WorldWideScience

Sample records for cerevisiae ribosome affect

  1. Heterologous production of non-ribosomal peptide LLD-ACV in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; Chen, Xiao; Huang, Le;

    2009-01-01

    Non-ribosomal peptides (NRPs) are a diverse family of secondary metabolites with a broad range of biological activities. We started to develop an eukaryotic microbial platform based on the yeast Saccharomyces cerevisiae for heterologous production of NRPs using δ-(l-α-aminoadipyl)–l-cysteinyl–d-v...

  2. “Silencing the ribosomal locus of Saccharomyces cerevisiae: role of RNA polymerase I transcription and chromatin acetylation”

    OpenAIRE

    Cesarini, Elisa

    2011-01-01

    During my PhD I investigated the transcriptional silencing occurring at the ribosomal DNA of Saccharomyces cerevisiae. In yeast the ribosomal locus (rDNA) is transcribed with high efficiency by RNA polymerase I (Pol I) and III to synthetize ribosomal RNAs. It has been discovered that RNA polymerase Pol II (Pol II) can also transcribe the ribosomal locus, at low level, starting from cryptic promoters and generating non coding RNAs (ncRNAs). ncRNA transcription leads to genome...

  3. Similarity between the association factor of ribosomal subunits and the protein Stm1p from Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Heriberto Correia

    2004-11-01

    Full Text Available A ribosome association factor (AF was isolated from the yeast Sacchharomyces cerevisiae. Partial amino acid sequence of AF was determined from its fragment of 25 kDa isolated by treating AF with 2-(2-nitrophenylsulfenyl-3-methyl-3'-Bromoindolenine (BNPS-skatole. This sequence has a 86% identity to the product of the single-copy S. cerevisiae STM1 gene that is apparently involved in several events like binding to quadruplex and triplex nucleic acids and participating in apoptosis, stability of telomere structures, cell cycle, and ribosomal function. Here we show that AF and Stm1p share some characteristics: both bind to quadruplex and Pu triplex DNA, associates ribosomal subunits, and are thermostable. These observations suggest that these polypeptides belong to a family of proteins that may have roles in the translation process.

  4. TORC1 and TORC2 work together to regulate ribosomal protein S6 phosphorylation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Yerlikaya, Seda; Meusburger, Madeleine; Kumari, Romika; Huber, Alexandre; Anrather, Dorothea; Costanzo, Michael; Boone, Charles; Ammerer, Gustav; Baranov, Pavel V; Loewith, Robbie

    2016-01-15

    Nutrient-sensitive phosphorylation of the S6 protein of the 40S subunit of the eukaryote ribosome is highly conserved. However, despite four decades of research, the functional consequences of this modification remain unknown. Revisiting this enigma in Saccharomyces cerevisiae, we found that the regulation of Rps6 phosphorylation on Ser-232 and Ser-233 is mediated by both TOR complex 1 (TORC1) and TORC2. TORC1 regulates phosphorylation of both sites via the poorly characterized AGC-family kinase Ypk3 and the PP1 phosphatase Glc7, whereas TORC2 regulates phosphorylation of only the N-terminal phosphosite via Ypk1. Cells expressing a nonphosphorylatable variant of Rps6 display a reduced growth rate and a 40S biogenesis defect, but these phenotypes are not observed in cells in which Rps6 kinase activity is compromised. Furthermore, using polysome profiling and ribosome profiling, we failed to uncover a role of Rps6 phosphorylation in either global translation or translation of individual mRNAs. Taking the results together, this work depicts the signaling cascades orchestrating Rps6 phosphorylation in budding yeast, challenges the notion that Rps6 phosphorylation plays a role in translation, and demonstrates that observations made with Rps6 knock-ins must be interpreted cautiously. PMID:26582391

  5. Defects in Protein Folding Machinery Affect Cell Wall Integrity and Reduce Ethanol Tolerance in S. cerevisiae.

    Science.gov (United States)

    Narayanan, Aswathy; Pullepu, Dileep; Reddy, Praveen Kumar; Uddin, Wasim; Kabir, M Anaul

    2016-07-01

    The chaperonin complex CCT/TRiC (chaperonin containing TCP-1/TCP-1 ring complex) participates in the folding of many crucial proteins including actin and tubulin in eukaryotes. Mutations in genes encoding its subunits can affect protein folding and in turn, the physiology of the organism. Stress response in Saccharomyces cerevisiae is important in fermentation reactions and operates through overexpression and underexpression of genes, thus altering the protein profile. Defective protein folding machinery can disturb this process. In this study, the response of cct mutants to stress conditions in general and ethanol in specific was investigated. CCT1 mutants showed decreased resistance to different conditions tested including osmotic stress, metal ions, surfactants, reducing and oxidising agents. Cct1-3 mutant with the mutation in the conserved ATP-binding region showed irreversible defects than other mutants. These mutants were found to have inherent cell wall defects and showed decreased ethanol tolerance. This study reveals that cell wall defects and ethanol sensitivity are linked. Genetic and proteomic analyses showed that the yeast genes RPS6A (ribosomal protein), SCL1 (proteasomal subunit) and TDH3 (glyceraldehyde-3-phosphate dehydrogenase) on overexpression, improved the growth of cct1-3 mutant on ethanol. We propose the breakdown of common stress response pathways caused by mutations in CCT complex and the resulting scarcity of functional stress-responsive proteins, affecting the cell's defence against different stress agents in cct mutants. Defective cytoskeleton and perturbed cell wall integrity reduce the ethanol tolerance in the mutants which are rescued by the extragenic suppressors. PMID:26992923

  6. Adjustable under-expression of yeast mating pathway proteins in Saccharomyces cerevisiae using a programmed ribosomal frameshift.

    Science.gov (United States)

    Choi, Min-Yeon; Park, Sang-Hyun

    2016-06-01

    Experimental research in molecular biology frequently relies on the promotion or suppression of gene expression, an important tool in the study of its functions. Although yeast is among the most studied model systems with the ease of maintenance and manipulation, current experimental methods are mostly limited to gene deletion, suppression or overexpression of genes. Therefore, the ability to reduce protein expressions and then observing the effects would promote a better understanding of the exact functions and their interactions. Reducing protein expression is mainly limited by the difficulties associated with controlling the reduction level, and in some cases, the initial endogenous abundance is too low. For the under-expression to be useful as an experimental tool, repeatability and stability of reduced expression is important. We found that cis-elements in programmed -1 ribosomal frameshifting (-1RFS) of beet western yellow virus (BWYV) could be utilized to reduced protein expression in Saccharomyces cerevisiae. The two main advantages of using -1RFS are adjustable reduction rates and ease of use. To demonstrate the utility of this under-expression system, examples of reduced protein abundance were shown using yeast mating pathway components. The abundance of MAP kinase Fus3 was reduced to approximately 28-75 % of the wild-type value. Other MAP kinase mating pathway components, including Ste5, Ste11, and Ste7, were also under-expressed to verify that the -1RFS system works with different proteins. Furthermore, reduced Fus3 abundance altered the overall signal transduction outcome of the mating pathway, demonstrating the potential for further studies of signal transduction adjustment via under-expression. PMID:26837218

  7. Conserved codon composition of ribosomal protein coding genes in Escherichia coli, Mycobacterium tuberculosis and Saccharomyces cerevisiae: lessons from supervised machine learning in functional genomics.

    Science.gov (United States)

    Lin, Kui; Kuang, Yuyu; Joseph, Jeremiah S; Kolatkar, Prasanna R

    2002-06-01

    Genomics projects have resulted in a flood of sequence data. Functional annotation currently relies almost exclusively on inter-species sequence comparison and is restricted in cases of limited data from related species and widely divergent sequences with no known homologs. Here, we demonstrate that codon composition, a fusion of codon usage bias and amino acid composition signals, can accurately discriminate, in the absence of sequence homology information, cytoplasmic ribosomal protein genes from all other genes of known function in Saccharomyces cerevisiae, Escherichia coli and Mycobacterium tuberculosis using an implementation of support vector machines, SVM(light). Analysis of these codon composition signals is instructive in determining features that confer individuality to ribosomal protein genes. Each of the sets of positively charged, negatively charged and small hydrophobic residues, as well as codon bias, contribute to their distinctive codon composition profile. The representation of all these signals is sensitively detected, combined and augmented by the SVMs to perform an accurate classification. Of special mention is an obvious outlier, yeast gene RPL22B, highly homologous to RPL22A but employing very different codon usage, perhaps indicating a non-ribosomal function. Finally, we propose that codon composition be used in combination with other attributes in gene/protein classification by supervised machine learning algorithms. PMID:12034849

  8. L-carnosine affects the growth of Saccharomyces cerevisiae in a metabolism-dependent manner.

    Directory of Open Access Journals (Sweden)

    Stephanie P Cartwright

    Full Text Available The dipeptide L-carnosine (β-alanyl-L-histidine has been described as enigmatic: it inhibits growth of cancer cells but delays senescence in cultured human fibroblasts and extends the lifespan of male fruit flies. In an attempt to understand these observations, the effects of L-carnosine on the model eukaryote, Saccharomyces cerevisiae, were examined on account of its unique metabolic properties; S. cerevisiae can respire aerobically, but like some tumor cells, it can also exhibit a metabolism in which aerobic respiration is down regulated. L-Carnosine exhibited both inhibitory and stimulatory effects on yeast cells, dependent upon the carbon source in the growth medium. When yeast cells were not reliant on oxidative phosphorylation for energy generation (e.g. when grown on a fermentable carbon source such as 2% glucose, 10-30 mM L-carnosine slowed growth rates in a dose-dependent manner and increased cell death by up to 17%. In contrast, in media containing a non-fermentable carbon source in which yeast are dependent on aerobic respiration (e.g. 2% glycerol, L-carnosine did not provoke cell death. This latter observation was confirmed in the respiratory yeast, Pichia pastoris. Moreover, when deletion strains in the yeast nutrient-sensing pathway were treated with L-carnosine, the cells showed resistance to its inhibitory effects. These findings suggest that L-carnosine affects cells in a metabolism-dependent manner and provide a rationale for its effects on different cell types.

  9. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    Science.gov (United States)

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  10. Conserved codon composition of ribosomal protein coding genes in Escherichia coli, Mycobacterium tuberculosis and Saccharomyces cerevisiae: lessons from supervised machine learning in functional genomics

    OpenAIRE

    Lin, Kui; Kuang, Yuyu; Joseph, Jeremiah S.; Kolatkar, Prasanna R

    2002-01-01

    Genomics projects have resulted in a flood of sequence data. Functional annotation currently relies almost exclusively on inter-species sequence comparison and is restricted in cases of limited data from related species and widely divergent sequences with no known homologs. Here, we demonstrate that codon composition, a fusion of codon usage bias and amino acid composition signals, can accurately discriminate, in the absence of sequence homology information, cytoplasmic ribosomal protein gene...

  11. Oxygen availability strongly affects chronological lifespan and thermotolerance in batch cultures of Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Markus M.M. Bisschops

    2015-10-01

    Full Text Available Stationary-phase (SP batch cultures of Saccharomyces cerevisiae, in which growth has been arrested by carbon-source depletion, are widely applied to study chronological lifespan, quiescence and SP-associated robustness. Based on this type of experiments, typically performed under aerobic conditions, several roles of oxygen in aging have been proposed. However, SP in anaerobic yeast cultures has not been investigated in detail. Here, we use the unique capability of S. cerevisiae to grow in the complete absence of oxygen to directly compare SP in aerobic and anaerobic bioreactor cultures. This comparison revealed strong positive effects of oxygen availability on adenylate energy charge, longevity and thermotolerance during SP. A low thermotolerance of anaerobic batch cultures was already evident during the exponential growth phase and, in contrast to the situation in aerobic cultures, was not substantially increased during transition into SP. A combination of physiological and transcriptome analysis showed that the slow post-diauxic growth phase on ethanol, which precedes SP in aerobic, but not in anaerobic cultures, endowed cells with the time and resources needed for inducing longevity and thermotolerance. When combined with literature data on acquisition of longevity and thermotolerance in retentostat cultures, the present study indicates that the fast transition from glucose excess to SP in anaerobic cultures precludes acquisition of longevity and thermotolerance. Moreover, this study demonstrates the importance of a preceding, calorie-restricted conditioning phase in the acquisition of longevity and stress tolerance in SP yeast cultures, irrespective of oxygen availability.

  12. A genome-wide deletion mutant screen identifies pathways affected by nickel sulfate in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Dai Wei

    2009-11-01

    Full Text Available Abstract Background The understanding of the biological function, regulation, and cellular interactions of the yeast genome and proteome, along with the high conservation in gene function found between yeast genes and their human homologues, has allowed for Saccharomyces cerevisiae to be used as a model organism to deduce biological processes in human cells. Here, we have completed a systematic screen of the entire set of 4,733 haploid S. cerevisiae gene deletion strains (the entire set of nonessential genes for this organism to identify gene products that modulate cellular toxicity to nickel sulfate (NiSO4. Results We have identified 149 genes whose gene deletion causes sensitivity to NiSO4 and 119 genes whose gene deletion confers resistance. Pathways analysis with proteins whose absence renders cells sensitive and resistant to nickel identified a wide range of cellular processes engaged in the toxicity of S. cerevisiae to NiSO4. Functional categories overrepresented with proteins whose absence renders cells sensitive to NiSO4 include homeostasis of protons, cation transport, transport ATPases, endocytosis, siderophore-iron transport, homeostasis of metal ions, and the diphthamide biosynthesis pathway. Functional categories overrepresented with proteins whose absence renders cells resistant to nickel include functioning and transport of the vacuole and lysosome, protein targeting, sorting, and translocation, intra-Golgi transport, regulation of C-compound and carbohydrate metabolism, transcriptional repression, and chromosome segregation/division. Interactome analysis mapped seven nickel toxicity modulating and ten nickel-resistance networks. Additionally, we studied the degree of sensitivity or resistance of the 111 nickel-sensitive and 72 -resistant strains whose gene deletion product has a similar protein in human cells. Conclusion We have undertaken a whole genome approach in order to further understand the mechanism(s regulating the cell

  13. Poly purine.pyrimidine sequences upstream of the beta-galactosidase gene affect gene expression in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Brahmachari Samir K

    2001-10-01

    Full Text Available Abstract Background Poly purine.pyrimidine sequences have the potential to adopt intramolecular triplex structures and are overrepresented upstream of genes in eukaryotes. These sequences may regulate gene expression by modulating the interaction of transcription factors with DNA sequences upstream of genes. Results A poly purine.pyrimidine sequence with the potential to adopt an intramolecular triplex DNA structure was designed. The sequence was inserted within a nucleosome positioned upstream of the β-galactosidase gene in yeast, Saccharomyces cerevisiae, between the cycl promoter and gal 10Upstream Activating Sequences (UASg. Upon derepression with galactose, β-galactosidase gene expression is reduced 12-fold in cells carrying single copy poly purine.pyrimidine sequences. This reduction in expression is correlated with reduced transcription. Furthermore, we show that plasmids carrying a poly purine.pyrimidine sequence are not specifically lost from yeast cells. Conclusion We propose that a poly purine.pyrimidine sequence upstream of a gene affects transcription. Plasmids carrying this sequence are not specifically lost from cells and thus no additional effort is needed for the replication of these sequences in eukaryotic cells.

  14. Antifungal canthin-6-one series accumulate in lipid droplets and affect fatty acid metabolism in Saccharomyces cerevisiae

    OpenAIRE

    Lagoutte, D.; Nicolas, V; Poupon, E.; Fournet, Anne; Hocquemiller, R.; Libong, D.; Chaminade, P.; Loiseau, P.M.

    2008-01-01

    The mechanism of action of antifungal canthin-6-one series was investigated in Saccharomyces cerevisiae. After a rapid uptake, a preferential accumulation of the drug within lipid droplets was observed. The antifungal action of canthin-6-one was found as reversible. Canthin-6-one did not exhibit affinity for sterols, and membrane ergosterol was not necessary for the antifungal activity since the MICs were similar on an ergosterol-deleted and the wild-type S. cerevisiae clones. Relative amount...

