WorldWideScience

Sample records for cerium 136

  1. Reaction chemistry of cerium

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  2. Reaction chemistry of cerium

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  3. Probing the cerium/cerium hydride interface using nanoindentation

    Energy Technology Data Exchange (ETDEWEB)

    Brierley, Martin, E-mail: martin.brierley@awe.co.uk [Atomic Weapons Establishment, Aldermaston, Berkshire RG7 4PR (United Kingdom); University of Manchester, Manchester M13 9PL (United Kingdom); Knowles, John, E-mail: john.knowles@awe.co.uk [Atomic Weapons Establishment, Aldermaston, Berkshire RG7 4PR (United Kingdom)

    2015-10-05

    Highlights: • A disparity exists between the minimum energy and actual shape of a cerium hydride. • Cerium hydride is found to be harder than cerium metal by a ratio of 1.7:1. • A zone of material under compressive stress was identified surrounding the hydride. • No distribution of hardness was apparent within the hydride. - Abstract: A cerium hydride site was sectioned and the mechanical properties of the exposed phases (cerium metal, cerium hydride, oxidised cerium hydride) were measured using nanoindentation. An interfacial region under compressive stress was observed in the cerium metal surrounding a surface hydride that formed as a consequence of strain energy generated by the volume expansion associated with precipitation of the hydride phase.

  4. Purification of cerium, neodymium and gadolinium for low background experiments

    Directory of Open Access Journals (Sweden)

    Boiko R.S.

    2014-01-01

    Full Text Available Cerium, neodymium and gadolinium contain double beta active isotopes. The most interesting are 150Nd and 160Gd (promising for 0ν2β search, 136Ce (2β+ candidate with one of the highest Q2β. The main problem of compounds containing lanthanide elements is their high radioactive contamination by uranium, radium, actinium and thorium. The new generation 2β experiments require development of methods for a deep purification of lanthanides from the radioactive elements. A combination of physical and chemical methods was applied to purify cerium, neodymium and gadolinium. Liquid-liquid extraction technique was used to remove traces of Th and U from neodymium, gadolinium and for purification of cerium from Th, U, Ra and K. Co-precipitation and recrystallization methods were utilized for further reduction of the impurities. The radioactive contamination of the samples before and after the purification was tested by using ultra-low-background HPGe gamma spectrometry. As a result of the purification procedure the radioactive contamination of gadolinium oxide (a similar purification efficiency was reached also with cerium and neodymium oxides was decreased from 0.12 Bq/kg to 0.007 Bq/kg in 228Th, from 0.04 Bq/kg to <0.006 Bq/kg in 226Ra, and from 0.9 Bq/kg to 0.04 Bq/kg in 40K. The purification methods are much less efficient for chemically very similar radioactive elements like actinium, lanthanum and lutetium.

  5. Search for double beta decay of $^{136}$Ce and $^{138}$Ce with HPGe gamma detector

    CERN Document Server

    Belli, P; Boiko, R S; Cappella, F; Cerulli, R; Danevich, F A; Incicchitti, A; Kropivyansky, B N; Laubenstein, M; Poda, D V; Polischuk, O G; Tretyak, V I

    2014-01-01

    Search for double $\\beta$ decay of $^{136}$Ce and $^{138}$Ce was realized with 732 g of deeply purified cerium oxide sample measured over 1900 h with the help of an ultra-low background HPGe $\\gamma$ detector with a volume of 465 cm$^3$ at the STELLA facility of the Gran Sasso National Laboratories of the INFN (Italy). New improved half-life limits on double beta processes in the cerium isotopes were set at the level of $\\lim T_{1/2}\\sim 10^{17}-10^{18}$~yr; many of them are even two orders of magnitude larger than the best previous results.

  6. Mechanochemical synthesis of cerium orthophosphate

    Institute of Scientific and Technical Information of China (English)

    A.Matraszek; I.Szczygiei; L.Macalik; J.Hanuza

    2009-01-01

    A facile,simple and rapid preparation method of cerium orthophosphate was presented.The synthesis of low-crystalline CePO4 occurred upon mixing of cerium (Ⅲ) nitrate and sodium phosphate,and was an exchange-type reaction.The phase composition of the obtained powder was checked by the XRD and FTIR methods,indicating the presence of cerium phosphate.Further investigations on thermal behavior of the synthesized cerium salt had shown that the obtained onhophosphate crystallized at first in rhabdophane-type structure.It convetted to monazite (monoclinic symmetry) during heating at the temperatures of above 600 ℃.Oxidation of Ce3+ to Ce4+ was avoided during the syntheses,as confirmed by the XPS experiments.

  7. PLUTONIUM-CERIUM-COBALT AND PLUTONIUM-CERIUM-NICKEL ALLOYS

    Science.gov (United States)

    Coffinberry, A.S.

    1959-08-25

    >New plutonium-base teroary alloys useful as liquid reactor fuels are described. The alloys consist of 10 to 20 atomic percent cobalt with the remainder plutonium and cerium in any desired proportion, with the plutonium not in excess of 88 atomic percent; or, of from 10 to 25 atomic percent nickel (or mixture of nickel and cobalt) with the remainder plutonium and cerium in any desired proportion, with the plutonium not in excess of 86 atomic percent. The stated advantages of these alloys over unalloyed plutonium for reactor fuel use are a lower melting point and a wide range of permissible plutonium dilution.

  8. Dissolution properties of cerium dibutylphosphate corrosion inhibitors

    NARCIS (Netherlands)

    Soestbergen, M. van; Erich, S.J.F.; Huinink, H.P.; Adan, O.C.G.

    2013-01-01

    The corrosion inhibitor cerium dibutylphosphate, Ce(dbp)3, prevents corrosion by cerium and dbp deposition at the alkaline cathode and acidic anode respectively. The pH dependent Ce(dbp)3 solubility seems to play an essential role in the inhibition degree. We found that Ce(dbp) 3 scarcely dissolves

  9. Formulation and method for preparing gels comprising hydrous cerium oxide

    Science.gov (United States)

    Collins, Jack L; Chi, Anthony

    2013-05-07

    Formulations useful for preparing hydrous cerium oxide gels contain a metal salt including cerium, an organic base, and a complexing agent. Methods for preparing gels containing hydrous cerium oxide include heating a formulation to a temperature sufficient to induce gel formation, where the formulation contains a metal salt including cerium, an organic base, and a complexing agent.

  10. A cerium(IV)-carbon multiple bond

    Energy Technology Data Exchange (ETDEWEB)

    Gregson, Matthew; Lu, Erli; McMaster, Jonathan; Lewis, William; Blake, Alexander J.; Liddle, Stephen T. [Nottingham Univ. (United Kingdom). School of Chemistry

    2013-12-02

    Straightforward access to a cerium(IV)-carbene complex was provided by one-electron oxidation of an anionic ''ate'' cerium(III)-carbene precursor, thereby avoiding decomposition reactions that plague oxidations of neutral cerium(III) compounds. The cerium(IV)-carbene complex is the first lanthanide(IV)-element multiple bond and involves a twofold bonding interaction of two electron pairs between cerium and carbon. [German] Auf direktem Wege zu einem Cer(IV)-Carbenkomplex gelangt man durch die Einelektronenoxidation einer anionischen Carben-Cerat(III)-Vorstufe. So werden Zersetzungsprozesse vermieden, die die Oxidation neutraler Cer(III)-Verbindungen erschweren. Der Cer(IV)-Carbenkomplex enthaelt die erste Lanthanoid(IV)-Element-Mehrfachbindung; dabei binden Cer und Kohlenstoff ueber zwei Elektronenpaare.

  11. Cerium extraction by metallothermic reduction using cerium oxide powder injection

    Institute of Scientific and Technical Information of China (English)

    J.S. Luna A; A. Flores V; R. Mu(n)iz V; A.F. Fuentes; J. Torres; N. Rodríuez R; J.C. Ortiz; P.Orozco

    2011-01-01

    This work presented the feasibility of cerium recovery by Al-Mg alloy through the metallothermic reduction of CeO2 to obtain a master alloy Al-4%Ce. The master alloy obtained in this investigation was for the grain refinement and modification of Al-Si alloys. The reagent was incorporated into a molten alloy using the submerged powder injection technique, and metallic samples were obtained during injection. Chemical and microstructural analyses (by inductively coupled plasma (ICP) and scanning electron microscopy (SEM), respectively) confirmed the possibility of Ce uptake in the bath (0 to 4 wt.%), as CeO2 was reduced through metallothermic reactions in the molten alloys.Based on the characterization of reaction products, the sequence of the reaction was proposed.

  12. Some Environmentally Relevant Reactions of Cerium Oxide

    Directory of Open Access Journals (Sweden)

    Janoš Pavel

    2014-12-01

    Full Text Available Reactive forms of cerium oxide were prepared by a thermal decomposition of various precursors, namely carbonates, oxalates and citrates, commercially available nanocrystalline cerium oxide (nanoceria was involved in the study for comparison. Scanning electron microscopy (SEM and x-ray diffraction analysis (XRD were used to examine the morphology and crystallinity of the samples, respectively, whereas the Brunauer-Emmett-Teller (BET method of nitrogen adsorption was used to determine surface areas. Interactions of cerium oxide with some phosphorus-containing compounds were investigated. Some of the examined samples, especially those prepared by annealing from carbonate precursors, exhibited an outstanding ability to destroy highly toxic organophosphates, such as pesticides (parathion methyl, or nerve agents (soman, VX. There were identified some relations between the degradation efficiency of cerium oxides and their crystallinity. It was also shown that cerium oxide is able to destroy one of widely used flame retardants - triphenyl phosphate. A phosphatase-mimetic activity of various cerium oxides was examined with the aid of a standardized phosphatase test.

  13. Pharmacological potential of cerium oxidenanoparticles

    Science.gov (United States)

    Celardo, Ivana; Pedersen, Jens Z.; Traversa, Enrico; Ghibelli, Lina

    2011-04-01

    Nanotechnology promises a revolution in pharmacology to improve or create ex novo therapies. Cerium oxidenanoparticles (nanoceria), well-known as catalysts, possess an astonishing pharmacological potential due to their antioxidant properties, deriving from a fraction of Ce3+ ions present in CeO2. These defects, compensated by oxygen vacancies, are enriched at the surface and therefore in nanosized particles. Reactions involving redox cycles between the Ce3+ and Ce4+oxidation states allow nanoceria to react catalytically with superoxide and hydrogen peroxide, mimicking the behavior of two key antioxidant enzymes, superoxide dismutase and catalase, potentially abating all noxious intracellularreactive oxygen species (ROS) via a self-regenerating mechanism. Hence nanoceria, apparently well tolerated by the organism, might fight chronic inflammation and the pathologies associated with oxidative stress, which include cancer and neurodegeneration. Here we review the biological effects of nanoceria as they emerge from in vitro and in vivo studies, considering biocompatibility and the peculiar antioxidant mechanisms.

  14. Cerium anomaly at microscale in fossils.

    Science.gov (United States)

    Gueriau, Pierre; Mocuta, Cristian; Bertrand, Loïc

    2015-09-01

    Patterns in rare earth element (REE) concentrations are essential instruments to assess geochemical processes in Earth and environmental sciences. Excursions in the "cerium anomaly" are widely used to inform on past redox conditions in sediments. This proxy resources to the specificity of cerium to adopt both the +III and +IV oxidation states, while most rare earths are purely trivalent and share very similar reactivity and transport properties. In practical terms, the level of cerium anomaly is established through elemental point quantification and profiling. All these models rely on a supposed homogeneity of the cerium oxidation state within the samples. However, this has never been demonstrated, whereas the cerium concentration can significantly vary within a sample, as shown for fossils, which would vastly complicate interpretation of REE patterns. Here, we report direct micrometric mapping of Ce speciation through synchrotron X-ray absorption spectroscopy and production of local rare earth patterns in paleontological fossil tissues through X-ray fluorescence mapping. The sensitivity of the approach is demonstrated on well-preserved fishes and crustaceans from the Late Cretaceous (ca. 95 million years (Myr) old). The presence of Ce under the +IV form within the fossil tissues is attributed to slightly oxidative local conditions of burial and agrees well with the limited negative cerium anomaly observed in REE patterns. The [Ce(IV)]/[Ce(tot)] ratio appears remarkably stable at the microscale within each fossil and is similar between fossils from the locality. Speciation maps were obtained from an original combination of synchrotron microbeam X-ray fluorescence, absorption spectroscopy, and diffraction, together with light and electron microscopy. This work also highlights the need for more systematic studies of cerium geochemistry at the microscale in paleontological contexts, in particular across fossil histologies.

  15. 7 CFR 58.136 - Rejected milk.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Rejected milk. 58.136 Section 58.136 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards... Milk § 58.136 Rejected milk. A plant shall reject specific milk from a producer if the milk fails to...

  16. 42 CFR 433.136 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Definitions. 433.136 Section 433.136 Public Health... ASSISTANCE PROGRAMS STATE FISCAL ADMINISTRATION Third Party Liability § 433.136 Definitions. For purposes of... contracts); (2) Any profit or nonprofit prepaid plan offering either medical services or full or...

  17. 42 CFR 136a.57 - Confidentiality.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Confidentiality. 136a.57 Section 136a.57 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT... Service Facilities and Indian Health Service Programs § 136a.57 Confidentiality. Information which is...

  18. 42 CFR 136.57 - Confidentiality.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Confidentiality. 136.57 Section 136.57 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT... Service Facilities and Indian Health Service Programs § 136.57 Confidentiality. Information which is...

  19. 42 CFR 136.1 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Definitions. 136.1 Section 136.1 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH Purpose and Definitions § 136.1 Definitions. When used in...

  20. 42 CFR 136.3 - Administrative instructions.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Administrative instructions. 136.3 Section 136.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH Purpose and Definitions § 136.3...

  1. 42 CFR 136a.31 - Transition period.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Transition period. 136a.31 Section 136a.31 Public... OF HEALTH AND HUMAN SERVICES INDIAN HEALTH Transition Provisions § 136a.31 Transition period. (a) The transition period for full implementation of the new eligibility regulations consists of three parts; (1) A...

  2. 42 CFR 136a.33 - Grace period.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Grace period. 136a.33 Section 136a.33 Public Health... HEALTH AND HUMAN SERVICES INDIAN HEALTH Transition Provisions § 136a.33 Grace period. (a) Upon the... of the new eligibility regulations) shall retain their eligibility for a six month grace period...

  3. 33 CFR 136.209 - Proof.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Proof. 136.209 Section 136.209 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.209 Proof. In addition to...

  4. 33 CFR 136.5 - Definitions

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Definitions 136.5 Section 136.5 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT General § 136.5 Definitions (a) As used in this part, the following terms...

  5. 33 CFR 136.3 - Information.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Information. 136.3 Section 136.3 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT General § 136.3 Information. Anyone desiring to file a claim against the...

  6. 33 CFR 136.225 - Authorized claimants.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Authorized claimants. 136.225 Section 136.225 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.225...

  7. 33 CFR 136.213 - Authorized claimants.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Authorized claimants. 136.213 Section 136.213 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.213...

  8. 33 CFR 136.237 - Authorized claimants.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Authorized claimants. 136.237 Section 136.237 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.237...

  9. 33 CFR 136.201 - Authorized claimants.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Authorized claimants. 136.201 Section 136.201 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.201...

  10. 33 CFR 136.221 - Proof.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Proof. 136.221 Section 136.221 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.221 Proof. In addition to...

  11. 33 CFR 136.211 - Compensation allowable.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Compensation allowable. 136.211 Section 136.211 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.211...

  12. 33 CFR 136.233 - Proof.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Proof. 136.233 Section 136.233 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.233 Proof. In addition to...

  13. 33 CFR 136.7 - Foreign claimants.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Foreign claimants. 136.7 Section 136.7 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE...; DESIGNATION OF SOURCE; AND ADVERTISEMENT General § 136.7 Foreign claimants. In addition to other...

  14. 33 CFR 136.205 - Compensation allowable.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Compensation allowable. 136.205 Section 136.205 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.205...

  15. 33 CFR 136.107 - Subrogated claims.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Subrogated claims. 136.107 Section 136.107 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT General Procedure § 136.107 Subrogated claims. (a)...

  16. 33 CFR 136.207 - Authorized claimants.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Authorized claimants. 136.207 Section 136.207 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.207...

  17. 33 CFR 136.111 - Insurance.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Insurance. 136.111 Section 136.111 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE...; DESIGNATION OF SOURCE; AND ADVERTISEMENT General Procedure § 136.111 Insurance. (a) A claimant shall...

  18. 33 CFR 136.241 - Compensation allowable.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Compensation allowable. 136.241 Section 136.241 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.241...

  19. 33 CFR 136.219 - Authorized claimants.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Authorized claimants. 136.219 Section 136.219 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.219...

  20. 33 CFR 136.223 - Compensation allowable.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Compensation allowable. 136.223 Section 136.223 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.223...

  1. 33 CFR 136.203 - Proof.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Proof. 136.203 Section 136.203 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.203 Proof. In addition to...

  2. 33 CFR 136.217 - Compensation allowable.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Compensation allowable. 136.217 Section 136.217 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.217...

  3. 33 CFR 136.227 - Proof.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Proof. 136.227 Section 136.227 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.227 Proof. In addition to...

  4. 33 CFR 136.235 - Compensation allowable.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Compensation allowable. 136.235 Section 136.235 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.235...

  5. 33 CFR 136.231 - Authorized claimants.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Authorized claimants. 136.231 Section 136.231 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.231...

  6. 33 CFR 136.215 - Proof.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Proof. 136.215 Section 136.215 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.215 Proof. (a) In addition to...

  7. 33 CFR 136.239 - Proof.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Proof. 136.239 Section 136.239 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.239 Proof. In addition to...

  8. 33 CFR 136.229 - Compensation allowable.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Compensation allowable. 136.229 Section 136.229 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.229...

  9. 33 CFR 136.113 - Other compensation.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Other compensation. 136.113 Section 136.113 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT General Procedure § 136.113 Other compensation....

  10. Nanocrystalline cerium oxide materials for solid fuel cell systems

    Science.gov (United States)

    Brinkman, Kyle S

    2015-05-05

    Disclosed are solid fuel cells, including solid oxide fuel cells and PEM fuel cells that include nanocrystalline cerium oxide materials as a component of the fuel cells. A solid oxide fuel cell can include nanocrystalline cerium oxide as a cathode component and microcrystalline cerium oxide as an electrolyte component, which can prevent mechanical failure and interdiffusion common in other fuel cells. A solid oxide fuel cell can also include nanocrystalline cerium oxide in the anode. A PEM fuel cell can include cerium oxide as a catalyst support in the cathode and optionally also in the anode.

  11. Search for double beta decay of {sup 136}Ce and {sup 138}Ce with HPGe gamma detector

    Energy Technology Data Exchange (ETDEWEB)

    Belli, P. [INFN sezione Roma “Tor Vergata”, I-00133 Rome (Italy); Bernabei, R., E-mail: rita.bernabei@roma2.infn.it [INFN sezione Roma “Tor Vergata”, I-00133 Rome (Italy); Dipartimento di Fisica, Università di Roma “Tor Vergata”, I-00133 Rome (Italy); Boiko, R.S. [Institute for Nuclear Research, MSP 03680 Kyiv (Ukraine); Cappella, F. [INFN sezione Roma, I-00185 Rome (Italy); Dipartimento di Fisica, Università di Roma “La Sapienza”, I-00185 Rome (Italy); Cerulli, R. [INFN, Laboratori Nazionali del Gran Sasso, I-67010 Assergi (AQ) (Italy); Danevich, F.A. [Institute for Nuclear Research, MSP 03680 Kyiv (Ukraine); Incicchitti, A. [INFN sezione Roma, I-00185 Rome (Italy); Dipartimento di Fisica, Università di Roma “La Sapienza”, I-00185 Rome (Italy); Kropivyansky, B.N. [Institute for Nuclear Research, MSP 03680 Kyiv (Ukraine); Laubenstein, M. [INFN, Laboratori Nazionali del Gran Sasso, I-67010 Assergi (AQ) (Italy); Poda, D.V. [Institute for Nuclear Research, MSP 03680 Kyiv (Ukraine); Polischuk, O.G.; Tretyak, V.I. [Institute for Nuclear Research, MSP 03680 Kyiv (Ukraine); INFN sezione Roma, I-00185 Rome (Italy)

    2014-10-15

    Search for double β decay of {sup 136}Ce and {sup 138}Ce was realized with 732 g of deeply purified cerium oxide sample measured over 1900 h with the help of an ultra-low background HPGe γ detector with a volume of 465 cm{sup 3} at the STELLA facility of the Gran Sasso National Laboratories of the INFN (Italy). New improved half-life limits on double beta processes in the cerium isotopes were set at the level of lim⁡T{sub 1/2}∼10{sup 17}–10{sup 18} yr; many of them are even two orders of magnitude larger than the best previous results.

  12. CHEMICAL BEHAVIOR OF CERIUM ELEMENT IN ROCK WEATHERING SYSTEM

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    A study on existing valence state and chemical behavior of cerium element in two categories of rock weathering system in China has been carried out. In the granitoid weathering crust of Southern China,cerium as tetravalent hydroxide absorbed on clay minerals occupies 62.58 % of total amount of cerium and the cerium partitioning in the phase is 69.58 %. The depositing cerium stops its mobility downward, resulting in rare earth partitioning variation, the light rare earth partitioning is high at upper layer of weathering crust, the heavy rare earth partitioning is high at bottom layer of weathering crust, and the extracted product exists cerium lose effect. For Mn2+ as reducing agent existing in black weathering earth of Maoniuping rare earth ore,cerium is trivalent and absorbed on Mn-Fe oxide as colloid phase sediment. Colloid sediment phase can be divided into Mn-Fe combined phase and hydroxide sediment phase with cerium contents of 19.77% and 48.30%, and their cerium partitionings are 80.72% and 37.38% respectively. The Mn-Fe combined phase can selectively absorb cerium.

  13. Uptake and accumulation of bulk and nanosized cerium oxide particles and ionic cerium by radish (Raphanus sativus L.).

    Science.gov (United States)

    Zhang, Weilan; Ebbs, Stephen D; Musante, Craig; White, Jason C; Gao, Cunmei; Ma, Xingmao

    2015-01-21

    The potential toxicity and accumulation of engineered nanomaterials (ENMs) in agricultural crops has become an area of great concern and intense investigation. Interestingly, although below-ground vegetables are most likely to accumulate the highest concentrations of ENMs, little work has been done investigating the potential uptake and accumulation of ENMs for this plant group. The overall objective of this study was to evaluate how different forms of cerium (bulk cerium oxide, cerium oxide nanoparticles, and the cerium ion) affected the growth of radish (Raphanus sativus L.) and accumulation of cerium in radish tissues. Ionic cerium (Ce(3+)) had a negative effect on radish growth at 10 mg CeCl3/L, whereas bulk cerium oxide (CeO2) enhanced plant biomass at the same concentration. Treatment with 10 mg/L cerium oxide nanoparticles (CeO2 NPs) had no significant effect on radish growth. Exposure to all forms of cerium resulted in the accumulation of this element in radish tissues, including the edible storage root. However, the accumulation patterns and their effect on plant growth and physiological processes varied with the characteristics of cerium. This study provides a critical frame of reference on the effects of CeO2 NPs versus their bulk and ionic counterparts on radish growth.

  14. 33 CFR 136.309 - Advertisement determinations.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Advertisement determinations. 136... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Designation of Source and Advertisement § 136.309 Advertisement determinations. (a) The Director, NPFC, determines for each incident the type, geographic...

  15. 42 CFR 136a.11 - Services available.

    Science.gov (United States)

    2010-10-01

    ..., public health nursing and preventive care including immunizations, and health examination of special... same health services in each area served. The services provided to any particular Indian community will... 42 Public Health 1 2010-10-01 2010-10-01 false Services available. 136a.11 Section 136a.11...

  16. 42 CFR 136.11 - Services available.

    Science.gov (United States)

    2010-10-01

    ..., public health nursing and preventive care (including immunizations), and health examination of special... same health services in each area served. The services provided to any particular Indian community will... 42 Public Health 1 2010-10-01 2010-10-01 false Services available. 136.11 Section 136.11...

  17. 10 CFR 600.136 - Intangible property.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Intangible property. 600.136 Section 600.136 Energy DEPARTMENT OF ENERGY (CONTINUED) ASSISTANCE REGULATIONS FINANCIAL ASSISTANCE RULES Uniform Administrative... in a peer-reviewed scientific or technical journal; or (B) A Federal agency publicly and...

  18. 42 CFR 136.110 - Facilities construction.

    Science.gov (United States)

    2010-10-01

    ... in the procurement standards for HHS grantees made applicable by subpart P of 45 CFR part 74. (4... 42 Public Health 1 2010-10-01 2010-10-01 false Facilities construction. 136.110 Section 136.110..., DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH Grants for Development, Construction, and Operation...

  19. Synthesis of Cerium-Doped Titania Nanoparticles and Nanotubes.

    Science.gov (United States)

    Cao, Wei; Suzuki, Takuya; Elsayed-Ali, Hani E; Abdel-Fattah, Tarek M

    2015-03-01

    Cerium-doped titania nanoparticles and nanotubes were synthesized via hydrothermal processes. X-Ray Diffraction revealed that cerium-doped titania nanoparticles have an anatase crystal structure, while cerium-doped titania nanotubes have an H2Ti3O7-type structure. Scanning electron microscopy and high resolution transmission electron microscopy showed that both types of titania are well crystallized with relatively uniform size distribution. The photocatalytic degradation of methylthioninium chloride known as methylene blue dye was tested and both cerium-doped titania nanoparticles and nanotubes. The preliminary photocatalytic degradation of Methylene Blue data showed significantly improved visible light photocatalytic activities as compared to commercial titania powders.

  20. Dicty_cDB: SLA136 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA136 (Link to dictyBase) - - - Contig-U12124-1 SLA136P (Link to Original site) SLA...136F 626 SLA136Z 389 SLA136P 1015 - - Show SLA136 Library SL (Link to library) Clone ID SLA...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLA1-B/SLA136Q.Seq.d/ Representative seq. ID SLA...136P (Link to Original site) Representative DNA sequence >SLA136 (SLA136Q) /CSM/SL/SLA1-B/SLA...ATTAAGTTGGTGTAAGACTTAAAAAAATTAAAGATATAACATTTAATTT TTACA sequence update 1999. 1.12 Translated Amino Acid seq

  1. Cerium and jojoba in engines?; Cerium et jojoba dans les moteurs?

    Energy Technology Data Exchange (ETDEWEB)

    Massy-Delhotel, E.

    1996-10-01

    The Belgium company CreaTel proposes a new system, called Forac, which can lead to a 10% reduction of fuel consumption in thermal engines together with a quasi-complete reduction of CO, HC, NOx pollutants and CO{sub 2} particulates emission. The system comprises a steam production device and an admission pipe with a cerium alloy whorl inside. The steam produced is mixed with the admission air and tears cerium particles from the inside of the admission pipe to the combustion chamber. The cerium particles act as a catalyst which favours the complete combustion of the fuel. The same company proposes also lubricant additives made from liquid jojoba wax which allow the reduction of pollutant emissions, fuel consumption and noise emissions of diesel engines. (J.S.)

  2. Thermodynamics of congruently subliming cerium-antimony

    Energy Technology Data Exchange (ETDEWEB)

    Schiffman, R.A.; Franzen, H.F.

    1982-01-01

    Congruently vaporizing cerium-antimony has been investigated by vapor pressure measurementa using a simultaneous weight-loss mass-spectrometric Knudsen effusion technique. The melting point of the 1:1 stoichiometry was determined to be 2179 +/- 10 K. The heat of formation at 298 K of CeSb was found to be -128.9 kJ/g-at from thermodynamic measurements in the temperature range 1985-2172 K.

  3. Environmental Geochemistry of Cerium: Applications and Toxicology of Cerium Oxide Nanoparticles

    OpenAIRE

    2015-01-01

    Cerium is the most abundant of rare-earth metals found in the Earth’s crust. Several Ce-carbonate, -phosphate, -silicate, and -(hydr)oxide minerals have been historically mined and processed for pharmaceutical uses and industrial applications. Of all Ce minerals, cerium dioxide has received much attention in the global nanotechnology market due to their useful applications for catalysts, fuel cells, and fuel additives. A recent mass flow modeling study predicted that a major source of CeO2 na...

  4. Lifetime measurement in {sup 136}Pm

    Energy Technology Data Exchange (ETDEWEB)

    Toney, D.; Zhong, Q.; De Angelis, G. [Istituto Nazionale di Fisica Nucleare laboratori Nazionali di Legnaro, Legnaro (Italy)] (and others)

    2005-07-01

    The aim of the present work is to investigate the electromagnetic transition probabilities in the doublet bands of {sup 136}Pm. These two bands have been observed up to I{pi} = (21{sup +}). Contrary to the case of {sup 134}Pr, the B(M1)/B(E2) ratios take similar values within the error bars in {sup 136}Pm. This is a strong indication that there is considerable difference between the two nuclei. However, a lifetime measurement in {sup 136}Pm is needed to shed light on the scale and the origin of the difference.

  5. Formation and characterization of cerium conversion coatings on magnesium alloy

    Institute of Scientific and Technical Information of China (English)

    LI Lingjie; LEI Jinglei; YU Shenghai; TIAN Yujing; JIANG Qiquan; PAN Fusheng

    2008-01-01

    Chemical conversion treatment by rare earth metal salt solution was considered as an alternative to chromium chemical conversion treatment to improve the corrosion resistance of magnesium alloys. In this study, cerium conversion coatings formed on AZ31 magnesium alloy were characterized and the formation mechanism was discussed. X-ray photoelectron spectroscopy (XPS) analysis showed that cerium conversion coating consisted of cerium hydroxides/oxides, in which both tetravalent cerium Ce(IV) and trivalent cerium Ce(III) species co-existed. Cerium conversion coating was a two-layer structure. Atomic force microscopy (AFM) images revealed that the morphology of the inside layer was different from that of the outside one, which was responsible for the inherent adhesive weakness of the coating. Corrosion potential (Ecorr) measurements indicated that poor adhesion limited the improvement of the corrosion resistance of the coating. During the treating process, the increased pH value of the cerium salt solution led to the precipitation of cerium hydroxides/oxides. The formation kinetics of the coating followed a parabolic curve.

  6. Structural, optical, morphological and dielectric properties of cerium oxide nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Prabaharan, Devadoss Mangalam Durai Manoharadoss [Department of Physics, NPR College of Engineering and Technology, Natham, Dindigul, Tamil Nadu (India); Sadaiyandi, Karuppasamy [Department of Physics, Alagappa Government Arts College, Karaikudi, Sivaganga, Tamil Nadu (India); Mahendran, Manickam [Department of Physics, Thiagarajar College of Engineering, Madurai, Tamil Nadu (India); Sagadevan, Suresh, E-mail: duraiphysics2011@gmail.com [Department of Physics, AMET University (India)

    2016-03-15

    Cerium oxide (CeO{sub 2}) nanoparticles were prepared by the precipitation method. The average crystallite size of cerium oxide nanoparticles was calculated from the X-ray diffraction (XRD) pattern and found to be 11 nm. The FT-IR spectrum clearly indicated the strong presence of cerium oxide nanoparticles. Raman spectrum confirmed the cubic nature of the cerium oxide nanoparticles. The Scanning Electron Microscopy (SEM) analysis showed that the nanoparticles agglomerated forming spherical-shaped particles. The Transmission Electron Microscopic (TEM) analysis confirmed the prepared cerium oxide nanoparticles with the particle size being found to be 16 nm. The optical absorption spectrum showed a blue shift by the cerium oxide nanoparticles due to the quantum confinement effect. The dielectric properties of cerium oxide nanoparticles were studied for different frequencies at different temperatures. The dielectric constant and the dielectric loss of the cerium oxide nanoparticles decreased with increase in frequency. The AC electrical conductivity study revealed that the conduction depended on both the frequency and the temperature. (author)

  7. Study of the cerium(IV)-picrate system in acetonitrile.

    Science.gov (United States)

    Kratochvil, B; Tipler, M; McKay, B

    1966-07-01

    A potentiometric and spectrophotometric study has been made of the reaction between hexanitratocerate and picrate in dry acetonitrile. Several cerium(IV)-picrate complexes are formed; the formation constant for the first is estimated to be 4 from spectrophotometric measurements. The catalytic effect of picrate on hydroquinone oxidation by nitratocerate is postulated to be due to more rapid electron transfer by cerium picrate complexes.

  8. 14 CFR 136.7 - Passenger briefings.

    Science.gov (United States)

    2010-01-01

    ... AND OPERATORS FOR COMPENSATION OR HIRE: CERTIFICATION AND OPERATIONS COMMERCIAL AIR TOURS AND NATIONAL PARKS AIR TOUR MANAGEMENT National Air Tour Safety Standards § 136.7 Passenger briefings. (a)...

  9. Ultrathin, epitaxial cerium dioxide on silicon

    Science.gov (United States)

    Flege, Jan Ingo; Kaemena, Björn; Höcker, Jan; Bertram, Florian; Wollschläger, Joachim; Schmidt, Thomas; Falta, Jens

    2014-03-01

    It is shown that ultrathin, highly ordered, continuous films of cerium dioxide may be prepared on silicon following substrate prepassivation using an atomic layer of chlorine. The as-deposited, few-nanometer-thin Ce2O3 film may very effectively be converted at room temperature to almost fully oxidized CeO2 by simple exposure to air, as demonstrated by hard X-ray photoemission spectroscopy and X-ray diffraction. This post-oxidation process essentially results in a negligible loss in film crystallinity and interface abruptness.

  10. Cerium-tannic acid passivation treatment on galvamzed steel

    Institute of Scientific and Technical Information of China (English)

    LIU Guangming; YU Fei; YANG Liu; TIAN Jihong; DU Nan

    2009-01-01

    A novel cerium-tannic acid passivation treatment was performed on galvanized steel. The corrosion resistance of cerium-tannic passivated samples was tested by dropping test with 0.5 wt.% CuSO4 aqueous solution. The mass loss per unit area of passivated samples was measured after the corrosion in 0.5 mol/L NaCl + 0.005 mol/L H2SO4 at room temperature for 96 h. The electrochemical behaviors of cerium, tannic acid, and cerium-tannic acid passivated samples on galvanized steel in 0.5 mol/L NaCI solution were investigated by polarization curves and electrochemical impendence spectra. The corrosion equivalent circuit was established according to the impedance characteristics. The results show that cerium-tannic acid treated samples exhibit better corrosion resistance than the sole cerium or tannic acid treated samples under the same condition. The mechanism of synergistic effect for cerium-tannic acid passivation on galvanized steel was discussed.

  11. Dicty_cDB: SSI136 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSI136 (Link to dictyBase) - G02311 DDB0185376 Contig-U13856-1 SSI...136P (Link to Original site) SSI136F 618 SSI136Z 496 SSI136P 1114 - - Show SSI136 Library SS (Link to library) Clone ID SSI...Contig-U13856-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSI1-B/SSI...136Q.Seq.d/ Representative seq. ID SSI136P (Link to Original site) Representative DNA sequence >SSI136 (SSI136Q) /CSM/SS/SSI...1-B/SSI136Q.Seq.d/ TGTAAAAAAAACAAAGAATGAAGACTCTTTCTTTATTATTTATTGTTATTTCTTTAATCT CCTTAAT

  12. Photodissociation of Cerium Oxide Nanocluster Cations.

    Science.gov (United States)

    Akin, S T; Ard, S G; Dye, B E; Schaefer, H F; Duncan, M A

    2016-04-21

    Cerium oxide cluster cations, CexOy(+), are produced via laser vaporization in a pulsed nozzle source and detected with time-of-flight mass spectrometry. The mass spectrum displays a strongly preferred oxide stoichiometry for each cluster with a specific number of metal atoms x, with x ≤ y. Specifically, the most prominent clusters correspond to the formula CeO(CeO2)n(+). The cluster cations are mass selected and photodissociated with a Nd:YAG laser at either 532 or 355 nm. The prominent clusters dissociate to produce smaller species also having a similar CeO(CeO2)n(+) formula, always with apparent leaving groups of (CeO2). The production of CeO(CeO2)n(+) from the dissociation of many cluster sizes establishes the relative stability of these clusters. Furthermore, the consistent loss of neutral CeO2 shows that the smallest neutral clusters adopt the same oxidation state (IV) as the most common form of bulk cerium oxide. Clusters with higher oxygen content than the CeO(CeO2)n(+) masses are present with much lower abundance. These species dissociate by the loss of O2, leaving surviving clusters with the CeO(CeO2)n(+) formula. Density functional theory calculations on these clusters suggest structures composed of stable CeO(CeO2)n(+) cores with excess oxygen bound to the surface as a superoxide unit (O2(-)).

  13. Atomic Transition Probabilities for Neutral Cerium

    Science.gov (United States)

    Chisholm, John; Nitz, D.; Sobeck, J.; Den Hartog, E. A.; Wood, M. P.; Lawler, J. E.

    2010-01-01

    Among the rare earth species, the spectra of neutral cerium (Ce I) and singly ionized cerium (Ce II) are some of the most complex. Like other rare earth species, Ce has many lines in the visible which are suitable for elemental abundance studies. Recent work on Ce II transition probabilities [1] is now being augmented with similar work on Ce I for future studies using such lines from astrophysical sources. Radiative lifetimes from laser induced fluorescence measurements [2] on neutral Ce are being combined with emission branching fractions from spectra recorded using a Fourier transform spectrometer. A total of 14 high resolution spectra are being analyzed to determine branching fractions for 2500 to 3000 lines from 153 upper levels in neutral Ce. Representative data samples and progress to date will be presented. This work was supported by the National Science Foundation's REU program and the Department of Defense's ASSURE program through NSF Award AST-0453442 and NSF Grant CTS0613277. [1] J. E. Lawler, C. Sneden, J. J. Cowan, I. I. Ivans, and E. A. Den Hartog, Astrophys. J. Suppl. Ser. 182, 51-79 (2009). [2] E. A. Den Hartog, K. P. Buettner, and J. E. Lawler, J. Phys. B: Atomic, Molecular & Optical Physics 42, 085006 (7pp) (2009).

  14. Fire retardancy of emulsion polymerized poly (methyl methacrylate)/cerium(IV) dioxide and polystyrene/cerium(IV) dioxide nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Guipeng [Department of Chemistry and Fire Retardant Research Facility, Marquette University, PO Box 1881, Milwaukee, WI 53201 (United States); Lu, Hongdian [Department of Chemical and Materials Engineering, Hefei University, Hefei, Anhui 230022 (China); Zhou, You; Hao, Jianwei [School of Material Science and Engineering, Beijing Institute of Technology, Beijing 100081 (China); Wilkie, Charles A., E-mail: charles.wilkie@marquette.edu [Department of Chemistry and Fire Retardant Research Facility, Marquette University, PO Box 1881, Milwaukee, WI 53201 (United States)

    2012-12-10

    Highlights: Black-Right-Pointing-Pointer We prepare PMMA and PS containing ceria. Black-Right-Pointing-Pointer Characterization by XRD and TEM shows that some of the ceria is well-dispersed in the polymers. Black-Right-Pointing-Pointer The addition of ceria to both polymers leads to reduced thermal stability. Black-Right-Pointing-Pointer In PMMA, the fire retardancy is enhanced but there is little effect in PS. - Abstract: In situ emulsion polymerization was employed to obtain poly (methyl methacrylate) (PMMA)/cerium(IV) dioxide and polystyrene (PS)/cerium(IV) dioxide nanocomposites at two different cerium(IV) dioxide loadings (2.3 wt% and 4.6 wt%). Transmission electron microscope results indicated uniform dispersion of cerium (IV) dioxide in the polymer matrix. Both PMMA and PS nanocomposites exhibit lower thermal stability than the pristine polymers. Microscale combustion calorimeter (MCC) and cone calorimetry are used to evaluate the fire retardancy of the polymer nanocomposites. PMMA/cerium(IV) dioxide showed significant heat release rate (HRR) reduction at low loadings (<5 wt%), while PS/cerium(IV) dioxide exhibits less HRR reduction at the same loadings. An explanation of the role of cerium (IV) dioxide in fire retardancy of polymer/ceria nanocomposites based on XPS results is suggested.

  15. 7 CFR 1150.136 - Vacancies.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order National Dairy Promotion and Research Board § 1150.136 Vacancies. To fill any vacancy...

  16. Pension kasvab vaid 136 krooni? / Olev Raju

    Index Scriptorium Estoniae

    Raju, Olev, 1948-

    2005-01-01

    Tartu Ülikooli majandusprofessori sõnul näitavad kõik arvud, et valitsus kavandabki vaid 136-kroonist pensionitõusu, kuigi peaminister Juhan Palts lubas mullu Riigikogule riigieelarvekava üle andes 250-kroonist pensionitõusu

  17. 42 CFR 136.403 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... HEALTH AND HUMAN SERVICES INDIAN HEALTH Indian Child Protection and Family Violence Prevention § 136.403... use of physical force or other abuse of a person and includes, but is not limited to, homicide... pleaded guilty or nolo contendere shall be controlling. Crimes of violence means a crime that has as...

  18. 33 CFR 136.301 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT Designation of Source and Advertisement § 136.301 Purpose. This subpart... discharge and advertisement of these designations, including the procedures by which claims may be...

  19. 33 CFR 136.303 - Definitions.

    Science.gov (United States)

    2010-07-01

    ....303 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE...; DESIGNATION OF SOURCE; AND ADVERTISEMENT Designation of Source and Advertisement § 136.303 Definitions. As used in this subpart— Advertisement means the dissemination of information, including but not...

  20. Reference: 136 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 136 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u15548601i Woodward Andrew...r PEX7 is necessary for peroxisome function and dependent on PEX5. 2 573-83 15548601 2005 Feb Molecular biology of the cell Bartel Bonnie|Woodward Andrew W

  1. Improvement in corrosion resistance of magnesium coating with cerium treatment

    Institute of Scientific and Technical Information of China (English)

    Samia Ben Hassen; Latifa Bousselmi; Patricc Bercot; El Mustafa Rezrazi; Ezzeddine Triki

    2009-01-01

    Corrosion protection afforded by a magnesium coating treated in cerium salt solution on steel substrate was investigated using open circuit potential, polarization curves, and electrochemical impedance spectroscopy (EIS) in 0.005 M sodium chloride solution (NaCl). The morphology of the surface was characterized by scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), and X-ray diffraction (XRD). The cerium treated coating was obtained by immersion in CeCl3 solution. The results showed that the corrosion resistance of the treated magnesium coating was improved. The corrosion potential of the treated coating was found to be nobler than that of the untreated magnesium coating and the corrosion current decreased significantly. Impedance results showed that the cerium treatment increased corrosion protection. The improvement of anti-corrosion properties was ataibuted to the formation of cerium oxides and hydroxides that gave to a physical barrier effect.

  2. Heteroaggregation of cerium oxide nanoparticles and nanoparticles of pyrolyzed biomass

    Science.gov (United States)

    Heteroaggregation with indigenous particles is an important process controlling the mobility of engineered nanomaterials in the environment. We studied heteroaggregation of cerium oxide nanoparticles (n-CeO2), which are widely used commercially, with nanoparticles of pyrogenic carbonaceous material ...

  3. Preparing Process of Cerium Acetate and Rare Earth Acetate

    Institute of Scientific and Technical Information of China (English)

    Qiao Jun; Ma Ying; Xu Yanhui; Zhang Jun; Chang Shu; Hao Xianku

    2004-01-01

    Preparing process was presented and the influences of concentration of acetic acid, reaction temperature, the ratio of cerium carbonate and acetic acid, heat preservation time to the yield of cerium acetate were discussed.The crystalline cerium acetate and rare earth acetate such as ( La, Ce, Pr, Nd) (Ac) 3, ( Ce, Pr, Nd) (Ac) 3, ( Pr, Nd, Er,Y) (Ac) 3 and yttrium acetate were prepared under this condition.The shape, structure and composition of the crystals were determined by the methods of SEM, TG-DTA, X-ray diffraction and chemical analysis.The optimum prepared conditions of cerium acetate were described.This prepared process has characteristics such as simple process route, low cost, high yield, good quality, no pollution to environment, etc.

  4. Cerium intermetallics CeTX. Review III

    Energy Technology Data Exchange (ETDEWEB)

    Poettgen, Rainer; Janka, Oliver [Muenster Univ. (Germany). Inst. fuer Anorganische und Analytische Chemie; Chevalier, Bernard [Bordeaux Univ., Pessac (France). Inst. de Chimie de la Matiere Condensee de Bordeaux

    2016-05-01

    The structure-property relationships of CeTX intermetallics with structures other than the ZrNiAl and TiNiSi type are systematically reviewed. These CeTX phases form with electron-poor and electron-rich transition metals (T) and X = Mg, Zn, Cd, Hg, Al, Ga, In, Tl, Si, Ge, Sn, Pb, P, As, Sb, and Bi. The review focusses on the crystal chemistry, the chemical bonding peculiarities, and the magnetic and transport properties. Furthermore {sup 119}Sn Moessbauer spectroscopic data, high-pressure studies, hydrogenation reactions and the formation of solid solutions are reviewed. This paper is the third of a series of four reviews on equiatomic intermetallic cerium compound [Part I: R. Poettgen, B. Chevalier, Z. Naturforsch. 2015, 70b, 289; Part II: R. Poettgen, B. Chevalier, Z. Naturforsch. 2015, 70b, 695].

  5. Exraction and separation of CERIUM(IV)/FLUORINE in fluoride-bearing cerium sulfate solution with fluoride coordination agent

    OpenAIRE

    Li, Y; J. G. He; X. X. Xue; Ru, H. Q.; X. W. Huang; Yang, H.

    2014-01-01

    In this paper the extraction and separation of cerium/fluorine in fluoride-bearing cerium sulfate solution with fluoride coordination agent has been studied. The UV-vis spectra suggest that Zr6+ and Al3+ can scrub the F- from [CeF2] 2+ complex. The separation and conductivity studies show that aluminum salt is the most suitable fluoride coordination agent, and an ion-exchange reaction is involved between Ce4+/ [CeF2] 2+ and hydrogen ion.

  6. Molecular and physiological responses to titanium dioxide and cerium oxide nanoparticles in arabidopsis

    Science.gov (United States)

    - Changes in tissue transcriptomes and productivity of Arabidopsis thaliana were investigated during exposure of plants to two widely-used engineered metal oxide nanoparticles, titanium dioxide (nano-titanium) and cerium dioxide (nano-cerium). Microarray analyses confirmed that e...

  7. Molecular and physiological responses to titanium dioxide and cerium oxide nanoparticles in arabidopsis

    Science.gov (United States)

    - Changes in tissue transcriptomes and productivity of Arabidopsis thaliana were investigated during exposure of plants to two widely-used engineered metal oxide nanoparticles, titanium dioxide (nano-titanium) and cerium dioxide (nano-cerium). Microarray analyses confirmed that e...

  8. Inhibition of pH fronts in corrosion cells due to the formation of cerium hydroxide

    NARCIS (Netherlands)

    Soestbergen, M. van; Erich, S.J.F.; Huinink, H.P.; Adan, O.C.G.

    2013-01-01

    The effect of cerium-based corrosion inhibitors on the pH front between the alkaline cathode and acidic anode in corrosion cells has been studied. The cerium component of these inhibitors can affect the pH front since it precipitates in an alkaline environment as cerium hydroxide, which is important

  9. 33 CFR 136.307 - Denial of designation.

    Science.gov (United States)

    2010-07-01

    ... Section 136.307 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Designation of Source and Advertisement § 136.307 Denial... Designation. Advertisement...

  10. Potential for recovery of cerium contained in automotive catalytic converters

    Science.gov (United States)

    Bleiwas, Donald I.

    2013-01-01

    Catalytic converters (CATCONs) are required by Federal law to be installed in nearly all gasoline- and diesel-fueled onroad vehicles used in the United States. About 85 percent of the light-duty vehicles and trucks manufactured worldwide are equipped with CATCONs. Portions of the CATCONs (called monoliths) are recycled for their platinum-group metal (PGM) content and for the value of the stainless steel they contain. The cerium contained in the monoliths, however, is disposed of along with the slag produced from the recycling process. Although there is some smelter capacity in the United States to treat the monoliths in order to recover the PGMs, a great percentage of monoliths is exported to Europe and South Africa for recycling, and a lesser amount is exported to Japan. There is presently no commercial-scale capacity in place domestically to recover cerium from the monoliths. Recycling of cerium or cerium compounds from the monoliths could help ensure against possible global supply shortages by increasing the amount that is available in the supply chain as well as the number and geographic distribution of the suppliers. It could also reduce the amount of material that goes into landfills. Also, the additional supply could lower the price of the commodity. This report analyzes how much cerium oxide is contained in CATCONs and how much could be recovered from used CATCONs.

  11. Electrodeposited cerium film as chromate replacement for tinplate

    Energy Technology Data Exchange (ETDEWEB)

    Huang Xingqiao [Department of Applied Chemistry, Harbin Institute of Technology, Harbin 150001 (China); Li Ning [Department of Applied Chemistry, Harbin Institute of Technology, Harbin 150001 (China)], E-mail: lining@hit.edu.cn; Wang Huiyong; Sun Hanxiao; Sun Shanshan; Zheng Jian [Department of Applied Chemistry, Harbin Institute of Technology, Harbin 150001 (China)

    2008-01-30

    The cerium film was prepared on tinplate by electrodeposition method. Sulfide-stain resistance of the Ce-passivated, unpassivated and Cr-passivated tinplates was evaluated using a cysteine tarnish test. Corrosion behavior of these tinplates in contact with 3.5% NaCl solution and 0.1 M citric-citrate buffer solution was investigated using Tafel measurement and electrochemical impedance spectroscopy measurement, respectively. The adhesion of epoxyphenolic lacquer to the Ce-passivated tinplate was checked using a cross hatch cutter. The morphology, composition and thickness of the cerium film were studied by atomic force microscopy, X-ray photoelectron spectroscopy and X-ray fluorescence spectrometry. According to the results, the Ce-passivated tinplate shows the best sulfide-stain resistance and the best corrosion protection property compared with the unpassivated and Cr-passivated tinplates. The adhesion of epoxyphenolic lacquer to the Ce-passivated tinplate is good. The cerium film is composed of the closely packed particles of about 50-200 nm in diameter. The film mainly consists of cerium and oxygen, which mainly exist as CeO{sub 2}, Ce{sub 2}O{sub 3} and their hydrates such as Ce(OH){sub 4}, Ce(OH){sub 3}. The total cerium amount of the film is about 0.110 g/m{sup 2}.

  12. 5 CFR 838.136 - Administrative appeal rights.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Administrative appeal rights. 838.136 Section 838.136 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE... Applicable to All Court Orders § 838.136 Administrative appeal rights. (a) Issues concerning application...

  13. 21 CFR 136.130 - Milk bread, rolls, and buns.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Milk bread, rolls, and buns. 136.130 Section 136....130 Milk bread, rolls, and buns. (a) Each of the foods milk bread, milk rolls, and milk buns conforms... ingredients prescribed for bread, rolls or buns by § 136.110 except that: (1) The only moistening ingredient...

  14. 21 CFR 136.160 - Raisin bread, rolls, and buns.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Raisin bread, rolls, and buns. 136.160 Section 136....160 Raisin bread, rolls, and buns. (a) Each of the foods raisin bread, raisin rolls, and raisin buns... of ingredients prescribed for bread, rolls or buns by § 136.110, except that: (1) Not less than 50...

  15. 21 CFR 136.115 - Enriched bread, rolls, and buns.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Enriched bread, rolls, and buns. 136.115 Section... § 136.115 Enriched bread, rolls, and buns. (a) Each of the foods enriched bread, enriched rolls, and... label statement of ingredients prescribed for bread, rolls or buns by § 136.110, except that: (1) Each...

  16. 42 CFR 136a.15 - Health Service Delivery Areas.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Health Service Delivery Areas. 136a.15 Section 136a... Receive Care? § 136a.15 Health Service Delivery Areas. (a) The Indian Health Service will designate and... Federal Indian reservations and areas surrounding those reservations as Health Service Delivery Areas....

  17. 42 CFR 136.61 - Payor of last resort.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Payor of last resort. 136.61 Section 136.61 Public... OF HEALTH AND HUMAN SERVICES INDIAN HEALTH Residual Status § 136.61 Payor of last resort. (a) The Indian Health Service is the payor of last resort for persons defined as eligible for contract...

  18. 42 CFR 136a.61 - Payor of last resort.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Payor of last resort. 136a.61 Section 136a.61..., DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH Residual Status § 136a.61 Payor of last resort. (a) The Indian Health Service is the payor of last resort of persons defined as eligible for contract...

  19. 42 CFR 136.333 - Distribution of scholarships.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Distribution of scholarships. 136.333 Section 136... J-4-Indian Health Scholarship Program § 136.333 Distribution of scholarships. The Secretary, acting through the Service, shall determine the distribution of Indian Health Scholarships among the...

  20. 42 CFR 136.330 - Indian health scholarships.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Indian health scholarships. 136.330 Section 136.330... J-4-Indian Health Scholarship Program § 136.330 Indian health scholarships. Indian Health Scholarships will be awarded by the Secretary pursuant to 338A through 339G of the Public Health Service...

  1. 42 CFR 136.373 - Scholarship and tuition.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Scholarship and tuition. 136.373 Section 136.373... J-8-Health Professions Pregraduate Scholarship Program for Indians § 136.373 Scholarship and tuition. (a) Scholarship grant awards under this subdivision shall consist of: (1) A stipend of $400 per...

  2. 42 CFR 136.320 - Preparatory scholarship grants.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Preparatory scholarship grants. 136.320 Section 136... J-3-Health Professions Preparatory Scholarship Program for Indians § 136.320 Preparatory scholarship grants. Scholarship grants may be awarded under this subdivision and section 103 of the act for...

  3. 42 CFR 136.323 - Scholarship and tuition.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Scholarship and tuition. 136.323 Section 136.323... J-3-Health Professions Preparatory Scholarship Program for Indians § 136.323 Scholarship and tuition. (a) Scholarship grant awards under this subdivision shall consist of: (1) A stipend of $400 per...

  4. 42 CFR 136.2 - Purpose of the regulations.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Purpose of the regulations. 136.2 Section 136.2 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH Purpose and Definitions § 136.2 Purpose of...

  5. 33 CFR 136.105 - General requirements for a claim.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false General requirements for a claim. 136.105 Section 136.105 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT General Procedure § 136.105 General requirements for...

  6. 33 CFR 136.9 - Falsification of claims.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Falsification of claims. 136.9 Section 136.9 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT General § 136.9 Falsification of claims....

  7. 33 CFR 136.101 - Time limitations on claims.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Time limitations on claims. 136.101 Section 136.101 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT General Procedure § 136.101 Time limitations on...

  8. 45 CFR 96.136 - Independent peer review.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Independent peer review. 96.136 Section 96.136... Abuse Prevention and Treatment Block Grant § 96.136 Independent peer review. (a) The State shall for the fiscal year for which the grant is provided, provide for independent peer review to assess the...

  9. Environmental geochemistry of cerium: applications and toxicology of cerium oxide nanoparticles.

    Science.gov (United States)

    Dahle, Jessica T; Arai, Yuji

    2015-01-23

    Cerium is the most abundant of rare-earth metals found in the Earth's crust. Several Ce-carbonate, -phosphate, -silicate, and -(hydr)oxide minerals have been historically mined and processed for pharmaceutical uses and industrial applications. Of all Ce minerals, cerium dioxide has received much attention in the global nanotechnology market due to their useful applications for catalysts, fuel cells, and fuel additives. A recent mass flow modeling study predicted that a major source of CeO2 nanoparticles from industrial processing plants (e.g., electronics and optics manufactures) is likely to reach the terrestrial environment such as landfills and soils. The environmental fate of CeO2 nanoparticles is highly dependent on its physcochemical properties in low temperature geochemical environment. Though there are needs in improving the analytical method in detecting/quantifying CeO2 nanoparticles in different environmental media, it is clear that aquatic and terrestrial organisms have been exposed to CeO2 NPs, potentially yielding in negative impact on human and ecosystem health. Interestingly, there has been contradicting reports about the toxicological effects of CeO2 nanoparticles, acting as either an antioxidant or reactive oxygen species production-inducing agent). This poses a challenge in future regulations for the CeO2 nanoparticle application and the risk assessment in the environment.

  10. Environmental Geochemistry of Cerium: Applications and Toxicology of Cerium Oxide Nanoparticles

    Directory of Open Access Journals (Sweden)

    Jessica T. Dahle

    2015-01-01

    Full Text Available Cerium is the most abundant of rare-earth metals found in the Earth’s crust. Several Ce-carbonate, -phosphate, -silicate, and -(hydroxide minerals have been historically mined and processed for pharmaceutical uses and industrial applications. Of all Ce minerals, cerium dioxide has received much attention in the global nanotechnology market due to their useful applications for catalysts, fuel cells, and fuel additives. A recent mass flow modeling study predicted that a major source of CeO2 nanoparticles from industrial processing plants (e.g., electronics and optics manufactures is likely to reach the terrestrial environment such as landfills and soils. The environmental fate of CeO2 nanoparticles is highly dependent on its physcochemical properties in low temperature geochemical environment. Though there are needs in improving the analytical method in detecting/quantifying CeO2 nanoparticles in different environmental media, it is clear that aquatic and terrestrial organisms have been exposed to CeO2 NPs, potentially yielding in negative impact on human and ecosystem health. Interestingly, there has been contradicting reports about the toxicological effects of CeO2 nanoparticles, acting as either an antioxidant or reactive oxygen species production-inducing agent. This poses a challenge in future regulations for the CeO2 nanoparticle application and the risk assessment in the environment.

  11. Cerium, manganese and cerium/manganese ceramic monolithic catalysts. Study of VOCs and PM removal

    Institute of Scientific and Technical Information of China (English)

    COLMAN-LERNER Esteban; PELUSO Miguel Andrs; SAMBETH Jorge; THOMAS Horacio

    2016-01-01

    Ceramic supported cerium, manganese and cerium-manganese catalysts were prepared by direct impregnation of aqueous precursor, and characterized by scanning electron microscopy (SEM), X-ray diffraction (XRD), Brunauer-Emmett-Teller method (BET), temperature programmed reduction (H2-TPR), X-ray photoelectron spectroscopy (XPS) acidity measurements and electrical conductivity. The catalytic activity was evaluated for volatile organic compounds (VOC) (ethanol, methyl ethyl ketone and toluene) oxidation. Additionally, catalysts were tested in particulate matter (PM) combustion. The characterization results indicated that Ce was in the form of Ce4+ and Ce3+, and Mn existed in the form of Mn4+and Mn3+on the surface of the Mn/AC sample and in the form of Mn4+ in the Ce/Mn/AC monolith. VOC oxidation results revealed that the Ce/Mn/AC sample showed an excellent performance compared with ceramic supported CeO2 (Ce/AC) and MnOx (Mn/AC) samples. The PM combustion was also higher on Ce/Mn/AC monoliths. The enhanced catalytic activity was mainly attributed to the Ce and Mn interaction which enhanced the acidity, conductiv-ity and the reducibility of the oxides.

