latter is possible only in 12M phosphoric acid. The simultaneous differential photometric titration of iron(II) and vanadium(IV) is also possible. Conditions have been found for the photometric titration of cerium(III) and of cerium(III) plus iron(II). The titration is carried out (at 450 mmicro or with a blue filter) in about 10.5M phosphoric acid. Application of the method to a cerium mineral is considered.

Absolute transition probabilities for 559 strong lines of neutral cerium

Energy Technology Data Exchange (ETDEWEB)

Curry, J J, E-mail: jjcurry@nist.go [National Institute of Standards and Technology, Gaithersburg, MD 20899-8422 (United States)

2009-07-07

Absolute radiative transition probabilities are reported for 559 strong lines of neutral cerium covering the wavelength range 340-880 nm. These transition probabilities are obtained by scaling published relative line intensities (Meggers et al 1975 Tables of Spectral Line Intensities (National Bureau of Standards Monograph 145)) with a smaller set of published absolute transition probabilities (Bisson et al 1991 J. Opt. Soc. Am. B 8 1545). All 559 new values are for lines for which transition probabilities have not previously been available. The estimated relative random uncertainty of the new data is +-35% for nearly all lines.

Octupole excitations in 146Sm

International Nuclear Information System (INIS)

Bizzeti, P.G.; Bizzetti-Sona, A.M.

1998-01-01

The mean lives of the lowest 9 - and 12 + states of 146 Sm have been measured by means of the RDM. Their (preliminary) values are r m (9 - )=0.97±0.05 ns and r m (12 + )=15±2 ps, respectively. The strengths of the collective E3 transitions of the 12 + →9 - →6 6 cascade are compared with the corresponding ones in 148 Gd

The effect of post-treatment time and temperature on cerium-based conversion coatings on Al 2024-T3

Energy Technology Data Exchange (ETDEWEB)

Heller, Daimon K [Missouri University of Science and Technology, 101 Straumanis Hall, 401 West 16th Street, Rolla, MO 65409 (United States)], E-mail: dkhvwb@mst.edu; Fahrenholtz, William G. [Missouri University of Science and Technology, 101 Straumanis Hall, 401 West 16th Street, Rolla, MO 65409 (United States)], E-mail: billf@mst.edu; O' Keefe, Matthew J. [Missouri University of Science and Technology, 101 Straumanis Hall, 401 West 16th Street, Rolla, MO 65409 (United States)

2010-02-15

Corrosion performance, morphology, and electrochemical characteristics of cerium-based conversion coatings on Al 2024-T3 were examined as a function of phosphate post-treatment time and temperature. Corrosion resistance improved after post-treatment in 2.5 wt.% NH{sub 4}H{sub 2}PO{sub 4} for times up to 10 min or temperatures up to 85 deg. C. Electrochemical impedance spectroscopy and polarization testing correlated to neutral salt spray corrosion performance. Hydrated cerium oxide and peroxide species present in the as-deposited coatings were transformed to CePO{sub 4}.H{sub 2}O for post-treatments at longer times and/or higher temperatures. Based on these results, processes active during post-treatment are kinetically dependent and strongly influenced by the post-treatment time and temperature.

Contribution to research on the metabolism of fission product. Studies on the physico-chemical state and the metabolic fate of radio-cerium solution; Contribution a l'etude du metabolisme des produits de fission. Recherches sur l'etat physico-chimique et le devenir metabolique des solutions de radiocerium

Energy Technology Data Exchange (ETDEWEB)

Aeberhardt, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1961-07-01

This paper describes a study of the physico-chemical state of radio-cerium in dilute solutions on the tracer scale, as a function of the pH of the solution. The way in which this radioelement is transported in the blood is studied in vitro and in vivo, with reference to the ionic or colloidal state of the radio-cerium used. The distribution of cerium amongst the various components of the blood is studied by a new method of blood fractionation and by paper electrophoresis. Evidence of a cerium globulin connection is shown in the case of ionic cerium. A study of the initial distribution of radio-cerium in rats, after intravenous administration of ionic or colloidal solutions, shows considerable differences according to the physico-chemical state of the cerium injected. (author) [French] Ce travail presente une etude de l'etat physico-chimique du radiocerium en solutions diluees a l'echelle des indicateurs, en fonction du pH de la solution. En fonction de l'etat ionique ou colloidal du radiocerium utilise, le mode de transport de ce radioelement dans le sang est etudie in vitro et in vivo. La distribution du cerium entre les differents constituants du sang est etudiee par une methode nouvelle de fractionnement du sang et par electrophorese sur papier. L'existence d'une liaison cerium-globuline est mise en evidence dans le cas du cerium ionique. L'etude de la distribution initiale du radiocerium, chez le rat apres administration par voie veineuse de solutions ionique ou colloidale, montre des differences importantes en fonction de l'etat physico-chimique du cerium injecte. (auteur)

Cerium dioxide as a new reactive sorbent for fast degradation of parathion methyl and some other organophosphates

Czech Academy of Sciences Publication Activity Database

Janos, P.; Kuráň, P.; Kormunda, M.; Štengl, Václav; Matys Grygar, Tomáš; Došek, M.; Šťastný, M.; Ederer, J.; Pilařová, V.; Vrtoch, L.

2014-01-01

Roč. 32, č. 4 (2014), s. 360-370 ISSN 1002-0721 Institutional support: RVO:61388980 Keywords : cerium dioxide * carbonate precursor * lanthanides * organophosphate pesticide * parathion methyl * chemical warfare agents Subject RIV: CA - Inorganic Chemistry Impact factor: 1.261, year: 2014

21 CFR 133.146 - Grated cheeses.

Science.gov (United States)

2010-04-01

... Products § 133.146 Grated cheeses. (a) Description. Grated cheeses is the class of foods prepared by..., and skim milk cheese for manufacturing may not be used. All cheese ingredients used are either made... ___ cheese”, the name of the cheese filling the blank. (ii) If only parmesan and romano cheeses are used and...

MicroRNA-146a Regulates Perfusion Recovery in Response to Arterial Occlusion via Arteriogenesis

Directory of Open Access Journals (Sweden)

Joshua L. Heuslein

2018-01-01

Full Text Available The growth of endogenous collateral arteries that bypass arterial occlusion(s, or arteriogenesis, is a fundamental shear stress-induced adaptation with implications for treating peripheral arterial disease. MicroRNAs (miRs are key regulators of gene expression in response to injury and have strong therapeutic potential. In a previous study, we identified miR-146a as a candidate regulator of vascular remodeling. Here, we tested whether miR-146a regulates in vitro angiogenic endothelial cell (EC behaviors, as well as perfusion recovery, arteriogenesis, and angiogenesis in response to femoral arterial ligation (FAL in vivo. We found miR-146a inhibition impaired EC tube formation and migration in vitro. Following FAL, Balb/c mice were treated with a single, intramuscular injection of anti-miR-146a or scramble locked nucleic acid (LNA oligonucleotides directly into the non-ischemic gracilis muscles. Serial laser Doppler imaging demonstrated that anti-miR-146a treated mice exhibited significantly greater perfusion recovery (a 16% increase compared mice treated with scramble LNA. Moreover, anti-miR-146a treated mice exhibited a 22% increase in collateral artery diameter compared to controls, while there was no significant effect on in vivo angiogenesis or muscle regeneration. Despite exerting no beneficial effects on angiogenesis, the inhibition of mechanosensitive miR-146a enhances perfusion recovery after FAL via enhanced arteriogenesis.

Chemiluminescence behavior based on oxidation reaction of rhodamine B with cerium(IV) in sulfuric acid medium

International Nuclear Information System (INIS)

Ma Yongjun; Jin Xiaoyong; Zhou Min; Zhang Ziyu; Teng Xiulan; Chen Hui

2003-01-01

The chemiluminescence (CL) of the rhodamine B (RhB)-cerium(IV) system was investigated by flow-injection. Rhodamine B was suggested to be a suitable chemiluminescent reagent in acidic conditions. When the concentration of rhodamine B was 100 mg l -1 and cerium sulfate was 1.6 mmol l -1 in sulfuric acid, the chemiluminescent intensity was found to be highest by using 0.3 mol l -1 sulfuric acid as a carrier solution. The particular chemiluminescent system could tolerate such distinct acidic environments that it was utilized for detecting many compounds that are stable in acidic solutions. Furthermore, by virtue of IR, UV-Vis and luminescence spectroscopic measurements, the chemiluminescent behavior of rhodamine B was studied and a possible mechanism for this chemiluminescent reaction was proposed. The emitter was affirmed to be a radical species due to one of the oxidation products of RhB; the chemiluminescent emissive wavelength was about 425 nm

Chemiluminescence behavior based on oxidation reaction of rhodamine B with cerium(IV) in sulfuric acid medium

Energy Technology Data Exchange (ETDEWEB)

Ma Yongjun; Jin Xiaoyong; Zhou Min; Zhang Ziyu; Teng Xiulan; Chen Hui

2003-08-18

The chemiluminescence (CL) of the rhodamine B (RhB)-cerium(IV) system was investigated by flow-injection. Rhodamine B was suggested to be a suitable chemiluminescent reagent in acidic conditions. When the concentration of rhodamine B was 100 mg l{sup -1} and cerium sulfate was 1.6 mmol l{sup -1} in sulfuric acid, the chemiluminescent intensity was found to be highest by using 0.3 mol l{sup -1} sulfuric acid as a carrier solution. The particular chemiluminescent system could tolerate such distinct acidic environments that it was utilized for detecting many compounds that are stable in acidic solutions. Furthermore, by virtue of IR, UV-Vis and luminescence spectroscopic measurements, the chemiluminescent behavior of rhodamine B was studied and a possible mechanism for this chemiluminescent reaction was proposed. The emitter was affirmed to be a radical species due to one of the oxidation products of RhB; the chemiluminescent emissive wavelength was about 425 nm.

Effect of Pressure on the Ferromagnetic Cerium Compound CeCu9Sn4

International Nuclear Information System (INIS)

Ishii, Y.; Mori, N.; Hedo, M.; Uwatoko, Y.

2003-01-01

Electrical resistivity measurements under hydrostatic pressure up to 2.2 GPa was carried out for a ferromagnetic ternary cerium compound CeCu 9 Sn 4 . The ferromagnetic transition temperature increases with increasing pressure up to 0.8 GPa and then decreases with increasing pressure above 1 GPa. Origins of this pressure dependence may be the competition between magnetic interaction in the c-plane and along the c-direction. (author)

Ab initio MCHF structural calculations of Mg-like cerium

Science.gov (United States)

Wajid, Abdul; Jabeen, S.; Husain, Abid

2018-05-01

Energy levels and emission line wavelengths of high-Z materials are useful for impurity diagnostics in the next generation fusion devices. For this here we have calculated E1, M2 transitions, oscillator strengths, and transition probabilities for transitions among the terms belonging to the 2p63s2, 2p63s3p, 2p63p2 and 2p63s3d for the Magnesium like cerium (Ce XLVII) using the GRASP2K package based on the fully relativistic multi-configuration Dirac-Fock method. The electron correlation effects, Breit interaction and quantum electrodynamics effects to the atomic state wave functions and the corresponding energies have been taken into account.

The influence of operational parameters on the performance of an undivided zinc–cerium flow battery

International Nuclear Information System (INIS)

Leung, P.K.; Ponce de Leon, C.; Walsh, F.C.

2012-01-01

Highlights: ► The performance of an undivided zinc–cerium flow battery under different conditions of temperature, concentration and electrolyte flow rate, was evaluated. ► Mixed electrolytes were considered; methanesulfonate and sulfate anions were tested. ► In a 30 min charge/discharge at 20 mA cm −2 , charge and energy efficiencies were 82% and 72%, respectively. ► After 4 h charge, the conversion of Ce(III) to Ce(IV) became less efficient with the oxygen evolution reaction becoming more favored. ► After a larger number of cycles the carbon felt electrode was electro- and chemically-oxidized by Ce(IV) leading to degradation of the positive electrode. - Abstract: An undivided zinc–cerium redox flow battery was studied under a wide range of operational conditions, including: (i) electrolyte composition; the concentrations of ([Zn 2+ ], [Ce 3+ ] and [H + ]), (ii) current density (0–80 mA cm −2 ), (iii) electrolyte flow linear velocity (0.64–7.0 cm s −1 ) and (iv) temperature (20–60 °C). The charge efficiency increased at higher current densities and at higher electrolyte flow velocities. Unlike the divided zinc–cerium system, the charge–discharge performance decreased at higher temperature, since oxygen evolution became increasingly favored at the positive electrode. The use of a low acid concentration led to a poor conversion of Ce(III) to Ce(IV) ions during the discharge cycle. Mixed electrolytes containing methanesulfonate and sulfate anions have been evaluated at a high Ce(III) ion concentration, e.g. 0.4 mol dm −3 . After charging the battery for 4 h, the conversion of Ce(III) to Ce(IV) ions became less efficient over time due to a greater fraction of the current being used in oxygen evolution. Critical aspects for improvements in the battery performance are considered.

Effect of polyvinylpyrrolidone on cerium oxide nanoparticle characteristics prepared by a facile heat treatment technique

Directory of Open Access Journals (Sweden)

Anwar Ali Baqer

Full Text Available An aqueous medium composed of polyvinylpyrrolidone (PVP and cerium nitrates at calcination temperature was utilised in the production of cerium oxide (CeO2 semiconductor nanoparticles. A variety of analytical approaches was utilized to examine the structural, morphological and optical characteristics of the resulting nanoparticles. Differential thermal (DTA and thermogravimetric (TGA analyses, indicated that the best calcination temperatures for achieving CeO2 nanoparticle production were more than 485 °C. The results from Fourier-transform infrared (FTIR verified the formation of a crystalline structure after calcination procedures were performed to remove residual organic compounds. Additionally, results from X-ray diffraction (XRD analysis confirmed the cubic fluorite structure of the CeO2 produced. Samples were also analysed by energy dispersive spectroscopy (EDXA which indicated the existence of O and Ce in the samples. Field emission scanning electron microscopy (FESEM was used in the characterisation of nanoparticle morphological features. Transmission electron microscopy (TEM was employed to estimate typical nanoparticle and distribution within sample. This analysis indicated that mean particle sizes were inversely correlated with PVP concentration, with nanoparticle sizes ranging between 12 ± 7 nm at 0.03 g/mL PVP and 6 ± 2 nm at 0.05 g/mL PVP. These results corroborated those obtained by XRD analysis. A UV–vis spectrophotometer was utilised in the demonstration of optical properties and to examine the band gap energy of samples. The potential UV-shielding properties of the nanoparticles were demonstrated by the observed blue shift of the estimated optical energy band, i.e. from 3.35 to 3.43 eV, whilst PL spectra results indicated that decreasing particle size was associated with diminishing photoluminescence intensity. Keywords: Cerium oxide nanoparticles, Heat treatment technique, Structural properties, Optical

Low Temperature Synthesis and Properties of Gadolinium-Doped Cerium Oxide Nanoparticles

DEFF Research Database (Denmark)

Machado, Marina F. S.; P. R. Moraes, Leticia; Monteiro, Natalia K.

2017-01-01

Gadolinium-doped cerium oxide (GDC) is an attractive ceramic material for solid oxide fuel cells (SOFCs) both as the electrolyte or in composite electrodes. The Ni/GDC cermet can be tuned as a catalytic layer, added to the conventional Ni/yttria-stabilized zirconia (YSZ), for the internal steam...... sintering temperature needed to obtain a fully dense ceramic body, which can result in undesired reactions with YSZ. In this study, a green chemistry route for the synthesis of 10 mol% GDC nanoparticles is proposed. Such a low temperature synthesis provides control over particle size and sinterability...

Low Temperature Synthesis and Properties of Gadolinium-Doped Cerium Oxide Nanoparticles

DEFF Research Database (Denmark)

Machado, M. F. S.; Moraes, L. P. R.; Monteiro, N. K.

2017-01-01

Gadolinium-doped cerium oxide (GDC) is an attractive ceramic material for solid oxide fuel cells (SOFCs) both as the electrolyte and in composite electrodes operating at low and intermediate temperatures. GDC exhibits high oxygen ion conductivity at a wide range of temperatures and displays a high...... resistance to carbon deposition when hydrocarbons are used as fuels. However, an inconvenience of ceria-based oxides is the high sintering temperature needed to obtain a fully dense ceramic body. In this study, a green chemistry route for the synthesis of 10 mol% GDC nanoparticles is proposed. The aqueous...

The different aspects of magnetism in cerium compounds

International Nuclear Information System (INIS)

Sereni, J. G.