  15. RPG: the Ribosomal Protein Gene database

    OpenAIRE

    Nakao, Akihiro; Yoshihama, Maki; Kenmochi, Naoya

    2004-01-01

    RPG (http://ribosome.miyazaki-med.ac.jp/) is a new database that provides detailed information about ribosomal protein (RP) genes. It contains data from humans and other organisms, including Drosophila melanogaster, Caenorhabditis elegans, Saccharo myces cerevisiae, Methanococcus jannaschii and Escherichia coli. Users can search the database by gene name and organism. Each record includes sequences (genomic, cDNA and amino acid sequences), intron/exon structures, genomic locations and informa...

  16. Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Bojsen, Rasmus K; Andersen, Kaj Scherz; Regenberg, Birgitte

    2012-01-01

    Microbial biofilms can be defined as multi-cellular aggregates adhering to a surface and embedded in an extracellular matrix (ECM). The nonpathogenic yeast, Saccharomyces cerevisiae, follows the common traits of microbial biofilms with cell-cell and cell-surface adhesion. S. cerevisiae is shown t...... cues, cell-to-cell variation and niches in S. cerevisiae biofilm. Being closely related to Candida species, S. cerevisiae is a model to investigate biofilms of pathogenic yeast....

  17. ppGpp negatively impacts ribosome assembly affecting growth and antimicrobial tolerance in Gram-positive bacteria.

    Science.gov (United States)

    Corrigan, Rebecca M; Bellows, Lauren E; Wood, Alison; Gründling, Angelika

    2016-03-22

    The stringent response is a survival mechanism used by bacteria to deal with stress. It is coordinated by the nucleotides guanosine tetraphosphate and pentaphosphate [(p)ppGpp], which interact with target proteins to promote bacterial survival. Although this response has been well characterized in proteobacteria, very little is known about the effectors of this signaling system in Gram-positive species. Here, we report on the identification of seven target proteins for the stringent response nucleotides in the Gram-positive bacteriumStaphylococcus aureus We demonstrate that the GTP synthesis enzymes HprT and Gmk bind with a high affinity, leading to an inhibition of GTP production. In addition, we identified five putative GTPases-RsgA, RbgA, Era, HflX, and ObgE-as (p)ppGpp target proteins. We show that RsgA, RbgA, Era, and HflX are functional GTPases and that their activity is promoted in the presence of ribosomes but strongly inhibited by the stringent response nucleotides. By characterizing the function of RsgA in vivo, we ascertain that this protein is involved in ribosome assembly, with anrsgAdeletion strain, or a strain inactivated for GTPase activity, displaying decreased growth, a decrease in the amount of mature 70S ribosomes, and an increased level of tolerance to antimicrobials. We additionally demonstrate that the interaction of ppGpp with cellular GTPases is not unique to the staphylococci, as homologs fromBacillus subtilisandEnterococcus faecalisretain this ability. Taken together, this study reveals ribosome inactivation as a previously unidentified mechanism through which the stringent response functions in Gram-positive bacteria. PMID:26951678

  18. Identity of the Growth-Limiting Nutrient Strongly Affects Storage Carbohydrate Accumulation in Anaerobic Chemostat Cultures of Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Hazelwood, L.A.; Walsh, M.C.; Luttik, M.A.H.; Daran-Lapujade, P.; Pronk, J.T.; Daran, J.M.

    2009-01-01

    OA Fund TU Delft Accumulation of glycogen and trehalose in nutrient-limited cultures of Saccharomyces cerevisiae is negatively correlated with the specific growth rate. Additionally, glucose-excess conditions (i.e., growth limitation by nutrients other than glucose) are often implicated in high-lev

  19. Estimates of Soil Bacterial Ribosome Content and Diversity Are Significantly Affected by the Nucleic Acid Extraction Method Employed.

    Science.gov (United States)

    Wüst, Pia K; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf; Overmann, Jörg

    2016-05-01

    Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particularActinobacteriaandProteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137

  20. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan

    2015-08-13

    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  1. Nutrient limitation leads to penetrative growth into agar and affects aroma formation in Pichia fabianii, P. kudriavzevii and Saccharomyces cerevisiae.

    Science.gov (United States)

    van Rijswijck, Irma M H; Dijksterhuis, Jan; Wolkers-Rooijackers, Judith C M; Abee, Tjakko; Smid, Eddy J

    2015-01-01

    Among fermentative yeast species, Saccharomyces cerevisiae is most frequently used as a model organism, although other yeast species may have special features that make them interesting candidates to apply in food-fermentation processes. In this study, we used three yeast species isolated from fermented masau (Ziziphus mauritiana) fruit, S. cerevisiae 131, Pichia fabianii 65 and Pichia kudriavzevii 129, and determined the impact of nitrogen and/or glucose limitation on surface growth mode and the production of volatile organic compounds (VOCs). All three species displayed significant changes in growth mode in all nutrient-limited conditions, signified by the formation of metafilaments or pseudohyphae. The timing of the transition was found to be species-specific. Transition in growth mode is suggested to be linked to the production of certain fusel alcohols, such as phenylethyl alcohol, which serve as quorum-sensing molecules. Interestingly, we did not observe concomitant increased production of phenylethyl alcohol and filamentous growth. Notably, a broader range of esters was found only for the Pichia spp. grown on nitrogen-limited agar for 21 days compared to nutrient-rich agar, and when grown on glucose- and glucose- plus nitrogen-limited agar. Our data suggest that for the Pichia spp., the formation of esters may play an important role in the switch in growth mode upon nitrogen limitation. Further biological or ecological implications of ester formation are discussed. PMID:25308873

  2. Vanillin Inhibits Translation and Induces Messenger Ribonucleoprotein (mRNP) Granule Formation in Saccharomyces cerevisiae: Application and Validation of High-Content, Image-Based Profiling

    OpenAIRE

    Iwaki, Aya; Ohnuki, Shinsuke; Suga, Yohei; Izawa, Shingo; Ohya, Yoshikazu

    2013-01-01

    Vanillin, generated by acid hydrolysis of lignocellulose, acts as a potent inhibitor of the growth of the yeast Saccharomyces cerevisiae. Here, we investigated the cellular processes affected by vanillin using high-content, image-based profiling. Among 4,718 non-essential yeast deletion mutants, the morphology of those defective in the large ribosomal subunit showed significant similarity to that of vanillin-treated cells. The defects in these mutants were clustered in three domains of the ri...

  3. The xylose reductase/xylitol dehydrogenase/xylulokinase ratio affects product formation in recombinant xylose-utilising Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Eliasson, Anna; Hofmeyr, J.H.S.; Pedler, S.;

    2001-01-01

    Data simulations based on a kinetic model implied that under simplified simulation conditions a 1:greater than or equal to 10:greater than or equal to4 relation of the xylose reductase (XR)/xylitol dehydrogenase (XDH)/xylulokinase (XK) ratio was optimal in minimising xylitol formation during xylose...... utilisation in yeast. The steady-state level of the intermediary xylitol depended also, to a great extent, on the NADH and NAD(+) concentrations. Anaerobic xylose utilisation was investigated for three different recombinant. XR-, XDH- and XK-expressing Saccharomyces cerevisiae strains, TMB 3002, TMB 3003 and...... TMB 3004, to verify the model predictions. Overexpression of XK was found to be necessary for ethanol formation from xylose. Furthermore, the xylitol formation decreased with decreasing XR/XDH ratio, while the ethanol formation increased. Of the three strains, TMB 3004, which was the strain with a XR...

  4. The xylose reductase/xylitol dehydrogenase/xylulokinase ratio affects product formation in recombinant xylose-utilising Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Eliasson, Anna; Hofmeyr, J.H.S.; Pedler, S.; Hahn-Hagerdal, B.

    Data simulations based on a kinetic model implied that under simplified simulation conditions a 1:greater than or equal to 10:greater than or equal to4 relation of the xylose reductase (XR)/xylitol dehydrogenase (XDH)/xylulokinase (XK) ratio was optimal in minimising xylitol formation during xylose...... utilisation in yeast. The steady-state level of the intermediary xylitol depended also, to a great extent, on the NADH and NAD(+) concentrations. Anaerobic xylose utilisation was investigated for three different recombinant. XR-, XDH- and XK-expressing Saccharomyces cerevisiae strains, TMB 3002, TMB 3003 and...... TMB 3004, to verify the model predictions. Overexpression of XK was found to be necessary for ethanol formation from xylose. Furthermore, the xylitol formation decreased with decreasing XR/XDH ratio, while the ethanol formation increased. Of the three strains, TMB 3004, which was the strain with a XR...

  5. Interrelationships between yeast ribosomal protein assembly events and transient ribosome biogenesis factors interactions in early pre-ribosomes.

    Directory of Open Access Journals (Sweden)

    Steffen Jakob

    Full Text Available Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA. Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins and ribosome precursors (pre-ribosomes are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains.

  6. 2-DE based proteomic analysis of Saccharomyces cerevisiae wild and K+ transport-affected mutant (trk1,2) strains at the growth exponential and stationary phases

    Czech Academy of Sciences Publication Activity Database

    Curto, M.; Valledor, L.; Navarrete, C.; Gutiérrez, D.; Sychrová, Hana; Ramos, J.; Jorrin, J.

    2010-01-01

    Roč. 73, č. 12 (2010), s. 2316-2335. ISSN 1874-3919 Institutional research plan: CEZ:AV0Z50110509 Keywords : potassium starvation * S. cerevisiae * proteom Subject RIV: CE - Biochemistry Impact factor: 5.074, year: 2010

  7. Abiotic Stress Resistance, a Novel Moonlighting Function of Ribosomal Protein RPL44 in the Halophilic Fungus Aspergillus glaucus

    OpenAIRE

    LIU, XIAO-DAN; Xie, Lixia; Wei, Yi; Zhou, Xiaoyang; Jia, Baolei; Liu, Jinliang; Zhang, Shihong

    2014-01-01

    Ribosomal proteins are highly conserved components of basal cellular organelles, primarily involved in the translation of mRNA leading to protein synthesis. However, certain ribosomal proteins moonlight in the development and differentiation of organisms. In this study, the ribosomal protein L44 (RPL44), associated with salt resistance, was screened from the halophilic fungus Aspergillus glaucus (AgRPL44), and its activity was investigated in Saccharomyces cerevisiae and Nicotiana tabacum. Se...

  8. Changes in the Sterol Composition of the Plasma Membrane Affect Membrane Potential, Salt Tolerance and the Activity of Multidrug Resistance Pumps in Saccharomyces cerevisiae

    Czech Academy of Sciences Publication Activity Database

    Kodedová, Marie; Sychrová, Hana

    2015-01-01

    Roč. 10, č. 9 (2015), e0139306. E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) EE2.3.30.0025; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:67985823 Keywords : Saccharomyces cerevisiae * ergosterol synthesis * multidrug resistance * membrane potential * diS-C3(3) assay Subject RIV: EE - Microbiology, Virology Impact factor: 3.234, year: 2014

  9. Evaluation of Mucor indicus and Saccharomyces cerevisiae capability to ferment hydrolysates of rape straw and Miscanthus giganteus as affected by the pretreatment method.

    Science.gov (United States)

    Lewandowska, Małgorzata; Szymańska, Karolina; Kordala, Natalia; Dąbrowska, Aneta; Bednarski, Włodzimierz; Juszczuk, Andrzej

    2016-07-01

    Rape straw and Miscanthus giganteus was pretreated chemically with oxalic acid or sodium hydroxide. The pretreated substrates were hydrolyzed with enzymatic preparations of cellulase, xylanase and cellobiase. The highest concentration of reducing sugars was achieved after hydrolysis of M. giganteus pretreated with NaOH (51.53gdm(-3)). In turn, the highest yield of enzymatic hydrolysis determined based on polysaccharides content in the pretreated substrates was obtained in the experiments with M. giganteus and oxalic acid (99.3%). Rape straw and M. giganteus hydrolysates were fermented using yeast Saccharomyces cerevisiae 7, NRRL 978 or filamentous fungus Mucor rouxii (Mucor indicus) DSM 1191. The highest ethanol concentration was determined after fermentation of M. giganteus hydrolysate pretreated with NaOH using S. cerevisiae (1.92% v/v). Considering cellulose content in the pretreated solid, the highest degree of its conversion to ethanol (86.2%) was achieved after fermentation of the hydrolysate of acid-treated M. giganteus using S. cerevisiae. PMID:27107482

  10. Immunomodulation by microbial ribosomes

    Directory of Open Access Journals (Sweden)

    W. Domzig

    1987-01-01

    Full Text Available Over the past twenty years, many authors have reported evidence of the immunoprotective capacity of ribosomes isolated from bacteria, fungi and parasites. Since 1971 we have explored the protective capacity of ribosomes isolated from a large variety of microorganisms responsible for human and animal diseases. More recently, using monoclonal antibodies raised against ribosomes and then selected for their ability to confer passive immunity to mice, we have studied the mechanism of the protection induced by ribosomes. These studies, in parallel with the development of a technology for the large scale production of ribosomes, have allowed us to achieve a new regard for ribosomal vaccines for use in human. The general concept of ribosomal vaccines in presented and examples of two such vaccines are described with data on the specific protection that they induce in mice against experimental infections with Klebsiella peneumoniae, Streptococcus pneumoniae, S. pyogenes and Haemophilus influenzae for the first one, and against Candida albicans type A and type B for the second one. Because of their high immunogenicity and their innocuity these vaccines represent a decisive improvement over classical microbial vaccines.

  11. Ctk1 function is necessary for full translation initiation activity in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Coordes, Britta; Brünger, Katharina M; Burger, Kaspar;

    2015-01-01

    Translation is a fundamental and highly regulated cellular process. Previously, we reported that the kinase and transcription elongation factor Ctk1 increases fidelity during translation elongation in Saccharomyces cerevisiae. Here, we show that loss of Ctk1 function also affects the initiation...... step of translation. Translation active extracts from Ctk1 depleted cells show impaired translation activity of capped, but not CrPV IRES containing mRNA reporters. Furthermore, the formation of 80S initiation complexes is decreased, which is probably due to reduced subunit joining. In addition, we...... determined the changes in the phosphorylation pattern of a ribosome enriched fraction after depletion of Ctk1. Thus, we provide a catalogue of phosphoproteomic changes dependent on Ctk1. Taken together, our data suggest a stimulatory function of Ctk1 in 80S formation during translation initiation....

  12. Ribosome-inactivating proteins

    OpenAIRE

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M.

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with oth...

  13. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    Directory of Open Access Journals (Sweden)

    Uli Ohmayer

    Full Text Available Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins and ribosomal RNAs (rRNAs. Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs.

  14. The Ribosome Comes Alive

    OpenAIRE

    Frank, Joachim

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as t...

  15. The Ribosome Comes Alive.

    Science.gov (United States)

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  16. Chaperoning ribosome assembly

    OpenAIRE

    Karbstein, Katrin

    2010-01-01

    Chaperones help proteins fold in all cellular compartments, and many associate directly with ribosomes, capturing nascent chains to assist their folding and prevent aggregation. In this issue, new data from Koplin et al. (2010. J. Cell Biol. doi: 10.1083/jcb.200910074) and Albanèse et al. (2010. J. Cell Biol. doi: 10.1083/jcb.201001054) suggest that in addition to promoting protein folding, the chaperones ribosome-associated complex (RAC), nascent chain–associated complex (NAC), and Jjj1 also...

  17. Ribosome recycling induces optimal translation rate at low ribosomal availability

    OpenAIRE

    Marshall, E.; Stansfield, I; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces ...

  18. Ribosome Assembly as Antimicrobial Target.

    Science.gov (United States)

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  19. Structural insights into ribosome translocation.

    Science.gov (United States)

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  20. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    Science.gov (United States)

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  1. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    OpenAIRE

    Prokhorova, Irina V.; Akulich, Kseniya A.; Desislava S. Makeeva; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Gulnara Yusupova; Yusupov, Marat M; Dmitriev, Sergey E

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a ...