  12. Characterization of cerium fluoride nanocomposite scintillators

    Energy Technology Data Exchange (ETDEWEB)

    Stange, Sy [Los Alamos National Laboratory; Esch, Ernst I [Los Alamos National Laboratory; Brown, Leif O [Los Alamos National Laboratory; Couture, Aaron J [Los Alamos National Laboratory; Mckigney, Edward A [Los Alamos National Laboratory; Muenchausen, Ross E [Los Alamos National Laboratory; Del Sesto, Rico E [Los Alamos National Laboratory; Gilbertson, Robert D [Los Alamos National Laboratory; Mccleskey, T Mark [Los Alamos National Laboratory; Reifarth, Rene [Los Alamos National Laboratory

    2009-01-01

    Measurement of the neutron capture cross-sections of a number of short-lived isotopes would advance both pure and applied scientific research. These cross-sections are needed for calculation of criticality and waste production estimates for the Advanced Fuel Cycle Initiative, for analysis of data from nuclear weapons tests, and to improve understanding of nucleosynthesis. However, measurement of these cross-sections would require a detector with a faster signal decay time than those used in existing neutron capture experiments. Crystals of faster detector materials are not available in sufficient sizes and quantities to supply these large-scale experiments. Instead, we propose to use nanocomposite detectors, consisting of nanoscale particles of a scintillating material dispersed in a matrix material. We have successfully fabricated cerium fluoride (CeF{sub 3}) nanoparticles and dispersed them in a liquid matrix. We have characterized this scintillator and have measured its response to neutron capture. Results of the optical, structural, and radiation characterization will be presented.

  13. Cerium-iron-based magnetic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Chen; Pinkerton, Frederick E.; Herbst, Jan F.

    2017-01-17

    New magnetic materials containing cerium, iron, and small additions of a third element are disclosed. These materials comprise compounds Ce(Fe.sub.12-xM.sub.x) where x=1-4, having the ThMn.sub.12 tetragonal crystal structure (space group I4/mmm, #139). Compounds with M=B, Al, Si, P, S, Sc, Co, Ni, Zn, Ga, Ge, Zr, Nb, Hf, Ta, and W are identified theoretically, and one class of compounds based on M=Si has been synthesized. The Si cognates are characterized by large magnetic moments (4.pi.M.sub.s greater than 1.27 Tesla) and high Curie temperatures (264.ltoreq.T.sub.c.ltoreq.305.degree. C.). The Ce(Fe.sub.12-xM.sub.x) compound may contain one or more of Ti, V, Cr, and Mo in combination with an M element. Further enhancement in T.sub.c is obtained by nitriding the Ce compounds through heat treatment in N.sub.2 gas while retaining the ThMn.sub.12 tetragonal crystal structure; for example CeFe.sub.10Si.sub.2N.sub.1.29 has T.sub.c=426.degree. C.

  14. Cerium Dioxide Thin Films Using Spin Coating

    Directory of Open Access Journals (Sweden)

    D. Channei

    2013-01-01

    Full Text Available Cerium dioxide (CeO2 thin films with varying Ce concentrations (0.1 to 0.9 M, metal basis were deposited on soda-lime-silica glass substrates using spin coating. It was found that all films exhibited the cubic fluorite structure after annealing at 500°C for 5 h. The laser Raman microspectroscopy and GAXRD analyses revealed that increasing concentrations of Ce resulted in an increase in the degree of crystallinity. FIB and FESEM images confirmed the laser Raman and GAXRD analyses results owing to the predicted increase in film thickness with increasing Ce concentration. However, porosity and shrinkage (drying cracking of the films also increased significantly with increasing Ce concentrations. UV-VIS spectrophotometry data showed that the transmission of the films decreased with increasing Ce concentrations due to the increasing crack formation. Furthermore, a red shift was observed with increasing Ce concentrations, which resulted in a decrease in the optical indirect band gap.

  15. Mechanical and Thermophysical Properties of Cerium Monopnictides

    Science.gov (United States)

    Bhalla, Vyoma; Singh, Devraj; Jain, S. K.

    2016-03-01

    The ultrasonic attenuation due to phonon-phonon interaction, thermoelastic relaxation and dislocation damping mechanisms has been investigated in cerium monopnictides CeX (X: N, P, As, Sb and Bi) for longitudinal and shear waves along {third-order elastic constants of CeX have also been computed in the temperature range 0 K to 500 K using Coulomb and Born-Mayer potential upto second nearest neighbours. The computed values of these elastic constants have been applied to find out Young's moduli, bulk moduli, Breazeale's non-linearity parameters, Zener anisotropy, ultrasonic velocity, ultrasonic Grüneisen parameter, thermal relaxation time, acoustic coupling constants and ultrasonic attenuation. The fracture/toughness ratio is less than 1.75, which shows that the chosen materials are brittle in nature as found for other monopnictides. The drag coefficient acting on the motion of screw and edge dislocations due to shear and compressional phonon viscosities of the lattice have also been evaluated for both the longitudinal and shear waves. The thermoelastic loss and dislocation damping loss are negligible in comparison to loss due to Akhieser damping (phonon-phonon interaction). The obtained results for CeX are in qualitative agreement with other semi-metallic monopnictides.

  16. Elaboration and characterization of thin solid films containing cerium

    Science.gov (United States)

    Hamdi, S.; Guerfi, S.; Siab, R.

    2009-11-01

    Cerium oxide films are widely studied as a promising alternative to Cr(VI) based pre-treatments for the corrosion protection of different metals and alloys. Cathodic electrodeposition of Cerium containing thin films was realised on TA6V substrates from a Ce(NO3)3, 6H2O and mixed water-ethyl alcohol solutions at 0.01 M. Experimental conditions to obtain homogeneous and crack free thin films were determined. The deposited cerium quantity appears proportional to the quantity of electricity used, as indicated by the Faraday law. Subsequent thermal treatment lead to a CeO2 coating, expected to provide an increase of TA6V oxidation resistance at high temperatures. The deposits were characterized by differential scanning calorimetry (DSC), optical and scanning electron microscopies.

  17. Thermodynamic Calculation among Cerium, Oxygen, and Sulfur in Liquid Iron

    Science.gov (United States)

    Pan, Fei; Zhang, Jian; Chen, Hao-Long; Su, Yen-Hsun; Su, Yen-Hao; Hwang, Weng-Sing

    2016-10-01

    Thermodynamic calculation has been applied to predict the inclusion formation in molten SS400 steel. When the Cerium addition in liquid iron is 70 ppm and the initial Oxygen and Sulphur are both 110 ppm, the formation of oxides containing Cerium would experience the transformation from Ce2O3 to CeO2 and also the formation of sulfides containing Cerium would experience the transformation from CeS to Ce2S3 and then to Ce3S4. Below 2000 K the most thermodynamic stable matter is CeO2 and the less thermodynamic stable inclusion is CeS. Only when the amount of [O] is extremely low and the amount of [S] and [Ce] is relatively high, Ce2S3 has the possibility to form.

  18. Synthesis and characterization of magnesium doped cerium oxide for the fuel cell application

    Science.gov (United States)

    Kumar, Amit; Kumari, Monika; Kumar, Mintu; Kumar, Sacheen; Kumar, Dinesh

    2016-05-01

    Cerium oxide has attained much attentions in global nanotechnology market due to valuable application for catalytic, fuel additive, and widely as electrolyte in solid oxide fuel cell. Doped cerium oxide has large oxygen vacancies that allow for greater reactivity and faster ion transport. These properties make cerium oxide suitable material for SOFCs application. Cerium oxide electrolyte requires lower operation temperature which shows improvement in processing and the fabrication technique. In our work, we synthesized magnesium doped cerium oxide by the co-precipitation method. With the magnesium doping catalytic reactivity of CeO2 was increased. Synthesized nanoparticle were characterized by the XRD and UV absorption techniques.

  19. Isomorphic phase transformation in shocked Cerium using molecular dynamics

    OpenAIRE

    Germann T.C.; Chen S.-P.; Dupont V.

    2011-01-01

    Cerium (Ce) undergoes a significant (∼16%) volume collapse associated with an isomorphic fcc-fcc phase transformation when subject to compressive loading. We present here a new Embedded Atom Method (EAM) potential for Cerium that models two minima for the two fcc phases. We show results from its use in Molecular Dynamics (MD) simulations of Ce samples subjected to shocks with pressures ranging from 0.5 to 25 GPa. A split wave structure is observed, with an elastic precursor followed by a plas...

  20. The PL "violet shift" of cerium dioxide on silicon

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    CeO2 thin film was fabricated by dual ion beam epitaxial technique. The phenomenon of PL violet shift at room temperature was observed, and the distance of shift was about 65 nm. After the analysis of crystal structure and valence in the compound were carried out by XRD and XPS technique, it was concluded that the PL shift was related with valence of cerium ion in the oxides. When the valence of cerium ion varied from tetravalence to trivalence, the PL peak position would move from blue region to violet region and the phenomenon of "violet shift" was observed.

  1. Optical and electrical studies of cerium mixed oxides

    Science.gov (United States)

    Sherly, T. R.; Raveendran, R.

    2014-10-01

    The fast development in nanotechnology makes enthusiastic interest in developing nanomaterials having tailor made properties. Cerium mixed oxide materials have received great attention due to their UV absorption property, high reactivity, stability at high temperature, good electrical property etc and these materials find wide applications in solid oxide fuel cells, solar control films, cosmetics, display units, gas sensors etc. In this study cerium mixed oxide compounds were prepared by co-precipitation method. All the samples were doped with Zn (II) and Fe (II). Preliminary characterizations such as XRD, SEM / EDS, TEM were done. UV - Vis, Diffuse reflectance, PL, FT-IR, Raman and ac conductivity studies of the samples were performed.

  2. Cerium fluoride nanoparticles protect cells against oxidative stress.

    Science.gov (United States)

    Shcherbakov, Alexander B; Zholobak, Nadezhda M; Baranchikov, Alexander E; Ryabova, Anastasia V; Ivanov, Vladimir K

    2015-05-01

    A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF3:Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF3 nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Cerium dioxide with large particle size prepared by continuous precipitation

    Institute of Scientific and Technical Information of China (English)

    李梅; 王觅堂; 柳召刚; 胡艳宏; 吴锦绣

    2009-01-01

    Cerium dioxide(CeO2) has attracted much attention and has wide applications such as automotive exhaust catalysts,polishing materials for optical glasses and additives for advanced glasses,as well as cosmetic materials.The particle size and its distribution are key factors to the performance of the materials in the functional applications.However,control of particle size is still a challenge in materials synthesis.Therefore,continuous precipitation of cerium oxalate(precursor of ceria) was carried out at dif...

  4. Optical and electrical studies of cerium mixed oxides

    Energy Technology Data Exchange (ETDEWEB)

    Sherly, T. R., E-mail: trsherly@gmail.com [Post Graduate Department of Physics, Sanathana Dharma College, Alappuzha, Kerala (India); Raveendran, R. [Nanoscience Research Laboratory, Sree Narayana College, Kollam, Kerala 691001 (India)

    2014-10-15

    The fast development in nanotechnology makes enthusiastic interest in developing nanomaterials having tailor made properties. Cerium mixed oxide materials have received great attention due to their UV absorption property, high reactivity, stability at high temperature, good electrical property etc and these materials find wide applications in solid oxide fuel cells, solar control films, cosmetics, display units, gas sensors etc. In this study cerium mixed oxide compounds were prepared by co-precipitation method. All the samples were doped with Zn (II) and Fe (II). Preliminary characterizations such as XRD, SEM / EDS, TEM were done. UV - Vis, Diffuse reflectance, PL, FT-IR, Raman and ac conductivity studies of the samples were performed.

  5. Police liaison and section 136: comparison of two different approaches.

    Science.gov (United States)

    Jenkins, Oliver; Dye, Stephen; Obeng-Asare, Franklin; Nguyen, Nam; Wright, Nicola

    2017-04-01

    Aims and method Two police liaison and section 136 schemes were developed alongside police services at different sites within the same NHS trust. In one, a mental health nurse worked with frontline police attending incidents related to mental health. The other involved nurses providing advice from the police control room. Section 136 detentions were measured over two 6-month periods (6 months apart) before and after practice change. Data analysed included total numbers of section 136 assessments, outcomes following subsequent assessment, and relevant diagnostic and demographic factors. Association of any change in section 136 total numbers and proportion subsequently admitted was investigated in both sites. Results The model involving a nurse alongside frontline police showed significant reduction in section 136 numbers (38%, P section 136 detention but showed a non-significant (P = 0.16) decrease in subsequent admission. Clinical implications Mental health nurses working alongside frontline police officers can help improve section 136 numbers and outcomes.

  6. Exraction and separation of CERIUM(IV/FLUORINE in fluoride-bearing cerium sulfate solution with fluoride coordination agent

    Directory of Open Access Journals (Sweden)

    Y. Li

    2014-07-01

    Full Text Available In this paper the extraction and separation of cerium/fluorine in fluoride-bearing cerium sulfate solution with fluoride coordination agent has been studied. The UV-vis spectra suggest that Zr6+ and Al3+ can scrub the F- from [CeF2] 2+ complex. The separation and conductivity studies show that aluminum salt is the most suitable fluoride coordination agent, and an ion-exchange reaction is involved between Ce4+/ [CeF2] 2+ and hydrogen ion.

  7. 136Sn and three-body forces

    Indian Academy of Sciences (India)

    M Saha Sarkar; S Sarkar

    2015-09-01

    New experimental data on 2+ energies of 136,138Sn confirm the trend of lower 2+ excitation energies of even–even tin isotopes with > 82 compared to those with N < 82. However, none of the theoretical predictions using both realistic and empirical interactions can reproduce experimental data on excitation energies as well as the transition probabilities ((2; 6+ → 4+)) of these nuclei, simultaneously, apart from the ones whose matrix elements have been changed empirically to produce mixed seniority states by weakening the pairing. We have shown that the experimental result also shows good agreement with the theory in which three-body forces have been included in a realistic interaction. The new theoretical results on transition probabilities are discussed to identify the experimental quantities which will clearly distinguish between different views.

  8. Determination of Impurity Elements in Pure Cerium Oxide Product

    Institute of Scientific and Technical Information of China (English)

    Li Peizhong; Chen Limin; Li Jie

    2004-01-01

    Determination of the rare earth impurity in pure cerium oxide is done by ICP-MS.The interference and other factors which affect analytical results were discussed.The accuracy are between 0.81% ~ 11.98% and the recoveries of standard addition are 96% ~ 112.5%.This method can meet the demand for product inspection.

  9. Processing and Characterization of Sol-Gel Cerium Oxide Microspheres

    Energy Technology Data Exchange (ETDEWEB)

    McClure, Zachary D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Padilla Cintron, Cristina [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2016-09-27

    Of interest to space exploration and power generation, Radioisotope Thermoelectric Generators (RTGs) can provide long-term power to remote electronic systems without the need for refueling or replacement. Plutonium-238 (Pu-238) remains one of the more promising materials for thermoelectric power generation due to its high power density, long half-life, and low gamma emissions. Traditional methods for processing Pu-238 include ball milling irregular precipitated powders before pressing and sintering into a dense pellet. The resulting submicron particulates of Pu-238 quickly accumulate and contaminate glove boxes. An alternative and dust-free method for Pu-238 processing is internal gelation via sol-gel techniques. Sol-gel methodology creates monodisperse and uniform microspheres that can be packed and pressed into a pellet. For this study cerium oxide microspheres were produced as a surrogate to Pu-238. The similar electronic orbitals between cerium and plutonium make cerium an ideal choice for non-radioactive work. Before the microspheres can be sintered and pressed they must be washed to remove the processing oil and any unreacted substituents. An investigation was performed on the washing step to find an appropriate wash solution that reduced waste and flammable risk. Cerium oxide microspheres were processed, washed, and characterized to determine the effectiveness of the new wash solution.

  10. Cerium; crystal structure and position in the periodic table.

    Science.gov (United States)

    Johansson, Börje; Luo, Wei; Li, Sa; Ahuja, Rajeev

    2014-09-17

    The properties of the cerium metal have intrigued physicists and chemists for many decades. In particular a lot of attention has been directed towards its high pressure behavior, where an isostructural volume collapse (γ phase → α phase) has been observed. Two main models of the electronic aspect of this transformation have been proposed; one where the 4f electron undergoes a change from being localized into an itinerant metallic state, and one where the focus is on the interaction between the 4f electron and the conduction electrons, often referred to as the Kondo volume collapse model. However, over the years it has been repeatedly questioned whether the cerium collapse really is isostructural. Most recently, detailed experiments have been able to remove this worrisome uncertainty. Therefore the isostructural aspect of the α-γ transition has now to be seriously addressed in the theoretical modeling, something which has been very much neglected. A study of this fundamental characteristic of the cerium volume collapse is made in present paper and we show that the localized [rlhar2 ] delocalized 4f electron picture provides an adequate description of this unique behavior. This agreement makes it possible to suggest that an appropriate crossroad position for cerium in The Periodic Table.

  11. Electrorheological Effects of Cerium-Doped TiO2

    Institute of Scientific and Technical Information of China (English)

    尹剑波; 赵晓鹏

    2001-01-01

    It is found that the doping of cerium ion into anatase TiO2 can improve the electrorheological (ER) effects of TiO2 and broaden the operational temperature range. Especially, the substitution of 7-11 mol% of the cerium dopant for Ti can obtain a relatively high shear stress, t-7.4kPa (at 4kV/mm), which is ten times larger than that of pure TiO2 ER fluid. Also, the typical Ce-doped TiO2 ER fluid shows the highest shear stress at 80℃, but 40℃ for pure TiO2 ER fluid. The dielectric loss and dielectric constant at a low frequency of TiO2 is improved by the doping of cerium, and the temperature dependence of the dielectric properties shows an obvious differnce between pure and doped TiO2 ER fluids. These can well explain the ER behaviour of doped TiO2. Furthermore, the change of rheological and dielectric properties is discussed on the basis of the lattice distortion and defects in TiO2 arising from the doping of cerium.

  12. Structural, optical and photocatalytic activity of cerium doped zinc aluminate

    Science.gov (United States)

    Sumathi, Shanmugam; Kavipriya, A.

    2017-03-01

    Zinc aluminate and cerium-doped zinc aluminate nanoparticles are synthesised by co-precipitation method. Ammonium hydroxide is used as a precipitating agent. The synthesised compounds are characterised by powder X-ray diffraction (XRD), Fourier transform Infrared spectroscopy (FT-IR), Ultraviolet diffuse reflectance spectroscopy (UV-DRS), Thermogravimetric analysis (TGA), Scanning electron microscopy (SEM) and Surface area measurements. The photocatalytic activity of zinc aluminate and cerium doped zinc aluminate nanoparticles are studied under the UV light and visible light taking methylene blue as a model pollutant. The amount of catalyst, concentration of dye solution and time are optimised under UV-light. Degradation of methylene blue under the UV-light is found to be 99% in 20 min with 10 mg of cerium doped catalyst. Compared to visible light degradation, the degradation of dye under UV-light is higher. Cerium doping in zinc aluminate (ZnAl2O4:Ce3+) increased the photocatalytic activity of zinc aluminate.

  13. Progress on Radiative Transition Probabilities in Neutral Cerium

    Science.gov (United States)

    Curry, J. J.

    2009-10-01

    Cerium is a rare-earth atom that is currently used in energy-efficient metal-halide lamps because of its rich visible emission spectrum. More than 20,000 lines have been observed and classified for neutral cerium in the wavelength range of 340 nm to 1 μm (Bill Martin, unpublished). We recently derived more than 500 absolute transition probabilities from existing experimental data (J. Phys. D: Appl. Phys. 2009). Lawler and Den Hartog at the University of Wisconsin have made measurements that are expected to produce a few thousand transition probabilities. These advances, however, leave the data situation far short of what is needed to simulate an accurate global emission spectrum in numerical models of metal-halide lamps containing cerium. One possibility for closing this gap is through atomic structure calculations. Although it may be difficult for calculations to match the accuracy of measurements for any given transition, the global spectral distribution produced with calculated transition probabilities may still be satisfactory. For such a large number of lines, calculations may be the only realistic way to produce a reasonably complete set of data. We will discuss our recent atomic structure calculations of neutral cerium with the Cowan code based on a parametric fit of calculated energy level values to experimental values.

  14. Preparation, Characterization and Antibacterial Property of Cerium Substituted Hydroxyapatite Nanoparticles

    Institute of Scientific and Technical Information of China (English)

    Lin Yingguang; Yang Zhuoru; Cheng Jiang

    2007-01-01

    Nanoparticles of hydroxyapatite (HAP) and cerium substituted hydroxyapatite (CeHAP) with the atomic ratio of Ce/[Ca+Ce] (xCe) from 0 to 0.2 were prepared by sol-gel-supercritical fluid drying (SCFD) method. The nanoparticles were characterized by TEM, XRD, and FT-IR, and the effects of cerium on crystal structure, crystallinity, and particle shape were discussed. With the tests of bacterial inhibition zone and antibacterial ratio, the antibacterial property of HAP and CeHAP nanoparticles on Escherichia coli, Staphylococcus aureus, Lactobacillus were researched. Results showed that the nanoparticles of HAP and CeHAP could be made by sol-gel-SCFD, cerium could partially substitute for calcium and enter the structure of HAP. After substitution, the crystallinity, the IR wavenumbers of bonds in CeHAP decreased gradually with increase of cerium substitution, and the morphology of the nanoparticles changed from the short rod-shaped HAP to the needle-shaped CeHAP. The nanoparticles of HAP and CeHAP with xCe below 0.08 had antibacterial property only forcibly contacting with the test bacteria at the test concentration of 0.1 g·ml-1, however, the CeHAP nanoparticles had antibacterial ability at that concentration no matter statically or dynamically contacting with the test bacteria when xCe was above 0.08, and the antibacterial ability gets better with the increase of xCe, indicating that the antibacterial property was improved after calcium was partially substituted by cerium. The improved antibacterial effects of CeHAP nanoparticle on Lactobacillus showed its potential ability to anticaries.

  15. Surface Morphology and Phase Stability of Titanium Foils Irradiated by 136 MeV 136Xe

    CERN Document Server

    Sadi, S; Loveland, W; Watson, P R; Greene, J P; Zhu, S; Zinkann, G

    2013-01-01

    A stack of titanium foils was irradiated with 136 MeV 136Xe to study microstructure damage and phase stability of titanium upon irradiation. X- ray diffraction, scanning electron microscopy/energy dispersive spectroscopy and atomic force microscopy were used to study the resulting microstructure damage and phase stability of titanium. We observed the phase transfor- mation of polycrystalline titanium from alpha-Ti (hexagonally closed packed (hcp)) to face centered cubic (fcc) after irradiation with 2.2 x 1015 ions/cm2. Irradiation of Ti with 1.8 x 1014-2.2 x 1015 ions/cm2 resulted in the forma- tion of voids, hillocks, dislocation loops, dislocation lines, as well as polygonal ridge networks.

  16. Solubility of cerium in LaCoO3-influence on catalytic activity.

    Science.gov (United States)

    French, S A; Catlow, C R A; Oldman, R J; Rogers, S C; Axon, S A

    2002-11-21

    The recent interest in the catalytic properties of lanthanum perovskites for methane combustion and three way catalysis has led to considerable debate as to their structure and defect chemistry. We have investigated the doping of LaCoO3 with the tetravalent cerium cation using atomistic simulation techniques. We have compared three routes for cerium insertion and identified the favoured doping mechanism, which explain experimental observations relating to the effect of cerium on catalytic activity.

  17. 29 CFR 2570.136 - Scope of discovery.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Scope of discovery. 2570.136 Section 2570.136 Labor Regulations Relating to Labor (Continued) EMPLOYEE BENEFITS SECURITY ADMINISTRATION, DEPARTMENT OF LABOR... impressions, conclusions, opinions, or legal theories of an attorney or other representatives of a party...

  18. Dicty_cDB: VSH136 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available S/VSH1-B/VSH136Q.Seq.d/ Representative seq. ID VSH136F (Link to Original site) Representative...as ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/V

  19. Dicty_cDB: VSF136 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available S/VSF1-B/VSF136Q.Seq.d/ Representative seq. ID VSF136F (Link to Original site) Representative...as ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/V

  20. 33 CFR 136.311 - Types of advertisement.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Types of advertisement. 136.311... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Designation of Source and Advertisement § 136.311 Types of advertisement. Advertisement required by the Director, NPFC, will normally include one or more...

  1. 33 CFR 136.313 - Content of advertisement.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Content of advertisement. 136.313... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Designation of Source and Advertisement § 136.313 Content of advertisement. Each advertisement required by this subpart may be required to contain...

  2. 21 CFR 136.110 - Bread, rolls, and buns.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Bread, rolls, and buns. 136.110 Section 136.110... Bread, rolls, and buns. (a) Bread, white bread, and rolls, white rolls, or buns, and white buns are the... be additional optional ingredients in the bread, rolls, or buns. All ingredients in any flour...

  3. 44 CFR 13.6 - Additions and exceptions.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Additions and exceptions. 13.6 Section 13.6 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT... requirements except in codified regulations published in the Federal Register. (b) Exceptions for classes...

  4. 47 CFR 61.136 - Revocation of concurrences.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Revocation of concurrences. 61.136 Section 61...) TARIFFS Concurrences § 61.136 Revocation of concurrences. A concurrence may be revoked by a revocation notice or cancelled by a new concurrence. A revocation notice or a new concurrence, if less broad...

  5. 13 CFR 136.110 - Self-evaluation.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Self-evaluation. 136.110 Section... § 136.110 Self-evaluation. (a) The Agency shall, by July 17, 1989, evaluate its current policies and... self-evaluation process by submitting comments (both oral and written). (c) The Agency shall, for...

  6. 42 CFR 136.303 - Indians applying for scholarships.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Indians applying for scholarships. 136.303 Section... Subdivision J-1-Provisions of General and Special Applicability § 136.303 Indians applying for scholarships. (a) For purposes of scholarship grants under Subdivisions J-3 and J-4 of this subpart,...

  7. 33 CFR 136.103 - Order of presentment.

    Science.gov (United States)

    2010-07-01

    ... Section 136.103 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... Director, NPFC, has advertised, or otherwise notified claimants in writing, in accordance with § 136.309(e... date upon which (A) the claim was presented, or (B) advertising was begun pursuant to §...

  8. 33 CFR 136.1 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... Section 136.1 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT General § 136.1 Purpose and applicability. (a) This part... advertisement of the designation and claims procedures; and (3) Other related matters. (b) This part applies...

  9. 33 CFR 136.305 - Notice of designation.

    Science.gov (United States)

    2010-07-01

    ... Section 136.305 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT Designation of Source and Advertisement § 136.305 Notice... Federal official to whom further communication regrading the incident, advertisement of the incident,...

  10. Study of cerium diffusion in undoped lithium-6 enriched glass with Rutherford backscattering spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiaodong, E-mail: xzhang39@utk.edu [Department of Nuclear Engineering, University of Tennessee, TN 37996 (United States); Moore, Michael E.; Lee, Kyung-Min; Lukosi, Eric D. [Department of Nuclear Engineering, University of Tennessee, TN 37996 (United States); Hayward, Jason P. [Department of Nuclear Engineering, University of Tennessee, TN 37996 (United States); Oak Ridge National Lab, Oak Ridge, TN 37831 (United States)

    2016-07-01

    Undoped lithium-6 enriched glasses coated with pure cerium (99.9%) with a gold protection layer on top were heated at three different temperatures (500, 550, and 600 °C) for varied durations (1, 2, and 4 h). Diffusion profiles of cerium in such glasses were obtained with the conventional Rutherford backscattering technique. Through fitting the diffusion profiles with the thin-film solution of Fick’s second law, diffusion coefficients of cerium with different annealing temperatures and durations were solved. Then, the activation energy of cerium for the diffusion process in the studied glasses was found to be 114 kJ/mol with the Arrhenius equation.

  11. Study of cerium diffusion in undoped lithium-6 enriched glass with Rutherford backscattering spectrometry

    Science.gov (United States)

    Zhang, Xiaodong; Moore, Michael E.; Lee, Kyung-Min; Lukosi, Eric D.; Hayward, Jason P.

    2016-07-01

    Undoped lithium-6 enriched glasses coated with pure cerium (99.9%) with a gold protection layer on top were heated at three different temperatures (500, 550, and 600 °C) for varied durations (1, 2, and 4 h). Diffusion profiles of cerium in such glasses were obtained with the conventional Rutherford backscattering technique. Through fitting the diffusion profiles with the thin-film solution of Fick's second law, diffusion coefficients of cerium with different annealing temperatures and durations were solved. Then, the activation energy of cerium for the diffusion process in the studied glasses was found to be 114 kJ/mol with the Arrhenius equation.

  12. Improvement of cerium of photosynthesis functions of maize under magnesium deficiency.

    Science.gov (United States)

    Zhou, Min; Gong, Xiaolan; Wang, Ying; Liu, Chao; Hong, Mengmeng; Wang, Ling; Hong, Fashui

    2011-09-01

    Rare earth elements can promote photosynthesis, but their mechanisms are still poorly understood under magnesium deficiency. The present study was designed to determine the role of cerium in magnesium-deficient maize plants. Maize was cultivated in Hoagland's solution added with cerium with and without adequate quantities of magnesium. Under magnesium-deficient conditions, cerium can prevents inhibition of synthesis of photosynthetic pigment, improves light energy absorption and conversion, oxygen evolution, and the activity of photo-phosphorelation and its coupling factor Ca(2+)-ATPase. These results suggest that cerium could partly substitute magnesium, improving photosynthesis and plant growth.

  13. The effect of cerium valence states at cerium oxide nanoparticle surfaces on cell proliferation

    KAUST Repository

    Naganuma, Tamaki

    2014-05-01

    Understanding and controlling cell proliferation on biomaterial surfaces is critical for scaffold/artificial-niche design in tissue engineering. The mechanism by which underlying integrin ligates with functionalized biomaterials to induce cell proliferation is still not completely understood. In this study, poly-l-lactide (PL) scaffold surfaces were functionalized using layers of cerium oxide nanoparticles (CNPs), which have recently attracted attention for use in therapeutic application due to their catalytic ability of Ce4+ and Ce3+ sites. To isolate the influence of Ce valance states of CNPs on cell proliferation, human mesenchymal stem cells (hMSCs) and osteoblast-like cells (MG63) were cultured on the PL/CNP surfaces with dominant Ce4+ and Ce3+ regions. Despite cell type (hMSCs and MG63 cells), different surface features of Ce4+ and Ce3+ regions clearly promoted and inhibited cell spreading, migration and adhesion behavior, resulting in rapid and slow cell proliferation, respectively. Cell proliferation results of various modified CNPs with different surface charge and hydrophobicity/hydrophilicity, indicate that Ce valence states closely correlated with the specific cell morphologies and cell-material interactions that trigger cell proliferation. This finding suggests that the cell-material interactions, which influence cell proliferation, may be controlled by introduction of metal elements with different valence states onto the biomaterial surface. © 2014 Elsevier Ltd.

  14. Adsorption of Fluoride Ion by Inorganic Cerium Based Adsorbent

    Institute of Scientific and Technical Information of China (English)

    Jiao Zhongzhi(焦中志); Chen Zhonglin; Yang Min; Zhang Yu; Li Guibai

    2004-01-01

    Excess of fluoride in drinking water is harmful to human health, the concentration of F- ions must be maintained in the range of 0.5 to 1.5 mg/L. An inorganic cerium based adsorbent (CTA) is developed on the basis of research of adsorption of fluoride on cerium oxide hydrate. Some adsorption of fluoride by CTA adsorbent experiments were carried out, and results showed that CTA adsorbent has a quick adsorption speed and a large adsorption capacity. Adsorption follows Freundlich isotherm, and low pH value helps fluoride removal. Some physical-chemical characteristics of CTA adsorbent were experimented, fluoride removal mechanism was explored, and results showed that hydroxyl group of CTA adsorbent played an important role in the fluoride removal.

  15. Isomorphic phase transformation in shocked Cerium using molecular dynamics

    Directory of Open Access Journals (Sweden)

    Germann T.C.

    2011-01-01

    Full Text Available Cerium (Ce undergoes a significant (∼16% volume collapse associated with an isomorphic fcc-fcc phase transformation when subject to compressive loading. We present here a new Embedded Atom Method (EAM potential for Cerium that models two minima for the two fcc phases. We show results from its use in Molecular Dynamics (MD simulations of Ce samples subjected to shocks with pressures ranging from 0.5 to 25 GPa. A split wave structure is observed, with an elastic precursor followed by a plastic wave. The plastic wave causes the expected fcc-fcc phase transformation. Comparisons to experiments and MD simulations on Cesium (Cs indicate that three waves could be observed. The construction of the EAM potential may be the source of the difference.

  16. Isomorphic phase transformation in shocked cerium using molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Dupont, Virginie [Los Alamos National Laboratory; Germann, Timothy C [Los Alamos National Laboratory; Chen, Shao - Ping [Los Alamos National Laboratory

    2010-08-12

    Cerium (Ce) undergoes a significant ({approx}16%) volume collapse associated with an isomorphic fcc-fcc phase transformation when subject to compressive loading. We present here a new Embedded Atom Method (EAM) potential for Cerium that models two minima for the two fcc phases. We show results from its use in Molecular Dynamics (MD) simulations of Ce samples subjected to shocks with pressures ranging from 0.5 to 25 GPa. A split wave structure is observed, with an elastic precursor followed by a plastic wave. The plastic wave causes the expected fcc-fcc phase transformation. Comparisons to experiments and MD simulations on Cesium (Cs) indicate that three waves could be observed. The construction of the EAM potential may be the source of the difference.

  17. Synthesis and characterization of cerium sulfide thin film

    Institute of Scientific and Technical Information of China (English)

    Ιshak Afsin Kariper

    2014-01-01

    Cerium sulfide (CexSy) polycrystalline thin film is coated with chemical bath deposition on substrates (commercial glass). Transmittance, absorption, optical band gap and refractive index are examined by using UV/VIS. Spectrum. The hexagonal form is observed in the structural properties in XRD. The structural and optical properties of cerium sulfide thin films are analyzed at different pH. SEM and EDX analyses are made for surface analysis and elemental ratio in films. It is observed that some properties of films changed with different pH values. In this study, the focus is on the observed changes in the properties of films. The pH values were scanned at 6–10. The optical band gap changed with pH between 3.40 to 3.60 eV. In addition, the film thickness changed with pH at 411 nm to 880 nm.

  18. Preparation and characterization of gelatin/cerium(Ⅲ) film

    Institute of Scientific and Technical Information of China (English)

    黄崇军; 黄雅钦; 田娜; 童元建; 殷瑞贤

    2010-01-01

    A novel gelatin film with antibacterial activity was prepared by electrostatic crosslinking using cerium (Ⅲ) nitrate hexahydrate as the crosslinking agent. The structure and properties of the films were investigated by Fourier transform infrared spectra, tensile tests, thermogravimetric analysis, static drop contact angle and disc diffusion method. The results showed that cross-linking could not only improve the thermal and mechanical properties and lower the hydrophilic property of the films, but also make...

  19. Cerium chloride reduces enamel lesion initiation and progression in vitro.

    Science.gov (United States)

    Wegehaupt, F J; Buchalla, W; Sener, B; Attin, T; Schmidlin, P R

    2014-01-01

    Determination of the potential of cerium chloride to reduce artificial carious mineral loss and lesion depth progression. A total of 160 enamel samples were prepared from 40 bovine lower central incisors. Crowns were sectioned into four pieces, embedded in acrylic resin, ground flat and allocated to eight groups (S1-S4 and D1-D4; n = 20). Specimens of groups D1-D4 were stored (for 7 days) in a demineralizing buffer solution to induce caries-like lesions. Afterwards, samples were treated for 30 s with one of the following solutions: placebo (S1 and D1), amine fluoride (S2 and D2), cerium chloride (S3 and D3) and a combination of fluoride and cerium chloride (S4 and D4). After another 7 (D1-D4) or 14 (S1-S4) days in demineralizing buffer solution, integrated mineral loss and lesion depth were determined by transversal microradiography and compared by Scheffé's post hoc tests. In groups S1-S4, the highest values for integrated mineral loss and lesion depth were observed for group S1 (placebo), the lowest values for group S4. The results in groups S2-S4 were not significantly different. In groups D1-D4, the highest values for integrated mineral loss and lesion depth were observed for group D1 (placebo), the lowest values in groups D3 and D4. In group D2, integrated mineral loss and lesion depth were significantly lower as compared to D1, but significantly higher compared to groups D3 and D4. Cerium chloride and its combination with fluoride are able to significantly reduce carious mineral loss and the progression of lesion depth.

  20. Jet formation in cerium metal to examine material strength

    Energy Technology Data Exchange (ETDEWEB)

    Jensen, B. J., E-mail: bjjensen@lanl.gov; Cherne, F. J.; Prime, M. B.; Yeager, J. D.; Ramos, K. J.; Hooks, D. E.; Cooley, J. C.; Dimonte, G. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Fezzaa, K. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Iverson, A. J.; Carlson, C. A. [National Security Technologies LLC, Los Alamos, New Mexico 87544 (United States)

    2015-11-21

    Examining the evolution of material properties at extreme conditions advances our understanding of numerous high-pressure phenomena from natural events like meteorite impacts to general solid mechanics and fluid flow behavior. Recent advances in synchrotron diagnostics coupled with dynamic compression platforms have introduced new possibilities for examining in-situ, spatially resolved material response with nanosecond time resolution. In this work, we examined jet formation from a Richtmyer-Meshkov instability in cerium initially shocked into a transient, high-pressure phase, and then released to a low-pressure, higher-temperature state. Cerium's rich phase diagram allows us to study the yield stress following a shock induced solid-solid phase transition. X-ray imaging was used to obtain images of jet formation and evolution with 2–3 μm spatial resolution. From these images, an analytic method was used to estimate the post-shock yield stress, and these results were compared to continuum calculations that incorporated an experimentally validated equation-of-state (EOS) for cerium coupled with a deviatoric strength model. Reasonable agreement was observed between the calculations and the data illustrating the sensitivity of jet formation on the yield stress values. The data and analysis shown here provide insight into material strength during dynamic loading which is expected to aid in the development of strength aware multi-phase EOS required to predict the response of matter at extreme conditions.

  1. Jet formation in cerium metal to examine material strength

    Science.gov (United States)

    Jensen, B. J.; Cherne, F. J.; Prime, M. B.; Fezzaa, K.; Iverson, A. J.; Carlson, C. A.; Yeager, J. D.; Ramos, K. J.; Hooks, D. E.; Cooley, J. C.; Dimonte, G.

    2015-11-01

    Examining the evolution of material properties at extreme conditions advances our understanding of numerous high-pressure phenomena from natural events like meteorite impacts to general solid mechanics and fluid flow behavior. Recent advances in synchrotron diagnostics coupled with dynamic compression platforms have introduced new possibilities for examining in-situ, spatially resolved material response with nanosecond time resolution. In this work, we examined jet formation from a Richtmyer-Meshkov instability in cerium initially shocked into a transient, high-pressure phase, and then released to a low-pressure, higher-temperature state. Cerium's rich phase diagram allows us to study the yield stress following a shock induced solid-solid phase transition. X-ray imaging was used to obtain images of jet formation and evolution with 2-3 μm spatial resolution. From these images, an analytic method was used to estimate the post-shock yield stress, and these results were compared to continuum calculations that incorporated an experimentally validated equation-of-state (EOS) for cerium coupled with a deviatoric strength model. Reasonable agreement was observed between the calculations and the data illustrating the sensitivity of jet formation on the yield stress values. The data and analysis shown here provide insight into material strength during dynamic loading which is expected to aid in the development of strength aware multi-phase EOS required to predict the response of matter at extreme conditions.

  2. Antibacterial activity of polymer coated cerium oxide nanoparticles.

    Directory of Open Access Journals (Sweden)

    Vishal Shah

    Full Text Available Cerium oxide nanoparticles have found numerous applications in the biomedical industry due to their strong antioxidant properties. In the current study, we report the influence of nine different physical and chemical parameters: pH, aeration and, concentrations of MgSO(4, CaCl(2, KCl, natural organic matter, fructose, nanoparticles and Escherichia coli, on the antibacterial activity of dextran coated cerium oxide nanoparticles. A least-squares quadratic regression model was developed to understand the collective influence of the tested parameters on the anti-bacterial activity and subsequently a computer-based, interactive visualization tool was developed. The visualization allows us to elucidate the effect of each of the parameters in combination with other parameters, on the antibacterial activity of nanoparticles. The results indicate that the toxicity of CeO(2 NPs depend on the physical and chemical environment; and in a majority of the possible combinations of the nine parameters, non-lethal to the bacteria. In fact, the cerium oxide nanoparticles can decrease the anti-bacterial activity exerted by magnesium and potassium salts.

  3. Study of tetravalent cerium incorporation in the monazite structure

    Energy Technology Data Exchange (ETDEWEB)

    Bregiroux, D.; Audubert, F.; Bernache-Assollant, D

    2004-07-01

    The incorporation of tetravalent cerium in the monazite structure (La{sub 1-2x}Ce{sup 4+}{sub x}Ca{sub x}PO{sub 4}) by high temperature solid state synthesis was investigated. First of all, the reaction was followed by DTA-TGA method and X-rays diffraction. It has been shown that CaO first reacts with the phosphate precursor to form Ca(PO{sub 3}){sub 2}. This compound melts near 940 deg C, inducing the dissociation of CeO{sub 2} and the reduction of a large part of cerium IV to cerium III. Two methods have been developed to determine the Ce{sup 4+}/Ce{sup 3+} ratio by using X-ray diffraction and microprobe analysis. We show that Ce{sup 4+} incorporation in LaPO{sub 4} is limited to a Ce{sup 4+}/Ce{sup 3+} = 0.15 value. (authors)

  4. pH-distribution of cerium species in aqueous systems

    Institute of Scientific and Technical Information of China (English)

    B.Bouchaud; J.Balmain; G.Bonnet; F.Pedraza

    2012-01-01

    Cerium-based oxide coalings can be obtained through either chemical or electrochemical processes on various conductor and semiconductor substrates.In both cases the films develop through a precipitation mechanism,which strongly depends on the solution chemistry.In the particular case of the electrolytic approach,the elaboration parameters play a key role on the interfacial pH modification thereby leading to an indirect precipitation mechanism.Indeed,the nucleation and growth mechanisms of crystallites and the composition of the resulting layers have been shown to be also strongly affected by the deposition conditions as well as by the substrate composition,which could in turn modify the protectiveness provided by such coatings.Therefore a better fundamental understanding of the system is required,in particular of the distribution of cerium-containing species in aqueous solution.To this end,the present work intended to develop a diagram showing the distribution as well as the relative amount of Ce(Ⅲ)/Ce(Ⅳ) species in aqueous media as a function of the pH range.The resulting pH-distribution diagram turned out to be a useful tool to predict the relevant precipitation mechanisms and species involved during the growth of cerium-containing films and to draw correlations with the characteristics of the as-deposited films.

  5. GHRS Spectroscopy of individual stars in R136a

    Science.gov (United States)

    Heap, Sara R.; Ebbets, Dennis; Malumuth, Eliot M.; Maran, Stephen P.; Koter, Alex DE; Hubeny, Ivan

    1994-01-01

    The installation of the Corrective Optics Space Telescope Axial Replacement (COSTAR) Instrument on the Hubble Space Telescope (HST) makes it possible to observe stars in very crowded regions with high spatial and spectral purity. To demonstrate this capability, we have used the Goddard High Resolution Spectrograph (GHRS) to obtain spectra of two stars in the dense center of the 30 Doradus ionizing cluster: R136a5, and its nearest neighbor, R136a2, only 0.17 sec away. R136a5 is shown to ben an O3f/WN star, while R136a2 is a WN4-w star. From both Wide Field/Planetary Camera (WFPC) photometry and GHRS, spectroscopy we estimate the following properties of R136a5: T(sub eff) = 42,500 K, R = 16.4 solar radius, L(sub bol) = 8 x 10(exp 5) solar luminosity, and M approx. equals 50 solar mass -- all indicating that, despite its spectral type, R136a5, as indicated by the strength of He II lambda 1640 emission. The observed mass-loss rate, dot-M = 1.8 x 10(exp -5) solar mass/yr, is an order of magnitude higher than is assumed by current stellar evolutionary models. We argue that this high rate of mass loss will alter drastically the evolutionary path of R136a5. If so, evolutionary models for massive stars require substantial revision.

  6. Induction of pulmonary fibrosis by cerium oxide nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Jane Y., E-mail: jym1@cdc.gov [Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Mercer, Robert R.; Barger, Mark; Schwegler-Berry, Diane; Scabilloni, James [Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States); Ma, Joseph K. [School of Pharmacy, West Virginia University, Morgantown, WV 26506 (United States); Castranova, Vincent [Health Effects Laboratory Division, National Institute for Occupational Safety and Health, Morgantown, WV 26505 (United States)

    2012-08-01

    Cerium compounds have been used as a diesel engine catalyst to lower the mass of diesel exhaust particles, but are emitted as cerium oxide (CeO{sub 2}) nanoparticles in the diesel exhaust. In a previous study, we have demonstrated a wide range of CeO{sub 2}-induced lung responses including sustained pulmonary inflammation and cellular signaling that could lead to pulmonary fibrosis. In this study, we investigated the fibrogenic responses induced by CeO{sub 2} in a rat model at various time points up to 84 days post-exposure. Male Sprague Dawley rats were exposed to CeO{sub 2} by a single intratracheal instillation. Alveolar macrophages (AM) were isolated by bronchial alveolar lavage (BAL). AM-mediated cellular responses, osteopontin (OPN) and transform growth factor (TGF)-β1 in the fibrotic process were investigated. The results showed that CeO{sub 2} exposure significantly increased fibrotic cytokine TGF-β1 and OPN production by AM above controls. The collagen degradation enzymes, matrix metalloproteinase (MMP)-2 and -9 and the tissue inhibitor of MMP were markedly increased in the BAL fluid at 1 day- and subsequently declined at 28 days after exposure, but remained much higher than the controls. CeO{sub 2} induced elevated phospholipids in BAL fluid and increased hydroxyproline content in lung tissue in a dose- and time-dependent manner. Immunohistochemical analysis showed MMP-2, MMP-9 and MMP-10 expressions in fibrotic regions. Morphological analysis noted increased collagen fibers in the lungs exposed to a single dose of 3.5 mg/kg CeO{sub 2} and euthanized at 28 days post-exposure. Collectively, our studies show that CeO{sub 2} induced fibrotic lung injury in rats, suggesting it may cause potential health effects. -- Highlights: ► Cerium oxide exposure significantly affected the following parameters in the lung. ► Induced fibrotic cytokine OPN and TGF-β1 production and phospholipidosis. ► Caused imbalance of the MMP-9/ TIMP-1 ratio that favors fibrosis

  7. LUMINESCENT PROPERTIES OF SILICATE GLASSES WITH CERIUM IONS AND ANTIMONY

    Directory of Open Access Journals (Sweden)

    A. M. Klykova

    2014-05-01

    Full Text Available The paper deals with the results of an experimental study of luminescence excitation spectra and luminescence of silicate glasses containing cerium ions and antimony. The aim of this work was to study the features of the luminescence and the effect of UV irradiation and heat treatment on luminescence and the state of cerium ions and antimony in glass. We investigated glass system Na2O-ZnO-Al2O3-SiO2-NaF-NaBr with additives CeO2 and Sb2O3. Synthesis was carried out in platinum crucibles in the air at 14500C. The samples were polished glass plates with a thickness of 0.5-1 mm. UV irradiation was carried out with a mercury lamp having a wide range of radiation in the spectral range 240-390 nm. It was conducted in a Nabertherm muffle furnaces. Luminescence spectra and excitation spectra were measured using a spectrofluorimeter MPF-44A (PerkinElmer at the room temperature. Measured luminescence spectra were corrected in view of the spectral sensitivity of the photodetector for spectrofluorimeter. Adjustment of the excitation spectra for the spectral dependence of the intensity of the excitation source was not carried out. During the experiments it was found that in silicate glasses Sb3+ ions can exist in two energy states, which corresponds to a different environment with oxygen ions. Heat treatment of these glasses in an oxidizing atmosphere leads to an increase in ion concentration of Sb3+ ions with a greater amount of oxygen in the environment. In glasses containing antimony and cerium ions, ultraviolet irradiation causes a change in the valence of cerium ions and antimony, which is accompanied by luminescence quenching. Subsequent heat treatment of glass leads to the inverse processes and restore luminescence excitation spectra. The study of fluorescent properties of silicate glasses with cerium and antimony ions led to the conclusion of the practical significance of this work. Promising multifunctional materials can be created on the basis of

  8. Single crystal to single crystal transformation and hydrogen-atom transfer upon oxidation of a cerium coordination compound.

    Science.gov (United States)

    Williams, Ursula J; Mahoney, Brian D; Lewis, Andrew J; DeGregorio, Patrick T; Carroll, Patrick J; Schelter, Eric J

    2013-04-15

    Trivalent and tetravalent cerium compounds of the octamethyltetraazaannulene (H2omtaa) ligand have been synthesized. Electrochemical analysis shows a strong thermodynamic preference for the formal cerium(IV) oxidation state. Oxidation of the cerium(III) congener Ce(Homtaa)(omtaa) occurs by hydrogen-atom transfer that includes a single crystal to single crystal transformation upon exposure to an ambient atmosphere.

  9. Direct growth of cerium oxide nanorods on diverse substrates for superhydrophobicity and corrosion resistance

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Young Jun; Jang, Hanmin; Lee, Kwan-Soo [School of Mechanical Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of); Kim, Dong Rip, E-mail: dongrip@hanyang.ac.kr [School of Mechanical Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of); Institute of Nano Science and Technology, Hanyang University, Seoul 133-791 (Korea, Republic of)

    2015-06-15

    Graphical abstract: - Highlights: • Cerium oxide nanorods were uniformly grown on diverse substrates. • Changes in growth conditions led to morphology evolution of cerium oxide nanostructures. • The grown cerium oxide nanostructures were single or poly crystalline. • Direct growth of cerium oxide nanorods made the diverse substrates superhydrophobic and anti-corrosive without any surface modifiers. - Abstract: Superhydrophobic surfaces with anti-corrosion properties have attracted great interest in many industrial fields, particularly to enhance the thermal performance of offshore applications such as heat exchangers, pipelines, power plants, and platform structures. Nanostructures with hydrophobic materials have been widely utilized to realize superhydrophobicity of surfaces, and cerium oxide has been highlighted due to its good corrosion resistive and intrinsically hydrophobic properties. However, few studies of direct growth of cerium oxide nanostructures on diverse substrates have been reported. Herein we report a facile hydrothermal method to directly grow cerium oxide nanorods on diverse substrates, such as aluminum alloy, stainless steel, titanium, and silicon. Diverse substrates with cerium oxide nanorods exhibited superhydrophobicity with no hydrophobic modifiers on their surfaces, and showed good corrosion resistive properties in corrosive medium. We believe our method could pave the way for realization of scalable and sustainable corrosion resistive superhydrophobic surfaces in many industrial fields.

  10. Cerium doped red mud catalytic ozonation for bezafibrate degradation in wastewater: Efficiency, intermediates, and toxicity.

    Science.gov (United States)

    Xu, Bingbing; Qi, Fei; Sun, Dezhi; Chen, Zhonglin; Robert, Didier

    2016-03-01

    In this study, the performance of bezafibrate (BZF) degradation and detoxification in the aqueous phase using cerium-modified red mud (RM) catalysts prepared using different cerium sources and synthesis methods were evaluated. Experimental results showed that the surface cerium modification was responsible for the development of the catalytic activity of RM and this was influenced by the cerium source and the synthesis method. Catalyst prepared from cerium (IV) by precipitation was found to show the best catalytic activity in BZF degradation and detoxification. Reactive oxygen species including peroxides, hydroxyl radicals, and super oxide ions were identified in all reactions and we proposed the corresponding catalytic reaction mechanism for each catalyst that prepared from different cerium source and method. This was supported by the intermediates profiles that were generated upon BZF degradation. The surface and the structural properties of cerium-modified RM were characterized in detail by several analytical methods. Two interesting findings were made: (1) the surface texture (specific surface area and mesoporous volume) influenced the catalytic reaction pathway; and (2) Ce(III) species and oxygen vacancies were generated on the surface of the catalyst after cerium modification. This plays an important role in the development of the catalytic activity.

  11. Tuning Reactivity and Electronic Properties through Ligand Reorganization within a Cerium Heterobimetallic Framework

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, Jerome R.; Gordon, Zachary; Booth, Corwin H.; Carroll, Patrick J.; Walsh, Patrick J.; Schelter, Eric J.

    2014-06-24

    Cerium compounds have played vital roles in organic, inorganic, and materials chemistry due to their reversible redox chemistry between trivalent and tetravalent oxidation states. However, attempts to rationally access molecular cerium complexes in both oxidation states have been frustrated by unpredictable reactivity in cerium(III) oxidation chemistry. Such oxidation reactions are limited by steric saturation at the metal ion, which can result in high energy activation barriers for electron transfer. An alternative approach has been realized using a rare earth/alkali metal/1,1'-BINOLate (REMB) heterobimetallic framework, which uses redox-inactive metals within the secondary coordination sphere to control ligand reorganization. The rational syntheses of functionalized cerium(IV) products and a mechanistic examination of the role of ligand reorganization in cerium(III) oxidation are presented.

  12. Effects of uncoated and citric acid coated cerium oxide nanoparticles, bulk cerium oxide, cerium acetate, and citric acid on tomato plants.

    Science.gov (United States)

    Barrios, Ana Cecilia; Rico, Cyren M; Trujillo-Reyes, Jesica; Medina-Velo, Illya A; Peralta-Videa, Jose R; Gardea-Torresdey, Jorge L

    2016-09-01

    Little is known about the physiological and biochemical responses of plants exposed to surface modified nanomaterials. In this study, tomato (Solanum lycopersicum L.) plants were cultivated for 210days in potting soil amended with uncoated and citric acid coated cerium oxide nanoparticles (nCeO2, CA+nCeO2) bulk cerium oxide (bCeO2), and cerium acetate (CeAc). Millipore water (MPW), and citric acid (CA) were used as controls. Physiological and biochemical parameters were measured. At 500mg/kg, both the uncoated and CA+nCeO2 increased shoot length by ~9 and ~13%, respectively, while bCeO2 and CeAc decreased shoot length by ~48 and ~26%, respectively, compared with MPW (p≤0.05). Total chlorophyll, chlo-a, and chlo-b were significantly increased by CA+nCeO2 at 250mg/kg, but reduced by bCeO2 at 62.5mg/kg, compared with MPW. At 250 and 500mg/kg, nCeO2 increased Ce in roots by 10 and 7 times, compared to CA+nCeO2, but none of the treatments affected the Ce concentration in above ground tissues. Neither nCeO2 nor CA+nCeO2 affected the homeostasis of nutrient elements in roots, stems, and leaves or catalase and ascorbate peroxidase in leaves. CeAc at 62.5 and 125mg/kg increased B (81%) and Fe (174%) in roots, while at 250 and 500mg/kg, increased Ca in stems (84% and 86%, respectively). On the other hand, bCeO2 at 62.5 increased Zn (152%) but reduced P (80%) in stems. Only nCeO2 at 62.5mg/kg produced higher total number of tomatoes, compared with control and the rest of the treatments. The surface coating reduced Ce uptake by roots but did not affect its translocation to the aboveground organs. In addition, there was no clear effect of surface coating on fruit production. To our knowledge, this is the first study comparing the effects of coated and uncoated nCeO2 on tomato plants. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Spectrophotometric determination of cerium with methylthymol blue in the presence of oxalate and cyanide as masking agents

    Energy Technology Data Exchange (ETDEWEB)

    Cabrera-Martin, A.; Izquierdo-Hornillos, R.; Quejido-Cabezas, A.J.; Peral-Fernandez, J.L. (Universidad Complutense de Madrid (Spain). Facultad de Ciencias Quimicas)

    1983-04-01

    The spectrophotometric determination of cerium can be carried out by several methods, which involve either the formation of complexes of cerium(III) and cerium(IV) or the oxidation of suitable reagents by cerium(IV) and further measuring the intensity of the colour of the oxidised matter. The latter methods show a lack of selectivity and low sensitivity owing to the nature of the redox reaction. The methods that involve the formation of complexes have also been shown to have low selectivity and sensitivity. However, the most useful methods are those based on the complexes of cerium(III) with Xylenol Orange and Methylthymol Blue (MTB), but they are affected by many interferences. In this work the reaction of cerium(III) with MTB in the presence of oxalate and cyanide ions was studied at pH 10.2, which improves the sensitivity and the selectivity of the determination of cerium.

  14. Electrochemical studies on cerium(Ⅲ) in molten fluoride mixtures

    Institute of Scientific and Technical Information of China (English)

    VIRGIL; CONSTANTIN; ANA-MARIA; POPESCU; MIRCEA; OLTEANU

    2010-01-01

    This study aims to determine the principal electrochemical characteristics of the electrodeposition of cerium metal from molten fluoride systems.The cathodic process of Ce3+ ions in LiF-NaF and LiF-NaF-CaF2 molten salts was studied using electrochemical techniques as steady state and cyclic voltammetry methods.The decomposition potential(Ed) and the overvoltage(η) were determined for NaCeF4 using current-potential curves under galvanostatic conditions.The Ed was found to be 2.025 V in LiF-NaF and 2.045 V in...

  15. Identification of the Charge Carriers in Cerium Phosphate Ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Ray, Hannah L.; Jonghe, Lutgard C. De

    2010-06-02

    The total conductivity of Sr-doped cerium orthophosphate changes by nearly two orders of magnitude depending on the oxygen and hydrogen content of the atmosphere. The defect model for the system suggests that this is because the identity of the dominant charge carrier can change from electron holes to protons when the sample is in equilibrium with air vs. humidified hydrogen. In this work are presented some preliminary measurements that can help to clarify this exchange between carriers. The conduction behavior of a 2percent Sr-doped CePO4 sample under symmetric atmospheric conditions is investigated using several techniques, including AC impedance, H/D isotope effects, and chronoamperometry.

  16. Cerium oxide based nanometric powders: synthesis and characterization

    Directory of Open Access Journals (Sweden)

    Ninić M.

    2007-01-01

    Full Text Available Nanometric powders of solid solutions of cerium oxide were obtained by a modified glycine nitrate procedure. Solid solutions of the host compound CeO2 with one or more dopants in the lattice were synthesized. Rare earth cations (Re=Yb, Gd and Sm were added to ceria in total concentration of x= 0.2 that was kept constant. The criterion in doping was to keep the value of lattice parameter of ceria unchanged. The lattice parameters were calculated by using the model that takes into account the existence of oxygen vacancies in the structure.

  17. Options for the recovery of cerium by solvent extraction

    Energy Technology Data Exchange (ETDEWEB)

    Soldenhoff, K.H. [Australian Nuclear Science and Technology Organisation, Lucas Heights, NSW (Australia)

    1996-12-31

    This paper reports the results of an experimental program to examine the use of various commercial reagents for the extraction of cerium (IV) from sulphate solutions. Extractants tested include organophosphorus esters (TOPO, Cyanex 923 and Cyanex 925), organophosphorus acids (DEHPA, lonquest 801 and Cyanex 272) and high molecular weight amine, Alamine 336. The suitability of reagents is assessed in terms of process relevant criteria such as extraction dependence on acidity, selectivity over other rare earths and thorium, stability of reagent towards oxidation and loading characteristics. (author) 15 refs., 2 tabs., 5 figs.

  18. Properties of hot liquid cerium by LDA + U molecular dynamics.

    Science.gov (United States)

    Siberchicot, Bruno; Clérouin, Jean

    2012-11-14

    We present ab initio simulations of liquid cerium in the framework of the LDA + U formulation. The liquid density has been determined self-consistently by searching for the zero pressure equilibrium state at 1320 K with the same set of parameters (U and J) and occupation matrices as those optimized for the γ phase. We have computed static and transport properties. The liquid produced by the simulations appears more structured than the available measurements. This raises questions regarding the ability of the theory to describe such a complex liquid. Conductivity calculations and temperature dependences are nevertheless in reasonable agreement with data.

  19. Soil organic matter influences cerium translocation and physiological processes in kidney bean plants exposed to cerium oxide nanoparticles.