1999-01-01

Different factors related to the formation of the Cerium magnetic ground state are analyzed from its electronic structure, following a decreasing scale of energy. The studied behaviours include from nonmagnetic states, like those with valence instability, to different magnetic phase diagrams. The competition between the Kondo effect, which screens the magnetic moments and the magnetic interactions, that tends to order them is also described. In the ordered phase boundary the phenomena related to the incipient magnetisms are analyzed and related to deviations from the Fermi liquid behaviour and divergences of the thermodynamic parameters when the temperature tend to zero. Some experimental techniques are described and the difference between thermodynamical and control parameters analyzed. Particular attention is paid to the effect of pressure and ligand substitution. (Author) 22 refs

Cerium intermetallics with TiNiSi-type structure

Energy Technology Data Exchange (ETDEWEB)

Janka, Oliver; Niehaus, Oliver; Poettgen, Rainer [Muenster Univ. (Germany). Inst. fuer Anorganische und Analytische Chemie; Chevalier, Bernard [Bordeaux Univ. CNRS (UPR 9048), Pessac (France). Inst. de Chimie de la Matiere Condensee de Bordeaux (ICMCB)

2016-08-01

Intermetallic compounds with the equiatomic composition CeTX that crystallize with the orthorhombic TiNiSi-type structure can be synthesized with electron-rich transition metals (T) and X = Zn, Al, Ga, Si, Ge, Sn, As, Sb, and Bi. The present review focusses on the crystal chemistry and chemical bonding of these CeTX phases and on their physical properties, {sup 119}Sn and {sup 121}Sb Moessbauer spectra, high-pressure effects, hydrogenation reactions and the formation of solid solutions in order to elucidate structure-property relationships. This paper is the final one of a series of four reviews on equiatomic intermetallic cerium compounds [Part I: Z. Naturforsch. 2015, 70b, 289; Part II: Z. Naturforsch. 2015, 70b, 695; Part III: Z. Naturforsch. 2016, 71b, 165].

Sulfonated macro-RAFT agents for the surfactant-free synthesis of cerium oxide-based hybrid latexes.

Science.gov (United States)

Garnier, Jérôme; Warnant, Jérôme; Lacroix-Desmazes, Patrick; Dufils, Pierre-Emmanuel; Vinas, Jérôme; van Herk, Alex

2013-10-01

Three types of amphiphatic macro-RAFT agents were employed as compatibilizers to promote the polymerization reaction at the surface of nanoceria for the synthesis of CeO2-based hybrid latexes. Macro-RAFT copolymers and terpolymers were first synthesized employing various combinations of butyl acrylate as a hydrophobic monomer and acrylic acid (AA) and/or 2-acrylamido-2-methylpropane sulfonic acid (AMPS) as hydrophilic monomers. After characterizing the adsorption of these macro-RAFT agents at the cerium oxide surface by UV-visible spectrometry, emulsion copolymerization reactions of styrene and methyl acrylate were then carried out in the presence of the surface-modified nanoceria. Dynamic Light Scattering and cryo-Transmission Electron Microscopy were employed to confirm the hybrid structure of the final CeO2/polymer latexes, and proved that the presence of acrylic acid units in amphiphatic macro-RAFT agents enabled an efficient formation of hybrid structures, while the presence of AMPS units, when combined with AA units, resulted in a better distribution of cerium oxide nanoclusters between latex particles. Copyright © 2013 Elsevier Inc. All rights reserved.

Effectiveness of Cerium Nitrate-Silver Sulfadiazine in the Treatment of Facial Burns: A Multicenter, Randomized, Controlled Trial

NARCIS (Netherlands)

Oen, I.M.M.H.; van Baar, M.E.; Middelkoop, E.; Nieuwenhuis, M.K.

2012-01-01

Background: The face is a very frequent site of burn injuries. This multicenter, randomized, controlled trial thus investigates the effectiveness of cerium nitrate-silver sulfadiazine in the treatment of facial burns compared with silver sulfadiazine. Methods: Adult patients with acute facial burns

The removal of gaseous impurities from the primary circuit in high temperature reactors with cerium-mischmetal-getters

International Nuclear Information System (INIS)

Heinen, R.

1986-11-01

The use of getters to remove tritium and other gaseous impurities (especially H 2 , N 2 and CO) from helium circuits in nuclear reactors has been investigated. The loading capcity of beds, containing small cerium-mischmetal chips has been tested for several typical conditions. The results show that it is possible to use getters to purify inert gas streams for given boundary conditions. High CO-levels, however, lead to a poisoning (passivation) of the getter material. The effect of poisoning is cumulative. A mathematical model describes the behavior of CO in this kind of getter. Safety tests under possible accident conditions were made with the highly reactive cerium-mischmetal chips. The results show that there isn't a critical problem in using this material in the form of a chemical reactive getter bed near a nuclear reactor in the investigated range of accident conditions. (orig.) [de

Inhaled Diesel Emissions Generated with Cerium Oxide Nanoparticle Fuel Additive Induce Adverse Pulmonary and Systemic Effects

Science.gov (United States)

Snow, Samantha J.; McGee, John; Miller, Desinia B.; Bass, Virginia; Schladweiler, Mette C.; Thomas, Ronald F.; Krantz, Todd; King, Charly; Ledbetter, Allen D.; Richards, Judy; Weinstein, Jason P.; Conner, Teri; Willis, Robert; Linak, William P.; Nash, David; Wood, Charles E.; Elmore, Susan A.; Morrison, James P.; Johnson, Crystal L.; Gilmour, Matthew Ian; Kodavanti, Urmila P.

2014-01-01

Diesel exhaust (DE) exposure induces adverse cardiopulmonary effects. Cerium oxide nanoparticles added to diesel fuel (DECe) increases fuel burning efficiency but leads to altered emission characteristics and potentially altered health effects. Here, we evaluated whether DECe results in greater adverse pulmonary effects compared with DE. Male Sprague Dawley rats were exposed to filtered air, DE, or DECe for 5 h/day for 2 days. N-acetyl glucosaminidase activity was increased in bronchial alveolar lavage fluid (BALF) of rats exposed to DECe but not DE. There were also marginal but insignificant increases in several other lung injury biomarkers in both exposure groups (DECe > DE for all). To further characterize DECe toxicity, rats in a second study were exposed to filtered air or DECe for 5 h/day for 2 days or 4 weeks. Tissue analysis indicated a concentration- and time-dependent accumulation of lung and liver cerium followed by a delayed clearance. The gas-phase and high concentration of DECe increased lung inflammation at the 2-day time point, indicating that gas-phase components, in addition to particles, contribute to pulmonary toxicity. This effect was reduced at 4 weeks except for a sustained increase in BALF γ-glutamyl transferase activity. Histopathology and transmission electron microscopy revealed increased alveolar septa thickness due to edema and increased numbers of pigmented macrophages after DECe exposure. Collectively, these findings indicate that DECe induces more adverse pulmonary effects on a mass basis than DE. In addition, lung accumulation of cerium, systemic translocation to the liver, and delayed clearance are added concerns to existing health effects of DECe. PMID:25239632

Biomineralization-Inspired Synthesis of Cerium-Doped Carbonaceous Nanoparticles for Highly Hydroxyl Radical Scavenging Activity

Science.gov (United States)

Zou, Shenqiang; Zhu, Xiaofang; Zhang, Lirong; Guo, Fan; Zhang, Miaomiao; Tan, Youwen; Gong, Aihua; Fang, Zhengzou; Ju, Huixiang; Wu, Chaoyang; Du, Fengyi

2018-03-01

Cerium oxide nanoparticles recently have received extensive attention in biomedical applications due to their excellent anti-oxidation performance. In this study, a simple, mild, and green approach was developed to synthesize cerium-doped carbonaceous nanoparticles (Ce-doped CNPs) using bio-mineralization of bull serum albumin (BSA) as precursor. The resultant Ce-doped CNPs exhibited uniform and ultrasmall morphology with an average size of 14.7 nm. XPS and FTIR results revealed the presence of hydrophilic group on the surface of Ce-doped CNPs, which resulted in excellent dispersity in water. The CCK-8 assay demonstrated that Ce-doped CNPs possessed favorable biocompatibility and negligible cytotoxicity. Using H2O2-induced reactive oxygen species (ROS) as model, Ce-doped CNPs showed highly hydroxyl radical scavenging capability. Furthermore, flow cytometry and live-dead staining results indicated that Ce-doped CNPs protected cells from H2O2-induced damage in a dose-dependent effect, which provided a direct evidence for anti-oxidative performance. These findings suggest that Ce-doped CNPs as novel ROS scavengers may provide a potential therapeutic prospect in treating diseases associated with oxidative stress.

22 CFR 146.100 - Purpose and effective date.

Science.gov (United States)

2010-04-01

... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.100 Purpose and... basis of sex in any education program or activity receiving Federal financial assistance, whether or not...

45 CFR 146.122 - Additional requirements prohibiting discrimination based on genetic information.

Science.gov (United States)

2010-10-01

... genetic information and should review the records to excise any genetic information. N assembles the data requested by M and, although N reviews it to delete genetic information, the data from a specific region... based on genetic information. 146.122 Section 146.122 Public Welfare DEPARTMENT OF HEALTH AND HUMAN...

Processing of Pakistani carbonatites for separation of cerium from adjacent rare earths

International Nuclear Information System (INIS)

Akram, M.; Qazi, N.K.; Khan, M.F.; Hasan, G.H.; Ahmed, N.; Chughtai, N.A.

2003-01-01

% (v/v) for the ratio 1:4. The optimum extraction and stripping times being 30 minutes for each. The rare earths concentrate (i.e. REs salt) produced using the optimum parameters contained approx. 50% REO (w/w). For separation of cerium from adjacent rare earths, the rare earths concentrate was effectively dissolved in 10% HCl at 60 deg. C after 3hrs stirring. The chloride solution was oxidized with sodium hypochlorite at pH 3-4 to form precipitates of Ce(OH)/sub 4/ and Ln(OH)/sub 3/. These precipitates when filtered and leached with 3% HCl gave Ce(OH)/sub 4/ Cake containing -80% of cerium present in the concentrate. The cake contained mainly cerium with <5% other rare earths. The trivalent rare earths were soluble in HCl which separated as LnCl/sub 3/ in filtrate. Cerium was isolated in the form of ceric salt from the adjacent rare earths. (author)

76 FR 6575 - Airworthiness Directives; BAE Systems (Operations) Limited Model BAe 146 and Avro 146-RJ Airplanes

Science.gov (United States)

2011-02-07

.... * * * * * * * * * * * [I]nvestigation by M-D showed that if any undetected crack was present at the time of the embodiment... terminating action for the repetitive inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB... optional closing action of EASA AD 2010-0001-E is embodiment of M-D B 146-32-150 (polishing and shot...

Steric and electronic effects of 1,3-disubstituted cyclopentadienyl ligands on metallocene derivatives of Cerium, Titanium, Manganese, and Iron

Energy Technology Data Exchange (ETDEWEB)

Sofield, Chadwick Dean [Univ. of California, Berkeley, CA (United States)

2000-05-01

Sterically demanding 1,3-disubstituted cyclopentadienyl ligands were used to modify the physical properties of the corresponding metallocenes. Sterically demanding ligands provided kinetic stabilization for trivalent cerium compounds. Tris(di-t-butylcyclopentadienyl)cerium was prepared and anion competition between halides and cyclopentadienyl groups which had complicated synthesis of the tris(cyclopentadienyl)compound was qualitatively examined. Bis(di-t-butylcyclopentadienyl)cerium methyl was prepared and its rate of decomposition, by ligand redistribution, to tris(di-t-butylcyclopentadienyl)cerium was shown to be slower than the corresponding rate for less sterically demanding ligands. Asymmetrically substituted ligands provided a symmetry label for examination of chemical exchange processes. Tris[trimethylsilyl(t-butyl)cyclopentadienyl]cerium was prepared and the rate of interconversion between the C1 and C3 isomers was examined. The enthalpy difference between the two distereomers is 7.0 kJ/mol. The sterically demanding cyclopentadienyl ligands ansa-di-t-butylcyclopentadiene (Me₂Si[(Me₃C)₂C₅H₃]₂), ansa-bis(trimethylsilyl)cyclopentadiene (Me₂Si[(Me₃Si)₂C₅H₃]₂) and tetra-t-butylfulvalene and metallocene derivatives of the ligands were prepared and their structures were examined by single crystal X-ray crystallography. The effect that substituents on the cyclopentadienyl ring have on the pi-electron system of the ligand was examined through interaction between ligand and metal orbitals. A series of 1,3-disubstituted manganocenes was prepared and their electronic states were determined by solid-state magnetic susceptibility, electron paramagnetic resonance, X-ray crystallography, and variable temperature UV-vis spectroscopy. Spin-equilibria in [(Me₃C)₂C₅H₃]₂Mn and [(Me₃

Stabilized zirconia with cerium and neodymium addition

International Nuclear Information System (INIS)

Andrade, I.M. de; Pessoa, R.C.; Nasar, M.C.; Nasar, R.S.; Rodriques, M.K.C.; Oliveira, J.F.

2006-01-01

Zr 0,9 Ce 0,05 Nd 0,05 O 1,975 system was synthesized with the use of the Pechini method. The polymeric resin was calcined at 350 deg C/3 h and analysed by FTIR that show bands relative to organic. Radicals esther type. The TGA curve indicated the polymeric decomposition occurring from 30 deg C to 740 deg C. DTA analysis show a exothermic peak in 100 deg C due to loss of water of material. From 500 deg C to 800 deg C was observed a intense peak due to polymer decomposition and the zirconia crystallization. The calcined powder from 350 deg C/3 h e 30 min to 900 deg/3 h were analysed by XRD that show the crystalline phase formation with the increase of temperature. The X-ray diffraction pattern show the presence of two phases, such as tetragonal and cubic of zirconia demonstrating that neodymium and cerium additions led to zirconia stabilization. (author)

Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice.

Science.gov (United States)

Martin, Nellie A; Molnar, Viktor; Szilagyi, Gabor T; Elkjaer, Maria L; Nawrocki, Arkadiusz; Okarmus, Justyna; Wlodarczyk, Agnieszka; Thygesen, Eva K; Palkovits, Miklos; Gallyas, Ferenc; Larsen, Martin R; Lassmann, Hans; Benedikz, Eirikur; Owens, Trevor; Svenningsen, Asa F; Illes, Zsolt

2018-01-01

The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs) during remyelination, but its role has not been examined during demyelination. MicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray) and proteome (liquid chromatography tandem mass spectrometry) of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis. miR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP + oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2 + OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3 + and Iba1 + macrophages/microglia was

The effect of stem cell factor on proliferation of human endometrial CD146+ cells

Directory of Open Access Journals (Sweden)

Mehri Fayazi

2016-07-01

Full Text Available Background: Stem cell factor (SCF is a transcriptional factor which plays crucial roles in normal proliferation, differentiation and survival in a range of stem cells. Objective: The aim of the present study was to examine the proliferation effect of different concentrations of SCF on expansion of human endometrial CD146+ cells. Materials and Methods: In this experimental study, total populations of isolated human endometrial suspensions after fourth passage were isolated by magnetic activated cell sorting (MACS into CD146+ cells. Human endometrial CD146+ cells were karyotyped and tested for the effect of SCF on proliferation of CD146+ cells, then different concentrations of 0, 12.5, 25, 50 and 100 ng/ml was carried out and mitogens-stimulated endometrial CD146+ cells proliferation was assessed by MTT assay. Results: Chromosomal analysis showed a normal metaphase spread and 46XX karyotype. The proliferation rate of endometrial CD146P + P cells in the presence of 0, 12.5, 25, 50 and 100 ng/ml SCF were 0.945±0.094, 0.962±0.151, 0.988±0.028, 1.679±0.012 and 1.129±0.145 respectively. There was a significant increase in stem/ stromal cell proliferation following in vitro treatment by 50 ng/ml than other concentrations of SCF (p=0.01. Conclusion: The present study suggests that SCF could have effect on the proliferation and cell survival of human endometrial CD146P+P cells and it has important implications for medical sciences and cell therapies

In-situ irradiation of cerium precursors in TEM to study nanocrystal formation

Science.gov (United States)

Asghar, Muhammad Sajid Ali; Sabri, Mohammed Mohammed; Tian, Zijian; Möbus, Günter

2017-09-01

Three of the most commonly used precursor chemicals for wet-chemical nano-ceria synthesis are examined by means of direct dry electron irradiation in TEM. Transformation reactions of micron-size carbonate, chloride, and nitrate grains into nanocrystallites (internal or external) are recorded in situ. Progress of possible redox-changes of cerium is tracked by EELS. We find a straight local oxidation reaction for carbonates, but external nanorod formation by condensation in the case of chlorides, while nitrates show a multi-stage complex redox behaviour.

The systems cerium(3) (samarium) nitrate-quinoline nitrate-water

International Nuclear Information System (INIS)

Khisaeva, D.A.; Zhuravlev, E.F.; Semenova, Eh.B.