  2. Nucleolus: The ribosome factory

    Czech Academy of Sciences Publication Activity Database

    Cmarko, Dušan; Šmigová, J.; Minichová, L.; Popov, Alexey

    2008-01-01

    Roč. 23, č. 10 (2008), s. 1291-1298. ISSN 0213-3911 R&D Projects: GA ČR(CZ) GA304/06/1691 Grant ostatní: Wellcome Trust(XE) 075834/04/Z; GA MŠk(CZ) LC535; GA ČR(CZ) GA304/06/1662 Institutional research plan: CEZ:AV0Z50110509 Keywords : nucleolus * nucleolar architecture * ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.194, year: 2008

  3. Chloroplast ribosomes and protein synthesis.

    OpenAIRE

    Harris, E. H.; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles i...

  4. Influence of organic acids and organochlorinated insecticides on metabolism of Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Pejin Dušanka J.

    2005-01-01

    Full Text Available Saccharomyces cerevisiae is exposed to different stress factors during the production: osmotic, temperature, oxidative. The response to these stresses is the adaptive mechanism of cells. The raw materials Saccharomyces cerevisiae is produced from, contain metabolism products of present microorganisms and protective agents used during the growth of sugar beet for example the influence of acetic and butyric acid and organochlorinated insecticides, lindan and heptachlor, on the metabolism of Saccharomyces cerevisiae was investigated and presented in this work. The mentioned compounds affect negatively the specific growth rate, yield, content of proteins, phosphorus, total ribonucleic acids. These compounds influence the increase of trechalose and glycogen content in the Saccharomyces cerevisiae cells.

  5. Ribosome dynamics and the evolutionary history of ribosomes

    Science.gov (United States)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  6. Ribosome traffic on mRNAs maps to gene ontology: genome-wide quantification of translation initiation rates and polysome size regulation.

    Science.gov (United States)

    Ciandrini, Luca; Stansfield, Ian; Romano, M Carmen

    2013-01-01

    To understand the complex relationship governing transcript abundance and the level of the encoded protein, we integrate genome-wide experimental data of ribosomal density on mRNAs with a novel stochastic model describing ribosome traffic dynamics during translation elongation. This analysis reveals that codon arrangement, rather than simply codon bias, has a key role in determining translational efficiency. It also reveals that translation output is governed both by initiation efficiency and elongation dynamics. By integrating genome-wide experimental data sets with simulation of ribosome traffic on all Saccharomyces cerevisiae ORFs, mRNA-specific translation initiation rates are for the first time estimated across the entire transcriptome. Our analysis identifies different classes of mRNAs characterised by their initiation rates, their ribosome traffic dynamics, and by their response to ribosome availability. Strikingly, this classification based on translational dynamics maps onto key gene ontological classifications, revealing evolutionary optimisation of translation responses to be strongly influenced by gene function. PMID:23382661

  7. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  8. Nucleosome alterations caused by mutations at modifiable histone residues in Saccharomyces cerevisiae

    Science.gov (United States)

    Liu, Hongde; Wang, Pingyan; Liu, Lingjie; Min, Zhu; Luo, Kun; Wan, Yakun

    2015-01-01

    Nucleosome organization exhibits dynamic properties depending on the cell state and environment. Histone proteins, fundamental components of nucleosomes, are subject to chemical modifications on particular residues. We examined the effect of substituting modifiable residues of four core histones with the non-modifiable residue alanine on nucleosome dynamics. We mapped the genome-wide nucleosomes in 22 histone mutants of Saccharomyces cerevisiae and compared the nucleosome alterations relative to the wild-type strain. Our results indicated that different types of histone mutation resulted in different phenotypes and a distinct reorganization of nucleosomes. Nucleosome occupancy was altered at telomeres, but not at centromeres. The first nucleosomes upstream (−1) and downstream (+1) of the transcription start site (TSS) were more dynamic than other nucleosomes. Mutations in histones affected the nucleosome array downstream of the TSS. Highly expressed genes, such as ribosome genes and genes involved in glycolysis, showed increased nucleosome occupancy in many types of histone mutant. In particular, the H3K56A mutant exhibited a high percentage of dynamic genomic regions, decreased nucleosome occupancy at telomeres, increased occupancy at the +1 and −1 nucleosomes, and a slow growth phenotype under stress conditions. Our findings provide insight into the influence of histone mutations on nucleosome dynamics. PMID:26498326

  9. Control of ribosome traffic by position-dependent choice of synonymous codons

    Science.gov (United States)

    Mitarai, Namiko; Pedersen, Steen

    2013-10-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species.

  10. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    Science.gov (United States)

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  11. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    Science.gov (United States)

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  12. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes. PMID:6121796

  13. 21 CFR 866.5785 - Anti-Saccharomyces cerevisiae (S. cerevisiae) antibody (ASCA) test systems.

    Science.gov (United States)

    2010-04-01

    ...) antibody (ASCA) test systems. 866.5785 Section 866.5785 Food and Drugs FOOD AND DRUG ADMINISTRATION... Immunological Test Systems § 866.5785 Anti-Saccharomyces cerevisiae (S. cerevisiae) antibody (ASCA) test systems. (a) Identification. The Anti-Saccharomyces cerevisiae (S. cerevisiae) antibody (ASCA) test system...

  14. Ribosome engineering to promote new crystal forms

    International Nuclear Information System (INIS)

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors

  15. A vaccine grade of yeast Saccharomyces cerevisiae expressing mammalian myostatin

    Directory of Open Access Journals (Sweden)

    Zhang Tingting

    2012-12-01

    Full Text Available Abstract Background Yeast Saccharomyces cerevisiae is a widely-used system for protein expression. We previously showed that heat-killed whole recombinant yeast vaccine expressing mammalian myostatin can modulate myostatin function in mice, resulting in increase of body weight and muscle composition in these animals. Foreign DNA introduced into yeast cells can be lost soon unless cells are continuously cultured in selection media, which usually contain antibiotics. For cost and safety concerns, it is essential to optimize conditions to produce quality food and pharmaceutical products. Results We developed a simple but effective method to engineer a yeast strain stably expressing mammalian myostatin. This method utilized high-copy-number integration of myostatin gene into the ribosomal DNA of Saccharomyces cerevisiae. In the final step, antibiotic selection marker was removed using the Cre-LoxP system to minimize any possible side-effects for animals. The resulting yeast strain can be maintained in rich culture media and stably express mammalian myostatin for two years. Oral administration of the recombinant yeast was able to induce immune response to myostatin and modulated the body weight of mice. Conclusions Establishment of such yeast strain is a step further toward transformation of yeast cells into edible vaccine to improve meat production in farm animals and treat human muscle-wasting diseases in the future.

  16. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    OpenAIRE

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucl...

  17. Ribosome Mechanics Informs about Mechanism.

    Science.gov (United States)

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  18. Determination of the core promoter regions of the Saccharomyces cerevisiae RPS3 gene.

    Science.gov (United States)

    Joo, Yoo Jin; Kim, Jin-Ha; Baek, Joung Hee; Seong, Ki Moon; Lee, Jae Yung; Kim, Joon

    2009-01-01

    Ribosomal protein genes (RPG), which are scattered throughout the genomes of all eukaryotes, are subjected to coordinated expression. In yeast, the expression of RPGs is highly regulated, mainly at the transcriptional level. Recent research has found that many ribosomal proteins (RPs) function in multiple processes in addition to protein synthesis. Therefore, detailed knowledge of promoter architecture as well as gene regulation is important in understanding the multiple cellular processes mediated by RPGs. In this study, we investigated the functional architecture of the yeast RPS3 promoter and identified many putative cis-elements. Using beta-galactosidase reporter analysis and EMSA, the core promoter of RPS3 containing UASrpg and T-rich regions was corroborated. Moreover, the promoter occupancy of RPS3 by three transcription factors was confirmed. Taken together, our results further the current understanding of the promoter architecture and trans-elements of the Saccharomyces cerevisiae RPS3 gene. PMID:19853675

  19. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    OpenAIRE

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G.

    2014-01-01

    eLife digest The production of a protein in a cell starts with a region of DNA being transcribed to produce a molecule of messenger RNA. A large molecular machine called ribosome then reads the information in the messenger RNA molecule to produce a protein. Ribosomes themselves are made of RNA and several different proteins called r-proteins. The construction of a ribosome starts with the assembly of a pre-ribosome inside the cell nucleus, and the ribosome is completed in the cytosol of the c...

  20. Chaperone binding at the ribosomal exit tunnel

    DEFF Research Database (Denmark)

    Kristensen, Ole; Gajhede, Michael

    2003-01-01

    The exit tunnel region of the ribosome is well established as a focal point for interaction between the components that guide the fate of nascent polypeptides. One of these, the chaperone trigger factor (TF), associates with the 50S ribosomal subunit through its N-terminal domain. Targeting of TF...

  1. Biochemical characterization of three mycobacterial ribosomal fractions.

    Science.gov (United States)

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  2. Surface topography of the Bacillus stearothermophilus ribosome

    International Nuclear Information System (INIS)

    The surface topography of the intact 70S ribosome and free 30S and 50S subunits from Bacillus stearothermophilus strain 2,184 was investigated by lactoperoxidase-catalyzed iodination. Two-dimensional polyacrylamide gel electrophoresis was employed to separate ribosomal proteins for analysis of their reactivity. Free 50S subunits incorporated about 18% more 125I than did 50S subunits derived from 70S ribosomes, whereas free 30S subunits and 30S subunits derived from 70S ribosomes incorporated similar amounts of 125I. Iodinated 70S ribosomes and subunits retained 62-78% of the protein synthesis activity of untreated particles and sedimentation profiles showed no gross conformational changes due to iodination. The proteins most reactive to enzymatic iodination were S4, S7, S10 and Sa of the small subunit and L2, L4, L5/9, L6 and L36 of the large subunit. Proteins S2, S3, S7, S13, Sa, L5/9, L10, L11 and L24/25 were labeled substantially more in the free subunits than in the 70S ribosome. Other proteins, including S5, S9, S12, S15/16, S18 and L36 were more extensively iodinated in the 70S ribosome than in the free subunits. The locations of tyrosine residues in some homologus ribosomal proteins from B. stearothermophilus and E. coli are compared. (orig.)

  3. Global mRNA expression analysis in myosin II deficient strains of Saccharomyces cerevisiae reveals an impairment of cell integrity functions

    Directory of Open Access Journals (Sweden)

    Rivera-Molina Félix E

    2008-01-01

    Full Text Available Abstract Background The Saccharomyces cerevisiae MYO1 gene encodes the myosin II heavy chain (Myo1p, a protein required for normal cytokinesis in budding yeast. Myo1p deficiency in yeast (myo1Δ causes a cell separation defect characterized by the formation of attached cells, yet it also causes abnormal budding patterns, formation of enlarged and elongated cells, increased osmotic sensitivity, delocalized chitin deposition, increased chitin synthesis, and hypersensitivity to the chitin synthase III inhibitor Nikkomycin Z. To determine how differential expression of genes is related to these diverse cell wall phenotypes, we analyzed the global mRNA expression profile of myo1Δ strains. Results Global mRNA expression profiles of myo1Δ strains and their corresponding wild type controls were obtained by hybridization to yeast oligonucleotide microarrays. Results for selected genes were confirmed by real time RT-PCR. A total of 547 differentially expressed genes (p ≤ 0.01 were identified with 263 up regulated and 284 down regulated genes in the myo1Δ strains. Gene set enrichment analysis revealed the significant over-representation of genes in the protein biosynthesis and stress response categories. The SLT2/MPK1 gene was up regulated in the microarray, and a myo1Δslt2Δ double mutant was non-viable. Overexpression of ribosomal protein genes RPL30 and RPS31 suppressed the hypersensitivity to Nikkomycin Z and increased the levels of phosphorylated Slt2p in myo1Δ strains. Increased levels of phosphorylated Slt2p were also observed in wild type strains under these conditions. Conclusion Following this analysis of global mRNA expression in yeast myo1Δ strains, we conclude that 547 genes were differentially regulated in myo1Δ strains and that the stress response and protein biosynthesis gene categories were coordinately regulated in this mutant. The SLT2/MPK1 gene was confirmed to be essential for myo1Δ strain viability, supporting that the up

  4. Viral IRES RNA structures and ribosome interactions.

    Science.gov (United States)

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  5. Adaption of Saccharomyces cerevisiae expressing a heterologous protein

    DEFF Research Database (Denmark)

    Krogh, Astrid Mørkeberg; Beck, Vibe; Højlund Christensen, Lars;

    2008-01-01

    Production of the heterologous protein, bovine aprotinin, in Saccharomyces cerevisiae was shown to affect the metabolism of the host cell to various extent depending on the strain genotype. Strains with different genotypes, industrial and laboroatory, respectively, were investigated. The maximal ...... result of the adaptation. Determination of the level of mRNA encoding aprotinin and the plasmid copy number pointed to different mechanisms responsible for the decline in aprotinin yield in the different strains. (C) 2008 Elsevier B.V. All rights reserved....

  6. Proteomic characterization of a wild-type wine strain of Saccharomyces cerevisiae.

    Science.gov (United States)

    Trabalzini, Lorenza; Paffetti, Alessandro; Ferro, Elisa; Scaloni, Andrea; Talamo, Fabio; Millucci, Lia; Martelli, Paola; Santucci, Annalisa

    2003-12-01

    Saccharomyces cerevisiae is the optimal eukaryotic model system to study mammalian biological responses. At the same time Saccharomyces cerevisiae is also widely utilized as a biotechnological tool in the food industry. Enological Saccharomyces cerevisiae strains have been so far routinely analyzed for their microbiological aspects. Nevertheless, wine yeasts are gaining an increasing interest in the last years since they strongly affect both the vinification process and the organoleptic properties of the final product wine. The protein repertoire is responsible of such features and, consequently, 2D-PAGE can be an useful tool to evaluate and select optimal wine yeast strains. We present here the first proteomic map of a wild-type wine Saccharomyces cerevisiae strain selected for the guided fermentation of very high quality wines. PMID:15141481

  7. Crucial elements that maintain the interactions between the regulatory TnaC peptide and the ribosome exit tunnel responsible for Trp inhibition of ribosome function.

    Science.gov (United States)

    Martínez, Allyson K; Shirole, Nitin H; Murakami, Shino; Benedik, Michael J; Sachs, Matthew S; Cruz-Vera, Luis R

    2012-03-01

    Translation of the TnaC nascent peptide inhibits ribosomal activity in the presence of l-tryptophan, inducing expression of the tnaCAB operon in Escherichia coli. Using chemical methylation, this work reveals how interactions between TnaC and the ribosome are affected by mutations in both molecules. The presence of the TnaC-tRNA(Pro) peptidyl-tRNA within the ribosome protects the 23S rRNA nucleotide U2609 against chemical methylation. Such protection was not observed in mutant ribosomes containing changes in 23S rRNA nucleotides of the A748-A752 region. Nucleotides A752 and U2609 establish a base-pair interaction. Most replacements of either A752 or U2609 affected Trp induction of a TnaC-regulated LacZ reporter. However, the single change A752G, or the dual replacements A752G and U2609C, maintained Trp induction. Replacements at the conserved TnaC residues W12 and D16 also abolished the protection of U2609 by TnaC-tRNA(Pro) against chemical methylation. These data indicate that the TnaC nascent peptide in the ribosome exit tunnel interacts with the U2609 nucleotide when the ribosome is Trp responsive. This interaction is affected by mutational changes in exit tunnel nucleotides of 23S rRNA, as well as in conserved TnaC residues, suggesting that they affect the structure of the exit tunnel and/or the nascent peptide configuration in the tunnel. PMID:22110039

  8. Cystathionine accumulation in Saccharomyces cerevisiae.

    OpenAIRE

    Ono, B; Suruga, T; Yamamoto, M.; Yamamoto, S.; Murata, K; Kimura, A; Shinoda, S; Ohmori, S.

    1984-01-01

    A cysteine-dependent strain of Saccharomyces cerevisiae and its prototrophic revertants accumulated cystathionine in cells. The cystathionine accumulation was caused by a single mutation having a high incidence of gene conversion. The mutation was designated cys3 and was shown to cause loss of gamma-cystathionase activity. Cysteine dependence of the initial strain was determined by two linked and interacting mutations, cys3 and cys1 . Since cys1 mutations cause a loss of serine acetyltransfer...