    Science.gov (United States)

    Majumdar, Sanghamitra; Peralta-Videa, Jose R; Trujillo-Reyes, Jesica; Sun, Youping; Barrios, Ana C; Niu, Genhua; Margez, Juan P Flores-; Gardea-Torresdey, Jorge L

    2016-11-01

    Soil organic matter plays a major role in determining the fate of the engineered nanomaterials (ENMs) in the soil matrix and effects on the residing plants. In this study, kidney bean plants were grown in soils varying in organic matter content and amended with 0-500mg/kg cerium oxide nanoparticles (nano-CeO2) under greenhouse condition. After 52days of exposure, cerium accumulation in tissues, plant growth and physiological parameters including photosynthetic pigments (chlorophylls and carotenoids), net photosynthesis rate, transpiration rate, and stomatal conductance were recorded. Additionally, catalase and ascorbate peroxidase activities were measured to evaluate oxidative stress in the tissues. The translocation factor of cerium in the nano-CeO2 exposed plants grown in organic matter enriched soil (OMES) was twice as the plants grown in low organic matter soil (LOMS). Although the leaf cover area increased by 65-111% with increasing nano-CeO2 concentration in LOMS, the effect on the physiological processes were inconsequential. In OMES leaves, exposure to 62.5-250mg/kg nano-CeO2 led to an enhancement in the transpiration rate and stomatal conductance, but to a simultaneous decrease in carotenoid contents by 25-28%. Chlorophyll a in the OMES leaves also decreased by 27 and 18% on exposure to 125 and 250mg/kg nano-CeO2. In addition, catalase activity increased in LOMS stems, and ascorbate peroxidase increased in OMES leaves of nano-CeO2 exposed plants, with respect to control. Thus, this study provides clear evidence that the properties of the complex soil matrix play decisive roles in determining the fate, bioavailability, and biological transport of ENMs in the environment. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Novel borothermal route for the synthesis of lanthanum cerium hexaborides and their field emission properties

    Energy Technology Data Exchange (ETDEWEB)

    Menaka [Department of Chemistry, Indian Institute of Technology, Hauz Khas, New Delhi-110016 (India); Patra, Rajkumar; Ghosh, Santanu [Department of Physics, Indian Institute of Technology, Hauz Khas, New Delhi-110016 (India); Ganguli, Ashok K., E-mail: ashok@chemistry.iitd.ac.in [Department of Chemistry, Indian Institute of Technology, Hauz Khas, New Delhi-110016 (India)

    2012-10-15

    The present study describes the development of a simple approach to stabilize polycrystalline lanthanum cerium hexaborides without using any flux and at ambient pressure. The nanostructured lanthanum-cerium borides were synthesized using hydroxide precursors. These precursors (La{sub 1-x}Ce{sub x}(OH){sub 3}, x=0.1, 0.2, 0.3 and 0.5) were synthesized via hydrothermal route in the presence of Tergitol (surfactant, nonylphenol ethoxylate) as a capping agent. The precursors on heating with boron at 1300 Degree-Sign C lead to the formation of nanostructures (cubes, rods and pyramids) of lanthanum cerium hexaboride. We have investigated the field emission behaviour of the hexaboride films fabricated by spin coating. It was observed that the pyramidal shaped nanostructures of La{sub 0.5}Ce{sub 0.5}B{sub 6} shows excellent field emission characteristics with high field enhancement factor of 4502. - Graphical abstract: Nanostructured lanthanum cerium hexaboride with efficient field emission have fabricated by low temperature hydroxide precursor mediated route. Highlights: Black-Right-Pointing-Pointer New methodology to prepare lanthanum cerium hexaboride at 1300 Degree-Sign C via borothermal route. Black-Right-Pointing-Pointer Nanostructured lanthanum cerium hexaboride film by spin coating process. Black-Right-Pointing-Pointer Nanopyramids based lanthanum cerium hexaboride shows excellent field emission.

  1. Hydrothermal synthesis of cerium titanate nanorods and its application in visible light photocatalysis

    Energy Technology Data Exchange (ETDEWEB)

    Pei, L.Z., E-mail: lzpei@ahut.edu.cn; Liu, H.D.; Lin, N.; Yu, H.Y., E-mail: yuhy@ahut.edu.cn

    2015-01-15

    Highlights: • Cerium titanate nanorods have been synthesized by a simple hydrothermal process. • The size of the cerium titanate nanorods can be controlled by growth conditions. • Cerium titanate nanorods exhibit good photocatalytic activities for methyl blue. - Abstract: Cerium titanate nanorods have been prepared via a hydrothermal process using sodium dodecyl sulfate (SDS) as the surfactant. The cerium titanate nanorods have been analyzed by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), and ultraviolet–visible (UV–vis) diffuse reflectance spectrum. XRD shows that the nanorods are composed of CeTi{sub 21}O{sub 38} phase. Electron microscopy observations indicate that the nanorods have good single crystalline nature. The diameter and length of the nanorods are about 50–200 nm and 1–2 μm, respectively. Cerium titanate nanorods have a band gap of 2.65 eV. The photocatalytic activities of the nanorods have been investigated by degrading methylene blue (MB) under visible light irradiation. MB solution with the concentration of 10 mg L{sup −1} can be degraded totally with the irradiation time increasing to 240 min. Cerium titanate nanorods exhibit great potential in photocatalytic degradation of MB under visible light irradiation.

  2. Altering properties of cerium oxide thin films by Rh doping

    Energy Technology Data Exchange (ETDEWEB)

    Ševčíková, Klára, E-mail: klarak.sevcikova@seznam.cz [Faculty of Mathematics and Physics, Department of Surface and Plasma Science, Charles University in Prague, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); NIMS Beamline Station at SPring-8, National Institute for Materials Science, Sayo, Hyogo 679-5148 (Japan); Nehasil, Václav, E-mail: nehasil@mbox.troja.mff.cuni.cz [Faculty of Mathematics and Physics, Department of Surface and Plasma Science, Charles University in Prague, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); Vorokhta, Mykhailo, E-mail: vorohtam@gmail.com [Faculty of Mathematics and Physics, Department of Surface and Plasma Science, Charles University in Prague, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); Haviar, Stanislav, E-mail: stanislav.haviar@gmail.com [Faculty of Mathematics and Physics, Department of Surface and Plasma Science, Charles University in Prague, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); Matolín, Vladimír, E-mail: matolin@mbox.troja.mff.cuni.cz [Faculty of Mathematics and Physics, Department of Surface and Plasma Science, Charles University in Prague, V Holešovičkách 2, 180 00 Prague 8 (Czech Republic); and others

    2015-07-15

    Highlights: • Thin films of ceria doped by rhodium deposited by RF magnetron sputtering. • Concentration of rhodium has great impact on properties of Rh–CeO{sub x} thin films. • Intensive oxygen migration in films with low concentration of rhodium. • Oxygen migration suppressed in films with high amount of Rh dopants. - Abstract: Ceria containing highly dispersed ions of rhodium is a promising material for catalytic applications. The Rh–CeO{sub x} thin films with different concentrations of rhodium were deposited by RF magnetron sputtering and were studied by soft and hard X-ray photoelectron spectroscopies, Temperature programmed reaction and X-ray powder diffraction techniques. The sputtered films consist of rhodium–cerium mixed oxide where cerium exhibits a mixed valency of Ce{sup 4+} and Ce{sup 3+} and rhodium occurs in two oxidation states, Rh{sup 3+} and Rh{sup n+}. We show that the concentration of rhodium has a great influence on the chemical composition, structure and reducibility of the Rh–CeO{sub x} thin films. The films with low concentrations of rhodium are polycrystalline, while the films with higher amount of Rh dopants are amorphous. The morphology of the films strongly influences the mobility of oxygen in the material. Therefore, varying the concentration of rhodium in Rh–CeO{sub x} thin films leads to preparing materials with different properties.

  3. Functionalization of nanostructured cerium oxide films with histidine.

    Science.gov (United States)

    Tsud, Nataliya; Bercha, Sofiia; Acres, Robert G; Vorokhta, Mykhailo; Khalakhan, Ivan; Prince, Kevin C; Matolín, Vladimír

    2015-01-28

    The surfaces of polycrystalline cerium oxide films were modified by histidine adsorption under vacuum and characterized by the synchrotron based techniques of core and valence level photoemission, resonant photoemission and near edge X-ray absorption spectroscopy, as well as atomic force microscopy. Histidine is strongly bound to the oxide surface in the anionic form through the deprotonated carboxylate group, and forms a disordered molecular adlayer. The imidazole ring and the amino side group do not form bonds with the substrate but are involved in the intermolecular hydrogen bonding which stabilizes the molecular adlayer. The surface reaction with histidine results in water desorption accompanied by oxide reduction, which is propagated into the bulk of the film. Previously studied, well-characterized surfaces are a guide to the chemistry of the present polycrystalline surface and histidine bonds via the carboxylate group in both cases. In contrast, bonding via the imidazole group occurs on the well-ordered surface but not in the present case. The morphology and structure of the cerium oxide are decisive factors which define the adsorption geometry of the histidine adlayer.

  4. Interactional effect of cerium and manganese on NO catalytic oxidation.

    Science.gov (United States)

    Liang, Yanli; Huang, Yufen; Zhang, Hailong; Lan, Li; Zhao, Ming; Gong, Maochu; Chen, Yaoqiang; Wang, Jianli

    2017-04-01

    To preferably catalyze the oxidation of NO to NO2 in diesel after-treatment system, a series of CeO2-MnO x composite oxides was supported on silica-alumina material by the co-impregnation method. The maximum conversion of NO of the catalyst with a Ce/Mn weight ratio of 5:5 was improved by around 40%, compared to the supported manganese-only or cerium-only sample. And its maximum reaction rate was 0.056 μmol g(-1) s(-1) at 250 °C at the gas hourly space velocity of 30,000 h(-1). The experimental results suggested that Ce-Mn solid solution was formed, which could modulate the valence state of cerium and manganese and exhibit great redox properties. Moreover, the strong interaction between ceria and manganese resulted in the largest desorption amount of strong chemical oxygen and oxygen vacancies, leading to the maximum O α area ratio of 62.26% from the O 1s result. These effective oxygen species could be continually transferred to the surface, leading to the best NO catalytic activity of 5Ce5Mn/SA catalyst. Graphical abstract.

  5. Cerium Tetrafluoride: Sublimation, Thermolysis, and Atomic Fluorine Migration.

    Science.gov (United States)

    Chilingarov, N S; Knot'ko, A V; Shlyapnikov, I M; Mazej, Z; Kristl, M; Sidorov, L N

    2015-08-06

    Saturated vapor pressure p° and enthalpy of sublimation (ΔsH°) of cerium tetrafluoride CeF4 were determined by means of Knudsen effusion mass spectrometry in the range of 750-920 K. It was discovered that sublimation of cerium tetrafluoride from a platinum effusion cell competes with thermal decomposition to CeF3 in the solid phase, but no accompanying release of fluorine to the gas phase occurs. Thus, fluorine atoms migrate within the surface layer of CeF4(s) to the regions of their irreversible drain. We used scanning electron microscopy to study the distribution of the residual CeF3(s) across the inner surface of the effusion cell after complete evaporation of CeF4(s). It was observed that CeF3 accumulates near the edge of the effusion orifice and near the junction of the lid and the body of the cell, that is, in those regions where the fluorine atoms can migrate to a free platinum surface and thus be depleted from the system. Distribution of CeF3(s) solid particles indicates the ways of fluorine atoms migration providing CeF3(s) formation inside the CeF4(s) surface layer.

  6. Biosorption potential of cerium ions usingSpirulina biomass

    Institute of Scientific and Technical Information of China (English)

    David Sadovsky; Asher Brenner; Boaz Astrachan; Boaz Asaf; Raphael Gonen

    2016-01-01

    Two types of cyanobacteria of the genusArthrospira (commonly known asSpirulina) were tested for biosorption of ce-rium(III) ions from aqueous solutions. An endemic type (ES) found in the northern Negev desert, Israel, and a commercial powder (CS) were used in this study. Biosorption was evaluated as a function of pH, contact time, initial metal concentration, number of sorp-tion-desorption cycles, and salt concentration. The optimum pH range for biosorption was found to be 5.0–5.5. The kinetic character-istics of bothSpirulina types were found to be highly compatible with a pseudo-second order kinetic model. The adsorption isotherms of both types were found to be well-suited to Langmuir and Freundlich adsorption isotherms. Maximum biosorption uptakes, accord-ing to the Langmuir model, were 18.1 and 38.2 mg/g, for ES and CS, respectively. Sodium chloride concentrations of up to 5 g/L had a minor effect on cerium biosorption. Desorption efficiency was found to be greater than 97% with 0.1 mol/L HNO3 after three sorp-tion-desorption cycles, without significant loss in the biosorption capacity. The results indicated the feasibility of cerium recovery from industrial wastes usingSpirulina biomass.

  7. Cerium fluoride nanoparticles protect cells against oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Shcherbakov, Alexander B.; Zholobak, Nadezhda M. [Zabolotny Institute of Microbiology and Virology, National Academy of Sciences of Ukraine, Kyiv D0368 (Ukraine); Baranchikov, Alexander E. [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); Ryabova, Anastasia V. [Prokhorov General Physics Institute of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow 115409 (Russian Federation); Ivanov, Vladimir K., E-mail: van@igic.ras.ru [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Tomsk State University, Tomsk 634050 (Russian Federation)

    2015-05-01

    A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF{sub 3}:Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF{sub 3} nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. - Highlights: • Facile method of CeF{sub 3} and CeF{sub 3}:Tb stable aqueous sols synthesis is proposed. • Naked CeF{sub 3} nanoparticles are shown to be non-toxic and to protect cells from the action of H{sub 2}O{sub 2}. • CeF{sub 3} and CeF{sub 3}:Tb nanoparticles are shown to protect living cells against the vesicular stomatitis virus.

  8. Structural, topographical and electrical properties of cerium doped strontium barium niobate (Ce:SBN60) ceramics

    Science.gov (United States)

    Raj, S. Gokul; Mathivanan, V.; Kumar, G. Ramesh; Yathavan, S.; Mohan, R.

    2016-05-01

    Tungsten bronze type cerium doped strontium barium niobate (Ce:SBN - Sr0.6B0.4Nb2O6) ceramics were synthesized by solid state process. Cerium was used as dopant to improve its electrical properties. Influence of Ce+ ions on the photoluminescence properties was investigated in detail. The grain size topographical behavior of SBN powders and their associated abnormal grain growth (AGG) were completely analyzed through SEM studies. Finally dielectric, measurement discusses about the broad phase transition observed due to cerium dopant The results were discussed in detail.

  9. Structural, topographical and electrical properties of cerium doped strontium barium niobate (Ce:SBN60) ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Raj, S. Gokul [Department of Physics, C. Kandaswami Naidu College For Men (CKNC), Annanagar, Chennai-600102 (India); Mathivanan, V.; Mohan, R. [Department of Physics, Presidency College, Chennai – 600005 (India); Kumar, G. Ramesh, E-mail: rameshvandhai@gmail.com; Yathavan, S. [Department of Physics, University College of Engineering Arni, Anna University Chennai, Arni-632317 (India)

    2016-05-06

    Tungsten bronze type cerium doped strontium barium niobate (Ce:SBN - Sr{sub 0.6}B{sub 0.4}Nb{sub 2}O{sub 6}) ceramics were synthesized by solid state process. Cerium was used as dopant to improve its electrical properties. Influence of Ce{sup +} ions on the photoluminescence properties was investigated in detail. The grain size topographical behavior of SBN powders and their associated abnormal grain growth (AGG) were completely analyzed through SEM studies. Finally dielectric, measurement discusses about the broad phase transition observed due to cerium dopant The results were discussed in detail.

  10. Titrimetric and Spectrophotometric Methods for the Assay of Ketotifen Using Cerium(IV) and Two Reagents

    OpenAIRE

    Madihalli Srinivas Raghu; Kanakapura Basavaiah; Kudige Nagaraj Prashanth; Kanakapura Basavaiah Vinay

    2013-01-01

    One titrimetric and two spectrophotometric methods are described for the determination of ketotifen fumarate (KTF) in bulk drug and in tablets using cerium(IV) as the oxidimetric agent. In titrimetry (method A), the drug was treated with a measured excess of cerium(IV) in H2SO4 medium and after a standing time of 10 min, the surplus oxidant was determined by back titration with iron(II). The spectrophotometric procedures involve addition of a known excess of cerium(IV) to KTF in acid medium f...

  11. Removal of fluoride from fluoride-bering cerium sulfate solution by hydrous zirconium oxide

    Directory of Open Access Journals (Sweden)

    J. G. He

    2014-04-01

    Full Text Available In this paper the removal of fluoride from fluoride-bearing cerium sulfate solution by amorphous hydrous zirconium oxide was studied. The FTIR, SEM, EDS and UV-vis spectra show that fluoride is successfully adsorbed on hydrous zirconium oxide, and cerium exists as Ce4+ in solution. The study indicates that it is feasible to separate fluorine and cerium from fluorine-bearing rare earth sulfate solution using hydrous zirconium oxide, and eliminate the influence of fluoride on the extraction separation of rare earths.

  12. Magnetophotonic crystal with cerium substituted yttrium iron garnet and enhanced Faraday rotation angle.

    Science.gov (United States)

    Yoshimoto, Takuya; Goto, Taichi; Isogai, Ryosuke; Nakamura, Yuichi; Takagi, Hiroyuki; Ross, C A; Inoue, M

    2016-04-18

    Magnetophotonic crystals (MPCs) comprising cerium-substituted yttrium iron garnet (CeYIG) sandwiched by two Bragg mirrors were fabricated by vacuum annealing. CeYIG was deposited on Bragg mirrors at room temperature and annealed in 5 Pa of residual air. No ceria or other non-garnet phases were detected. Cerium 3 + ions substituted on the yttrium sites and no cerium 4 + ions were found. The Faraday rotation angle of the MPC was -2.92° at a wavelength of λ = 1570 nm was 30 times larger than that of the CeYIG film. These results showed good agreement with calculated values derived using a matrix approach.

  13. 2$^{+}$ anomaly and configurational isospin polarization of $^{136}$Te

    CERN Multimedia

    It is proposed to perform a Coulomb excitation experiment on beams of radioactive ions of $^{136}$Te delivered by HIE-ISOLDE impinging on a $^{58}$Ni target. Scattered particles will be detected by a DSSSD detector and $\\gamma$-rays will be detected by the MINIBALL array. The proposed Configurational Isospin Polarization (CIP) of the two lowest 2$^+$ states will be determined by measuring the E2 excitation yield distribution to them. The expected proton-dominated one-phonon character of the second excited 2$^+$ state of $^{136}$Te will be tested on the basis of absolute electromagnetic matrix elements from the observed Coulomb excitation cross sections. Complementary lifetime information on this predominant 2$^+_{1,ms}$ state will be extracted using the differential DSAM technique. The experiment will clarify to what extent CIP is responsible for the 2$^+$ anomaly in $^{136}$Te.

  14. Transverse wobbling motion in $^{134}$Ce and $^{136}$Nd

    CERN Document Server

    Petrache, C M

    2016-01-01

    The existence of one-phonon and possible two-phonon transverse wobbling bands is proposed for the first time in two even-even nuclei, $^{134}$Ce and $^{136}$Nd. The predominant $E2$ character of the $\\Delta I = 1$ transitions connecting the one-phonon wobbling band in $^{134}$Ce to the two-quasiparticle yrast band supports the wobbling interpretation. The extracted wobbling frequencies decrease with increasing spin, indicating the transverse character of the wobbling motion, with the angular momenta of the two quasiparticles aligned perpendicular to the axis of collective rotation. A candidate for two-phonon wobbling motion is also proposed in $^{136}$Nd. The wobbling frequencies calculated in the harmonic frozen approximation are in good agreement with the experimental ones for both the$^{134}$Ce and $^{136}$Nd nuclei.

  15. Effects of uncoated and citric acid coated cerium oxide nanoparticles, bulk cerium oxide, cerium acetate, and citric acid on tomato plants

    Energy Technology Data Exchange (ETDEWEB)

    Barrios, Ana Cecilia [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); Rico, Cyren M. [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Trujillo-Reyes, Jesica [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); Medina-Velo, Illya A. [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Peralta-Videa, Jose R. [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); Environmental Science and Engineering Ph.D. Program, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Gardea-Torresdey, Jorge L., E-mail: jgardea@utep.edu [Department of Chemistry, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); Environmental Science and Engineering Ph.D. Program, The University of Texas at El Paso, 500 W. University Avenue, El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN), The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States)

    2016-09-01

    Little is known about the physiological and biochemical responses of plants exposed to surface modified nanomaterials. In this study, tomato (Solanum lycopersicum L.) plants were cultivated for 210 days in potting soil amended with uncoated and citric acid coated cerium oxide nanoparticles (nCeO{sub 2}, CA + nCeO{sub 2}) bulk cerium oxide (bCeO{sub 2}), and cerium acetate (CeAc). Millipore water (MPW), and citric acid (CA) were used as controls. Physiological and biochemical parameters were measured. At 500 mg/kg, both the uncoated and CA + nCeO{sub 2} increased shoot length by ~ 9 and ~ 13%, respectively, while bCeO{sub 2} and CeAc decreased shoot length by ~ 48 and ~ 26%, respectively, compared with MPW (p ≤ 0.05). Total chlorophyll, chlo-a, and chlo-b were significantly increased by CA + nCeO{sub 2} at 250 mg/kg, but reduced by bCeO{sub 2} at 62.5 mg/kg, compared with MPW. At 250 and 500 mg/kg, nCeO{sub 2} increased Ce in roots by 10 and 7 times, compared to CA + nCeO{sub 2}, but none of the treatments affected the Ce concentration in above ground tissues. Neither nCeO{sub 2} nor CA + nCeO{sub 2} affected the homeostasis of nutrient elements in roots, stems, and leaves or catalase and ascorbate peroxidase in leaves. CeAc at 62.5 and 125 mg/kg increased B (81%) and Fe (174%) in roots, while at 250 and 500 mg/kg, increased Ca in stems (84% and 86%, respectively). On the other hand, bCeO{sub 2} at 62.5 increased Zn (152%) but reduced P (80%) in stems. Only nCeO{sub 2} at 62.5 mg/kg produced higher total number of tomatoes, compared with control and the rest of the treatments. The surface coating reduced Ce uptake by roots but did not affect its translocation to the aboveground organs. In addition, there was no clear effect of surface coating on fruit production. To our knowledge, this is the first study comparing the effects of coated and uncoated nCeO{sub 2} on tomato plants. - Highlights: • At 500 mg/kg, coated and bare NPs increased stem length by 13 and 9

  16. EFFECT OF CERIUM ION IMPLANTATION ON THE AQUEOUS CORROSION BEHAVIOR OF ZIRCONIUM

    Institute of Scientific and Technical Information of China (English)

    D.Q. Peng; X.D. Bai; Q.G. Zhou; X.W. Chen; R.H. Yu; X.Y. Liu

    2004-01-01

    In order to study the influence of cerium ion implantation on the aqueous corrosion behavior of zirconium, specimens were implanted by cerium ions with a dosage range from 1 ×1016 to 1 ×1017 ions/cm2 at about 150℃, using MEWA source at an acceler ative voltage of 40kV. The valence of the surface layer was analyzed by X-ray photoelectron spectroscopy (XPS); Three-sweep potentiodynamic polarization measurement was employed to value the aqueous corrosion resistance of zirconium in a 0.5mol/L H2SO4 solution. It was found that a remarkable decline in the aqueous corrosion behavior of zirconium implanted with cerium ions compared with that of the as-received zirconium. Finally, the mechanism of the corrosion resistance decline of the cerium-implanted zirconium is discussed.

  17. Study on Catalysts with Rhodium Loading on Different Cerium-Zirconium Mixed Oxides

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The catalysts with Rh loading on different cerium-zirconium mixed oxides were characterized by BET, H2-TPR and OSC. The effects of different cerium-zirconium mixed oxides on catalytic performance and thermal stability of Rh loaded catalyst were studied. The results show that: (1) Rh can enhance cerium-zirconium mixed oxides OSC and catalytic reaction rates; (2) cerium-zirconium mixed oxides with high Ce contents and low Zr contents are more favorable to the stability of catalysts. Moreover, the contents of CeO2 have important effect on catalysts characteristics, and the addition of some rare earth components, such as La, Pr and Nd also have some influences.

  18. Synthesis of cerium oxide (CeO{sub 2}) nanoparticles using simple CO-precipitation method

    Energy Technology Data Exchange (ETDEWEB)

    Farahmandjou, M.; Zarinkamar, M.; Firoozabadi, T. P., E-mail: farahamndjou@iauvaramin.ac.ir [Islamis Azad University, Varamin-Phisva Branch, Department of Physics, Varamin (Iran, Islamic Republic of)

    2016-11-01

    Synthesis of cerium oxide (CeO{sub 2}) nanoparticles was studied by new and simple co-precipitation method. The cerium oxide nanoparticles were synthesized using cerium nitrate and potassium carbonate precursors. Their physicochemical properties were characterized by high resolution transmission electron microscopy (HRTEM), scanning electron microscopy (Sem), X-ray diffraction (XRD), energy dispersive spectroscopy (EDS), Fourier transform infrared spectroscopy (Ftir) and UV-Vis spectrophotometer. XRD pattern showed the cubic structure of the cerium oxide nanoparticles. The average particle size of CeO{sub 2} was around 20 nm as estimated by XRD technique and direct HRTEM observations. The surface morphological studies from Sem and Tem depicted spherical particles with formation of clusters. The sharp peaks in Ftir spectrum determined the existence of CeO{sub 2} stretching mode and the absorbance peak of UV-Vis spectrum showed the bandgap energy of 3.26 eV. (Author)

  19. Inhaled Diesel Emissions Generated with Cerium Oxide Nanoparticle Fuel Additive Induce Adverse Pulmonary and Systemic Effects

    Science.gov (United States)

    Diesel exhaust (DE) exposure induces adverse cardiopulmonary effects. Cerium oxide nanoparticles added to diesel fuel (DECe) increases fuel burning efficiency but leads to altered emission characteristics and potentially altered health effects. Here, we evaluated whether DECe res...

  20. 14 CFR 136.5 - Additional requirements for Hawaii.

    Science.gov (United States)

    2010-01-01

    ... (CONTINUED) AIR CARRIERS AND OPERATORS FOR COMPENSATION OR HIRE: CERTIFICATION AND OPERATIONS COMMERCIAL AIR TOURS AND NATIONAL PARKS AIR TOUR MANAGEMENT National Air Tour Safety Standards § 136.5 Additional requirements for Hawaii. No person may conduct a commercial air tour in the State of Hawaii unless they...

  1. 14 CFR 136.3 - Letters of Authorization.

    Science.gov (United States)

    2010-01-01

    ...) AIR CARRIERS AND OPERATORS FOR COMPENSATION OR HIRE: CERTIFICATION AND OPERATIONS COMMERCIAL AIR TOURS AND NATIONAL PARKS AIR TOUR MANAGEMENT National Air Tour Safety Standards § 136.3 Letters of Authorization. Operators subject to this subpart who have Letters of Authorization may use the...

  2. 14 CFR 136.39 - Air tour management plans (ATMP).

    Science.gov (United States)

    2010-01-01

    ... curfews) for the adoption of quiet technology aircraft by commercial air tour operators conducting... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Air tour management plans (ATMP). 136.39... (CONTINUED) AIR CARRIERS AND OPERATORS FOR COMPENSATION OR HIRE: CERTIFICATION AND OPERATIONS COMMERCIAL...

  3. 14 CFR 136.13 - Helicopter performance plan and operations.

    Science.gov (United States)

    2010-01-01

    ... TRANSPORTATION (CONTINUED) AIR CARRIERS AND OPERATORS FOR COMPENSATION OR HIRE: CERTIFICATION AND OPERATIONS COMMERCIAL AIR TOURS AND NATIONAL PARKS AIR TOUR MANAGEMENT National Air Tour Safety Standards § 136.13 Helicopter performance plan and operations. (a) Each operator must complete a performance plan before...

  4. 14 CFR 136.11 - Helicopter floats for over water.

    Science.gov (United States)

    2010-01-01

    ... aircraft is no longer over water. (d) Air tour operators required to comply with paragraphs (a) and/or (b... (CONTINUED) AIR CARRIERS AND OPERATORS FOR COMPENSATION OR HIRE: CERTIFICATION AND OPERATIONS COMMERCIAL AIR TOURS AND NATIONAL PARKS AIR TOUR MANAGEMENT National Air Tour Safety Standards § 136.11...

  5. 14 CFR 136.9 - Life preservers for over water.

    Science.gov (United States)

    2010-01-01

    ... operator and pilot in command of a commercial air tour over water beyond the shoreline must ensure that a... (CONTINUED) AIR CARRIERS AND OPERATORS FOR COMPENSATION OR HIRE: CERTIFICATION AND OPERATIONS COMMERCIAL AIR TOURS AND NATIONAL PARKS AIR TOUR MANAGEMENT National Air Tour Safety Standards § 136.9 Life...

  6. 42 CFR 136.370 - Pregraduate scholarship grants.

    Science.gov (United States)

    2010-10-01

    ..., audiology, medical technology, dental hygiene, dental technicians, engineering, radiologic technology... J-8-Health Professions Pregraduate Scholarship Program for Indians § 136.370 Pregraduate scholarship..., registration or other types of credentials required for the practice of a health or allied health...

  7. Image modeling of compact starburst clusters: I. R136

    CERN Document Server

    Khorrami, Zeinab; Chesneau, Olivier

    2016-01-01

    Continuous progress in data quality from HST, recent multiwavelength high resolution spectroscopy and high contrast imaging from ground adaptive optics on large telescopes need modeling of R136 to understand its nature and evolutionary stage. To produce the best synthesized multiwavelength images of R136 we need to simulate the effect of dynamical and stellar evolution, mass segregation and binary stars fraction on the survival of young massive clusters with the initial parameters of R136 in the LMC, being set to the present knowledge of this famous cluster. We produced a series of 32 young massive clusters using the NBODY6 code. Each cluster was tracked with adequate temporal samples to follow the evolution of R136 during its early stages. To compare the NBODY6 simulations with observational data, we created the synthetic images from the output of the code. We used the TLUSTY and KURUCZ model atmospheres to produce the fluxes in HST/ WFPC2 filters. GENEVA isochrones were used to track the evolution of stars....

  8. Phenotype abnormality: 136 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 136 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u642i decreased efficiency... http://metadb.riken.jp/db/SciNetS_ria224i/cria224u2ria224u34i ... decreased efficiency ...

  9. 40 CFR 136.5 - Approval of alternate test procedures.

    Science.gov (United States)

    2010-07-01

    ... data submitted by the applicant and any available EPA analysis of those data. (4) Following a period of... PROGRAMS (CONTINUED) GUIDELINES ESTABLISHING TEST PROCEDURES FOR THE ANALYSIS OF POLLUTANTS § 136.5... is complete. If the application is incomplete, the applicant shall be informed of the...

  10. 18 CFR 367.1360 - Account 136, Temporary cash investments.

    Science.gov (United States)

    2010-04-01

    ... GAS ACT Balance Sheet Chart of Accounts Current and Accrued Assets § 367.1360 Account 136, Temporary... cash investments. 367.1360 Section 367.1360 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REGULATIONS UNDER THE PUBLIC UTILITY HOLDING COMPANY ACT OF...

  11. Cerium Aryloxides as Precursors for Monopentamethylcyclopentadienyl Organocerium(III) Compounds; X-Ray Crystal Structure of (η5-Pentamethylcyclopentadienyl)bis(2,6-di-t-butylphenoxo)cerium

    NARCIS (Netherlands)

    Heeres, Hero J.; Meetsma, Auke; Teuben, Jan H.

    1988-01-01

    Tris(2,6-di-t-butylphenoxo)cerium reacts with (C5Me5)Li in pentane to form (η5-C5Me5)bis(2,6-di-t-butylphenoxo)cerium, whose structure was established by X-ray crystallography and which, on subsequent reaction with LiCH(SiMe3)2, gives a novel mono(C5Me5)cerium-bisalkyl complex,

  12. Transformation of Cerium Oxide Nanoparticles from a Diesel Fuel Additive during Combustion in a Diesel Engine.

    Science.gov (United States)

    Dale, James G; Cox, Steven S; Vance, Marina E; Marr, Linsey C; Hochella, Michael F

    2017-02-21

    Nanoscale cerium oxide is used as a diesel fuel additive to reduce particulate matter emissions and increase fuel economy, but its fate in the environment has not been established. Cerium oxide released as a result of the combustion of diesel fuel containing the additive Envirox, which utilizes suspended nanoscale cerium oxide to reduce particulate matter emissions and increase fuel economy, was captured from the exhaust stream of a diesel engine and was characterized using a combination of bulk analytical techniques and high resolution transmission electron microscopy. The combustion process induced significant changes in the size and morphology of the particles; ∼15 nm aggregates consisting of 5-7 nm faceted crystals in the fuel additive became 50-300 nm, near-spherical, single crystals in the exhaust. Electron diffraction identified the original cerium oxide particles as cerium(IV) oxide (CeO2, standard FCC structure) with no detectable quantities of Ce(III), whereas in the exhaust the ceria particles had additional electron diffraction reflections indicative of a CeO2 superstructure containing ordered oxygen vacancies. The surfactant coating present on the cerium oxide particles in the additive was lost during combustion, but in roughly 30% of the observed particles in the exhaust, a new surface coating formed, approximately 2-5 nm thick. The results of this study suggest that pristine, laboratory-produced, nanoscale cerium oxide is not a good substitute for the cerium oxide released from fuel-borne catalyst applications and that future toxicity experiments and modeling will require the use/consideration of more realistic materials.

  13. Catalysts with Cerium in a Membrane Reactor for the Removal of Formaldehyde Pollutant from Water Effluents

    OpenAIRE

    2016-01-01

    We report the synthesis of cerium oxide, cobalt oxide, mixed cerium, and cobalt oxides and a Ce–Co/Al2O3 membrane, which are employed as catalysts for the catalytic wet oxidation (CWO) reaction process and the removal of formaldehyde from industrial effluents. Formaldehyde is present in numerous waste streams from the chemical industry in a concentration low enough to make its recovery not economically justified but high enough to create an environmental hazard. Common biological degradation ...

  14. Thermal Treatment of Cerium Oxide and Its Properties: Adsorption Ability versus Degradation Efficiency

    Directory of Open Access Journals (Sweden)

    Pavel Janoš

    2014-01-01

    Full Text Available Cerium oxide belongs to the most important heterogeneous catalysts, but its applicability as so-called reactive sorbent for the degradation of toxic chemicals was only recently discovered. For these purposes, cerium oxide is prepared by precipitation of insoluble cerium salts (carbonates with a subsequent thermal decomposition. Properties of cerium oxide prepared from the carbonate precursor are strongly affected by the temperature during the calcination. Main physicochemical properties of cerium oxide (specific surface area, crystallinity, and surface chemistry were examined in dependence on the calcination temperature. As the adsorptive properties of CeO2 are undoubtedly of great importance in the abovementioned applications, the adsorption ability was studied using an azo dye Acid Orange 7 (AO7 as a model compound. The highest sorption efficiency towards AO7 exhibited sorbents prepared at temperatures below 700°C, which was attributed mainly to the presence of hydroxyl groups on the oxide surface. A strong correlation was found between an adsorption efficiency of cerium oxides and their degradation efficiency for organophosphate pesticide parathion methyl. The >Ce–OH groups on the sorbent surface are responsible for the dye binding by the surface-complexation mechanism, and probably also for the nucleophilic cleavage of the P–O–aryl bond in the pesticide molecule.

  15. Characterization of a zinc-cerium flow battery

    Science.gov (United States)

    Leung, P. K.; Ponce-de-León, C.; Low, C. T. J.; Shah, A. A.; Walsh, F. C.

    The performance of a divided, parallel-plate zinc-cerium redox flow battery using methanesulfonic acid electrolytes was studied. Eight two and three-dimensional electrodes were tested under both constant current density and constant cell voltage discharge. Carbon felt and the three-dimensional platinised titanium mesh electrodes exhibited superior performance over the 2-dimensional electrodes. The charge and discharge characteristics of the redox flow battery were studied under different operating conditions and Zn/Ce reactant, as well as methansulfonic acid concentration. The cell performance improved at higher operating temperatures and faster electrolyte flow velocities. The number of possible cycles increased at reduced states of charge. During 15 min charge/discharge per cycle experiment, 57 cycles were obtained and the zinc reaction was found to be the limiting process during long term operation.

  16. Geometry of electromechanically active structures in Gadolinium - doped Cerium oxides

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yuanyuan; Zacharowicz, Renee; Frenkel, Anatoly I., E-mail: igor.lubomirsky@weizmann.ac.il, E-mail: anatoly.frenkel@yu.edu [Physics Department, Yeshiva University, 245 Lexington Avenue, New York, New York 10016 (United States); Kraynis, Olga; Lubomirsky, Igor, E-mail: igor.lubomirsky@weizmann.ac.il, E-mail: anatoly.frenkel@yu.edu [Department of Materials and Interfaces, Weizmann Institute of Science, Rehovot 76100 (Israel); Kas, Joshua [Department of Physics, University of Washington, Seattle, Washington 98195 (United States); Weng, Tsu-Chien; Sokaras, Dimosthenis [Stanford Synchrotron Radiation Lightsource, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

    2016-05-15

    Local distortions from average structure are important in many functional materials, such as electrostrictors or piezoelectrics, and contain clues about their mechanism of work. However, the geometric attributes of these distortions are exceedingly difficult to measure, leading to a gap in knowledge regarding their roles in electromechanical response. This task is particularly challenging in the case of recently reported non-classical electrostriction in Cerium-Gadolinium oxides (CGO), where only a small population of Ce-O bonds that are located near oxygen ion vacancies responds to external electric field. We used high-energy resolution fluorescence detection (HERFD) technique to collect X-ray absorption spectra in CGO in situ, with and without an external electric field, coupled with theoretical modeling to characterize three-dimensional geometry of electromechanically active units.

  17. Growth of transition metals on cerium tungstate model catalyst layers

    Science.gov (United States)

    Skála, T.; Tsud, N.; Stetsovych, V.; Mysliveček, J.; Matolín, V.

    2016-10-01

    Two model catalytic metal/oxide systems were investigated by photoelectron spectroscopy and scanning tunneling microscopy. The mixed-oxide support was a cerium tungstate epitaxial thin layer grown in situ on the W(1 1 0) single crystal. Active particles consisted of palladium and platinum 3D islands deposited on the tungstate surface at 300 K. Both metals were found to interact weakly with the oxide support and the original chemical state of both support and metals was mostly preserved. Electronic and morphological changes are discussed during the metal growth and after post-annealing at temperatures up to 700 K. Partial transition-metal coalescence and self-cleaning from the CO and carbon impurities were observed.

  18. Cerium intermetallics with TiNiSi-type structure

    Energy Technology Data Exchange (ETDEWEB)

    Janka, Oliver; Niehaus, Oliver; Poettgen, Rainer [Muenster Univ. (Germany). Inst. fuer Anorganische und Analytische Chemie; Chevalier, Bernard [Bordeaux Univ. CNRS (UPR 9048), Pessac (France). Inst. de Chimie de la Matiere Condensee de Bordeaux (ICMCB)

    2016-08-01

    Intermetallic compounds with the equiatomic composition CeTX that crystallize with the orthorhombic TiNiSi-type structure can be synthesized with electron-rich transition metals (T) and X = Zn, Al, Ga, Si, Ge, Sn, As, Sb, and Bi. The present review focusses on the crystal chemistry and chemical bonding of these CeTX phases and on their physical properties, {sup 119}Sn and {sup 121}Sb Moessbauer spectra, high-pressure effects, hydrogenation reactions and the formation of solid solutions in order to elucidate structure-property relationships. This paper is the final one of a series of four reviews on equiatomic intermetallic cerium compounds [Part I: Z. Naturforsch. 2015, 70b, 289; Part II: Z. Naturforsch. 2015, 70b, 695; Part III: Z. Naturforsch. 2016, 71b, 165].

  19. On the mixed nature of cerium conversion coatings

    Energy Technology Data Exchange (ETDEWEB)

    Botana, F.J.; Aballe, A.; Bethencourt, M.; Cano, M.J. [Cadiz Univ. (Spain). Dept. de Ciencia de los Materiales e Ingenieria Metalurgica y Quimica Inorganica; Marcos, M. [Cadiz Univ. (Spain). Dept. de Ingenieria Mecanica y Diseno Industrial

    2002-03-01

    Alternative pretreatments are currently under development in order to avoid the environmental impact produced by using surface finishing processes based on chromates. Some of the environmentally friendly alternatives proposed involve the use of lanthanide based compounds. In this study, conversion coatings on AA5083 (Al-Mg) samples developed using full immersion pretreatments in 500 ppm CeCl{sub 3} aqueous solutions have been investigated. Their microscopic and compositional features have been analyzed using SEM images and EDS spectra. From this analysis it has been determined that this layer over the surface of the samples is of a heterogeneous composition. This coating is formed by an alumina coating covering the aluminum matrix and dispersed cerium-rich islands deposited over the cathodic sites of the alloy. A characterization methodology is proposed based on the utilization of different electrochemical techniques, such as open circuit potential monitoring (OCP), linear polarization (LP) and electrochemical impedance spectroscopy (EIS). (orig.)

  20. Molecular dynamics simulations of oxygen Frenkel pairs in cerium dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Shiiyama, Kenichi, E-mail: shiiyama@nucl.kyushu-u.ac.j [Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Motooka 744, Nishi-ku, Fukuoka 819-0395 (Japan); Yamamoto, Tomokazu; Takahashi, Tatsuro [Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Motooka 744, Nishi-ku, Fukuoka 819-0395 (Japan); Guglielmetti, Aurore; Chartier, Alain [CEA-Saclay, DEN/DPC/SCP, 91191 Gif-sur-Yvette (France); Yasuda, Kazuhiro; Matsumura, Syo; Yasunaga, Kazufumi [Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Motooka 744, Nishi-ku, Fukuoka 819-0395 (Japan); Meis, Constantin [CEA-Saclay, INSTN, 91191 Gif-sur-Yvette (France)

    2010-10-01

    Molecular dynamics simulations of oxygen Frenkel pairs (FPs) in cerium dioxide (CeO{sub 2}) were carried out in order to understand their kinetic behavior. The results show that an oxygen FP recombine with the vacancy and the interstitial after the vacancy jump preferentially along the <1 0 0> direction. When multiple oxygen FPs are introduced, the interstitials aggregate into a (1 1 1) plate-like cluster at relatively lower temperature lower than 600 K, while they recombine with vacancies at elevated temperatures higher than 900 K within 10 ps. Molecular mechanics calculations of oxygen FPs on a (1 1 1) plane show that the formation energy per a FP decreases with increase of the number of FPs. The theoretical results are consistent with the transmission electron microscopy observations of formation of 1/9<1 1 1>{l_brace}1 1 1{r_brace} oxygen interstitial platelets in CeO{sub 2} under electron irradiation.

  1. Interplay of spin-orbit and entropic effects in cerium

    Energy Technology Data Exchange (ETDEWEB)

    Lanata, Nicola [Rutgers University; Yao, Yong-Xin [Ames Laboratory; Wang, Cai-Zhuang [Ames Laboratory; Ho, Kai-Ming [Ames Laboratory; Kotliar, Gabriel [Rutgers University

    2014-10-01

    We perform first-principles calculations of elemental cerium and compute its pressure-temperature phase diagram, finding good quantitative agreement with the experiments. Our calculations indicate that, while a signature of the volume-collapse transition appears in the free energy already at low temperatures, at higher temperatures this signature is enhanced because of the entropic effects, and originates an actual thermodynamical instability. Furthermore, we find that the catalyst determining this feature is—in all temperature regimes—a pressure-induced effective reduction of the f-level degeneracy due to the spin-orbit coupling. Our analysis suggests also that the lattice vibrations might be crucial in order to capture the behavior of the pressure-temperature transition line at large temperatures.

  2. EPDM composite membranes modified with cerium doped lead zirconate titanate

    Science.gov (United States)

    Zaharescu, T.; Dumitru, A.; Lungulescu, M. E.; Velciu, G.

    2016-01-01

    This study was performed on γ-irradiated ethylene-propylene diene terpolymer (EPDM) loaded with lead zirconate titanate. The inorganic phase has a perovskite structure with general formula Pb(Zr0.65-xCexTi0.35)O3. The three composites with different Ce dopant concentrations revealed the stabilization activity of filler against oxidation proved by chemiluminescence investigation in respect to pristine polymer. The presence of cerium low concentrations in the solid lead zirconate titanate nanoparticles causes significant slowing of oxidation rate during radiation exposure. The improvement in the stabilization feature of filler is correlated with the existence of traps, whose interaction with free radicals assumes medium energy due to their convenient depth.

  3. Effect of Surface Modification on Behaviors of Cerium Oxide Nanopowders

    Institute of Scientific and Technical Information of China (English)

    Li Mei; Shi Zhenxue; Liu Zhaogang; Hu Yanhong; Wang Mitang; Li Hangquan

    2007-01-01

    Study was made on the effect of surface modification on the behaviors of cerium oxide nanopowders. A surfactant-sodium dodecyl sulfate(C12H25SO4Na) was used to modify the surface of CeO2 powder particles. The unmodified and modified CeO2 powders were characterized by using a powder comprehensive characteristic tester, laser particle size analyzer, specific surface area tester, X-ray diffraction tester, and a scanning electron microscope. The testing and analysis results showed that C12H25SO4Na surface modification might increase the flowability and dispersity, and decrease the specific surface area and agglomeration of CeO2 powders. The mechanism of the surface modification of CeO2 powder particles was also discussed.

  4. Thermopower enhancement by encapsulating cerium in clathrate cages.

    Science.gov (United States)

    Prokofiev, A; Sidorenko, A; Hradil, K; Ikeda, M; Svagera, R; Waas, M; Winkler, H; Neumaier, K; Paschen, S

    2013-12-01

    The increasing worldwide energy consumption calls for the design of more efficient energy systems. Thermoelectrics could be used to convert waste heat back to useful electric energy if only more efficient materials were available. The ideal thermoelectric material combines high electrical conductivity and thermopower with low thermal conductivity. In this regard, the intermetallic type-I clathrates show promise with their exceedingly low lattice thermal conductivities. Here we report the successful incorporation of cerium as a guest atom into the clathrate crystal structure. In many simpler intermetallic compounds, this rare earth element is known to lead, through the Kondo interaction, to strong correlation phenomena including the occurrence of giant thermopowers at low temperatures. Indeed, we observe a 50% enhancement of the thermopower compared with a rare-earth-free reference material. Importantly, this enhancement occurs at high temperatures and we suggest that a rattling-enhanced Kondo interaction underlies this effect.

  5. Structure and Electronic Properties of Cerium Orthophosphate: Theory and Experiment

    Energy Technology Data Exchange (ETDEWEB)

    Adelstein, Nicole; Mun, B. Simon; Ray, Hannah; Ross Jr, Phillip; Neaton, Jeffrey; De Jonghe, Lutgard

    2010-07-27

    Structural and electronic properties of cerium orthophosphate (CePO{sub 4}) are calculated using density functional theory (DFT) with the local spin-density approximation (LSDA+U), with and without gradient corrections (GGA-(PBE)+U), and compared to X-ray diffraction and photoemission spectroscopy measurements. The density of states is found to change significantly as the Hubbard parameter U, which is applied to the Ce 4f states, is varied from 0 to 5 eV. The calculated structural properties are in good agreement with experiment and do not change significantly with U. Choosing U = 3 eV for LDSA provides the best agreement between the calculated density of states and the experimental photoemission spectra.

  6. The Spin Glass-Kondo Competition in Disordered Cerium Systems

    Science.gov (United States)

    Magalhaes, S. G.; Zimmer, F.; Coqblin, B.

    2013-10-01

    We discuss the competition between the Kondo effect, the spin glass state and a magnetic order observed in disordered Cerium systems. We present firstly the experimental situation of disordered alloys such as CeNi1 - xCux and then the different theoretical approaches based on the Kondo lattice model, with different descriptions of the intersite exchange interaction for the spin glass. After the gaussian approach of the Sherrington-Kirkpatrick model, we discuss the Mattis and the van Hemmen models. Then, we present simple cluster calculations in order to describe the percolative evolution of the clusters from the cluster spin glass to the inhomogeneous ferromagnetic order recently observed in CeNi1 - xCux disordered alloys and finally we discuss the effect of random and transverse magnetic field.

  7. Mechanochemical synthesis and spark plasma sintering of the cerium silicides

    Energy Technology Data Exchange (ETDEWEB)

    Alanko, Gordon A.; Jaques, Brian; Bateman, Allyssa [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Butt, Darryl P., E-mail: darrylbutt@boisestate.edu [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Center for Advanced Energy Studies, 995 University Boulevard, Idaho Falls, ID 83401 (United States)

    2014-12-15

    Highlights: • Ce{sub 5}Si{sub 3}, Ce{sub 3}Si{sub 2}, CeSi, CeSi{sub 2−x} and CeSi{sub 2} were mechanochemically synthesized. • Temperature and pressure were monitored to investigate reaction progress. • All syntheses proceeded through a MSR event followed by rapid solid-state diffusion. • Milling time before MSR correlates well with effective heat of formation. • Some synthesized material was densified by spark plasma sintering. - Abstract: The cerium silicides, Ce{sub 5}Si{sub 3}, Ce{sub 3}Si{sub 2}, CeSi, CeSi{sub 2−y}, and CeSi{sub 2−x}, have been prepared from the elements by mechanochemical processing in a planetary ball mill. Preparation of the cerium silicide Ce{sub 5}Si{sub 4} was unsuccessfully attempted and potential reasons for this are discussed. Temperature and pressure of the milling vial were monitored in situ to gain insight into the mechanochemical reaction kinetics, which include a mechanically-induced self-propagating reaction (MSR). Some prepared powders were consolidated by spark plasma sintering to high density. Starting materials, as-milled powders, and consolidated samples were characterized by X-ray diffraction, scanning electron microscopy, and energy dispersive spectroscopy. The results obtained help elucidate key questions in mechanochemical processing of intermetallics, showing first phase formation similar to thin films, MSR ignition times that are composition- and milling speed-dependent, and sensitivity of stable compound formation on the impact pressure. The results demonstrate mechanochemical synthesis as a viable technique for rare earth silicides.

  8. Mass and Double-Beta-Decay Q Value of Xe136

    Science.gov (United States)

    Redshaw, Matthew; Wingfield, Elizabeth; McDaniel, Joseph; Myers, Edmund G.

    2007-02-01

    The atomic mass of Xe136 has been measured by comparing cyclotron frequencies of single ions in a Penning trap. The result, with 1 standard deviation uncertainty, is M(Xe136)=135.907 214 484 (11) u. Combined with previous results for the mass of Ba136 [Audi, Wapstra, and Thibault, Nucl. Phys. A 729, 337 (2003)NUPABL0375-947410.1016/j.nuclphysa.2003.11.003], this gives a Q value (M[Xe136]-M[Ba136])c2=2457.83(37)keV, sufficiently precise for ongoing searches for the neutrinoless double-beta decay of Xe136.

  9. Effects of cerium nitrate on the growth and physiological characteristics in Cyclocarya paliurusseedlings

    Institute of Scientific and Technical Information of China (English)

    谢寅峰; 李颖; 刘娜娜; 张颖颖; 郭楠; 王涛; 尚绪岚

    2015-01-01

    Field studies were conducted to examine the effects of cerium on the growth and physiological characteristics ofCyclo-carya paliurusseedlings by spraying the foliage with different concentrations of cerium nitrate. Optimal concentrations of cerium ni-trate improved the relative growth yield of seedling height and stems and the soluble protein and sugar content of the leaves. Cerium nitrate also increased the concentration of secondary metabolites including triterpenoids, quercetin and kaempferol, mineral elements K, P, Mg, Mn, Fe and Cu, and the activities of superoxide dismutase (SOD), peroxidase (POX), and phenylalanine ammonia-lyase (PAL) in the leaves. The effects of cerium nitrate on these indices were dose dependent. A concentration of 0.20 mmol/L was optimal to promote the relative growth yield of seedling height, contents of soluble sugar, kaempferol, K, P, Cu, and activities of PAL, SOD, and POX, significantlyincreased by 54.61%, 14.71%, 55.19%, 105.2%, 74.5%, 133.3%, 80.48%, 25.35% and 22.54%, respectively, as compared with the control. However, the maximal increase in relative growth yield of stems, contents of triterpenoid, quercetin, Mg, Mn, and Fe was attained at 1.00 mmol/L treatment, which significantlyincreased by 87.00%, 80.56%, 452.44%, 93.2%, 29.4%, and 133.9%, respectively, compared with control check (CK). Correlation analysis revealed positive relationships between activities of PAL, SOD and contents of triterpenoid, quercetin and kaempferol within a certain concentration range of cerium nitrate. These re-sults suggested that an appropriate concentration of cerium not only was effective in the improvement of physiological function ofC. paliurus, but alsoincreased seedling resistance. Moreover, it stimulated the synthesis of medicinal components in leaves.

  10. Exposure and Health Effects Review of Engineered Nanoscale Cerium and Cerium Dioxide Associated with its Use as a Fuel Additive - NOW IN PRINT IN THE JOURNAL

    Science.gov (United States)

    Advances of nanoscale science have produced nanomaterials with unique physical and chemical properties at commercial levels that are now incorporated into over 1000 products. Nanoscale cerium (di) oxide (Ce02) has recently gained a wide range of applications which includes coatin...

  11. Exposure, Health and Ecological Effects Review of Engineered Nanoscale Cerium and Cerium Oxide Associated with its Use as a Fuel Additive

    Science.gov (United States)

    Advances of nanoscale science have produced nanomaterials with unique physical and chemical properties at commercial levels which are now incorporated into over 1000 products. Nanoscale cerium (di) oxide (CeO(2)) has recently gained a wide range of applications which includes coa...

  12. Thermochemical Modeling of the Uranium-Cerium-Oxygen System

    Energy Technology Data Exchange (ETDEWEB)

    Voit, Stewart L [ORNL; Besmann, Theodore M [ORNL

    2010-10-01

    with actinide materials, fundamental studies with uranium are performed using surrogate materials as stand-ins for transuranic elements. In most cases, cerium can be used as a suitable substitute for plutonium when performing O:M and sintering kinetics studies because of identical valence states. Differences exist between the magnitude of reported thermodynamic data of (U,Pu)O{sub x} and (U,Ce)O{sub x}, however the change in oxygen potential versus O:M follows the same trend for both systems. Cerium is also a major fission product element, and thus understanding its behavior in fuel is an important issue as well.

  13. Effects of precipitate aging time on the cerium-zirconium composite oxides

    Institute of Scientific and Technical Information of China (English)

    钟强; 崔梅生; 岳梅; 王琦; 王磊; 郭荣贵; 龙志奇; 黄小卫

    2014-01-01

    Cerium-zirconium composite oxides with high performance were synthesized by a co-precipitation method, using zirco-nium oxychloride and rare earth chloride as raw materials. The effects of precipitate aging time on the properties of cerium-zirconium composite oxides were investigated. The prepared cerium-zirconium composite oxides were characterized by X-ray diffraction (XRD), BET specific surface area, pulsed oxygen chemical adsorption, H2 temperature-programmed-reduction (H2-TPR), scanning electron microscopy (SEM), etc. The results showed that the precipitate aging time caused great effects on the properties of cerium zirconium composite oxides. With the increase of aging time, the cerium zirconium composite oxides showed enhanced specific sur-face area, good thermal stability, and high oxygen storage capacity (OSC). The best performance sample was obtained while the pre-cipitate aging time up to 48 h, with the specific surface area of 140.7 m2/g, and OSC of 657.24μmolO2/g for the fresh sample. Even after thermal aged under 1000 ºC for 4 h, the aged specific surface area was 41.6 m2/g, moreover with a good OSC of 569.9μmolO2/g.

  14. Structural and luminescent studies on nanosized cerium doped strontium barium niobate

    Science.gov (United States)

    John, Nuja; Nandakumar, K.

    2017-06-01

    The nanosized cerium doped Strontium Barium Niobate ceramic powder system have been synthesized by sol-gel technique. The X-ray diffraction measurement confirmed the structure of cerium doped Strontium Barium Niobate ceramic powder system. The absorption peaks were analysed by FTIR spectroscopy. Particle morphology and size of the powder were examined using SEM and TEM. Crystal quality and structure were also examined by micro raman spectra. The transmission electron microscopy image of cerium doped Strontium Barium Niobate nano powder system consist of particles with average size of 20 nm. A band gap of the system was measured by optical absorption spectra. Photoluminescence data were recorded at room temperature. The emission peaks were detected under excitation at 305 nm wavelength. The peaks are assigned to the cerium electron transition from lowest 5d level to 2F5/2 and 2F7/2 of 4f, respectively. The decay time were also measured for cerium doped Strontium Barium Niobate powder system.

  15. Catalysts with Cerium in a Membrane Reactor for the Removal of Formaldehyde Pollutant from Water Effluents.

    Science.gov (United States)

    Gutiérrez-Arzaluz, Mirella; Noreña-Franco, Luis; Ángel-Cuevas, Saúl; Mugica-Álvarez, Violeta; Torres-Rodríguez, Miguel

    2016-05-24

    We report the synthesis of cerium oxide, cobalt oxide, mixed cerium, and cobalt oxides and a Ce-Co/Al₂O₃ membrane, which are employed as catalysts for the catalytic wet oxidation (CWO) reaction process and the removal of formaldehyde from industrial effluents. Formaldehyde is present in numerous waste streams from the chemical industry in a concentration low enough to make its recovery not economically justified but high enough to create an environmental hazard. Common biological degradation methods do not work for formaldehyde, a highly toxic but refractory, low biodegradability substance. The CWO reaction is a recent, promising alternative that also permits much lower temperature and pressure conditions than other oxidation processes, resulting in economic benefits. The CWO reaction employing Ce- and Co-containing catalysts was carried out inside a slurry batch reactor and a membrane reactor. Experimental results are reported. Next, a mixed Ce-Co oxide film was supported on an γ-alumina membrane used in a catalytic membrane reactor to compare formaldehyde removal between both types of systems. Catalytic materials with cerium and with a relatively large amount of cerium favored the transformation of formaldehyde. Cerium was present as cerianite in the catalytic materials, as indicated by X-ray diffraction patterns.

  16. Production of cerium zinc molybdate nano pigment by innovative ultrasound assisted approach.

    Science.gov (United States)

    Patel, M A; Bhanvase, B A; Sonawane, S H

    2013-05-01

    Ultrasound assisted synthesis of yellow rare earth cerium zinc molybdate anticorrosion nanopigment is presented. This new class of pigment is eco-friendly alternatives to lead, cadmium and chromium pigment as these pigments contains carcinogenic species like Cr(6+) which is responsible for human disease. The synthesis of nanosized cerium zinc molybdate was carried out using cerium nitrate, sodium zinc molybdate as a precursor materials by conventional and ultrasound assisted chemical precipitation method without addition of emulsification agent. XRD, FTIR and elemental analysis confirm the formation of cerium zinc molybdate nanoparticles. The conductivity results indicate that conventional synthesis takes longer time, while in sonochemical technique (US), reaction completes within short period of time. Improved solute transfer rate, rapid nucleation, and formation of large number of nuclei are attributed to presence of cavitation. Saturation of the Ce(3+) ions reaches earlier in case of sonochemical technique which restricts the growth of particles hence smaller size is obtained. The crystallite size of cerium zinc molybdate was found to be 27nm from XRD analysis.