1982-01-01

Using the method of cross sections at 25 and 50 deg C the solubility in the systems cerium (3) nitrate-quinoline nitrate-water and samarium nitrate-quinoline nitrate-water has been studied. It is established that in the systems during chemical interaction of components congruently melting compounds of the composition: Ce(NO 3 ) 2 x2[C 9 H 7 NxHNO 3 ]x6H 2 O and Sm(NO 3 ) 3 x2[C 9 H 7 NxHNO 3 ]x2H 2 O are formed. New solid phases are separated preparatively and are subjected to chemical, differential thermal and IR spectroscopic analyses. The investigation results are compared with similar ones for nitrates of other representatives of lanthanide group

Promotion of Hendra Virus Replication by MicroRNA 146a

Science.gov (United States)

Marsh, Glenn A.; Jenkins, Kristie A.; Gantier, Michael P.; Tizard, Mark L.; Middleton, Deborah; Lowenthal, John W.; Haining, Jessica; Izzard, Leonard; Gough, Tamara J.; Deffrasnes, Celine; Stambas, John; Robinson, Rachel; Heine, Hans G.; Pallister, Jackie A.; Foord, Adam J.; Bean, Andrew G.; Wang, Lin-Fa

2013-01-01

Hendra virus is a highly pathogenic zoonotic paramyxovirus in the genus Henipavirus. Thirty-nine outbreaks of Hendra virus have been reported since its initial identification in Queensland, Australia, resulting in seven human infections and four fatalities. Little is known about cellular host factors impacting Hendra virus replication. In this work, we demonstrate that Hendra virus makes use of a microRNA (miRNA) designated miR-146a, an NF-κB-responsive miRNA upregulated by several innate immune ligands, to favor its replication. miR-146a is elevated in the blood of ferrets and horses infected with Hendra virus and is upregulated by Hendra virus in human cells in vitro. Blocking miR-146a reduces Hendra virus replication in vitro, suggesting a role for this miRNA in Hendra virus replication. In silico analysis of miR-146a targets identified ring finger protein (RNF)11, a member of the A20 ubiquitin editing complex that negatively regulates NF-κB activity, as a novel component of Hendra virus replication. RNA interference-mediated silencing of RNF11 promotes Hendra virus replication in vitro, suggesting that increased NF-κB activity aids Hendra virus replication. Furthermore, overexpression of the IκB superrepressor inhibits Hendra virus replication. These studies are the first to demonstrate a host miRNA response to Hendra virus infection and suggest an important role for host miRNAs in Hendra virus disease. PMID:23345523

45 CFR 146.120 - Interaction with the Family and Medical Leave Act. [Reserved

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Interaction with the Family and Medical Leave Act. [Reserved] 146.120 Section 146.120 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS... Interaction with the Family and Medical Leave Act. [Reserved] ...

SU-E-T-279: Dose Enhancement Effect Due to Cerium Oxide Nanoparticles Employed as Radiation Protectants

Energy Technology Data Exchange (ETDEWEB)

Ouyang, Z; Altundal, Y; Sajo, E [Univ Massachusetts Lowell, Lowell, MA (United States); Ngwa, W [Univ Massachusetts Lowell, Lowell, MA (United States); Brigham and Women’s Hospital, Dana Farber Cancer Institute, Harvard Medical, Boston, MA (United States)

2015-06-15

Purpose: The goal of radiotherapy is to maximize radiation dose to diseased cells while minimizing radiation damage to normal tissues. In order to minimize damage to normal tissues, cerium oxide nanoparticles (nanoceria) are currently considered as a radioprotectant. However, some studies have reported concerns that nanoceria can also lead to radiotherapy dose enhancement due to the high atomic number of cerium, especially when used in conjunction with kV energy and brachytherapy sources. In this study, this concern is investigated to determine if the concentrations of nanoceria employed in in-vivo studies to confer radioprotection can engender a significant dose enhancement. Methods: Radiation with energies ranging from 50kVp to 140kVp is investigated in this work along with brachytherapy sources Pd-103 and I-125. A previously established theoretical model is used to calculate the dose enhancement factor (DEF). In this model, each cell is assumed to be a voxel of size (10 µm, 10 µm, 10 µm) with nanoceria homogeneously distributed among them. Electron energy loss formula of Cole is used to calculate energy (and hence dose) deposited by photoelectrons and Auger electrons in each tissue voxel due to irradiation of nanoceria. The DEF is defined as the ratio of the dose with and without nanoparticles. Results: DEF calculation results are smaller than 1.02 with dosages of nanoceria smaller than 0.645 mg/g, which is shown to be sufficiently protective by some previous in-vitro and in-vivo experiments. The brachytherapy sources show higher DEF’s than kVp radiations. DEF peaks are consistent with K shell and L shell energies of cerium, 40 keV and 6 keV, respectively. Conclusion: The results show that for sufficiently radioprotective concentrations of nanoceria, there will be minimal DEF when used in conjunction with clinically applicable kV energy radiotherapy sources or brachytherapy sources.

The effect of cerium valence states at cerium oxide nanoparticle surfaces on cell proliferation

KAUST Repository

Naganuma, Tamaki

2014-05-01

Understanding and controlling cell proliferation on biomaterial surfaces is critical for scaffold/artificial-niche design in tissue engineering. The mechanism by which underlying integrin ligates with functionalized biomaterials to induce cell proliferation is still not completely understood. In this study, poly-l-lactide (PL) scaffold surfaces were functionalized using layers of cerium oxide nanoparticles (CNPs), which have recently attracted attention for use in therapeutic application due to their catalytic ability of Ce4+ and Ce3+ sites. To isolate the influence of Ce valance states of CNPs on cell proliferation, human mesenchymal stem cells (hMSCs) and osteoblast-like cells (MG63) were cultured on the PL/CNP surfaces with dominant Ce4+ and Ce3+ regions. Despite cell type (hMSCs and MG63 cells), different surface features of Ce4+ and Ce3+ regions clearly promoted and inhibited cell spreading, migration and adhesion behavior, resulting in rapid and slow cell proliferation, respectively. Cell proliferation results of various modified CNPs with different surface charge and hydrophobicity/hydrophilicity, indicate that Ce valence states closely correlated with the specific cell morphologies and cell-material interactions that trigger cell proliferation. This finding suggests that the cell-material interactions, which influence cell proliferation, may be controlled by introduction of metal elements with different valence states onto the biomaterial surface. © 2014 Elsevier Ltd.

BDNF VAL66MET Polymorphism Elevates the Risk of Bladder Cancer via MiRNA-146b in Micro-Vehicles

Directory of Open Access Journals (Sweden)

Cong Li

2018-01-01

Full Text Available Background/Aims: Emerging studies on brain-derived neurotrophic factor (BDNF have shown that might be novel biomarkers and therapeutic targets for cancer. We explore the role of BDNF in the tumorigenesis of bladder cancer and the underlying molecular mechanism. Methods: 368 patients with diagnosed bladder cancer and 352 healthy controls were enrolled to evaluate the association of BDNF and the miR-146b. Bioinformatics algorithm analysis and luciferase assay were performed to identify the target genes of miR-146b. Real-time PCR and western-blot were carried out to validate the relationship between miR-146b and CRK. MTT assay and FACS were used to evaluated the proliferation and apoptosis of cancer cells. MVs were isolated and transfect into the culture cells to confirm the above observation. Results: The clinical study shows that BDNF Met/Met was significantly associated with the risk of bladder cancer. In addition, comparing with Val/Val and Val/Met, Met/Met has lower miR-146b level. Luciferase assay shows that BDNF Val/Val is apparently enhanced miR-146b promoter-luciferase, but not BDNF Met/Met. Based on luciferase assay, CRK is a direct target gene of miR-146b. MiR-146b mimics significantly inhibited the expression of CRK and activation of AKT level. The expression of CRK and the activation of AKT (p-AKT were significantly inhibited by MV-BDNF Val/Val-miR-146b or MV-BDNF Val/Met-miR-146b, but not MV-BDNF Met/Met-miR-146b. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b obviously inhibited cell proliferation, which eliminated by CRK. Meanwhile, with MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not affect the proliferation. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b enhanced cell apoptosis, which could be eliminated by CRK. Meanwhile, MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not promote apoptosis. Conclusion: BDNF VAL66MET polymorphism is associated with miR-146b and its target gene CRK. MiR-146b and CRK mediated BDNF VAL66

Oxidation behaviour and electrical properties of cobalt/cerium oxide composite coatings for solid oxide fuel cell interconnects

DEFF Research Database (Denmark)

Harthøj, Anders; Holt, Tobias; Møller, Per

2015-01-01

This work evaluates the performance of cobalt/cerium oxide (Co/CeO2) composite coatings and pure Co coatings to be used for solid oxide fuel cell (SOFC) interconnects. The coatings are electroplated on the ferritic stainless steels Crofer 22 APU and Crofer 22H. Coated and uncoated samples...

Germination and early plant development of ten plant species exposed to titanium dioxide and cerium oxide nanoparticles

Science.gov (United States)

Ten agronomic plant species were exposed to different concentrations of nano titanium dioxide (nTiO2) or nano cerium oxide (nCeO2) (0, 250, 500 and 1000 mg/L) to examine potential effects on germination and early seedling development. We modified a standard test protocol develop...

Electron paramagnetic resonance of V4+ in the lanthanum and cerium orthophosphates

International Nuclear Information System (INIS)

Lima, J.C. de.

1983-11-01

The Electron Paramagnetic Resonance (EPR) spectrum of V 4+ was investigated in polycrystalline samples of lanthanum orthophosphate (LaPO 4 ) and cerium orthophosphate (CePO 4 ) doped with 0.2 wt % vanadium pentoxide (V 2 O 5 ). Measurements were performed at room temperature and 9.5 GHz. In LaPO 4 , two non-equivalent axial sites were inferred from the EPR spectra. The most stable of these two sites is probably substitutional. In CePO 4 , a single axial spectrum was observed. It was attributed to V 4+ in substitutional sites. A central, wide line was also seen; it was attributed to ferromagnetic clusters of vanadium ions. Photoacoustic absorption spectra were also recorded for the two compounds. The EPR and photoacoustic absorption data, when analyzed using the molecular orbital theory, show that for both lanthanum orthophosphate and cerium orthophosphate the ground orbital (d sub(x) 2 sub(-y) 2) of the unpainred electron is purely ionic, while the excited orbitals d sub(xy) and d sub(xz,yz) are partly covalent. The degree of covalency is higher for the d sub(xy) orbital. Finally, it should be pointed out that part of the theory used for the interpretation of the EPR and photoacoustic absorption spectra (study of the ligand field splitting of a d orbital in a site of distorted capped antiprism structure) was developed by the author in the present work and is therefore an original contribution. (Author) [pt

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Mørck Nielsen, H; Rømer Rassing, M; Nielsen, Hanne Mørck

2000-01-01

cell culture model, and human and porcine buccal epithelium were compared. The esterase activity in the intact cell culture model and in the porcine buccal mucosa was compared. Further, the TR146 cell culture model was used to study the permeability rate and metabolism of leu-enkephalin. The activity...... of the three enzymes in the TR146 homogenate supernatants was in the same range as the activity in homogenate supernatants of human buccal epithelium. In the TR146 cell culture model, the activity of aminopeptidase (13.70+/-2.10 nmol/min per mg protein) was approx. four times the activity of carboxypeptidase...

Comparison of the air oxidation behaviors of Zircaloy-4 implanted with yttrium and cerium ions at 500 deg. C

International Nuclear Information System (INIS)

Chen, X.W.; Bai, X.D.; Xu, J.; Zhou, Q.G.; Chen, B.S.

2002-01-01

As a valuable process for surface modification of materials, ion implantation is eminent to improve mechanical properties, electrochemical corrosion resistance and oxidation behaviors of varieties of materials. To investigate and compare the oxidation behaviors of Zircaloy-4, implantation of yttrium ion and cerium ion were respectively employed by using an MEVVA source at the energy of 40 keV with a dose ranging from 1x10 16 to 1x10 17 ions/cm 2 . Subsequently, weight gain curves of the different specimens including as-received Zircaloy-4 and Zircaloy-4 specimens implanted with the different ions were measured after oxidation in air at 500 deg. C for 100 min. It was obviously found that a significant improvement was achieved in the oxidation behaviors of implanted Zircaloy-4 compared with that of the as-received Zircaloy-4, and the oxidation behavior of cerium-implanted Zircaloy-4 was somewhat better than that of yttrium-implanted specimen. To obtain the valence and the composition of the oxides in the scale, X-ray photoemission spectroscopy was used in the present study. Glancing angle X-ray diffraction, employed to analyze the phase transformation in the oxide films, showed that the addition of yttrium transformed the phase from monoclinic zirconia to tetragonal zirconia, yet the addition of cerium transformed the phase from monoclinic zirconia to hexagonal zirconia. In the end, the mechanism of the improvement of the oxidation behavior was discussed

Hydroxamic acid interactions with solvated cerium hydroxides in the flotation of monazite and bastnäsite—Experiments and DFT study

Energy Technology Data Exchange (ETDEWEB)

Sarvaramini, A., E-mail: amin.sarvaramini.1@ulaval.ca; Azizi, D., E-mail: dariush.azizi.1@ulaval.ca; Larachi, F., E-mail: faical.larachi@gch.ulaval.ca

2016-11-30

Highlights: • Experimental and DFT studies of hydroxamic acid adsorption on monazite and bastnäsite. • Highest bastnäsite and monazite floatability observed at pH 7–9. • First solvation layer of cerium hydroxides consisted of up to 10 water molecules. • Solvated Ce(OH){sub 2}{sup +} and Ce(OH){sup 2+} cations interact with up to 3 collector anions. • Interaction of zero-charge solvated Ce(OH){sub 3} involves up to 2 collector anions. - Abstract: Density functional theory (DFT) simulations and experiments were performed to clarify the interaction mechanisms between hydroxamic acid collectors and cerium hydroxides during the flotation of bastnäsite and monazite minerals. These minerals showed considerable floatability at moderately alkaline pH which was related to the adsorption of hydroxamic acids on their surfaces as confirmed by vibrational spectroscopic and zeta potential measurements. DFT simulations showed that at moderately alkaline pH, the interactions between solvated Ce(OH){sup 2+} and Ce(OH){sub 2}{sup +} and heptyl-hydroxamic acid (HHA) anions resulted in the formation of, respectively, [Ce(OH)(HHA){sub x}(H{sub 2}O){sub y}]{sup 2−x} (x[y = ] = 1[6],2[3],3[1]) and [Ce(OH){sub 2}(HHA){sub x}(H{sub 2}O){sub y}]{sup 1−x} (x[y = ] = 1[5],2[1],3[0]) complexes. The collector anions were found to interact directly through formation of two covalent bonds between their two polar-head oxygen atoms and cerium in the hydroxide complexes. However, formation of such new bonds resulted in breakage of a few covalent/electrostatic bonds between cerium and water molecules initially present in the first hydration shell of the rare-earth metal cation. Building up in the electric double layer of the semi-soluble minerals, these complexes, and by extension, those from other rare-earth elements belonging to monazite and bastnäsite, are speculated to play a role in the interactions between rare-earth minerals and hydroxamic acid collectors.

X-ray spectrum emitted by a laser-produced cerium plasma in the 7.5 to 12 A wavelength range

International Nuclear Information System (INIS)

Doron, R.; Behar, E.; Fraenkel, M.; Mandelbaum, P.; Schwob, J.L.; Zigler, A.

2001-01-01

A highly stripped cerium (Z = 58) plasma is produced by irradiating a solid cerium target with an intense short laser pulse. The X-ray spectrum emitted from the plasma is recorded in the 7.5-12 A wavelength range using a flat RAP crystal spectrometer. Ab-initio calculations using the RELAC relativistic computer code, as well as isoelectronic trends deduced from previous works, together with spectra obtained under different laser beam focusing conditions, are all employed for the identification of the spectral lines and features emitted by various ions from Fe-like Ce 32+ to As-like Ce 25+ . The technique of comparing spectra obtained using different laser intensities is also employed to confirm or to resolve some ambiguous identifications of spectral features in the spectrum of a laser-produced lanthanum plasma studied in a previous work. (orig.)

X-ray spectrum emitted by a laser-produced cerium plasma in the 7.5 to 12 A wavelength range

Energy Technology Data Exchange (ETDEWEB)

Doron, R.; Behar, E.; Fraenkel, M.; Mandelbaum, P.; Schwob, J.L.; Zigler, A. [Hebrew Univ., Jerusalem (Israel). Racah Inst. of Physics; Faenov, A.Ya.; Pikuz, T.A. [Multicharged Ion Spectra Data Center, VNIIFTRI, Mendeleevo (Russian Federation)

2001-01-01

A highly stripped cerium (Z = 58) plasma is produced by irradiating a solid cerium target with an intense short laser pulse. The X-ray spectrum emitted from the plasma is recorded in the 7.5-12 A wavelength range using a flat RAP crystal spectrometer. Ab-initio calculations using the RELAC relativistic computer code, as well as isoelectronic trends deduced from previous works, together with spectra obtained under different laser beam focusing conditions, are all employed for the identification of the spectral lines and features emitted by various ions from Fe-like Ce{sup 32+} to As-like Ce{sup 25+}. The technique of comparing spectra obtained using different laser intensities is also employed to confirm or to resolve some ambiguous identifications of spectral features in the spectrum of a laser-produced lanthanum plasma studied in a previous work. (orig.)

Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice

Directory of Open Access Journals (Sweden)

Nellie A. Martin

2018-03-01

Full Text Available BackgroundThe cuprizone (CPZ model of multiple sclerosis (MS was used to identify microRNAs (miRNAs related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs during remyelination, but its role has not been examined during demyelination.MethodsMicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray and proteome (liquid chromatography tandem mass spectrometry of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis.ResultsmiR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP+ oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2+ OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3+ and

The evolution mechanism of the dislocation loops in irradiated lanthanum doped cerium oxide

International Nuclear Information System (INIS)

Miao, Yinbin; Aidhy, Dilpuneet; Chen, Wei-Ying; Mo, Kun; Oaks, Aaron; Wolf, Dieter; Stubbins, James F.