  9. Viral IRES RNA structures and ribosome interactions

    OpenAIRE

    Kieft, Jeffrey S.

    2008-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IR...

  10. The economics of ribosome biosynthesis in yeast.

    Science.gov (United States)

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  11. Differential phosphorylation of ribosomal acidic proteins from yeast cell by two endogenous protein kinases: casein kinase-2 and 60S kinase

    International Nuclear Information System (INIS)

    The native 80S ribosomes isolated from ''Saccharomyces cerevisiae'' (strain W303) cells was phosphorylated by two endogenous protein kinases: multifunctional casein kinase-2 (CK-2) and specific 60S kinase. Three acidic proteins within the 60S ribosomal subunit: YP1β, YP1β' and YP2α are phosphorylated by both kinases. The other two proteins: YP1α and YP2β are predominantly phosphorylated by CK-2 but not by 60S kinase. This was confirmed in the experiment with the recombinant protein, YP2β, as a substrate, which is practically not phosphorylated by specific 60S kinase. These results together with the previous data based on the target amino-acid sequences suggest that, in addition to the multifunctional casein kinase-2 and specific 60S kinase, there exist probably other protein kinase(s) which phosphorylate the ribosomal acidic proteins in the cell. (author). 23 refs, 3 figs, 1 tab

  12. Eukaryotic Ribosome Assembly and Nuclear Export.

    Science.gov (United States)

    Nerurkar, Purnima; Altvater, Martin; Gerhardy, Stefan; Schütz, Sabina; Fischer, Ute; Weirich, Christine; Panse, Vikram Govind

    2015-01-01

    Accurate translation of the genetic code into functional polypeptides is key to cellular growth and proliferation. This essential process is carried out by the ribosome, a ribonucleoprotein complex of remarkable size and intricacy. Although the structure of the mature ribosome has provided insight into the mechanism of translation, our knowledge regarding the assembly, quality control, and intracellular targeting of this molecular machine is still emerging. Assembly of the eukaryotic ribosome begins in the nucleolus and requires more than 350 conserved assembly factors, which transiently associate with the preribosome at specific maturation stages. After accomplishing their tasks, early-acting assembly factors are released, preparing preribosomes for nuclear export. Export competent preribosomal subunits are transported through nuclear pore complexes into the cytoplasm, where they undergo final maturation steps, which are closely connected to quality control, before engaging in translation. In this chapter, we focus on the final events that commit correctly assembled ribosomal subunits for translation. PMID:26404467

  13. The circadian clock coordinates ribosome biogenesis.

    Directory of Open Access Journals (Sweden)

    Céline Jouffe

    Full Text Available Biological rhythms play a fundamental role in the physiology and behavior of most living organisms. Rhythmic circadian expression of clock-controlled genes is orchestrated by a molecular clock that relies on interconnected negative feedback loops of transcription regulators. Here we show that the circadian clock exerts its function also through the regulation of mRNA translation. Namely, the circadian clock influences the temporal translation of a subset of mRNAs involved in ribosome biogenesis by controlling the transcription of translation initiation factors as well as the clock-dependent rhythmic activation of signaling pathways involved in their regulation. Moreover, the circadian oscillator directly regulates the transcription of ribosomal protein mRNAs and ribosomal RNAs. Thus the circadian clock exerts a major role in coordinating transcription and translation steps underlying ribosome biogenesis.

  14. The immunological properties of Brucella ribosomal preparations.

    Science.gov (United States)

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  15. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  16. Ribosome biogenesis during skeletal muscle hypertrophy

    OpenAIRE

    von Walden, Ferdinand

    2014-01-01

    Muscle adaptation to chronic resistance exercise (RE) is the result of a cumulative effect on gene expression and protein content. Following a bout of RE, muscle protein synthesis increases and, if followed by consecutive bouts (training), protein accretion and muscle hypertrophy develops. The protein synthetic capacity of the muscle is dictated by ribosome content. Therefore, the general aim of this thesis is to investigate the regulation of ribosome biogenesis during skeletal muscle hypertr...

  17. Progress in Metabolic Engineering of Saccharomyces cerevisiae

    OpenAIRE

    Nevoigt, Elke

    2008-01-01

    Summary: The traditional use of the yeast Saccharomyces cerevisiae in alcoholic fermentation has, over time, resulted in substantial accumulated knowledge concerning genetics, physiology, and biochemistry as well as genetic engineering and fermentation technologies. S. cerevisiae has become a platform organism for developing metabolic engineering strategies, methods, and tools. The current review discusses the relevance of several engineering strategies, such as rational and inverse metabolic...

  18. Post-transcriptional regulation in the myo1Δ mutant of Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Akamine Pearl

    2010-12-01

    Full Text Available Abstract Background Saccharomyces cerevisiae myosin type II-deficient (myo1Δ strains remain viable and divide, despite the absence of a cytokinetic ring, by activation of the PKC1-dependent cell wall integrity pathway (CWIP. Since the myo1Δ transcriptional fingerprint is a subset of the CWIP fingerprint, the myo1Δ strain may provide a simplified paradigm for cell wall stress survival. Results To explore the post-transcriptional regulation of the myo1Δ stress response, 1,301 differentially regulated ribosome-bound mRNAs were identified by microarray analysis of which 204 were co-regulated by transcription and translation. Four categories of mRNA were significantly affected - protein biosynthesis, metabolism, carbohydrate metabolism, and unknown functions. Nine genes of the 20 CWIP fingerprint genes were post-transcriptionally regulated. Down and up regulation of selected ribosomal protein and cell wall biosynthesis mRNAs was validated by their distribution in polysomes from wild type and myo1Δ strains. Western blot analysis revealed accumulation of the phosphorylated form of eukaryotic translation initiation factor 2 (eIF2α-P and a reduction in the steady state levels of the translation initiation factor eIF4Gp in myo1Δ strains. Deletion of GCN2 in myo1Δ abolished eIF2αp phosphorylation, and showed a severe growth defect. The presence of P-bodies in myo1Δ strains suggests that the process of mRNA sequestration is active, however, the three representative down regulated RP mRNAs, RPS8A, RPL3 and RPL7B were present at equivalent levels in Dcp2p-mCh-positive immunoprecipitated fractions from myo1Δ and wild type cells. These same RP mRNAs were also selectively co-precipitated with eIF2α-P in myo1Δ strains. Conclusions Quantitative analysis of ribosome-associated mRNAs and their polyribosome distributions suggests selective regulation of mRNA translation efficiency in myo1Δ strains. Inhibition of translation initiation factor eIF2α (e

  19. The A1 Subunit of Shiga Toxin 2 Has Higher Affinity for Ribosomes and Higher Catalytic Activity than the A1 Subunit of Shiga Toxin 1.

    Science.gov (United States)

    Basu, Debaleena; Li, Xiao-Ping; Kahn, Jennifer N; May, Kerrie L; Kahn, Peter C; Tumer, Nilgun E

    2016-01-01

    Shiga toxin (Stx)-producing Escherichia coli (STEC) infections can lead to life-threatening complications, including hemorrhagic colitis (HC) and hemolytic-uremic syndrome (HUS), which is the most common cause of acute renal failure in children in the United States. Stx1 and Stx2 are AB5 toxins consisting of an enzymatically active A subunit associated with a pentamer of receptor binding B subunits. Epidemiological evidence suggests that Stx2-producing E. coli strains are more frequently associated with HUS than Stx1-producing strains. Several studies suggest that the B subunit plays a role in mediating toxicity. However, the role of the A subunits in the increased potency of Stx2 has not been fully investigated. Here, using purified A1 subunits, we show that Stx2A1 has a higher affinity for yeast and mammalian ribosomes than Stx1A1. Biacore analysis indicated that Stx2A1 has faster association and dissociation with ribosomes than Stx1A1. Analysis of ribosome depurination kinetics demonstrated that Stx2A1 depurinates yeast and mammalian ribosomes and an RNA stem-loop mimic of the sarcin/ricin loop (SRL) at a higher catalytic rate and is a more efficient enzyme than Stx1A1. Stx2A1 depurinated ribosomes at a higher level in vivo and was more cytotoxic than Stx1A1 in Saccharomyces cerevisiae. Stx2A1 depurinated ribosomes and inhibited translation at a significantly higher level than Stx1A1 in human cells. These results provide the first direct evidence that the higher affinity for ribosomes in combination with higher catalytic activity toward the SRL allows Stx2A1 to depurinate ribosomes, inhibit translation, and exhibit cytotoxicity at a significantly higher level than Stx1A1. PMID:26483409

  20. Fungal genomics beyond Saccharomyces cerevisiae?

    DEFF Research Database (Denmark)

    Hofmann, Gerald; Mcintyre, Mhairi; Nielsen, Jens

    2003-01-01

    Fungi are used extensively in both fundamental research and industrial applications. Saccharomyces cerevisiae has been the model organism for fungal research for many years, particularly in functional genomics. However, considering the diversity within the fungal kingdom, it is obvious that the...... application of the existing methods of genome, transcriptome, proteome and metabolome analysis to other fungi has enormous potential, especially for the production of food and food ingredients. The developments in the past year demonstrate that we have only just started to exploit this potential....

  1. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    Science.gov (United States)

    Prokhorova, Irina V.; Akulich, Kseniya A.; Makeeva, Desislava S.; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Yusupova, Gulnara; Yusupov, Marat M.; Dmitriev, Sergey E.

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value. PMID:27296282

  2. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen (1H) for deuterium (2H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.)

  3. Structural and Functional Studies of Ribosome-inactivating Proteins and Ribosomal RNA

    Institute of Scientific and Technical Information of China (English)

    LIU Wangyi; ZHANG Jinsong; LIU Renshui; HE Wenjun; LING Jun

    2007-01-01

    @@ A plant's ribosome-inactivating proteins (RIPs) are a group of toxic proteins. Theoretically, they can be employed as a tool enzyme in the exploration of the structure and function of the ribosomal RNA; in practical application, they can be used as an insecticide in agriculture, for preparation of immuno-toxic protein to kill cancer cells or against viral infection in medicine.

  4. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  5. Splicing-Mediated Autoregulation Modulates Rpl22p Expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Gabunilas, Jason; Chanfreau, Guillaume

    2016-04-01

    In Saccharomyces cerevisiae, splicing is critical for expression of ribosomal protein genes (RPGs), which are among the most highly expressed genes and are tightly regulated according to growth and environmental conditions. However, knowledge of the precise mechanisms by which RPG pre-mRNA splicing is regulated on a gene-by-gene basis is lacking. Here we show that Rpl22p has an extraribosomal role in the inhibition of splicing of the RPL22B pre-mRNA transcript. A stem loop secondary structure within the intron is necessary for pre-mRNA binding by Rpl22p in vivo and splicing inhibition in vivo and in vitro and can rescue splicing inhibition in vitro when added in trans to splicing reactions. Splicing inhibition by Rpl22p may be partly attributed to the reduction of co-transcriptional U1 snRNP recruitment to the pre-mRNA at the RPL22B locus. We further demonstrate that the inhibition of RPL22B pre-mRNA splicing contributes to the down-regulation of mature transcript during specific stress conditions, and provide evidence hinting at a regulatory role for this mechanism in conditions of suppressed ribosome biogenesis. These results demonstrate an autoregulatory mechanism that fine-tunes the expression of the Rpl22 protein and by extension Rpl22p paralog composition according to the cellular demands for ribosome biogenesis. PMID:27097027

  6. Xylose utilizing recombinant Saccharomyces cerevisiae strains

    Energy Technology Data Exchange (ETDEWEB)

    Walfridsson, M.

    1996-04-01

    Through metabolic engineering, S. cerevisiae was provided with the necessary enzymes required for xylose utilisation during ethanolic fermentation of xylose-rich lignocellulose raw materials. For xylitol production, S. cerevisiae was provided with the Pichia stipitis XYL1 gene encoding xylose reductase (XR). The in-vivo reduction and the following excretion of xylitol, requires a co-substrate for maintenance and cofactor regeneration. Xylitol yields close to 100% were obtained with the XYL1 containing S. cerevisiae. Introducing P. stipitis XYL1 and XYL2 genes, encoding XR and xylitol dehydrogenase (XDH), respectively, enabled S. cerevisiae to convert xylose to xylulose, via xylitol. During the screening work of P. stipitis XDH gene, another gene encoding a polyol dehydrogenase was isolated and cloned in S. cerevisiae. The gene was identified as a D-arabinitol dehydrogenase gene. In P. stipitis it may function as a redox sink by reducing D-ribulose to D-arabinitol. The metabolism through the pentose phosphate pathway (PPP) was enhanced by over-expressing the native genes TKL1 and TAL1 encoding transketolase and transaldolase, respectively, resulting in improved xylose utilisation. The XR and XDH activities in recombinant S. cerevisiae were produced at different levels by constructing yeast vectors in which the PGK1 and ADHI promoters controlled XYL1 and XYL2. With higher XDH than XR activities, less by-products, in the form of xylitol and glycerol, were formed by the recombinant S. cerevisiae strains. The Thermus thermophilus xylA gene encoding a thermostable xylose isomerase was cloned and expressed in S. cerevisiae. The recombinant xylose isomerase was actively produced and a new functional metabolic pathway was established in S. cerevisiae resulting in ethanol production from xylose. 150 refs, 3 figs, 4 tabs

  7. Ribosome traffic on mRNAs maps to gene ontology: genome-wide quantification of translation initiation rates and polysome size regulation.

    Directory of Open Access Journals (Sweden)

    Luca Ciandrini

    Full Text Available To understand the complex relationship governing transcript abundance and the level of the encoded protein, we integrate genome-wide experimental data of ribosomal density on mRNAs with a novel stochastic model describing ribosome traffic dynamics during translation elongation. This analysis reveals that codon arrangement, rather than simply codon bias, has a key role in determining translational efficiency. It also reveals that translation output is governed both by initiation efficiency and elongation dynamics. By integrating genome-wide experimental data sets with simulation of ribosome traffic on all Saccharomyces cerevisiae ORFs, mRNA-specific translation initiation rates are for the first time estimated across the entire transcriptome. Our analysis identifies different classes of mRNAs characterised by their initiation rates, their ribosome traffic dynamics, and by their response to ribosome availability. Strikingly, this classification based on translational dynamics maps onto key gene ontological classifications, revealing evolutionary optimisation of translation responses to be strongly influenced by gene function.

  8. Structure of a mitochondrial ribosome with minimal RNA

    OpenAIRE

    Sharma, Manjuli R.; Booth, Timothy M.; Simpson, Larry; Maslov, Dmitri A.; Agrawal, Rajendra K.

    2009-01-01

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show th...

  9. Identification of amino acids critical for the cytotoxicity of Shiga toxins 1 and 2 in Saccharomyces cerevisiae

    OpenAIRE

    Di, Rong; Kyu, Eric; Shete, Varsha; Saidasan, Hemalatha; Kahn, Peter C.; Tumer, Nilgun E.

    2010-01-01

    Shiga toxins (Stx1 and Stx2) are produced by E. coli O157:H7, which is a leading cause of food-borne illness. The A subunits of Stx1 (Stx1A) and Stx2 (Stx2A) are ribosome inactivating proteins (RIPs) that inhibit translation by removing an adenine from the highly conserved α-sarcin ricin loop (SRL) of the large rRNA. Here, we used mutagenesis in S. cerevisiae to identify residues critical for cytotoxicity of Stx1A and Stx2A. The A subunits depurinated the SRL, inhibited translation and caused...

  10. Ribosome-dependent activation of stringent control.

    Science.gov (United States)

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  11. Nucleolar dominance and ribosomal RNA gene silencing

    OpenAIRE

    Tucker, Sarah; Vitins, Alexa; Pikaard, Craig S.

    2010-01-01

    Nucleolar dominance is an epigenetic phenomenon that occurs in genetic hybrids and describes the expression of 45S rRNA genes inherited from one progenitor due to the silencing of the other progenitor’s rRNA genes. Nucleolar dominance is a manifestation of rRNA gene dosage control, which also occurs in non-hybrids, regulating the number of active rRNA genes according to the cellular demand for ribosomes and protein synthesis. Ribosomal RNA gene silencing involves changes in DNA methylation an...