  17. Catalysts with Cerium in a Membrane Reactor for the Removal of Formaldehyde Pollutant from Water Effluents

    Directory of Open Access Journals (Sweden)

    Mirella Gutiérrez-Arzaluz

    2016-05-01

    Full Text Available We report the synthesis of cerium oxide, cobalt oxide, mixed cerium, and cobalt oxides and a Ce–Co/Al2O3 membrane, which are employed as catalysts for the catalytic wet oxidation (CWO reaction process and the removal of formaldehyde from industrial effluents. Formaldehyde is present in numerous waste streams from the chemical industry in a concentration low enough to make its recovery not economically justified but high enough to create an environmental hazard. Common biological degradation methods do not work for formaldehyde, a highly toxic but refractory, low biodegradability substance. The CWO reaction is a recent, promising alternative that also permits much lower temperature and pressure conditions than other oxidation processes, resulting in economic benefits. The CWO reaction employing Ce- and Co-containing catalysts was carried out inside a slurry batch reactor and a membrane reactor. Experimental results are reported. Next, a mixed Ce–Co oxide film was supported on an γ-alumina membrane used in a catalytic membrane reactor to compare formaldehyde removal between both types of systems. Catalytic materials with cerium and with a relatively large amount of cerium favored the transformation of formaldehyde. Cerium was present as cerianite in the catalytic materials, as indicated by X-ray diffraction patterns.

  18. Mechanism of chlorinating lanthanum oxide and cerium oxide with ammonium chloride

    Institute of Scientific and Technical Information of China (English)

    朱国才; 李赋屏; 肖明贵

    2003-01-01

    Using ammonium chloride(NH4Cl)as a chlorinating agent,the effects of chlorinating temperature,at 300℃ for 90 min,and have no advantage to chlorination of lanthanum and cerium oxides at higher temperature.The thermal decomposition of LaCl3 and CeCl3 is carried out to explore the mechanism of chlorinating lanthanum and cerium oxides.At the same time,the chlorination of lanthanum and cerium oxides is not devoted to the HCl decomposed from NH4Cl,but to NH4Cl directly taking part in the chlorination of La2O3 and CeO2.The lanthanum and cerium oxides in chlorination firstly form intermediate LaOCl and CeOCl,and then transfer to LaCl3 and CeCl3,fither prove the existence of the intermediates LaOCl and CeOCl.Therefore the chlorinating temperature and time should strictly be controlled when the lanthanum oxide and cerium oxide are chlorinated with NH4 Cl.And over-dosage of NH4 Cl should be also applied in the process of chlorination.

  19. Application of cerium chloride to improve the acid resistance of dentine.

    Science.gov (United States)

    Wegehaupt, Florian J; Sener, Beatrice; Attin, Thomas; Schmidlin, Patrick R

    2010-06-01

    To investigate the effect of cerium chloride, cerium chloride/fluoride and fluoride application on calcium release during erosion of treated dentine. Forty dentine samples were prepared from human premolars and randomly assigned to four groups (1-4). Samples were treated twice a day for 5 days, 30s each, with the following solutions: group 1 placebo, group 2 fluoride (Elmex fluid), group 3 cerium chloride and group 4 combined fluoride and cerium chloride. For the determination of acid resistance, the samples were consecutively eroded six times for 5 min with lactic acid (pH 3.0) and the calcium release in the acid was determined. Furthermore, six additional samples per group were prepared and used for EDS analysis. SEM pictures of these samples of each group were also captured. Samples of group 1 presented the highest calcium release when compared with the samples of groups 2-4. The highest acid resistance was observed for group 2. Calcium release in group 3 was similar to that of group 4 for the first two erosive attacks, after which calcium release in group 4 was lower than that of group 3. Generally, the SEM pictures showed a surface coating for groups 2-4. No deposits were observed in group 1. Although fluoride showed the best protective effect, cerium chloride was also able to reduce the acid susceptibility of dentine significantly, which merits further investigation. Copyright 2010 Elsevier Ltd. All rights reserved.

  20. Toenail cerium levels and risk of a first acute myocardial infarction: The EURAMIC and heavy metals study

    NARCIS (Netherlands)

    Gomez-Aracena, J.; Riemersma, R.A.; Veer, van 't P.; Kok, F.J.

    2006-01-01

    The association between cerium status and risk of first acute myocardial infarction (AMI) was examined in a case-control study in 10 centres from Europe and Israel. Cerium in toenails was assessed by neutron activation analysis in 684 cases and 724 controls aged 70years or younger. Mean concentratio

  1. Catalytic properties and biomedical applications of cerium oxide nanoparticles

    KAUST Repository

    Walkey, Carl D.

    2014-11-10

    Cerium oxide nanoparticles (nanoceria) have shown promise as catalytic antioxidants in the test tube, cell culture models and animal models of disease. However given the reactivity that is well established at the surface of these nanoparticles, the biological utilization of nanoceria as a therapeutic still poses many challenges. Moreover the form that these particles take in a biological environment, such as the changes that can occur due to a protein corona, are not well established. This review aims to summarize the existing literature on biological use of nanoceria, and to raise questions about what further study is needed to apply this interesting catalytic material to biomedical applications. These questions include: 1) How does preparation, exposure dose, route and experimental model influence the reported effects of nanoceria in animal studies? 2) What are the considerations to develop nanoceria as a therapeutic agent in regards to these parameters? 3) What biological targets of reactive oxygen species (ROS) and reactive nitrogen species (RNS) are relevant to this targeting, and how do these properties also influence the safety of these nanomaterials?

  2. Anti-angiogenic activity of heparin functionalised cerium oxide nanoparticles.

    Science.gov (United States)

    Lord, Megan S; Tsoi, Bonny; Gunawan, Cindy; Teoh, Wey Yang; Amal, Rose; Whitelock, John M

    2013-11-01

    Cerium oxide nanoparticles (nanoceria) are widely reported to be non-cytotoxic and modulate intracellular reactive oxygen species (ROS). In this study, nanoceria (dxRD = 12 nm) were functionalised with either 130 or 880 molecules of unfractionated heparin using the organosilane linker, 3-aminopropyltriethoxysilane. Nanoceria with a low level of heparin functionalisation were found to scavenge intracellular ROS to the same extent as unfunctionalised nanoceria and significantly more than cells exposed to medium only. In contrast, nanoceria with the highest level of heparin functionalisation were not as effective at scavenging intracellular ROS. Nanoceria were localised predominantly in the cytoplasm, while heparin-nanoceria were localised in both the cytoplasm and lysosomes. Together these data demonstrated that the level of nanoceria surface functionalisation with heparin determined the intracellular localisation and ROS scavenging ability of these particles. Additionally, heparin-nanoceria were effective in reducing endothelial cell proliferation indicating that they may find application in the control of angiogenesis in cancer in the future.

  3. Surface modification of promising cerium oxide nanoparticles for nanomedicine applications

    KAUST Repository

    Nanda, Himansu Sekhar

    2016-11-14

    Cerium oxide nanoparticles (CNPs) or nanoceria have emerged as a potential nanomedicine for the treatment of several diseases such as cancer. CNPs have a natural tendency to aggregate or agglomerate in their bare state, which leads to sedimentation in a biological environment. Since the natural biological environment is essentially aqueous, nanoparticle surface modification using suitable biocompatible hydrophilic chemical moieties is highly desirable to create effective aqueous dispersions. In this report, (6-{2-[2-(2-methoxy-ethoxy)-ethoxy]-ethoxy}-hexyl)triethoxysilane was used as a functional, biocompatible organosilane to modify the surface of CNPs to produce promising nanoparticles which open substantial therapeutic avenues. The surface modified nanoparticles were produced in situ via an ammonia-induced ethylene glycol-assisted precipitation method and were characterized using complimentary characterization techniques. The interaction between the functional moiety and the nanoparticle was studied using powerful cross polarization/magic angle sample spinning solid state nuclear magnetic resonance spectroscopy. The surface-modified nanoparticles were extremely small and demonstrated a significant improvement in aqueous dispersibility. Moreover, the existence of a strong ionic coordination between the functional moiety and the surface of the nanoparticle was realised, indicating that the surface modified nanoceria are stable and that the nanoparticles should demonstrate an enhanced circulation time in a biological environment. The surface modification approach should be promising for the production of CNPs for nanomedicine applications. © The Royal Society of Chemistry.

  4. Antioxidant Cerium Oxide Nanoparticles in Biology and Medicine.

    Science.gov (United States)

    Nelson, Bryant C; Johnson, Monique E; Walker, Marlon L; Riley, Kathryn R; Sims, Christopher M

    2016-05-17

    Previously, catalytic cerium oxide nanoparticles (CNPs, nanoceria, CeO2-x NPs) have been widely utilized for chemical mechanical planarization in the semiconductor industry and for reducing harmful emissions and improving fuel combustion efficiency in the automobile industry. Researchers are now harnessing the catalytic repertoire of CNPs to develop potential new treatment modalities for both oxidative- and nitrosative-stress induced disorders and diseases. In order to reach the point where our experimental understanding of the antioxidant activity of CNPs can be translated into useful therapeutics in the clinic, it is necessary to evaluate the most current evidence that supports CNP antioxidant activity in biological systems. Accordingly, the aims of this review are three-fold: (1) To describe the putative reaction mechanisms and physicochemical surface properties that enable CNPs to both scavenge reactive oxygen species (ROS) and to act as antioxidant enzyme-like mimetics in solution; (2) To provide an overview, with commentary, regarding the most robust design and synthesis pathways for preparing CNPs with catalytic antioxidant activity; (3) To provide the reader with the most up-to-date in vitro and in vivo experimental evidence supporting the ROS-scavenging potential of CNPs in biology and medicine.

  5. Antioxidant Cerium Oxide Nanoparticles in Biology and Medicine

    Directory of Open Access Journals (Sweden)

    Bryant C. Nelson

    2016-05-01

    Full Text Available Previously, catalytic cerium oxide nanoparticles (CNPs, nanoceria, CeO2-x NPs have been widely utilized for chemical mechanical planarization in the semiconductor industry and for reducing harmful emissions and improving fuel combustion efficiency in the automobile industry. Researchers are now harnessing the catalytic repertoire of CNPs to develop potential new treatment modalities for both oxidative- and nitrosative-stress induced disorders and diseases. In order to reach the point where our experimental understanding of the antioxidant activity of CNPs can be translated into useful therapeutics in the clinic, it is necessary to evaluate the most current evidence that supports CNP antioxidant activity in biological systems. Accordingly, the aims of this review are three-fold: (1 To describe the putative reaction mechanisms and physicochemical surface properties that enable CNPs to both scavenge reactive oxygen species (ROS and to act as antioxidant enzyme-like mimetics in solution; (2 To provide an overview, with commentary, regarding the most robust design and synthesis pathways for preparing CNPs with catalytic antioxidant activity; (3 To provide the reader with the most up-to-date in vitro and in vivo experimental evidence supporting the ROS-scavenging potential of CNPs in biology and medicine.

  6. 12 CFR 204.136 - Treatment of trust overdrafts for reserve requirement reporting purposes.

    Science.gov (United States)

    2010-01-01

    ... requirement reporting purposes. 204.136 Section 204.136 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM RESERVE REQUIREMENTS OF DEPOSITORY INSTITUTIONS (REGULATION D) Interpretations § 204.136 Treatment of trust overdrafts for reserve requirement reporting purposes. (a)...

  7. Candidates for chiral doublet bands in 136Nd

    Science.gov (United States)

    Mergel, E.; Petrache, C. M.; Lo Bianco, G.; Hübel, H.; Domscheit, J.; Roßbach, D.; Schönwaßer, G.; Nenoff, N.; Neußer, A.; Görgen, A.; Becker, F.; Bouchez, E.; Houry, M.; Hürstel, A.; Le Coz, Y.; Lucas, R.; Theisen, Ch.; Korten, W.; Bracco, A.; Blasi, N.; Camera, F.; Leoni, S.; Hannachi, F.; Lopez-Martens, A.; Rejmund, M.; Gassmann, D.; Reiter, P.; Thirolf, P. G.; Astier, A.; Buforn, N.; Meyer, M.; Redon, N.; Stezowski, O.

    The even-even nucleus 136Nd was studied via in-beam γ-ray spectroscopy using the 16O + 125Te reaction at 100 MeV and the EUROBALL array. One new dipole band was observed. Together with a previously identified dipole band, whose position in the level scheme is revised, the new band forms a doublet structure similar to the recently observed chiral bands in the odd-odd neighboring nuclei. This would be the first case of a chiral doublet in an even-even nucleus.

  8. Fine structure of the pygmy dipole resonance in (136)Xe.

    Science.gov (United States)

    Savran, D; Fritzsche, M; Hasper, J; Lindenberg, K; Müller, S; Ponomarev, V Yu; Sonnabend, K; Zilges, A

    2008-06-13

    The photoresponse of the semimagic N=82 nucleus (136)Xe was measured up to the neutron separation energy S(n) using the (gamma, gamma') reaction. A concentration of strong dipole excitations is observed well below S(n) showing a fragmented resonancelike structure. Microscopic calculations in the quasiparticle phonon model including complex configurations of up to three phonons agree well with the experimental data in the total integrated strength, in the shape and the fragmentation of the resonance, which allows us to draw conclusions on the damping mechanism of the pygmy dipole resonance.

  9. High-{ital j} Neutron Excitations Outside {sup 136}Xe

    Energy Technology Data Exchange (ETDEWEB)

    Talwar, R.; Kay, B. P.; Mitchell, A. J.; Adachi, S.; Entwisle, J. P.; Fujita, Y.; Gey, G.; Noji, S.; Ong, H. J.; Schiffer, J. P.; Tamii, A

    2017-08-17

    The nu 0h(9/2) and nu 0i(13/2) strength at Xe-137, a single neutron outside the N = 82 shell closure, has been determined using the Xe-136(alpha, He-3)Xe-137 reaction carried out at 100 MeV. We confirm the recent observation of the second 13/2(+) state and reassess previous data on the 9/2(-) states, obtaining spectroscopic factors. These new data provide additional constraints on predictions of the same single-neutron excitations at Sn-133.

  10. Low-lying quadrupole collectivity in {sup 136}Xe

    Energy Technology Data Exchange (ETDEWEB)

    Stahl, Christian; Leske, Joerg; Pietralla, Norbert; Reese, Michael [Institut fuer Kernphysik, Technische Universitaet Darmstadt (Germany); Bazzacco, Dino; Farnea, Enrico [Istituto Nazionale di Fisica Nucleare, Sezione di Padova, Padova (Italy); Gadea, Andres [Instituto de Fisica Corpuscular, CSIC-Universitat de Valencia, Valencia (Spain); Gottardo, Andrea [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Legnaro (Italy); Dipartimento di Fisica e Astronomia dell' Universita degli Studi di Padova, Padova (Italy); John, Philipp Rudolf; Michelagnoli, Caterina [Istituto Nazionale di Fisica Nucleare, Sezione di Padova, Padova (Italy); Dipartimento di Fisica e Astronomia dell' Universita degli Studi di Padova, Padova (Italy); Valiente-Dobon, Jose Javier [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Legnaro (Italy)

    2015-07-01

    We present recent results from our investigation of low-lying quadrupole collectivity in the semi-magic N=82 nucleus {sup 136}Xe. An experiment was performed at the Legnaro National Laboratory employing the AGATA demonstrator. Level-lifetimes and B(E2, 0{sup +}{sub 1}→2{sup +}{sub i})-values were determined from Coulomb excitation and by the continuous-angle DSA method exploiting AGATA's position resolution. 2{sup +}{sub i} - states up to i=7 were excited and analyzed.

  11. Self-Correction of Lanthanum-Cerium Halide Gamma Spectra (pre-print)

    Energy Technology Data Exchange (ETDEWEB)

    Ding Yuan, Paul Guss, and Sanjoy Mukhopadhyay

    2009-04-01

    Lanthanum-cerium halide detectors generally exhibit superior energy resolutions for gamma radiation detection compared with conventional sodium iodide detectors. However, they are also subject to self-activities due to lanthanum-138 decay and contamination due to beta decay in the low-energy region and alpha decay in the high-energy region. The detector’s self-activity and crystal contamination jointly contribute a significant amount of uncertainties to the gamma spectral measurement and affect the precision of the nuclide identification process. This paper demonstrates a self-correction procedure for self-activity and contamination reduction from spectra collected by lanthanum-cerium halide detectors. It can be implemented as an automatic self-correction module for the future gamma radiation detector made of lanthanum-cerium halide crystals.

  12. Mesoporous cerium oxide nanospheres for the visible-light driven photocatalytic degradation of dyes

    Directory of Open Access Journals (Sweden)

    Subas K. Muduli

    2014-04-01

    Full Text Available A facile, solvothermal synthesis of mesoporous cerium oxide nanospheres is reported for the purpose of the photocatalytic degradation of organic dyes and future applications in sustainable energy research. The earth-abundant, relatively affordable, mixed valence cerium oxide sample, which consists of predominantly Ce7O12, has been characterized by powder X-ray diffraction, X-ray photoelectron and UV–vis spectroscopy, and transmission electron microscopy. Together with N2 sorption experiments, the data confirms that the new cerium oxide material is mesoporous and absorbs visible light. The photocatalytic degradation of rhodamin B is investigated with a series of radical scavengers, suggesting that the mechanism of photocatalytic activity under visible-light irradiation involves predominantly hydroxyl radicals as the active species.

  13. Oxochloroalkoxide of the Cerium (IV and Titanium (IV as oxides precursor

    Directory of Open Access Journals (Sweden)

    Machado Luiz Carlos

    2002-01-01

    Full Text Available The Cerium (IV and Titanium (IV oxides mixture (CeO2-3TiO2 was prepared by thermal treatment of the oxochloroisopropoxide of Cerium (IV and Titanium (IV. The chemical route utilizing the Cerium (III chloride alcoholic complex and Titanium (IV isopropoxide is presented. The compound Ce5Ti15Cl16O30 (iOPr4(OH-Et15 was characterized by elemental analysis, FTIR and TG/DTG. The X-ray diffraction patterns of the oxides resulting from the thermal decomposition of the precursor at 1000 degreesC for 36 h indicated the formation of cubic cerianite (a = 5.417Å and tetragonal rutile (a = 4.592Å and (c = 2.962 Å, with apparent crystallite sizes around 38 and 55nm, respectively.

  14. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Science.gov (United States)

    Kaur, Parvinder; Kaur, Simranpreet; Singh, Gurinder Pal; Arora, Deepawali; Kumar, Sunil; Singh, D. P.

    2016-08-01

    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV-Vis absorption spectra and fluorescence spectra (λexc.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO4 units thus supporting the density results. The UV- Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  15. Structure, Morphology and Reducibility of Epitaxial Cerium Oxide Ultrathin Films and Nanostructures

    Directory of Open Access Journals (Sweden)

    Paola Luches

    2015-08-01

    Full Text Available Cerium oxide is a very interesting material that finds applications in many different fields, such as catalysis, energy conversion, and biomedicine. An interesting approach to unravel the complexity of real systems and obtain an improved understanding of cerium oxide-based materials is represented by the study of model systems in the form of epitaxial ultrathin films or nanostructures supported on single crystalline substrates. These materials often show interesting novel properties, induced by spatial confinement and by the interaction with the supporting substrate, and their understanding requires the use of advanced experimental techniques combined with computational modeling. Recent experimental and theoretical studies performed within this field are examined and discussed here, with emphasis on the new perspectives introduced in view of the optimization of cerium oxide-based materials for application in different fields.

  16. The role of chemical interactions between thorium, cerium, and lanthanum in lymphocyte toxicity.

    Science.gov (United States)

    Oliveira, Monica S; Duarte, Isabelle M; Paiva, Amanda V; Yunes, Samira N; Almeida, Carlos E; Mattos, Rita C; Sarcinelli, Paula N

    2014-01-01

    Thorium, cerium, and lanthanum are metals present in several types of minerals, the most common of which is monazite. Cerium and lanthanum are elements in the lanthanides series. Thorium, an actinide metal, is a hazardous element due to its radioactive characteristics. There is a lack of information describing the possible chemical interactions among these elements and the effects they may have on humans. Toxicological analyses were performed using cell viability, cell death, and DNA damage assays. Chemical interactions were evaluated based on the Loewe additivity model. The results indicate that thorium and cerium individually have no toxic effects on lymphocytes. However, thorium associated with lanthanum increases the toxicity of this element, thereby reducing the viability of lymphocytes at low concentrations of metals in the mixture.

  17. Effect of Impurities and Cerium on Stress Concentration Sensitivity of Al-Li Based Alloys

    Institute of Scientific and Technical Information of China (English)

    孟亮; 田丽

    2002-01-01

    A notch sensitivity factor was derived in order to evaluate the stress concentration sensitivity of Al-Li based alloys. The factor values for the Al-Li alloy sheets containing various contents of impurities and cerium addition were evaluated by determining the mechanical properties. It is found that the impurities Fe, Si, Na and K significantly enhance the stress concentration sensitivity of the alloys 2090 and 8090, whereas cerium addition reduces the stress concentration sensitivity to a certain degree for the high strength alloys. However, an excess amount of cerium addition in the high ductility alloy 1420 can significantly increase the stress concentration sensitivity. As compared with conventional aluminum alloys, the Al-Li based alloys generally show high stress concentration sensitivity. Therefore, a special attention must be paid to this problem in the practical application of Al-Li based alloys.

  18. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: dpsinghdr@yahoo.com [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)

    2016-08-15

    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  19. Study of phase transitions in cerium in shock-wave experiments

    Directory of Open Access Journals (Sweden)

    Zhernokletov M.V.

    2015-01-01

    Full Text Available Cerium has a complex phase diagram that is explained by the presence of structure phase transitions. Planar gauges were used in various combinations in experiments for determination of sound velocity dependence on pressure in cerium by the technique of PVDF gauge. The data of time dependence on pressure profiles with use of x(t diagrams and the D(u relation for cerium allowed the definition of the Lagrangian velocity of the unloading wave CLagr and the Eulerian velocity CEul by taking into account the compression σ. These results accords with data obtained by using the technique of VISAR and a manganin-based gauge, and calculated pressure dependence of isentropic sound velocity according to the VNIITF EOS. Metallography analysis of post-experimental samples did not find any changes in a phase composition.

  20. KINETIC AND MECHANISTIC STUDY OF OXIDATION OF ATENOLOL BY CERIUM (IV IN SULPHURIC ACIDIC MEDIUM

    Directory of Open Access Journals (Sweden)

    Fadnis G Anand

    2012-03-01

    Full Text Available The kinetics of oxidation of antihypertensive drug, atenolol by cerium (IV in sulphuric acidic medium has been studied spectrophotometrically at 360 nm. The reaction between cerium (IV and atenolol in acidic medium has exhibited 2:1 stoichiometry. The order of the reaction with respect to atenolol has been found to be one. The observed pseudo first order rate constants kobs increased with sulphuric acid and hydrogen ion concentrations where as decreased bisulphate ion concentration indicating the formation bisulphato reactive species of cerium (IV in the present reaction. The thermodynamic parameters have been evaluated from the temperature variation kinetic data. A possible mechanism is proposed which has been validated by derived rate law. An attempt has been made to use rate data for kinetic estimation of atenolol.KEYWORDS:

  1. Fabrication of Cerium Oxide and Uranium Oxide Microspheres for Space Nuclear Power Applications

    Energy Technology Data Exchange (ETDEWEB)

    Jeffrey A. Katalenich; Michael R. Hartman; Robert C. O' Brien

    2013-02-01

    Cerium oxide and uranium oxide microspheres are being produced via an internal gelation sol-gel method to investigate alternative fabrication routes for space nuclear fuels. Depleted uranium and non-radioactive cerium are being utilized as surrogates for plutonium-238 (Pu-238) used in radioisotope thermoelectric generators and for enriched uranium required by nuclear thermal rockets. While current methods used to produce Pu-238 fuels at Los Alamos National Laboratory (LANL) involve the generation of fine powders that pose a respiratory hazard and have a propensity to contaminate glove boxes, the sol-gel route allows for the generation of oxide microsphere fuels through an aqueous route. The sol-gel method does not generate fine powders and may require fewer processing steps than the LANL method with less operator handling. High-quality cerium dioxide microspheres have been fabricated in the desired size range and equipment is being prepared to establish a uranium dioxide microsphere production capability.

  2. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure

    Science.gov (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline

    2017-06-01

    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  3. Experimental Investigations on the Effects of Cerium Oxide Nanoparticle Fuel Additives on Biodiesel

    Directory of Open Access Journals (Sweden)

    V. Sajith

    2010-01-01

    Full Text Available This paper reports the results of experimental investigations on the influence of the addition of cerium oxide in the nanoparticle form on the major physicochemical properties and the performance of biodiesel. The physicochemical properties of the base fuel and the modified fuel formed by dispersing the catalyst nanoparticles by ultrasonic agitation are measured using ASTM standard test methods. The effects of the additive nanoparticles on the individual fuel properties, the engine performance, and emissions are studied, and the dosing level of the additive is optimized. Comparisons of the performance of the fuel with and without the additive are also presented. The flash point and the viscosity of biodiesel were found to increase with the inclusion of the cerium oxide nanoparticles. The emission levels of hydrocarbon and NOx are appreciably reduced with the addition of cerium oxide nanoparticles.

  4. Luminescence properties and decay kinetics of nano ZnO powder doped with cerium ions

    Energy Technology Data Exchange (ETDEWEB)

    Panda, Nihar Ranjan, E-mail: nihar@iitbbs.ac.in [Indian Institute of Technology Bhubaneswar, Bhubaneswar 751013, Orissa (India); Acharya, B.S., E-mail: bsacharya1950@gmail.com [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar 752054, Orissa (India); Singh, Th. Basanta [Luminescence Dating Laboratory, Manipur University, Imphal 795003 (India); Gartia, R.K. [Department of Physics, Manipur University, Imphal 795003 (India)

    2013-04-15

    ZnO nanopowders doped with cerium ions (1.2 and 1.5 at. wt.%) were synthesized through soft solution route using ultrasound. Sonication has been found to be an effective way for doping rare earth ions like cerium into ZnO. This was confirmed from energy dispersive analysis of X-rays (EDAX) measurement. Further, optical absorption and photoluminescence (PL) measurements corroborate this finding. X-ray diffraction (XRD) studies show the increase of crystallite size and unit cell volume with doping of cerium ions. Formation of fibrous structure of ZnO:Ce was observed from the transmission electron microscopy (TEM) measurements. Although the structural measurements indicate Ce{sup 4+} ion occupying substitutional site in ZnO, PL and absorption studies confirmed the presence of Ce{sup 3+} ion in the powder. The coexistence of Ce{sup 3+} and Ce{sup 4+} ions has been explained on the basis of conversion of Ce{sup 3+} to Ce{sup 4+} in the oxidizing environment. Thermoluminescence (TL) and photo-stimulated decay of luminescence (PSDL) decay studies give an idea of various trapping levels present in the band gap of ZnO. These traps release electrons during optical stimulation to give bimolecular kinetics in nano ZnO:Ce powders. -- Highlights: ► Sonication: an effective way of incorporation of cerium ions into ZnO. ► Site dependent characteristic emission of cerium. ► Energy transfer from host lattice to cerium ions. ► Mono and bimolecular kinetics of ZnO:Ce.

  5. Exposure of cerium oxide nanoparticles to kidney bean shows disturbance in the plant defense mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Majumdar, Sanghamitra [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Peralta-Videa, Jose R. [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Bandyopadhyay, Susmita [Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Castillo-Michel, Hiram [European Synchrotron Radiation Facility, B.P. 220-38043 Grenoble, Cedex (France); Hernandez-Viezcas, Jose-Angel [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States); Sahi, Shivendra [Department of Biology, Western Kentucky University, Bowling Green, KY 42101 (United States); Gardea-Torresdey, Jorge L., E-mail: jgardea@utep.edu [Department of Chemistry, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); Environmental Science and Engineering PhD Program, The University of Texas at El Paso, 500 West University Ave., El Paso, TX 79968 (United States); University of California Center for Environmental Implications of Nanotechnology (UC CEIN) (United States)

    2014-08-15

    Graphical abstract: - Highlights: • Kidney bean roots uptake nCeO{sub 2} primarily without biotransformation. • Cerium reached the root vascular tissues through gaps in the Casparian strip. • On longer exposure to high concentration, roots demonstrate stress response. • In leaves, guaiacol peroxidase plays a major role in ROS scavenging. - Abstract: Overwhelming use of engineered nanoparticles demands rapid assessment of their environmental impacts. The transport of cerium oxide nanoparticles (nCeO{sub 2}) in plants and their impact on cellular homeostasis as a function of exposure duration is not well understood. In this study, kidney bean plants were exposed to suspensions of ∼8 ± 1 nm nCeO{sub 2} (62.5 to 500 mg/L) for 15 days in hydroponic conditions. Plant parts were analyzed for cerium accumulation after one, seven, and 15 days of nCeO{sub 2} exposure. The primary indicators of stress like lipid peroxidation, antioxidant enzyme activities, total soluble protein and chlorophyll contents were studied. Cerium in tissues was localized using scanning electron microscopy and synchrotron μ-XRF mapping, and the chemical forms were identified using μ-XANES. In the root epidermis, cerium was primarily shown to exist as nCeO{sub 2}, although a small fraction (12%) was biotransformed to Ce(III) compound. Cerium was found to reach the root vascular tissues and translocate to aerial parts with time. Upon prolonged exposure to 500 mg nCeO{sub 2}/L, the root antioxidant enzyme activities were significantly reduced, simultaneously increasing the root soluble protein by 204%. In addition, leaf's guaiacol peroxidase activity was enhanced with nCeO{sub 2} exposure in order to maintain cellular homeostasis.

  6. Homoleptic cerium(III) and cerium(IV) nitroxide complexes: significant stabilization of the 4+ oxidation state.

    Science.gov (United States)

    Bogart, Justin A; Lewis, Andrew J; Medling, Scott A; Piro, Nicholas A; Carroll, Patrick J; Booth, Corwin H; Schelter, Eric J

    2013-10-07

    Electrochemical experiments performed on the complex Ce(IV)[2-((t)BuNO)py]4, where [2-((t)BuNO)py](-) = N-tert-butyl-N-2-pyridylnitroxide, indicate a 2.51 V stabilization of the 4+ oxidation state of Ce compared to [(n)Bu4N]2[Ce(NO3)6] in acetonitrile and a 2.95 V stabilization compared to the standard potential for the ion under aqueous conditions. Density functional theory calculations suggest that this preference for the higher oxidation state is a result of the tetrakis(nitroxide) ligand framework at the Ce cation, which allows for effective electron donation into, and partial covalent overlap with, vacant 4f orbitals with δ symmetry. The results speak to the behavior of CeO2 and related solid solutions in oxygen uptake and transport applications, in particular an inherent local character of bonding that stabilizes the 4+ oxidation state. The results indicate a cerium(IV) complex that has been stabilized to an unprecedented degree through tuning of its ligand-field environment.

  7. Feasibility of Substituting Cerium-Rich Metal by La-Pr-Ce Alloy in Magnesium Alloy

    Institute of Scientific and Technical Information of China (English)

    伏思静; 赵平

    2004-01-01

    In magnesium alloy ZM3, using cheap Lanthanum-praseodymium-cerium (LPC) rare earth as a substitute for rich-cerium rare earth was studied. The experimental results show that when the adding amount of LPC is between 2.53% and 3.33%, the tensile strength increases as the adding amount of LPC increases; when the amount of RE is 2.53% and 3.33%, the average tensile strength is 142.35, 153.65 MPa respectively. The results show that LPC rare earth replacing rich Ce rare earth is feasible for the tensile strength of ZM3.

  8. Effects of cerium salts on corrosion behaviors of Si–Zr hybrid sol–gel coatings

    OpenAIRE

    Yu Mei; Liu Yuxing; Liu Jianhua; Li Songmei; Xue Bing; Zhang You; Yin Xiaolin

    2015-01-01

    The present work examines the effects of cerium salts on corrosion behaviors of Si–Zr hybrid sol–gel coatings. The Si–Zr hybrid sol–gel coatings on a 2A12 aluminum substrate were prepared through hydrolysis and condensation of glycidoxypropyl-trimethoxy-silane (GTMS) and zirconium(IV) n-propoxide (TPOZ). Used as inhibitors for corrosion, three types of cerium salts (Ce(NO3)3, CeCl3, and Ce(CH3COO)3) were doped into the sol–gel coatings. Fourier transform infrared (FTIR) and scanning electron ...

  9. Photocatalytic action of cerium molybdate and iron-titanium oxide hollow nanospheres on Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Kartsonakis, I. A., E-mail: ikartsonakis@ims.demokritos.gr; Kontogiani, P.; Pappas, G. S.; Kordas, G. [NCSR ' DEMOKRITOS' , Sol-Gel Laboratory, Institute of Advanced Materials, Physicochemical Processes, Nanotechnology and Microsystems (Greece)

    2013-06-15

    This study is focused on the production of hollow nanospheres that reveal antibacterial action. Cerium molybdate and iron-titanium oxide hollow nanospheres with a diameter of 175 {+-} 15 and 221 {+-} 10 nm, respectively, were synthesized using emulsion polymerization and the sol-gel process. Their morphology characterization was accomplished using scanning electron microscopy. Their antibacterial action was examined on pure culture of Escherichia coli considering the loss of their viability. Both hollow nanospheres presented photocatalytic action after illumination with blue-black light, but those of cerium molybdate also demonstrated photocatalytic action in the dark. Therefore, the produced nanospheres can be used for antibacterial applications.

  10. Dissociation of outer membrane for Escherichia coli cell caused by cerium nitrate

    Institute of Scientific and Technical Information of China (English)

    陈爱美; 施庆珊; 冯劲; 欧阳友生; 陈仪本; 谭绍早

    2010-01-01

    The biological effect of cerium nitrate on the outer membrane(OM) of Escherichia coli(E.coli) cell was studied,and the antim-icrobial mechanism of rare earth elements was explored.The antimicrobial effect of cerium nitrate on E.coli cell was valued by plate count method,and the morphology change of E.coli cell was observed with scanning electron microscopy(SEM) and transmission electron microscopy(TEM).The results showed that the E.coli cell suspension was flocculated when the concentration of Ce(NO3)3?6H2O...

  11. Photocatalytic action of cerium molybdate and iron-titanium oxide hollow nanospheres on Escherichia coli

    Science.gov (United States)

    Kartsonakis, I. A.; Kontogiani, P.; Pappas, G. S.; Kordas, G.

    2013-06-01

    This study is focused on the production of hollow nanospheres that reveal antibacterial action. Cerium molybdate and iron-titanium oxide hollow nanospheres with a diameter of 175 ± 15 and 221 ± 10 nm, respectively, were synthesized using emulsion polymerization and the sol-gel process. Their morphology characterization was accomplished using scanning electron microscopy. Their antibacterial action was examined on pure culture of Escherichia coli considering the loss of their viability. Both hollow nanospheres presented photocatalytic action after illumination with blue-black light, but those of cerium molybdate also demonstrated photocatalytic action in the dark. Therefore, the produced nanospheres can be used for antibacterial applications.

  12. Synthesis and characterization of two dimensional metal organic framework of cerium with tetraaza macrocyclic

    Energy Technology Data Exchange (ETDEWEB)

    Bt Safiin, Nurul Atikah; Yarmo, Ambar; Yamin, Bohari M. [School of Chemical Science and Food Technology. Faculty Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor Darul Ehsan (Malaysia)

    2013-11-27

    A two dimensional metal organic framework containing cerium sufate layers and ethylenediaminium between layers was obtained by refluxing the mixture of cerium sulphate and 5,5,7,12,12,14-hexamethyl-1,4,8,11-tetraazacyclotetradeca-7, 14-diene bromide. The complex was characterized by infrared spectroscopy and microelemental analysis. X-ray study showed that the complex adopts eleven coordination environments about the central atom. Thermogravimetric study showed the removal of water molecules at about 70°C followed by a gradual mass loss until the whole structure collapsed at about 400°C.

  13. Cerium: catalytic properties, technological and environmental applications; Cerio: propriedades cataliticas, aplicacoes tecnologicas e ambientais

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Tereza S. [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Fisica; Hewer, Thiago L.R. [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica; Freire, Renato S. [Universidade de Sao Paulo (USP), Cubatao (Brazil). Centro de Capacitacao e Pesquisa em Meio Ambiente]. E-mail: tmartins@if.usp.br

    2007-07-01

    Cerium based-compounds have great importance in a wide range of technological applications, such as: fuel cell devices development; metallurgic processes, petroleum refining; glass and ceramic production. Recently, its catalytic properties have been also explored for environmental applications, especially those to prevent or to control atmospheric and water pollution. Subjects covered in this work include a brief description of the fundaments of cerium catalytic properties and some relevant technological applications. Special attention is given to its photo catalytic activity and its ability to degrade pollutants. Recent results and future prospect about these applications are also evaluated. (author)

  14. A corrosion resistant cerium oxide based coating on aluminum alloy 2024 prepared by brush plating

    Energy Technology Data Exchange (ETDEWEB)

    Tang Junlei; Han Zhongzhi [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.cn [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Tang Yuming [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

    2011-01-15

    Cerium oxide based coatings were prepared on AA2024 Al alloy by brush plating. The characteristic of this technology is that hydrogen peroxide, which usually causes the plating solution to be unstable, is not necessary in the plating electrolyte. The coating showed laminated structures and good adhesive strength with the substrate. X-ray diffraction and X-ray photoelectron spectroscopy analysis showed that the coatings were composed of Ce(III) and Ce(IV) oxides. The brush plated coatings on Al alloys improved corrosion resistance. The influence of plating parameters on structure and corrosion resistance of the cerium oxide based coating was studied.

  15. Synthesis and characterization of two dimensional metal organic framework of cerium with tetraaza macrocyclic

    Science.gov (United States)

    Bt Safiin, Nurul Atikah; Yarmo, Ambar; Yamin, Bohari M.

    2013-11-01

    A two dimensional metal organic framework containing cerium sufate layers and ethylenediaminium between layers was obtained by refluxing the mixture of cerium sulphate and 5,5,7,12,12,14-hexamethyl-1,4,8,11-tetraazacyclotetradeca-7, 14-diene bromide. The complex was characterized by infrared spectroscopy and microelemental analysis. X-ray study showed that the complex adopts eleven coordination environments about the central atom. Thermogravimetric study showed the removal of water molecules at about 70°C followed by a gradual mass loss until the whole structure collapsed at about 400°C.

  16. Evaluation of Antiproliferative Potential of Cerium Oxide Nanoparticles on HeLa Human Cervical Tumor Cell

    Directory of Open Access Journals (Sweden)

    Zoriţa Diaconeasa

    2015-05-01

    Full Text Available Cerium oxide nanoparticles (CeO2 nanoparticles as nanomaterials have promising biomedical applications. In this paper, the cytotoxicity induced by CONPs human cervical tumor cells was investigated. Cerium oxide nanoparticles were synthesized using the precipitation method. The nanoparticles were found to inhibit the proliferation of HeLa human cervical tumor cells in a dose dependent manner but did not showed to be cytotoxic as analyzed by MTT assay. The administrated treatment decreased the HeLa cell viability cells from 100% to 65% at the dose of 100 μg/mL.

  17. Cerium-based conversion coatings on magnesium alloys

    Science.gov (United States)

    Castano Londono, Carlos Eduardo

    This research is primarily focused on gaining a better understanding of the deposition and corrosion behavior of cerium-based conversion coatings (CeCCs) on AZ31B and AZ91D Mg alloys. Deposition of homogenous and protective CeCCs was highly dependent on the surface preparation steps. The best results were obtained when Mg samples underwent grinding, acid cleaning, and alkaline cleaning processes. This reduced the number of active cathodic sites and promoted the formation of a protective Al-rich Mg oxide/hydroxide layer. Electrochemical properties of the CeCCs were also strongly correlated with morphological, microstructural, and chemical characteristics. Protective CeCCs were deposited on both AZ31 and AZ91 Mg alloys using a range of deposition times (5 to 180 s) and temperatures (10 to 80 °C). However, shorter deposition times (5 s) and lower deposition temperatures (~10 °C) showed higher impedance and longer bath stability than other deposition conditions. The increase in impedance was related with fewer cracks and smaller nodule sizes. Additional investigations of post-treated CeCCs exposed to NaCl environments showed an increased in the total impedance. The increase in corrosion protection of the CeCCs was associated with an overall increase in coating thickness from 400 to 800 nm. A microstructural evolution from ~3 nm nodular nanocrystals of CeO2/CePO4*H2O embedded in an amorphous matrix to >50 nm CePO4*H2O nanocrystals was responsible for the electrochemically active corrosion protection. Exposure of CeCCs to sunlight in humid environments promoted the reduction of Ce(IV) into Ce(III) species compared to unexposed coatings. This reduction process was related with photocatalytic water oxidation reaction.

  18. Variations in Reactivity on Different Crystallographic Orientations of Cerium Oxide

    Energy Technology Data Exchange (ETDEWEB)

    Mullins, David R [ORNL; Albrecht, Peter M [ORNL; Calaza, Florencia C [ORNL

    2013-01-01

    Cerium oxide is a principal component in many heterogeneous catalytic processes. One of its key characteristics is the ability to provide or remove oxygen in chemical reactions. The different crystallographic faces of ceria present significantly different surface structures and compositions that may alter the catalytic reactivity. The structure and composition determine the number of coordination vacancies surrounding surface atoms, the availability of adsorption sites, the spacing between adsorption sites and the ability to remove O from the surface. To investigate the role of surface orientation on reactivity, CeO2 films were grown with two different orientations. CeO2(100) films were grown ex situ by pulsed laser deposition on Nb-doped SrTiO3(100). CeO2(111) films were grown in situ by thermal deposition of Ce metal onto Ru(0001) in an oxygen atmosphere. The chemical reactivity was characterized by the adsorption and decomposition of various molecules such as alcohols, aldehydes and organic acids. In general the CeO2(100) surface was found to be more active, i.e. molecules adsorbed more readily and reacted to form new products, especially on a fully oxidized substrate. However the CeO2(100) surface was less selective with a greater propensity to produce CO, CO2 and water as products. The differences in chemical reactivity are discussed in light of possible structural terminations of the two surfaces. Recently nanocubes and nano-octahedra have been synthesized that display CeO2(100) and CeO2(111) faces, respectively. These nanoparticles enable us to correlate reactions on high surface area model catalysts at atmospheric pressure with model single crystal films in a UHV environment.

  19. Thermoluminescence of cerium and terbium -doped calcium pyrophosphate

    Energy Technology Data Exchange (ETDEWEB)

    Roman L, J.; Cruz Z, E. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Lozano R, I. B.; Diaz G, J. A. I., E-mail: jesus.roman@nucleares.unam.mx [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, 11500 Mexico D. F. (Mexico)

    2015-10-15

    The aim of this work is to report the thermoluminescence (Tl) response of Calcium Pyrophosphate phosphor doped with Cerium and Terbium impurities (Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+}). The phosphors were synthesized using the co-precipitation method and annealed at 900 degrees C by two hours for obtain the β phase. The intentional doping with Ce and Tb ions was 1 at.% and 0.1 at.%, whereas in the EDS results the concentration of impurities was 0.39 at.% and 0.05 at.%, respectively. The superficial morphology of phosphor is mainly composed by thin wafers of different size. All samples were exposed to gamma rays from {sup 60}Co in the Gammacell-200 irradiator. The Tl response of the phosphor was measured from Rt up to 350 degrees C and under nitrogen atmosphere in a Harshaw TLD 3500 reader. The glow curves of the Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+} powders showed a broad intense Tl peak centered at 165 degrees C and a shoulder at approximate 260 degrees C was observed. A linear Tl response in the range of absorbed dose of 0.2 to 10 Gy was obtained. Tl glow curves were analyzed using the initial rise (IR)and computerized glow curve deconvolution methods to evaluate the kinetics parameters such as activation energy (E), frequency factor (s) and kinetic order (b). (Author)

  20. Gas sensing behaviour of cerium oxide and magnesium aluminate composites

    Indian Academy of Sciences (India)

    N NITHYAVATHY; V RAJENDRAN; L JOHN BERCHMANS; M MAAZA; S KRITHIKA; S ARUNMETHA

    2017-08-01

    Composites of cerium oxide (CeO$_2$) and magnesium aluminate (MgAl$_2$O$_4$) were prepared by the moltensalt synthesis (MSS) method at 1130 K. The composite samples were named as MA, MAC0.07 and MAC0.14 (at CeO$_2$:0, 0.07 and 0.14 g in MgAl$_2$O$_4$, respectively) and these were characterized by X-ray diffraction and energy-dispersiveX-ray analyses. It is seen that the microstructure of the composite samples are quite similar except for a small increasein particle size. The energy-dispersive X-ray analyses provide the presence of concentration of Ce, Mg, Al and O in thecomposite. Scanning electron microscope, coupled with energy-dispersive X-ray analysis (SEM-EDAX) was used to identifythe morphology, microstructure and elemental composition of the prepared samples. The decomposition and dissociationreactions of the precursors were determined using differential thermal and thermogravimetric analysis (TGA). A lone pairof the electron state was identified from the electro paramagnetic resonance spectrum. An optical energy band gap of 3.3 eV was calculated from the UV–Vis absorbance spectra. The gas response to changes in oxygen (O$_2$), carbon monoxide (CO) (at 0.5, 1.0 and 1.5 bar) and ethanol (at 50 and 100 ppm) was quantitatively analysed in all the samples at differentoperating temperatures (300-500 K). The magnitude of the temperature varied linearly regardless of the gas pressure insidethe chamber, by increasing the supply in the heating pad, mounted below the sensor sample. The composite samples indicatea good response to different gases with detection of the smallest change in gas pressure.

  1. Fate of cerium dioxide nanoparticles in endothelial cells: exocytosis

    Energy Technology Data Exchange (ETDEWEB)

    Strobel, Claudia, E-mail: Claudia.Strobel@med.uni-jena.de [Jena University Hospital – Friedrich Schiller University Jena, Department of Experimental Radiology, Institute of Diagnostic and Interventional Radiology (Germany); Oehring, Hartmut [Jena University Hospital – Friedrich Schiller University Jena, Institute of Anatomy II (Germany); Herrmann, Rudolf [University of Augsburg, Department of Physics (Germany); Förster, Martin [Jena University Hospital – Friedrich Schiller University Jena, Department of Internal Medicine I, Division of Pulmonary Medicine and Allergy/Immunology (Germany); Reller, Armin [University of Augsburg, Department of Physics (Germany); Hilger, Ingrid, E-mail: ingrid.hilger@med.uni-jena.de [Jena University Hospital – Friedrich Schiller University Jena, Department of Experimental Radiology, Institute of Diagnostic and Interventional Radiology (Germany)

    2015-05-15

    Although cytotoxicity and endocytosis of nanoparticles have been the subject of numerous studies, investigations regarding exocytosis as an important mechanism to reduce intracellular nanoparticle accumulation are rather rare and there is a distinct lack of knowledge. The current study investigated the behavior of human microvascular endothelial cells to exocytose cerium dioxide (CeO{sub 2}) nanoparticles (18.8 nm) by utilization of specific inhibitors [brefeldin A; nocodazole; methyl-β-cyclodextrin (MβcD)] and different analytical methods (flow cytometry, transmission electron microscopy, inductively coupled plasma mass spectrometry). Overall, it was found that endothelial cells were able to release CeO{sub 2} nanoparticles via exocytosis after the migration of nanoparticle containing endosomes toward the plasma membrane. The exocytosis process occurred mainly by fusion of vesicular membranes with plasma membrane resulting in the discharge of vesicular content to extracellular environment. Nevertheless, it seems to be likely that nanoparticles present in the cytosol could leave the cells in a direct manner. MβcD treatment led to the strongest inhibition of the nanoparticle exocytosis indicating a significant role of the plasma membrane cholesterol content in the exocytosis process. Brefeldin A (inhibitor of Golgi-to-cell-surface-transport) caused a higher inhibitory effect on exocytosis than nocodazole (inhibitor of microtubules). Thus, the transfer from distal Golgi compartments to the cell surface influenced the exocytosis process of the CeO{sub 2} nanoparticles more than the microtubule-associated transport. In conclusion, endothelial cells, which came in contact with nanoparticles, e.g., after intravenously applied nano-based drugs, can regulate their intracellular nanoparticle amount, which is necessary to avoid adverse nanoparticle effects on cells.

  2. Effects of Cerium Oxide Nanoparticles on Sorghum Plant Traits

    Science.gov (United States)

    Mu, L.; Chen, Y.; Darnault, C. J. G.; Rauh, B.; Kresovich, S.; Korte, C.

    2015-12-01

    Nanotechnology and nanomaterials are considered as the development of the modern science. However, besides with that wide application, nanoparticles arouse to the side effects on the environment and human health. As the catalyst of ceramics and fuel industry, Cerium (IV) oxide nanoparticles (CeO2 NPs) can be found in the environment following their use and life-cycle. Therefore, it is critical to assess the potential effects that CeO2 NPs found in soils may have on plants. In this study, CeO2 NPs were analyzed for the potential influence on the sorghum [Sorghum bicolor (L.) Moench] (Reg. no. 126) (PI 154844) growth and traits. The objectives of this research were to determine whether CeO2 NPs impact the sorghum germination and growth characteristics. The sorghum was grown in the greenhouse located at Biosystems Research Complex, Clemson University under different CeO2 NPs treatments (0mg; 100mg; 500mg; 1000mg CeO2 NPs/Kg soil) and harvested around each month. At the end of the each growing period, above ground vegetative tissue was air-dried, ground to 2mm particle size and compositional traits estimated using near-infrared spectroscopy. Also, the NPK value of the sorghum tissue was tested by Clemson Agriculture Center. After the first harvest, the result showed that the height of above ground biomass under the nanoparticles stress was higher than that of control group. This difference between the control and the nanoparticles treatments was significant (F>F0.05; LSD). Our results also indicated that some of the compositional traits were impacted by the different treatments, including the presence and/or concentrations of the nanoparticles.

  3. FASB Statement No. 136 clarifies transfers of assets.

    Science.gov (United States)

    Luecke, R W; Meeting, D T

    2000-03-01

    FASB Statement of Financial Accounting Standards No. 136, Transfers of Assets to a Not-for-Profit Organization or Charitable Trust That Raises or Holds Contributions for Others, provides guidance and establishes accounting standards for the transfer of assets from donors to not-for-profit organizations that may then transfer those same assets to a beneficiary organization. Recipient organizations that accept financial assets from a donor and agree to use those assets on behalf of a specified unaffiliated beneficiary or transfer those assets, the return on investment of those assets, or both to that beneficiary must recognize the assets received from the donor and recognize the assets' fair value as a liability to the beneficiary. The statement describes circumstances in which a transfer of assets to a recipient organization is accounted for as an asset and corresponding liability of the recipient organization, and as an asset and donation revenue by the beneficiary organization because the transfer is irrevocable.

  4. Cerium Oxide Nanoparticles and Bulk Cerium Oxide Leading to Different Physiological and Biochemical Responses in Brassica rapa.

    Science.gov (United States)

    Ma, Xingmao; Wang, Qiang; Rossi, Lorenzo; Zhang, Weilan

    2016-07-05

    Cerium oxide nanoparticles (CeO2NPs) have been incorporated into many commercial products, and their potential release into the environment through the use and disposal of these products has caused serious concerns. Despite the previous efforts and rapid progress on elucidating the environmental impact of CeO2NPs, the long-term impact of CeO2NPs to plants, a key component of the ecosystem, is still not well understood. The potentially different impact of CeO2NPs and their bulk counterparts to plants is also unclear. The main objectives of this study were (1) to investigate whether continued irrigation with solutions containing different concentrations of CeO2NPs (0, 10, and 100 mg/L) would induce physiological and biochemical adjustments in Brassica rapa in soil growing conditions and (2) to determine whether CeO2NPs and bulk CeO2 particles exert different impacts on plants. The results indicated that bulk CeO2 at 10 and 100 mg/L enhanced plant biomass by 28% and 35%, respectively, while CeO2NPs at equivalent concentrations did not. While the bulk CeO2 treatment resulted in significantly higher concentrations of hydrogen peroxide (H2O2) in plant tissues at the vegetative stage, CeO2NPs led to significantly higher H2O2 levels in plant tissues at the floral stage. The activity of superoxide dismutase (SOD) in Brassica rapa also displayed a growth-stage dependent response to different sizes of CeO2 while catalase (CAT) activity was not affected by either size of CeO2 throughout the life cycle of Brassica rapa. Altogether, the results demonstrated that plant responses to CeO2 exposure varied with the particle sizes and the growth stages of plants.

  5. Structural and electrochemical studies on the utilization of Cerium (Ce3+ as an additive for nickel hydroxide electrode

    Directory of Open Access Journals (Sweden)

    Marcio Vidotti

    2007-03-01

    Full Text Available This paper describes electrochemical and spectroscopic studies on the utilization of cerium atoms as additives for nickel hydroxide electrodes. Thin films were galvanostatically grown with different amounts of cerium and mixed electrodes were studied by electrochemical measurements and the spectroscopic technique. The electrochromic behavior was investigated by “in situ” experiments , while the amount of species was determined by ICP-OES. The addition of cerium to nickel hydroxide electrodes increases durability, due to modifications in the structural properties, as seen by Raman spectras.

  6. Growth and characterization of Sm3+ doped cerium oxalate single crystals

    Directory of Open Access Journals (Sweden)

    Minu Mary C

    2016-07-01

    Full Text Available Single crystals of Sm3+ doped cerium oxalate decahydrate were synthesized using single diffusion gel technique and the conditions influencing the size, morphology, nucleation density and quality of the crystals were optimized. Highly transparent single crystals of average size 3 mm × 2 mm × 1 mm with well-defined hexagonal morphology were grown during a time period of two weeks. X-ray powder diffraction analysis revealed that the grown crystals crystallize in the monoclinic system with space group P21/c as identical with the pure cerium oxalate. The various functional groups of the oxalate ligand and the water of crystallization were identified by Fourier transform infrared spectroscopy. The photoluminescence spectrum of the Sm3+ doped cerium oxalate indicated that the Sm3+ ions are optically active in the cerium oxalate matrix. The crystal has a strong and efficient orange red emission with a wavelength peak at 595 nm and hence can be effectively used for optical amplification. Microhardness measurements of the crystal revealed that they belong to the soft material category.

  7. Cerium (IV) oxide nanotubes prepared by low temperature deposition at normal pressure

    Energy Technology Data Exchange (ETDEWEB)

    Boehme, M; Fu, G; Ionescu, E; Ensinger, W, E-mail: mboehme@ca.tu-darmstadt.de [Department of Materials Science, Darmstadt University of Technology, D-64287 Darmstadt (Germany)

    2011-02-11

    This paper reports the synthesis of cerium dioxide nanotubes (CeNTs) by electroless deposition using ion-track-etched polycarbonate templates. To achieve nanotubes with thin walls and small surface roughness the tubes were generated by a several-step-containing procedure under aqueous conditions. The approach reported below will process open end nanotubes with well-defined outer diameter and wall thickness.

  8. Cerium (IV) oxide nanotubes prepared by low temperature deposition at normal pressure.

    Science.gov (United States)

    Boehme, M; Fu, G; Ionescu, E; Ensinger, W

    2011-02-11

    This paper reports the synthesis of cerium dioxide nanotubes (CeNTs) by electroless deposition using ion-track-etched polycarbonate templates. To achieve nanotubes with thin walls and small surface roughness the tubes were generated by a several-step-containing procedure under aqueous conditions. The approach reported below will process open end nanotubes with well-defined outer diameter and wall thickness.

  9. Formation of Self-Assembled Monolayer on Cerium Conversion Coated AZ31 Mg Alloy

    Science.gov (United States)

    Salman, S. A.; Akira, N.; Kuroda, K.; Okido, M.

    Magnesium alloys are recognized as alternatives to Al alloys and steel to reduce the weight of structural materials. However, a major obstacle to the widespread use of magnesium alloys is its poor corrosion resistance. Therefore, further surface treatment of magnesium and its alloy is important in meeting several industrial specifications. In a previous research, we investigated the surface treatment of AZ31 magnesium alloy using cerium conversion coating. The anticorrosion properties could be improved with the cerium treatment. In this present research, self-assembled monolayer (SAM) was adsorbed on the surface of cerium conversion coated AZ31 magnesium alloy. The SAM thin film was deposited using (Tridecafluoro-1, 1, 2, 2-tetrahydrooctyl) trimethoxysilane (FAS13) and Tetrakis(trimethylsiloxy)titanium (TTMS) as a catalyst. The corrosion resistance of cerium conversion coated AZ31 Mg alloy was improved with SAM post treatment. Furthermore, the contact angle increases from 13 deg. to 169 deg. indicating to production of super hydrophobic surface with SAM post treatment.

  10. Phenotypic and genomic responses to titanium dioxide and cerium oxide nanoparticles in Arabidopsis germinants

    Science.gov (United States)

    The effects of exposure to two nanoparticles (NPs) -titanium dioxide (nano-titania) and cerium oxide (nano-ceria) at 500 mg NPs L-1 on gene expression and growth in Arabidopsis thaliana germinants were studied using microarrays and phenotype studies. After 12 days post treatment,...

  11. Characteristics of cerium-gadolinium oxide (CGO) suspensions as a function of dispersant and powder properties

    DEFF Research Database (Denmark)

    Phair, John; Lönnroth, Nadja; Lundberg, Mats;

    2009-01-01

    A series of concentrated suspensions ( = 0.18–0.34) of cerium-gadolinium oxide (CGO) in terpineol were prepared as a function of dispersant, powder surface area and solids concentration. The stability of the suspensions was assessed by rheological measurements including viscosity and oscillatory...

  12. On the synthesis of monopentamethylcyclopentadienyl derivatives of yttrium, lanthanum, and cerium

    NARCIS (Netherlands)

    Booij, Martin; Kiers, Niklaas H.; Heeres, Hero J.; Teuben, Jan H.

    1989-01-01

    Two routes leading to monopentamethylcyclopentadienyl-yttrium, -lanthanum and -cerium complexes have been explored. Transmetallation of LnCl3(THF)x with Cp*Li (Cp* = C5Me5) proved useful only in some particular cases. Acid-base reactions of homoleptic complexes LnR3 with Cp*H generally gave Cp*2LnR

  13. Effects of Cerium on Alloy Elements Distribution in Ferrous Matrix Material

    Institute of Scientific and Technical Information of China (English)

    刘英才; 刘俊友; 尹衍生; 刘国权

    2001-01-01

    The effect of the addition of rare earths in Fe-based high chromium alloy powders on elements distribution in matrix materials and mechanical properties were studied. The results show that the addition of cerium can increase the chromium amount in carbonides and increase the micro-hardness after carbonization and the wear-resistant property of materials.

  14. Transient Dynamics of Fluoride-Based High Concentration Erbium/Cerium Co-Doped Fiber Amplifier

    Institute of Scientific and Technical Information of China (English)

    S. S-H. Yam; Y. Akasaka; Y. Kubota; R. Huang; D. L. Harris; J. Pan

    2003-01-01

    We designed and evaluated a fluoride-based high concentration erbium/ cerium co-doped fiber amplifier. It is suitable for Metropolitan Area Networks due to faster transient, flatter (unfiltered) gain, smaller footprint and gain excursion than its silica-based counterpart.