2014-01-01

Cerium dioxide, a non-radioactive surrogate of uranium dioxide, is useful for simulating the radiation responses of uranium dioxide and mixed oxide fuel (MOX). Controlled additions of lanthanum can also be used to form various levels of lattice oxide or anion vacancies. In previous transmission electron microscopy (TEM) experimental studies, the growth rate of dislocation loops in irradiated lanthanum doped ceria was reported to vary with lanthanum concentration. This work reports findings of the evolution mechanisms of the dislocation loops in cerium oxide with and without lanthanum dopants based on a combination of molecular statics and molecular dynamics simulations. These dislocation loops are found to be b=1/3〈111〉 interstitial type Frank loops. Calculations of the defect energy profiles of the dislocation loops with different structural configurations and radii reveal the basis for preference of nucleation as well as the driving force of growth. Frenkel pair evolution simulations and displacement cascade overlaps simulations were conducted for a variety of lanthanum doping conditions. The nucleation and growth processes of the Frank loop were found to be controlled by the mobility of cation interstitials, which is significantly influenced by the lanthanum doping concentration. Competition mechanisms coupled with the mobility of cation point defects were discovered, and can be used to explain the lanthanum effects observed in experiments

Synthesis of cerium and nickel doped titanium nanofibers for hydrolysis of sodium borohydride.

Science.gov (United States)

Tamboli, Ashif H; Gosavi, S W; Terashima, Chiaki; Fujishima, Akira; Pawar, Atul A; Kim, Hern

2018-07-01

A recyclable titanium nanofibers, doped with cerium and nickel doped was successfully synthesized by using sol-gel and electrospinning method for hydrogen generation from alkali free hydrolysis of NaBH 4 . The resultant nanocomposite was characterized to find out the structural and physical-chemical properties by a series of analytical techniques such as FT-IR (Fourier transform infrared spectroscopy), XRD (X-ray diffraction), SEM (scanning electron microscope), EDX (energy-dispersive X-ray spectroscopy),N 2 adsorption-desorption and BET (Brunauer-Emmett-Teller), etc. The results revealed that cerium and nickel nanoparticles were homogeneously distributed on the surface of the TiO 2 nanofibers due to having similar oxidation state and atomic radium of TiO 2 nanofibers with CeO 2 and NiO for the effective immobilization of metal ions. The NiO doped catalyst showed superior catalytic performance towards the hydrolysis reaction of NaBH 4 at room temperature. These catalysts have ability to produce 305 mL of H 2 within the time of 160 min at room temperature. Additionally, reusability test revealed that the catalyst is active even after five runs of hydrolytic reaction, implying the as-prepared NiO doped TiO 2 nanofibers could be considered as a potential candidate catalyst for portable hydrogen fuel system such as PEMFC (proton exchange membrane fuel cells). Copyright © 2018 Elsevier Ltd. All rights reserved.

Anomalous plastic flow of cerium near the isomorphic phase transformations under high hydrostatic pressure

International Nuclear Information System (INIS)

Witczak, Z.; Goncharova, V.A.

1999-01-01

Compression tests have been carried out on cerium specimens at room temperature (0.27 T m ) under high hydrostatic pressures up to 1.2 GPa. A strong increase of the yield strength was observed for both isomorphic γ and α phases at pressures approaching the γ ↔ α isomorphic phase transformations. That increase was in good agreement with the theory of dislocations when the dependence of elastic properties and a lattice parameter of cerium on pressure was applied to calculate the effect of pressure on the yield stress controlled by the edge dislocations. An anomalous strong decrease of the yield stress was observed in both γ and α phases in the vicinity of both γ ↔ α phase transformations. That phenomenon was explained as an effect of pressure induced new phase atoms through spreading the cores of edge dislocations. A complete disappearance of work hardening in both γ and α phases was also observed in the wide range of pressures. The influence of hydrostatic pressure on the energy of grain boundaries of both phases was considered to be responsible for that property. The ratio of the grain boundary energy to the Peierls energy is suggested to be a criterion of the work hardening ability of f.c.c. polycrystals

Micro-precipitation of Americium by Cerium Hydroxide for alpha spectrometry

International Nuclear Information System (INIS)

Wankhede, Sonal M.; Kumar, Suja A.; Sawant, Pramilla D.

2018-01-01

Estimation of trace amount of actinides in any biological and/or environmental sample is done by radiochemical separation followed by alpha spectrometry. Alpha-spectrometric determination of actinides requires thin, homogeneous and nearly weightless sample sources. The most widely used method for preparation of actinides for alpha spectrometry involves electro deposition of the alpha emitters using stainless steel planchetts (cathode) and platinum rod (anode). This procedure is time consuming, requires relatively elaborate equipment, and is expensive. Micro-precipitation technique using hydrofluoric acid (HF) is also reliable and already standardized at Bioassay Laboratory (Wankhede, 2016). However, it uses hazardous chemical such as HF, hence, in the present study, cerium hydroxide micro-precipitation technique was standardized

Structure and Electronic Properties of Cerium Orthophosphate: Theory and Experiment

Energy Technology Data Exchange (ETDEWEB)

Adelstein, Nicole; Mun, B. Simon; Ray, Hannah; Ross Jr, Phillip; Neaton, Jeffrey; De Jonghe, Lutgard

2010-07-27

Structural and electronic properties of cerium orthophosphate (CePO{sub 4}) are calculated using density functional theory (DFT) with the local spin-density approximation (LSDA+U), with and without gradient corrections (GGA-(PBE)+U), and compared to X-ray diffraction and photoemission spectroscopy measurements. The density of states is found to change significantly as the Hubbard parameter U, which is applied to the Ce 4f states, is varied from 0 to 5 eV. The calculated structural properties are in good agreement with experiment and do not change significantly with U. Choosing U = 3 eV for LDSA provides the best agreement between the calculated density of states and the experimental photoemission spectra.

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Nielsen, H M; Rassing, M R; Nielsen, Hanne Mørck

2000-01-01

The objective of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium. For this purpose, the permeability of water, mannitol and testosterone across the TR146 cell culture model was compared to the permeability across human, monkey...

Chlorination and Carbochlorination of Cerium Oxide

International Nuclear Information System (INIS)

Esquivel, Marcelo; Bohe, Ana; Pasquevich, Daniel

2000-01-01

The chlorination and carbochlorination of cerium oxide were studied by thermogravimetry under controlled atmosphere (TG) in the 700 0 C 950 0 C temperature range.Both reactants and products were analyzed by X-ray diffraction (RX), scanning electronic microscopy (SEM) and energy dispersive spectroscopy (EDS). Thermodynamic calculations were performed by computer assisted software.The chlorination starts at a temperature close to 800 0 C.This reaction involves the simultaneous formation and evaporation of CeCl3.Both processes control the reaction rate and their kinetic may not be easily separated.The apparent chlorination activation energy in the 850 0 C-950 0 C temperature range is 172 to 5 kJ/ mole.Carbon transforms the CeO2-Cl2 into a more reactive system: CeO2-C-Cl2, where the effects of the carbon content, total flow rate and temperature were analyzed.The carbochlorination starting temperature is 700 0 C.This reaction is completed in one step controlled by mass transfer with an apparent activation energy of 56 to 5 kJ/mole in the 850 0 C-950 0 C temperature range

Structure and activity of tellurium-cerium oxide acrylonitrile catalysts

International Nuclear Information System (INIS)

Bart, J.C.J.; Giordano, N.

1982-01-01

Ammoxidation of propylene to acrylonitrile (ACN) was investigated over various silica-supported (Te,Ce)O catalysts at 360 and 440 0 C. The binary oxide system used consists of a single nonstoichiometric fluorite-type phase α-(Ce,Te)O 2 up to about 80 mole% TeO 2 and a tellurium-saturated solid solution β-(Ce,Te)O 2 at higher tellurium concentrations. The ACN yield varies almost linearly with the tellurium content of (Ce,Te)O 2 . The β-(Ce,Te)O 2 phase is the most active component of the system (propylene conversion and ACN selectivity at 440 C of 76.7 and 74%, respectively) and is slightly more selective to ACN than α-Te0 2 . Tellurium reduces the overoxidation properties of cerium and selective oxidation occurs through Te(IV)-bonded oxygen

Antioxidant and antigenotoxic properties of CeO2 NPs and cerium sulphate: Studies with Drosophila melanogaster as a promising in vivo model.

Science.gov (United States)

Alaraby, Mohamed; Hernández, Alba; Annangi, Balasubramanyam; Demir, Esref; Bach, Jordi; Rubio, Laura; Creus, Amadeu; Marcos, Ricard

2015-01-01

Although in vitro approaches are the most used for testing the potential harmful effects of nanomaterials, in vivo studies produce relevant information complementing in vitro data. In this context, we promote the use of Drosophila melanogaster as a suitable in vivo model to characterise the potential risks associated to nanomaterials exposure. The main aim of this study was to evaluate different biological effects associated to cerium oxide nanoparticles (Ce-NPs) and cerium (IV) sulphate exposure. The end-points evaluated were egg-to-adult viability, particles uptake through the intestinal barrier, gene expression and intracellular reactive oxygen species (ROS) production by haemocytes, genotoxicity and antigenotoxicity. Transmission electron microscopy images showed internalisation of Ce-NPs by the intestinal barrier and haemocytes, and significant expression of Hsp genes was detected. In spite of these findings, neither toxicity nor genotoxicity related to both forms of cerium were observed. Interestingly, Ce-NPs significantly reduced the genotoxic effect of potassium dichromate and the intracellular ROS production. No morphological malformations were detected after larvae treatment. This study highlights the importance of D. melanogaster as animal model in the study of the different biological effects caused by nanoparticulated materials, at the time that shows its usefulness to study the role of the intestinal barrier in the transposition of nanomaterials entering via ingestion.

miR-146a modulates autoreactive Th17 cell differentiation and regulates organ-specific autoimmunity.

Science.gov (United States)

Li, Bo; Wang, Xi; Choi, In Young; Wang, Yu-Chen; Liu, Siyuan; Pham, Alexander T; Moon, Heesung; Smith, Drake J; Rao, Dinesh S; Boldin, Mark P; Yang, Lili

2017-10-02

Autoreactive CD4 T cells that differentiate into pathogenic Th17 cells can trigger autoimmune diseases. Therefore, investigating the regulatory network that modulates Th17 differentiation may yield important therapeutic insights. miR-146a has emerged as a critical modulator of immune reactions, but its role in regulating autoreactive Th17 cells and organ-specific autoimmunity remains largely unknown. Here, we have reported that miR-146a-deficient mice developed more severe experimental autoimmune encephalomyelitis (EAE), an animal model of human multiple sclerosis (MS). We bred miR-146a-deficient mice with 2D2 T cell receptor-Tg mice to generate 2D2 CD4 T cells that are deficient in miR-146a and specific for myelin oligodendrocyte glycoprotein (MOG), an autoantigen in the EAE model. miR-146a-deficient 2D2 T cells induced more severe EAE and were more prone to differentiate into Th17 cells. Microarray analysis revealed enhancements in IL-6- and IL-21-induced Th17 differentiation pathways in these T cells. Further study showed that miR-146a inhibited the production of autocrine IL-6 and IL-21 in 2D2 T cells, which in turn reduced their Th17 differentiation. Thus, our study identifies miR-146a as an important molecular brake that blocks the autocrine IL-6- and IL-21-induced Th17 differentiation pathways in autoreactive CD4 T cells, highlighting its potential as a therapeutic target for treating autoimmune diseases.

Expression of miR-146a-5p in patients with intracranial aneurysms and its association with prognosis.

Science.gov (United States)

Zhang, H-L; Li, L; Cheng, C-J; Sun, X-C

2018-02-01

The study aims to detect the association of miR-146a-5p with intracranial aneurysms (IAs). The expression of miR-146a-5p was compared from plasma samples between 72 patients with intracranial aneurysms (IAs) and 40 healthy volunteers by quantitative Real-time polymerase chain reaction (qRT-PCR). Statistical analysis was performed to analyze the relationship between miR-146a-5p expression and clinical data and overall survival (OS) time of IAs patients. Univariate and multivariate Cox proportional hazards have also been performed. Notably, higher miR-146a-5p expression was found in plasma samples from 72 patients with intracranial aneurysms (IAs) compared with 40 healthy controls. Higher miR-146a-5p expression was significantly associated with rupture and Hunt-Hess level in IAs patients. Kaplan-Meier survival analysis verified that higher miR-146a-5p expression predicted a shorter overall survival (OS) compared with lower miR-146a-5p expression in IAs patients. Univariate and multivariate Cox proportional hazards demonstrated that higher miR-146a-5p expression, rupture, and Hunt-Hess were independent risk factors of OS in patients with intracranial aneurysms (IAs). MiR-146a-5p expression may serve as a biomarker for predicting prognosis in patients with IAs.

Spectrophotometric study of the complexes of cerium and uranides with diethylenetetraaminepentaacetic acid (DTPA); Contribution a l'etude de la complexation du cerium et des uranides par l'acide diethylenetetraminepentaacetique (DTPA)

Energy Technology Data Exchange (ETDEWEB)

Hafez, M B [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

1968-03-01

A spectrophotometric determination was made of the complexes of cerium and uranides in their different degrees of oxidation with diethylenetriaminepentaacetic acid (DTPA). Two physico-chemical states, the ionic and hydrolysis ones, were considered. In the former case, we studied the influence of the pH on the formation of the complex, and whenever the complexes were stable, we determined the molecular ratio and calculated their stability constants. In the latter case, we studied the conditions of solubilization of the precipitate by formation of complexes soluble in water as a function of pH, age of the precipitate and time of precipitate-chelate contact. (authors) [French] Etude spectrophotometrique de la complexation du cerium et des uranides (uranium, neptunium, plutonium et americium) dans leurs differents etats d'oxydation par l'acide diethylenetriaminepentaacetique (DTPA). Deux etats physicochimiques ont retenu notre attention, l'etat ionique et l'etat precipite d'hydrolyse. Dans le premier cas, nous avons etudie l'influence du pH sur la formation du complexe, et dans tous les cas ou le complexe est stable, nous avons determine le rapport moleculaire (5) [element]/[chelatant] du complexe forme et nous avons calcule leurs constantes de stabilite. Dans le deuxieme cas, l'etat de precipite d'hydrolyse, nous avons etudie les conditions de solubilisation du precipite, par formation du complexe, en fonction du pH, de l'age du precipite et du temps de contact precipite - chelatant. (auteurs)

MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias

Energy Technology Data Exchange (ETDEWEB)

Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy); Vitale, A; Foà, R [Department of Cellular Biotechnologies and Hematology, Division of Hematology, ‘Sapienza' University, Rome (Italy); Testa, U; Labbaye, C [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy)

2011-06-01

CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies.

MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias

International Nuclear Information System (INIS)

Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E; Vitale, A; Foà, R; Testa, U; Labbaye, C

2011-01-01

CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies

Kinetics and mechanism of reduction of cerium(IV) by ascorbic acid

International Nuclear Information System (INIS)

Bhatt, K.; Nand, K.C.

1979-01-01

The reduction of cerium(IV) has been studied in sulfuric acid medium using ascorbic acid as the reductant. The rate is found to be function of both Ce(IV) and AH 2 concentrations. Sulfuric acid retards the rate and the inverse order with respect to sulfuric acid is unity. The addition of chloride, bisulfate and sulfate of sodium show negative salt effect and an increase in the dielectric constant of the medium shows an accelerating effect on the reaction rate. Arrhenius parameters have been evaluated. A mechanism involving intermediate formation of ascorbate radical (AH) is proposed and the derived rate law agrees well with the experimental observations. (author)

The properties of protective oxide scales containing cerium on alloy 800H in oxidizing and oxidizing/sulphidizing environments

NARCIS (Netherlands)

Haanappel, V.A.C.; Haanappel, V.A.C.; Fransen, T.; Geerdink, Bert; Gellings, P.J.; Stroosnijder, M.F.

1991-01-01

The corrosion protection of oxide scales formed by electrophoretic deposition in a cerium-containing sol on Alloy 800H, a 32Ni-20Cr steel, followed by firing in air at 1123 K was studied in oxidizing and mixed oxidizing/sulphidizing environments at elevated temperatures. In particular, the influence

Difference of EGCg adhesion on cell surface between Staphylococcus aureus and Escherichia coli visualized by electron microscopy after novel indirect staining with cerium chloride.

Science.gov (United States)

Nakayama, Motokazu; Shigemune, Naofumi; Tsugukuni, Takashi; Tokuda, Hajime; Miyamoto, Takahisa

2011-07-01

We developed a novel method using indirect staining with cerium chloride for visualization of the catechin derivative epigallocatechin gallate (EGCg) on the surface of particles, i.e., polystyrene beads and bacterial cells, by electron microscopy. The staining method is based on the fact that in an alkaline environment, EGCg produces hydrogen peroxide, and then hydrogen peroxide reacts with cerium, resulting in a cerium hydroperoxide precipitate. This precipitate subsequently reacts with EGCg to produce larger deposits. The amount of precipitate is proportional to the amount of EGCg. Highly EGCg-sensitive Staphylococcus aureus and EGCg-resistant Escherichia coli were treated with EGCg under various pH conditions. Transmission electron microscopy observation showed that the amount of deposits on S. aureus increased with an increase in EGCg concentration. After treating bacterial cells with 0.5mg/mL EGCg (pH 6.0), attachment of EGCg was significantly lower to E. coli than to S. aureus. This is the first report that shows differences in affinity of EGCg to the cell surfaces of Gram-positive and -negative bacteria by electron microscopy. Copyright © 2011 Elsevier B.V. All rights reserved.