  12. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.;

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha}-methylgluc......The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...

  13. Glycolipids of Saccharomyces cerevisiae Cell

    Directory of Open Access Journals (Sweden)

    Renuka Malhotra

    2005-01-01

    Full Text Available Total lipids of Saccharomyces cerevisiae were isolated by chloroform and methanol (2:1. Glycolipids were separated from total lipids by silicic acid chromatography. Glycolipid’s constituent sugars and fatty acids were analyzed by using Gas Liquid Chromatography. Galactose was the prominent sugar followed by mannose. Relative concentrations of fucose, mannose, galactose and glucose in the glycolipid were 5.3, 35.2, 55.1 and 4.2%. 16:0, 18:0, 18:1, 18:2 and 18:3 were the major fatty acids of the total glycolipids. Oleic acid was the dominating fatty acid followed by linoliec acid. They were separated into different fractions by using DEAE-Sephadex ion exchange chromatography. Glycolipids were fractionated and identified as cerebrosides, ceramide polyhexosides, sulfatides, monoglucosyldiglycerides and diglucosyldiglycerides. Ceramide polyhexosides were present in higher concentration as compared to other fractions.

  14. Glucose repression in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Kayikci, Omur; Nielsen, Jens

    2015-01-01

    Glucose is the primary source of energy for the budding yeast Saccharomyces cerevisiae. Although yeast cells can utilize a wide range of carbon sources, presence of glucose suppresses molecular activities involved in the use of alternate carbon sources as well as it represses respiration and...... gluconeogenesis. This dominant effect of glucose on yeast carbon metabolism is coordinated by several signaling and metabolic interactions that mainly regulate transcriptional activity but are also effective at post-transcriptional and post-translational levels. This review describes effects of glucose repression...... on yeast carbon metabolism with a focus on roles of the Snf3/Rgt2 glucose-sensing pathway and Snf1 signal transduction in establishment and relief of glucose repression....

  15. Methionine catabolism in Saccharomyces cerevisiae.

    Science.gov (United States)

    Perpète, Philippe; Duthoit, Olivier; De Maeyer, Simon; Imray, Louise; Lawton, Andrew I; Stavropoulos, Konstantinos E; Gitonga, Virginia W; Hewlins, Michael J E; Dickinson, J Richard

    2006-01-01

    The catabolism of methionine to methionol and methanethiol in Saccharomyces cerevisiae was studied using (13)C NMR spectroscopy, GC-MS, enzyme assays and a number of mutants. Methionine is first transaminated to alpha-keto-gamma-(methylthio)butyrate. Methionol is formed by a decarboxylation reaction, which yields methional, followed by reduction. The decarboxylation is effected specifically by Ydr380wp. Methanethiol is formed from both methionine and alpha-keto-gamma-(methylthio)butyrate by a demethiolase activity. In all except one strain examined, demethiolase was induced by the presence of methionine in the growth medium. This pathway results in the production of alpha-ketobutyrate, a carbon skeleton, which can be re-utilized. Hence, methionine catabolism is more complex and economical than the other amino acid catabolic pathways in yeast, which use the Ehrlich pathway and result solely in the formation of a fusel alcohol. PMID:16423070

  16. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    OpenAIRE

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  17. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation

    Science.gov (United States)

    Rooijers, Koos; Loayza-Puch, Fabricio; Nijtmans, Leo G.; Agami, Reuven

    2013-12-01

    Mitochondria are essential cellular organelles for generation of energy and their dysfunction may cause diabetes, Parkinson’s disease and multi-systemic failure marked by failure to thrive, gastrointestinal problems, lactic acidosis and early lethality. Disease-associated mitochondrial mutations often affect components of the mitochondrial translation machinery. Here we perform ribosome profiling to measure mitochondrial translation at nucleotide resolution. Using a protocol optimized for the retrieval of mitochondrial ribosome protected fragments (RPFs) we show that the size distribution of wild-type mitochondrial RPFs follows a bimodal distribution peaking at 27 and 33 nucleotides, which is distinct from the 30-nucleotide peak of nuclear RPFs. Their cross-correlation suggests generation of mitochondrial RPFs during ribosome progression. In contrast, RPFs from patient-derived mitochondria mutated in tRNA-Tryptophan are centered on tryptophan codons and reduced downstream, indicating ribosome stalling. Intriguingly, long RPFs are enriched in mutated mitochondria, suggesting they characterize stalled ribosomes. Our findings provide the first model for translation in wild-type and disease-triggering mitochondria.

  18. Acetylation dynamics and stoichiometry in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Weinert, Brian Tate; Iesmantavicius, Vytautas; Moustafa, Tarek; Schölz, Christian; Wagner, Sebastian A; Magnes, Christoph; Zechner, Rudolf; Choudhary, Chuna Ram

    2014-01-01

    Lysine acetylation is a frequently occurring posttranslational modification; however, little is known about the origin and regulation of most sites. Here we used quantitative mass spectrometry to analyze acetylation dynamics and stoichiometry in Saccharomyces cerevisiae. We found that acetylation...

  19. The uptake of different iron salts by the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Gaensly, Fernanda; Picheth, Geraldo; Brand, Debora; Bonfim, Tania M B

    2014-01-01

    Yeasts can be enriched with microelements, including iron; however, special physicochemical conditions are required to formulate a culture media that promotes both yeast growth and iron uptake. Different iron sources do not affect biomass formation; however, considering efficacy, cost, stability, and compatibility with Saccharomyces cerevisiae metabolism, ferrous sulphate is recommended. PMID:25242932

  20. The uptake of different iron salts by the yeast Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Fernanda Gaensly

    2014-06-01

    Full Text Available Yeasts can be enriched with microelements, including iron; however, special physicochemical conditions are required to formulate a culture media that promotes both yeast growth and iron uptake. Different iron sources do not affect biomass formation; however, considering efficacy, cost, stability, and compatibility with Saccharomyces cerevisiae metabolism, ferrous sulphate is recommended.

  1. The uptake of different iron salts by the yeast Saccharomyces cerevisiae

    OpenAIRE

    Fernanda Gaensly; Geraldo Picheth; Debora Brand; Tania M. B. Bonfim

    2014-01-01

    Yeasts can be enriched with microelements, including iron; however, special physicochemical conditions are required to formulate a culture media that promotes both yeast growth and iron uptake. Different iron sources do not affect biomass formation; however, considering efficacy, cost, stability, and compatibility with Saccharomyces cerevisiae metabolism, ferrous sulphate is recommended.

  2. The origin recognition complex links replication, sister chromatid cohesion and transcriptional silencing in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Suter, Bernhard; Tong, Amy; Chang, Michael; Yu, Lisa; Brown, Grant W; Boone, Charles; Rine, Jasper

    2004-01-01

    Mutations in genes encoding the origin recognition complex (ORC) of Saccharomyces cerevisiae affect initiation of DNA replication and transcriptional repression at the silent mating-type loci. To explore the function of ORC in more detail, a screen for genetic interactions was undertaken using large

  3. TOTAL ANTIOXIDANT ACTIVITY OF YEAST SACCHAROMYCES CEREVISIAE

    OpenAIRE

    Blažena Lavová; Dana Urminská

    2013-01-01

    Antioxidants are health beneficial compounds that can protect cells and macromolecules (e.g. fats, lipids, proteins and DNA) from the damage of reactive oxygen species (ROS). Sacchamomyces cerevisiae are know as organisms with very important antioxidative enzyme systems such as superoxide dismutase or catalase. The total antioxidant activity (mmol Trolox equivalent – TE.g-1 d.w.) of Saccharomyces cerevisiae was measured by 2,2´-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) during the yeas...

  4. Influence of Quinoxyfen Residues on Saccharomyces cerevisiae Fermentation of Grape Musts

    OpenAIRE

    Chaves López, Clemencia; Boselli, Emanuele; Piva, Andrea; Ndaghijimana, Maurice; Paparella, Antonello; Suzzi, Giovanna; Mastrocola, Dino

    2004-01-01

    The effect of Quinoxyfen, a new pesticide against powdery mildew, on the fermentation of Saccharomyces cerevisiae has been evaluated. When vines (Montepulciano d’Abruzzo, Trebbiano and Sangiovese) were treated with doses recommended by the producer (30 mL/hL of a suspension concentrate 250 g/L), Quinoxyfen was detected up to the concentration of 0.014 mg/L in the must. The S. cerevisiae growth parameters, μmax and lag phase, were not affected by this residual level during fermentation. Howeve...

  5. Switching the mode of sucrose utilization by Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Miletti Luiz C

    2008-02-01

    Full Text Available Abstract Background Overflow metabolism is an undesirable characteristic of aerobic cultures of Saccharomyces cerevisiae during biomass-directed processes. It results from elevated sugar consumption rates that cause a high substrate conversion to ethanol and other bi-products, severely affecting cell physiology, bioprocess performance, and biomass yields. Fed-batch culture, where sucrose consumption rates are controlled by the external addition of sugar aiming at its low concentrations in the fermentor, is the classical bioprocessing alternative to prevent sugar fermentation by yeasts. However, fed-batch fermentations present drawbacks that could be overcome by simpler batch cultures at relatively high (e.g. 20 g/L initial sugar concentrations. In this study, a S. cerevisiae strain lacking invertase activity was engineered to transport sucrose into the cells through a low-affinity and low-capacity sucrose-H+ symport activity, and the growth kinetics and biomass yields on sucrose analyzed using simple batch cultures. Results We have deleted from the genome of a S. cerevisiae strain lacking invertase the high-affinity sucrose-H+ symporter encoded by the AGT1 gene. This strain could still grow efficiently on sucrose due to a low-affinity and low-capacity sucrose-H+ symport activity mediated by the MALx1 maltose permeases, and its further intracellular hydrolysis by cytoplasmic maltases. Although sucrose consumption by this engineered yeast strain was slower than with the parental yeast strain, the cells grew efficiently on sucrose due to an increased respiration of the carbon source. Consequently, this engineered yeast strain produced less ethanol and 1.5 to 2 times more biomass when cultivated in simple batch mode using 20 g/L sucrose as the carbon source. Conclusion Higher cell densities during batch cultures on 20 g/L sucrose were achieved by using a S. cerevisiae strain engineered in the sucrose uptake system. Such result was accomplished by

  6. An overview of pre-ribosomal RNA processing in eukaryotes

    OpenAIRE

    Henras, Anthony K.; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2014-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. ...

  7. Molecular paleontology: a biochemical model of the ancestral ribosome

    OpenAIRE

    Hsiao, Chiaolong; Lenz, Timothy K.; Peters, Jessica K; Fang, Po-Yu; Schneider, Dana M.; Anderson, Eric J.; Preeprem, Thanawadee; Bowman, Jessica C.; O'Neill, Eric B.; Lie, Lively; Athavale, Shreyas S.; Gossett, J. Jared; Trippe, Catherine; Murray, Jason; Anton S. Petrov

    2013-01-01

    Ancient components of the ribosome, inferred from a consensus of previous work, were constructed in silico, in vitro and in vivo. The resulting model of the ancestral ribosome presented here incorporates ∼20% of the extant 23S rRNA and fragments of five ribosomal proteins. We test hypotheses that ancestral rRNA can: (i) assume canonical 23S rRNA-like secondary structure, (ii) assume canonical tertiary structure and (iii) form native complexes with ribosomal protein fragments. Footprinting exp...

  8. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.; Trier Hansen, M.; Pato, M. L.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...

  9. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    Koji Tamura

    2011-12-01

    Proteins, the main players in current biological systems, are produced on ribosomes by sequential amide bond (peptide bond) formations between amino-acid-bearing tRNAs. The ribosome is an exquisite super-complex of RNA-proteins, containing more than 50 proteins and at least 3 kinds of RNAs. The combination of a variety of side chains of amino acids (typically 20 kinds with some exceptions) confers proteins with extraordinary structure and functions. The origin of peptide bond formation and the ribosome is crucial to the understanding of life itself. In this article, a possible evolutionary pathway to peptide bond formation machinery (proto-ribosome) will be discussed, with a special focus on the RNA minihelix (primordial form of modern tRNA) as a starting molecule. Combining the present data with recent experimental data, we can infer that the peptidyl transferase center (PTC) evolved from a primitive system in the RNA world comprising tRNA-like molecules formed by duplication of minihelix-like small RNA.

  10. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    OpenAIRE

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Background Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role...

  11. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.

    Science.gov (United States)

    Veit, Guido; Oliver, Kathryn; Apaja, Pirjo M; Perdomo, Doranda; Bidaud-Meynard, Aurélien; Lin, Sheng-Ting; Guo, Jingyu; Icyuz, Mert; Sorscher, Eric J; Hartman Iv, John L; Lukacs, Gergely L

    2016-05-01

    The most common cystic fibrosis (CF) causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del), results in functional expression defect of the CF transmembrane conductance regulator (CFTR) at the apical plasma membrane (PM) of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER). Deletion of phenylalanine 670 (ΔF670) in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter) of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic) analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor) restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect. PMID:27168400

  12. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect

    Science.gov (United States)

    Veit, Guido; Oliver, Kathryn; Apaja, Pirjo M.; Perdomo, Doranda; Bidaud-Meynard, Aurélien; Guo, Jingyu; Icyuz, Mert; Sorscher, Eric J.; Hartman IV, John L.; Lukacs, Gergely L.

    2016-01-01

    The most common cystic fibrosis (CF) causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del), results in functional expression defect of the CF transmembrane conductance regulator (CFTR) at the apical plasma membrane (PM) of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER). Deletion of phenylalanine 670 (ΔF670) in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter) of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic) analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor) restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect. PMID:27168400

  13. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.

    Directory of Open Access Journals (Sweden)

    Guido Veit

    2016-05-01

    Full Text Available The most common cystic fibrosis (CF causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del, results in functional expression defect of the CF transmembrane conductance regulator (CFTR at the apical plasma membrane (PM of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER. Deletion of phenylalanine 670 (ΔF670 in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.

  14. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    Science.gov (United States)

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  15. Higher order structure in the 3'-minor domain of small subunit ribosomal RNAs from a gram negative bacterium, a gram positive bacterium and a eukaryote

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1983-01-01

    , T2 and S1. The data enabled the various minimal secondary structural models, proposed for the 3'-regions of the E. coli and S. cerevisiae RNAs, to be critically examined, and to demonstrate that the main common features of these models are correct. The results also reveal the presence and position...... "unstructured" regions. Several unusual structural features were detected. Multiple G X A pairings in two of the putative helices, which are compatible with phylogenetic sequence comparisons, are strongly supported by the occurrence of cobra venom ribonuclease cuts adjacent to, and in one case between, these......An experimental approach was used to determine and compare the highest order structure within the 150 to 200 nucleotides at the 3'-ends of the RNAs from the small ribosomal subunits of Escherichia coli, Bacillus stearothermophilus and Saccharomyces cerevisiae. Chemical reagents were employed to...

  16. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  17. SACCHAROMYCES CEREVISIAE AND ITS VALIDATION

    Directory of Open Access Journals (Sweden)

    Miroslav Ondrejovič

    2015-02-01

    Full Text Available The aim of this study was to optimize of independent variables as temperature, time and reaction ratio to output parameter of simultaneous enzyme saccharification and fermentation by Saccharomyces cerevisiae of pretreated wheat straw as model substrate via RSM (response surface methodology approach. As dependent variable, it was chosen ethanol yields characterizing effectivity of process. The optimal conditions were approximately temperature 100 °C, time 1 hour and reaction ratio 26 mL to 1 g of treated wheat straw with ethanol yields 141.9 mg.g-1. After calculating the optimal values, the validation analyze was carried out and it was found out that the predicted and experimentally verified dependent variable was in agreement with the optimal parameters (~ 95 %. Proposed model was tested for three lignocellulosic materials (winter wheat straw, alfalfa hay and maize straw as wheat straw used as model substrate and it was confirmed the possibility of its use for other agricultural residues with similar content of lignocellulose.