  15. Anti-erosive potential of amine fluoride, cerium chloride and laser irradiation application on dentine.

    Science.gov (United States)

    Wegehaupt, Florian J; Sener, Beatrice; Attin, Thomas; Schmidlin, Patrick R

    2011-12-01

    Ninety-six dentine samples were prepared from human premolars and randomly assigned to eight groups (G1-G8). Samples were treated for 30s with the following solutions: placebo (G1/G2), amine fluoride (Elmex fluid; G3/G4), cerium chloride (G5/G6) and combined fluoride/cerium chloride application (G7/G8). Samples of groups G2, G4, G6 and G8 were additionally irradiated with a carbon dioxide laser through the solutions for 30s. Acid resistance was assessed in a six-time 5-min consecutive lactic acid (pH 3.0) erosion model and calcium release was determined by atomic absorption spectroscopy (AAS). Furthermore, six additional samples per group were prepared and subjected to EDS-analysis. In the non-irradiated groups, specimens of G1 (placebo) showed the highest calcium release when compared to the other treatments (G3, G5 and G7). The highest acid resistance was observed for G7. In G3, calcium release was lower than in G5, but higher than in G7. In general (except for the placebo groups), calcium release in the laser-irradiated groups was higher compared with the respective non-irradiated groups. EDS showed a replacement of calcium by cerium and of phosphor by fluoride. The highest anti-erosive potential was found after combined cerium chloride and amine fluoride application. Laser irradiation had not adjunctive effect. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Synthesis and Characterization of the First Organically Templated Layered Cerium Phosphate Fluoride

    National Research Council Canada - National Science Library

    Ranbo Yu; Dan Wang; Shintaro Ishiwata; Takashi Saito; Masaki Azuma; Mikio Takano; Yunfa Chen; Jinghai Li

    2004-01-01

      A novel organically templated layered cerium phosphate fluoride [(CH2)2(NH3)2]0.5[CeIVF3(HPO4)] has been synthesized by hydrothermal synthesis technology, and characterized by means of single-crystal X-ray diffraction...

  17. Growth and characterization of cerium lanthanum oxalate crystals grown in hydro-silica gel

    Energy Technology Data Exchange (ETDEWEB)

    John, M.V.; Ittyachen, M.A. [Mahatma Gandhi Univ., Kerala (India). School of Pure and Applied Physics

    2001-07-01

    Single crystals of mixed cerium lanthanum oxalate (CLO) are grown by gel method. Over the hydrosilica gel prepared by mixing oxalic acid and sodium meta silicate, a mixture of aqueous solutions of cerium nitrate and lanthanum nitrate are poured gently. Cerium and lanthanum ions diffuse into the gel and react with oxalic acid to give colorless, transparent cerium lanthanum oxalate crystals with in a few days. Different growth parameters give crystals of various dimensions. Infrared (IR) spectrum confirms the presence of water molecules and carboxylic acid. X-ray diffraction (XRD) pattern of these samples reveals the crystalline nature. Diffraction peaks are indexed. Unit cell parameters are determined. Thermogravimetric analysis (TGA) and differential thermal analysis (DTA) data support the presence of 9 H{sub 2}O molecules attached to the CLO crystal lattice which are lost around 200 C as revealed by the endotherm record. Exothermic peak around 350 C-425 C shows the release of CO and CO{sub 2}. Elemental analysis done by energy dispersive X-ray fluorescence analysis (EDXRF) for the mixed rare earth compound is almost in good agreement with experimental and theoretical values. (orig.)

  18. Release of cerium dibutylphosphate corrosion inhibitors from highly filled epoxy coating systems

    NARCIS (Netherlands)

    Soestbergen, M. van; Baukh, V.; Erich, S.J.F.; Huinink, H.P.; Adan, O.C.G.

    2014-01-01

    Carcinogenic chromates are phased out as corrosion inhibitors in organic coatings, and are replaced by benign alternatives. Cerium-based compounds are excellent corrosion inhibitors in an aqueous environment. However, whether they are effective as corrosion inhibitor in an organic coating also depen

  19. Titrimetric and Spectrophotometric Methods for the Assay of Ketotifen Using Cerium(IV and Two Reagents

    Directory of Open Access Journals (Sweden)

    Madihalli Srinivas Raghu

    2013-01-01

    Full Text Available One titrimetric and two spectrophotometric methods are described for the determination of ketotifen fumarate (KTF in bulk drug and in tablets using cerium(IV as the oxidimetric agent. In titrimetry (method A, the drug was treated with a measured excess of cerium(IV in H2SO4 medium and after a standing time of 10 min, the surplus oxidant was determined by back titration with iron(II. The spectrophotometric procedures involve addition of a known excess of cerium(IV to KTF in acid medium followed by the determination of unreacted oxidant by reacting with either p-dimethyl amino benzaldehyde and measuring the resulting colour at 460 nm (method B or o-dianisidine and subsequent measurement of the absorbance of coloured product at 470 nm (method C. Titrimetric assay is based on a 1 : 2 reaction stoichiometry between KTF and cerium(IV and the method is applicable over 2–18 mg range. In spectrophotometry, regression analysis of Beer’s law plots showed a good correlation in 0.4–8.0 and 0.4–10.0 g mL−1 KTF ranges for method B and method C, respectively, and the corresponding molar absorptivity coefficients are calculated to be and  L mol−1 cm−1.

  20. 4d → 4f resonance in photoabsorption of cerium ion Ce3+ and endohedral cerium in fullerene complex {\\rm{Ce}}@{{{\\rm{C}}}_{82}}^{+}

    Science.gov (United States)

    Schrange-Kashenock, G.

    2016-09-01

    The theoretical investigation of the single-photoionization spectra in the 4d-resonance region (120-150 eV) for the ionic cerium Ce3+ and cerium in the endohedral complex {{Ce}}@{{{{C}}}82}+ (in practice, {{{Ce}}}3+@{{{{C}}}82}2-) is presented. The fullerene cage is modeled by ab initio spherical jellium shell with an accurate account for the real distribution of carbon electron density. The oscillator strengths are calculated within the multiconfiguration Dirac-Fock (MCDF) approach for phototransitions from the outermost shells of the ion Ce3+ with and without the influence of the potential generated by a fullerene cage. It is shown that the integrated oscillator strengths have the main contribution from the Ce3+ 4d → 4f (ten possible from the phototransitions {}2F{7/2,5/2}\\to {}2D{3/2,5/2},{}2F{5/2,7/2},{}2G{5/2,7/2}) resonance photoexcitations. The corresponding precise MCDF values for the oscillator strengths and the transition energies are presented for the first time. It is demonstrated that the resonance {f}4d\\to 4f oscillator strengths are slightly affected by the presence of the cage potential, despite the fact that the spectral levels structure is changed when the effect of this potential is included. The Auger 4d -1 decay from the cerium free ion Ce3+ and the encapsulated endohedral ion Ce3+@ are considered within the two-step model and the corresponding Lorentzian profiles are presented. This model clearly reveals the correspondence of the complex resonance profile in the Ce3+ photoabsorption to the fine structure of ion energy levels. The smoothing of the resonance profile in the photoabsorption of the endohedral system {{Ce}}@{{{{C}}}82}+ compared with the free ion Ce3+ is attributed to increasing the linewidths of the Auger transitions. This increase is estimated from the relevant experiment (Müller et al 2008 Phys. Rev. Lett. 101 133001) to be strong; as at least three times the value for an isolated ion. The presence of the confining fullerene

  1. Effect of cerium substitution on structural and magnetic properties of magnetite nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Padalia, Diwakar, E-mail: Padalia.diwakar@gmail.com [Department of Physics, G.B.Pant University of Agriculture & Technology, Pantnagar, Uttrakhand (India); Johri, U.C. [Department of Physics, G.B.Pant University of Agriculture & Technology, Pantnagar, Uttrakhand (India); Zaidi, M.G.H. [Supercritical Fluid Processing Laboratory, Department of Chemistry, G.B.Pant University of Agriculture & Technology, Pantnagar, Uttrakhand (India)

    2016-02-01

    The current work presents the synthesis and properties of cerium doped magnetite (Fe{sub 3}O{sub 4}) nanoparticles synthesized by standard chemical co-precipitation method using NH{sub 4}OH as co-precipitating agent. The effects of cerium ion substitution on structural and magnetic properties of magnetite (Fe{sub 3}O{sub 4}) nanoparticles were reported. These materials were characterized by X-ray powder diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and vibrating sample magnetometer (VSM). The cerium content has a significant influence on structural and magnetic properties. The X-ray diffraction study confirmed the formation of single-phase magnetite with space group Fd3m and crystallite size ranging from 39 to 58 nm. The addition of cerium resulted in a reduction of crystallite size and an increase of cell parameters. FTIR measurements confirmed the formation of different samples and suggested that the reduction of Fe{sup +3} to Fe{sup +2} preferred on a site adjacent to Ce{sup +4}. Magnetic measurements revealed that the saturation magnetization (Ms) and remanence (M{sub r}) decreased while the coercivity (H{sub C}) and squareness (M{sub r}/M{sub S}) increased with increasing cerium content. - Highlights: • There is an increase in cell parameters and strain with Ce-content. • Samples show the presence of secondary phase after 1.0% doping level. • Ce-ions prefer octahedral sites and charge neutrality is accompanied by Fe{sup +3} → Fe{sup +2}. • Magnetization decreases due to weakening of the super exchange interactions. • Squareness and coercivity start to increase with Ce content.

  2. Magnetic hysteresis of cerium doped bismuth ferrite thin films

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, Surbhi [Department of Physics and Astrophysics, University of Delhi (India); Tomar, Monika [Physics Department, Miranda House, University of Delhi (India); Gupta, Vinay, E-mail: drguptavinay@gmail.com [Department of Physics and Astrophysics, University of Delhi (India)

    2015-03-15

    The influence of Cerium doping on the structural and magnetic properties of BiFeO{sub 3} thin films have been investigated. Rietveld refinement of X-ray diffraction data and successive de-convolution of Raman scattering spectra of Bi{sub 1−x}Ce{sub x}FeO{sub 3} (BCFO) thin films with x=0–0.20 reflect the single phase rhombohedral (R3c) formation for x<0.08, whereas concentration-driven gradual structural phase transition from rhombohedral (R3c) to partial tetragonal (P4mm) phase follows for x≥0.08. All low wavenumber Raman modes (<300 cm{sup −1}) showed a noticeable shift towards higher wavenumber with increase in doping concentration, except Raman E-1 mode (71 cm{sup −1}), shows a minor shift. Sudden evolution of Raman mode at 668 cm{sup −1}, manifested as A{sub 1}-tetragonal mode, accompanied by the shift to higher wavenumber with increase in doping concentration (x) affirm partial structural phase transition. Anomalous wasp waist shaped (M–H) hysteresis curves with improved saturation magnetization (M{sub s}) for BCFO thin films is attributed to antiferromagnetic interaction/hybridization between Ce 4f and Fe 3d electronic states. The contribution of both hard and soft phase to the total coercivity is calculated. Polycrystalline Bi{sub 0.88}Ce{sub 0.12}FeO{sub 3} thin film found to exhibit better magnetic properties with M{sub s}=15.9 emu/g without any impure phase. - Highlights: • Synthesis of single phase Bi{sub 1−x}Ce{sub x}FeO{sub 3} thin films with (x=0–0.2) on cost effective corning glass and silicon substrates using CSD technique. • Structural modification studies using Rietveld refinement of XRD and de-convolution of Raman spectra revealed partial phase transition from rhombohedral (R3c) to tetragonal (P4mm) phase. • Possible reasons for origin of pinched magnetic behavior of BCFO thin films are identified. • Contribution of both hard and soft magnetic phase in coercivity of BCFO thin films is calculated and practical

  3. Radioactive waste forms stabilized by ChemChar gasification: characterization and leaching behavior of cerium, thorium, protactinium, uranium, and neptunium.

    Science.gov (United States)

    Marrero, T W; Morris, J S; Manahan, S E

    2004-02-01

    The uses of a thermally reductive gasification process in conjunction with vitrification and cementation for the long-term disposal of low level radioactive materials have been investigated. gamma-ray spectroscopy was used for analysis of carrier-free protactinium-233 and neptunium-239 and a stoichiometric amount of cerium (observed cerium-141) subsequent to gasification and leaching, up to 48 days. High resolution ICP-MS was used to analyze the cerium, thorium, and uranium from 46 to 438 days of leaching. Leaching procedures followed the guidance of ASTM Procedure C 1220-92, Standard Test Method for Static Leaching of Monolithic Waste Forms for Disposal of Radioactive Waste. The combination of the thermally reductive pretreatment, vitrification and cementation produced a highly non-leachable form suitable for long-term disposal of cerium, thorium, protactinium, uranium, and neptunium.

  4. A chemical-spectrochemical method for the determination of rare earth elements and thorium in cerium minerals

    Science.gov (United States)

    Rose, H.J.; Murata, K.J.; Carron, M.K.

    1954-01-01

    In a combined chemical-spectrochemical procedure for quantitatively determining rare earth elements in cerium minerals, cerium is determined volumetrically, a total rare earths plus thoria precipitate is separated chemically, the ceria content of the precipitate is raised to 80??0 percent by adding pure ceria, and the resulting mixture is analyzed for lanthanum, praseodymium, neodymium, samarium, gadolinium, yttrium, and thorium spectrochemically by means of the d.c. carbon arc. Spectral lines of singly ionized cerium are used as internal standard lines in the spectrochemical determination which is patterned after Fassel's procedure [1]. Results of testing the method with synthetic mixtures of rare earths and with samples of chemically analyzed cerium minerals show that the coefficient of variation for a quadruplicate determination of any element does not exceed 5??0 (excepting yttrium at concentrations less than 1 percent) and that the method is free of serious systematic error. ?? 1954.

  5. Convenient synthesis of substituted pyrroles via a cerium (IV ammonium nitrate (CAN-catalyzed Paal–Knorr reaction

    Directory of Open Access Journals (Sweden)

    Ahmed Kamal

    2016-07-01

    Full Text Available A screening of various cerium salts for promoting the Paal–Knorr pyrrole synthesis revealed the superiority of cerium (IV ammonium nitrate (CAN as a catalyst. Excellent yields of substituted pyrroles were obtained in CAN-catalyzed Paal–Knorr reactions of 1,4-diketones with various amines. The protocol is noteworthy for the mild reaction condition, short reaction times, scalability and easy isolation of products and high yields of the products.

  6. Study of gels of molybdenum with cerium in the preparation of generators of 99Mo - 99mTc

    OpenAIRE

    Vanessa Moraes; Bárbara Marczewski; Carla Roberta Dias; João Alberto Osso Junior

    2005-01-01

    99mTc has ideal nuclear properties for organ imaging in nuclear medicine, and it is obtained from the 99Mo-99mTc generator. Four different types of generators are available: chromatographic that uses 99Mo from fission of uranium; MEK solvent extraction; Tc2O7 sublimation; gel chromatographic. This work presents the preparation of gel generators of molybdenum with cerium and characterization of the gels: mass ratio between molybdenum and cerium, structure, size of particles and elution percent...

  7. [Multiple pregnancy at 11+0 - 13+6 weeks].

    Science.gov (United States)

    Nicolaides, Kypros H; Wegrzyn, Piotr

    2006-03-01

    Chorionicity, rather than zygosity, is the main factor determining pregnancy outcome. In monochorionic twins the rates of miscarriage, perinatal death, preterm delivery, fetal growth restriction and fetal abnormalities are much higher than in dichorionic twins. High mortality confined to monochorionic pregnancies is the consequence of severe early-onset TTTS. Death of a monochorionic fetus is associated with a high chance of sudden death or severe neurological damage in the co-twin. Sonographic examination provides reliable distinction between dichorionic and monochorionic pregnancies. Reduction of the excess fetal loss in twins, can only be achieved through early identification of monochorionic pregnancies by ultrasound examination at 11+0 - 13+6 weeks, close surveillance and appropriate treatment in those that develop severe TTTS. In multiple pregnancies, compared to singletons, prenatal diagnosis of chromosomal abnormalities is complicated because, firstly, the techniques of invasive testing may provide uncertain results or may be associated with higher risks of miscarriage and, secondly, the fetuses may be discordant for an abnormality.

  8. Structure Analysis of Oxidation Film of Ignition-Inhibition AZ91D Ma gnesium Alloy Added with Cerium

    Institute of Scientific and Technical Information of China (English)

    黄晓锋; 周宏; 何镇明

    2003-01-01

    The effect of cerium on ignition temperature of AZ91D magnesium alloy was studied. By the addition of cerium of 1%, the ignition temperature is raised by 180 ℃, so the magnesium alloy added with cerium can be melted in air. The burning temperature increases with the increasing of cerium. The structure and chemical compositions of the surface oxide film were investigated by XRD and Auger electron spectrometry(AES). The results of XRD indicate that the oxide film of the surface of ignition-inhibition magnesium alloy can change from loose structure of simple magnesia to compact composite structure consisting of magnesia, cerium oxide, Mg17 A112 and aluminum oxide, which has excellent ignition-inhibition effect. AES depth profile analysis shows that the oxide film can be divided into three layers. The outside layer is mainly made up of magnesia, the middle layer, which consists of cerium oxide, magnesia, and aluminum oxide, is compound and compact. Thermodynamic analysis indicates that the structure of the surface oxide film is accordant to the change of free energy and high vapor pressure of magnesium.

  9. Chromatographic separation of cerium(Ⅲ) in L-valine medium using poly[dibenzo-18-crown-6

    Institute of Scientific and Technical Information of China (English)

    SABALE Sandip R; MOHITE Baburao S

    2009-01-01

    A column chromatographic method has been developed for the separation and determination of cerium(Ⅲ) using poly[dibenzo-18-crown-6]. The separation was carried out in L-valine medium. The adsorption of cerium(Ⅲ) was quantitative from 1×10-1 to 1×10-4 mol/L L-valine. Amongst the various eluents, 1.0-8.0 mol/L hydrochloric acid, 1.0-8.0 mol/L hydrobromic acid, 1.0-8.0 mol/L perchloric acid, 1.0-2.0 mol/L sulfuric acid and 4.0-5.0 mol/L acetic acid, were found to be the efficient eluents for cerium(Ⅲ). The capacity of poly[dibenzo-18-crown-6] for cerium(Ⅲ) was (0.428±0.01) mmol/g. The method was applied to the separation of cerium(Ⅲ) from associated elements link uranium(Ⅵ) and thorium(Ⅳ). It was also applied for the determination of cerium(Ⅲ) in geological samples. The method is simple, rapid and selective with good reproducibility (approximately±2% ).

  10. Light microscopical localization of enzymes by means of cerium-based methods. I.V. Optimization procedures for acid phosphatase.

    Science.gov (United States)

    Halbhuber, K J; Zimmermann, N; Feuerstein, H

    1986-01-01

    The earlier described cerium based histochemical reaction for acid phosphatase [Ce-Pb-reaction, Zimmermann and Halbhuber (1985)] was optimized. The target tissues (kidney, intestine) were fixed by perfusion with glutaraldehyde in cacodylate or piperazine buffer in anesthetized animals. Postfixation of prefixed sections is not advantageous because of the detectable repressing of the enzyme activity. Moreover, the employment of unfixed cryostat sections, which were postfixed, was always connected with a complete abolition of the acid phosphatase activity. The optimal concentration of the primary capture cerium III chloride in the incubation medium is about 1 mmol. Lower concentrations lead to an incomplete histochemical detection of phosphatase activity in lysosomes. The treatment of cryostat sections of perfusion fixed tissue with borohydride (diminution of aldehyde induced cross links) or with dimethylsulfoxide (extraction of lysosomal materials or the well known vehicle property) brought about an improvement of the penetration capacity for cerium-III-cations into the target structures. After conversion of the cerium phosphate (primary specific reaction product) into cerium perhydroxide, oxalate or fluoride, the Ce-Pb-reaction was negative. Therefore, these blocking reactions represent specific inhibition controls, which indicates the formation and presence of cerium phosphate. On the basis of these reactions it is possible to check the specificity of the histochemical Ce-Pb-reaction for phosphatase activity in sections.

  11. 136例缺铁性贫血病因分析%136 Cases of Iron Deficiency Anemia Cause Analysis

    Institute of Scientific and Technical Information of China (English)

    邓凤珠; 黄雁

    2009-01-01

    目的 分析总结缺铁性贫血的主要病因.方法 回顾分析台山市第二人民医院2003年1月至2008年12月门诊及住院的136例缺铁性贫血患者的临床资料.结果 男性病例中,胃肠道疾病是引起缺铁性贫血的主要病因,其中最为常见的是消化性溃疡、慢性胃炎,占46%,痔疮占10%;其次是钩虫病,占10%.女性病例中,月经过多是最主要的病因,占39%;其次是消化性溃疡、慢性胃炎,占21%;再次是妊娠、哺乳,占8%.结论 除月经过多、妊娠、哺乳等女性特殊生理时期外,从总体上看,消化性溃疡、慢性胃炎等胃肠道疾病是引起15岁以上人群缺铁性贫血的主要原因占31%应引起重视.%Objective To analyze and summarize the main reason for iron deficiency anemia. Methods The clinical data of 136 cases with iron deficiency anemia in hospital out-patient clinics of our hospital from January 2003 to December 2008 was reviewed and analyzed. Results In male cases, The major cause of gastrointestinal tract disease is caused by iron deficiency anemia, and the most common of gastrointestinal tract disease is peptic ulcer and chronic gastritis(46%), hemorrhoids and ancylostomiasis(10%). In female cases, The major cause of gasrointesinal tract disease is caused by menorrhagia(39%); and peptic ulcer and chronic gastritis (21%), the pregnancy and breast-feeding(8%).Results On the whole, in addition to menorrhagia,pregnancy,breast-feeding women and other special physiological periods, pepticulcer,chronic gastritis and other gastrointestinal diseases are caused by people over the age of 15 the main reason for iron deficiency anemia (31%), we should pay attention to this disease.

  12. Effects of Cerium Nitrate on Expression of CaM Ⅰ and PMCA Ca2+-ATPase mRNA in Rat Liver

    Institute of Scientific and Technical Information of China (English)

    杨维东; 王艇; 刘洁生; 雷衡毅; 杨燕生

    2001-01-01

    The effect of cerium nitrate on expression of CaM Ⅰ and PMCA1b in rat liver was studied by means of reverse transcription-polymerase chain reaction (RT-PCR). The result shows that neither a high dose (50 mg*kg-1) nor a low dose (1 mg*kg-1) of cerium nitrate induces any alterations of expression of CaM Ⅰ and PMCA 1b mRNA after recurrent intraperitoneal injection of cerium nitrate, which suggests that effect of cerium nitrate on CaM and Ca2+-ATPase might be at posttranscription level.

  13. Clinical Study on 136 Children with Sudden Sensorineural Hearing Loss.

    Science.gov (United States)

    Li, Feng-Jiao; Wang, Da-Yong; Wang, Hong-Yang; Wang, Li; Yang, Feng-Bo; Lan, Lan; Guan, Jing; Yin, Zi-Fang; Rosenhall, Ulf; Yu, Lan; Hellstrom, Sten; Xue, Xi-Jun; Duan, Mao-Li; Wang, Qiu-Ju

    2016-04-20

    The prevalence of sudden sensorineural hearing loss in children (CSSNHL) is consistently increasing. However, the pathology and prognosis of CSSNHL are still poorly understood. This retrospective study evaluated clinical characteristics and possible associated factors of CSSNHL. One hundred and thirty-six CSSNHL patients treated in Department of Otolaryngology-Head and Neck Surgery and Institute of Otolaryngology at Chinese PLA General Hospital between July 2008 and August 2015 were included in this study. These patients were analyzed for clinical characteristics, audiological characteristics, laboratory examinations, and prognostic factors. Among the 136 patients (151 ears), 121 patients (121 ears, 80.1%) were diagnosed with unilaterally CSSNHL, and 15 patients (30 ears, 19.9%) with bilateral CSSNHL. The complete recovery rate of CSSNHL was 9.3%, and the overall recovery rate was 37.7%. We found that initial degree of hearing loss, onset of treatment, tinnitus, the ascending type audiogram, gender, side of hearing loss, the recorded auditory brainstem response (ABR), and distortion product otoacoustic emissions (DPOAEs) had prognostic significance. Age, ear fullness, and vertigo had no significant correlation with recovery. Furthermore, the relevant blood tests showed 30.8% of the children had abnormal white blood cell (WBC) counts, 22.1% had elevated homocysteine levels, 65.8% had high alkaline phosphatase (ALP), 33.8% had high IgE antibody levels, and 86.1% had positive cytomegalovirus (CMV) IgG antibodies. CSSNHL commonly occurs unilaterally and results in severe hearing loss. Initial severe hearing loss and bilateral hearing loss are negative prognostic factors for hearing recovery, while positive prognostic factors include tinnitus, gender, the ascending type audiogram, early treatment, identifiable ABR waves, and DPOAEs. Age, vertigo, and ear fullness are not correlated with the recovery. Some serologic indicators, including the level of WBC, platelet

  14. Clinical Study on 136 Children with Sudden Sensorineural Hearing Loss

    Science.gov (United States)

    Li, Feng-Jiao; Wang, Da-Yong; Wang, Hong-Yang; Wang, Li; Yang, Feng-Bo; Lan, Lan; Guan, Jing; Yin, Zi-Fang; Rosenhall, Ulf; Yu, Lan; Hellstrom, Sten; Xue, Xi-Jun; Duan, Mao-Li; Wang, Qiu-Ju

    2016-01-01

    Background: The prevalence of sudden sensorineural hearing loss in children (CSSNHL) is consistently increasing. However, the pathology and prognosis of CSSNHL are still poorly understood. This retrospective study evaluated clinical characteristics and possible associated factors of CSSNHL. Methods: One hundred and thirty-six CSSNHL patients treated in Department of Otolaryngology-Head and Neck Surgery and Institute of Otolaryngology at Chinese PLA General Hospital between July 2008 and August 2015 were included in this study. These patients were analyzed for clinical characteristics, audiological characteristics, laboratory examinations, and prognostic factors. Results: Among the 136 patients (151 ears), 121 patients (121 ears, 80.1%) were diagnosed with unilaterally CSSNHL, and 15 patients (30 ears, 19.9%) with bilateral CSSNHL. The complete recovery rate of CSSNHL was 9.3%, and the overall recovery rate was 37.7%. We found that initial degree of hearing loss, onset of treatment, tinnitus, the ascending type audiogram, gender, side of hearing loss, the recorded auditory brainstem response (ABR), and distortion product otoacoustic emissions (DPOAEs) had prognostic significance. Age, ear fullness, and vertigo had no significant correlation with recovery. Furthermore, the relevant blood tests showed 30.8% of the children had abnormal white blood cell (WBC) counts, 22.1% had elevated homocysteine levels, 65.8% had high alkaline phosphatase (ALP), 33.8% had high IgE antibody levels, and 86.1% had positive cytomegalovirus (CMV) IgG antibodies. Conclusions: CSSNHL commonly occurs unilaterally and results in severe hearing loss. Initial severe hearing loss and bilateral hearing loss are negative prognostic factors for hearing recovery, while positive prognostic factors include tinnitus, gender, the ascending type audiogram, early treatment, identifiable ABR waves, and DPOAEs. Age, vertigo, and ear fullness are not correlated with the recovery. Some serologic indicators

  15. 27 CFR 17.136 - Compliance with Food and Drug Administration requirements.

    Science.gov (United States)

    2010-04-01

    ... products manufactured solely for export or for uses other than internal human consumption (e.g. tobacco... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Compliance with Food and Drug Administration requirements. 17.136 Section 17.136 Alcohol, Tobacco Products and Firearms...

  16. 21 CFR 133.136 - Washed curd and soaked curd cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Washed curd and soaked curd cheese. 133.136... Standardized Cheese and Related Products § 133.136 Washed curd and soaked curd cheese. (a) Description. (1) Washed curd, soaked curd cheese is the food prepared by the procedure set forth in paragraph (a)(3)...

  17. 34 CFR 668.136 - Institutional determinations of eligibility based on INS responses to secondary confirmation...

    Science.gov (United States)

    2010-07-01

    ... INS responses to secondary confirmation requests. 668.136 Section 668.136 Education Regulations of the... determinations of eligibility based on INS responses to secondary confirmation requests. (a) Except as provided...) by relying on the INS response to the Form G-845. (b) An institution shall make its...

  18. 40 CFR 52.136 - Control strategy for ozone: Oxides of nitrogen.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Control strategy for ozone: Oxides of nitrogen. 52.136 Section 52.136 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... for ozone: Oxides of nitrogen. EPA is approving an exemption request submitted by the State of...

  19. 17 CFR 1.36 - Record of securities and property received from customers and option customers.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Record of securities and property received from customers and option customers. 1.36 Section 1.36 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION GENERAL REGULATIONS UNDER THE COMMODITY EXCHANGE ACT Recordkeeping § 1...

  20. Synthesis of mesoporous cerium-zirconium mixed oxides by hydrothermal templating method

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Mesoporous cerium-zirconium mixed oxides were prepared by hydrothermal method using cetyl trimethyl ammonium bromide (CTAB) as template.The effects of amount of template,pH value of solution and hydrothermal temperature on mesostructure of samples were systematically investigated.The final products were characterized by XRD,TEM,FT-IR,and BET.The results indicate that all the cerium-zirconium mixed oxides present a meso-structure.At molar ratio of n(CTAB)/n((Ce)+(Zr))=0.15,pH value of 9,and hydrothermal temperature of 120 ℃,the samples obtained possess a specific surface area of 207.9 m2/g with pore diameter of 3.70 nm and pore volume of 0.19 cm3/g.

  1. Structure and synergetic antibacterial effect of zinc and cerium carried sodium zirconium phosphates

    Institute of Scientific and Technical Information of China (English)

    YANG Yunhua; DAI Guangjian; TAN Shaozao; LIU Yingliang; SHI Qingshan; OUYANG Yousheng

    2011-01-01

    Zinc and cerium carried zirconium phosphates (Zn-Ce/ZrPs) were prepared by exchanging zinc and cerium cations into sodium zirconium phosphate (NaZrP) through the ion-exchange method and characterized by X-ray diffraction(XRD), energy dispersive X-ray spectroscopy (EDX) and scanning electron microscopy (SEM). Furthermore, the specific surface area, zeta potential and antibacterial activity were tested. The results showed that Zn-Ce/ZrPs were with hexagonal crystal system, and the surface area of Zn-Ce/ZrPs increased much more than that of NaZrP. Zn-Ce/ZrPs showed obvious synergetic antibacterial effect, and have the potential to be used as antibacterial agents in environmental control.

  2. Color-Fading Spectrophotometric Determination of Cerium with DBC-Arsenazo

    Institute of Scientific and Technical Information of China (English)

    翟庆洲; 张晓霞

    2004-01-01

    In the medium of 0.18~1.08 mol·L-1 sulfuric acid, cerium(Ⅳ) has the color-fading effect on DBC-arsenazo. The apparent molar absorptivity of the color-fading reaction is ε530 nm=1.03×104 L·mol-1·cm-1. Beer′s law is obeyed over the range of 1.20~12.0 μg·ml-1 of Ce (Ⅳ) which shows a linear relationship with the decrease in the absorbance of the colored solution. The effect of thirty-six coexisting ions was studied. The method was applied to the determination of the trace amount of cerium in water samples and has the advantage of high accuracy and good selectivity.

  3. Synthesis, characterization and antimicrobial activity of zinc and cerium co-doped α-zirconium phosphate

    Institute of Scientific and Technical Information of China (English)

    DAI Guangjian; YU Aili; CAI Xiang; SHI Qingshan; OUYANG Yousheng; TAN Shaozao

    2012-01-01

    A series of zinc ions or/and cerium ions co-doped a-zirconium phosphate (Zn-Ce@ZrPs) were prepared.The novel Zn-Ce@ZrPs were characterized and the antibacterial activity on Gram-negative Escherichia coli and Gram-positive Staphylococcus aureus were tested.The results showed that zinc ions (Zn2+) or/and cerium ions (Ce3+) were combined with ZrP,and the Ce3+ was adsorbed on the surface of ZrP through hydrogen bonds,while Zn2+ intercalated into the interlayer of ZrP.Zn-Ce@ZrPs showed excellent synergistic antibacterial activity.When Zn2+/Ce3+ atomic ratio was 0.6,the Zn-Ce@ZrP3 showed the highest synergistic antibacterial efficiency,suggesting great potential application as antibacterial agents in microbial control.

  4. Post treatment of silane and cerium salt as chromate replacers on galvanized steel

    Institute of Scientific and Technical Information of China (English)

    KONG Gang; LU Jintang; WU Haijiang

    2009-01-01

    A complex film on hot-dip galvanized steel sheet (HDG) was prepared by immersing the sheet in 0.1wt.% Ce(NO3)3 solution and 5vol.% silane solution in turn. The corrosion protection of the complex film was evaluated by potentiodynamic linear polarization(LPR), electrochemical impendence spectra (EIS) and natural salt spray (NSS) tests and compared with that of single cerium film and silane film. The results showed that, the presence of these films on the zinc coating hindered corrosion reaction by reducing the rate of both anodic and cathodic reaction in the corrosion process, and the corrosion protection of the complex film was much better than that of single cerium film or silane film and closed to that of chromate film, because the polarization resistance Rp and electrochemical impendence were increased markedly. Microstructure and chemical composition of these pretreated films were also investigated by scanning electron microscopy (SEM) and AES.

  5. Effect of oxygen defects on thermal conductivity of thorium-cerium dioxide solid solutions

    Science.gov (United States)

    Muta, Hiroaki; Kado, Hirohisa; Ohishi, Yuji; Kurosaki, Ken; Yamanaka, Shinsuke

    2017-01-01

    Thermal conductivity of thorium-cerium dioxide solid solutions has been measured and analyzed using the relaxation time approximation. Despite the presence of oxygen defects, the partially reduced Th0.8Ce0.2O1.97 exhibited higher thermal conductivity than the stoichiometric one, Th0.8Ce0.2O2.00, showing the same tendency as that previously reported for Th0.7Pu0.3O2-δ. The increase in thermal conductivity with the oxygen defects can be explained by assuming that cerium ions have an average ionic radius of the ionic radii of Ce3+ and Ce4+ in the description of phonon-impurity scattering. This result indicates that the small reduction of (Th,Pu)O2-δ fuel increases the thermal conductivity, especially at high temperatures.

  6. Deposition of cerium contained conversion films on LC4 alloy with square wave pulse method

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wei; LI Jiuqing; WU Yinshun; ZHANG Pei; HE Jianping

    2004-01-01

    Cerium contained conversion films were deposited on LC4 aluminum alloy using square wave pulse (SWP) in a CeC13 solution with KMnO4 as the oxidant. Energy dispersive spectroscopy (EDS) and scanning electron microscopy (SEM) were adopted to study the composition and the morphology of the film. It is found that the film is composed of Al, Zn, Cu,and small amount of cerium. The polarization curves of the specimens treated with SWP technique measured in 3.5% (mass fraction) NaCl solution reveal that the film thus formed inhibits both the anodic and cathodic process of the corrosion of the specimen. The immersion tests of treated specimens in 3.5% NaCl solution indicate that the corrosion resistance of the SWP treated specimen is better than that of the untreated and is equivalent to or even better than that of the traditionally electrochemically treated specimens.

  7. Reduction behavior of cerium(Ⅲ) ions in NaCl-2CsCl melt

    Institute of Scientific and Technical Information of China (English)

    QI Xue; ZHU Hongmin

    2005-01-01

    The cathodic process of cerium(Ⅲ) ions in NaCl-2CsCl melt was studied by cyclic voltammetry and square wave voltammetry with tungsten and gold electrodes at 873 K. The two electroanalytical methods yield similar results. The cathodic process of cerium(Ⅲ) ions consists of two reversible steps: Ce3+ + e-= Ce2+ and Ce2+ + 2e-= Ce. The half wave potentials of Ce3+/Ce2+ and Ce2+/Ce were determined as -2.525 V vs. Cl2/Cl- and -2.975 V vs. Cl2/Cl-, respectively. The diffusion coefficient of Ce3+ was also determined as 5.5 × 10-5 cm2·s-1.

  8. Energy transfer and thermal studies of Pr3+ doped cerium oxalate crystals

    Indian Academy of Sciences (India)

    R Pragash; Gijo Jose; N V Unnikrishnan; C Sudarsanakumar

    2011-07-01

    Energy transfer process at room temperature for cerium (sensitizer) oxalate single crystals doped with different concentrations (10, 13, 15, 17 and 20%) of praseodymium ions (activator) grown by hydro silica gel method has been evaluated. The analysis of energy level diagrams of cerium and praseodymium ions indicates that the energy gap between the sensitizer and the activator ions varies in a small range suggesting a possible energy transfer from the Ce3+ to Pr3+. The emission and absorption spectra of these crystals were recorded. The overlapping of the absorption spectra of Pr3+ and emission spectra of Ce3+ at wavelengths 484 and 478 nm, respectively, strongly supports the possible energy transfer process in this system. From the absorption spectra, oscillator strength, electric dipole moment, branching ratio and Judd–Ofelt parameters of this system were evaluated by least square programming. The quantum efficiency, energy transfer probabilities and thermal properties have been studied.

  9. Thermodynamics of the α -γ transition in cerium studied by an LDA + Gutzwiller method

    Science.gov (United States)

    Tian, Ming-Feng; Song, Hai-Feng; Liu, Hai-Feng; Wang, Cong; Fang, Zhong; Dai, Xi

    2015-03-01

    Utilizing the local-density approximation (LDA) + Gutzwiller method, we have studied the α -γ transition in cerium. Our results indicate that the volume collapse transition between α and γ phases is present at zero temperature with negative pressure. By further providing a newly finite temperature generalization of the LDA + Gutzwiller method (using the mean-field potential approach), the entropy contributed by both electronic quasiparticles and lattice vibration included, we obtain the Gibbs free energy at a given volume and temperature, from which we get the α -γ transition at finite temperature and pressure. Our results indicate that the electronic entropy and lattice vibrational entropy both play important roles in the α -γ transition. We also calculated the equation of state and phase diagram of cerium, finding good agreement with the experiments.

  10. Monte Carlo radiative transfer simulation of a cavity solar reactor for the reduction of cerium oxide

    Energy Technology Data Exchange (ETDEWEB)

    Villafan-Vidales, H.I.; Arancibia-Bulnes, C.A.; Dehesa-Carrasco, U. [Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico, Privada Xochicalco s/n, Col. Centro, A.P. 34, Temixco, Morelos 62580 (Mexico); Romero-Paredes, H. [Departamento de Ingenieria de Procesos e Hidraulica, Universidad Autonoma Metropolitana-Iztapalapa, Av. San Rafael Atlixco No.186, Col. Vicentina, A.P. 55-534, Mexico D.F 09340 (Mexico)

    2009-01-15

    Radiative heat transfer in a solar thermochemical reactor for the thermal reduction of cerium oxide is simulated with the Monte Carlo method. The directional characteristics and the power distribution of the concentrated solar radiation that enters the cavity is obtained by carrying out a Monte Carlo ray tracing of a paraboloidal concentrator. It is considered that the reactor contains a gas/particle suspension directly exposed to concentrated solar radiation. The suspension is treated as a non-isothermal, non-gray, absorbing, emitting, and anisotropically scattering medium. The transport coefficients of the particles are obtained from Mie-scattering theory by using the optical properties of cerium oxide. From the simulations, the aperture radius and the particle concentration were optimized to match the characteristics of the considered concentrator. (author)

  11. DEVELOPMENT OF A COMPOSITE OF POLY-Ɛ-CAPROLACTONE-CERIUM OXIDE

    OpenAIRE

    Alejandra Melissa Martínez-Hernández; Simón Yobanny Reyes-López

    2017-01-01

    Nanotechnology is used in a variety of sectors for the manufacture of materials. However, there is a risk from exposure to nanomaterials due to their chemical composition and processing form, giving rise to health risks. CeO2 particles present antioxidant properties that accelerate the wound poly-Ɛ-caprolactone (PCL) provides the property of biocompatibility and biodegradability of the material. For the regulation of the transport and release of cerium oxide particles was incorporated into a ...

  12. Photocatalytic C-C Bond Cleavage and Amination of Cycloalkanols by Cerium(III) Chloride Complex.

    Science.gov (United States)

    Guo, Jing-Jing; Hu, Anhua; Chen, Yilin; Sun, Jianfeng; Tang, Haoming; Zuo, Zhiwei

    2016-12-05

    A general strategy for the cleavage and amination of C-C bonds of cycloalkanols has been achieved through visible-light-induced photoredox catalysis utilizing a cerium(III) chloride complex. This operationally simple methodology has been successfully applied to a wide array of unstrained cyclic alcohols, and represents the first example of catalytic C-C bond cleavage and functionalization of unstrained secondary cycloalkanols.

  13. Effect of cerium addition on microstructure and texture of aluminum foil for electrolytic capacitors

    Institute of Scientific and Technical Information of China (English)

    王海燕; 李文学; 任慧平; 黄丽颖; 王向阳

    2010-01-01

    Anode foil of aluminum electrolytic capacitor,which requires large surface area for high capacitance,were prepared by rolling,annealing and electrochemical etching.Effects of cerium addition on the capacitance of aluminum electrolytic capacitors were investigated.Microstructure of the aluminum foil surface was observed by optical microscopy(OM) and scanning electron microscopy(SEM).Electron back scattered diffraction(EBSD) was also employed to reveal texture evolvement of cold-rolled aluminum foil after ann...

  14. CO Responses of Sensors Based on Cerium Oxide Thick Films Prepared from Clustered Spherical Nanoparticles

    OpenAIRE

    Woosuck Shin; Takafumi Akamatsu; Toshio Itoh; Ichiro Matsubara; Noriya Izu

    2013-01-01

    Various types of CO sensors based on cerium oxide (ceria) have been reported recently. It has also been reported that the response speed of CO sensors fabricated from porous ceria thick films comprising nanoparticles is extremely high. However, the response value of such sensors is not suitably high. In this study, we investigated methods of improving the response values of CO sensors based on ceria and prepared gas sensors from core-shell ceria polymer hybrid nanoparticles. These hybrid nano...

  15. Broadly tunable ultraviolet miniature cerium-doped LiLuF lasers.

    Science.gov (United States)

    Liu, H; Spence, D J; Coutts, D W; Sato, H; Fukuda, T

    2008-02-04

    Ultraviolet (UV) miniature cerium fluoride lasers have been demonstrated using a low cost, frequency-quadrupled microchip Nd:YAG pump laser. The use of miniature laser cavities was shown to significantly improve the laser performance in the low pump power region. We have achieved slope efficiencies up to 70% and pump thresholds as low as 100 nJ. Continuous tuning from 306 nm to 338 nm was achieved using a Brewster angle prism.

  16. Intensification of electrochemical properties of the molten chloride electrolytes of the cerium subgroup lanthanides

    Science.gov (United States)

    Shabanov, O. M.; Suleymanov, S. I.; Magomedova, A. O.

    2017-01-01

    The electrical conductivity of molten chloride electrolytes of the cerium subgroup lanthanides increases with rising electric field strength and strive to achieve the limiting high voltage values (Wien effect). On exposure of the high-voltage microsecond pulsed fields, the melts are transited into a prolonged non-equilibrium state with increased electrical conductivity and electrolyze current density. During the relaxation processes in non-equilibrium melts, increased electrical conductivity tends to restore the values that are specific to equilibrium systems.

  17. Effects of cerium salts on corrosion behaviors of Si–Zr hybrid sol–gel coatings

    Directory of Open Access Journals (Sweden)

    Yu Mei

    2015-04-01

    Full Text Available The present work examines the effects of cerium salts on corrosion behaviors of Si–Zr hybrid sol–gel coatings. The Si–Zr hybrid sol–gel coatings on a 2A12 aluminum substrate were prepared through hydrolysis and condensation of glycidoxypropyl-trimethoxy-silane (GTMS and zirconium(IV n-propoxide (TPOZ. Used as inhibitors for corrosion, three types of cerium salts (Ce(NO33, CeCl3, and Ce(CH3COO3 were doped into the sol–gel coatings. Fourier transform infrared (FTIR and scanning electron microscopy (SEM were employed to investigate the structures and morphologies of various coatings, and the corrosion resistances of the coatings were evaluated by electrochemical methods and neutral salt spray tests. Experimental results indicate that the addition of cerium salts can hinder the process of corrosion due to their self-healing abilities. Furthermore, the sol–gel coating doped with Ce(CH3COO3 has the best corrosion resistance because of the promotions of hydrolysis and condensation provided by CH3COO−.

  18. Infrared, thermal and X-ray diffraction analysis of cerium soaps

    Energy Technology Data Exchange (ETDEWEB)

    Mehrotra, K.N. [Agra Univ. (India). Dept. of Chemistry; Chauhan, M. [Agra Univ. (India). Dept. of Chemistry; Shukla, R.K. [R.B.S. Coll., Agra (India)

    1997-03-01

    The physico-chemical characteristics of cerium soaps (Caproate and caprate) in solid state were investigated by IR, thermal and X-ray diffraction measurements. The IR results reveal that the fatty acids exist in dimeric state through hydrogen bonding and soaps possess partial ionic character. The decomposition reaction was found kinetically of zero order with energy of activation 6.7 and 7.3 K cal mol{sup -1} for cerium caproate and caprate, respectively. The X-ray diffraction measurements were used to calculate the long spacings and the results confirm the double layer structure of cerium soaps. (orig.) [Deutsch] Mit Hilfe von IR-, thermischen und Roentgendiffraktionsmessungen wurden die physikalisch-chemischen Eigenschaften von Cerseifen (Capron- und Caprylsaeuresalze)in festem Zustand bestimmt. Die IR-Untersuchungen zeigen, dass die Fettseifen in dimerem Zustand, gebunden durch Wasserstoffbruecken vorliegen und partiell ionischen Charakter haben. Die Zersetzungsreaktion war von einer Kinetik nullter Ordnung, die Aktivierungsenergien lagen bei 6,7 K cal mol{sup -1} fuer Capronsaeuresalze und 7,3 K cal mol{sup -1} fuer Caprylsaeuresalze. Mit Hilfe von Roentgendiffraktionsmessungen wurden die grossen Zwischenraeume bestimmt. Die Ergebnisse lassen auf eine Doppelschichtstruktur der Cerseifen schliessen. (orig.)

  19. Nanoceria and bulk cerium oxide effects on the germination of asplenium adiantum-nigrum spores

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Garay, A.; Pintos, B.; Manzanera, J.A.; Prada, C.; Martin, L.; Gabriel y Galan, J.M.

    2016-07-01

    Aim of the study: The effect of cerium oxide engineered nanoparticles on the spore germination of the fern. Asplenium adiantum-nigrum. Area of study: France, Britanny Region, Finistére Department, Plougonvelin, in rocks near the sea. Material and methods: Asplenium spores were cultured in vitro on agar medium with Nano-CeO2 (less than 25 nm particle size) and bulk-CeO2. The addition of each nano- and bulk particles ranged from 0 to 3000 mg L-1. Observations on rhizoidal and prothallial cells during first stages of gametophyte development were made. The No-Observed-Adverse-Effect concentration (NOAEC) and Lowest-Observed-Adverse-Effect-Concentration (LOEC) values for spore germination rate data were analyzed. Main results: Germination was speeded up by 100 to 2000 mg L-1 nanoceria, while bulk cerium oxide had the same effect for 500 to 200 mg L-1 concentrations. Present results showed cellular damage in the protonema while rhizoid cells seemed not to be affected, as growth and membrane integrity remained. Research highlights: Both nanosized and bulk cerium oxide are toxic for the fern Asplenium adiantum-nigrum, although diverse toxicity patterns were shown for both materials. Diverse toxic effects have been observed: chloroplast membrane damage and lysis, cell wall and membrane disruption which leads to cell lysis; and alterations in morphology and development. (Author)

  20. Cerium, gallium and zinc containing mesoporous bioactive glass coating deposited on titanium alloy

    Science.gov (United States)

    Shruti, S.; Andreatta, F.; Furlani, E.; Marin, E.; Maschio, S.; Fedrizzi, L.

    2016-08-01

    Surface modification is one of the methods for improving the performance of medical implants in biological environment. In this study, cerium, gallium and zinc substituted 80%SiO2-15%CaO-5%P2O5 mesoporous bioactive glass (MBG) in combination with polycaprolactone (PCL) were coated over Ti6Al4 V substrates by dip-coating method in order to obtain an inorganic-organic hybrid coating (MBG-PCL). Structural characterization was performed using XRD, nitrogen adsorption, SEM-EDXS, FTIR. The MBG-PCL coating uniformly covered the substrate with the thickness found to be more than 1 μm. Glass and polymer phases were detected in the coating along with the presence of biologically potent elements cerium, gallium and zinc. In addition, in vitro bioactivity was investigated by soaking the coated samples in simulated body fluid (SBF) for up to 30 days at 37 °C. The apatite-like layer was monitored by FTIR, SEM-EDXS and ICP measurements and it formed in all the samples within 15 days except zinc samples. In this way, an attempt was made to develop a new biomaterial with improved in vitro bioactive response due to bioactive glass coating and good mechanical strength of Ti6Al4 V alloy along with inherent biological properties of cerium, gallium and zinc.

  1. Preparation and Characterization of Cerium (III Doped Captopril Nanoparticles and Study of their Photoluminescence Properties

    Directory of Open Access Journals (Sweden)

    Ghamami Shahriar

    2016-01-01

    Full Text Available In this research Ce3+ doped Captopril nanoparticles (Ce3+ doped CAP-NP were prepared by a cold welding process and have been studied. Captopril may be applied in the treatment of hypertension and some types of congestive heart failure and for preventing kidney failure due to high blood pressure and diabetes. CAP-NP was synthesized by a cold welding process. The cerium nitrate was added at a ratio of 10% and the optical properties have been studied by photoluminescence (PL. The synthesized compounds were characterized by Fourier transform infrared spectroscopy. The size of CAP-NP was calculated by X-ray diffraction (XRD. The size of CAP-NP was in the range of 50 nm. Morphology of surface of synthesized nanoparticles was studied by scanning electron microscopy (SEM. Finally the luminescence properties of undoped and doped CAP-NP were compared. PL spectra from undoped CAP-NP show a strong pack in the range of 546 nm after doped cerium ion into the captopril appeared two bands at 680 and 357 nm, which is ascribed to the well-known 5d–4f emission band of the cerium.

  2. Nanoceria and bulk cerium oxide effects on the germination of asplenium adiantum-nigrum spores

    Directory of Open Access Journals (Sweden)

    Aranzazu Gomez-Garay

    2016-12-01

    Full Text Available Aim of study: The effect of cerium oxide engineered nanoparticles on the spore germination of the fern. Asplenium adiantum-nigrum. Area of study: France, Britanny Region, Finistére Department, Plougonvelin, in rocks near the sea. Material and methods: Asplenium spores were cultured in vitro on agar medium with Nano-CeO2 (less than 25 nm particle size and bulk-CeO2. The addition of each nano- and bulk particles ranged from 0 to 3000 mg L-1. Observations on rhizoidal and prothallial cells during first stages of gametophyte development were made. The No-Observed-Adverse-Effect concentration (NOAEC and Lowest-Observed-Adverse-Effect-Concentration (LOEC values for spore germination rate data were analyzed.  Main results: Germination was speeded up by 100 to 2000 mg L-1 nanoceria, while bulk cerium oxide had the same effect for 500 to 200 mg L-1 concentrations. Present results showed cellular damage in the protonema while rhizoid cells seemed not to be affected, as growth and membrane integrity remained. Research highlights: Both nanosized and bulk cerium oxide are toxic for the fern Asplenium adiantum-nigrum, although diverse toxicity patterns were shown for both materials. Diverse toxic effects have been observed: chloroplast membrane damage and lysis, cell wall and membrane disruption which leads to cell lysis; and alterations in morphology and development. Keywords: Nanoparticles; rhizoid; prothallus; chloroplast; fern.

  3. Synthesis and Characterization of Cerium Doped Titanium Catalyst for the Degradation of Nitrobenzene Using Visible Light

    Directory of Open Access Journals (Sweden)

    Padmini Ellappan

    2014-01-01

    Full Text Available Cerium doped catalyst was synthesized using Titanium isopropoxide as the Titanium source. The metal doped nanoparticles semiconductor catalyst was prepared by sol-sol method with the sol of Cerium. The synthesized catalyst samples were characterized by powder X-ray diffraction, BET surface area, thermogravimetric analysis (TGA, scanning electron microscopy (SEM, and UV-vis diffuse reflectance measurements (DRS and compared with undoped TiO2 catalyst. The photocatalytic activity of the sample was investigated for the decomposition of nitrobenzene (NB using visible light as the artificial light source. Cerium doped catalyst was found to have better degradation of nitrobenzene owing to its shift in the band gap from UV to visible region as compared to undoped TiO2 catalyst. The operational parameters were optimized with catalyst dosage of 0.1 g L−1, pH of 9, and light intensity of 500 W. The degradation mechanism followed the Langmuir Hinshelwood kinetic model with the rate constant depending nonlinearly on the operational parameters as given by the relationship Kapp (theoretical = 2.29 * 10−4 * Intensity0.584 * Concentration−0.230 * Dosage0.425 * pH0.336.

  4. Controlled Redox Chemistry at Cerium within a Tripodal Nitroxide Ligand Framework.

    Science.gov (United States)

    Bogart, Justin A; Lippincott, Connor A; Carroll, Patrick J; Booth, Corwin H; Schelter, Eric J

    2015-12-01

    Ligand reorganization has been shown to have a profound effect on the outcome of cerium redox chemistry. Through the use of a tethered, tripodal, trianionic nitroxide ligand, [((2-tBuNOH)C6 H4 CH2 )3 N](3-) (TriNOx (3-) ), controlled redox chemistry at cerium was accomplished, and typically reactive complexes of tetravalent cerium were isolated. These included rare cationic complexes [Ce(TriNOx )thf][BAr(F) 4 ], in which Ar(F) =3,5-(CF3 )2 -C6 H3 , and [Ce(TriNOx )py][OTf]. A rare complete Ce-halide series, Ce(TriNOx )X, in which X=F(-) , Cl(-) , Br(-) , I(-) , was also synthesized. The solution chemistry of these complexes was explored through detailed solution-phase electrochemistry and (1) H NMR experiments and showed a unique shift in the ratio of species with inner- and outer-sphere anions with size of the anionic X(-) group. DFT calculations on the series of calculations corroborated the experimental findings.

  5. Cytochemical localization of adenylate cyclase activity in heart tissue with cerium.

    Science.gov (United States)

    Schulze, W; Will-Shahab, L; Küttner, I

    1986-01-01

    Adenylate cyclase (AC) activity showed a doses depending inactivation of the basal activity and of the sodium fluoride stimulation by cerium in homogenates of unfixed and fixed guinea pig hearts. The isoproterenol and guanine nucleotide stimulation was not more than two times of the basal activity in glutaraldehyde-prefixed heart homogenates in the presence of 2 mmol/l CeCl3. The inactivation of the AC (activity) by cerium was less than in the presence of lead. Test tube experiments showed no differences in the precipitation of imidodiphosphate in comparison with inorganic phosphate. The substrate AMP-PNP was not spontaneously hydrolysed by 2 mmol/l CeCl3. Ultrastructural analysis of cytochemical incubation of glutaraldehyde-fixed slices and small pieces of guinea pig heart tissue showed fine-amorphous precipitations of reaction products localized along the plasma membrane of the sarcolemma, the nexuses of the intercalated discs and the T-tubule membranes. No precipitates were found neither on the junctional nor on other SR membranes. Nonspecific coarse and clumped precipitates have been detected in the intercellular space on components of the basal membranes. It was not able to demonstrate cytochemically stimulation of AC by hormones or by sodium fluoride. The localization of the basal AC activity in heart tissue seems to be better with cerium as capture agent than with lead. However, differences in the localization of the AC activity in heart tissue were not observed.

  6. Cerium Biomagnification in a Terrestrial Food Chain: Influence of Particle Size and Growth Stage.

    Science.gov (United States)

    Majumdar, Sanghamitra; Trujillo-Reyes, Jesica; Hernandez-Viezcas, Jose A; White, Jason C; Peralta-Videa, Jose R; Gardea-Torresdey, Jorge L

    2016-07-01

    Mass-flow modeling of engineered nanomaterials (ENMs) indicates that a major fraction of released particles partition into soils and sediments. This has aggravated the risk of contaminating agricultural fields, potentially threatening associated food webs. To assess possible ENM trophic transfer, cerium accumulation from cerium oxide nanoparticles (nano-CeO2) and their bulk equivalent (bulk-CeO2) was investigated in producers and consumers from a terrestrial food chain. Kidney bean plants (Phaseolus vulgaris var. red hawk) grown in soil contaminated with 1000-2000 mg/kg nano-CeO2 or 1000 mg/kg bulk-CeO2 were presented to Mexican bean beetles (Epilachna varivestis), which were then consumed by spined soldier bugs (Podisus maculiventris). Cerium accumulation in plant and insects was independent of particle size. After 36 days of exposure to 1000 mg/kg nano- and bulk-CeO2, roots accumulated 26 and 19 μg/g Ce, respectively, and translocated 1.02 and 1.3 μg/g Ce, respectively, to shoots. The beetle larvae feeding on nano-CeO2 exposed leaves accumulated low levels of Ce since ∼98% of Ce was excreted in contrast to bulk-CeO2. However, in nano-CeO2 exposed adults, Ce in tissues was higher than Ce excreted. Additionally, Ce content in tissues was biomagnified by a factor of 5.3 from the plants to adult beetles and further to bugs.

  7. Cerium(III-Selective Membrane Electrode Based on Dibenzo-24-crown-8 as a Neutral Carrier

    Directory of Open Access Journals (Sweden)

    Susheel K. Mittal

    2010-01-01

    Full Text Available Cerium(III-selective membrane electrodes have been prepared using dibenzo-24-crown-8 (DB24C8 as an electroactive material. A membrane having a composition: DB24C8 (4.5%, plasticizer (NPOE, 62.5% and PVC (33% gives the best performance. It works well over a wide Ce(III ion-concentration range of 1x10-5 M to 1x10-1 M with a Nernstian slope of 19.0 mV/decade and a detection limit of 3x10-5 M. It has a fast response time of 20 seconds and has an average lifetime of four months. The internal solution concentration does not have a significant effect on the response of the electrode except for a change in intercept of the calibration curves. The working pH range for Ce(III solutions (1x10-2 M and 1x10-3 M is 3.5-8.0. The proposed sensor shows a good selectivity for cerium(III with respect to alkali, alkaline earth, some transition and rare earth metal ions that are normally present along with cerium in its ores. The proposed sensor was investigated in partially non-aqueous media using acetone, methanol and DMSO mixtures with water. The electrode was further used as an indicator electrode for the potentiometric titration of Ce(III solution against oxalic acid solution.

  8. Effect of cerium oxide addition on electrical properties of ZnO

    Energy Technology Data Exchange (ETDEWEB)

    Ibrahim, D.M. [National Research Center, Dokki, Giza (Egypt). Dept. of Ceramics; Mounir, M. [Dept. of Physics, Cairo Univ., Giza (Egypt); Mahgoub, A.S. [Cairo Univ., Giza (Egypt). Dept. of Chemistry; Turky, G. [Dept. of Physics, National Research Center, Dokki, Giza (Egypt); El-Desouky, O.A. [Cer. Cleopatra Co., Ramadan City (Egypt)

    2002-07-01

    Mixtures of ZnO and Ce{sub 6} O{sub 11} as additive were prepared by solid state reaction from the calcined oxides with the following proportions: 0.03, 0.08, 0.1, 0.2 and 0.4 mole. Disc specimens 1.2 cm 5 cm in diameter and 0.3 cm thickness were processed under a force of 70 kN and fired at 1150 C/ 30 minutes. XRD revealed the presence of limited solid solution of cerium in ZnO, as evident from the shift in the peaks [0.03-0.04 A ] up to 0.1 mole addition and remains constant. SEM revealed the presence of inter-granular phase. EDAX showed it to be a mixture of ZnO and Ce{sub 6}O{sub 11}. Also cerium was detected in the ZnO grains confirming the XRD results. RCL circuit was used to measure the capacitance and resistance at different frequencies at room temperature. The dielectric constant and conductivity were calculated. The change in resistivity with temperature was followed up to 523 K. The change in dielectric strength with temperature at spot frequency of 10 kHz is demonstrated. The electrical conductivity was found to increase with the proportion of cerium oxide up to 0.2 mole then decreased. (orig.)