One-step synthesis and characterizations of cerium oxide nanoparticles in an ambient temperature via Co-precipitation method

Science.gov (United States)

Pujar, Malatesh S.; Hunagund, Shirajahammad M.; Desai, Vani R.; Patil, Shivaprasadgouda; Sidarai, Ashok H.

2018-04-01

We report the simple Co-precipitation method for the synthesis of Cerium oxide (CeO2) nanoparticles (NPs) in an ambient temperature. We have taken the Cerium (III) nitrate hexahydrate (Ce(NO3)3.6H2O) and Sodium hydroxide (NaOH) as the precursors. The obtained NPs were analyzed using the UV-Vis spectrophotometer, Fourier transform infrared spectroscopy (FT-IR) and X-ray diffraction (XRD). The obtained results signify that UV-Vis spectrum exhibited a well-defined absorption peak at 274 nm and the estimated energy gap (Eg) is 4.05 eV. The FT-IR analysis provides the supporting evidence for the presence of bonding of O-H, nitrates, alcohols and O-Ce-O vibrations. The XRD result reveals that the synthesized CeO2 NPs was crystallite with cubic phase structure and the estimated average crystallite size of CeO2 NPs using Scherer's and W-H method was significantly different due to their assumptions. Further, it is purposed to study their photocatalytic biological activities.

Dioxin induces expression of hsa-miR-146b-5p in human neuroblastoma cells.

Science.gov (United States)

Xu, Tuan; Xie, Heidi Q; Li, Yunping; Xia, Yingjie; Sha, Rui; Wang, Lingyun; Chen, Yangsheng; Xu, Li; Zhao, Bin

2018-01-01

Dioxin can cause a series of neural toxicological effects. MicroRNAs (miRs) play important roles in regulating nervous system function and mediating cellular responses to environmental pollutants, such as dioxin. Hsa-miR-146b-5p appears to be involved in neurodegenerative diseases and brain tumors. However, little is known about effects of dioxin on the expression of hsa-miR-146b-5p. We found that the hsa-miR-146b-5p expression and its promoter activity were significantly increased in dioxin treated SK-N-SH cells, a human-derived neuroblastoma cell line. Potential roles of hsa-miR-146b-5p in mediating neural toxicological effects of dioxin may be due to the regulation of certain target genes. We further confirmed that hsa-miR-146b-5p significantly suppressed acetylcholinesterase (AChE) activity and targeted the 3'-untranslated region of the AChE T subunit, which has been down-regulated in dioxin treated SK-N-SH cells. Functional bioinformatic analysis showed that the known and predicted target genes of hsa-miR-146b-5p were involved in some brain functions or cyto-toxicities related to known dioxin effects, including synapse transmission, in which AChE may serve as a responsive gene for mediating the effect. Copyright © 2017. Published by Elsevier B.V.

22 CFR 146.445 - Marital or parental status.

Science.gov (United States)

2010-04-01

... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.445 Marital or parental status. (a) Status..., or marital status that treats students differently on the basis of sex. (b) Pregnancy and related...

Thermodynamic characteristics of sorption extraction and chromatographic separation of anionic complexes of erbium and cerium with Trilon B on weakly basic anionite

Science.gov (United States)

Cheremisina, O. V.; Ponomareva, M. A.; Sagdiev, V. N.

2016-03-01

The adsorption of anionic complexes of erbium with Trilon B on D-403 anionite is studied at ionic strengths of 1 and 2 mol/kg (NaNO3) and temperatures of 298 and 343 K. The values of the stability constants of complex ions of REE with Trilon B and the Gibbs energies of complexation are calculated. The values of the Gibbs energy and the enthalpy and entropy of ion exchange are determined. Using the obtained thermo-dynamic and sorption characteristics, the possible separation of anionic complexes of erbium and cerium with Trilon B is demonstrated via frontal ion-exchange chromatography. A series of sorption capacities of anionic complexes of cerium, yttrium, and erbium is presented using the values of the Gibbs energy of ion exchange.

Nuclear fuel technology - Determination of uranium in solutions, uranium hexafluoride and solids - Part 2: Iron(II) reduction/cerium(IV) oxidation titrimetric method

International Nuclear Information System (INIS)

2004-01-01

This first edition of ISO 7097-1 together with ISO 7097-2:2004 cancels and replaces ISO 7097:1983, which has been technically revised, and ISO 9989:1996. ISO 7097 consists of the following parts, under the general title Nuclear fuel technology - Determination of uranium in solutions, uranium hexafluoride and solids: Part 1: Iron(II) reduction/potassium dichromate oxidation titrimetric method; Part 2: Iron(II) reduction/cerium(IV) oxidation titrimetric method. This part 2. of ISO 7097 describes procedures for determination of uranium in solutions, uranium hexafluoride and solids. The procedures described in the two independent parts of this International Standard are similar: this part uses a titration with cerium(IV) and ISO 7097-1 uses a titration with potassium dichromate

Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome.

Science.gov (United States)

Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M

2015-01-01

Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.

Pyrazolates advance cerium chemistry: a CeIII/CeIV redox equilibrium with benzoquinone.

Science.gov (United States)

Werner, Daniel; Deacon, Glen B; Junk, Peter C; Anwander, Reiner

2017-05-16

Two stable cerium(iv) 3,5-dialkylpyrazolate complexes are presented, namely dimeric [Ce(Me 2 pz) 4 ] 2 (Me 2 pz = 3,5-dimethylpyrazolate) and monomeric Ce(tBu 2 pz) 4 (tBu 2 pz = 3,5-di-tert-butylpyrazolate) along with their trivalent counterparts [Ce(Me 2 pz) 3 ] and [Ce(tBu 2 pz) 3 ] 2 . All complexes were obtained from protonolysis reactions employing the silylamide precursors Ce[N(SiHMe 2 ) 2 ] 4 and Ce[N(SiMe 3 ) 2 ] 3 . Treatment of homoleptic Ce IV and Ce III Me 2 pz complexes with 1,4-hydroquinone (H 2 hq) or 1,4-benzoquinone (bq), respectively, ultimately gave the same trimetallic Ce III species via a cerium redox equilibrium. The Ce III complex Ce 3 (Me 2 pz) 5 (pchd) 2 (L) (pchd = 1,4-bis(3,5-dimethylpyrazol-1-yl)cyclohex-2,5-diene-1,4-diolato; L = Me 2 pzH or (thf) 2 ) results from a di-1,4-pyrazolyl attack on pre-coordinated bq. The reduction of bq by [Ce(Me 2 pz) 3 (thf)] 2 , and re-oxidation by the resulting Ce IV species was supported by UV-vis spectroscopic investigations. Comparisons with the redox-innocent complexes [Ln(Me 2 pz) 3 (thf)] 2 (Ln = La and Pr) revealed far less selective reactions with bq, giving hexametallic and octametallic rare-earth metal side products containing 2-Me 2 pz substituted hq ligands.

MiR-146a modulates macrophage polarization by inhibiting Notch1 pathway in RAW264.7 macrophages.

Science.gov (United States)

Huang, Cheng; Liu, Xue-Jiao; QunZhou; Xie, Juan; Ma, Tao-Tao; Meng, Xiao-Ming; Li, Jun

2016-03-01

Macrophages are heterogeneous and plastic cells which are able to undergo dynamic transition between M1 and M2 polarized phenotypes in response to the microenvironment signals. However, the underlying molecular mechanisms of macrophage polarization are still obscure. In the current study, it was revealed that miR-146a might play a pivotal role in macrophage polarization. As our results indicated, miR-146a was highly expressed in M2 macrophages rather than M1 macrophages. Over-expression of miR-146a resulted in significantly decreased production of pro-inflammatory cytokines including iNOS and TNF-α in M1 macrophages, while increased production of M2 marker genes such as Arg1 and CD206 in M2 macrophages. In contrast, knockdown of miR-146a promoted M1 macrophage polarization but diminished M2 macrophage polarization. Mechanistically, it was revealed that miR-146a modulated macrophage polarization by targeting Notch1. Of note, PPARγ was responsible as another target for miR-146a-mediated macrophage polarization. Taken together, it was suggested that miR-146a might serve as a molecular regulator in macrophage polarization and is a potential therapeutic target for inflammatory diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

22 CFR 146.520 - Job classification and structure.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Job classification and structure. 146.520... IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the... and structure. A recipient shall not: (a) Classify a job as being for males or for females; (b...

40 CFR 146.4 - Criteria for exempted aquifers.

Science.gov (United States)

2010-07-01

... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.4 Criteria... of a permit application for a Class II or III operation to contain minerals or hydrocarbons that... public water system. (Clean Water Act, Safe Drinking Water Act, Clean Air Act, Resource Conservation and...

The biological effects of subacute inhalation of diesel exhaust following addition of cerium oxide nanoparticles in atherosclerosis-prone mice

NARCIS (Netherlands)

Cassee, Flemming R.; Campbell, Arezoo; Boere, A. John F.; McLean, Steven G.; Duffin, Rodger; Krystek, Petra; Gosens, Ilse; Miller, Mark R.

Bacground: Cerium oxide (CeO 2) nanoparticles improve the burning efficiency of fuel, however, little is known about health impacts of altered emissions from the vehicles. Methods: Atherosclerosis-prone apolipoprotein E knockout (ApoE -/-) mice were exposed by inhalation to diluted exhaust (1.7mg/m

CD146 expression on primary nonhematopoietic bone marrow stem cells is correlated with in situ localization

Science.gov (United States)

Tormin, Ariane; Li, Ou; Brune, Jan Claas; Walsh, Stuart; Schütz, Birgit; Ehinger, Mats; Ditzel, Nicholas; Kassem, Moustapha

2011-01-01

Nonhematopoietic bone marrow mesenchymal stem cells (BM-MSCs) are of central importance for bone marrow stroma and the hematopoietic environment. However, the exact phenotype and anatomical distribution of specified MSC populations in the marrow are unknown. We characterized the phenotype of primary human BM-MSCs and found that all assayable colony-forming units-fibroblast (CFU-Fs) were highly and exclusively enriched not only in the lin−/CD271+/CD45−/CD146+ stem-cell fraction, but also in lin−/CD271+/CD45−/CD146−/low cells. Both populations, regardless of CD146 expression, shared a similar phenotype and genotype, gave rise to typical cultured stromal cells, and formed bone and hematopoietic stroma in vivo. Interestingly, CD146 was up-regulated in normoxia and down-regulated in hypoxia. This was correlated with in situ localization differences, with CD146 coexpressing reticular cells located in perivascular regions, whereas bone-lining MSCs expressed CD271 alone. In both regions, CD34+ hematopoietic stem/progenitor cells were located in close proximity to MSCs. These novel findings show that the expression of CD146 differentiates between perivascular versus endosteal localization of non-hematopoietic BM-MSC populations, which may be useful for the study of the hematopoietic environment. PMID:21415267

Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a

Directory of Open Access Journals (Sweden)

Min-Ching Wang

2018-04-01

Full Text Available Background/Purpose: Bioaggregates such as Portland cement (PC can be an economical alternative for mineral trioxide aggregate (MTA with additional benefit of less discoloration. MTA has been known to induce differentiations of several dental cells. MicroRNAs are important regulators of biological processes, including differentiation, physiologic homeostasis, and disease progression. This study is to explore how PC enhances the differentiation of periodontal ligament (PDL cells in microRNAs level. Methods: PDL cells were cultured in a regular PC- or MTA-conditioned medium or an osteoinduction medium (OIM. Alizarin red staining was used to evaluate the extent of mineralization. Transfection of microRNA mimics induced exogenous miR-31 and miR-146a expression. The expression of microRNAs and differentiation markers was assayed using reverse-transcriptase polymerase chain reaction. Results: PC enhanced the mineralization of PDL cells in a dose-dependent manner in the OIM. Exogenous miR-31 and miR-146a expression upregulated alkaline phosphatase (ALP, bone morphogenic protein (BMP, and dentin matrix protein 1 (DMP1 expression. However, miR-31 and miR-146a modulates cementum protein 1 (CEMP1 expression in different ways. PC also enhanced ALP and BMP but attenuated CEMP1 in the OIM. Although the OIM or PC treatment upregulated miR-21, miR-29b, and miR-146a, only miR-146a was able to be induced by PC in combination with OIM. Conclusion: This study demonstrated that PC enhances the differentiation of PDL cells, especially osteogenic through miR-146a upregulation. In order to control the ankylosis after regenerative endodontics with the usage of bioaggregates, further investigations to explore these differentiation mechanisms in the miRNA level may be needed. Keywords: Portland cement, Bioaggregate, miR-146a, Osteogenic differentiation, Periodontal ligament (PDL

A single nucleotide polymorphism in primary-microRNA-146a reduces the expression of mature microRNA-146a in patients with Alzheimer's disease and is associated with the pathogenesis of Alzheimer's disease.

Science.gov (United States)

Zhang, Bin; Wang, Aihong; Xia, Cuiping; Lin, Qunfeng; Chen, Chunfu

2015-09-01

Alzheimer's disease (AD) is a progressive neurodegenerative disorder and is the most common form of dementia among the aging population. Although the incidence of the disease continues to increase, no cure has been developed. Effective treatment is restricted not only due to the lack of curative medicine, but also due to limited understanding of the underlying mechanisms and the difficulties in accurately diagnosing AD in its earliest stages prior to clinical symptoms. Micro (mi) RNAs (miR) have gained increasing attention in the investigation of neurodegenerative diseases. Previous reports have demonstrated that deregulation of miR‑146a‑5p is associated with the pathogenesis of human AD. In the present study, the coding region of primary (pri)‑miR‑146a in patients with AD was scanned and the rare C allele of rs2910164 was found to be associated with AD. Using reverse transcription quantitative polymerase chain reaction, it was demonstrated that site variation reduced the expression of mature miR‑146a‑5p. Notably, a reduction in the expression of miR‑146a‑5p led to less efficient inhibition of target genes, including Toll‑like receptor (TLR)2, which is important in the pathogenesis of AD. Biological function investigations in RAW264.7 cells indicated that, compared with the G allele, the rare C allele upregulated the expression of tumor necrosis factor‑α following stimulation with β‑amyloid. These findings suggested that one common polymorphism in pri‑miR‑146a may contribute to the genetic predisposition to AD by disrupting the production of miR‑146a‑5p and affecting the expression and function of TLR2.

Photocatalytic Degradation of Malachite Green Using Nano-sized cerium-iron Oxide

Directory of Open Access Journals (Sweden)

K. L. Ameta

2014-05-01

Full Text Available Nano-sized cerium-iron oxide nanoparticles has been synthesized, characterized and explored as an efficient photocatalyst for the photocatalytic degradation of malachite green. The effects of different variables on degradation of dye were optimized such as the pH of the dye solution, dye concentration, amount of photocatalyst and light intensity. About 91% degradation of dye of 2×10-5 M concentration was observed after 2 hours at 8.5 pH and 600 Wm-2 light intensity. The reason for the high catalytic activity of the synthesized nanoparticles is ascribed to the high surface area which determines the active sites of the catalyst and accelerates the photocatalytic degradation.

An investigation of the use of cerium and polyhedral oligomeric silsesquioxanes for the protection of polymeric epoxy compounds in the low Earth orbit environment

Science.gov (United States)

Piness, Jessica Miriam

with the epoxy-amine matrix. A sedimented layer of the most incompatible POSS moiety was observed at the bottom of bars at the highest loading level of 5 wt% POSS. It was concluded that POSS could form a sedimented layer in this epoxy during cure. Epoxy amine materials containing POSS derivatives were tested by exposure to atomic oxygen at NASA Glenn Research Center with each POSS derivative present in separate samples at 2.5 wt% loading levels. Mass loss did not decrease against an unfilled control and glassification was not observed, leading to the conclusion that POSS could not be effectively concentrated at a surface to reduce degradation given the methods used. Taking this into account, the study transitioned into seeking ways to integrate highly UV absorbent cerium compounds with POSS. This part of the study is reported in Chapter IV. It was anticipated that POSS with a polar pendant group would interact through intermolecular forces with cerium (IV) oxide and produce a suspension that could be cured at the surface of polymers. However, in every experiment, the cerium (IV) oxide was not dispersed. However, a homogeneous dispersion of a cerium-containing compound was achieved by combining trisilanol phenyl POSS with cerium (III) nitrate hexahydrate. NMR and mass spectrometry showed that the mixture of Cerium nitrate and trisilanol phenyl POSS did not result in the formation of a chemical compound but FTIR studies indicated the presence of hydrogen bonding between the POSS silanols and cerium-associated water. The resulting material was termed "CePOSS". CePOSS was more UV absorbent in the UVc region than POSS or other cerium compounds as measured by solution UV-vis spectroscopy. In addition, CePOSS could be mixed into a POSS-epoxy coating, after pre-blending with poly(ethylene glycol) POSS, to produce films that were essentially opaque in the UV region below a wavelength of about 300 nm, and transparent in the visible region above 300 nm. The discovery of a 'window

Microstructure, texture evolution and magnetic properties of strip-casting non-oriented 6.5 wt.% Si electrical steel doped with cerium

Energy Technology Data Exchange (ETDEWEB)

Li, Hao-Ze, E-mail: lhzqq83@163.com; Liu, Hai-Tao; Liu, Zhen-Yu, E-mail: zyliu@mail.neu.edu.cn; Wang, Guo-Dong

2015-05-15

A 0.3 mm thick non-oriented 6.5 wt.% Si electrical steel sheet doped with cerium is produced by twin-roll strip casting, hot rolling, warm rolling and annealing. A detailed study of the cerium precipitates in the as-cast strip, microstructure and texture evolution at different processing stages is carried out by electron probe micro-analysis, optical microscopy, X-ray diffraction and electron backscattered diffraction analysis. Grain interior distributing precipitates identified as Ce-oxides, Ce-oxysulfides and Ce-phosphides, and boundary distributing Ce-oxides and Ce-phosphides are observed in the as-cast strip. The initial as-cast strip is characterized by a much finer solidification microstructure and dominated by obvious < 001 >//ND texture through the strip thickness. After hot and warm rolling, inhomogeneous microstructure containing large amounts of in-grain shear bands is characterized by mixed < 110 >//RD and < 111 >//ND textures. The texture of the annealed sheet with a relatively large average grain size is far more optimized by the domination of the beneficial cube, rotated cube, (001)< 120 > to (001)< 130 > and Goss texture components, and the elimination of the detrimental γ-fiber texture, leading to a superior magnetic induction and improved iron loss. - Highlights: • An Fe–6.5 wt.% Si as-cast strip doped with cerium was produced. • A thin warm rolled sheet with limited edge cracks was obtained. • Microstructure and texture evolution at each stage were investigated. • Strong λ-fiber and Goss recrystallization textures were formed. • The magnetic properties of the annealed sheet were significantly improved.

miR-146a Suppresses Invasion of Pancreatic Cancer Cells

Science.gov (United States)

Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.