  18. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  19. Compositions and methods for modeling Saccharomyces cerevisiae metabolism

    DEFF Research Database (Denmark)

    2012-01-01

    The invention provides an in silica model for determining a S. cerevisiae physiological function. The model includes a data structure relating a plurality of S. cerevisiae reactants to a plurality of S. cerevisiae reactions, a constraint set for the plurality of S. cerevisiae reactions, and...... commands for determining a distribution of flux through the reactions that is predictive of a S. cerevisiae physiological function. A model of the invention can further include a gene database containing information characterizing the associated gene or genes. The invention further provides methods for...... making an in silica S. cerevisiae model and methods for determining a S. cerevisiae physiological function using a model of the invention. The invention provides an in silica model for determining a S. cerevisiae physiological function. The model includes a data structure relating a plurality of S...

  20. Interaction between the yeast mitochondrial and nuclear genomes influences the abundance of novel transcripts derived from the spacer region of the nuclear ribosomal DNA repeat.

    OpenAIRE

    Parikh, V S; Conrad-Webb, H; Docherty, R; Butow, R A

    1989-01-01

    We have identified stable transcripts from the so-called nontranscribed spacer region (NTS) of the nuclear ribosomal DNA repeat in certain respiration-deficient strains of Saccharomyces cerevisiae. These RNAs, which are transcribed from the same strand as is the 37S rRNA precursor, are 500 to 800 nucleotides long and extend from the 5' end of the 5S rRNA gene to three major termination sites about 1,780, 1,830, and 1,870 nucleotides from the 3' end of the 26S rRNA gene. A survey of various wi...

  1. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    Science.gov (United States)

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  2. Neurodegeneration-associated instability of ribosomal DNA

    OpenAIRE

    Hallgren, Justin; Pietrzak, Maciej; Rempala, Grzegorz; Nelson, Peter T.; Hetman, Michal

    2014-01-01

    Homologous recombination (HR)-mediated instability of the repetitively organized ribosomal DNA (rDNA) has been proposed as a mediator of cell senescence in yeast triggering the DNA damage response. High individual variability in the content of human rDNA suggests that this genomic region remained relatively unstable throughout evolution. Therefore, quantitative real time PCR was used to determine the genomic content of rDNA in post mortem samples of parietal cortex from 14 young- and 9 elderl...

  3. Ribosome Inactivating Proteins from Plants Inhibiting Viruses

    Institute of Scientific and Technical Information of China (English)

    Inderdeep Kaur; R C Gupta; Munish Puri

    2011-01-01

    Many plants contain ribosome inactivating proteins (RIPs) with N-glycosidase activity,which depurinate large ribosomal RNA and arrest protein synthesis.RIPs so far tested inhibit replication of mRNA as well as DNA viruses and these proteins,isolated from plants,are found to be effective against a broad range of viruses such as human immunodeficiency virus (HIV),hepatitis B virus (HBV) and herpes simplex virus (HSV).Most of the research work related to RIPs has been focused on antiviral activity against HIV; however,the exact mechanism of antiviral activity is still not clear.The mechanism of antiviral activity was thought to follow inactivation of the host cell ribosome,leading to inhibition of viral protein translation and host cell death.Enzymatic activity of RIPs is not hmited to depurination of the large rRNA,in addition they can depurinate viral DNA as well as RNA.Recently,Phase Ⅰ/Ⅱ clinical trials have demonstrated the potential use of RIPs for treating patients with HIV disease.The aim of this review is to focus on various RIPs from plants associated with anti-HIV activity.

  4. Structure of a mitochondrial ribosome with minimal RNA.

    Science.gov (United States)

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  5. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  6. Protein Folding Activity of the Ribosome (PFAR –– A Target for Antiprion Compounds

    Directory of Open Access Journals (Sweden)

    Debapriya Banerjee

    2014-10-01

    Full Text Available Prion diseases are fatal neurodegenerative diseases affecting mammals. Prions are misfolded amyloid aggregates of the prion protein (PrP, which form when the alpha helical, soluble form of PrP converts to an aggregation-prone, beta sheet form. Thus, prions originate as protein folding problems. The discovery of yeast prion(s and the development of a red-/white-colony based assay facilitated safe and high-throughput screening of antiprion compounds. With this assay three antiprion compounds; 6-aminophenanthridine (6AP, guanabenz acetate (GA, and imiquimod (IQ have been identified. Biochemical and genetic studies reveal that these compounds target ribosomal RNA (rRNA and inhibit specifically the protein folding activity of the ribosome (PFAR. The domain V of the 23S/25S/28S rRNA of the large ribosomal subunit constitutes the active site for PFAR. 6AP and GA inhibit PFAR by competition with the protein substrates for the common binding sites on the domain V rRNA. PFAR inhibition by these antiprion compounds opens up new possibilities for understanding prion formation, propagation and the role of the ribosome therein. In this review, we summarize and analyze the correlation between PFAR and prion processes using the antiprion compounds as tools.

  7. An organic acid-tolerant HAA1-overexpression mutant of an industrial bioethanol strain of Saccharomyces cerevisiae and its application to the production of bioethanol from sugarcane molasses

    OpenAIRE

    Inaba, Takuya; Watanabe, Daisuke; Yoshiyama, Yoko; Tanaka,Koichi; Ogawa, Jun; Takagi, Hiroshi; Shimoi, Hitoshi; Shima, Jun

    2013-01-01

    Bacterial contamination is known as a major cause of the reduction in ethanol yield during bioethanol production by Saccharomyces cerevisiae. Acetate is an effective agent for the prevention of bacterial contamination, but it negatively affects the fermentation ability of S. cerevisiae. We have proposed that the combined use of organic acids including acetate and lactate and yeast strains tolerant to organic acids may be effective for the elimination of principally lactic acid bacterial (LAB)...

  8. Molecular Profiling of Activated Neurons by Phosphorylated Ribosome Capture

    OpenAIRE

    Knight, Zachary A.; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L.; Wysocki, Robert W.; Emiliano, Ana; Ekstrand, Mats I.; Friedman, Jeffrey M.

    2012-01-01

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, there...

  9. Nitrogen Catabolite Repression in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hofman-Bang, H Jacob Peider

    1999-01-01

    In Saccharomyces cerevisiae the expression of all known nitrogen catabolite pathways are regulated by four regulators known as Gln3, Gat1, Da180, and Deh1. This is known as nitrogen catabolite repression (NCR). They bind to motifs in the promoter region to the consensus sequence S' GATAA 3'. Gln3...

  10. Oscillations in glycolysis in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Kloster, Antonina; Olsen, Lars Folke

    Wehave investigated the glycolytic oscillations, measured as NADH autofluorescence, in the yeast Saccharomyces cerevisiae in a batch reactor. Specifically, we have tested the effect of cell density and a number of inhibitors or activators of ATPase activity on the amplitude of the oscillations. The...

  11. Tangential Ultrafiltration of Aqueous "Saccharomyces Cerevisiae" Suspensions

    Science.gov (United States)

    Silva, Carlos M.; Neves, Patricia S.; Da Silva, Francisco A.; Xavier, Ana M. R. B.; Eusebio, M. F. J.

    2008-01-01

    Experimental work on ultrafiltration is presented to illustrate the practical and theoretical principles of this separation technique. The laboratory exercise comprises experiments with pure water and with aqueous "Saccharomyces cerevisiae" (from commercial Baker's yeast) suspensions. With this work students detect the characteristic phenomena…

  12. Structural and functional topography of the human ribosome

    Institute of Scientific and Technical Information of China (English)

    Dmitri Graifer; Galina Karpova

    2012-01-01

    This review covers data on the structural organization of functional sites in the human ribosome,namely,the messenger RNA binding center,the binding site of the hepatitis C virus RNA internal ribosome entry site,and the peptidyl transferase center.The data summarized here have been obtained primarily by means of a site-directed crosslinking approach with application of the analogs of the respective ribosomal ligands bearing cross-linkers at the designed positions.These data are discussed taking into consideration available structural data on ribosomes from various kingdoms obtained with the use of cryo-electron microscopy,X-ray crystallography,and other approaches.

  13. Stem–loop structures can effectively substitute for an RNA pseudoknot in −1 ribosomal frameshifting

    OpenAIRE

    Yu, Chien-Hung; Noteborn, Mathieu H.; Pleij, Cornelis W. A.; Olsthoorn, René C. L.

    2011-01-01

    −1 Programmed ribosomal frameshifting (PRF) in synthesizing the gag-pro precursor polyprotein of Simian retrovirus type-1 (SRV-1) is stimulated by a classical H-type pseudoknot which forms an extended triple helix involving base–base and base–sugar interactions between loop and stem nucleotides. Recently, we showed that mutation of bases involved in triple helix formation affected frameshifting, again emphasizing the role of the triple helix in −1 PRF. Here, we investigated the efficiency of ...

  14. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation

    OpenAIRE

    Rooijers, Koos; Loayza-Puch, Fabricio; Nijtmans, Leo G.; Agami, Reuven

    2013-01-01

    Mitochondria are essential cellular organelles for generation of energy and their dysfunction may cause diabetes, Parkinson's disease and multi-systemic failure marked by failure to thrive, gastrointestinal problems, lactic acidosis and early lethality. Disease-associated mitochondrial mutations often affect components of the mitochondrial translation machinery. Here we perform ribosome profiling to measure mitochondrial translation at nucleotide resolution. Using a protocol optimized for the...

  15. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  16. Ribosome-Inactivating and Related Proteins

    OpenAIRE

    Joachim Schrot; Alexander Weng; Matthias F. Melzig

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant ...

  17. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  18. Production of bioethanol and associated by-products from potato starch residue stream by Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Hashem, Mohamed [King Khalid University, Faculty of Science, Biological Science Department, P.O. Box 10255, Abha 61321 (Saudi Arabia); Darwish, Soumia M.I. [Department of Food Science and Technology, Faculty of Agriculture, Assiut University (Egypt)

    2010-07-15

    Potato starch residue stream produced during chips manufacturing was used as an economical source for biomass and bioethanol production by Saccharomyces cerevisiae. Results demonstrated that 1% H{sub 2}SO{sub 4} at 100 C for 1 h was enough to hydrolyze all starch contained in the residue stream. Two strains of S. cerevisiae (y-1646 and commercial one) were able to utilize and ferment the acid-treated residue stream under both aerobic and semi-anaerobic conditions. The maximum yield of ethanol (5.52 g L{sup -1}) was achieved at 35 C by S. cerevisiae y-1646 after 36 h when ZnCl{sub 2} (0.4 g L{sup -1}) was added. Addition of NH{sub 4}NO{sub 3} as a source of nitrogen did not significantly affect either growth or ethanol production by S. cerevisiae y-1646. Some secondary by-products including alcohol derivatives and medical active compound were found to be associated with the ethanol production process. (author)

  19. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  20. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    Science.gov (United States)

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  1. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  2. Effects of aeration on formation and localization of the acetyl coenzyme A synthetases of Saccharomyces cerevisiae

    Science.gov (United States)

    Klein, H. P.; Jahnke, L.

    1979-01-01

    Previous studies on the yeast Saccharomyces cerevisiae have shown that two different forms of the enzyme acetyl coenzyme A synthetase (ACS) are present, depending on the conditions under which the cells are grown. The paper evaluates the usefulness of a method designed to assay both synthetases simultaneously in yeast homogenates. The data presented confirm the possibility of simultaneous detection and estimation of the amount of both ACSs of S. cerevisiae in crude homogenates of this strain, making possible the study of physiological factors involved in the formation of these isoenzymes. One important factor for specifying which of the two enzymes is found in these yeast cells is the presence or absence of oxygen in their environment. Aeration not only affects the ratio of the two ACSs but also appears to affect the cellular distribution of these enzymes. Most of the data presented suggest the possibility that the nonaerobic ACS may serve as a precursor to the aerobic form.

  3. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region.

    Science.gov (United States)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko; Lo Svenningsen, Sine; Sneppen, Kim; Pedersen, Steen

    2011-03-18

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described. Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts of slowly translated codons before codon 20 or after codon 45 should shorten or prolong, respectively, the functional mRNA half-life by altering the ribosome density in the important region. These predictions were tested on eight new lacZ variants, and their experimentally determined mRNA half-lives all supported the model. We thus suggest that translation-rate-mediated differences in the spacing between ribosomes in this early coding region is a parameter that determines the mRNAs functional half-life. We present a model that is in accordance with many earlier observations and that allows a prediction of the functional half-life of a given mRNA sequence. PMID:21255584

  4. Interaction among Saccharomyces cerevisiae pheromone receptors during endocytosis

    Directory of Open Access Journals (Sweden)

    Chien-I Chang

    2014-03-01

    Full Text Available This study investigates endocytosis of Saccharomyces cerevisiae α-factor receptor and the role that receptor oligomerization plays in this process. α-factor receptor contains signal sequences in the cytoplasmic C-terminal domain that are essential for ligand-mediated endocytosis. In an endocytosis complementation assay, we found that oligomeric complexes of the receptor undergo ligand-mediated endocytosis when the α-factor binding site and the endocytosis signal sequences are located in different receptors. Both in vitro and in vivo assays suggested that ligand-induced conformational changes in one Ste2 subunit do not affect neighboring subunits. Therefore, recognition of the endocytosis signal sequence and recognition of the ligand-induced conformational change are likely to be two independent events.

  5. Transcriptional regulation of an hsp70 heat shock gene in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Slater, M R; Craig, E A

    1987-01-01

    The yeast Saccharomyces cerevisiae contains three heat-inducible hsp70 genes. We have characterized the promoter region of the hsp70 heat shock gene YG100, that also displays a basal level of expression. Deletion of the distal region of the promoter resulted in an 80% drop in the basal level of expression without affecting expression after heat shock. Progressive-deletion analysis suggested that sequences necessary for heat-inducible expression are more proximal, within 233 base pairs of the ...

  6. Interactions between mutations for sensitivity to psoralen photoaddition (pso) and to radiation (rad) in Saccharomyces cerevisiae.

    OpenAIRE

    Henriques, J A; Moustacchi, E

    1981-01-01

    The mode of interaction in haploid Saccharomyces cerevisiae of two pso mutations with each other and with rad mutations affected in their excision-resynthesis (rad3), error-prone (rad6), and deoxyribonucleic acid double-strand break (rad52) repair pathways was determined for various double mutant combinations. Survival data for 8-methoxypsoralen photoaddition, 254-nm ultraviolet light and gamma rays are presented. For 8-methoxypsoralen photoaddition, which induces both deoxyribonucleic acid i...

  7. Improving Stress Tolerance in Industrial Saccharomyces cerevisiae Strains for Ethanol Production from Lignocellulosic Biomass

    OpenAIRE

    Wallace, Valeria

    2014-01-01

    The present work was aimed at developing industrial S. cerevisiae strains with improved tolerance to two types of stressors encountered during the fermentation of lignocellulosic biomass that affect ethanol yield and productivity, namely hydrolysate-derived inhibitors and high temperature, and at understanding the response of yeast and mechanisms of adaptation to such stressors. In one part of the study, key amino acid substitutions that were responsible for the acquired ability of a mutated ...

  8. Evaluation of apoptosis and necrosis in Saccharomyces cerevisiae during wine fermentations

    OpenAIRE

    Salvador, Vanessa Alexandra Guerreiro

    2009-01-01

    During wine fermentation the yeast cells are affected by several stress conditions in different phases of the fermentation process, which induces deeply changes in yeast cells physiology. The aim of this work was to evaluate different parameters related to the physiological state of an industrial strain of Saccharomyces cerevisiae (ISA1000), during wine fermentations of white grape must, 15ºC and 30ºC, simulating winery conditions. As indicator of the number of viable cells and...

  9. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    Science.gov (United States)

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  10. Regulating the Ribosome: A Spotlight on RNA Dark Matter

    OpenAIRE

    Lintner, Nathanael G.; Cate, Jamie H. D.

    2014-01-01

    In this issue Pircher et al.(2014) show that an abundant ribosome-associated 18-nt noncoding RNA (ncRNA),derived from the open reading frame of an mRNA,acts directly on the ribosome and regulates global translation levels in response to hypertonic shock.