  9. Chromium VI adsorption on cerium oxide nanoparticles and morphology changes during the process

    Energy Technology Data Exchange (ETDEWEB)

    Recillas, Sonia; Colon, Joan [Department of Chemical Engineering, Engineering School, Autonomous University of Barcelona, 08193 Bellaterra (Spain); Casals, Eudald; Gonzalez, Edgar [Catalan Institute of Nanotechnology, Autonomous University of Barcelona Campus, 08193 Bellaterra (Spain); Puntes, Victor [Catalan Institute of Nanotechnology, Autonomous University of Barcelona Campus, 08193 Bellaterra (Spain); Catalan Institute of Research and Advanced Studies, Passeig Lluis Companys, 23, 08010 Barcelona (Spain); Sanchez, Antoni, E-mail: antoni.sanchez@uab.cat [Department of Chemical Engineering, Engineering School, Autonomous University of Barcelona, 08193 Bellaterra (Spain); Font, Xavier [Department of Chemical Engineering, Engineering School, Autonomous University of Barcelona, 08193 Bellaterra (Spain)

    2010-12-15

    In this study, suspended cerium oxide nanoparticles stabilized with hexamethylenetetramine were used for the removal of dissolved chromium VI in pure water. Several concentrations of adsorbent and adsorbate were tested, trying to cover a large range of possible real conditions. Results showed that the Freundlich isotherm represented well the adsorption equilibrium reached between nanoparticles and chromium, whereas adsorption kinetics could be modeled by a pseudo-second-order expression. The separation of chromium-cerium nanoparticles from the medium and the desorption of chromium using sodium hydroxide without cerium losses was obtained. Nanoparticles agglomeration and morphological changes during the adsorption-desorption process were observed by TEM. Another remarkable result obtained in this study is the low toxicity in the water treated by nanoparticles measured by the Microtox commercial method. These results can be used to propose this treatment sequence for a clean and simple removal of drinking water or wastewater re-use when a high toxicity heavy metal such as chromium VI is the responsible for water pollution.

  10. Clinical Study on 136 Children with Sudden Sensorineural Hearing Loss

    Institute of Scientific and Technical Information of China (English)

    Feng-Jiao Li; Da-Yong Wang; Hong-Yang Wang; Li Wang; Feng-Bo Yang; Lan Lan; Jing Guan

    2016-01-01

    Background:The prevalence of sudden sensorineural hearing loss in children (CSSNHL) is consistently increasing.However,the pathology and prognosis of CSSNHL are still poorly understood.This retrospective study evaluated clinical characteristics and possible associated factors of CSSNHL.Methods:One hundred and thirty-six CSSNHL patients treated in Department of Otolaryngology-Head and Neck Surgery and Institute of Otolaryngology at Chinese PLA General Hospital between July 2008 and August 2015 were included in this study.These patients were analyzed for clinical characteristics,audiological characteristics,laboratory examinations,and prognostic factors.Results:Among the 136 patients (151 ears),121 patients (121 ears,80.1%) were diagnosed with unilaterally CSSNHL,and 15 patients (30 ears,19.9%) with bilateral CSSNHL.The complete recovery rate of CSSNHL was 9.3%,and the overall recovery rate was 37.7%.We found that initial degree of hearing loss,onset of treatment,tinnitus,the ascending type audiogram,gender,side of hearing loss,the recorded auditory brainstem response (ABR),and distortion product otoacoustic emissions (DPOAEs) had prognostic significance.Age,ear fullness,and vertigo had no significant correlation with recovery.Furthermore,the relevant blood tests showed 30.8% of the children had abnormal white blood cell (WBC) counts,22.1% had elevated homocysteine levels,65.8% had high alkaline phosphatase (ALP),33.8% had high IgE antibody levels,and 86.1% had positive cytomegalovirus (CMV) IgG antibodies.Conclusions:CSSNHL commonly occurs unilaterally and results in severe hearing loss.Initial severe hearing loss and bilateral hearing loss are negative prognostic factors for hearing recovery,while positive prognostic factors include tinnitus,gender,the ascending type audiogram,early treatment,identifiable ABR waves,and DPOAEs.Age,vertigo,and ear fullness are not correlated with the recovery.Some serologic indicators,including the level of WBC

  11. Influence of agglomeration of cerium oxide nanoparticles and speciation of cerium(III) on short term effects to the green algae Chlamydomonas reinhardtii

    Energy Technology Data Exchange (ETDEWEB)

    Röhder, Lena A. [Eawag, Swiss Federal Institute of Aquatic Science and Technology, Department of Environmental Toxicology, Dübendorf 8600 (Switzerland); ETH-Zurich, Institute of Biogeochemistry and Pollutant Dynamics, Zürich 8092 (Switzerland); Brandt, Tanja [Eawag, Swiss Federal Institute of Aquatic Science and Technology, Department of Environmental Toxicology, Dübendorf 8600 (Switzerland); Sigg, Laura [Eawag, Swiss Federal Institute of Aquatic Science and Technology, Department of Environmental Toxicology, Dübendorf 8600 (Switzerland); ETH-Zurich, Institute of Biogeochemistry and Pollutant Dynamics, Zürich 8092 (Switzerland); Behra, Renata, E-mail: Renata.behra@eawag.ch [Eawag, Swiss Federal Institute of Aquatic Science and Technology, Department of Environmental Toxicology, Dübendorf 8600 (Switzerland)

    2014-07-01

    Highlights: • Phosphate-dispersed CeO₂ NP did not affect photosynthetic yield in C. reinhardtii. • Agglomerated CeO₂ NP slightly decreased photosynthetic yield. • Cerium(III) was shown to affect photosynthetic yield and intracellular ROS level. • Slight effects of CeO₂ NP were caused by dissolved Ce³⁺ ions present in suspensions. • Wild type and cell wall free mutant of C. reinhardtii showed the same sensitivity. - Abstract: Cerium oxide nanoparticles (CeO₂ NP) are increasingly used in industrial applications and may be released to the aquatic environment. The fate of CeO₂ NP and effects on algae are largely unknown. In this study, the short term effects of CeO₂ NP in two different agglomeration states on the green algae Chlamydomonas reinhardtii were examined. The role of dissolved cerium(III) on toxicity, its speciation and the dissolution of CeO₂ NP were considered. The role of cell wall of C. reinhardtii as a barrier and its influence on the sensitivity to CeO₂ NP and cerium(III) was evaluated by testing both, the wild type and the cell wall free mutant of C. reinhardtii. Characterization showed that CeO₂ NP had a surface charge of ~0 mV at physiological pH and agglomerated in exposure media. Phosphate stabilized CeO₂ NP at pH 7.5 over 24 h. This effect was exploited to test CeO₂ NP dispersed in phosphate with a mean size of 140 nm and agglomerated in absence of phosphate with a mean size of 2000 nm. The level of dissolved cerium(III) in CeO₂ NP suspensions was very low and between 0.1 and 27 nM in all tested media. Exposure of C. reinhardtii to Ce(NO₃)₃ decreased the photosynthetic yield in a concentration dependent manner with EC₅₀ of 7.5 ± 0.84 μM for wild type and EC₅₀ of 6.3 ± 0.53 μM for the cell wall free mutant. The intracellular level of reactive oxygen species (ROS) increased upon exposure to Ce(NO₃)₃ with effective concentrations similar to those inhibiting photosynthesis. The agglomerated Ce

  12. Grain Growth Behavior, Tensile Impact Ductility, and Weldability of Cerium-Doped Iridium Alloys

    Energy Technology Data Exchange (ETDEWEB)

    McKamey, C.G.

    2002-05-28

    An iridium alloy doped with small amounts of cerium and thorium is being developed as a potential replacement for the iridium-based DOP-26 alloy (doped with thorium only) that is currently used by the National Aeronautics and Space Administration (NASA) for cladding and post-impact containment of the radioactive fuel in radioisotope thermoelectric generator (RTG) heat sources which provide electric power for interplanetary spacecraft. This report summarizes results of studies conducted to date under the Iridium Alloy Characterization and Development subtask of the Radioisotope Power System Materials Production and Technology Program to characterize the properties of the iridium-based alloy (designated as DOP-40) containing both cerium and thorium. Included within this report are data on grain growth of sheet material in vacuum and low-pressure oxygen environments, grain growth in vacuum of the clad vent set cup material, weldability, and the effect of grain size and test temperature on tensile properties. Where applicable, data for the DOP-26 alloy are included for comparison. Both grain size and grain-boundary cohesion affect the ductility of iridium alloys. In this study it was found that cerium and thorium, when added together, refine grain size more effectively than when thorium is added by itself (especially at high temperatures). In addition, the effect of cerium additions on grain-boundary cohesion is similar to that of thorium. Mechanical testing at both low ({approx} 10{sup -3}s{sup -1}) and high ({approx} 10{sup -3}s{sup -1}) strain rates showed that the Ce/Th-doped alloys have tensile ductilities that are as good or better than the DOP-26 alloy. The general conclusion from these studies is that cerium can be used to replace some of the radioactive thorium currently used in DOP-26 while maintaining or improving its metallurgical properties. The current DOP-26 alloy meets all requirements for cladding the radioactive fuel in the RTG heat source, but the

  13. Using cerium anomaly as an indicator of redox reactions in constructed wetland

    Science.gov (United States)

    Liang, R.

    2013-12-01

    The study area, Chiayi County located in southern Taiwan, has highly developed livestock. The surface water has very low dissolved oxygen and high NH4. Under the situation, constructed wetland becomes the most effective and economic choice to treat the wastewater in the natural waterways. Hebao Island free surface constructed wetland started to operate in late 2006. It covers an area of 0.28 km2 and is subdivided into 3 major cells, which are sedimentation cell, 1st aeration cell with rooted plants and 2nd aeration cell with float plants. The water depth of cells ranges from 0.6 m to 1.2 m. The total hydraulic retention time is about a half day. In this study, the water samples were sequentially collected along the flow path. The results of hydrochemical analysis show that the untreated inflow water can be characterized with enriched NH4 (11 ppm), sulfate (6 ppm) and arsenic (50 ppb). The removal efficiency of NH4 in the first two cells is constructed wetland. However, the removal of sulfate and phosphate is very weak. It is worth to note that arsenic is still higher than the permissible limits recommended by WHO (10 ppb). The wetland operation should be tuned to take more arsenic away in the future. As demonstrated in the above, oxidation reaction is the most dominant mechanism to remove pollutants from the wastewater; therefore, dissolved oxygen is traditionally considered as an important indicator to evaluate the operation efficiency of wetland. However, it would need longer time to achieve equilibrium state of redox reaction involving dissolved oxygen due to the slower reaction rate. For example, the input water in this study has fairly high dissolved oxygen (5 ppm) but the NH4 content is still high, which indicates a non-equilibrium condition. In this study, the cerium anomaly is alternatively utilized to evaluate the water redox state. The results demonstrate that the input water has the negative cerium anomaly of -0.16. Along the flow path, the cerium

  14. Rearrangement of valence neutrons in the neutrinoless double-$\\beta$ decay of $^{136}$Xe

    CERN Document Server

    Szwec, S V; Cocolios, T E; Entwisle, J P; Freeman, S J; Gaffney, L P; Guimarães, V; Hammache, F; McKee, P P; Parr, E; Portail, C; Schiffer, J P; de Séréville, N; Sharp, D K; Smith, J F; Stefan, I

    2016-01-01

    A quantitative description of the change in ground-state neutron occupancies between $^{136}$Xe and $^{136}$Ba, the initial and final state in the neutrinoless double-$\\beta$ decay of $^{136}$Xe, has been extracted from precision measurements of the cross sections of single-neutron adding and -removing reactions. Comparisons are made to recent theoretical calculations of the same properties using various nuclear-structure models. These are the same calculations used to determine the magnitude of the nuclear matrix elements for the process, which at present disagree with each other by factors of 2 or 3. The experimental neutron occupancies show some disagreement with the theoretical calculations.

  15. Change of nuclear configurations in the neutrinoless double-$\\beta$ decay of $^{130}$Te $\\rightarrow$ $^{130}$Xe and $^{136}$Xe $\\rightarrow$ $^{136}$Ba

    CERN Document Server

    Entwisle, J P; Tamii, A; Adachi, S; Aoi, N; Clark, J A; Freeman, S J; Fujita, H; Fujita, Y; Furuno, T; Hashimoto, T; Hoffman, C R; Ideguchi, E; Ito, T; Iwamoto, C; Kawabata, T; Liu, B; Miura, M; Ong, H J; Schiffer, J P; Sharp, D K; Süsoy, G; Suzuki, T; Szwec, S V; Takaki, M; Tsumura, M; Yamamoto, T

    2016-01-01

    The change in the configuration of valence protons between the initial and final states in the neutrinoless double-$\\beta$ decay of $^{130}$Te $\\rightarrow$ $^{130}$Xe and of $^{136}$Xe $\\rightarrow$ $^{136}$Ba has been determined by measuring the cross sections of the ($d$,$^3$He) reaction with 101-MeV deuterons. Together with our recent determination of the relevant neutron configurations involved in the process, a quantitative comparison with the latest shell-model and interacting-boson-model calculations reveals significant discrepancies. These are the same calculations used to determine the nuclear matrix elements governing the rate of neutrinoless double-$\\beta$ decay in these systems.

  16. Cyanex 923 as the extractant in a rare earth element impurity analysis of high-purity cerium oxide.

    Science.gov (United States)

    Duan, Taicheng; Li, Hongfei; Kang, JianZhen; Chen, Hangting

    2004-06-01

    In this work, the feasibility of employing Cyanex 923 as an extractant into the non-cerium REE (rare earth elements) impurity analysis of high-purity cerium oxide was investigated. Through investigations on the choice of the extraction medium, the optimium extraction acidity, matrix Ce4+ effect on the non-cerium REE ion extraction, the optimium extractant concentration and suitable extracting time, and oscillation strengh, it was found that when the phase ratio was at 1:1 and the acicidity was about 2% H2SO4, by gently shaking by hand for about 2 min, 10 mL of 30% Cyanex 923 could not extract even for a 20 ng amount of non-cerium REE3+ ions. However, the extraction efficiency for Ce4+ of 100 mg total amount under the same conditions was about 96%, indicating that a 25-fold preconcentration factor could be achieved. Thus, it was concluded that Cyanex 923 could be used in a REE impurity analysis of 99.9999% or so pure cerium oxide for primary sepapation to elimilate matrix-induced interferences encountered in an ICP-MS (inductively coupled plasma mass spectroscopy) determination.

  17. Self-poled transparent and flexible UV light-emitting cerium complex-PVDF composite: a high-performance nanogenerator.

    Science.gov (United States)

    Garain, Samiran; Sinha, Tridib Kumar; Adhikary, Prakriti; Henkel, Karsten; Sen, Shrabanee; Ram, Shanker; Sinha, Chittaranjan; Schmeißer, Dieter; Mandal, Dipankar

    2015-01-21

    Cerium(III)-N,N-dimethylformamide-bisulfate [Ce(DMF)(HSO4)3] complex is doped into poly(vinylidene fluoride) (PVDF) to induce a higher yield (99%) of the electroactive phases (β- and γ-phases) of PVDF. A remarkable enhancement of the output voltage (∼32 V) of a nanogenerator (NG) based on a nonelectrically poled cerium(III) complex containing PVDF composite film is achieved by simple repeated human finger imparting, whereas neat PVDF does not show this kind of behavior. This high electrical output resembles the generation of self-poled electroactive β-phase in PVDF due to the electrostatic interactions between the fluoride of PVDF and the surface-active positive charge cloud of the cerium complex via H-bonding and/or bipolar interaction among the opposite poles of cerium complex and PVDF, respectively. The capacitor charging capability of the flexible NG promises its applicability as piezoelectric-based energy harvester. The cerium(III) complex doped PVDF composite film exhibit an intense photoluminescence in the UV region, which might be due to a participation of electron cloud from negative pole of bipolarized PVDF. This fact may open a new area for prospective development of high-performance energy-saving flexible solid-state UV light emitters.

  18. SYNTHESIS OF CATIONIC CERIUM COMPOUNDS [CP2CE(L)2][BPH4] (L = TETRAHYDROFURAN OR TETRAHYDROTHIOPHENE) AND THE CRYSTAL-STRUCTURE OF THE TETRAHYDROTHIOPHENE DERIVATIVE

    NARCIS (Netherlands)

    HEERES, HJ; MEETSMA, A; TEUBEN, JH

    1991-01-01

    Protolysis of the cerium alkyl Cp2*CeCH(SiMe3)2 (1) by triethylammoniumtetraphenylborate provides a useful route to cationic cerium compounds [Cp2*Ce(L)2][BPh4] (2, L = tetrahydrofuran; 3, L = tetrahydrothiophene). The crystal structure of the tetrahydrothiophene derivative was determined by X-ray d

  19. Effect of cerium additive and secondary phase analysis on Ag0.5Bi0.5TiO3 ceramics

    Indian Academy of Sciences (India)

    S Supriya; Antonio J Dos Santos-García; F Fernández-Martinez

    2016-02-01

    Cerium-doped silver bismuth titanate—Ag0.5Bi0.5TiO3 (ABT) ceramics have been synthesized by the high-temperature solid-state reaction method. The structure and elemental examination of the prepared ceramic was analysed by X-ray diffraction (XRD), Fourier transform infrared, scanning electron microscopy and energydispersive spectroscopy. XRD analysis showed the presence of pyrochlore structure and secondary phase when more than 5 mol% cerium was added. The impact of temperature on cerium-doped silver bismuth titanate samples was analysed by differential thermal analysis and differential scanning calorimetry. Cerium doping caused the flaky morphology comparing with undoped sample. The homogeneity of all the samples was discussed in detail by diffuse reflectance spectrum. This is the first time the reflection process is analysed for the cerium-doped ABT system to the best of our knowledge.

  20. Reactive removal of 2-chloroethyl ethyl sulfide vapors under visible light irradiation by cerium oxide modified highly porous zirconium (hydr) oxide

    Science.gov (United States)

    Mitchell, Joshua K.; Arcibar-Orozco, Javier A.; Bandosz, Teresa J.

    2016-12-01

    Highly porous cerium oxide modified Zr(OH)4 samples were synthesized using a simple one stage urea precipitation method. The amorphicity level of zirconium hydroxide did not change upon addition of cerium oxide particles. A unique aspect of the cerium oxide-modified materials is the presence of both the oxide (CeO2) and hydroxide (Zr(OH)4) phases resulting in a unique microporous structure of the final material. Extensive characterization using various chemical and physical methods revealed significant differences in the surface features. All synthesized materials were microporous and small additions of cerium oxide affected the surface chemistry. These samples were found as effective catalysts for a decontamination of mustard gas surrogate, 2-chloroethyl ethyl sulfide (CEES). Cerium oxide addition significantly decreased the band gap of zirconium hydroxide. Ethyl vinyl sulfide and 1,2-bis (Ethyl thio) ethane were identified as surface reaction products.

  1. Section 136 of the Mental Health Act: a new literature review.

    Science.gov (United States)

    Borschmann, R D; Gillard, S; Turner, K; Chambers, M; O'Brien, A

    2010-01-01

    Section 136 of the Mental Health Act 1983 (amended) provides police officers in the United Kingdom with the authority to remove individuals who appear to be suffering from a mental illness from any public place to a designated 'place of safety' for appropriate assessment. A considerable amount of research has been dedicated to investigate who is detained under this section and how it is implemented. A review of the literature revealed a high prevalence of schizophrenia, personality disorders and mania in individuals detained under Section 136 and an over-representation of black detainees. Several studies also reported poor communication between different agencies and poor levels of knowledge regarding the implementation of the section. There is a lack of qualitative research exploring detainee and professional experience of Section 136 and in particular the patient pathway to mental health care via Section 136 experienced by black detainees. Implications for clinical practice, multi-agency collaboration and future research are discussed.

  2. 21 CFR 136.180 - Whole wheat bread, rolls, and buns.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Whole wheat bread, rolls, and buns. 136.180... § 136.180 Whole wheat bread, rolls, and buns. (a) Each of the foods whole wheat bread, graham bread... composition of milk and/or other dairy products does not apply. (b) The name of the food is “whole wheat bread...

  3. Crystallization behavior of electroless Co-Ni-B alloy plated in magnetic field in presence of cerium

    Institute of Scientific and Technical Information of China (English)

    XUAN Tian-peng; ZHANG Lei; HUANG Qin-hua

    2006-01-01

    The electrochemical property, chemical composition and crystal structure of electroless Co-Ni-B-Ce alloy plated in general state as well as in magnetic field were studied using potentiometer, plasma emission spectrometer, X-ray diffractometer,transmission electron microscope. The results show that the static potential and polarizability of electroless Co-Ni-B alloy are remarkably improved as the plating is carried out in magnetic field in the presence of a little amount of cerium in plating bath.Because of the action of magnetic field and rare earth element cerium, the boron content in alloy decreases, while cobalt and nickel contents increase. As a result, the amorphous Co-Ni-B alloy transforms to the microcrystalline Co-Ni-B-Ce alloy when the plating is in general state, and the Co-Ni-B alloy makes a crystalline transformation because of the action of magnetic field and rare earth element cerium.

  4. Determination of Ideal Broth Formulations Needed to Prepare Hydrous Cerium Oxide Microspheres via the Internal Gelation Process

    Energy Technology Data Exchange (ETDEWEB)

    Collins, Jack Lee [ORNL; Chi, Anthony [ORNL

    2009-02-01

    A simple test tube methodology was used to determine optimum process parameters for preparing hydrous cerium oxide microspheres via the internal gelation process.1 Broth formulations of cerium ammonium nitrate [(NH4)2Ce(NO3)6], hexamethylenetetramine, and urea were found that can be used to prepare hydrous cerium oxide gel spheres in the temperature range of 60 to 90 C. A few gel-forming runs were made in which microspheres were prepared with some of these formulations to be able to equate the test-tube gelation times to actual gelation times. These preparations confirmed that the test-tube methodology is reliable for determining the ideal broth formulations.

  5. Catalytic activity of cerium-doped Ru/Al2O3 during ozonation of dimethyl phthalate

    Institute of Scientific and Technical Information of China (English)

    Yunrui ZHOU; Wanpeng ZHU; Xun CHEN

    2008-01-01

    In this paper, factors influencing the mineraliza-tion of dimethyl phthalate (DMP) during catalytic ozona-tion with a cerium-doped Ru/Al2O3 catalyst were studied. The catalytic contribution was calculated through the results of a companrison experiment. It showed that doping cerium significantly enhanced catalytic activity. The total organic carbon (TOC) removal over the doped catalyst at 100 rain reached 75.1%, 61.3% using Ru/Al2O3 catalyst and only 14.0% using ozone alone. Catalytic activity reached the maximum when 0.2% of ruthenium and 1.0% of cerium'were simultaneously loaded onto Al2O3 support. Results of experiments on oxidation by ozone alone, adsorption of the catalyst, Ce ion's and heterogeneous catalytic ozonation confirmed that the contribution of het-erogeneous catalytic ozonation was about 50%, which showed the obvious effect of Ru-Ce/Al2O3 on catalytic activity.

  6. Corrosion resistance of flaky aluminum pigment coated with cerium oxides/hydroxides in chloride and acidic electrolytes

    Science.gov (United States)

    Niroumandrad, S.; Rostami, M.; Ramezanzadeh, B.

    2015-12-01

    The objective of this study was to enhance the corrosion resistance of lamellar aluminum pigment through surface treatment by cerium oxides/hydroxides. The surface composition of the pigments was studied by energy-dispersive spectroscopy (EDS) and X-ray photoelectron spectroscopy (XPS). The corrosion resistance of the pigment was evaluated by conventional hydrogen evolution measurements in acidic solution and electrochemical impedance spectroscopy (EIS) in 3.5% NaCl solution. Results showed that the Ce-rich coating composed of Ce2O3 and CeO2 was precipitated on the pigment surface after immersion in the cerium solution. The corrosion resistance of pigment was significantly enhanced after modification with cerium layer.

  7. Single crystal fiber growth of cerium doped strontium yttrate, SrY2O4:Ce3+

    Science.gov (United States)

    Philippen, J.; Guguschev, C.; Klimm, D.

    2017-02-01

    First single crystal fibers of cerium doped strontium yttrate were fabricated using the laser-heated pedestal growth technique. Through thermodynamic equilibrium calculations and by high-temperature mass spectrometry suitable growth conditions could be determined. The atmosphere played an important role during crystallization. It affected the composition shift, on the one hand, and the valence state of cerium, on the other hand. These dependencies can be explained by combining X-ray diffraction, elemental analysis, and optical spectroscopy. Crystallization in slightly reducing nitrogen atmosphere proved to be a reasonable choice, because evaporation is suppressed and trivalent cerium is stabilized. Strong green emission that depends on the oxygen fugacity during crystallization could be excited using UV light. Optical properties of SrY2O4:Ce3+ were measured for the first time.

  8. Ab initio molecular dynamics study of the properties of cerium in liquid sodium at 1000 K temperature

    Energy Technology Data Exchange (ETDEWEB)

    Samin, Adib; Li, Xiang; Zhang, Jinsuo [Nuclear Engineering Program, Department of Mechanical and Aerospace Engineering, The Ohio State University, 201 W 19th Avenue, Columbus, Ohio 43210 (United States); Mariani, R. D. [Idaho National Laboratory, Materials and Fuels Complex, Idaho Falls, Idaho 83415 (United States); Unal, Cetin [Los Alamos National Laboratory, P.O. Box 1663, Los Alamos, New Mexico 87545 (United States)

    2015-12-21

    For liquid-sodium-cooled fast nuclear reactor systems, it is crucial to understand the behavior of lanthanides and other potential fission products in liquid sodium or other liquid metal solutions such as liquid cesium-sodium. In this study, we focus on lanthanide behavior in liquid sodium. Using ab initio molecular dynamics, we found that the solubility of cerium in liquid sodium at 1000 K was less than 0.78 at. %, and the diffusion coefficient of cerium in liquid sodium was calculated to be 5.57 × 10{sup −9} m{sup 2}/s. Furthermore, it was found that cerium in small amounts may significantly alter the heat capacity of the liquid sodium system. Our results are consistent with the experimental results for similar materials under similar conditions.

  9. Ab initio molecular dynamics study of the properties of cerium in liquid sodium at 1000 K temperature

    Science.gov (United States)

    Samin, Adib; Li, Xiang; Zhang, Jinsuo; Mariani, R. D.; Unal, Cetin

    2015-12-01

    For liquid-sodium-cooled fast nuclear reactor systems, it is crucial to understand the behavior of lanthanides and other potential fission products in liquid sodium or other liquid metal solutions such as liquid cesium-sodium. In this study, we focus on lanthanide behavior in liquid sodium. Using ab initio molecular dynamics, we found that the solubility of cerium in liquid sodium at 1000 K was less than 0.78 at. %, and the diffusion coefficient of cerium in liquid sodium was calculated to be 5.57 × 10-9 m2/s. Furthermore, it was found that cerium in small amounts may significantly alter the heat capacity of the liquid sodium system. Our results are consistent with the experimental results for similar materials under similar conditions.

  10. Implementation of a complex multi-phase equation of state for cerium and its correlation with experiment

    Energy Technology Data Exchange (ETDEWEB)

    Cherne, Frank J [Los Alamos National Laboratory; Jensen, Brian J [Los Alamos National Laboratory; Elkin, Vyacheslav M [VNIITF

    2009-01-01

    The complexity of cerium combined with its interesting material properties makes it a desirable material to examine dynamically. Characteristics such as the softening of the material before the phase change, low pressure solid-solid phase change, predicted low pressure melt boundary, and the solid-solid critical point add complexity to the construction of its equation of state. Currently, we are incorporating a feedback loop between a theoretical understanding of the material and an experimental understanding. Using a model equation of state for cerium we compare calculated wave profiles with experimental wave profiles for a number of front surface impact (cerium impacting a plated window) experiments. Using the calculated release isentrope we predict the temperature of the observed rarefaction shock. These experiments showed that the release state occurs at different magnitudes, thus allowing us to infer where dynamic {gamma} - {alpha} phase boundary is.

  11. Effect of ultrasound on the structural and textural properties of copper-impregnated cerium-modified zirconium-pillared bentonite

    Science.gov (United States)

    Tomul, Fatma

    2011-12-01

    In this study, the synthesis of zirconium-pillared bentonite modified with cerium was performed via two different methods by the application of conventional and ultrasonic treatments during the intercalation stage. To synthesise copper-impregnated pillared clays by wet impregnation, cerium-modified zirconium-pillared clays were used as supportive materials after being calcined at 300 °C. Ultrasonic treatment significantly decreased the required processing time compared with the conventional treatment of the synthesised pillared bentonites. Chemical analysis confirmed the incorporation of Zr 4+, Ce 4+ and Cu 2+ species into the pillared bentonites. X-ray diffraction (XRD) patterns of zirconium- and cerium/zirconium-pillared bentonites prepared by conventional treatment show that one large d-spacing above 3.5 nm corresponds to the mesoporous delaminated part, and another small d-spacing above 1.7 nm is indicative of the microporous pillared part. Zirconium- and cerium/zirconium-pillared bentonites prepared via ultrasonic treatment exhibited similar results, with the same high d-spacing but with a second low-intensity d-spacing above 1.9 nm. The delaminated structures of the pillared bentonites synthesised by both methods were conserved after copper impregnation. Nitrogen-adsorption isotherm analysis showed that the textural characteristics of products synthesised by ultrasonic treatment were comparable to those of products synthesised by conventional treatment. Fourier-transform infrared spectroscopy (FTIR) analyses showed the presence of Brønsted- and Lewis-acid sites, and zirconium-pillared clays synthesised by conventional treatment exhibited increased numbers of Brønsted- and Lewis-acid sites after cerium addition and copper impregnation. However, the products synthesised by ultrasonic treatment exhibited an increased number of Brønsted- and Lewis-acid sites after cerium addition, but a decreased number of acid sites after copper impregnation.

  12. Influence of agglomeration of cerium oxide nanoparticles and speciation of cerium(III) on short term effects to the green algae Chlamydomonas reinhardtii.

    Science.gov (United States)

    Röhder, Lena A; Brandt, Tanja; Sigg, Laura; Behra, Renata

    2014-07-01

    Cerium oxide nanoparticles (CeO2 NP) are increasingly used in industrial applications and may be released to the aquatic environment. The fate of CeO2 NP and effects on algae are largely unknown. In this study, the short term effects of CeO2 NP in two different agglomeration states on the green algae Chlamydomonas reinhardtii were examined. The role of dissolved cerium(III) on toxicity, its speciation and the dissolution of CeO2 NP were considered. The role of cell wall of C. reinhardtii as a barrier and its influence on the sensitivity to CeO2 NP and cerium(III) was evaluated by testing both, the wild type and the cell wall free mutant of C. reinhardtii. Characterization showed that CeO2 NP had a surface charge of ∼0mV at physiological pH and agglomerated in exposure media. Phosphate stabilized CeO2 NP at pH 7.5 over 24h. This effect was exploited to test CeO2 NP dispersed in phosphate with a mean size of 140nm and agglomerated in absence of phosphate with a mean size of 2000nm. The level of dissolved cerium(III) in CeO2 NP suspensions was very low and between 0.1 and 27nM in all tested media. Exposure of C. reinhardtii to Ce(NO3)3 decreased the photosynthetic yield in a concentration dependent manner with EC50 of 7.5±0.84μM for wild type and EC50 of 6.3±0.53μM for the cell wall free mutant. The intracellular level of reactive oxygen species (ROS) increased upon exposure to Ce(NO3)3 with effective concentrations similar to those inhibiting photosynthesis. The agglomerated CeO2 NP caused a slight decrease of photosynthetic yield at the highest concentrations (100μM), while no effect was observed for dispersed CeO2 NP. The low toxicity of agglomerated CeO2 NP was attributed quantitatively to Ce(3+) ions co-occurring in the nanoparticle suspension whereas for dispersed CeO2 NP, dissolved Ce(3+) was precipitated with phosphate and not bioavailable. Furthermore CeO2 NP did not affect the intracellular ROS level. The cell wall free mutant and wild type of C

  13. Trinitratobis{N'-[1-(2-pyridyl)ethylidene]isonicotinohydrazide}cerium(III): a three-dimensional cerium-organic supramolecular structure.

    Science.gov (United States)

    Zhang, Ying Ying; Liu, Shi Xiong

    2009-07-01

    The Ce(III) ion in the title complex, [Ce(NO(3))(3)(C(13)H(12)N(4)O)(2)], is 12-coordinated by six chelating nitrate O atoms and six donors (2 O and 4 N atoms) of two N'-[1-(2-pyridyl)ethylidene]isonicotinohydrazide ligands, exhibiting a bicapped pentagonal-antiprism-type coordination geometry. The title complex possesses C(2) point symmetry and is located on a twofold crystallographic axis. Each molecule is linked with four surrounding molecules by four N-H...N hydrogen bonds, resulting in an extended two-dimensional layer parallel to the ab plane, while pi-pi interactions between pyridine rings from neighboring complex molecules connect the two-dimensional layers into a three-dimensional cerium-organic supramolecular structure.

  14. Equivalent Activity Coefficient Phenomenon of Cerium Reacting with Lead or Bismuth in Ag, Cu and Zn Alloy

    Institute of Scientific and Technical Information of China (English)

    薛松柏; 钱乙余; 董健

    2002-01-01

    The relation between contents of cerium and impurity lead or bismuth to their activity coefficient in Ag, Cu and Zn-base alloy was calculated and analyzed by using the ternary system Chou model. The thermodynamic calculation results show that the "equivalent activity coefficient phenomenon" emerges among the activity coefficient of solute in a certain range of cerium (or at a certain point) for the Ce-Pb-X and Ce-Bi-X (X=Ag, Cu or Zn) ternary alloy system. Under this condition, the activity coefficient of solute has nothing to do with its own concentration. The preliminary theoretical analysis to this phenomenon was also made.

  15. Improvement of corrosion resistance of AZ31 Mg alloy by anodizing with co-precipitation of cerium oxide

    Institute of Scientific and Technical Information of China (English)

    Salah Abdelghany SALMAN; Ryoichi ICHINO; Masazumi OKIDO

    2009-01-01

    Anodizing of AZ31 Mg alloy in NaOH solution by co-precipitation of cerium oxide was investigated. The chemical composition and phase structure of the coating film were determined via optical microscopy, SEM and XRD. The corrosion properties of the anodic film were characterized by using potentiodynamic polarization curves in 17 mmol/L NaCl and 0.1 mol/L Na2SO4 solution at 298 K. The corrosion resistance of AZ31 magnesium alloy is significantly improved by adding cerium oxide to alkaline solution. In addition, the surface properties are enhanced and the film contains no crack.

  16. Catalytic wet peroxidation of pyridine bearing wastewater by cerium supported SBA-15

    Energy Technology Data Exchange (ETDEWEB)

    Subbaramaiah, V. [Department of Chemical Engineering, Indian Institute of Technology Roorkee, Roorkee 247667 Uttarakhand (India); Srivastava, Vimal Chandra, E-mail: vimalcsr@yahoo.co.in [Department of Chemical Engineering, Indian Institute of Technology Roorkee, Roorkee 247667 Uttarakhand (India); Mall, Indra Deo [Department of Chemical Engineering, Indian Institute of Technology Roorkee, Roorkee 247667 Uttarakhand (India)

    2013-03-15

    Highlights: ► Cerium supported SBA-15 (Ce/SBA-15) synthesized by two-step synthesis. ► Characterization of Ce/SBA-15 by FTIR, XRD and BET surface area. ► Catalytic peroxidation of pyridine by Ce/SBA-15. ► Optimization of parameters like catalyst dose, H{sub 2}O{sub 2} dose, initial concentration and temperature. ► Catalyst reusability and leaching study performed. -- Abstract: Cerium supported SBA-15 (Ce/SBA-15) was synthesized by two-step synthesis method in acidic medium. It was further characterized by various characterization techniques such as X-ray diffraction, field-emission scanning electron microscopy, Fourier transform infrared spectroscopy and N{sub 2} adsorption–desorption pore size distribution analysis. The Ce/SBA-15 showed highly ordered meso-structure with pore diameter ≈ 70–100 A and pore volume ≈ 0.025 cm{sup 3}/g. Ce/SBA-15 was further evaluated as a catalyst for the oxidation of highly toxic and non-biodegradable material, pyridine, by catalytic wet-peroxidation method. The effects of various operating parameters such as catalyst dose (0.5–6 g/l), stoichiometric ratio of H{sub 2}O{sub 2}/pyridine (1–6), initial pyridine concentration (50–800 mg/l) and temperature (313–358 K) have been evaluated and optimized. Ce/SBA-15 showed stable performance during reuse for six cycles with negligible cerium leaching. Kinetic and thermodynamic parameters and operation cost have also been determined.

  17. Application of Cerium (IV as an Oxidimetric Agent for the Determination of Ethionamide in Pharmaceutical Formulations

    Directory of Open Access Journals (Sweden)

    Kanakapura Basavaiah

    2016-01-01

    Full Text Available Two simple methods are described for the determination of ethionamide (ETM in bulk drug and tablets using cerium (IV sulphate as the oxidimetric agent. In both methods, the sample solution is treated with a measured excess of cerium (IV solution in H2SO4 medium, and after a fixed standing time, the residual oxidant is determined either by back titration with standard iron (II solution to a ferroin end point in titrimetry or by reacting with o-dianisidine followed by measurement of the absorbance of the orange-red coloured product at 470 nm in spectrophotometry. In titrimetry, the reaction proceeded with a stoichiometry of 1 : 2 (ETM : Ce (IV and the amount of cerium (IV consumed by ETM was related to the latter’s amount, and the method was applicable over 1.0–8.0 mg of drug. In spectrophotometry, Beer’s law was obeyed over the concentration range of 0.5–5.0 μg/mL ETM with a molar absorptivity value of 2.66 × 104 L/(mol·cm. The limits of detection (LOD and quantification (LOQ calculated according to ICH guidelines were 0.013 and 0.043 μg/mL, respectively. The proposed titrimetric and spectrophotometric methods were found to yield reliable results when applied to bulk drug and tablets analysis, and hence they can be applied in quality control laboratories.

  18. Relationship between surface area and crystal size of pure and doped cerium oxides

    Institute of Scientific and Technical Information of China (English)

    C.; Bueno-Ferrer; S.; Parres-Esclapez; D.; Lozano-Castelló; A.; Bueno-López

    2010-01-01

    Pure and Zr, La or Pr-doped cerium oxides were characterised by transmission electron microscopy (TEM), N2 adsorption-desorption at -196 oC and X-ray diffraction (XRD). For crystal sizes calculation, the Scherrer and Williamson-Hall equations were compared, and the relationship between surface area and crystal size was critically discussed. It was demonstrated that the Williamson-Hall equation must be used instead of the Scherrer equation to calculate crystal sizes, since the latter equation underestimated ...

  19. Trace electrochemical analysis of Europium, Ytterbium, and Cerium at their joint presence in solution

    Directory of Open Access Journals (Sweden)

    Rema Matakova

    2012-03-01

    Full Text Available In the course of several decades at the department of analytical chemistry and chemistry of rare elements there were studied the electrode processes with participation of rare-earth metals (REM in accordance with the long awaiting problem of the development of rare-metal and rare-earth branch of non-ferrous metallurgy of Kazakhstan. With the aim of express and highly sensitive analytical control of raw materials and final product of rare-earth industry there were developed the methods of inversion-voltamperometric determination of low concentrations of europium, ytterbium and cerium under the conditions of their individual and combined presence in the solution.

  20. Sequence-specific Hydrolysis of Single-stranded DNA by PNA-Cerium (Ⅳ) Adduct

    Institute of Scientific and Technical Information of China (English)

    He Bai SHEN; Feng WANG; Yong Tao YANG

    2005-01-01

    A novel artificial site specific cleavage reagent, with peptide nucleic acid (PNA) as sequence-recognizing moiety and cerium (Ⅳ) ions as "scissors" for cleaving target DNA, was synthesized. Subsequently, it was employed in the cleavage of target 26-mer single-stranded DNA (ssDNA), which has 10-mer sequence complementary with PNA recognizer in the hybrids,under physiological conditions. Reversed-phase high-performance liquid chromatogram (RPHPLC) experiments indicated that the artificial site specific cleavage reagent could cleave the target DNA specifically.

  1. Surface structures of cerium oxide nanocrystalline particles from the size dependence of the lattice parameters

    Science.gov (United States)

    Tsunekawa, S.; Ito, S.; Kawazoe, Y.

    2004-10-01

    Cerium oxide nanocrystalline particles are synthesized and monodispersed in the size range from 2 to 8nm in diameter. The dependence of the lattice parameters on particle size is obtained by x-ray and electron diffraction analyses. The size dependence well coincides with the estimation based on the assumption that the surface is composed of one layer of Ce2O3 and the inside consists of CeO2. The effect of particle size on lattice parameters is discussed from the differences in the fabrication method and the surface structure.

  2. High-quality single-crystal growth and unique electronic states in cerium and uranium compounds

    Science.gov (United States)

    Onuki, Yoshichika; Settai, Rikio; Sugiyama, Kiyohiro; Inada, Yoshihiko; Takeuchi, Tetsuya; Haga, Yoshinori; Yamamoto, Etsuji; Harima, Hisatomo; Yamagami, Hiroshi

    2007-03-01

    We have grown many kinds of high-quality single crystals of cerium and uranium compounds and studied the Fermi surface properties via the de Haas-van Alphen experiments and energy band calculations. The quasi-two-dimensional electronic states are clarified in some compounds such as USb2, CeCoIn5, UPtGa5 and most likely UIr. In a ferromagnet CeRh3B2, we have found unique electronic states with quasi-one-dimensional character.

  3. A nonreciprocal racetrack resonator based on vacuum-annealed magnetooptical cerium-substituted yttrium iron garnet.

    Science.gov (United States)

    Goto, Taichi; Onbasli, Mehmet C; Kim, Dong Hun; Singh, Vivek; Inoue, M; Kimerling, Lionel C; Ross, C A

    2014-08-11

    Vacuum annealed polycrystalline cerium substituted yttrium iron garnet (CeYIG) films deposited by radio frequency magnetron sputtering on non-garnet substrates were used in nonreciprocal racetrack resonators. CeYIG annealed at 800°C for 30 min provided a large Faraday rotation angle, close to the single crystal value. Crystallinity, magnetic properties, refractive indices and absorption coefficients were measured. The resonant transmission peak of the racetrack resonator covered with CeYIG was non-reciprocally shifted by applying an in-plane magnetic field.

  4. Performance of a Tungsten-Cerium Fluoride Sampling Calorimeter in High-Energy Electron Beam Tests

    CERN Document Server

    Becker, R.; Dissertori, G.; Djambazov, L.; Donega, M.; Lustermann, W.; Marini, A.C.; Nessi-Tedaldi, F.; Pandolfi, F.; Peruzzi, M.; Schönenberger, M.; Cavallari, F.; Dafinei, I.; Diemoz, M.; Lope, C. Jorda; Meridiani, P.; Nuccetelli, M.; Paramatti, R.; Pellegrino, F.; Micheli, F.; Organtini, G.; Rahatlou, S.; Soffi, L.; Brianza, L.; Govoni, P.; Martelli, A.; Tabarelli de Fatis, T.; Monti, V.; Pastrone, N.; Trapani, P.P.; Candelise, V.; Della Ricca, G.

    2015-12-21

    A prototype for a sampling calorimeter made out of cerium fluoride crystals interleaved with tungsten plates, and read out by wavelength-shifting fibres, has been exposed to beams of electrons with energies between 20 and 150 GeV, produced by the CERN Super Proton Synchrotron accelerator complex. The performance of the prototype is presented and compared to that of a Geant4 simulation of the apparatus. Particular emphasis is given to the response uniformity across the channel front face, and to the prototype's energy resolution.

  5. UV-Shielding and Catalytic Characteristics of Nanoscale Zinc-Cerium Oxides

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Fine particles of zinc-cerium oxides (ZCO) used as an ultraviolet filter were prepared via combustion synthesis route. The catalytic activity, UV-shielding performance, surface modification and application of ZCO in polyester varnish were discussed in detail. The experimental results indicate that the photo-catalytic activity of ZCO is much smaller than these of ZnO and TiO2; the oxidation catalytic activity of ZCO is far lower than that of CeO2; the ZCO has shown excellent ultraviolet absorption in the range of UV;addition modified ZCO (MZCO) into polyester will enhance the UV-shielding capability of polyester.

  6. APPLICATIONS OF CERIUM BIS (MONOMYRISTY—LPHOSPHATE)ADSORBENT TO REVERSED PHASE LIQUID CHROMATOGRAPHY

    Institute of Scientific and Technical Information of China (English)

    SuZhengquan; FengHuixia; 等

    1996-01-01

    The tetravalent metal salts of monoalkyl phosphates [M(O3POR)2]are a new kind of stationary phases of Chromatography-homogeneous bonded phases.This paper deals with the application of cerium bis(monomyristylphosphate)as support to reversed phase liquid chromatography.The results show that the best mobil phase is CH3CN:H2O=95:5.The good separation to the mixture containing six aromatic hydrocarbons and the determination of naphthalene in a group samples have been achieved.The regression analysis shows that detect limits,linearities and precision for six aromatic hydrocarbons are good.

  7. ARTICLES: Photoinduced light scattering in cerium-doped barium strontium niobate crystals

    Science.gov (United States)

    Voronov, Valerii V.; Dorosh, I. R.; Kuz'minov, Yu S.; Tkachenko, N. V.

    1980-11-01

    Photoinduced light scattering was observed in cerium-doped (SrxBa1-x)1-y(Nb2O6)y crystals having the composition x = 0.61, y = 0.4993. It was found that this effect is due to holographic amplification of light scattered by crystal defects. An analysis is made of static and dynamic characteristics of self-amplification of scattered light in the crystals. A theoretical model of the process is constructed assuming that the hologram recording process is of the diffusion type. Theoretical results are compared with the experiment.

  8. Photoinduced light scattering in cerium-doped barium strontium niobate crystals

    Science.gov (United States)

    Voronov, V. V.; Dorosh, I. R.; Kuz'minov, Yu. S.; Tkachenko, N. V.

    Photoinduced light scattering was observed in cerium-doped (Srx Ba1-x)1-y(Nb2O6)y crystals having the composition x = 0.61, y = 0.4993. It was found that this effect is due to holographic amplification of light scattered by crystal defects. An analysis is made of static and dynamic characteristics of self-amplification of scattered light in the crystals. A theoretical model of the process is constructed assuming that the hologram recording process is of the diffusion type. Theoretical results are compared with the experiment.

  9. Performance of a tungsten–cerium fluoride sampling calorimeter in high-energy electron beam tests

    Energy Technology Data Exchange (ETDEWEB)

    Becker, R.; Bianchini, L.; Dissertori, G.; Djambazov, L.; Donega, M.; Lustermann, W.; Marini, A.C.; Nessi-Tedaldi, F. [Institut for Particle Physics, ETH Zurich (Switzerland); Pandolfi, F., E-mail: francesco.pandolfi@cern.ch [Institut for Particle Physics, ETH Zurich (Switzerland); Peruzzi, M.; Schönenberger, M. [Institut for Particle Physics, ETH Zurich (Switzerland); Cavallari, F.; Dafinei, I.; Diemoz, M.; Lope, C. Jorda; Meridiani, P.; Nuccetelli, M.; Paramatti, R.; Pellegrino, F. [INFN – Sezione di Roma (Italy); Micheli, F. [Dipartimento di Fisica “Sapienza”, Università di Roma e INFN – Sezione di Roma (Italy); and others

    2015-12-21

    A prototype for a sampling calorimeter made out of cerium fluoride crystals interleaved with tungsten plates, and read out by wavelength-shifting fibres, has been exposed to beams of electrons with energies between 20 and 150 GeV, produced by the CERN Super Proton Synchrotron accelerator complex. The performance of the prototype is presented and compared to that of a GEANT4 simulation of the apparatus. Particular emphasis is given to the response uniformity across the channel front face, and to the prototype's energy resolution.

  10. PVC-based 1,3,5-trithiane sensor for cerium(III) ions

    Science.gov (United States)

    Shamsipur; Yousefi; Ganjali

    2000-06-01

    A PVC membrane sensor for cerium(III) ions based on 1,3,5-trithiane as membrane carrier was prepared. The sensor has a linear dynamic range of 1.0 x 10(-1)-5.0 x 10(-5) M, with a Nernstian slope of 19.4+/-0.4 mV decade(-1), and a detection limit 3.0 x 10(-5) M. It has a fast response time of fluoride ions and in determination of F- ion in some mouth wash preparations.

  11. Spectroscopy of gadolinium gallium garnet doped with cerium under high hydrostatic pressure

    OpenAIRE

    2012-01-01

    Studies of the spectroscopic properties of Ce3+ dopant in bulk Gd3Ga5O12:Ce crystal under pressure are presented. In spite of strong inter-shell 4f ® 5d absorption bands at ambient pressure the cerium luminescence in Gd3Ga5O12 is entirely quenched even at low temperature. It has been shown that applying pressure allows for recovering the 5d ® 4f radiative transitions. Further increase of pressure improves the emission efficiency. This effect is analyzed in terms of two possible phenomen...

  12. The highly conserved human cytomegalovirus UL136 ORF generates multiple Golgi-localizing protein isoforms through differential translation initiation.

    Science.gov (United States)

    Liao, Huanan; Lee, Jung-Hyun; Kondo, Rikita; Katata, Marei; Imadome, Ken-Ichi; Miyado, Kenji; Inoue, Naoki; Fujiwara, Shigeyoshi; Nakamura, Hiroyuki

    2014-01-22

    The UL133-UL138 locus in the unique long b' (ULb') region of the human cytomegalovirus (HCMV) genome is considered to play certain roles in viral replication, dissemination and latency in a host cell type-dependent manner. Here we characterized the proteins encoded by UL136, one of the open reading frames (ORFs) in the locus. Comparative sequence analysis of UL136 among clinical isolates and laboratory strains indicates that its predicted amino-acid sequence is highly conserved. A polyclonal antibody against UL136 proteins (pUL136s) was raised against its carboxy-terminal region and this antibody specifically recognized at least five UL136-encoded protein isoforms of 29-17 kDa both in HCMV-infected cells and in cells transfected with a construct expressing pUL136. Immunofluorescence analysis with this antibody revealed localization of pUL136 in the Golgi apparatus. Analysis of several pUL136 mutants indicated that the putative transmembrane domain of pUL136 is required for its Golgi localization. Mutational analysis of multiple AUG codons in UL136 demonstrated that translation initiation from these AUG codons contributes in the generation of pUL136 isoforms.

  13. Scintillation and Luminescence Properties of Undoped and Cerium-doped LiGdCl4 and NaGdCl4

    Energy Technology Data Exchange (ETDEWEB)

    Porter-Chapman, Yetta D.; Bourret-Courchesne, Edith D.; Bizarri, Gregory; Weber, Marvin J.; Derenzo, Stephen E.

    2008-10-05

    We report the scintillation properties of the undoped and cerium-doped variations of LiGdCl4 and NaGdCl4. Powder samples of these materials exhibit significant scintillation under X-rays. The samples were synthesized by solid-state methods from a 1:1 molar ratio of lithium or sodium chloride and gadolinium chloride. Cerium trichloride was used as the dopant. The physical, optical, and scintillation properties of these materials were analyzed by powder X-ray diffraction, photoluminescence, X-ray excited luminescence, and pulsed X-ray luminosity measurements. Increases in light yields are observed as the concentration of cerium increases. The highest light yields occurred at 20 percent cerium doping for both compounds. At larger concentrations neither compound formed, indicating a breakdown of the lattice with the addition of large amounts of cerium cations. At 20 percent cerium, LiGdCl4 and NaGdCl4 display scintillation light 3.6 times and 2.2 times the light yield of the reference material, YAlO3:Ce3+, respectively. Both emit in the ranges of 340 ? 350 nm and 365 - 370 nm and display multiexponential decays with cerium-like decay components at 33 ns (LiGdCl4:Ce) and 26 ns (NaGdCl4:Ce).

  14. Effects of cerium oxide supplementation to laying hen diets on performance, egg quality, some antioxidant enzymes in serum and lipid oxidation in egg yolk.

    Science.gov (United States)

    Bölükbaşı, S C; Al-Sagan, A A; Ürüşan, H; Erhan, M K; Durmuş, O; Kurt, N

    2016-08-01

    This study was conducted to determine the effects of dietary cerium oxide levels (0, 100, 200, 300 or 400 mg/kg) on the laying performance, egg quality, some blood serum parameters and egg lipid peroxidation of laying hen. In total, one hundred and twenty 22-week-old brown Lohman LSL laying hens were randomly assigned to five groups equally (n = 24). Each treatment was replicated six times. Dietary supplementation of cerium oxide had no significant effect on feed intake and egg weight. The addition of cerium oxide to the laying hens' feed improved feed conversion ratio and increased (p laying hens feed led to a significant (p laying hen diets. It was also observed that serum superoxide dismutase (SOD) activity and malondialdehyde (MDA) concentration decreased significantly with supplementation of cerium oxide in diets. Inclusion of cerium oxide resulted in a significant reduction in thiobarbituric acid reactive substance (TBARS) values in egg yolk in this study. It can be concluded that the addition of cerium oxide had positive effects on egg production, feed conversion ratio and egg shelf life. Based on the results of this study, it could be advised to supplement laying hens feed with cerium oxide as feed additives.

  15. Effect of cerium on structure modifications of a hybrid sol–gel coating, its mechanical properties and anti-corrosion behavior

    Energy Technology Data Exchange (ETDEWEB)

    Cambon, Jean-Baptiste, E-mail: cambon@chimie.ups-tlse.fr [Institut Carnot CIRIMAT, Université de Toulouse, UMR CNRS 5085, 118 Route de Narbonne, 31062 Toulouse Cedex 9 (France); Esteban, Julien; Ansart, Florence; Bonino, Jean-Pierre; Turq, Viviane [Institut Carnot CIRIMAT, Université de Toulouse, UMR CNRS 5085, 118 Route de Narbonne, 31062 Toulouse Cedex 9 (France); Santagneli, S.H.; Santilli, C.V.; Pulcinelli, S.H. [Departamento Fısico-Química, Instituto de Química, Universidade Estadual Paulista, UNESP, CP 355, 14801-970 Araraquara, SP (Brazil)

    2012-11-15

    Highlights: ► New sol–gel routes to replace chromates for corrosion protection of aluminum. ► Effect of cerium concentration on the microstructure of xerogel. ► Electrochemical and mechanical performances of hybrid coating with different cerium contents. ► Good correlation between the different results with an optimal cerium content of 0.01 M. -- Abstract: An organic–inorganic hybrid coating was developed to improve the corrosion resistance of the aluminum alloy AA 2024-T3. Organic and inorganic coatings derived from glycidoxypropyl-trimethoxysilane (GPTMS) and aluminum tri-sec-butoxide Al(O{sup s}Bu){sub 3}, with different cerium contents, were deposited onto aluminum by dip-coating process. Corrosion resistance and mechanical properties were investigated by electrochemical impedance measurements and nano-indentation respectively. An optimal cerium concentration of 0.01 M was evidenced. To correlate and explain the hybrid coating performances in relation to the cerium content, NMR experiments were performed. It has been shown that when the cerium concentration in the hybrid is higher than 0.01 M there are important modifications in the hybrid structure that account for the mechanical properties and anti-corrosion behavior of the sol–gel coating.

  16. Characterization of microstructure and catalytic of cerium oxide obtained by colloidal solution; Caracterizacao da microestrutura e da atividade catalitica de oxido de cerio obtido por solucao coloidal

    Energy Technology Data Exchange (ETDEWEB)

    Senisse, C.A.L.; Bergmann, C.P.; Alves, A.K., E-mail: carolinasenisse@hotmail.com [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alege, RS (Brazil). Lab. de Materiais Ceramicos

    2012-07-01

    This study investigated to obtain particles of cerium oxide, for use as catalysts for the combustion of methane using the technique of through polymeric colloidal solution. Obtaining the colloidal system is based on hydrolysis of salts such as cerium acetylacetonate, cerium nitrate in the presence of additives such as polyvinylbutyral (PVB), polyvinylpyrrolidone (PVP) and polyvinyl acetate (PVA), at concentrations of 5, 10 and 15% in aqueous or alcoholic medium. These solutions containing ions of interest were subjected to a heat treatment at 650° C for 30 minutes, with heating rate of 2 ° C/ min. After heat treatment, the fibers were characterized according to their morphology, surface area, crystallinity, weight loss and catalytic activity. Samples obtained from cerium acetylacetonate were more reactive than the cerium nitrate to the combustion of methane, as showed greater conversions and higher temperatures reached during the process, which is of utmost importance since the combustion catalytic methane is used for generating thermal energy. After the reaction with methane, the samples underwent significant change in surface area, probably due to the intensity of combustion reactions of the nitrate and the generation of heat involved in this reaction, which gave rise to coarse particles. During the combustion process using the obtained from particles of cerium acetylacetonate, there was the release of large quantities of nitrogen compared to the results of assays with the particles obtained with cerium nitrate. (author)

  17. Detection of the barium daughter in 136Xe →136Ba+2e- by in situ single-molecule fluorescence imaging

    Science.gov (United States)

    Nygren, David R.

    2016-07-01

    A robust technique for rejection of all γ-ray induced backgrounds in the search for the decay 136Xe→136Ba+2e- is needed to proceed to ton-scale detection systems. Efficient detection of the barium daughter would provide a long-sought pathway toward this goal. Single-molecule fluorescent imaging may offer a new way to detect the barium daughter atom in a naturally ionized state. A doubly charged barium ion can initiate a chelation process with a non-fluorescent precursor molecule, leading to a highly fluorescent complex. Repeated photo-excitation of the complex can reveal both presence and location of a single ionized atom with high precision and selectivity. Detection would be automatic, and is accomplished within the active volume of a xenon gas Time Projection Chamber operating at high pressure.

  18. Analysis of Sleepl EEG in 136 Patients with Epilepsy in Childred%136例小儿癫痫的睡眠脑电图分析

    Institute of Scientific and Technical Information of China (English)

    莫仲娟

    2005-01-01

    目的探讨睡眠EEG对癫痫的诊断价值、优点及诊断中的注意事项.方法分析应用日本光电4418型EEG仪监测136例癫痫患者睡眠EEG.结果136例,正常28例(20.6%),非特异性异常12例(8.8%),痫样放电96例(70.6%).结论睡眠EEG可反映睡眠结构和异常放电的发作情况;同时EEG可观察临床发作的全过程及发作时EEG的演变过程,能更明确局限性癫痫诊断及定位,也可为全身性发作者寻找致痫灶.

  19. [XPS study on the influence of calcination conditions to cerium ion valence].

    Science.gov (United States)

    Mei, Yan; Yan, Jian-ping; Nie, Zuo-ren

    2010-01-01

    For the system of Ce(NO3)2.6H2O and urea solution during homogeneous precipitation method, X-ray diffraction (XRD), infrared spectrum (IR) and especially X-ray photoelectron spectroscopy (XPS) were used to study and characterize the product structure, variety of cerium ion valence, compound surface character and kernel electronic configurations. The results of XRD and IR showed that calcination temperature had a great effect on the cerium ion valence. The products are orthorhombic Ce2 O(CO3)2.H2O with valence III by using homogeneous precipitation method directly. When heated from the temperature 200 degrees C to 250 degrees C, the product of CeO(CO3)2.H2O with valence VI was finally changed into stable CeO2 with valence IV. XPS was used to study the surface character and kernel electronic configurations of the three different compounds through fine scanning of O(1s), Ce(3d) and Ce(4d) apices, and the results approved that the compounds with different valences are caused by the different valence electronic configurations of the products.

  20. Custom cerium oxide nanoparticles protect against a free radical mediated autoimmune degenerative disease in the brain.