2010-01-01

The aggressive course of pancreatic cancer is believed to reflect its unusually invasive and metastatic nature, which is associated with epidermal growth factor receptor (EGFR) overexpression and NF-κB activation. MicroRNAs (miRNA) have been implicated in the regulation of various pathobiological processes in cancer, including metastasis in pancreatic cancer and in other human malignancies. In this study, we report lower expression of miR-146a in pancreatic cancer cells compared with normal human pancreatic duct epithelial cells. Reexpression of miR-146a inhibited the invasive capacity of pancreatic cancer cells with concomitant downregulation of EGFR and the NF-κB regulatory kinase interleukin 1 receptor–associated kinase 1 (IRAK-1). Cellular mechanism studies revealed crosstalk between EGFR, IRAK-1, IκBα, NF-κB, and MTA-2, a transcription factor that regulates metastasis. Treatment of pancreatic cancer cells with the natural products 3,3′-diinodolylmethane (DIM) or isoflavone, which increased miR-146a expression, caused a downregulation of EGFR, MTA-2, IRAK-1, and NF-κB, resulting in an inhibition of pancreatic cancer cell invasion. Our findings reveal DIM and isoflavone as nontoxic activators of a miRNA that can block pancreatic cancer cell invasion and metastasis, offering starting points to design novel anticancer agents. PMID:20124483

146----10 Dec indd [ FINAL VERSION].indd

African Journals Online (AJOL)

23 Sep 2009 ... e o lo g ic a l S tu d ie s http://www.hts.org.za. HTS. Original Research. A ... phronēsis and Paul Ricoeur's movement from mimēsis1 ... It is not only pastors' knowledge of the Bible, theological tradition and ...... way that we are led into the truth and life (John 14:6). ..... human brain, Harper Collins, New York.

miR-146a negatively regulates the induction of proinflammatory cytokines in response to Japanese encephalitis virus infection in microglial cells.

Science.gov (United States)

Deng, Minnan; Du, Ganqin; Zhao, Jiegang; Du, Xiaowei

2017-06-01

Increasing evidence confirms the involvement of virus infection and miRNA, such as miR-146a, in neuroinflammation-associated epilepsy. In the present study, we investigated the upregulation of miR-146a with RT-qPCR and in situ hybridization methods in a mice infection model of Japanese encephalitis virus (JEV) and in vitro. Subsequently we investigated the involvement of miR-146a in modulating JEV-induced neuroinflammation. It was demonstrated that JEV infection promoted miR-146a production in BALB/c mice brain and in cultured mouse microglial C8-B4 cells, along with pro-inflammatory cytokines, such as IL-1β, IL-6, TNF-α, IFN-β and IFN-α. We also found that miR-146a exerted negative regulatory effects upon IL-1β, IL-6, TNF-α, IFN-β and IFN-α in C8-B4 cells. Accordingly, miR-146a downregulation with a miR-146a inhibitor promoted the upregulation of IL-1β, IL-6, TNF-α, IFN-β and IFN-α, whereas miR-146a upregulation with miR-146a mimics reduced the upregulation of these cytokines. Moreover, miR-146a exerted no regulation upon JEV growth in C8-B4 cells. In conclusion, JEV infection upregulated miR-146a and pro-inflammatory cytokine production, in mice brain and in cultured C8-B4 cells. Furthermore, miR-146a negatively regulated the production of JEV-induced pro-inflammatory cytokines, in virus growth independent fashion, identifying miR-146a as a negative feedback regulator in JEV-induced neuroinflammation, and possibly in epilepsy.

MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer

Science.gov (United States)

2015-09-01

determined whether miR-146a inhibitor promotes CRPC phenotype by upregulating SIAH2 in LNCaP and MDAPCa2b cells. First we determined the effect of DHT (5α...dihydrotestosterone) on proliferation of these cells grown in the presence of charcoal stripped calf serum. The results indicated that DHT increased...proliferation of both parental LNCaP and MDAPCa2b cells but DHT did not increase proliferation of miR-146a inhibitor expressing cell lines (Fig. 6

Study of gels of molybdenum with cerium in the preparation of generators of 99Mo-99mTc

International Nuclear Information System (INIS)

Moraes, Vanessa; Marczewski, Barbara; Dias, Carla Roberta; Osso Junior, Joao Alberto

2005-01-01

99m Tc has ideal nuclear properties for organ imaging in nuclear medicine, and it is obtained from the 99 Mo- 99m Tc generator. Four different types of generators are available: chromatographic that uses 99 Mo from fission of uranium; MEK solvent extraction; Tc 2 O 7 sublimation; gel chromatographic. This work presents the preparation of gel generators of molybdenum with cerium and characterization of the gels: mass ratio between molybdenum and cerium, structure, size of particles and elution percentage of 99m Tc after irradiating the gels. Eight gels were prepared at the same temperature of 50 deg C with concentrations of NaOH of 2 and 4 mol/L, mass ratio of 0.31 and 0.38 and final pH of 3.5 and 4.5. The analysis of the results proved that these gels are not adequate for preparation of the generators of 99 Mo- 99m Tc, since the elution percentages are low, when compared with the gel of molybdenum with zirconium.(author)

Experimental demyelination and axonal loss are reduced in MicroRNA-146a deficient mice

DEFF Research Database (Denmark)

Martin, Nellie A.; Molnar, Viktor; Szilagyi, Gabor T.

2018-01-01

Background: The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differ...

Bio-sensing applications of cerium oxide nanoparticles: Advantages and disadvantages.

Science.gov (United States)

Charbgoo, Fahimeh; Ramezani, Mohammad; Darroudi, Majid

2017-10-15

Cerium oxide nanoparticles (CNPs) contain several properties such as catalytic activity, fluorescent quencher and electrochemical, high surface area, and oxygen transfer ability, which have attracted considerable attention in developing high-sensitive biosensors. CNPs can be used as a whole sensor or a part of recognition or transducer element. However, reports have shown that applying these nanoparticles in sensor design could remarkably enhance detection sensitivity. CNP's outstanding properties in biosensors which go from high catalytic activity and surface area to oxygen transfer and fluorescent quenching capabilities are also highlighted. Herein, we discuss the advantages and disadvantages of CNPs-based biosensors that function through various detection modes including colorimetric, electrochemistry, and chemoluminescent regarding the detection of small organic chemicals, metal ions and biomarkers. Copyright © 2017 Elsevier B.V. All rights reserved.

The E3 ubiquitin ligase RNF146 promotes colorectal cancer by activating the Wnt/β-catenin pathway via ubiquitination of Axin1.

Science.gov (United States)

Shen, Jiangli; Yu, Zhaohui; Li, Na

2018-06-20

The E3 ubiquitin ligase ring finger protein 146 (RNF146) has been implicated in tumor development. However, the role and clinical significance of RNF146 in colorectal cancer (CRC) remain unknown. In this study, we reported for the first time that RNF146 was upregulated in CRC tissues as well as in cell lines. Further, RNF146 expression was independent prognostic factor for poor outcome of CRC patients. RNF146 knockdown in cell lines inhibited cell growth, promoted cell apoptosis in vitro and suppressed colorectal tumor growth in vivo. Mechanistic investigations revealed that RNF146 exerted oncogenic role through ubiquitination of Axin1 to activate β-catenin signalling. In addition, RNF146 expression was positively correlated with β-catenin expression in CRC tissues. Collectively, our data suggest that RNF146 might function as a oncogene in human CRC, and represent a promising prognostic factor and a valuable therapeutic target for CRC. Copyright © 2018. Published by Elsevier Inc.

Protection by Thermal and Chemical Activation with Cerium Salts of the Alloy AA2017 in Aqueous Solutions of NaCl

Science.gov (United States)

Bethencourt, Manuel; Botana, Francisco Javier; Cano, María José; González-Rovira, Leandro; Marcos, Mariano; Sánchez-Amaya, José María

2012-01-01

A wide variety of anticorrosive treatments for aluminum alloys that can be employed as "green" alternatives to those based on Cr(VI) are currently under development. This article reports a study of the morphological and anticorrosive characteristics of surface layers formed on the Al-Cu alloy AA2017 by immersion treatment in baths of cerium salt, accelerated by increased temperature and the employment of hydrogen peroxide. Scanning electron microscopy (SEM)/X-ray energy dispersive spectroscopy (XEDS) studies of the samples treated have demonstrated the existence of a heterogeneous layer formed by a film of aluminum oxide/hydroxide on the matrix, and a series of dispersed islands of cerium over the cathodic intermetallics. The protective efficacy has been evaluated using electrochemical techniques, linear polarizations (LP) and electrochemical impedance spectroscopy (EIS), and salt spray tests. The results obtained indicate that the layer provided good resistance to corrosion in media with chlorides, and the method gives a considerable reduction of the time required for the immersion treatments.

Cerium oxide for the destruction of chemical warfare agents: A comparison of synthetic routes

Energy Technology Data Exchange (ETDEWEB)

Janoš, Pavel, E-mail: pavel.janos@ujep.cz [Faculty of the Environment, University of Jan Evangelista Purkyně, Králova Výšina 7, 400 96 Ústí nad Labem (Czech Republic); Henych, Jiří [Faculty of the Environment, University of Jan Evangelista Purkyně, Králova Výšina 7, 400 96 Ústí nad Labem (Czech Republic); Institute of Inorganic Chemistry AS CR v.v.i., 25068 Řež (Czech Republic); Pelant, Ondřej; Pilařová, Věra; Vrtoch, Luboš [Faculty of the Environment, University of Jan Evangelista Purkyně, Králova Výšina 7, 400 96 Ústí nad Labem (Czech Republic); Kormunda, Martin [Faculty of Sciences, University of Jan Evangelista Purkyně, České Mládeže 8, 400 96 Ústí nad Labem (Czech Republic); Mazanec, Karel [Military Research Institute, Veslařská 230, 637 00 Brno (Czech Republic); and others

2016-03-05

Highlights: • Four synthetic routes were compared to prepare the nanoceria-based reactive sorbents. • The sorbents prepared by homogeneous hydrolysis destroy efficiently the soman and VX nerve agents. • Toxic organophosphates are converted to less-dangerous products completely within a few minutes. • Surface non-stoichiometry and −OH groups promote the destruction by the S{sub N}2 mechanism. - Abstract: Four different synthetic routes were used to prepare active forms of cerium oxide that are capable of destroying toxic organophosphates: a sol–gel process (via a citrate precursor), homogeneous hydrolysis and a precipitation/calcination procedure (via carbonate and oxalate precursors). The samples prepared via homogeneous hydrolysis with urea and the samples prepared via precipitation with ammonium bicarbonate (with subsequent calcination at 500 °C in both cases) exhibited the highest degradation efficiencies towards the extremely dangerous nerve agents soman (O-pinacolyl methylphosphonofluoridate) and VX (O-ethyl S-[2-(diisopropylamino)ethyl] methylphosphonothioate) and the organophosphate pesticide parathion methyl. These samples were able to destroy more than 90% of the toxic compounds in less than 10 min. The high degradation efficiency of cerium oxide is related to its complex surface chemistry (presence of surface −OH groups and surface non-stoichiometry) and to its nanocrystalline nature, which promotes the formation of crystal defects on which the decomposition of organophosphates proceeds through a nucleophilic substitution mechanism that is not dissimilar to the mechanism of enzymatic hydrolysis of organic phosphates by phosphotriesterase.

Targeted delivery of microRNA 146b mimic to hepatocytes by lactosylated PDMAEMA nanoparticles for the treatment of NAFLD.

Science.gov (United States)

He, Shuying; Guo, Weihong; Deng, Feihong; Chen, Kequan; Jiang, Yonghong; Dong, Minyu; Peng, Liang; Chen, Xueqing

2018-03-21

Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, and precision therapeutic will be a benefit for the NAFLD regression. In this study, we observed low microRNA 146 b (miR-146 b) expression in NAFLD mice model induced by methionine-choline-deficient diet (MCD) compared with control group. Furthermore, miR-146b -/- mice induced MCD exhibited severe liver steatosis and hepatitis. A bio-distribution study showed that novel Lactosylated PDMAEMA nanoparticles effectively targeted hepatocytes Lac-PDMAEMA. We coupled miR-146b mimic with Lac-PDMAEMA and then were administrated to NAFLD mice model, which could obviously alleviate the hepatic steatosis. Lac-PDMAEMA effectively delivered miR-146b mimic to hepatocytes with a ∼8-fold upregulation of miR-146b mimic targeting MyD88 and IRAK1, and in turn suppressed the expression of PPARγ. Meanwhile, TNF-α and IL-6 mRNA levels were decreased after administration of Lac-PDMAEMA/miR-146b mimic. So, we made a conclusion that targeted delivering miR-146b mimic to the hepatocytes by, coupling Lac-PDMAEMA nanoparticles could effectively alleviate the hepatic steatosis in NAFLD mice, which maybe bring a new and effective way to intervene and therapy the NAFLD.

Inhibition of miR-146b expression increases radioiodine-sensitivity in poorly differential thyroid carcinoma via positively regulating NIS expression

Energy Technology Data Exchange (ETDEWEB)

Li, Luchuan; Lv, Bin; Chen, Bo [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Guan, Ming [Department of General Surgery, Qihe People' s Hospital, Qihe, Shandong 251100 (China); Sun, Yongfeng [Department of General Surgery, Licheng District People' s Hospital, Jinan, Shandong 250115 (China); Li, Haipeng [Department of General Surgery, Caoxian People' s Hospital, Caoxian, Shandong 274400 (China); Zhang, Binbin; Ding, Changyuan; He, Shan [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Zeng, Qingdong, E-mail: qingdz0201@163.com [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China)

2015-07-10

Dedifferentiated thyroid carcinoma (DTC) with the loss of radioiodine uptake (RAIU) is often observed in clinical practice under radioiodine therapy, indicating the challenge for poor prognosis. MicroRNA (miRNA) has emerged as a promising therapeutic target in many diseases; yet, the role of miRNAs in RAIU has not been generally investigated. Based on recent studies about miRNA expression in papillary or follicular thyroid carcinomas, the expression profiles of several thyroid relative miRNAs were investigated in one DTC cell line, derived from normal DTC cells by radioiodine treatment. The top candidate miR-146b, with the most significant overexpression profiles in dedifferentiated cells, was picked up. Further research found that miR-146b could be negatively regulated by histone deacetylase 3 (HDAC3) in normal cells, indicating the correlation between miR-146b and Na{sup +}/I{sup −} symporter (NIS)-mediated RAIU. Fortunately, it was confirmed that miR-146b could regulate NIS expression/activity; what is more important, miR-146b interference would contribute to the recovery of radioiodine-sensitivity in dedifferentiated cells via positively regulating NIS. In the present study, it was concluded that NIS-mediated RAIU could be modulated by miR-146b; accordingly, miR-146b might serve as one of targets to enhance efficacy of radioactive therapy against poorly differential thyroid carcinoma (PDTC). - Highlights: • Significant upregulated miR-146b was picked up from thyroid relative miRNAs in DTC. • MiR-146b was negatively regulated by HDAC3 in normal thyroid carcinoma cells. • NIS activity and expression could be regulated by miR-146b in thyroid carcinoma. • MiR-146b inhibition could recover the decreased radioiodine-sensitivity of DTC cells.

Study of nano - second isomers near 146Gd

International Nuclear Information System (INIS)

Pramanik, Dibyadyuti; Sarkar, S.; Bisoi, Abhijit; Ray, Sudatta; Ray, I.; Pradhan, M.K.; Goswami, A.; Banerjee, P.; Mukherjee, A.; Bhattacharya, S.; Saha Sarkar, M.; Chakraborty, A.; Dey, Gautam; Krishichayan; Kshetri, R.; Ganguly, S.; Raut, R.; Ray Basu, M.; Ganguly, G.; Ghugre, S.S.; Sinha, A.K.; Basu, S.K.