  11. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko;

    2011-01-01

    codons. When comparing the ribosome spacing at various segments of the mRNA to its functional half-life, we found a clear correlation between the functional mRNA half-life and the ribosome spacing in the mRNA region approximately between codon 20 and codon 45. From this finding, we predicted that inserts......Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described....... Here, we characterize a determinant of the functional stability of an mRNA, which is located in the early coding region. Using literature values for the mRNA half-lives of variant lacZ mRNAs in Escherichia coli, we modeled how the ribosome spacing is affected by the translation rate of the individual...

  12. Translation with frameshifting of ribosome along mRNA transcript

    CERN Document Server

    Li, Jingwei

    2015-01-01

    Translation is an important process for prokaryotic and eukaryotic cells to produce necessary proteins for cell growth. Numerious experiments have been performed to explore the translational properties. Diverse models have also been developed to determine the biochemical mechanism of translation. However, to simplify the majority of the existing models, the frameshifting of ribosome along the mRNA transcript is neglected, which actually occurs in real cells and has been extensively experimentally studied. The frameshifting of ribosome evidently influences the efficiency and speed of translation, considering that the peptide chains synthesized by shifted ribosomes will not fold into functional proteins and will degrade rapidly. In this study, a theoretical model is presented to describe the translational process based on the model for totally asymmetric simple exclusion process. In this model, the frameshifting of the ribosome along the mRNA transcript and the attachment/detachment of the ribosome to/from the ...

  13. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    Science.gov (United States)

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  14. TOTAL ANTIOXIDANT ACTIVITY OF YEAST SACCHAROMYCES CEREVISIAE

    Directory of Open Access Journals (Sweden)

    Blažena Lavová

    2013-02-01

    Full Text Available Antioxidants are health beneficial compounds that can protect cells and macromolecules (e.g. fats, lipids, proteins and DNA from the damage of reactive oxygen species (ROS. Sacchamomyces cerevisiae are know as organisms with very important antioxidative enzyme systems such as superoxide dismutase or catalase. The total antioxidant activity (mmol Trolox equivalent – TE.g-1 d.w. of Saccharomyces cerevisiae was measured by 2,2´-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid during the yeast cultivation. It was found that the total antioxidant activity was the highest (1.08 mmol TE.g-1 d.w. in the strain Kolín after 32 hours of cultivation and the lowest (0.26 mmol TE.g-1 d.w. in the strain Gyöng after 12 hours of cultivation.

  15. X-ray Analyses of the Ribosomal A-Site Molecular Switches

    Science.gov (United States)

    Kondo, Jiro

    The aminoacyl-tRNA decoding site (A-site) on the small ribosomal subunit is an RNA molecular switch guaranteeing high translation fidelity. Due to the similarity of the secondary structure of the A-site, it has long been believed that the functional characteristics and tertiary structure of the A-site molecular switch are basically conserved in three main cell types, bacteria, mitochondria and eukaryotic cytoplasm. However, these three cell types are noticeably different in their biological properties such as life cycle, genome size, structural component of ribosome and number of tRNA species. In our structural studies, we have shown how a small difference of nucleotide sequences affects the dynamics of the A-site molecular switches underlying the decoding mechanism adapted to their biological properties and environments. The observed structural insights into the decoding process allowed us to understand molecular mechanisms of non-syndromic hearing loss and toxicity mechanism of aminoglycoside antibiotics.

  16. Genome-scale reconstruction of the Saccharomyces cerevisiae metabolic network

    DEFF Research Database (Denmark)

    Förster, Jochen; Famili, I.; Fu, P.; Palsson, B.O.; Nielsen, Jens

    2003-01-01

    The metabolic network in the yeast Saccharomyces cerevisiae was reconstructed using currently available genomic, biochemical, and physiological information. The metabolic reactions were compartmentalized between the cytosol and the mitochondria, and transport steps between the compartments and the...... containing 1175 metabolic reactions and 584 metabolites. The number of gene functions included in the reconstructed network corresponds to similar to16% of all characterized ORFs in S. cerevisiae. Using the reconstructed network, the metabolic capabilities of S. cerevisiae were calculated and compared with...

  17. Phosphate transport and sensing in Saccharomyces cerevisiae.

    OpenAIRE

    Wykoff, D D; O'Shea, E K

    2001-01-01

    Cellular metabolism depends on the appropriate concentration of intracellular inorganic phosphate; however, little is known about how phosphate concentrations are sensed. The similarity of Pho84p, a high-affinity phosphate transporter in Saccharomyces cerevisiae, to the glucose sensors Snf3p and Rgt2p has led to the hypothesis that Pho84p is an inorganic phosphate sensor. Furthermore, pho84Delta strains have defects in phosphate signaling; they constitutively express PHO5, a phosphate starvat...

  18. Viruses and prions of Saccharomyces cerevisiae

    OpenAIRE

    Wickner, Reed B.; Fujimura, Tsutomu; Esteban, Rosa

    2013-01-01

    Saccharomyces cerevisiae has been a key experimental organism for the study of infectious diseases, including dsRNA viruses, ssRNA viruses, and prions. Studies of the mechanisms of virus and prion replication, virus structure, and structure of the amyloid filaments that are the basis of yeast prions have been at the forefront of such studies in these classes of infectious entities. Yeast has been particularly useful in defining the interactions of the infectious elements with cellular compone...

  19. Stationary phase in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Werner-Washburne, M; Braun, E.; Johnston, G C; Singer, R A

    1993-01-01

    Growth and proliferation of microorganisms such as the yeast Saccharomyces cerevisiae are controlled in part by the availability of nutrients. When proliferating yeast cells exhaust available nutrients, they enter a stationary phase characterized by cell cycle arrest and specific physiological, biochemical, and morphological changes. These changes include thickening of the cell wall, accumulation of reserve carbohydrates, and acquisition of thermotolerance. Recent characterization of mutant c...

  20. Identification of coated vesicles in Saccharomyces cerevisiae

    OpenAIRE

    1984-01-01

    Clathrin-coated vesicles were found in yeast, Saccharomyces cerevisiae, and enriched from spheroplasts by a rapid procedure utilizing gel filtration on Sephacryl S-1000. The coated vesicles (62-nm diam) were visualized by negative stain electron microscopy and clathrin triskelions were observed by rotary shadowing. The contour length of a triskelion leg was 490 nm. Coated vesicle fractions contain a prominent band with molecular weight of approximately 185,000 when analyzed by SDS PAGE. The p...

  1. Cell Wall Assembly in Saccharomyces cerevisiae

    OpenAIRE

    Lesage, Guillaume; Bussey, Howard

    2006-01-01

    An extracellular matrix composed of a layered meshwork of β-glucans, chitin, and mannoproteins encapsulates cells of the yeast Saccharomyces cerevisiae. This organelle determines cellular morphology and plays a critical role in maintaining cell integrity during cell growth and division, under stress conditions, upon cell fusion in mating, and in the durable ascospore cell wall. Here we assess recent progress in understanding the molecular biology and biochemistry of cell wall synthesis and it...

  2. Ribosome-Inactivating and Related Proteins

    Directory of Open Access Journals (Sweden)

    Joachim Schrot

    2015-05-01

    Full Text Available Ribosome-inactivating proteins (RIPs are toxins that act as N-glycosidases (EC 3.2.2.22. They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs.

  3. N-hypermannose glycosylation disruption enhances recombinant protein production by regulating secretory pathway and cell wall integrity in Saccharomyces cerevisiae.

    Science.gov (United States)

    Tang, Hongting; Wang, Shenghuan; Wang, Jiajing; Song, Meihui; Xu, Mengyang; Zhang, Mengying; Shen, Yu; Hou, Jin; Bao, Xiaoming

    2016-01-01

    Saccharomyces cerevisiae is a robust host for heterologous protein expression. The efficient expression of cellulases in S. cerevisiae is important for the consolidated bioprocess that directly converts lignocellulose into valuable products. However, heterologous proteins are often N-hyperglycosylated in S. cerevisiae, which may affect protein activity. In this study, the expression of three heterologous proteins, β-glucosidase, endoglucanase and cellobiohydrolase, was found to be N-hyperglycosylated in S. cerevisiae. To block the formation of hypermannose glycan, these proteins were expressed in strains with deletions in key Golgi mannosyltransferases (Och1p, Mnn9p and Mnn1p), respectively. Their extracellular activities improved markedly in the OCH1 and MNN9 deletion strains. Interestingly, truncation of the N-hypermannose glycan did not increase the specific activity of these proteins, but improved the secretion yield. Further analysis showed OCH1 and MNN9 deletion up-regulated genes in the secretory pathway, such as protein folding and vesicular trafficking, but did not induce the unfolded protein response. The cell wall integrity was also affected by OCH1 and MNN9 deletion, which contributed to the release of secretory protein extracellularly. This study demonstrated that mannosyltransferases disruption improved protein secretion through up-regulating secretory pathway and affecting cell wall integrity and provided new insights into glycosylation engineering for protein secretion. PMID:27156860

  4. Sumoylation of Rap1 mediates the recruitment of TFIID to promote transcription of ribosomal protein genes.

    Science.gov (United States)

    Chymkowitch, Pierre; Nguéa, Aurélie P; Aanes, Håvard; Koehler, Christian J; Thiede, Bernd; Lorenz, Susanne; Meza-Zepeda, Leonardo A; Klungland, Arne; Enserink, Jorrit M

    2015-06-01

    Transcription factors are abundant Sumo targets, yet the global distribution of Sumo along the chromatin and its physiological relevance in transcription are poorly understood. Using Saccharomyces cerevisiae, we determined the genome-wide localization of Sumo along the chromatin. We discovered that Sumo-enriched genes are almost exclusively involved in translation, such as tRNA genes and ribosomal protein genes (RPGs). Genome-wide expression analysis showed that Sumo positively regulates their transcription. We also discovered that the Sumo consensus motif at RPG promoters is identical to the DNA binding motif of the transcription factor Rap1. We demonstrate that Rap1 is a molecular target of Sumo and that sumoylation of Rap1 is important for cell viability. Furthermore, Rap1 sumoylation promotes recruitment of the basal transcription machinery, and sumoylation of Rap1 cooperates with the target of rapamycin kinase complex 1 (TORC1) pathway to promote RPG transcription. Strikingly, our data reveal that sumoylation of Rap1 functions in a homeostatic feedback loop that sustains RPG transcription during translational stress. Taken together, Sumo regulates the cellular translational capacity by promoting transcription of tRNA genes and RPGs. PMID:25800674

  5. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  6. Conservation of ribosomal protein gene ordering in 16 complete genomes

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The organization of ribosomal proteins in 16 prokaryotic genomes was studied as an example of comparative genome analyses of gene systems. Hypothetical ribosomal protein-containing operons were constructed. These operons also contained putative genes and other non-ribosomal genes. The correspondences among these genes across different organisms were clarified by sequence homology computations. In this way a cross tabulation of 70 ribosomal proteins genes was constructed. On average, these were organized into 9-14 operons in each genome. There were also 25 non-ribosomal or putative genes in these mainly ribosomal protein operons. Hence the table contains 95 genes in total. It was found that: (i) the conservation of the block of about 20 r-proteins in the L3 and L4 operons across almost the entire eubacteria and archaebacteria is remarkable; (ii) some operons only belong to eubacteria or archaebacteria; (iii) although the ribosomal protein operons are highly conserved within domain, there are fine variations in some operons across different organisms within each domain, and these variations are informative on the evolutionary relations among the organisms. This method provides a new potential for studying the origin and evolution of old species.

  7. Conservation of ribosomal protein gene ordering in 16 complete genomes

    Institute of Scientific and Technical Information of China (English)

    王宁; 陈润生; 王永雄

    2000-01-01

    The organization of ribosomal proteins in 16 prokaryotic genomes was studied as an example of comparative genome analyses of gene systems. Hypothetical ribosomal protein-containing operons were constructed. These operons also contained putative genes and other non-ribosomal genes. The correspondences among these genes across different organisms were clarified by sequence homology computations. In this way a cross tabulation of 70 ribosomal proteins genes was constructed. On average, these were organized into 9-14 operons in each genome. There were also 25 non-ribosomal or putative genes in these mainly ribosomal protein operons. Hence the table contains 95 genes in total. It was found that: (i) the conservation of the block of about 20 r-proteins in the L3 and L4 operons across almost the entire eubacteria and ar-chaebacteria is remarkable; (ii) some operons only belong to eubacteria or archaebacte-ria; (iii) although the ribosomal protein operons are highly conserved within domain, there are fine variat

  8. Ribosomal crystallography: peptide bond formation and its inhibition.

    Science.gov (United States)

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada

    2003-09-01

    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  9. Genome-wide screening of Saccharomyces cerevisiae genes required to foster tolerance towards industrial wheat straw hydrolysates.

    Science.gov (United States)

    Pereira, Francisco B; Teixeira, Miguel C; Mira, Nuno P; Sá-Correia, Isabel; Domingues, Lucília

    2014-12-01

    The presence of toxic compounds derived from biomass pre-treatment in fermentation media represents an important drawback in second-generation bio-ethanol production technology and overcoming this inhibitory effect is one of the fundamental challenges to its industrial production. The aim of this study was to systematically identify, in industrial medium and at a genomic scale, the Saccharomyces cerevisiae genes required for simultaneous and maximal tolerance to key inhibitors of lignocellulosic fermentations. Based on the screening of EUROSCARF haploid mutant collection, 242 and 216 determinants of tolerance to inhibitory compounds present in industrial wheat straw hydrolysate (WSH) and in inhibitor-supplemented synthetic hydrolysate were identified, respectively. Genes associated to vitamin metabolism, mitochondrial and peroxisomal functions, ribosome biogenesis and microtubule biogenesis and dynamics are among the newly found determinants of WSH resistance. Moreover, PRS3, VMA8, ERG2, RAV1 and RPB4 were confirmed as key genes on yeast tolerance and fermentation of industrial WSH. PMID:25287021

  10. Heterologous Expression of Membrane and Soluble Proteins Derepresses GCN4 mRNA Translation in the Yeast Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Steffensen, L.; Pedersen, P. A.

    2006-01-01

    -located endogenous H-ATPase also induced GCN4 translation. Derepression of GCN4 translation required phosphorylation of eIF-2 , the tRNA binding domain of Gcn2p, and the ribosome-associated proteins Gcn1p and Gcn20p. The increase in Gcn4p density in response to heterologous expression did not induce transcription...... from the HIS4 promoter, a traditional Gcn4p target.......This paper describes the first physiological response at the translational level towards heterologous protein production in Saccharomyces cerevisiae. In yeast, the phosphorylation of eukaryotic initiation factor 2 (eIF-2 ) by Gcn2p protein kinase mediates derepression of GCN4 mRNA translation. Gcn4...