    Science.gov (United States)

    Heckman, Karin L; DeCoteau, William; Estevez, Ana; Reed, Kenneth J; Costanzo, Wendi; Sanford, David; Leiter, James C; Clauss, Jennifer; Knapp, Kylie; Gomez, Carlos; Mullen, Patrick; Rathbun, Elle; Prime, Kelly; Marini, Jessica; Patchefsky, Jamie; Patchefsky, Arthur S; Hailstone, Richard K; Erlichman, Joseph S

    2013-12-23

    Cerium oxide nanoparticles are potent antioxidants, based on their ability to either donate or receive electrons as they alternate between the +3 and +4 valence states. The dual oxidation state of ceria has made it an ideal catalyst in industrial applications, and more recently, nanoceria's efficacy in neutralizing biologically generated free radicals has been explored in biological applications. Here, we report the in vivo characteristics of custom-synthesized cerium oxide nanoparticles (CeNPs) in an animal model of immunological and free-radical mediated oxidative injury leading to neurodegenerative disease. The CeNPs are 2.9 nm in diameter, monodispersed and have a -23.5 mV zeta potential when stabilized with citrate/EDTA. This stabilizer coating resists being 'washed' off in physiological salt solutions, and the CeNPs remain monodispersed for long durations in high ionic strength saline. The plasma half-life of the CeNPs is ∼4.0 h, far longer than previously described, stabilized ceria nanoparticles. When administered intravenously to mice, the CeNPs were well tolerated and taken up by the liver and spleen much less than previous nanoceria formulations. The CeNPs were also able to penetrate the brain, reduce reactive oxygen species levels, and alleviate clinical symptoms and motor deficits in mice with a murine model of multiple sclerosis. Thus, CeNPs may be useful in mitigating tissue damage arising from free radical accumulation in biological systems.

  1. Studies on luminescence from a cerium-doped strontium stannate phosphor.

    Science.gov (United States)

    Karabulut, Yüksel; Ayvacikli, Mehmet; Canimoglu, Adil; Garcia Guinea, Javier; Can, Nurdogan

    2015-06-01

    The crystal structure and morphology of Ce(3+) -doped SrSnO3 materials prepared using the solid-state reaction method were extensively characterized using experimental techniques. X-Ray diffraction results show that the cerium substitution of strontium does not change the structure of the strontium stannate. Raman spectroscopy was used to investigate the microstructures and lattice vibrations. Environmental scanning electron microscopy images showed that phosphors aggregate and their particles form irregular shapes. SrSnO3 exhibits an intense green emission with a broad band originating from the 5d(1)  → 4f(1) transition of cerium. It was observed that, after exposure to beta-irradiation, the glow curve of this material has two broad thermoluminescence peaks, one centered at ~ 127°C and the other at ~ 245°C for a heating rate of 5 K/s. The kinetic parameters, which include the frequency factor and the activation energy of the material, were calculated using Chen's method, after beta-irradiation. The fading and reusability of the phosphor were also studied and it was found that the phosphor is suitable for radiation dosimetry. Copyright © 2014 John Wiley & Sons, Ltd.

  2. Self-healing Performance of Composite Coatings Prepared by Phosphating and Cerium Nitrate Post-sealing

    Institute of Scientific and Technical Information of China (English)

    LIN Bilan; LU Jintang

    2015-01-01

    The phosphated and cerium nitrate post-sealed galvanized steel was ifrstly scratched to expose zinc layer and then placed in neutral salt spray (NSS) chamber for different durations. The microstructure and compositions of the scratches were investigated using SEM and EDS. The phases of the corrosion products were examined through XRD. The self-healing mechanism of the composite coatings was discussed. The experimental results show that the composite coatings have an excellent corrosion resistance. The corrosion products increase with corrosion time and ifnally cover the whole scratch. They contain phosphorous, cerium, oxygen, chloride and zinc, and are ifne needle and exceedingly compact. The composite coatings are favorable self-healing. During corrosion, the self-healing ions such as Ce3+, Ce4+, PO43-, Zn2+ in the composite coatings were dissolved, migrated, recombined, and covered the exposed zinc, impeding zinc corrosion. The self-healing process of the scratches on the composite coatings can be divided into three stages, about 2 h, 4 h, and 24 h, respectively.

  3. Honeycomb nano cerium oxide fabricated by vacuum drying process with sodium alginate

    Science.gov (United States)

    Zhao, Guozheng; Li, Changbo; Zhang, Honglin

    2017-06-01

    Nano cerium oxide (CeO2) with honeycomb structure were synthesized simply and rapidly by vacuum drying method with sodium alginate as the biological template agent, Ce(NO3)3·6H2O as cerium source. The composition, aperture size, specific surface area and morphology of the prepared samples were characterized by Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD), N2 adsorption-desorption and scanning electron microscopy (SEM). Simultaneously, the effects on the morphology of the samples, which were caused by the drying method and the concentration of sodium alginate, were investigated. The results indicate that the prepared samples were nano CeO2 with high crystallinity and uniform dispersion, most of which had mesoporous, macroporous and honeycomb structure. The specific surface area of CeO2 is 210.0 m2/g, and the average aperture is 12.77 nm. The prepared samples can act as catalyst in the catalytic wet oxidation process for the treatment of high concentration organic wastewater, and the COD removal rate could exceed 90%.

  4. Selective catalytic oxidation of ammonia over copper-cerium composite catalyst.

    Science.gov (United States)

    Lou, Jie-Chung; Hung, Chang-Mao; Yang, Sheng-Fu

    2004-01-01

    This work considers the oxidation of ammonia (NH3) by selective catalytic oxidation (SCO) over a copper (Cu)-cerium (Ce) composite catalyst at temperatures between 150 and 400 degrees C. A Cu-Ce composite catalyst was prepared by coprecipitation of copper nitrate and cerium nitrate at various molar concentrations. This study also considers how the concentration of influent NH3 (500-1000 ppm), the space velocity (72,000-110,000 hr(-1)), the relative humidity (12-18%) and the concentration of oxygen (4-20%) affect the operational stability and the capacity for removing NH3. The effects of the O2 and NH3 content of the carrier gas on the catalyst's reaction rate also are considered. The experimental results show that the extent of conversion of NH3 by SCO in the presence of the Cu-Ce composite catalyst was a function of the molar ratio. The NH3 was removed by oxidation in the absence of Cu-Ce composite catalyst, and approximately 99.2% NH3 reduction was achieved during catalytic oxidation over the Cu-Ce (6:4, molar/molar) catalyst at 400 degrees C with an O2 content of 4%. Moreover, the effect of the initial concentration and reaction temperature on the removal of NH3 in the gaseous phase was also monitored at a gas hourly space velocity of less than 92,000 hr(-1).

  5. Visible Light Induced Photocatalysis of Cerium Ion Modified Titania Sol and Nanocrystallites

    Institute of Scientific and Technical Information of China (English)

    Yibing XIE; Chunwei YUAN

    2004-01-01

    The cerium ion(Ce4+) doped titania sol and nanocrystallites were prepared by chemical coprecipitation-peptization and hydrothermal synthesis methods, respectively. The X-ray diffraction pattern shows that Ce4+-TiO2 xerogel powder has semicrystalline structure and thermal sintering sample has crystalline structure. Ce4+-TiO2 nanocrystallites are composed of the major anatase phase titania (88.82 wt pct) and a small amount of crystalline cerium titanate.AFM micrograph shows that primary particle size of well-dispersed ultrafine sol particles is below 15 nm in diameter.The particle sizes are 30 nm for xerogel sample and 70 nm for nanocrystallites sample, which is different from the estimated values (2.41 nm and 4.53 nm) by XRD Scherrer's formula. The difference is mainly due to aggregation of nanocrystallites. The experimental results exhibit that photocatalysts of Ce4+-TiO2 sol and nanocrystallites have the ability to photodegrade reactive brilliant red dye (X-3B) under visible light irradiation with the ion-TiO2/VIS/dye system. Moreover, Ce4+ doped titania sol has shown higher efficiency than the nanocrystallites sample in respect of potocatalytic activity. Meanwhile, dye photodegradation mechanisms are proposed to different photocatalytic reaction systems, which are dye photosensitization, ion-dye photosensitization and interband photocatalysis & dye photosensitization with respect to TiO2 nanocrystallites, Ce4+-TiO2 sol and Ce4+-TiO2 nanocrystallites system.

  6. Cerium relieving the inhibition of photosynthesis and growth of spinach caused by lead

    Institute of Scientific and Technical Information of China (English)

    ZHOU; Min

    2009-01-01

    Chloroplasts were isolated from spinach cultured in lead chloride-present, Ce3+-administered, cerium chloride-administered lead chloride-present Hoagland's media or that of Hoagland's media. The experimental study demonstrated the effects of cerium (Ce) on distribu-tion of light energy and photochemical activities of spinach chloroplast grown in lead (Pb)-present media. It was observed that Pb2+ signifi-cantly inhibited photosynthesis in spinach, including light absorption, energy transfer from LHCII to photosystem II, excitation energy dis-tribution from photosystem I to photosystem II, and transformation from light energy to electron energy and oxygen evolution of chloroplasts,and decreased spinach growth. However, Ce3+ treatment to pb2+-present chloroplasts could obviously improve light absorption and excitation energy distribution in both photosystems and increase activity of photochemical reaction and oxygen evolution of chloroplasts. The results suggested that Ce3+ under Pb2+ stress could maintain the stability of chloroplast membrane, and improve photosynthesis of spinach chloro-plast, thus promote spinach growth.

  7. Cerium relieving the inhibition of photosynthesis and growth of spinach caused by lead

    Institute of Scientific and Technical Information of China (English)

    ZHOU Min; ZE Yuguan; LI Na; DUAN Yanmei; CHEN Ting; LIU Chao; HONG Fashui

    2009-01-01

    Chloroplasts were isolated from spinach cultured in lead chloride-present, Ce~(3+)-administered, cerium chloride-administered lead chloride-present Hoagland's media or that of Hoagland's media. The experimental study demonstrated the effects of cerium (Ce) on distribu-tion of light energy and photochemical activities of spinach chloroplast grown in lead (Pb)-present media. It was observed that Pb~(2+) signifi-cantly inhibited photosynthesis in spinach, including light absorption, energy transfer from LHCII to photosystem II, excitation energy dis-tribution from photosystem I to photosystem II, and transformation from light energy to electron energy and oxygen evolution of chloroplasts,and decreased spinach growth. However, Ce~(3+) treatment to pb~(2+)-present chloroplasts could obviously improve light absorption and excitation energy distribution in both photosystems and increase activity of photochemical reaction and oxygen evolution of chloroplasts. The results suggested that Ce~(3+) under Pb~(2+) stress could maintain the stability of chloroplast membrane, and improve photosynthesis of spinach chloro-plast, thus promote spinach growth.

  8. Removal of aromatic amines from water by montmorillonite-(cerium or zirconium) phosphate crosslinked compounds

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Pradas, E.; Villafranca-Sanchez, M.; Urena-Amate, M.D. (Univ. of Almeria (Spain). Dept. of Inorganic Chemistry); Del Rey-Bueno, F.; Garcia-Rodriguez, A. (Univ. of Granada (Spain). Dept. of Inorganic Chemistry)

    To evaluate the potential use of two montmorillonite-(Ce or Zr) phosphate crosslinked compounds in removing organic pollutants such as aniline, p-toluidine, and p-acetylaniline from water, adsorption experiments were performed under conditions of varied temperature (288 and 308 K). Adsorption on the montmorillonite-Ce-phosphate compound was best described by a hyperbolic (H-type) isotherm, whereas for the montmorillonite-Zr-phosphate compound, S-type isotherms were obtained for p-toluidine and aniline and L-type for p-acetylaniline. Amines adsorption increases with increasing temperature on the cerium crosslinked material, while for the zirconium-crosslinked compound, adsorption decreases as temperature increases from 288 to 308 K, possibly due to a mainly physical process. Fourier-transform infrared (FTIR) spectroscopy indicated that at the pH generated by the adsorbents, the protonated species of these amines plays an important role in the adsorption process. X-ray diffraction analysis showed that the aromatic amines are intercalated into the adsorbents. For any given amine, the cerium-montmorillonite adsorbent shows a higher capacity of adsorption compared with zirconium-montmorillonite adsorbent, so it might be reasonably used in removing aromatic amines from water.

  9. Cerium(III) molybdate nanoparticles: Synthesis, characterization and radionuclides adsorption studies.

    Science.gov (United States)

    Yousefi, Taher; Khanchi, Ali Reza; Ahmadi, Seyed Javad; Rofouei, Mohamad Kazem; Yavari, Ramin; Davarkhah, Reza; Myanji, Behzad

    2012-05-15

    Cerium(III) molybdate nanostructure with average size about 40nm was prepared by adding cerium(III) chloride and ammonium molybdate solutions under varying conditions. The product was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transform infrared (FT-IR), thermogravimetric analysis (TGA) and Brunauere Emmette Teller (BET) techniques. Ion exchange capacity of the sample for potassium ion and distribution coefficients (K(d)) for 23 metal ions were determined, the K(d) values for Tl(I), Pb(II), Th(IV), U(VI), and Cs(I) ions were found to be sufficiently high for their removal from various effluents. The adsorption behavior of the sample towards Cs(I)(134) species were studied. Finally, the binary separation of Dy(III)-U(VI), Sm(III)-Th(IV) and Cs(I)-Rb(I) and removal of Cs(I)(134) from the real sample were successfully achieved.

  10. Cerium oxide for the destruction of chemical warfare agents: A comparison of synthetic routes

    Energy Technology Data Exchange (ETDEWEB)

    Janoš, Pavel, E-mail: pavel.janos@ujep.cz [Faculty of the Environment, University of Jan Evangelista Purkyně, Králova Výšina 7, 400 96 Ústí nad Labem (Czech Republic); Henych, Jiří [Faculty of the Environment, University of Jan Evangelista Purkyně, Králova Výšina 7, 400 96 Ústí nad Labem (Czech Republic); Institute of Inorganic Chemistry AS CR v.v.i., 25068 Řež (Czech Republic); Pelant, Ondřej; Pilařová, Věra; Vrtoch, Luboš [Faculty of the Environment, University of Jan Evangelista Purkyně, Králova Výšina 7, 400 96 Ústí nad Labem (Czech Republic); Kormunda, Martin [Faculty of Sciences, University of Jan Evangelista Purkyně, České Mládeže 8, 400 96 Ústí nad Labem (Czech Republic); Mazanec, Karel [Military Research Institute, Veslařská 230, 637 00 Brno (Czech Republic); and others

    2016-03-05

    Highlights: • Four synthetic routes were compared to prepare the nanoceria-based reactive sorbents. • The sorbents prepared by homogeneous hydrolysis destroy efficiently the soman and VX nerve agents. • Toxic organophosphates are converted to less-dangerous products completely within a few minutes. • Surface non-stoichiometry and −OH groups promote the destruction by the S{sub N}2 mechanism. - Abstract: Four different synthetic routes were used to prepare active forms of cerium oxide that are capable of destroying toxic organophosphates: a sol–gel process (via a citrate precursor), homogeneous hydrolysis and a precipitation/calcination procedure (via carbonate and oxalate precursors). The samples prepared via homogeneous hydrolysis with urea and the samples prepared via precipitation with ammonium bicarbonate (with subsequent calcination at 500 °C in both cases) exhibited the highest degradation efficiencies towards the extremely dangerous nerve agents soman (O-pinacolyl methylphosphonofluoridate) and VX (O-ethyl S-[2-(diisopropylamino)ethyl] methylphosphonothioate) and the organophosphate pesticide parathion methyl. These samples were able to destroy more than 90% of the toxic compounds in less than 10 min. The high degradation efficiency of cerium oxide is related to its complex surface chemistry (presence of surface −OH groups and surface non-stoichiometry) and to its nanocrystalline nature, which promotes the formation of crystal defects on which the decomposition of organophosphates proceeds through a nucleophilic substitution mechanism that is not dissimilar to the mechanism of enzymatic hydrolysis of organic phosphates by phosphotriesterase.

  11. Effects of different valences of cerium ion on conformation of Horseradish Peroxidase

    Institute of Scientific and Technical Information of China (English)

    XIANG Li; GE Zhiqiang

    2008-01-01

    Our previous studies demonstrated that Ce4+ could induce reactive oxygen species (ROS) burst as a signal to promote pacilitaxel biosynthesis in suspension cultured Taxus cuspidate cells. To further understand the mechanism of cerium ions inducing ROS burst, circular dichroism (CD), synchronous fluorescence, and electron paramagnetic resonance (EPR) were used to detect them inducing conforma-tional change of horseradish peroxidase (HRF). Horseradish peroxidase activity was reduced by 78% by 0.1 mmol/L Ce4+, whereas it was only reduced by 28% by 0.1 mmol/L Ce3+. Circular dichroism spectra showed that the percentage of transition from helical content and other structure to βstrands andβturns was 23.1 when induced by Ce4+, whereas it was only 13.2 when induced by Ce3+. In synchronous fluorescence spectra, Ce4+ led to red shift and intensity-elevation of tryptophan fluorescence emission maximum, whereas in the case of Ce3+, the results were a contrast to the above. Furthermore, g factor (gx and gy) in electron paramagnetic resonance (EPR) induced by Ce4+ and Ce3+ was significantly different. These results indicated that the different valence of cerium ion induced various conformations of HRP, and Ce4+ was more effective than Ce3+. This suggested that Ce4+ affected the burst of ROS through changing the conformation of oxidoreductase.

  12. FT-IR Studies of Cerium Oxide Nanoparticles and Natural Zeolite Materials

    Directory of Open Access Journals (Sweden)

    Oana Lelia Pop

    2015-05-01

    Full Text Available An emerging topic of our days is nanoscience and nanotechnology successfully applied in the food industry. Characteristics such as size, surface area and morphology can modify the basic properties and the chemical reactivity of the nanomaterials. The breakthrough of innovative materials, processes, and phenomena at the nanoscale, as well as the progress of new experimental and theoretical techniques for research, supply novel opportunities for the expansion of original nanosystems and nanostructured materials. These study examine two types of nanoparticles, namely cerium oxide nanoparticles (CeO2 NP and natural zeolites. In view of the importance of CeO2 NP in various biological applications, the primary objective of this study is to characterise four samples of CeO2 NP in order to understand the role of the synthesis process in the final product. Nanocrystalline natural zeolites are materials with interesting properties which allows them to be used as adjuvant in many therapies. The characterisation of CeO2 NP and two types of natural zeolites using Fourier Transform Infrared (FT-IR spectroscopy is described. Therefore, this study examined two types of nanomaterials, namely cerium oxide nanoparticles and zeolites, for further applications on microorganisms and living cells.

  13. Kinetics of Cerium(IV) Extraction from H(2)SO(4)-HF Medium with Cyanex 923.

    Science.gov (United States)

    Liao, Wuping; Yu, Guihong; Yue, Shantang; Li, Deqian

    2002-03-11

    Studies of the extraction kinetics of cerium(IV) from H(2)SO(4)-HF solutions with Cyanex 923 in n-heptane have been carried out using a constant interfacial area cell with laminar flow. The experimental hydrodynamic conditions were chosen so that the contribution of diffusion to the measured rate of reaction was minimized. The data were analyzed in terms of pseudo-first order constants. The results were compared with those of the system without HF. It was concluded that the addition of HF reduces the activation energy for the forward rate from 46.2 to 36.5 kJ mol(-1) while it has an opposite effect on the activation energy for the reverse process(the activation energy increased from 23.3 to 90.8 kJ mol(-1)). Thus, HF can accelerate the rate of cerium(IV) extraction. At the same time, the extraction rate is controlled by a mixed chemical reaction-diffusion rather than by a chemical reaction alone. A rate equation has also been obtained.

  14. Cerium and neodymium co-precipitation in molten chloride by wet argon sparging

    Energy Technology Data Exchange (ETDEWEB)

    Vigier, J.F. [CEA, Nuclear Energy Division, RadioChemistry and Processes Department, SMCS/LEPS, F-30207 Bagnols sur Ceze (France); Unite de Catalyse et de Chimie du Solide, UCCS UMR CNRS 8181, Univ. Lille Nord de France, ENSCL-USTL, B.P. 90108, 59652 Villeneuve d' Ascq Cedex (France); Renard, C., E-mail: catherine.renard@ensc-lille.fr [Unite de Catalyse et de Chimie du Solide, UCCS UMR CNRS 8181, Univ. Lille Nord de France, ENSCL-USTL, B.P. 90108, 59652 Villeneuve d' Ascq Cedex (France); Laplace, A. [CEA, Nuclear Energy Division, RadioChemistry and Processes Department, SMCS/LEPS, F-30207 Bagnols sur Ceze (France); Lacquement, J. [CEA, Nuclear Energy Division, DTEC/DIR, F-30207 Bagnols sur Ceze (France); Abraham, F. [Unite de Catalyse et de Chimie du Solide, UCCS UMR CNRS 8181, Univ. Lille Nord de France, ENSCL-USTL, B.P. 90108, 59652 Villeneuve d' Ascq Cedex (France)

    2013-01-15

    Co-precipitations of cerium (III) and neodymium (III) at 10 wt.% in LiCl-CaCl{sub 2} (30-70 mol%) molten salt at 705 Degree-Sign C have been achieved using an original way of precipitation, wet argon sparging. Several CeCl{sub 3}/NdCl{sub 3} ratios have been studied, and the isolated powders were analyzed using different characterization methods including XRD investigations. The lanthanides precipitation yields have been determined around 99.9% using ICP-AES analysis. XRD demonstrated that the precipitates mainly contained mixed oxychloride (Ce{sub 1-x}Nd{sub x})OCl and a small amount of the mixed oxide Ce{sub 1-y}Nd{sub y}O{sub 2-0.5y}. Calcination of these precipitates has resulted in the cerium and neodymium mixed oxides. For the precipitation with a Ce/Nd = 50/50 ratio, an hydroxychloride Ln(OH){sub 2}Cl and the oxychloride Ce{sup IV}(Nd{sub 0.7}Ce{sub 0.3}){sup III}O{sub 3}Cl have been identified as unexpected intermediate compounds.

  15. Production of cerium-apatite in sound and carious dental enamel under in vitro conditions.

    Science.gov (United States)

    Kiss, J; Bánóczy, J; Fehérváry, E; Gintner, Z; Albrecht, M

    1990-01-01

    Incipient dental caries--according to up-to-date concepts in dental research--means a demineralization without cavity formation. At this stage the carious process is reversible, and remineralization can be achieved in the presence of locally applied fluorides. In chrystalchemical experiments, however, by treating natural apatites with lanthanides, [Ce, La, Pr, Nd, Sm, Eu, Tb ... Y, Sc] a more resistant complex could be developed. In this study extracted human molar teeth were kept for 60 days in Cerium (III)-nitrate solution, in order to investigate the incorporation of Ce3+ into human sound and carious enamel by light-microscopic-, and electron microprobe methods. Ce3+ was incorporated in sound enamel as well as into the incipient carious lesion, showing the histological characteristics of a remineralizing lesion. The mean values of the microprobe analysis data showed an increase in Ce3+ changing place with the Ca2+ the developing cerium-apatite being more hard and resistant from a mineralophysical point of view.

  16. Catalytic wet peroxidation of pyridine bearing wastewater by cerium supported SBA-15.

    Science.gov (United States)

    Subbaramaiah, V; Srivastava, Vimal Chandra; Mall, Indra Deo

    2013-03-15

    Cerium supported SBA-15 (Ce/SBA-15) was synthesized by two-step synthesis method in acidic medium. It was further characterized by various characterization techniques such as X-ray diffraction, field-emission scanning electron microscopy, Fourier transform infrared spectroscopy and N2 adsorption-desorption pore size distribution analysis. The Ce/SBA-15 showed highly ordered meso-structure with pore diameter≈70-100Ǻ and pore volume≈0.025cm(3)/g. Ce/SBA-15 was further evaluated as a catalyst for the oxidation of highly toxic and non-biodegradable material, pyridine, by catalytic wet-peroxidation method. The effects of various operating parameters such as catalyst dose (0.5-6g/l), stoichiometric ratio of H2O2/pyridine (1-6), initial pyridine concentration (50-800mg/l) and temperature (313-358K) have been evaluated and optimized. Ce/SBA-15 showed stable performance during reuse for six cycles with negligible cerium leaching. Kinetic and thermodynamic parameters and operation cost have also been determined.

  17. Cerium-zinc redox flow battery: Positive half-cell electrolyte studies

    Institute of Scientific and Technical Information of China (English)

    XIE Zhipeng; ZHOU Debi; XIONG Fengjiao; ZHANG Shimin; HUANG Kelong

    2011-01-01

    Experimental work was performed to evaluate the Ce3+/Ce4+ redox couple in methane sulfonic acid (MSA) electrolyte for use in redox flow battery (RFB) technology. The electrochemical behaviour of the Ce3+/Ce4+ in MSA media was investigated using cyclic voltammetry, linear sweep voltammetry, chronoamperometry and rotating disc electrode. The standard rate constant of the Ce3+/Ce4+ redox reaction on graphite electrode in MSA was 4.06x10-4 cm/s. The diffusion coefficient of Ce3+ in MSA was 5.87-6.15x10-6 cm2/s, and was 2.56-2.68x 10-6 cm2/s for Ce4+. The energy efficiency of a cerium-zinc test cell was 74.8%. The high stability of cerium salts in MSA media and relatively fast redox kinetics of the Ce3+/Ce4+ redox reaction at graphite ectrode indicated that the Ce3+/Ce4+ might be well suited for use in RFB technology.

  18. 2,2',3,3',6,6'-Hexachlorobiphenyl (PCB 136) is enantioselectively oxidized to hydroxylated metabolites by rat liver microsomes.

    Science.gov (United States)

    Wu, Xianai; Pramanik, Ananya; Duffel, Michael W; Hrycay, Eugene G; Bandiera, Stelvio M; Lehmler, Hans-Joachim; Kania-Korwel, Izabela

    2011-12-19

    Developmental exposure to multiple ortho-substituted polychlorinated biphenyls (PCBs) causes adverse neurodevelopmental outcomes in laboratory animals and humans by mechanisms involving the sensitization of Ryanodine receptors (RyRs). In the case of PCB 136, the sensitization of RyR is enantiospecific, with only (-)-PCB 136 being active. However, the role of enantioselective metabolism in the developmental neurotoxicity of PCB 136 is poorly understood. The present study employed hepatic microsomes from phenobarbital (PB)-, dexamethasone (DEX)- and corn oil (VEH)-treated male Sprague-Dawley rats to investigate the hypothesis that PCB 136 atropisomers are enantioselectively metabolized by P450 enzymes to potentially neurotoxic, hydroxylated PCB 136 metabolites. The results demonstrated the time- and isoform-dependent formation of three metabolites, with 5-OH-PCB 136 (2,2',3,3',6,6'-hexachlorobiphenyl-5-ol) being the major metabolite. The formation of 5-OH-PCB 136 increased with the activity of P450 2B enzymes in the microsomal preparation, which is consistent with PCB 136 metabolism by rat P450 2B1. The minor metabolite 4-OH-PCB 136 (2,2',3,3',6,6'-hexachlorobiphenyl-4-ol) was produced by a currently unidentified P450 enzyme. An enantiomeric enrichment of (-)-PCB 136 was observed in microsomal incubations due to the preferential metabolism of (+)-PCB 136 to the corresponding 5-OH-PCB 136 atropisomer. 4-OH-PCB 136 displayed an enrichment of the atropisomer formed from (-)-PCB 136; however, the enrichment of this metabolite atropisomer did not affect the enantiomeric enrichment of the parent PCB because 4-OH-PCB 136 is only a minor metabolite. Although the formation of 5- and 4-OH-PCB 136 atropisomers increased with time, the enantioselective formation of the OH-PCB metabolites resulted in constant enantiomeric enrichment, especially at later incubation times. These observations not only demonstrate that the chiral signatures of PCBs and their metabolites in wildlife

  19. [The influences of lanthanum,cerium and fluoride on the activity of glucosyltransferase(GTF) and adherence of oral cariogenic bacteria in vitro

    Science.gov (United States)

    Li, M Y; Zhang, W G; Liu, Z

    1998-09-01

    OBJECTIVE:Study of the influences of lanthanum,cerium and fluoride on the activity of flucosyltransferase(GTF) and adherence of oral cariogenic bacteria. METHODS: The influences of lanthanum,certium and fluoride on the acitivity of GTF and adherences of Steptococcus sobrinus 6715,Lactobacillus 4356 and Actinomycetes viscosus 19246 in vitro were investigated. RESULTS: Lanthanum and cerium can efficiently inhibit the acitivity of GTF than fluoride. CONCLUSION: The result was given a data that lanthanum and cerium could be used as a cariostatic agent in future.At the same time the inhibition of the bacterial adherence by these trace elements was also revealed.

  20. Effect of cerium ion implantation on the oxidation behavior of zircaloy-4 at 500 degree sign C

    CERN Document Server

    Chen, X W; Yu, H R; Zhou, Q G; Chen, B S

    2002-01-01

    In order to investigate the oxidation behavior changes of zircaloy-4 induced by cerium ion implantation using a MEVVA source at an energy of 40 keV with a dose range from 1x10 sup 1 sup 6 to 1x10 sup 1 sup 7 ions/cm sup 2 at the maximum temperature of 130 degree sign C, weight gain curves of the different specimens including as-received zircaloy-4 and cerium-implanted zircaloy-4 were measured after oxidation in air at 500 degree sign C for 100 min. It was obviously found that a significant improvement was achieved in the oxidation behavior of cerium ion implanted zircaloy-4 compared with that of the as-received zircaloy-4. The depth profile of the element composition in the surface region of the samples was obtained by Auger electron spectroscopy, and the valence of the oxides in the scale was analyzed by X-ray photoemission spectroscopy. Glancing angle X-ray diffraction employed to examine the phase transformation in the oxide films showed that the addition of cerium transformed the phase from monoclinic zir...

  1. Comparative hazard identification of nano- and micro-sized cerium oxide particles based on 28-day inhalation studies in rats

    NARCIS (Netherlands)

    Gosens, Ilse; Mathijssen, Liesbeth E A M; Bokkers, Bas G H|info:eu-repo/dai/nl/304847062; Muijser, Hans; Cassee, Flemming R.|info:eu-repo/dai/nl/143038990

    2014-01-01

    There are many uncertainties regarding the hazard of nanosized particles compared to the bulk material of the parent chemical. Here, the authors assess the comparative hazard of two nanoscale (NM-211 and NM-212) and one microscale (NM-213) cerium oxide materials in 28-day inhalation toxicity studies

  2. Germination and early plant development of ten plant species exposed to titanium dioxide and cerium oxide nanoparticles

    Science.gov (United States)

    Ten agronomic plant species were exposed to different concentrations of nano titanium dioxide (nTiO2) or nano cerium oxide (nCeO2) (0, 250, 500 and 1000 mg/L) to examine potential effects on germination and early seedling development. We modified a standard test protocol develop...

  3. Influence of hydroxyl content of binders on rheological properties of cerium-gadolinium oxide (CGO) screen printing inks

    DEFF Research Database (Denmark)

    Marani, Debora; Gadea, Christophe; Hjelm, Johan;

    2015-01-01

    vinyl resins) were selected and characterized in solution via viscosimetry method. A high degree of hyper-entanglement was observed for ethyl cellulose polymers, whereas a mitigated effect characterized the two vinyl resins. Cerium-gadolinium oxides (CGO)-based inks, prepared using the selected binders...

  4. [The changes of the motor function of the stomach and the colon under the action of the nanocrystalline cerium dioxide].

    Science.gov (United States)

    Iefimenko, O Iu; Savchenko, Iu O; Falalieieva, T M; Berehova, T V; Shcherbakov, O B; Ivanov, V K; Zholobak, N M; Maliukin, Iu V; Spivak, M Ia

    2014-01-01

    We investigated the effect of nanocrystalline cerium dioxide on parameters of spontaneous and stimulated motility of the stomach and colon in rats. It was found that administration of nanocrystalline cerium dioxide for 10 days increased the amplitude of contractions of stimulated motility in the stomach by 33.0 +/- 2.4% and the frequency of contractions of the colon by 80.3 +/- 7.5%. In this group, the introduction of carbachol also increased the frequency of the contractions by 274.0 +/- 22.9%, compared to the control group. The administration of nanocrystalline cerium dioxide increased the index of motor activity of spontaneous and stimulated motility of the stomach by 19.8 +/- 1.4 and 14.5 +/- 9.0%, respectively. In the colon, the motor activity increased by 14.3 +/- 1.1 and 11.1 +/- 0.8%, respectively. We also found that the nanocrystalline cerium dioxide rebuilt morphological condition of the mucous of the colon.

  5. Effect of rare element cerium on the morphology and corrosion resistance of electro-less Ni-P coatings

    Directory of Open Access Journals (Sweden)

    Fu Chuan-qi

    2015-01-01

    Full Text Available This paper reports an experimental study on the microstructure and corrosion resistance of electro-less Ni-P coatings with increasing content of the rare element cerium (Ce. Surface morphology and the composition of the electro-less Ni-P coatings were studied by scanning electron microscope (SEM, X-ray energy dispersed analysis (EDS and X-ray diffraction analysis (XRD. Hardness and Adhesive force are researched by a HX-200 Vickers diamond indenter micro-hardness tester. Furthermore, we study the adhesive force by using the Revetest scratch tester. We get the possession of Ce amorphous Ni-P coatings which has excellent properties in anti-corrosion. The effect of the rare element cerium concentration on corrosion resistance of the coatings was evaluated in the groundwater immersion test and porosity test, respectively. The results indicated that added little the rare element cerium into the plating bath increased the phosphorus content of the coatings, decreased the corrosion rates, it also decreases the porosity of the amorphous Ni-P coatings. The lowest corrosion rates of the amorphous Ni-P coatings in groundwater immersion test is 4.1 um · h-1, at the rare element cerium concentration of 0.12g · L-1.

  6. A mixed acid based vanadium-cerium redox flow battery with a zero-gap serpentine architecture

    Science.gov (United States)

    Leung, P. K.; Mohamed, M. R.; Shah, A. A.; Xu, Q.; Conde-Duran, M. B.

    2015-01-01

    This paper presents the performance of a vanadium-cerium redox flow battery using conventional and zero-gap serpentine architectures. Mixed-acid solutions based on methanesulfonate-sulfate anions (molar ratio 3:1) are used to enhance the solubilities of the vanadium (>2.0 mol dm-3) and cerium species (>0.8 mol dm-3), thus achieving an energy density (c.a. 28 Wh dm-3) comparable to that of conventional all-vanadium redox flow batteries (20-30 Wh dm-3). Electrochemical studies, including cyclic voltammetry and galvanostatic cycling, show that both vanadium and cerium active species are suitable for energy storage applications in these electrolytes. To take advantage of the high open-circuit voltage (1.78 V), improved mass transport and reduced internal resistance are facilitated by the use of zero-gap flow field architecture, which yields a power density output of the battery of up to 370 mW cm-2 at a state-of-charge of 50%. In a charge-discharge cycle at 200 mA cm-2, the vanadium-cerium redox flow battery with the zero-gap architecture is observed to discharge at a cell voltage of c.a. 1.35 V with a coulombic efficiency of up to 78%.

  7. The properties of protective oxide scales containing cerium on alloy 800H in oxidizing and oxidizing/sulphidizing environments

    NARCIS (Netherlands)

    Haanappel, V.A.C.; Fransen, T.; Geerdink, B.; Gellings, P.J.; Stroosnijder, M.F.

    1991-01-01

    The corrosion protection of oxide scales formed by electrophoretic deposition in a cerium-containing sol on Alloy 800H, a 32Ni-20Cr steel, followed by firing in air at 1123 K was studied in oxidizing and mixed oxidizing/sulphidizing environments at elevated temperatures. In particular, the influence

  8. Shell Model description of the {beta}{beta} decay of {sup 136}Xe

    Energy Technology Data Exchange (ETDEWEB)

    Caurier, E.; Nowacki, F. [IPHC, IN2P3-CNRS/Universite Louis Pasteur BP 28, F-67037 Strasbourg Cedex 2 (France); Poves, A., E-mail: alfredo.poves@uam.es [Departamento de Fisica Teorica, Universidad Autonoma de Madrid and Instituto de Fisica Teorica, UAM/CSIC, E-28049, Madrid (Spain)

    2012-05-01

    We study in this Letter the double beta decay of {sup 136}Xe with emission of two neutrinos which has been recently measured by the EXO-200 Collaboration. We use the same shell model framework, valence space, and effective interaction that we have already employed in our calculation of the nuclear matrix element (NME) of its neutrinoless double beta decay. Using the quenching factor of the Gamow-Teller operator which is needed to reproduce the very recent high resolution {sup 136}Xe ({sup 3}He, t) {sup 136}Cs data, we obtain a nuclear matrix element M{sup 2{nu}}=0.025 MeV{sup -1} compared with the experimental value M{sup 2{nu}}=0.019(2) MeV{sup -1}.

  9. Nanocrystalline cerium dioxide efficacy for prophylaxis of erosive and ulcerative lesions in the gastric mucosa of rats induced by stress.

    Science.gov (United States)

    Golyshkin, Dmytro; Kobyliak, Nazarii; Virchenko, Oleksandr; Falalyeyeva, Tetyana; Beregova, Tetyana; Ostapchenko, Lyudmyla; Caprnda, Martin; Skladany, Lubomir; Opatrilova, Radka; Rodrigo, Luis; Kruzliak, Peter; Shcherbokov, Alexandr; Spivak, Mykola

    2016-12-01

    In our previous works, the important therapeutic properties of nanocrystalline cerium dioxide such as strong antioxidant ability, prebiotical and antibiotic activity were shown. Such properties were obtained due to stabilization of nanoparticles with precise size 3-7nm. Such modification of nanocrystalline cerium dioxide has contributed to its remarkable efficacy and low toxicity. We have carried out the investigation of toxicity of the nanodrug and revealed that in the condition of the acute toxicity test, LD 50 was 2000mg/kg when it was administered per os. This indicator is approximately 1000 times greater than effective dose of the compound that proved the possibility of its usage for humans. Considering the strong antioxidant properties of this substance, we have performed the investigation of the influence of nanocrystalline cerium dioxide on the erosive-ulcerative lesions in gastric mucosa of rats induced by Selye's restraint stress. It was established that the studied compound significantly reduced the lesions area by 58.3% (p<0.05) induced by Selye's restraint stress. The attenuation of inflammation and decrease of lipid peroxidation in the conditions of gastric lesions and prophylactic administration of nanocrystalline cerium dioxide were shown. That was confirmed by the decrease of pro-inflammatory cytokines content (interleukin (IL) 1β, 12B p40) and raise of anti-inflammatory cytokines content (IL-10 and transforming growth factor β). Measurement of lipid peroxidation products has proved the antioxidant properties of nanocrystalline cerium dioxide as it decreased the content of conjugated dienes and thiobarbituric acid active products in the conditions of gastric ulceration induced by stress.

  10. Observation of Two-Neutrino Double-Beta Decay in Xe-136 with EXO-200

    CERN Document Server

    Ackerman, N; Auger, M; Auty, D J; Barbeau, P S; Barry, K; Bartoszek, L; Beauchamp, E; Belov, V; Benitez-Medina, C; Breidenbach, M; Burenkov, A; Cleveland, B; Conley, R; Conti, E; Cook, J; Cook, S; Coppens, A; Counts, I; Craddock, W; Daniels, T; Danilov, M V; Davis, C G; Davis, J; deVoe, R; Djurcic, Z; Dobi, A; Dolgolenko, A G; Dolinski, M J; Donato, K; Fairbank, W; Farine, J; Fierlinger, P; Franco, D; Freytag, D; Giroux, G; Gornea, R; Graham, K; Gratta, G; Green, M P; Hagemann, C; Hall, C; Hall, K; Haller, G; Hargrove, C; Herbst, R; Herrin, S; Hodgson, J; Hughes, M; Johnson, A; Karelin, A; Kaufman, L J; Koffas, T; Kuchenkov, A; Kumar, A; Kumar, K S; Leonard, D S; Leonard, F; LePort, F; Mackay, D; MacLellan, R; Marino, M; Martin, Y; Mong, B; Diez, M Montero; Morgan, P; Muller, A R; Neilson, R; Nelson, R; Odian, A; O'Sullivan, K; Ouellet, C; Piepke, A; Pocar, A; Prescott, C Y; Pushkin, K; Rivas, A; Rollin, E; Rowson, P C; Russell, J J; Sabourov, A; Sinclair, D; Skarpaas, K; Slutsky, S; Stekhanov, V; Strickland, V; Swift, M; Tosi, D; Twelker, K; Vogel, P; Vuilleumier, J -L; Vuilleumier, J -M; Waite, A; Waldman, S; Walton, T; Wamba, K; Weber, M; Wichoski, U; Wodin, J; Wright, J D; Yang, L; Yen, Y -R; Zeldovich, O Ya

    2011-01-01

    We report the observation of two-neutrino double-beta decay in Xe-136 with T_1/2 = 2.11 +- 0.04 (stat.) +- 0.21 (sys.) x 10^21 yr. This second order process, predicted by the Standard Model, has been observed for several nuclei but not for Xe-136. The observed decay rate provides new input to matrix element calculations and to the search for the more interesting neutrino-less double-beta decay, the most sensitive probe for the existence of Majorana particles and the measurement of the neutrino mass scale.

  11. Search for neutrinoless double beta decay in {sup 136}Xe with EXO-200

    Energy Technology Data Exchange (ETDEWEB)

    Feldmeier, Wolfhart

    2015-02-19

    Several properties of neutrinos, such as their absolute mass, their possible Majorana nature or the mechanisms that lead to small neutrino masses, are still unknown. The EXO-200 experiment is trying to answer some of these questions by searching for the hypothetical neutrinoless double beta decay of the isotope {sup 136}Xe. This thesis describes an analysis of two years of detector data, which yields a lower limit on the half-life of neutrinoless double beta decay of {sup 136}Xe of 1.1 x 10{sup 25} years.

  12. Coulomb excitation of neutron-rich $^{134-136}$Sn isotopes

    CERN Multimedia

    We propose to study excited states in the isotopes $^{134,136}$Sn by $\\gamma$-ray spectroscopy following "safe" Coulomb excitation. The experiment aims to investigate the evolution of quadrupole collectivity beyond the magic shell closure at N = 82 by the determination of B(E2) values and electric quadrupole moments $\\mathcal{Q}_2$. Recent shell-model calculations using realistic interactions predict possible enhanced collectivity in neutron-rich regions. Evidence for this could be obtained by this experiment. Furthermore, the currently unknown excitation energies of the 2$^+_{1}$ and 4$^+_{1}$ states in $^{136}$Sn will be measured for the first time.

  13. Observation of Two-Neutrino Double-Beta Decay in Xe-136 with EXO-200

    Energy Technology Data Exchange (ETDEWEB)

    Ackerman, N.; /SLAC; Aharmim, B.; /Laurentian U.; Auger, M.; /Bern U.; Auty, D.J.; /Alabama U.; Barbeau, P.S.; Barry, K.; Bartoszek, L.; /Stanford U., Phys. Dept.; Beauchamp, E.; /Laurentian U.; Belov, V.; /Moscow, ITEP; Benitez-Medina, C.; /Colorado State U.; Breidenbach, M.; /SLAC; Burenkov, A.; /Moscow, ITEP; Cleveland, B.; /Laurentian U.; Conley, R.; Conti, E.; /SLAC; Cook, J.; /Massachusetts U., Amherst; Cook, S.; /Colorado State U.; Coppens, A.; /Carleton U.; Counts, I.; /Stanford U., Phys. Dept.; Craddock, W.; /SLAC; Daniels, T.; /Massachusetts U., Amherst /Moscow, ITEP /Maryland U. /Stanford U., Phys. Dept. /Alabama U. /Maryland U. /Moscow, ITEP /Stanford U., Phys. Dept. /Laurentian U. /Carleton U. /Colorado State U. /Laurentian U. /Munich, Tech. U. /Bern U. /SLAC /Bern U. /Carleton U. /Stanford U., Phys. Dept. /Carleton U. /Maryland U. /Colorado State U. /SLAC /Carleton U. /SLAC /Alabama U. /SLAC /Moscow, ITEP /Indiana U. /Stanford U., Phys. Dept. /Moscow, ITEP /Stanford U., Phys. Dept. /Massachusetts U., Amherst /Seoul U. /Carleton U. /Stanford U., Phys. Dept.; /more authors..

    2012-09-14

    We report the observation of two-neutrino double-beta decay in {sup 136}Xe with T{sub 1/2} = 2.11 {+-} 0.04(stat) {+-} 0.21(syst) x 10{sup 21} yr. This second-order process, predicted by the standard model, has been observed for several nuclei but not for {sup 136}Xe. The observed decay rate provides new input to matrix element calculations and to the search for the more interesting neutrinoless double-beta decay, the most sensitive probe for the existence of Majorana particles and the measurement of the neutrino mass scale.

  14. Effect of Guest Atom Composition on the Structural and Vibrational Properties of the Type II Clathrate-Based Materials AxSi136, AxGe136 and AxSn136 (A = Na, K, Rb, Cs; 0 ≤ x ≤ 24

    Directory of Open Access Journals (Sweden)

    Dong Xue

    2016-08-01

    Full Text Available Type II clathrates are interesting due to their potential thermoelectric applications. Powdered X-ray diffraction (XRD data and density functional calculations for NaxSi136 found a lattice contraction as x increases for 0 < x < 8 and an expansion as x increases for x > 8. This is explained by XRD data that shows that as x increases, the Si28 cages are filled first for x < 8 and the Si20 cages are then filled for x > 8. Motivated by this work, here we report the results of first-principles calculations of the structural and vibrational properties of the Type II clathrate compounds AxSi136, AxGe136, and AxSn136. We present results for the variation of the lattice constants, bulk moduli, and other structural parameters with x. These are contrasted for the Si, Ge, and Sn compounds and for guests A = Na, K, Rb, and Cs. We also present calculated results of phonon dispersion relations for Na4Si136, Na4Ge136, and Na4Sn136 and we compare these for the three materials. Finally, we present calculated results for the elastic constants in NaxSi136, NaxGe136, and NaxSn136 for x = 4 and 8. These are compared for the three hosts, as well as for the two compositions.

  15. Tribological characteristics of monodispersed cerium borate nanospheres in biodegradable rapeseed oil lubricant

    Energy Technology Data Exchange (ETDEWEB)

    Boshui, Chen, E-mail: boshuichen@163.com; Kecheng, Gu; Jianhua, Fang; Jiang, Wu; Jiu, Wang; Nan, Zhang

    2015-10-30

    Graphical abstract: - Highlights: • Monodispersed stearic acid-capped cerium borate composite nanoparticles were prepared by hydrothermal method. Their morphologies, element compositions, size distributions, crystal and chemical structures, hydrophobic characteristics were also characterized. • The surface-capped cerium borate nanoparticles exhibited excellent dispersing stability in rapeseed oil. As new lubricating additives, they were also outstanding in enhancing friction-reducing and anti-wear capacities of rapeseed oil in biodegradable rapeseed oil. The results presented in this paper would be of important significance for developing green lubricants and lubricant additives. • The prominent tribological performances of SA/CeBO{sub 3} in rapeseed oil were investigated and attributed to the formation of a composite boundary lubrication film mainly composed of lubricous tribochemical species on the tribo-surfaces. - Abstract: Stearic acid-capped cerium borate composite nanoparticles, abbreviated as SA/CeBO{sub 3}, were prepared by hydrothermal method. The morphologies, element compositions, size distributions, crystal and chemical structures, hydrophobic characteristics, of SA/CeBO{sub 3} were characterized by scanning electron microscope, energy dispersive X-ray spectrometer, dynamic laser particle size analyzer, X-ray diffraction, and Fourier transform infrared spectrometer, respectively. The friction and wear performances of SA/CeBO{sub 3} as a lubricating additive in a rapeseed oil were evaluated on a four-ball tribo-tester. The tribochemical characteristics of the worn surfaces were investigated by X-ray photoelectron spectroscopy. The results showed that the hydrophobic SA/CeBO{sub 3} were monodispersed nanospheres with an average diameter of 8 nm, and exhibited excellent dispersing stability in rapeseed oil. Meanwhile, SA/CeBO{sub 3} nanospheres were outstanding in enhancing friction-reducing and anti-wear capacities of rapeseed oil. The prominent

  16. Cerium doped lanthanum halides: fast scintillators for medical imaging; Halogenures de lanthane dopes cerium des scintillateurs rapides pour l'imagerie medicale

    Energy Technology Data Exchange (ETDEWEB)

    Selles, O

    2006-12-15

    This work is dedicated to two recently discovered scintillating crystals: cerium doped lanthanum halides (LaCl{sub 3}:Ce{sup 3+} and LaBr{sub 3}:Ce{sup 3+}).These scintillators exhibit interesting properties for gamma detection, more particularly in the field of medical imaging: a short decay time, a high light yield and an excellent energy resolution. The strong hygroscopicity of these materials requires adapting the usual experimental methods for determining physico-chemical properties. Once determined, these can be used for the development of the industrial manufacturing process of the crystals. A proper comprehension of the scintillation mechanism and of the effect of defects within the material lead to new possible ways for optimizing the scintillator performance. Therefore, different techniques are used (EPR, radioluminescence, laser excitation, thermally stimulated luminescence). Alongside Ce{sup 3+} ions, self-trapped excitons are involved in the scintillation mechanism. Their nature and their role are detailed. The knowledge of the different processes involved in the scintillation mechanism leads to the prediction of the effect of temperature and doping level on the performance of the scintillator. A mechanism is proposed to explain the thermally stimulated luminescence processes that cause slow components in the light emission and a loss of light yield. Eventually the study of afterglow reveals a charge transfer to deep traps involved in the high temperature thermally stimulated luminescence. (author)

  17. 40 CFR 81.136 - Corpus Christi-Victoria Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Corpus Christi-Victoria Intrastate Air... Air Quality Control Regions § 81.136 Corpus Christi-Victoria Intrastate Air Quality Control Region. The Corpus Christi-Victoria Intrastate Air Quality Control Region (Texas) consists of the...

  18. 25 CFR 170.136 - How can a tribe obtain funds?

    Science.gov (United States)

    2010-04-01

    ... PROGRAM Indian Reservation Roads Program Policy and Eligibility Recreation, Tourism and Trails § 170.136 How can a tribe obtain funds? (a) To receive funding for programs that serve recreation, tourism, and... and have it ready for development; and (2) Have a viable project ready for improvement or...

  19. Yeast Interacting Proteins Database: YER081W, YPR136C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available mental and comparative sequence data; partially overlaps verified ORF RRP9 Rows w...tially overlaps verified ORF RRP9 Rows with this prey as...YPR136C - Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; par

  20. 31 CFR 13.6 - Reimbursement of State and local governments.

    Science.gov (United States)

    2010-07-01

    ... FOR PROVIDING ASSISTANCE TO STATE AND LOCAL GOVERNMENTS IN PROTECTING FOREIGN DIPLOMATIC MISSIONS § 13.6 Reimbursement of State and local governments. (a) State and local governments providing services... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Reimbursement of State and...

  1. 42 CFR 136.22 - Establishment of contract health service delivery areas.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Establishment of contract health service delivery... Services § 136.22 Establishment of contract health service delivery areas. (a) In accordance with the..., contract health service delivery areas are established as follows: (1) The State of Alaska; (2) The...

  2. Analysis of 136 ureteral injuries in gynecological and obstetrical surgery from completed insurance claims

    DEFF Research Database (Denmark)

    Hove, L.D.; Michelsen, Jonas Bock; Christoffersen, J.K.;

    2010-01-01

    Association. Main outcome measures. Preventable ureteral injuries. Results. From 1996 to 2006, 136 submitted claims concerning ureteral injuries were registered. Among these, 73 claims were approved (54%), and compensation paid. In 44 of these, the injury was caused by negligence. Failure to dissect...

  3. Study of collisions of {sup 136}Xe + {sup 198}Pt for the KEK isotope separator

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, Y.X., E-mail: yutaka.watanabe@kek.jp [Institute of Particle and Nuclear Studies, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Hirayama, Y.; Imai, N.; Ishiyama, H.; Jeong, S.C.; Miyatake, H. [Institute of Particle and Nuclear Studies, High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Clement, E.; France, G. de; Navin, A.; Rejmund, M.; Schmitt, C. [Grand Accélérateur National d’Ions Lourds (GANIL), CEA/DSM-CNRS/IN2P3, Bd Henri Becquerel, BP 55027, F-14076 Caen Cedex 05 (France); Pollarolo, G. [Dipartimento di Fisica Teorica, Università di Torino, Via Pietro Giuria 1, 10125 Torino (Italy); Corradi, L.; Fioretto, E. [Laboratori Nazionali di Legnaro dell’INFN, Via Romea 4, 35020 Legnaro (Italy); Montanari, D. [Università di Padova, Via 8 Febbraio, 2-35122 Padova (Italy); Choi, S.H.; Kim, Y.H.; Song, J.S. [Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742 (Korea, Republic of); Niikura, M.; Suzuki, D. [Institut de Physique Nucléaire (IPN), IN2P3-CNRS, Université Paris-Sud 11, F-91406 Orsay Cedex (France); and others

    2013-12-15

    Highlights: • {sup 136}Xe + {sup 198}Pt shows a comparable contribution of proton pick-up and stripping. • Proton stripping channels in {sup 136}Xe + {sup 198}Pt show enhanced cross sections. • Mass distributions of proton stripping channels in {sup 136}Xe + {sup 198}Pt shift to heavy side. -- Abstract: Multinucleon transfer reactions between two heavy ions are an important tool for production and investigation of exotic neutron-rich nuclei, which are difficult to access by other methods. The {sup 136}Xe + {sup 198}Pt system is a candidate to efficiently produce neutron-rich nuclei around the neutron magic number N=126 for the KEK isotope separation project. In order to confirm this, measurements of the production cross sections with the large acceptance magnetic spectrometer VAMOS++ and de-excitation gamma rays from target-like fragments using the high efficiency germanium array EXOGAM at GANIL are reported. The measured isotopic distributions of the projectile-like fragments are compared with GRAZING calculations. The proton stripping channels show rough agreements between measurements and calculations. For the proton pick-up channels, the measured distributions are shifted toward the heavier masses and show enhanced cross sections in transfers of two or more protons.

  4. Runaway massive stars from R136: VFTS 682 is very likely a "slow runaway"

    CERN Document Server

    Banerjee, Sambaran; Oh, Seungkyung

    2011-01-01

    We conduct a theoretical study on the ejection of runaway massive stars from R136 --- the central massive, star-burst cluster in the 30 Doradus complex of the Large Magellanic Cloud. Specifically, we investigate the possibility of the very massive star (VMS) VFTS 682 being a runaway member of R136. Recent observations of the above VMS, by virtue of its isolated location and its moderate peculiar motion, have raised the fundamental question whether isolated massive star formation is indeed possible. We perform the first realistic N-body computations of fully mass-segregated R136-type star clusters in which all the massive stars are in primordial binary systems. These calculations confirm that the dynamical ejection of a VMS from a R136-like cluster, with kinematic properties similar to those of VFTS 682, is common. Hence the conjecture of isolated massive star formation is unnecessary to account for this VMS. Our results are also quite consistent with the ejection of 30 Dor 016, another suspected runaway VMS f...

  5. Direct liquid chromatography determination of the reactive imine SJG-136 (NSC 694501).

    Science.gov (United States)

    Cheung, Andrew; Struble, Elaine; He, Jingyi; Yang, Chun; Wang, Euphemia; Thurston, David E; Liu, Paul

    2005-08-05

    SJG-136 (NSC 694501), 8,8'-[[(propane-1,3-diyl)dioxy]bis[(11aS)-7-methoxy-2-methylidene-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one], which is being developed as a DNA-interactive antitumor agent, contains highly reactive imines in the diazepinone portions of the molecule. Water or alcohol adds readily to the imino moiety to form the corresponding carbinolamine or its alkyl ether, respectively. This sensitivity to protic substances poses a formidable challenge to the formulation and HPLC assay development for the compound. After studying the solution chemistry of SJG-136 and its potential interaction with various stationary phases, two reversed-phase liquid chromatographic assays for the compound have been developed. A direct assay that separates SJG-136 from its water or methanol adducts and an indirect assay that quantifies SJG-136 as its dihydrate adduct are reported. The latter method, which is more practical for drug development, has been validated. It is reproducible (R.S.D.<2%), linear (r2=0.9999) and accurate (within 98-102% recovery), with a lower detection limit of 2.5 ng.

  6. Revisions to ANSI Z136.1-2007 : safe use of lasers.

    Energy Technology Data Exchange (ETDEWEB)

    Snell, Jonathan

    2008-10-01

    The parent document and cornerstone of the Z136 series of laser safety standards, the revised ANSI Z136.1 (2007) provides guidance for the safe use of lasers and laser systems by defining control measures for each of the four laser classes. As a result of advances in laser devices and applications, new guidelines have been incorporated into this 2007 revision. The new revision should be obtained by all laser end users and is a must for users of class 3B and 4 lasers as it renders all previous editions obsolete. Since the ANSI Z136.1 standard is the foundation of laser safety programs for industrial, military, medical, and educational applications nationwide, revisions to the previous version can and will affect the training and practice of laser safety in these environments. Changes to the previous version include the addition of new laser hazard classification definitions, new requirements for refresher training, and changes to medical surveillance requirements. The ANSI Z136.1 (2007) standard provides an updated and thorough set of guidelines for implementing a safe laser program. In addition to these changes, the standard covers laser safety program provisions including the duties and responsibilities of the LSO, non-beam hazards, administrative/engineering control measures, definitions, optical density, nominal hazard zone (NHZ), MPEs, accessible emission limit (AEL), bioeffects, standard operating procedures (SOPs), and example calculations.

  7. 49 CFR 572.136 - Knees and knee impact test procedure.

    Science.gov (United States)

    2010-10-01

    ... Hybrid III 5th Percentile Female Test Dummy, Alpha Version § 572.136 Knees and knee impact test procedure... as measured with the test probe-mounted accelerometer must be not less than 3450 N (776 lbf) and not... tibia may contact any exterior surface. (3) Align the test probe so that throughout its stroke and...

  8. 40 CFR 63.136 - Process wastewater provisions-individual drain systems.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 9 2010-07-01 2010-07-01 false Process wastewater provisions... Chemical Manufacturing Industry for Process Vents, Storage Vessels, Transfer Operations, and Wastewater § 63.136 Process wastewater provisions—individual drain systems. (a) For each individual drain...

  9. 7 CFR 1955.136 - Environmental Assessment (EA) and Environmental Impact Statement (EIS).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 14 2010-01-01 2009-01-01 true Environmental Assessment (EA) and Environmental Impact... Disposal of Inventory Property General § 1955.136 Environmental Assessment (EA) and Environmental Impact Statement (EIS). (a) Prior to a final decision on some disposal actions, an environmental assessment must be...

  10. Effects of acetic acid on microstructure and electrochemical properties of nano cerium oxide films coated on AA7020-T6 aluminum alloy

    Institute of Scientific and Technical Information of China (English)

    H. Hasannejad; T. Shahrabi; M. Aliofkhazraei

    2009-01-01

    Nano cerium oxide films were applied on AA7020-T6 aluminum alloy and the effects of acetic acid concentration on the microstructure and electrochemical properties of the coated samples were investigated by using scanning electron microscopy (SEM), X-ray diffraction (XRD), crack-flee films with well-developed grains were obtained and grain sizes of the films decreased. Elimination of cracks and decreasing grain size of the nano cerium oxide films caused corrosion resistance to increase.

  11. Completion summary for borehole USGS 136 near the Advanced Test Reactor Complex, Idaho National Laboratory, Idaho

    Science.gov (United States)

    Twining, Brian V.; Bartholomay, Roy C.; Hodges, Mary K.V.