2010-01-01

The nuclei near 146 Gd show rich variety in their excitation spectra. Spectra exhibiting characteristics of extreme single particle, multi-particle-hole excitation, magnetic bands to strong collectivity manifested through superdeformation, and triaxial superdeformation have been widely studied. In the present work, a few isomers in the mass ≅150 region using the RF - gamma coincidence data are studied

Evaluation of σ-1 receptor radioligand 18F-FTC-146 in rats and squirrel monkeys using PET

DEFF Research Database (Denmark)

James, Michelle L; Shen, Bin; Nielsen, Carsten Haagen

2014-01-01

. Pretreatment with known S1R compounds, haloperidol, or BD1047, before radioligand administration, significantly attenuated (18)F-FTC-146 accumulation in all rat brain regions by approximately 85% (P ...-FTC-146 was observed in rat plasma. Preliminary monkey PET/MRI studies demonstrated specific accumulation of (18)F-FTC-146 in the brain (mainly in cortical structures, cerebellum, and vermis) that could be attenuated by pretreatment with haloperidol. HPLC of monkey plasma suggested radioligand metabolism...

Bio-functionalized dense-silica nanoparticles for MR/NIRF imaging of CD146 in gastric cancer

Directory of Open Access Journals (Sweden)

Wang P

2015-01-01

Full Text Available Pu Wang,1,* Yazhuo Qu,2,* Chuan Li,3 Li Yin,2 Caifei Shen,1 Wei Chen,3 Shiming Yang,4 Xiuwu Bian,2 Dianchun Fang11Institute of Gastroenterology, 2Institute of Pathology, 3Department of Radiology, Southwest Hospital, The Third Military Medical University, Chongqing, People’s Republic of China; 4Department of Gastroenterology, Xinqiao Hospital, The Third Military Medical University, Chongqing, People’s Republic of China*These authors contributed equally to this workPurpose: Nano dense-silica (dSiO2 has many advantages such as adjustable core–shell structure, multiple drug delivery, and controllable release behavior. Improving the gastric tumor-specific targeting efficiency based on the development of various strategies is crucial for anti-cancer drug delivery systems.Methods: Superparamagnetic iron oxide nanoparticles (SPION were coated with dSiO2 as core–shell nanoparticles, and labeled with near infra-red fluorescence (NIRF dye 800ZW (excitation wavelength: 778 nm/­emission wavelength: 806 nm and anti-CD146 monoclonal antibody YY146 for magnetic resonance (MR/NIRF imaging study in xenograft gastric cancer model. The morphology and the size of pre- and postlabeling SPION@dSiO2 core–shell nanoparticles were characterized using transmission electron microscopy. Iron content in SPION@dSiO2 nanoparticles was measured by inductively coupled plasma optical emission spectrometry. Fluorescence microscopy and fluorescence-activated cell sorter studies were carried out to confirm the binding specificity of YY146 and 800ZW–SPION@dSiO2–YY146 on MKN45 cells. In vivo and in vitro NIRF imaging, control (nanoparticles only and blocking studies, and histology were executed on MKN45 tumor-bearing nude mice to estimate the affinity of 800ZW–SPION@dSiO2–YY146 to target tumor CD146.Results: 800ZW–SPION@dSiO2–YY146 nanoparticles were uniformly spherical in shape and dispersed evenly in a cell culture medium. The diameter of the nanoparticle

Kinetics of bromide catalysed oxidation of dextrose by cerium (IV) in aqueous sulphuric acid solution

International Nuclear Information System (INIS)

Sharma, J.; Sah, M.P.

1994-01-01

Kinetics of bromide catalysed oxidation of dextrose by Ce IV in aqueous sulphuric acid medium show first order dependence each in dextrose and cerium(IV). The reaction rate decreases on increasing the concentration of hydrogen ion. The increase in [HSO 4 - ] or [SO 4 2- ] decreases the rate. The bromide ion shows positive catalytic effect on the reaction rate. The value of activation energy has been calculated and a suitable mechanism confirming to the kinetic data is proposed. (author). 3 refs., 3 tabs

Thermoluminescence and sintering of ultra-pure {alpha} alumina doped with zirconium, thorium, calcium or cerium; Thermoluminescence et frittage de l'alumine {alpha} ultra-pure dopee par le zirconium, le thorium, le calcium, ou le cerium

Energy Technology Data Exchange (ETDEWEB)

Ferey, F

2002-01-01

Thermoluminescence is a technique of identification of the point defects that appear in a solid consecutively to its fabrication. The synthesis parameters of {alpha}-alumina that will be taken into account here are the atmosphere during thermal treatment (oxidising or reducing), and the effect of the dopants: zirconium, thorium, calcium or cerium. The aim of this work is to correlate the point defects to the reactivity of the powder, especially its sintering. The TL mechanisms of the dosimetric peak of {alpha}-alumina, around 200 deg C, were clarified: the trap is an aggregate of 2 point defects (V{sub al}-V{sub O}), and the recombination centre is Cr{sup 3+}. The sensibilizing effect observed for thorium, or for cerium under reducing atmosphere, is attributed to the presence of a large emission band in the blue-green domain. Chromium is the main impurity at the origin of the E' peak (360 deg C) of {alpha}-alumina. It is acting as trap and also as recombination centre. A mechanism of transfer of energy between Cr{sup 3+} and Ti{sup 4+} is also presented in order to explain the increase of the TL intensity of the E' peak when doping by a tetravalent cation. In the case of doping by calcium, TL allows the revelation of the phase CaAl{sub 12}O{sub 19}. A quenching was observed for {alpha}Al{sub 2}O{sub 3}:Ca and {alpha}Al{sub 2}O{sub 3}:Ce under reducing atmosphere. It is attributed to oxygen vacancies for the doping by calcium, and to the presence of Ce{sup 3+} for the doping by cerium. The alumina prepared under reducing conditions exhibit a perturbation of kinetics during sintering, and also abnormal grain growth in doped samples. This unusual kinetic is explained by a decrease in the concentration of aluminium vacancies under reducing atmosphere, conducting indirectly to a greater segregation of Si{sup 4+} at the grain boundaries, and to the formation of a liquid phase at the surface of grains. This phenomenon is amplified in the case of doping by

31 CFR 363.146 - May a certificate of indebtedness be pledged or used as collateral?

Science.gov (United States)

2010-07-01

... pledged or used as collateral? 363.146 Section 363.146 Money and Finance: Treasury Regulations Relating to... certificate of indebtedness be pledged or used as collateral? A certificate of indebtedness may not be pledged or used as collateral for the performance of an obligation. [69 FR 50309, Aug. 16, 2004. Redesignated...

Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

DEFF Research Database (Denmark)

Pauly, N; Yubero, F; Espinós, J P

2017-01-01

Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 ke...

MicroRNA-146a provides feedback regulation of lyme arthritis but not carditis during infection with Borrelia burgdorferi.

Directory of Open Access Journals (Sweden)

Robert B Lochhead

2014-06-01

Full Text Available MicroRNAs have been shown to be important regulators of inflammatory and immune responses and are implicated in several immune disorders including systemic lupus erythematosus and rheumatoid arthritis, but their role in Lyme borreliosis remains unknown. We performed a microarray screen for expression of miRNAs in joint tissue from three mouse strains infected with Borrelia burgdorferi. This screen identified upregulation of miR-146a, a key negative regulator of NF-κB signaling, in all three strains, suggesting it plays an important role in the in vivo response to B. burgdorferi. Infection of B6 miR-146a-/- mice with B. burgdorferi revealed a critical nonredundant role of miR-146a in modulating Lyme arthritis without compromising host immune response or heart inflammation. The impact of miR-146a was specifically localized to the joint, and did not impact lesion development or inflammation in the heart. Furthermore, B6 miR-146a-/- mice had elevated levels of NF-κB-regulated products in joint tissue and serum late in infection. Flow cytometry analysis of various lineages isolated from infected joint tissue of mice showed that myeloid cell infiltration was significantly greater in B6 miR-146a-/- mice, compared to B6, during B. burgdorferi infection. Using bone marrow-derived macrophages, we found that TRAF6, a known target of miR-146a involved in NF-κB activation, was dysregulated in resting and B. burgdorferi-stimulated B6 miR-146a-/- macrophages, and corresponded to elevated IL-1β, IL-6 and CXCL1 production. This dysregulated protein production was also observed in macrophages treated with IL-10 prior to B. burgdorferi stimulation. Peritoneal macrophages from B6 miR-146a-/- mice also showed enhanced phagocytosis of B. burgdorferi. Together, these data show that miR-146a-mediated regulation of TRAF6 and NF-κB, and downstream targets such as IL-1β, IL-6 and CXCL1, are critical for modulation of Lyme arthritis during chronic infection with B

Determination of Cerium (IV) Using Rhodamine 6G Fluorescence Quenching

Science.gov (United States)

Zhao, Zh.; Sheng, L.; Su, B.; Tao, C.; Jing, W.

2017-11-01

The interaction between rhodamine 6G (Rh6G) and cerium sulfate was studied by the fluorescence quenching method. In a sulfuric acid medium, the interaction of Ce(IV) with Rh6G results in Rh6G fluorescence quenching. The maximum excitation wavelength (λex) and the maximum emission wavelength (λem) are 530 nm and 555 nm, respectively. A good linearity between the relative fl uorescence intensity (ΔF) and Ce(IV) was observed in the range 0.12-1.08 μg/mL. The detection limit was 1.4 × 10-3 μg/mL. The optimum reaction conditions, influencing factors, and effect of coexisting substances were investigated in the experiment. We found that the concentration of Rh6G was 3.2 × 10-6 mol/L, and the fl uorescence intensity was maximum.

Development and design application of cerium (IV) decontamination process

International Nuclear Information System (INIS)

Bray, L.A.; Seay, J.M.

1988-01-01

A simple and effective method was developed for decontamination of high-level waste canisters. This method of chemical decontamination is applicable to a wide variety of contaminated equipment found in the nuclear industry. Conceptual design of the cerium [Ce(IV)] decontamination process equipment has been completed for the West Valley Demonstration project (WVDP) vitrification facility. This remote equipment, which is the first engineering scale application of this technology, will remove surface contamination from stainless-steel (SS) containers containing high-level waste (HLW) glass prior to placing them into temporary storage and ultimate shipment to a U.S. Department of Energy (DOE) repository for disposal. The objective of the development and design study was to identify an effective chemical process and to design equipment to decontaminate the HLW glass canisters to limits that meet U.S. DOE requirements. The equipment includes canister-capping and smear stations in addition to the decontamination module and associated services

Development and design application of cerium (IV) decontamination process

International Nuclear Information System (INIS)

Bray, L.A.; Seay, J.M.

1988-10-01

A simple and effective method was developed for decontamination of high-level waste canisters. This method of chemical decontamination is applicable to a wide variety of contaminated equipment found in the nuclear industry. Conceptual design of the cerium [Ce(IV)] decontamination process equipment has been completed for the West Valley Demonstration Project (WVDP) vitrification facility. This remote equipment, which is the first engineering scale application of this technology, will remove surface contamination from stainless-steel (SS) containers containing high-level waste (HLW) glass prior to placing them into temporary storage and ultimate shipment to a US Department of Energy (DOE) repository for disposal. The objective of the development and design study was to identify an effective chemical process and to design equipment to decontaminate the HLW glass canisters to limits that meet USDOE requirements. The equipment includes canister-capping and smear stations in addition to the decontamination module and associated services. 2 refs., 1 fig

Structure, dielectric and electrical properties of cerium doped barium zirconium titanate ceramics

International Nuclear Information System (INIS)

Feng Hongjun; Hou Jungang; Qu Yuanfang; Shan Dan; Yao Guohua

2012-01-01

Highlights: ► Rare-earth doped barium zirconate titanate (BZT) ceramics, Ba(Zr 0.25 Ti 0.75 )O 3 + xCeO 2 , (x = 0–1.5 at%) were obtained by a solid state reaction route. ► Morphological analysis on sintered samples by scanning electron microscopy shows that the addition of rare-earth ions affects the growth of the grain and remarkably changes the grain morphology. ► The effect of rare-earth addition to BZT on dielectric and electrical properties is analyzed, demonstrating that the samples with x = 0.4 and x = 0.6 could be semiconducting in air atmosphere. - Abstract: Rare-earth doped barium zirconium titanate (BZT) ceramics, Ba(Zr 0.25 Ti 0.75 )O 3 + xCeO 2 , (x = 0–1.5 at%) were obtained by a solid state reaction route. Perovskite-like single-phase compounds were confirmed from X-ray diffraction data and the lattice parameters were refined by the Rietveld method. It is found that, integrating with the lattice parameters and the distortion of crystal lattice, there is an alternation of substitution preference of cerium ions for the host cations in perovskite lattice. Morphological analysis on sintered samples by scanning electron microscopy shows that the addition of rare-earth ions affects the growth of the grain and remarkably changes the grain morphology. The effect of rare-earth addition to BZT on dielectric and electrical properties is analyzed. High values of dielectric tunability are obtained for cerium doped BZT. Especially, the experimental results on the effect of the contents of rare-earth addition on the resistivity of BZT ceramics were investigated, demonstrating that the samples with x = 0.4 and x = 0.6 could be semiconducting in air atmosphere.

Effect of miR-146a-5p on proliferation and metastasis of triple-negative breast cancer via regulation of SOX5.

Science.gov (United States)

Si, Chengshuai; Yu, Qiao; Yao, Yufeng

2018-05-01

MicroRNA (miR)-146a-5p functions as a tumor suppressor in various types of cancer. However, the role of miR-146a-5p in the development of triple-negative breast cancer (TNBC) is unclear. The present study aimed to investigate the role of miR-146a-5p in TNBC. The expression level of miR-146a-5p in TNBC tissues and cell lines was initially detected using reverse transcription-quantitative polymerase chain reaction. To predict the target gene of miR-146a-5p, TargetScan software was used and a dual luciferase assay was performed to verify the prediction. Furthermore, in order to explore the role of miR-146a-5p in TNBC, miR-146a-5p was overexpressed in TNBC cells using miR-146a-5p mimics. An MTT assay was performed to detect cell proliferation, and a Transwell assay was conducted to determine cell migration and invasion. Furthermore, western blotting was performed to measure associated protein expression. It was revealed that miR-146a-5p was downregulated in TNBC tissues and cell lines. SOX5 was indicated to be a target gene of miR-146a-5p and was upregulated in TNBC cells. Additionally, miR-146a-5p could inhibit TNBC cell proliferation, migration and invasion, repress the expression of mesenchymal markers (N-cadherin, vimentin and fibronectin) and increase epithelial marker (E-cadherin) expression. Furthermore, SOX5 overexpression eliminated the effects of miR-146a-5p mimics on TNBC cells. In conclusion, the data of the present study indicated that miR-146a-5p inhibits the proliferation and metastasis of TNBC cells by regulating SOX5.

The microstructure and mechanical properties of Mg-3Al-3RE alloys

International Nuclear Information System (INIS)

Tian, X.; Wang, L.M.; Wang, J.L.; Liu, Y.B.; An, J.; Cao, Z.Y.

2008-01-01

The Mg-3Al-3RE alloys (RE, the cerium-rich or the yttrium-rich misch metal) were smelted in a resistance furnace under the protective flux from the Mg-RE master alloys and pure magnesium ingots. The microstructure and mechanical properties of samples prepared by steel mould casting method were investigated. Results show that the main phases of the alloys are α-Mg, Mg 17 Al 12 and Al-RE compounds, and the grain size reduced with the increasing content of the cerium-rich misch metal. Mg-3Al-2Ymm-1Cemm (Ymm, the yttrium-rich misch metal; Cemm, the Cerium-rich misch metal) exhibited the highest mechanical properties, that is UTS = 201 MPa and YS = 75 MPa, and ε = 8.2% at room temperature; UTS = 146 MPa, and YS = 70 MPa, ε = 18.2% at the temperature of 150 deg. C, respectively. Fracture surface analysis revealed that the Mg-3Al-2Ymm-1Cemm alloy has a mixed fracture feature at room temperature but ductile fracture at elevated temperature (150 deg. C)

Study of cyclic oxidation for stainless steels AISI 309 T 253 M A, with low additions of cerium; Estudio de la oxidacion ciclica de los aceros inoxidables AISI 309 T 253 MA, con pequenas adiciones de Cerio

Energy Technology Data Exchange (ETDEWEB)

Velazquez F, G.L.; Martinez, M.; Ruiz, A. [Universidad Nacional Experimental Politecnica (UNEXPO) - Vicerrectorado de Puerto Ordaz, Centro de Estudios de Corrosion. Puerto Ordaz. venezuela (Venezuela)

1998-12-31

It has been detected that the addition of small amounts (<1%) of the so called `reactive elements` such as Cerium to Fe-Cr alloys that was utilized in oxidating environment at high temperatures improving its resistance to oxidation under isothermal and cyclic conditions. In this work, it was evaluated the behavior under cyclic oxidation conditions for an austenitic stainless steel at chromium-nickel (253MA) with cerium addition, and comparing it with the AISI 310S austenitic stainless steel. The cyclic oxidation essays consist of five cycles by 24 hours each one, following of a cooling in air until ambient temperature from the temperatures of 850, 900 and 950 Centigrade, registering the gain mass of the specimen at end of each cycle. In order to this were prepared samples with dimensions of 20 mm. x 10 mm. x 1 mm. Later to the oxidation essays was evaluated the morphology of the corrosion products layer by scanning electron microscopy. The present phases were identified by X-ray diffraction and by chemical microanalysis by Dispersive energy (EDAX). The results obtained show that the steel with cerium addition, presents a higher adherence and resistance to the spalling noting that the cerium promotes the casting anchor of the oxides layer to matrix and by reducing the grain size of the layer improving its plasticity. Additionally the cerium promotes the preferential oxidation of the forming elements of protective layers like the chromium. (Author)

CDCP1 identifies a CD146 negative subset of marrow fibroblasts involved with cytokine production.

Directory of Open Access Journals (Sweden)

Mineo Iwata

Full Text Available In vitro expanded bone marrow stromal cells contain at least two populations of fibroblasts, a CD146/MCAM positive population, previously reported to be critical for establishing the stem cell niche and a CD146-negative population that expresses CUB domain-containing protein 1 (CDCP1/CD318. Immunohistochemistry of marrow biopsies shows that clusters of CDCP1+ cells are present in discrete areas distinct from areas of fibroblasts expressing CD146. Using a stromal cell line, HS5, which approximates primary CDCP1+ stromal cells, we show that binding of an activating antibody against CDCP1 results in tyrosine-phosphorylation of CDCP1, paralleled by phosphorylation of Src Family Kinases (SFKs Protein Kinase C delta (PKC-δ. When CDCP1 expression is knocked-down by siRNA, the expression and secretion of myelopoietic cytokines is increased. These data suggest CDCP1 expression can be used to identify a subset of marrow fibroblasts functionally distinct from CD146+ fibroblasts. Furthermore the CDCP1 protein may contribute to the defining function of these cells by regulating cytokine expression.

Synthesis and performance of cerium oxide as anode materials for lithium ion batteries by a chemical precipitation method

International Nuclear Information System (INIS)

Liu, Haowen; Le, Qi

2016-01-01

In this present work, chemical precipitation method was employed for preparing cerium oxide. XRD, SEM, TEM, TGA/DTA and BET were used to investigate the structure, shape and formation mechanism, respectively. No impurities were detected. It was found that alcohol had obvious effection on the growth of the final sample. The shape of the precursor was retained after calcined at 500 °C. This result led to the possibility of an easy scale up to a commercial process. EIS and charge–discharge tests were carried out by using the as-prepared CeO_2 as an anode material for lithium ion batteries. Specially, the initial discharge specific capacity of the rhombus CeO_2 was about 529 mAh g"−"1 and stabilized reversibly at about 374 mAh g"−"1 after 50 cycles. It showed a promising usage as anode materials in lithium ion battery. - Highlights: • Chemical precipitation method was employed for the synthesis of cerium oxide. • Alcohol has obvious effection on the growth of the final sample. • The rhombus CeO_2 showed the better electrochemical properties as anode of lithium ion batteries.

Synthesis and performance of cerium oxide as anode materials for lithium ion batteries by a chemical precipitation method

Energy Technology Data Exchange (ETDEWEB)

Liu, Haowen, E-mail: liuhwchem@hotmail.com; Le, Qi

2016-06-05

In this present work, chemical precipitation method was employed for preparing cerium oxide. XRD, SEM, TEM, TGA/DTA and BET were used to investigate the structure, shape and formation mechanism, respectively. No impurities were detected. It was found that alcohol had obvious effection on the growth of the final sample. The shape of the precursor was retained after calcined at 500 °C. This result led to the possibility of an easy scale up to a commercial process. EIS and charge–discharge tests were carried out by using the as-prepared CeO{sub 2} as an anode material for lithium ion batteries. Specially, the initial discharge specific capacity of the rhombus CeO{sub 2} was about 529 mAh g{sup −1} and stabilized reversibly at about 374 mAh g{sup −1} after 50 cycles. It showed a promising usage as anode materials in lithium ion battery. - Highlights: • Chemical precipitation method was employed for the synthesis of cerium oxide. • Alcohol has obvious effection on the growth of the final sample. • The rhombus CeO{sub 2} showed the better electrochemical properties as anode of lithium ion batteries.

Cyclic stretch induced miR-146a upregulation delays C2C12 myogenic differentiation through inhibition of Numb

International Nuclear Information System (INIS)

Kuang Wei; Tan Jiali; Duan Yinzhong; Duan Jianmin; Wang Weijian; Jin Fang; Jin Zuolin; Yuan Xiao; Liu Yanpu

2009-01-01

Proliferation and differentiation of muscle stem cells must be tightly regulated by intrinsic and extrinsic signals for effective regeneration and adaptive response. MicroRNAs have been implicated as potent regulators in diverse biological processes at the level of posttranscriptional repression. In this study, we found that miR-146a was significantly upregulated upon a 48-h cyclic stretch of 5% elongation/10cycles/min. Importantly, miR-146 was predicted to base-pair with sequences in the 3' UTR of Numb, which promotes satellite cell differentiation towards muscle cells by inhibiting Notch signaling. Through reporter assay and exogenous expression experiment, we confirmed Numb was inhibited by miR-146a. Inhibition of miR-146a by antago-miR-146a rescued the expression of Numb and facilitated the differentiation of C2C12 at a cost of compromised proliferation. Thus, for the first time, we propose a role of miR-146a in skewing the balance of muscle differentiation and proliferation through inhibiting the expression of Numb.

Evaluation of self-healing ability in protective coatings modified with combinations of layered double hydroxides and cerium molibdate nanocontainers filled with corrosion inhibitors

International Nuclear Information System (INIS)

Montemor, M.F.; Snihirova, D.V.; Taryba, M.G.; Lamaka, S.V.; Kartsonakis, I.A.; Balaskas, A.C.; Kordas, G.C.; Tedim, J.; Kuznetsova, A.; Zheludkevich, M.L.; Ferreira, M.G.S.

2012-01-01

Nowadays, there is a strong demand on the search of thinner, but more effective organic coatings for corrosion protection of metallic substrates, like galvanised steel, used in the automotive industry. In order to guarantee effective corrosion protection of these coatings, and because chromate-based pigments cannot be used, one of the most attractive strategies consists on the modification of the organic matrix with nano-additives filled with corrosion inhibitors, which can be released to the active sites. In this work, two different nano-additives are explored as potential self-healing materials for the development of active protective coatings. These additives are layered double hydroxides and cerium molybdate hollow nanospheres loaded with mercaptobenzothiazole, as a corrosion inhibitor. These additives were added to epoxy primers, individually, or combining the two nanoadditives in the same layer. The electrochemical behaviour and the potential of self-healing ability were studied by electrochemical impedance spectroscopy, scanning vibrating electrode technique and scanning ion-selective electrode technique. The results reveal that both types of nanocontainers can provide effective corrosion inhibition on artificial induced defects, at different stages of the degradation process. Moreover, the results also show that there is a synergistic effect concerning corrosion inhibition and self-healing potential when a mixture of the two nanocontainers is used. The mechanism of self healing is presented and discussed in terms of effect of organic inhibitor and role of the nanocontainers, including effect of cerium ions released from cerium molibdate nanoparticles.

Cerium(IV) Tellurite Halides [Ce ₂ Te ₇ O ₁₇ ]X ₂ (X = Cl ^– or Br ^– ): The First Cerium-Containing Cationic Frameworks

Energy Technology Data Exchange (ETDEWEB)

Lin, Jian [Department of Civil; amp, Environmental Engineering & amp, Earth Sciences and Department of Chemistry and Biochemistry, University of Notre Dame, 156 Fitzpatrick Hall, Notre; Diwu, Juan [Department of Civil; amp, Environmental Engineering & amp, Earth Sciences and Department of Chemistry and Biochemistry, University of Notre Dame, 156 Fitzpatrick Hall, Notre; Cross, Justin N. [Department of Civil; amp, Environmental Engineering & amp, Earth Sciences and Department of Chemistry and Biochemistry, University of Notre Dame, 156 Fitzpatrick Hall, Notre; Villa, Eric M. [Department of Civil; amp, Environmental Engineering & amp, Earth Sciences and Department of Chemistry and Biochemistry, University of Notre Dame, 156 Fitzpatrick Hall, Notre; Albrecht-Schmitt, Thomas E. [Department of Chemistry

2012-09-13

Two isotypic cerium tellurite halides with the formulas [Ce2Te7O17]Cl2 and [Ce2Te7O17]Br2 have been synthesized hydrothermally via the reactions of CeCl3 and CeBr3 with TeO2. The structures of these compounds feature a cationic inorganic framework. The CeIV dimers are bound by a novel 3D Te7O176– building unit, forming an unusual hexagonal-bipyramidal environment around CeIV.

Redox-active cerium oxide nanoparticles protect human dermal fibroblasts from PQ-induced damage

Directory of Open Access Journals (Sweden)

Claudia von Montfort

2015-04-01

Full Text Available Recently, it has been published that cerium (Ce oxide nanoparticles (CNP; nanoceria are able to downregulate tumor invasion in cancer cell lines. Redox-active CNP exhibit both selective pro-oxidative and antioxidative properties, the first being responsible for impairment of tumor growth and invasion. A non-toxic and even protective effect of CNP in human dermal fibroblasts (HDF has already been observed. However, the effect on important parameters such as cell death, proliferation and redox state of the cells needs further clarification. Here, we present that nanoceria prevent HDF from reactive oxygen species (ROS-induced cell death and stimulate proliferation due to the antioxidative property of these particles.

Boric Acid as an Accelerator of Cerium Surface Treatment on Aluminum

Directory of Open Access Journals (Sweden)

K. Cruz-Hernández

2014-01-01

Full Text Available Aluminum pieces are often used in various industrial processes like automotive and aerospace manufacturing, as well as in ornamental applications, so it is necessary to develop processes to protect these materials, processes that can be industrialized to protect the aluminum as well or better than chromate treatments. The purpose of this research is to evaluate boric acid as an accelerator by optimizing its concentration in cerium conversion coatings (CeCC with 10-minute immersion time with a concentration of 0.1 g L−1 over aluminum to protect it. The evaluation will be carried out by measuring anticorrosion properties with electrochemical techniques (polarization resistance, Rp, polarization curves, PC, and electrochemical impedance spectroscopy, EIS in NaCl 3.5% wt. aqueous solution and surface characterization with scanning electron microscopy (SEM.

Fabrication of Al5083 surface composites reinforced by CNTs and cerium oxide nano particles via friction stir processing

Energy Technology Data Exchange (ETDEWEB)

Hosseini, S.A. [Department of Materials Science and Engineering, Faculty of Engineering, Shahid Chamran University of Ahvaz (Iran, Islamic Republic of); Ranjbar, Khalil, E-mail: k_ranjbar@scu.ac.ir [Department of Materials Science and Engineering, Faculty of Engineering, Shahid Chamran University of Ahvaz (Iran, Islamic Republic of); Dehmolaei, R. [Department of Materials Science and Engineering, Faculty of Engineering, Shahid Chamran University of Ahvaz (Iran, Islamic Republic of); Amirani, A.R. [12th Ghaem Street, Bld. Hashemzadeh, Shahrak Golestan, Tehran (Iran, Islamic Republic of)

2015-02-15

Highlights: • Using friction stir processing, an effect of CNTs and CeO{sub 2} reinforcements on mechanical and corrosion properties of Al5083 alloy is reported. • The strength of Al5083 was increased by 42%, its matrix grain size reduced five times, and hardness was doubled by the incorporation of CNTs-CeO{sub 2} mixture in the volume ratio of 75-25 respectively. • Unlike the CNTs, incorporation of nanosized CeO{sub 2} particles resulted in remarkable increase in pitting resistance of the alloy. - Abstract: In the present investigation, friction stir processing (FSP) was utilized to incorporate Multi Walled Carbon Nano Tubes (MWCNT) and nanosized cerium oxide particles into the matrix of Al5083 alloy to form surface reinforced composites. The effect of these nanosized reinforcements either separately or in the combined form, on microstructural modification, mechanical properties and corrosion resistance of FSPed Al5083 surface composites was studied. A threaded cylindrical hardened steel tool was used with the rotation speeds of 600 and 800 rpm and travel speeds of 35 and 45 mm/min and a tilt angle of 5°. Mechanical properties and corrosion resistance of FSPed samples were evaluated and compared with the base alloy. The maximum tensile strength and hardness value were achieved for the hybrid composite containing a mixture of CNTs and cerium oxide in the volume ratio of 75-25, respectively, whereas a significant increase in pitting resistance of the base alloy was obtained when cerium oxide alone was incorporated. The corrosion behavior of the samples was investigated by potentiodynamic polarization tests and assessed in term of pitting potential and passivation range. Microstructural analysis carried out by using optical and electron microscopes showed that reinforcements are well dispersed inside the nugget zone (NZ), and remarkable grain refinement is gained. The study was aimed to fabricate surface composites with improved mechanical properties and

22 CFR 146.110 - Remedial and affirmative action and self-evaluation.

Science.gov (United States)

2010-04-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.110 Remedial and affirmative action and self-evaluation. (a) Remedial action. If the...

Simple preparation of fluorescent composite films based on cerium and europium doped LaF3 nanoparticles

Science.gov (United States)

Secco, Henrique de L.; Ferreira, Fabio F.; Péres, Laura O.

2018-03-01

The combination of materials to form hybrids with unique properties, different from those of the isolated components, is a strategy used to prepare functional materials with improved properties aiming to allow their application in specific fields. The doping of lanthanum fluoride with other rare earth elements is used to obtain luminescent particles, which may be useful to the manufacturing of electronic devices' displays and biological markers, for instance. The application of the powder of nanoparticles has limitations in some fields; to overcome this, the powder may be incorporated in a suitable polymeric matrix. In this work, lanthanum fluoride nanoparticles, undoped and doped with cerium and europium, were synthesized through the co-precipitation method in aqueous solution. Aiming the formation of solid state films, composites of nanoparticles in an elastomeric matrix, the nitrile rubber (NBR), were prepared. The flexibility and the transparency of the matrix in the regions of interest are advantages for the application of the luminescent composites. The composites were applied as films using the casting and the spin coating techniques and luminescent materials were obtained in the samples doped with europium and cerium. Scanning electron microscopy images showed an adequate dispersion of the particles in the matrix in both film formation techniques. Aggregates of the particles were detected in the samples which may affect the uniformity of the emission of the composites.

Lanthanum and cerium co-modified Ni/SiO2 catalyst for CO methanation from syngas

Science.gov (United States)

Gong, Dandan; Li, Shuangshuang; Guo, Shaoxia; Tang, Honggui; Wang, Hong; Liu, Yuan

2018-03-01

Sintering of active metal nanoparticles (NPs) and carbon deposition is critical problems for many metal catalysts, such as nickel based catalysts for generating methane from syngas. To improve the resistance to the sintering and carbon deposition, a new scheme was proposed in this work. Lanthanum and cerium co-modified Ni/SiO2 catalysts were synthesized by using perovskite type oxide of La1-xCexNiO3 loaded on SiO2 as the precursor. In a nanocrystallite of La1-xCexNiO3, ions of nickel, lanthanum and cerium are evenly mixed at atomic level and confined in the nanocrystallite, therefore, Ni NPs and the two promoters of La2O3 and CeO2 should be in close contact and highly dispersed on SiO2 after reduction. The catalysts were characterized by using XRD, TEM, BET, H2-TPD, XPS, TG and Raman techniques. Compared with the mono-promoted catalysts, the bi-promoted La0.75Ce0.25NiO3/SiO2 showed much better resistance to carbon deposition, higher resistance to sintering and higher activity for CO methanation, which are attributed to co-eliminating effect of the two promoters for the deposited carbon, confinement of the interacted two promoters for Ni NPs and the higher dispersion of Ni NPs derived from the smaller size of La0.75Ce0.25NiO3.

9 CFR 146.23 - Terminology and classification; flocks and products.

Science.gov (United States)

2010-01-01

... layers through routine serological surveillance of each participating commercial table-egg layer flock. A... SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT NATIONAL POULTRY IMPROVEMENT PLAN FOR COMMERCIAL POULTRY Special Provisions for Commercial Table-Egg Layer Flocks § 146.23 Terminology and classification...

Study of gels of molybdenum with cerium in the preparation of generators of {sup 99}Mo-{sup 99m}Tc

Energy Technology Data Exchange (ETDEWEB)

Moraes, Vanessa; Marczewski, Barbara; Dias, Carla Roberta; Osso Junior, Joao Alberto [Instituto de Pesquisas Energeticas e Nucleares (IPEN-CNEN/SP), SP (Brazil). Centro de Radiofarmacia

2005-10-15

{sup 99m} Tc has ideal nuclear properties for organ imaging in nuclear medicine, and it is obtained from the {sup 99}Mo-{sup 99m} Tc generator. Four different types of generators are available: chromatographic that uses {sup 99}Mo from fission of uranium; MEK solvent extraction; Tc{sub 2}O{sub 7} sublimation; gel chromatographic. This work presents the preparation of gel generators of molybdenum with cerium and characterization of the gels: mass ratio between molybdenum and cerium, structure, size of particles and elution percentage of {sup 99m} Tc after irradiating the gels. Eight gels were prepared at the same temperature of 50 deg C with concentrations of NaOH of 2 and 4 mol/L, mass ratio of 0.31 and 0.38 and final pH of 3.5 and 4.5. The analysis of the results proved that these gels are not adequate for preparation of the generators of {sup 99}Mo-{sup 99m} Tc, since the elution percentages are low, when compared with the gel of molybdenum with zirconium.(author)