    2012-01-01

    In 2011, the U.S. Geological Survey, in cooperation with the U.S. Department of Energy, cored and completed borehole USGS 136 for stratigraphic framework analyses and long-term groundwater monitoring of the eastern Snake River Plain aquifer at the Idaho National Laboratory. The borehole was initially cored to a depth of 1,048 feet (ft) below land surface (BLS) to collect core, open-borehole water samples, and geophysical data. After these data were collected, borehole USGS 136 was cemented and backfilled between 560 and 1,048 ft BLS. The final construction of borehole USGS 136 required that the borehole be reamed to allow for installation of 6-inch (in.) diameter carbon-steel casing and 5-in. diameter stainless-steel screen; the screened monitoring interval was completed between 500 and 551 ft BLS. A dedicated pump and water-level access line were placed to allow for aquifer testing, for collecting periodic water samples, and for measuring water levels. Geophysical and borehole video logs were collected after coring and after the completion of the monitor well. Geophysical logs were examined in conjunction with the borehole core to describe borehole lithology and to identify primary flow paths for groundwater, which occur in intervals of fractured and vesicular basalt. A single-well aquifer test was used to define hydraulic characteristics for borehole USGS 136 in the eastern Snake River Plain aquifer. Specific-capacity, transmissivity, and hydraulic conductivity from the aquifer test were at least 975 gallons per minute per foot, 1.4 × 105 feet squared per day (ft2/d), and 254 feet per day, respectively. The amount of measureable drawdown during the aquifer test was about 0.02 ft. The transmissivity for borehole USGS 136 was in the range of values determined from previous aquifer tests conducted in other wells near the Advanced Test Reactor Complex: 9.5 × 103 to 1.9 × 105 ft2/d. Water samples were analyzed for cations, anions, metals, nutrients, total organic

  12. T136

    Directory of Open Access Journals (Sweden)

    O. Mynbaev

    2015-11-01

    Conclusion: An in vitro model of oxidative stress during CO2-pneumoperitoneum increased HeLa cancer cell invasion capacity in comparison with standard CO2-pneumoperitoneum condition with continuous CO2 insufflation. Oxidative stress followed by acute hypoxia and reperfusions during deflations can increase cancer cell attachment and survival capacity, and may trigger cancer cell invasion and metastasis. These data suggest that a regime of laparoscopic procedures may affect attachment and invasion of cancer cells and hence can explain the occurrence of port-site cancer metastasis.

  13. Domain Structure in Calcium-Cerium Fluorocarbonate Minerals, Mianning County, Sichuan Province, China

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The domain structures in calcium-cerium fluorocarbonate mineral series from a rare earth mineral deposit within an aegirine alkali granite massif in Mianning County, Sichuan Province, China, were studied by means of transmission electron microscopy. Many categories of domain structures in this mineral series were observed and investigated, including the microtwin domains of parisite-6R2 and B2S-6R, the antiphase domains of B2S-2H. The results show that the antiphase domains which are faults along crystal plane (0001) are formed by the displacement of crystal lattice in c* direction and the displacement is 0.471 nm. A new polytype (B4S2-3R) of regular mixed-layer structure with B4S2 type is found in the domain region of mixed-layer structure.

  14. Structural Characteristics of Cerium Oxide Nanocrystals Prepared by the Microemulsion Method

    Institute of Scientific and Technical Information of China (English)

    J.Zhang; X.Ju; Z.Y.Wu; T.Liu; T.D.Hu; Y.N.Xie

    2001-01-01

    The aim of this work is to investigate the microstructure development of erium oxide nanocrystal,prepared by the microemulsion process,as a function of annealing temperature in air.Combined with the HRTEM and the thermogravimetric-differential thermal analysis in air.Combined withthe HRTEm and the thremogravimetric-differential thermal analysis(TG-DTA),the XRD patterns reveal that the sample annealed at 623 K is amorphous,and the formation of cerium oxide nanocrystal occurs above 773 K.The local structural and electronic properties in the nanocrystallization process are probed by X-ray absorption spectra (XAS) at the Ce L3 edge.It is found that the phase structure changes from triclinic to cubic (CeO2),and the electroic structure changes from Ce3 to Ce4 upon increasing the annealing temperature.

  15. Effect of Cerium on the Viscosity of Liquid Fe-C Alloy of Eutectic Content

    Institute of Scientific and Technical Information of China (English)

    滕新营; 叶以富; 刘含莲; 王焕荣; 石志强; 耿浩然

    2002-01-01

    The viscosities of liquid Fe-4.30C and Fe-4.30C-Ce alloys were measured by oscillating crucible viscometer. The results show that viscosity of Fe-4.30C alloy changes from 5.50 to 8.30 MPa*s when the liquid is cooled from 1425 ℃ to the melting point. The abnormity of viscosity of Fe-4.30C alloy near the melting point is reasonable due to the formation of graphite. The addition of cerium especially with content higher than 0.21% causes an evidently decrease in viscosity for eutectic alloy resulting from increase of free volume and size decrease of atom cluster in the liquids. It can be concended that the existence of C-Ce compound contributes to the discontinuous of viscosity at 1340~1370 ℃ for the Fe-4.30C-Ce alloy by experinments with differential scanning calorimeter.

  16. Physical properties and valence state of cerium in the filled skutterudite CePt₄Ge₁₂.

    Science.gov (United States)

    Gumeniuk, R; Kvashnina, K O; Schnelle, W; Nicklas, M; Borrmann, H; Rosner, H; Skourski, Y; Tsirlin, A A; Leithe-Jasper, A; Grin, Yu

    2011-11-23

    Electronic, magnetic, and transport properties of the filled platinum-germanium skutterudite CePt₄Ge₁₂ are investigated. High resolution x-ray absorption spectroscopy measurements at the cerium L(III) edge demonstrate that CePt₄Ge₁₂ in this compound has a temperature-independent valence close to three. However, magnetic susceptibility, thermopower, Hall effect, and electronic specific heat reveal a broad maximum at Tmax D 65-80 K, suggesting the presence of valence fluctuations. The Sommerfeld coefficient γ = 105 mJ mol⁻¹ K⁻², deduced from specific heat, indicates moderately enhanced band masses for CePt₄Ge₁₂. We discuss these findings and conclude that CePt₄Ge₁₂ represents a system at the border between intermediate valence (IV) and Kondo lattice behavior. In addition, the lattice specific heat and the thermal conductivity are discussed with respect to the vibrational dynamics of Ce in the [Pt₄Ge₁₂] framework.

  17. Effect of cerium on ignition point of AZ91D magnesium alloy

    Institute of Scientific and Technical Information of China (English)

    Zhao Hongjin; Zhang Yinghui; Kang Yonglin

    2008-01-01

    The surface and interior temperature-time curves of blocky cerium modified AZ91D magnesium alloy were measured during a non-protective heating and melting process. Two inflection points with rapid increase in temperature were found on both curves, which corresponded to the formation of "auliflower" oxide on the surface and the occurrence of flame during melting. These two temperatures are therefore defined as oxidation point and ignition point, respectively.The interior temperature-time curve is similar to that measured on the surface except for a comparable time delay. The oxidation and ignition temperatures increase with Ce content, an average increase of 33℃ and 61℃ was found when Ce addition was about 1.0 wt %. However, the increasing rate of the oxidation and ignition temperature decreases with increasing Ce content. An addition of 0.6wt% Ce is recommended for ignition-resistant AZ91 magnesium alloy.

  18. Effect of cerium on ignition point of AZ91D magnesium alloy

    Directory of Open Access Journals (Sweden)

    Zhao Hongjin

    2008-02-01

    Full Text Available The surface and interior temperature-time curves of blocky cerium modified AZ91D magnesium alloy were measured during a non-protective heating and melting process. Two inflection points with rapid increase in temperature were found on both curves, which corresponded to the formation of “auliflower”oxide on the surface and the occurrence of flame during melting. These two temperatures are therefore defined as oxidation point and ignition point, respectively. The interior temperature-time curve is similar to that measured on the surface except for a comparable time delay. The oxidation and ignition temperatures increase with Ce content, an average increase of 33=and 61= was found when Ce addition was about 1.0 wt %. However, the increasing rate of the oxidation and ignition temperature decreases with increasing Ce content. An addition of 0.6wt% Ce is recommended for ignition-resistant AZ91 magnesium alloy.

  19. Effect of cerium and lanthanum additives on plasma electrolytic oxidation of AZ31 magnesium alloy

    Institute of Scientific and Technical Information of China (English)

    沈德久; 马豪杰; 郭长虹; 蔡景瑞; 李国龙; 何东磊; 杨庆祥

    2013-01-01

    Plasma electrolytic oxidation (PEO) coatings on AZ31 magnesium (Mg) alloy were developed using the aqueous solution with alkaline silicate and sodium hydroxide as a base electrolyte system. The effects of cerium (Ce) nitrate and lanthanum (La) nitrate additives on the voltage response, microstructure, compositions and corrosion resistance of PEO coatings were investigated by scan-ning electron microscopy (SEM), energy-dispersive spectrum (EDS), X-ray diffraction (XRD) and potentiodynamic polarization tests, etc. The results showed that Ce and La additives increased the stable voltage and compactness of the PEO coatings, while, those did not change the compositions of the PEO coatings. The corrosion resistance of the PEO coating obtained in solutions with La nitrate of 0.1 g/L was the best, followed by that with Ce nitrate of 0.1 g/L and that without additives.

  20. Effect of CO2 on the Conversion of Isobutane over Iron, Cerium and Molybdenum Mixed Oxides

    Directory of Open Access Journals (Sweden)

    Daifallah Al-Dhayan

    2016-10-01

    Full Text Available A series of cerium and iron mixed oxide catalysts were prepared by thermal decomposition of Fe1.5PMo12O40 and Ce1.5PMo12O40 heteropolyanions mixture. The prepared catalysts have been characterized and tested for the conversion of isobutane in the presence of CO2. Characterization by XRD showed that besides Fe2O3 and CeO2, α-MoO3 was the main phase formed after thermal treatment. The effect of the support, the reaction temperature, and the presence of H2O in the reactant mixture was investigated. It has been found that the support enhanced both the conversion and isobutene selectivity. As for the reaction temperature and addition of water, it has been found that increasing the temperature increased both the conversion and isobutene selectivity, whereas the presence of water increased the isobutene selectivity but decreased the conversion.

  1. Cerium oxide-chitosan based nanobiocomposite for food borne mycotoxin detection

    Science.gov (United States)

    Kaushik, Ajeet; Solanki, Pratima R.; Pandey, M. K.; Ahmad, Sharif; Malhotra, Bansi D.

    2009-10-01

    Cerium oxide nanoparticles (NanoCeO2) and chitosan (CH) based nanobiocomposite film deposited onto indium-tin-oxide coated glass substrate has been used to coimmobilize rabbit immunoglobin (r-IgGs) and bovine serum albumin (BSA) for food borne mycotoxin [ochratoxin-A (OTA)] detection. Electrochemical studies reveal that presence of NanoCeO2 increases effective electro-active surface area of CH-NanoCeO2/indium tin oxide (ITO) nanobiocomposite resulting in high loading of r-IgGs. BSA/r-IgGs/CH-NanoCeO2/ITO immunoelectrode exhibits improved linearity (0.25-6.0 ng/dl), detection limit (0.25 ng/dl), response time (25 s), sensitivity (18 μA/ng dl-1 cm-2), and regression coefficient (r2˜0.997).

  2. Stability and morphology of cerium oxide surfaces in an oxidizing environment: A first-principles investigation

    Science.gov (United States)

    Fronzi, Marco; Soon, Aloysius; Delley, Bernard; Traversa, Enrico; Stampfl, Catherine

    2009-09-01

    We present density functional theory investigations of the bulk properties of cerium oxides (CeO2 and Ce2O3) and the three low index surfaces of CeO2, namely, (100), (110), and (111). For the surfaces, we consider various terminations including surface defects. Using the approach of "ab initio atomistic thermodynamics," we find that the most stable surface structure considered is the stoichiometric (111) surface under "oxygen-rich" conditions, while for a more reducing environment, the same (111) surface, but with subsurface oxygen vacancies, is found to be the most stable one, and for a highly reducing environment, the (111) Ce-terminated surface becomes energetically favored. Interestingly, this latter surface exhibits a significant reconstruction in that it becomes oxygen terminated and the upper layers resemble the Ce2O3(0001) surface. This structure could represent a precursor to the phase transition of CeO2 to Ce2O3.

  3. Investigation of the Carbon Monoxide Gas Sensing Characteristics of Tin Oxide Mixed Cerium Oxide Thin Films

    Directory of Open Access Journals (Sweden)

    Muhammad B. Haider

    2012-02-01

    Full Text Available Thin films of tin oxide mixed cerium oxide were grown on unheated substrates by physical vapor deposition. The films were annealed in air at 500 °C for two hours, and were characterized using X-ray photoelectron spectroscopy, atomic force microscopy and optical spectrophotometry. X-ray photoelectron spectroscopy and atomic force microscopy results reveal that the films were highly porous and porosity of our films was found to be in the range of 11.6–21.7%. The films were investigated for the detection of carbon monoxide, and were found to be highly sensitive. We found that 430 °C was the optimum operating temperature for sensing CO gas at concentrations as low as 5 ppm. Our sensors exhibited fast response and recovery times of 26 s and 30 s, respectively.

  4. Inconsistencies with the single-impurity Anderson model in photoelectron spectra of cerium heavy fermion compounds

    Energy Technology Data Exchange (ETDEWEB)

    Joyce, J.J.; Arko, A.J.; Lawrence, J.; Canfield, P.C.; Fisk, Z.; Bartlett, R.J.; Thompson, J.D.; Smith, J.L. (Los Alamos National Lab., NM (United States))

    1992-04-03

    A series of cerium heavy fermion compounds have been studied in order to check for the systematics with T{sub K} and the temperature dependence of the Kondo resonance predicted by the Kondo model. Neither the systematics nor the temperature dependence is found, the latter primarily determined from a detailed study in CeSi{sub 2}. The qualitative shapes of the features at E{sub F} remain nearly constant irrespectively of T{sub K}, while all the temperature dependence can be explained as resulting from phonon broadening of core-like states as well as Fermi function broadening. In addition, if the d electron contribution to the spectra is subtracted, one obtains a symmetric, lorentzian line shape for the ''main'' 4f peak. (orig.).

  5. Effect of cerium on the corrosion behaviour of sintered (Nd,Ce)FeB magnet

    Science.gov (United States)

    Yang, Lijing; Bi, Mengxue; Jiang, Jianjun; Ding, Xuefeng; Zhu, Minggang; Li, Wei; Lv, Zhongshan; Song, Zhenlun

    2017-06-01

    For the balanced consumption of rare-earth elements, cerium (Ce) was partially used for NdFeB magnets instead of Nd. The corrosion behaviour of the (Nd,Ce)FeB magnet with different Ce contents in 3.5% NaCl solution was investigated by SEM, XRD, EDS and electrochemical tests. After immersion, the weight loss was calculated and the magnetic properties of the samples were measured. Results showed that Ce affected the corrosion of the (Nd,Ce)FeB magnet. Compared with the NdFeB magnet without Ce but of the same grade as the magnetic energy product, (Nd,Ce)FeB magnet showed better corrosion resistance. With increased Ce content, the corrosion resistances and magnetic properties of (Nd,Ce)FeB magnets were investigated.

  6. Sorptive separation of yttrium and cerium on a weakly basic anionite

    Science.gov (United States)

    Cheremisina, O. V.; Ponomareva, M. A.; Chirkst, D. E.; Lobacheva, O. L.; Shul'gin, I. A.

    2015-01-01

    The sorption of complex yttrium ions with Trilon B onto the weakly basic anionite D-403 in nitrate form from an acidic medium at pH 3 with constant ionic strength (NaNO3, 1 mol/kg) is investigated. A thermodynamic evaluation of the sorption isotherm of anionic yttrium complexes is performed using a method based on the linearization of the equation of the law of active mass, modified for ionic exchange reactions. The ionic exchange constant, the Gibbs free energy of ionic exchange, the capacity of the anionite, and the sorption limit of ethylenediaminetetraacetatoyttrate ions (EDTA yttrate ions) are calculated. Using a frontal version of ion exchange chromatography, cerium and yttrium are separated on D-403 anionite with a fraction of pure yttrium at the column outlet of no less than 30%.

  7. Nanoscale Hybrid Langmuir-Blodgett Films Based on Cerium-Substituted Heteropolymolybdate and Polyquinoline

    Institute of Scientific and Technical Information of China (English)

    王峥; 柳士忠; 杜祖亮; 胡振纲; 张洪杰

    2003-01-01

    Nanoscale hybrid organic/inorganic Langmuir-Blodgett films of cerium-substituted heteropolymolybdates(Ce-HPMo) and π-conjugated macromolecule poly(1,2-dihydro-2,2,4-trimethyl)quinoline(PQ) were obtained with auxiliary film-forming material stearic acid(SA) or octadecylamine(ODA). The surface pressure-area isotherms illuminate the formation of the hybrid LB films of PQ/ODA/Ce-HPMo and P Q/SA/Ce-HPMo. The different film-forming mechanism was discussed when the different auxiliary film-forming materials were used in the system. The absorption spectra indicate that the molecules of PQ and Ce-HPMo are incorporated into the LB films. Tapping-mode AFM image reveals a granular surface texture of nanosized Ce-substituted heteropolymolybdate. STM image shows that the conductivity is greatly improved after Ce-substituted heteropolymolybdates are incorporated in the films.

  8. Dielectric studies on cerium doped BaLa2Ti3O10

    Directory of Open Access Journals (Sweden)

    Parshuram B. Abhange

    2015-12-01

    Full Text Available The BaLa2-xCexTi3O10 samples (with x = 0.2, 0.4, 0.6 and 0.8 were prepared by hydroxide co-precipitation method and finally sintered at 1150 °C. The structure of the prepared samples was characterized by XRD and SEM. The single phase material was confirmed only for the BaLa1.8Ce0.2Ti3O10 ceramics. However, at higher cerium concentration secondary phase was observed. The characteristic plate-like structure, having grains with submicrometer thickness and high aspect ratio, was clearly observed by SEM. The results of dielectric measurement suggest that the appropriate adjustment of doping (with x between 0.2 and 0.8 will give sufficient high dielectric constant at very low loss. The resistivity of samples decreases with increase in temperature indicating the normal semiconducting electrical behaviour.

  9. Valence Control of Ce Ions in Cerium-substituted Yttrium Iron Garnet

    Institute of Scientific and Technical Information of China (English)

    SONG Fengbing; LI Qiang; ZHONG Zhifeng

    2005-01-01

    Cerium-substituted yttrium iron garnet(CexY3-xFe5O12, Ce∶YIG) was prepared via coprecipitation. The structure, morphology, valence state and constituent of Ce ions were investigated respectively. X-ray powder diffraction(XRD) analysis shows that Ce∶YIG was of single cubic YIG phase. The result of X-ray photoelectron spectroscopy(XPS) indicates the Ce ions in Ce∶YIG were in the state of trivalence. Scanning electron microscope(SEM) demonstrates the conglobation of Ce∶YIG particles about 0.2μm scale.The magnetic properties were studied by a vibrating sample magnetometer(VSM) and the result exhibits that substitution of Ce3+ changes the magnetic parameters of YIG. The effects of doping content of Ce ions and synthesis temperature on valence control were discussed in detail.

  10. Electrospun cerium nitrate/polymer composite fibres:synthesis, characterization and fibre-division model

    Institute of Scientific and Technical Information of China (English)

    Li Meng-Meng; Long Yun-Ze; Yin Hong-Xing; Zhang Zhi-Ming

    2011-01-01

    Cerium (III)nitrate/poly(vinylpyrrolidone)(Ce(NO3)3/PVP)composite fibres have been prepared by electrospinning. After calcining the composite fibres in air at 500℃, CeO2 nanowires were obtained. The characterizations of the as-spun composite fibres and resultant nanowires have been carried out by a scanning electron microscope (SEM),an infrared spectrometer, an x-ray diffractometer and a fluorescence spectrophotometer. Interestingly, some unusual ribbon-like or twin fibres were observed besides the common fibres with circular or elliptic cross sections. We developed a fibre-division model resulting from Coulomb repulsion and solvent vaporization to interpret the formation of the ribbona or twin fibres, which has been confirmed by the SEM studies. Our results also indicate that the formation of the ribbons or twin fibres is less dependent on operation voltage and work distance.

  11. Cerium(IV)-based chemiluminescence of phentolamine sensitized by rhodamine 6G

    Energy Technology Data Exchange (ETDEWEB)

    Liu Weibing; Huang Yuming

    2004-03-24

    A new chemiluminescence (CL) method is proposed for the determination of phentolamine, which is based on the reaction between studied drug and Cerium(IV) (Ce(IV)) in a nitric acid medium and measurement of the CL intensity produced by rhodamine 6G used as a sensitizer. In the optimum conditions, CL intensities are proportional to concentrations of the studied drug over the range 1x10{sup -9}-1x10{sup -6} g/ml with a detection limit of 4x10{sup -10} g/ml. The relative standard deviation (R.S.D.) is 3.4% for 1x10{sup -7} g/ml phentolamine (n=11). The method has been applied to the determination of studied drug in injections and biological fluids with satisfactory results.

  12. Highly stable, mesoporous mixed lanthanum-cerium oxides with tailored structure and reducibility

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Shuang; Broitman, Esteban; Wang, Yanan; Cao, Anmin; Veser, Goetz

    2011-05-01

    Pure and mixed lanthanum and cerium oxides were synthesized via a reverse microemulsion-templated route. This approach yields highly homogeneous and phase-stable mixed oxides with high surface areas across the entire range of La:Ce ratios from pure lanthana to pure ceria. Surprisingly, all mixed oxides show the fluorite crystal structure of ceria, even for lanthanum contents as high as 90%. Varying the La:Ce ratio not only allows tailoring of the oxide morphology (lattice parameter, pore structure, particle size, and surface area), but also results in a fine-tuning of the reducibility of the oxide which can be explained by the creation of oxygen vacancies in the ceria lattice upon La addition. Such finely controlled syntheses, which enable the formation of stable, homogeneous mixed oxides across the entire composition range, open the path towards functional tailoring of oxide materials, such as rational catalyst design via fine-tuning of redox activity.

  13. Taguchi design and equilibrium modeling for fluoride adsorption on cerium loaded cellulose nanocomposite bead.

    Science.gov (United States)

    Santra, Dhiman; Joarder, Rajib; Sarkar, Mitali

    2014-10-13

    The cooperative influence of operational variables for fluoride adsorption on cerium loaded cellulose nanocomposite bead (CCNB) was assessed using Taguchi design tool. The percentage contribution of each operational variable was determined. The solution pH, with a maximum contribution of 80.78%, indicates its highest influence on the response, the adsorption percent of fluoride. The quality and validity of the experimental design were assessed from ANOVA and subsequently by the confirmation experiment. The equilibrium adsorption data showed that the Temkin isotherm is the most suited one compared to the Langmuir and Freundlich model. It is found that almost 90% adsorbed fluoride can be eluted with 0.01 (N) NaOH and the regenerated bead can successively be reused for at least three times. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Removal of fluoride ion from aqueous solution by a cerium-poly(hydroxamic acid) resin complex.

    Science.gov (United States)

    Haron, M J; Yunus, W M

    2001-05-01

    A cerium-loaded poly(hydroxamic acid) chelating ion exchanger was used for fluoride ion removal from aqueous solution. The resin was effective in decreasing the fluoride concentration from 5 mM down to 0.001 mM in acidic pH between 3 and 6. The sorption followed a Langmuir model with a maximum capacity of 0.5 mmol/g. The removal is accomplished by an anion exchange mechanism. The rate constant for the sorption was found to be 9.6 x 10(-2) min-1. A column test shows that the fluoride ion was retained on the column until breakthrough point and the fluoride sorbed in the column can be eluted with 0.1 M NaOH. The column can be reused after being condition with hydrochloric acid at pH 4. The resin was tested and found to be effective for removal of fluoride from actual industrial wastewater.

  15. Effects of Cerium on Microalloying in Low Sulfur Nb-Ti-Bearing Steel

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The CCT curves of supercooled austenite were investigated by using THERMECMASTOR-Z simulation machine, test samples refined from 50 kg vacuum induction furnace and two-stage controlled rolling in laboratorial condition.Test results show that influence of cerium (Ce) addition in low sulfur Nb-Ti-Bearing steel is as follows: Ce can increase the transformation point tAr3 and tAr1, enlarge the interval of transformation (tAr3-tAr1). Ce moves CCT curves upwards and rightwards, and reduces hardenability. Ce increases bainitic transformation temperature and enlarges interval of bainite formation. With higher cooling rates, Ce changes the martensite from coarse strip to fine strip. It decreases Ms, enhances the trend of lath martensitic structure and limits the formation of lamellar crystal.

  16. Boric Acid as an Accelerator of Cerium Surface Treatment on Aluminum

    Directory of Open Access Journals (Sweden)

    K. Cruz-Hernández

    2014-01-01

    Full Text Available Aluminum pieces are often used in various industrial processes like automotive and aerospace manufacturing, as well as in ornamental applications, so it is necessary to develop processes to protect these materials, processes that can be industrialized to protect the aluminum as well or better than chromate treatments. The purpose of this research is to evaluate boric acid as an accelerator by optimizing its concentration in cerium conversion coatings (CeCC with 10-minute immersion time with a concentration of 0.1 g L−1 over aluminum to protect it. The evaluation will be carried out by measuring anticorrosion properties with electrochemical techniques (polarization resistance, Rp, polarization curves, PC, and electrochemical impedance spectroscopy, EIS in NaCl 3.5% wt. aqueous solution and surface characterization with scanning electron microscopy (SEM.

  17. Porous microspheres of manganese-cerium mixed oxides by a polyvinylpyrrolidone assisted solvothermal method

    Science.gov (United States)

    Schmit, F.; Bois, L.; Chiriac, R.; Toche, F.; Chassagneux, F.; Descorme, C.; Besson, M.; Khrouz, L.

    2017-04-01

    Mixed cerium manganese oxides were synthesized using a polyvinylpyrrolidone (PVP) assisted solvothermal method. Materials obtained after calcination at 400 °C were characterized by X-ray diffraction, scanning and transmission electron microscopies, electron paramagnetic resonance (EPR), Raman spectroscopy, thermal analysis and nitrogen adsorption/desorption isotherms. The influence of the synthesis parameters on the oxide structure, such as the Mn:Ce ratio or the amount of PVP, was discussed. Micrometric spheres of mixed Mn-Ce oxides, resulting from the aggregation of 100 nm porous snowflakes, were successfully synthesized. These snowflakes were formed from the aggregation of smaller oriented crystallites (size 4 nm). The hydrothermal stability of these materials was also investigated.

  18. Deuterium isotope effect on the induction period of the cerium catalyzed Belousov-Zhabotinsky reaction

    Science.gov (United States)

    Rossi, Federico; Simoncini, Eugenio; Marchettini, Nadia; Tiezzi, Enzo

    2009-02-01

    In this work we present results about the deuterium isotopic effect on the global kinetics of a cerium catalyzed Belousov-Zhabotinsky reaction. A nonlinear dependence of the induction period upon the percentage of deuterated reactants was found in batch conditions. In order to understand this result, we investigated two reaction pathways responsible for the length of the induction period, namely: (a) the reaction between the enolic form of the malonic acid with molecular bromine and (b) the oxidation of malonic acid by the Ce(IV) ion. In both cases we obtained a linear dependence of the kinetic constants on the percentage of deuterated reactants. Nevertheless, by inserting the experimental values in the MBM (Marburg-Budapest-Missoula) model, we were able to qualitatively simulate the observed trend of the induction period.

  19. Air, aqueous and thermal stabilities of Ce3+ ions in cerium oxide nanoparticle layers with substrates

    KAUST Repository

    Naganuma, Tamaki

    2014-01-01

    Abundant oxygen vacancies coexisting with Ce3+ ions in fluorite cerium oxide nanoparticles (CNPs) have the potential to enhance catalytic ability, but the ratio of unstable Ce3+ ions in CNPs is typically low. Our recent work, however, demonstrated that the abundant Ce3+ ions created in cerium oxide nanoparticle layers (CNPLs) by Ar ion irradiation were stable in air at room temperature. Ce valence states in CNPs correlate with the catalytic ability that involves redox reactions between Ce3+ and Ce4+ ions in given application environments (e.g. high temperature in carbon monoxide gas conversion and immersion conditions in biomedical applications). To better understand the mechanism by which Ce3+ ions achieve stability in CNPLs, we examined (i) extra-long air-stability, (ii) thermal stability up to 500 °C, and (iii) aqueous stability of Ce 3+ ions in water, buffer solution and cell culture medium. It is noteworthy that air-stability of Ce3+ ions in CNPLs persisted for more than 1 year. Thermal stability results showed that oxidation of Ce 3+ to Ce4+ occurred at 350 °C in air. Highly concentrated Ce3+ ions in ultra-thin CNPLs slowly oxidized in water within 1 day, but stability was improved in the cell culture medium. Ce 3+ stability of CNPLs immersed in the medium was associated with phosphorus adsorption on the Ce3+ sites. This study also illuminates the potential interaction mechanisms of stable Ce3+ ions in CNPLs. These findings could be utilized to understand catalytic mechanisms of CNPs with abundant oxygen vacancies in their application environments. © The Royal Society of Chemistry 2014.

  20. Cerium(III) molybdate nanoparticles: Synthesis, characterization and radionuclides adsorption studies

    Energy Technology Data Exchange (ETDEWEB)

    Yousefi, Taher, E-mail: Taher_yosefy@yahoo.com [NFCRS, Nuclear Science and Technology Institute, Kargher Ave, Tehran (Iran, Islamic Republic of); Tarbiat Moallem University, Mofatteh Ave, Tehran (Iran, Islamic Republic of); Khanchi, Ali Reza; Ahmadi, Seyed Javad [NFCRS, Nuclear Science and Technology Institute, Kargher Ave, Tehran (Iran, Islamic Republic of); Rofouei, Mohamad Kazem [Tarbiat Moallem University, Mofatteh Ave, Tehran (Iran, Islamic Republic of); Yavari, Ramin; Davarkhah, Reza; Myanji, Behzad [NFCRS, Nuclear Science and Technology Institute, Kargher Ave, Tehran (Iran, Islamic Republic of)

    2012-05-15

    Highlights: Black-Right-Pointing-Pointer A new inorganic nanoparticles with average size about 40 nm were synthesized by chemical method. Black-Right-Pointing-Pointer The morphology studies reveal existing nanowires among dense nanoparticles. Black-Right-Pointing-Pointer Investigation shows it has high stability in rough media and high affinity for Cs(I), U(VI), and Th(IV). Black-Right-Pointing-Pointer It was used for adsorption of radionuclides and removal of {sup 134}Cs from real sample. Black-Right-Pointing-Pointer These findings are important for evaluating human and environmental risk assessment. - Abstract: Cerium(III) molybdate nanostructure with average size about 40 nm was prepared by adding cerium(III) chloride and ammonium molybdate solutions under varying conditions. The product was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transform infrared (FT-IR), thermogravimetric analysis (TGA) and Brunauere Emmette Teller (BET) techniques. Ion exchange capacity of the sample for potassium ion and distribution coefficients (K{sub d}) for 23 metal ions were determined, the K{sub d} values for Tl(I), Pb(II), Th(IV), U(VI), and Cs(I) ions were found to be sufficiently high for their removal from various effluents. The adsorption behavior of the sample towards Cs(I){sub 134} species were studied. Finally, the binary separation of Dy(III)-U(VI), Sm(III)-Th(IV) and Cs(I)-Rb(I) and removal of Cs(I){sub 134} from the real sample were successfully achieved.

  1. Label-free electrochemical immunosensor based on cerium oxide nanowires for Vibrio cholerae O1 detection

    Energy Technology Data Exchange (ETDEWEB)

    Tam, Phuong Dinh, E-mail: phuongdinhtam@gmail.com; Thang, Cao Xuan, E-mail: thang.caoxuan@hust.edu.vn

    2016-01-01

    This paper developed a label-free immunosensor based on cerium oxide nanowire for Vibrio cholerae O1 detection application. The CeO{sub 2} nanowires were synthesized by hydrothermal reaction. The immobilization of Anti-V. cholerae O1 onto CeO{sub 2} nanowire-deposited sensor was performed via an amino ester, which was created by using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, and sulfo-N-hydroxysuccinimide. The electrochemical responses of the immunosensor were studied by electrochemical impedance spectroscopy with [Fe (CN) {sub 6}] {sup 3−/4−} as redox probe. A linear response in electron transfer resistance for cell of V. cholerae O1 concentration was found in the range of 1.0 × 10{sup 2} CFU/mL to 1.0 × 10{sup 4} CFU/mL. The detection limit of the immunosensor was 1.0 × 10{sup 2} CFU/mL. The immunosensor sensitivity was 56.82 Ω/CFU·mL{sup −1}. Furthermore, the parameters affecting immunosensor response were also investigated, as follows: pH value, immunoreaction time, incubation temperature, and anti-V. cholerae O1 concentration. - Highlights: • A label-free immunosensor based on cerium oxide nanowire for Vibrio cholerae O1 detection application was developed. • A linear response was found in the range of 1.0 × 10{sup 2} CFU/mL to 1.0 × 10{sup 4} CFU/mL. • The detection limit of the immunosensor was 1.0 × 10{sup 2} CFU/mL. • The immunosensor sensitivity was 56.82 Ω/CFU.mL{sup −1}.

  2. Simultaneous oxidation and adsorption of As(III) from water by cerium modified chitosan ultrafine nanobiosorbent

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Lingfan [School of Chemistry and Molecular Engineering, East China University of Science and Technology, Shanghai 200237 (China); Research Center of Analysis and Test, East China University of Science and Technology, Shanghai 200237 (China); Zhu, Tianyi [School of Chemistry and Molecular Engineering, East China University of Science and Technology, Shanghai 200237 (China); Liu, Xin, E-mail: liuxin@ecust.edu.cn [School of Chemistry and Molecular Engineering, East China University of Science and Technology, Shanghai 200237 (China); Zhang, Wenqing, E-mail: zhwqing@ecust.edu.cn [School of Chemistry and Molecular Engineering, East China University of Science and Technology, Shanghai 200237 (China)

    2016-05-05

    Highlights: • A novel ultrafine nanobiosorbent of cerium modified chitosan (Ce-CNB) was prepared. • The Ce-CNB possessed properties for simultaneous oxidation and adsorption As(III). • Adsorption of As(III) by Ce-CNB was in high efficiency. • Mechanisms for As(III) adsorption on Ce-CNB were elucidated. - Abstract: Since most existing arsenic removal adsorbents are difficult to effectively remove arsenite (As(III)), an urgent need is to develop an efficient adsorbent for removing As(III) from contaminated water. In this study, a novel ultrafine nanobiosorbent of cerium modified chitosan (Ce-CNB) with simultaneous oxidation and adsorption As(III) performance has been successfully developed. The resulting Ce-CNB with or without As(III) adsorption was characterized by FTIR, XRD, SEM, EDS, TEM, EMI and XPS analysis. Batch of adsorption experiments were performed to investigate the effects of various conditions on the As(III) adsorption. The adsorption behaviors were well described by the Langmuir isotherm and the pseudo-second-order kinetic model, with the maximum adsorption capacities of 57.5 mg g{sup −1}. The adsorption mechanisms for As(III) were (i) formed monodentate and bidentate complexes between hydroxyl groups and arsenite; and (ii) partial As(III) oxidized to As(V) followed by simultaneously adsorbed on the surface of Ce-CNB. This novel nanocomposite can be reused while maintaining a high removal efficiency and can be applied to treat 5.8 L of As(III)-polluted water with the effluent concentration lower than the World Health Organization standard, which suggests its great potential to remove As(III) from contaminated water.

  3. Cerium oxide dispersed multi walled carbon nanotubes as cathode material for flexible field emitters.

    Science.gov (United States)

    Baby, Tessy Theres; Rakhi, R B; Ravi, N; Ramaprabhu, S

    2012-08-01

    Nanomaterials based electron sources are omnipresent in modern flat panel displays. Multi walled carbon nanotubes (MWNT) are the well studied electron emitter among the carbon materials. Since the surface modification of MWNT with low work function materials would have a positive impact on the field emission property of MWNT, cerium oxide (CeO2) nanoparticles dispersed multi walled carbon nanotubes (CeO2/MWNT) were synthesized by catalytic chemical vapour deposition followed by chemical reduction and its field emission property was investigated. The high-purity MWNT as well as CeO2/MWNT showed crystalline structure conformed by X-ray diffraction (XRD) and thermogravimetric analysis (TGA). Further characterisation was done with Raman spectroscopy, UV-Visible absorption spectra and Fourier transform IR spectroscopy (FT-IR). The morphology and structural details of CeO2/MWNT composite was probed by field-emission scanning electron microscopy (FESEM) and energy dispersive X-ray analysis (EDX). The direct evidence of the formation of CeO2/MWNT composites was given by transmission electron microscopy (TEM). The synthesized sample was coated over a flexible carbon paper using spin coating technique. The experiment was performed under a vacuum of 1 x 10(-6) Torr and Fowler-Nordheim equation was used to analyse the data. The turn-on voltage for the cerium oxide dispersed MWNT was found for a current density of 10 microA/cm2. The emission current density from the CeO2 nanoparticles dispersed MWNT reached 0.2 mA/cm2 at a reasonable bias field of 2.58 V/microm. The results were compared with those of pure MWNT and pure CeO2 nanoparticles with literature values.

  4. Ultrastructural Analysis of Human Breast Cancer Cells during Their Overtime Interaction with Cerium Oxide Nanoparticles

    KAUST Repository

    AlAbbadi, Shatha H.

    2016-12-01

    Cerium oxide nanoparticles have been proposed as an anticancer agent, thanks to their ability of tuning the redox activity in accordance to different conditions, which lead to selective roles on healthy and cancer cells. Recent evidence suggested the ability of these nanoparticles to be toxic against cancer cells, while confer protection from oxidative stress, toward healthy cells. The main focus of this study was to determine the ultrastructural effects of cerium oxide nanoparticles over multiple incubation time of 1, 3, and 7 days on breast healthy and cancer cells. Cellular characterizations were carried out using electron microscopes, both transmission and scanning electron microscopes, while the viability assessments were performed by propidium iodide and trypan blue viability assays. The obtained results of the viability assays and electron microscopy suggested higher toxic effects on the cancer cell line viability by using a nanoceria dose of 300 μg/mL after 1 day of treatment. Such effects were shown to be preserved at 3 days, and in a longer time point of 7 days. On the contrary, the healthy cells underwent less effects on their viability at time point of 1 and 7 days. The 3 days treatment demonstrated a reduction on the number of cells that did not correlate with an increase of the dead cells, which suggested a possible initial decrease of the cell growth rate, which could be due to the high intracellular loading of nanoparticles. To conclude, the overall result of this experiment suggested that 300 μg/mL of CeO2 nanoparticles is the most suitable dose, within the range and the time point tested, which induces long-lasting cytotoxic effects in breast cancer cells, without harming the normal cells, as highlighted by the viability assays and ultrastructural characterization of electron microscopy analysis.

  5. Structural and electronic properties of cerium from LDA+U calculations

    Directory of Open Access Journals (Sweden)

    F. Kheradmand

    2008-12-01

    Full Text Available  In this work structural, electronic and magnetic properties of alpha and gamma phases of cerium crystal have been calculated by means of the LDA and LDA+U methods. The equilibrium volume and magnetic moment obtained from the GGA approximation in agreement with the experiment are equal to 27.64 Å3 and 0.00018 µB, respectively. This agreement shows that the 4f electrons in alpha phase are itinerant due to the use of the GGA, where no strong correlations have been yet thaken into account. We have observed that even after applying the GGA+U method with U = 6.1 eV, the density of states of f orbital remains still at Fermi surface. Therefore, in complete accord with the experiment, our results show that the 4f electrons in the alpha phase are not localized. This is the case where the LDA and the GGA approximations could not describe the gamma phase properly. Indeed, physical properties of the gamma phase is consistent with the experiment and could only be reproduced after applying LDA+U method with U = 4.4 eV. In this way, the value of equilibrium volume and magnetic moment calculated for the gamma phase were found to be 34.33 Å3 and 1.15 µB, respectively. After including correlations among 4f electrons the γ-Ce DOS is positioned at its more reasonable place lower than Fermi level compared with the DOS obtained from GGA calculations. Our results, then, show that the 4f electrons in the gamma phase, as opposed to the alpha phase, are localized which is indicative of the fact that gamma cerium is a strongly correlated system. The volume of 11 kbar has been obtained for the pressure of the alpha-gamma phase transition .

  6. Cerium oxide nanoparticles inhibit the migration and proliferation of gastric cancer by increasing DHX15 expression

    Directory of Open Access Journals (Sweden)

    Xiao YF

    2016-07-01

    Full Text Available Yu-Feng Xiao,1 Jian-Mei Li,2 Su-Min Wang,1 Xin Yong,1 Bo Tang,1 Meng-Meng Jie,1 Hui Dong,1 Xiao-Chao Yang,2 Shi-Ming Yang1 1Department of Gastroenterology, Xinqiao Hospital, Third Military Medical University, Chongqing, People’s Republic of China; 2School of Biomedical Engineering, Third Military Medical University, Chongqing, People’s Republic of China Abstract: Gastric cancer is one of the leading causes of tumor-related deaths in the world. Current treatment options do not satisfy doctors and patients, and new therapies are therefore needed. Cerium oxide nanoparticles (CNPs have been studied as a potential therapeutic approach for treating many diseases. However, their effects on human gastric cancer are currently unknown. Therefore, in this study, we aimed to characterize the effects of CNPs on human gastric cancer cell lines (MKN28 and BGC823. Gastric cancer cells were cocultured with different concentrations of CNPs, and proliferation and migration were measured both in vitro and in vivo. We found that CNPs inhibited the migration of gastric cancer cells when applied at different concentrations, but only a relatively high concentration (10 µg/mL of CNPs suppressed proliferation. Furthermore, we found that CNPs increased the expression of DHX15 and its downstream signaling pathways. We therefore provide evidence showing that CNPs may be a promising approach to suppress malignant activity of gastric cancer by increasing the expression of DHX15. Keywords: cerium oxide nanoparticles, gastric cancer, DHX15, p38

  7. Nuclear structure of even 120-136Ba under the framework of IBM, IVBM and new method (SEF)

    Science.gov (United States)

    Al-Jubbori, Mushtaq A.; Kassim, Huda H.; Sharrad, Fadhil I.; Hossain, I.

    2016-11-01

    The positive and negative-state bands of even-even 120-136Ba nuclei have been studied. The energy levels for the ground-state band of 120-136Ba have been calculated using Interacting Boson Model (IBM), Interacting Vector Boson Model (IVBM) and a new method called Semi-Empirical Formula (SEF). The negative parity band of even-even 120-136Ba isotopes has been also calculated using (IVBM) and (SEF). The γ and β-bands of even-even 120-136Ba isotopes have been calculated using IBM and SEF. The parameters of the best fit to the measured data are determined. The reduced transition probabilities B (E 2) of these nuclei was calculated. The critical points have been determined for 134,136Ba isotopes. The potential energy surfaces for even-even Ba isotopes are studied using the simplified form of Interacting Boson Model (IBM) with an intrinsic coherent state.

  8. Preparation and properties of a cerium-containing hydroxyapatite coating on commercially pure titanium by micro-arc oxidation

    Institute of Scientific and Technical Information of China (English)

    HUANG Yong; WANG Yingjun; NING Chengyun; NAN Kaihui; HAN Yong

    2008-01-01

    A porous cerium-containing hydroxyapatite coating on commercially pure titanium was prepared by micro-arc oxidation (MAO) in an electrolytic solution containing calcium acetate, β-glycerol phosphate disodium salt pentahydrate (β-GP), and cerium nitrate. The thickness, phase, composition morphology, and biocompatibility of the oxide coating were characterized by X-ray diffraction (XRD), electron probe microanalysis (EPMA), scanning electron microscopy (SEM) with energy dispersive X-ray spectrometer (EDS), and cell culture. The thickness of the MAO film is about 15-25μm, and the coating is porous and uneven, without any apparent interface to the titanium substrates. The results of XRD and EDS show that the porous coating is made up of hydroxyapatite (HA) film containing Ce. The favorable osteoblast cell affinity makes the Ce-HA film have a good biocompatibility. The Ce-HA film is expected to have significant medical applications as dental implants and artificial bone joints.

  9. Using EIS to analyse samples of Al-Mg alloy AA5083 treated by thermal activation in cerium salt baths

    Energy Technology Data Exchange (ETDEWEB)

    Bethencourt, M. [Departamento de Ciencia de los Materiales e Ingenieria Metalurgica y Quimica Inorganica, Facultad de Ciencias del Mar y Ambientales, Universidad de Cadiz, Poligono Rio San Pedro s/n, Puerto Real 11510, Cadiz (Spain)], E-mail: manuel.bethencourt@uca.es; Botana, F.J.; Cano, M.J.; Marcos, M.; Sanchez-Amaya, J.M.; Gonzalez-Rovira, L. [Departamento de Ciencia de los Materiales e Ingenieria Metalurgica y Quimica Inorganica, Facultad de Ciencias del Mar y Ambientales, Universidad de Cadiz, Poligono Rio San Pedro s/n, Puerto Real 11510, Cadiz (Spain)

    2008-05-15

    This paper describes a study undertaken of the morphological and anticorrosive characteristics of surface layers formed on the Al-Mg alloy AA5083 from solutions of Ce(III), by means of various heat treatments while immersed in baths of cerium salts. SEM/EDS studies have demonstrated the existence of a heterogeneous layer formed by a film of aluminium oxide/hydroxide on the matrix and a series of dispersed islands of cerium deposited on the cathodic intermetallics. With the object of evaluating the degree of protection provided by the layers formed and of characterising the particular contribution of the electrochemical response of the system in NaCl, the results obtained by means of EIS are presented and discussed.

  10. Ceria nanoparticles vis-à-vis cerium nitrate as corrosion inhibitors for silica-alumina hybrid sol-gel coating

    Science.gov (United States)

    Lakshmi, R. V.; Aruna, S. T.; Sampath, S.

    2017-01-01

    The present work provides a comparative study on the corrosion protection efficiency of defect free sol-gel hybrid coating containing ceria nanoparticles and cerium nitrate ions as corrosion inhibitors. Less explored organically modified alumina-silica hybrid sol-gel coatings are synthesized from 3-glycidoxypropyltrimethoxysilane and aluminium-tri-sec-butoxide. The microemulsion derived nanoparticles and the hybrid coatings are characterized and compared with coatings containing cerium nitrate. Corrosion inhibiting capability is assessed using electrochemical impedance spectroscopy. Scanning Kelvin probe measurements are also conducted on the coatings for identifying the apparent corrosion prone regions. Detailed X-ray photoelectron spectroscopy (XPS) analysis is carried out to comprehend the bonding and corrosion protection rendered by the hybrid coatings.

  11. Spectral tunability of cerium photoluminescence in nano sized LaF{sub 3}:Ce{sup 3+}

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, T. K.; Suriyamurthy, N., E-mail: igcarsuri@yahoo.com; Panigrahi, B. S.; Venkatraman, B. [Indira Gandhi Centre for Atomic Research, Kalpakkam – 603 102 (India); Sukumar, A. A. [CCCM, Bhabha Atomic Research Centre, Hyderabad (India)

    2015-06-24

    Nano sized LaF{sub 3}:Ce{sup 3+} was synthesized by adopting co-precipitation technique with nominal composition as well as with different molar ratio of reactants La{sup 3+} (Lanthanum) and F{sup −} (Fluoride). All the samples were subjected to X-ray diffraction (XRD), XRF, UV-Vis absorption, and PL characterizations. XRD analysis did not reveal any significant change in the diffraction profile. Particle size variations were observed with respect to change in lanthanum to fluoride molar ratio. An interesting and intense photoluminescence excitation peaks were observed for the samples prepared non-stoichiometrically. The effect of varying nominal reactant composition demonstrates a possibility of introducing tunability in cerium emission in the same host. Life time of cerium has been measured to be in the order of nano seconds.

  12. Adsorption kinetics of NO on ordered mesoporous carbon (OMC) and cerium-containing OMC (Ce-OMC)

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Jinghuan; Cao, Feifei; Chen, Songze; Ni, Mingjiang; Gao, Xiang, E-mail: xgao1@zju.edu.cn; Cen, Kefa

    2014-10-30

    Graphical abstract: - Highlights: • Ordered mesoporous carbon (OMC) and Ce-OMC were used for NO adsorption. • The NO adsorption capacity of OMC was two times larger than that of activated carbon. • With the addition of cerium both adsorption capacity and adsorption rate increased. • The pseudo-second-order model was the most suitable model for NO adsorption on OMC. • Intraparticle diffusion was the rate controlling step for NO adsorption. - Abstract: Ordered mesoporous carbon (OMC) and cerium-containing OMC (Ce-OMC) were prepared using evaporation-induced self-assembly (EISA) method and used to adsorb NO. N{sub 2} sorption, X-ray diffraction (XRD) and transmission electron microscopy (TEM) were used to confirm their structures. The results showed that the ordered and uniform structures were successfully synthesized and with the introduction of cerium pore properties were not significantly changed. The NO adsorption capacity of OMC was two times larger than that of activated carbon (AC). With the introduction of cerium both the adsorption capacity and the adsorption rate were improved. The effects of residence time and oxygen concentration on NO adsorption were also investigated. Oxygen played an important role in the NO adsorption (especially in the form of chemisorption) and residence time had small influence on the NO adsorption capacity. The NO adsorption kinetics was analyzed using pseudo-first-order, pseudo-second-order, Elovich equation and intraparticle diffusion models. The results indicated that the NO adsorption process can be divided into rapid adsorption period, slow adsorption period, and equilibrium adsorption period. The pseudo-second-order model was the most suitable model for NO adsorption on OMC and Ce-OMC. The rate controlling step was the intraparticle diffusion together with the adsorption reaction.

  13. The biological effects of subacute inhalation of diesel exhaust following addition of cerium oxide nanoparticles in atherosclerosis-prone mice

    Energy Technology Data Exchange (ETDEWEB)

    Cassee, Flemming R., E-mail: flemming.cassee@rivm.nl [National Institute for Public Health and the Environment, PO box 1, 3720 BA Bilthoven (Netherlands); Campbell, Arezoo, E-mail: acampbell@westernu.edu [Western University of Health Sciences, Pomona, CA (United States); Boere, A. John F., E-mail: john.boere@rivm.nl [National Institute for Public Health and the Environment, PO box 1, 3720 BA Bilthoven (Netherlands); McLean, Steven G., E-mail: smclean1@staffmail.ed.ac.uk [BHF/University Centre for Cardiovascular Sciences, University of Edinburgh, Edinburgh (United Kingdom); Duffin, Rodger, E-mail: Rodger.Duffin@ed.ac.uk [MRC Centre for Inflammation Research, University of Edinburgh, Edinburgh (United Kingdom); Krystek, Petra, E-mail: petra.krystek@philips.com [Philips Innovation Services, Eindhoven (Netherlands); Gosens, Ilse, E-mail: Ilse.gosens@rivm.nl [National Institute for Public Health and the Environment, PO box 1, 3720 BA Bilthoven (Netherlands); Miller, Mark R., E-mail: Mark.Miller@ed.ac.uk [BHF/University Centre for Cardiovascular Sciences, University of Edinburgh, Edinburgh (United Kingdom)

    2012-05-15

    Background: Cerium oxide (CeO{sub 2}) nanoparticles improve the burning efficiency of fuel, however, little is known about health impacts of altered emissions from the vehicles. Methods: Atherosclerosis-prone apolipoprotein E knockout (ApoE{sup -/-}) mice were exposed by inhalation to diluted exhaust (1.7 mg/m{sup 3}, 20, 60 or 180 min, 5 day/week, for 4 weeks), from an engine using standard diesel fuel (DE) or the same diesel fuel containing 9 ppm cerium oxide nanoparticles (DCeE). Changes in hematological indices, clinical chemistry, atherosclerotic burden, tissue levels of inflammatory cytokines and pathology of the major organs were assessed. Results: Addition of CeO{sub 2} to fuel resulted in a reduction of the number (30%) and surface area (10%) of the particles in the exhaust, whereas the gaseous co-pollutants were increased (6-8%). There was, however, a trend towards an increased size and complexity of the atherosclerotic plaques following DE exposure, which was not evident in the DCeE group. There were no clear signs of altered hematological or pathological changes induced by either treatment. However, levels of proinflammatory cytokines were modulated in a brain region and liver following DCeE exposure. Conclusions: These results imply that addition of CeO{sub 2} nanoparticles to fuel decreases the number of particles in exhaust and may reduce atherosclerotic burden associated with exposure to standard diesel fuel. From the extensive assessment of biological parameters performed, the only concerning effect of cerium addition was a slightly raised level of cytokines in a region of the central nervous system. Overall, the use of cerium as a fuel additive may be a potentially useful way to limit the health effects of vehicle exhaust. However, further testing is required to ensure that such an approach is not associated with a chronic inflammatory response which may eventually cause long-term health effects.

  14. Mixtures of room temperature ionic liquid/ethanol solutions as electrolytic media for cerium oxide thin layer electrodeposition

    Energy Technology Data Exchange (ETDEWEB)

    Lair, V., E-mail: virginie-lair@chimie-paristech.f [Laboratoire d' Electrochimie, Chimie des Interfaces et Modelisation pour l' Energie, LECIME, CNRS UMR 7575-Chimie Paristech (ENSCP)-Paris, 11, rue Pierre et Marie Curie, 75231 Paris Cedex 05 (France); Sirieix-Plenet, J.; Gaillon, L.; Rizzi, C. [UPMC University Paris 06, UMR 7195, Laboratoire de Physicochimie des Electrolytes, Colloides et Sciences Analytiques (PECSA), F-75005 Paris (France); CNRS, UMR 7195, PECSA, F-75005 Paris (France); ESPCI, UMR 7195, PECSA, F-75005 Paris (France); Ringuede, A. [Laboratoire d' Electrochimie, Chimie des Interfaces et Modelisation pour l' Energie, LECIME, CNRS UMR 7575-Chimie Paristech (ENSCP)-Paris, 11, rue Pierre et Marie Curie, 75231 Paris Cedex 05 (France)

    2010-12-30

    A cerium oxide thin layer was electrodeposited onto stainless steel, using mixed room temperature ionic liquid (the 1-methyl-3-butylimidazolium bis(trifluoromethyl sulfonyl)imide)/ethanol solutions, as electrolytic medium. The hydrophobic ionic liquid content is one of the main parameters in the morphology control influencing the ceria growth rate and crystallinity. Micro-nano structural properties and electrical behaviour are presented, using XRD, SEM/EDS and impedance spectroscopy, as a function of electrodeposition conditions.

  15. Cerium-modified doped strontium titanate compositions for solid oxide fuel cell anodes and electrodes for other electrochemical devices

    Science.gov (United States)

    Marina, Olga A [Richland, WA; Stevenson, Jeffry W [Richland, WA

    2010-03-02

    The present invention provides novel compositions that find advantageous use in making electrodes for electrochemical cells and electrochemical devices such as solid oxide fuel cells, electrolyzers, sensors, pumps and the like, the compositions comprising cerium-modified doped strontium titanate. The invention also provides novel methods for making and using anode material compositions and solid oxide fuel cells and solid oxide fuel cell assemblies having anodes comprising the compositions.

  16. Study on corrosion resistance of the BTESPT silane cooperating with rare earth cerium on the surface of aluminum-tube

    Institute of Scientific and Technical Information of China (English)

    肖围; 满瑞林; 缪畅; 彭天兰

    2010-01-01

    Bis-3-(triethoxysilyl)propyltetrasulfide(BTESPT) silane-rare earth cerium composite coatings on aluminum-tube were prepared at 60 °C by immersion method.The performance of composite coatings to protect the aluminum-tube against corrosion was investigated with potentiodynamic polarization curves,electrochemical impedance spectroscopy(EIS),and salt spray test(SST).The results of potentiodynamic polarization curves and EIS indicated that the self-corrosion current decreased by two orders of magnitude and the i...

  17. Cerium(Ⅳ) ammonium nitrate catalysed facile and efficient synthesis of polyhydroquinoline derivatives through Hantzsch multicomponent condensation

    Institute of Scientific and Technical Information of China (English)

    Cherkupally Sanjeeva Reddy; Mekala Raghu

    2008-01-01

    A general and convenient practical approach for the synthesis of polyhydroquinoline derivatives has been achieved via one-pot four-component Hantzsch condensation of aromatic aldehydes,dimedone,ethyl acetoacetate and ammonium acetate in the presence of a catalytic amount of cerium(Ⅳ) ammonium nitrate (CAN),in ethanol solvent at ambient temperature.Simple work-up,mild reaction conditions,inexpensive and non-toxic catalyst,and excellent product yields are the advantageous features of this method.

  18. Preparation and Defluorination Performance of Activated Cerium(IV) Oxide/SiMCM-41 Adsorbent in Water.

    Science.gov (United States)

    Xu, Ying-Ming; Ning, An-Rong; Zhao, Jing

    2001-03-01

    By using the wetness impregnation-coprecipitation method, a new adsorbent, cerium(IV) oxide coated on SiMCM-41 ((Ce)SiMCM-41), was prepared for removal of fluoride ions from water. Factors investigated were number of impregnations, Ce/Si ratios, concentrations of F(-) ions, pH values, and calcination temperatures. The dynamics, isotherms, and mechanism of adsorption of F(-) ions were discussed. Copyright 2001 Academic Press.

  19. Nuclear matrix element for two neutrino double beta decay from 136Xe

    CERN Document Server

    Ejiri, Hiroyasu

    2012-01-01

    The nuclear matrix element for the two neutrino double beta decay (DBD) of 136Xe was evaluated by FSQP (Fermi Surface Quasi Particle model), where experimental GT strengths measured by the charge exchange reaction and those by the beta decay rates were used. The 2 neutrino DBD matrix element is given by the sum of products of the single beta matrix elements via low-lying (Fermi Surface) quasi-particle states in the intermediate nucleus. 136Xe is the semi-magic nucleus with the closed neutron-shell, and the beta + transitions are almost blocked. Thus the 2 neutrino DBD is much suppressed. The evaluated 2 neutrino DBD matrix element is consistent with the observed value.

  20. Adsorption kinetics of NO on ordered mesoporous carbon (OMC) and cerium-containing OMC (Ce-OMC)

    Science.gov (United States)

    Chen, Jinghuan; Cao, Feifei; Chen, Songze; Ni, Mingjiang; Gao, Xiang; Cen, Kefa

    2014-10-01

    Ordered mesoporous carbon (OMC) and cerium-containing OMC (Ce-OMC) were prepared using evaporation-induced self-assembly (EISA) method and used to adsorb NO. N2 sorption, X-ray diffraction (XRD) and transmission electron microscopy (TEM) were used to confirm their structures. The results showed that the ordered and uniform structures were successfully synthesized and with the introduction of cerium pore properties were not significantly changed. The NO adsorption capacity of OMC was two times larger than that of activated carbon (AC). With the introduction of cerium both the adsorption capacity and the adsorption rate were improved. The effects of residence time and oxygen concentration on NO adsorption were also investigated. Oxygen played an important role in the NO adsorption (especially in the form of chemisorption) and residence time had small influence on the NO adsorption capacity. The NO adsorption kinetics was analyzed using pseudo-first-order, pseudo-second-order, Elovich equation and intraparticle diffusion models. The results indicated that the NO adsorption process can be divided into rapid adsorption period, slow adsorption period, and equilibrium adsorption period. The pseudo-second-order model was the most suitable model for NO adsorption on OMC and Ce-OMC. The rate controlling step was the intraparticle diffusion together with the adsorption reaction.