  11. Temporal Regulation of Distinct Internal Ribosome Entry Sites of the Dicistroviridae Cricket Paralysis Virus.

    Science.gov (United States)

    Khong, Anthony; Bonderoff, Jennifer M; Spriggs, Ruth V; Tammpere, Erik; Kerr, Craig H; Jackson, Thomas J; Willis, Anne E; Jan, Eric

    2016-01-01

    Internal ribosome entry is a key mechanism for viral protein synthesis in a subset of RNA viruses. Cricket paralysis virus (CrPV), a member of Dicistroviridae, has a positive-sense single strand RNA genome that contains two internal ribosome entry sites (IRES), a 5'untranslated region (5'UTR) and intergenic region (IGR) IRES, that direct translation of open reading frames (ORF) encoding the viral non-structural and structural proteins, respectively. The regulation of and the significance of the CrPV IRESs during infection are not fully understood. In this study, using a series of biochemical assays including radioactive-pulse labelling, reporter RNA assays and ribosome profiling, we demonstrate that while 5'UTR IRES translational activity is constant throughout infection, IGR IRES translation is delayed and then stimulated two to three hours post infection. The delay in IGR IRES translation is not affected by inhibiting global translation prematurely via treatment with Pateamine A. Using a CrPV replicon that uncouples viral translation and replication, we show that the increase in IGR IRES translation is dependent on expression of non-structural proteins and is greatly stimulated when replication is active. Temporal regulation by distinct IRESs within the CrPV genome is an effective viral strategy to ensure optimal timing and expression of viral proteins to facilitate infection. PMID:26797630

  12. Mechanical insights into ribosomal progression overcoming RNA G-quadruplex from periodical translation suppression in cells

    Science.gov (United States)

    Endoh, Tamaki; Sugimoto, Naoki

    2016-03-01

    G-quadruplexes formed on DNA and RNA can be roadblocks to movement of polymerases and ribosome on template nucleotides. Although folding and unfolding processes of the G-quadruplexes are deliberately studied in vitro, how the mechanical and physical properties of the G-quadruplexes affect intracellular biological systems is still unclear. In this study, mRNAs with G-quadruplex forming sequences located either in the 5‧ untranslated region (UTR) or in the open reading frame (ORF) were constructed to evaluate positional effects of the G-quadruplex on translation suppression in cells. Periodic fluctuation of translation suppression was observed at every three nucleotides within the ORF but not within the 5‧ UTR. The results suggested that difference in motion of ribosome at the 5‧ UTR and the ORF determined the ability of the G-quadruplex structure to act as a roadblock to translation in cells and provided mechanical insights into ribosomal progression to overcome the roadblock.

  13. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    Energy Technology Data Exchange (ETDEWEB)

    He, Kaiyu [Department of Microbiology and Molecular Genetics (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Zhou, Hui-Ren [Food Science and Human Nutrition (United States); Pestka, James J., E-mail: pestka@msu.edu [Department of Microbiology and Molecular Genetics (United States); Food Science and Human Nutrition (United States); Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824 (United States)

    2012-11-15

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  14. Mechanisms for ribotoxin-induced ribosomal RNA cleavage

    International Nuclear Information System (INIS)

    The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activated kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via

  15. The DNA-damage signature in Saccharomyces cerevisiae is associated with single-strand breaks in DNA

    Directory of Open Access Journals (Sweden)

    Begley Thomas J

    2006-12-01

    Full Text Available Abstract Background Upon exposure to agents that damage DNA, Saccharomyces cerevisiae undergo widespread reprogramming of gene expression. Such a vast response may be due not only to damage to DNA but also damage to proteins, RNA, and lipids. Here the transcriptional response of S. cerevisiae specifically induced by DNA damage was discerned by exposing S. cerevisiae to a panel of three "radiomimetic" enediyne antibiotics (calicheamicin γ1I, esperamicin A1 and neocarzinostatin that bind specifically to DNA and generate varying proportions of single- and double-strand DNA breaks. The genome-wide responses were compared to those induced by the non-selective oxidant γ-radiation. Results Given well-controlled exposures that resulted in similar and minimal cell death (~20–25% across all conditions, the extent of gene expression modulation was markedly different depending on treatment with the enediynes or γ-radiation. Exposure to γ-radiation resulted in more extensive transcriptional changes classified both by the number of genes modulated and the magnitude of change. Common biological responses were identified between the enediynes and γ-radiation, with the induction of DNA repair and stress response genes, and the repression of ribosomal biogenesis genes. Despite these common responses, a fraction of the response induced by gamma radiation was repressed by the enediynes and vise versa, suggesting that the enediyne response is not entirely "radiomimetic." Regression analysis identified 55 transcripts with gene expression induction associated both with double- or single-strand break formation. The S. cerevisiae "DNA damage signature" genes as defined by Gasch et al. 1 were enriched among regulated transcripts associated with single-strand breaks, while genes involved in cell cycle regulation were associated with double-strand breaks. Conclusion Dissection of the transcriptional response in yeast that is specifically signaled by DNA strand

  16. Investigation of autonomous cell cycle oscillation in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hansen, Morten Skov

    2007-01-01

    Autonome Oscillationer i kontinuert kultivering af Saccharomyces cerevisiae Udgangspunktet for dette Ph.d. projekt var at søge at forstå, hvad der gør det muligt at opnå multiple statiske tilstande ved kontinuert kultivering af Saccharomyces cerevisiae med glukose som begrænsende substrat...

  17. Kluyveromyces lactis maintains Saccharomyces cerevisiae intron-encoded splicing signals.

    OpenAIRE

    Deshler, J O; Larson, G P; Rossi, J J

    1989-01-01

    The actin (ACT) gene from the budding yeast Kluyveromyces lactis was cloned, and the nucleotide sequence was determined. The gene had a single intron 778 nucleotides in length which possessed the highly conserved splicing signals found in Saccharomyces cerevisiae introns. We demonstrated splicing of heterologous ACT transcripts in both K. lactis and S. cerevisiae.

  18. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    Science.gov (United States)

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  19. Ploidy influences cellular responses to gross chromosomal rearrangements in saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Lemoine Sophie

    2011-06-01

    Full Text Available Abstract Background Gross chromosomal rearrangements (GCRs such as aneuploidy are key factors in genome evolution as well as being common features of human cancer. Their role in tumour initiation and progression has not yet been completely elucidated and the effects of additional chromosomes in cancer cells are still unknown. Most previous studies in which Saccharomyces cerevisiae has been used as a model for cancer cells have been carried out in the haploid context. To obtain new insights on the role of ploidy, the cellular effects of GCRs were compared between the haploid and diploid contexts. Results A total number of 21 haploid and diploid S. cerevisiae strains carrying various types of GCRs (aneuploidies, nonreciprocal translocations, segmental duplications and deletions were studied with a view to determining the effects of ploidy on the cellular responses. Differences in colony and cell morphology as well as in the growth rates were observed between mutant and parental strains. These results suggest that cells are impaired physiologically in both contexts. We also investigated the variation in genomic expression in all the mutants. We observed that gene expression was significantly altered. The data obtained here clearly show that genes involved in energy metabolism, especially in the tricarboxylic acid cycle, are up-regulated in all these mutants. However, the genes involved in the composition of the ribosome or in RNA processing are down-regulated in diploids but up-regulated in haploids. Over-expression of genes involved in the regulation of the proteasome was found to occur only in haploid mutants. Conclusion The present comparisons between the cellular responses of strains carrying GCRs in different ploidy contexts bring to light two main findings. First, GCRs induce a general stress response in all studied mutants, regardless of their ploidy. Secondly, the ploidy context plays a crucial role in maintaining the stoichiometric balance

  20. Effects of spaceflight on polysaccharides of Saccharomyces cerevisiae cell wall.

    Science.gov (United States)

    Liu, Hong-Zhi; Wang, Qiang; Liu, Xiao-Yong; Tan, Sze-Sze

    2008-12-01

    Freeze-dried samples of four Saccharomyces cerevisiae strains, namely, FL01, FL03, 2.0016, and 2.1424, were subjected to spaceflight. After the satellite's landing on Earth, the samples were recovered and changes in yeast cell wall were analyzed. Spaceflight strains of all S. cerevisiae strains showed significant changes in cell wall thickness (P growth curve analysis showed spaceflight S. cerevisiae 2.0016 had a faster growth rate, shorter lag phase periods, higher final biomass, and higher content of beta-glucan. Genetic stability analysis showed that prolonged subculturing of spaceflight strain S. cerevisiae 2.0016 did not lead to the appearance of variants, indicating that the genetic stability of S. cerevisiae 2.0016 mutant could be sufficient for its exploitation of beta-glucan production. PMID:18797865

  1. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  2. Molecular mechanisms of ribosomal protein gene coregulation.

    Science.gov (United States)

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  3. Nonenzymatic microorganism identification based on ribosomal RNA

    Science.gov (United States)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  4. Metabolic alterations during ascosporogenesis of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Sporulation of S. cerevisiae has been shown to alter the profiles of enzymes involved in gluconeogenesis and glycolysis. The enhancement in the levels of total cellular carbohydrates could be correlated with the enhancement in fructose 1,6-diphosphatase and trehalose-phosphate synthetase. The latter activity could account for the 15-fold increase in trehalose levels in sporulating cells. Glucose-6-phosphatase, pyruvate kinase and phosphofructokinase showed continuous decline during ascosporogenesis. The relative incorporation of radioactivity from possible precursors of gluconeogenesis indicated that acetate-2-14C alone could contribute to carbohydrate synthesis. (author)

  5. Identification of arginine- and lysine-methylation in the proteome of Saccharomyces cerevisiae and its functional implications

    Directory of Open Access Journals (Sweden)

    Gasteiger Elisabeth

    2010-02-01

    Full Text Available Abstract Background The methylation of eukaryotic proteins has been proposed to be widespread, but this has not been conclusively shown to date. In this study, we examined 36,854 previously generated peptide mass spectra from 2,607 Saccharomyces cerevisiae proteins for the presence of arginine and lysine methylation. This was done using the FindMod tool and 5 filters that took advantage of the high number of replicate analysis per protein and the presence of overlapping peptides. Results A total of 83 high-confidence lysine and arginine methylation sites were found in 66 proteins. Motif analysis revealed many methylated sites were associated with MK, RGG/RXG/RGX or WXXXR motifs. Functionally, methylated proteins were significantly enriched for protein translation, ribosomal biogenesis and assembly and organellar organisation and were predominantly found in the cytoplasm and ribosome. Intriguingly, methylated proteins were seen to have significantly longer half-life than proteins for which no methylation was found. Some 43% of methylated lysine sites were predicted to be amenable to ubiquitination, suggesting methyl-lysine might block the action of ubiquitin ligase. Conclusions This study suggests protein methylation to be quite widespread, albeit associated with specific functions. Large-scale tandem mass spectroscopy analyses will help to further confirm the modifications reported here.

  6. Saccharomyces cerevisiae: A novel and efficient biological control agent for Colletotrichum acutatum during pre-harvest.

    Science.gov (United States)

    Lopes, Marcos Roberto; Klein, Mariana Nadjara; Ferraz, Luriany Pompeo; da Silva, Aline Caroline; Kupper, Katia Cristina

    2015-06-01

    In this study, we evaluated the efficiency of six isolates of Saccharomyces cerevisiae in controlling Colletotrichum acutatum, the causal agent of postbloom fruit drop that occur in pre-harvest citrus. We analyzed the mechanisms of action involved in biological control such as: production of antifungal compounds, nutrient competition, detection of killer activity, and production of hydrolytic enzymes of the isolates of S. cerevisiae on C. acutatum and their efficiency in controlling postbloom fruit drop on detached citrus flowers. Our results showed that all six S. cerevisiae isolates produced antifungal compounds, competed for nutrients, inhibited pathogen germination, and produced killer activity and hydrolytic enzymes when in contact with the fungus wall. The isolates were able to control the disease when detached flowers were artificially inoculated, both preventively and curatively. In this work we identified a novel potential biological control agent for C. acutatum during pre-harvest. This is the first report of yeast efficiency for the biocontrol of postbloom fruit drop, which represents an important contribution to the field of biocontrol of diseases affecting citrus populations worldwide. PMID:25960430

  7. The effect of gamma irradiation on alcoholic fermentation of cassava by saccharomyces cerevisiae and kluyveromyces marxianus

    International Nuclear Information System (INIS)

    A study to examine the influence of gamma irradiation (Co60) on the production of alcohol from cassava by two yeast cultures, S. cerevisiae and a thermotolerant K. marxianus was carried out. Irradiation doses used were 0; 0.1; 0.3; 0.5 and 7 kGy. Two enzymes thermamyl and amyloglucosidase were used for liquifaction and saccharification, respectively. A part of the cassava substrate was enriched with NH4H2PO4 as nitrogen source. Irradiated yeast suspension (+-108 cells/ml) was inoculated to the medium to a final concentration of 5% (v/v). Incubation period was 3 days at a temperature of 30oC for S. cerevisiae and 37oC for K. marxianus. Results showed that gamma irradiation had a significant effect on the number of both yeast colonies. It decreased the number of yeast colonies, but not the content of ethanol produced by its fermentation. The yeast still viable after irradiation probably had an increased activity. Adding nitrogen to S. cerevisiae caused a decrease in the content of ethanol, but no significant effect was found on the number of colonies of both yeasts as affected by added nitrogen. (author). 10 refs

  8. The ribosome in action: Tuning of translational efficiency and protein folding.

    Science.gov (United States)

    Rodnina, Marina V

    2016-08-01

    The cellular proteome is shaped by the combined activities of the gene expression and quality control machineries. While transcription plays an undoubtedly important role, in recent years also translation emerged as a key step that defines the composition and quality of the proteome and the functional activity of proteins in the cell. Among the different post-transcriptional control mechanisms, translation initiation and elongation provide multiple checkpoints that can affect translational efficiency. A multitude of specific signals in mRNAs can determine the frequency of translation initiation, choice of the open reading frame, global and local elongation velocities, and the folding of the emerging protein. In addition to specific signatures in the mRNAs, also variations in the global pools of translation components, including ribosomes, tRNAs, mRNAs, and translation factors can alter translational efficiencies. The cellular outcomes of phenomena such as mRNA codon bias are sometimes difficult to understand due to the staggering complexity of covariates that affect codon usage, translation, and protein folding. Here we summarize the experimental evidence on how the ribosome-together with the other components of the translational machinery-can alter translational efficiencies of mRNA at the initiation and elongation stages and how translation velocity affects protein folding. We seek to explain these findings in the context of mechanistic work on the ribosome. The results argue in favour of a new understanding of translation control as a hub that links mRNA homeostasis to production and quality control of proteins in the cell. PMID:27198711

  9. Biosorption of cesium by saccharomyces cerevisia

    International Nuclear Information System (INIS)

    The characteristics of Cs+ biosorption by Saccharornyces cerevisia was investigated, including the biosorption kinetics, biosorption equilibrium, isotherm as well as the IR spectrum of biomass pre- and post-biosorption. The experimental results show that the process of Cs+ biosorption onto the biomass of Saccharornyces cerevisia can be devided into two stages, the first stage is physical sorption and the sorption equilibrium is very quickly reached (within 20 min). The biosorption kinetics can be described by the pseudo second-order equation quite well (R2=0.989), the kinetic parameters k2 and qe are 3.56 x 10-3 g/(mg·min) and 7.18 mg/g, respectively. The equilibrium isotherm data can be fitted with Langmuir and Freundlich models, with the maximum biosorptive capacity of 10.13 mg/g. Both the IR spectra of the biomass pre- and post-biosorption almost are same, and it indicates that the biosorption of Cs+ does not change the structure of the biomass, however, some adsorptive peaks shift. (authors)

  10. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...... gene product had no PRPP synthase activity. In contrast, expression of five pairwise combinations of PRS genes resulted in the formation of active PRPP synthase. These combinations were PRS1 PRS2, PRS1 PRS3, and PRS1 PRS4, as well as PRS5 PRS2 and PRS5 PRS4. None of the remaining five possible pairwise...... combinations of PRS genes appeared to produce active enzyme. Extract of an E. coli strain containing a plasmid-borne PRS1 gene and a chromosome-borne PRS3 gene contained detectable PRPP synthase activity, whereas extracts of strains containing PRS1 PRS2, PRS1 PRS4, PRS5 PRS2, or PRS5 PRS4 contained no...

  11. Response of Saccharomyces cerevisiae to cadmium stress

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Luciana Mara Costa; Ribeiro, Frederico Haddad; Neves, Maria Jose [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia], e-mail: luamatu@uol.com.br; Porto, Barbara Abranches Araujo; Amaral, Angela M.; Menezes, Maria Angela B.C. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Lab. de Ativacao Neutronica], e-mail: menezes@cdtn.br; Rosa, Carlos Augusto [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: carlrosa@icb.ufmg

    2009-07-01

    The intensification of industrial activity has been greatly contributing with the increase of heavy metals in the environment. Among these heavy metals, cadmium becomes a serious pervasive environmental pollutant. The cadmium is a heavy metal with no biological function, very toxic and carcinogenic at low concentrations. The toxicity of cadmium and several other metals can be mainly attributed to the multiplicity of coordination complexes and clusters that they can form. Some aspects of the cellular response to cadmium were extensively investigated in the yeast Saccharomyces cerevisiae. The primary site of interaction between many toxic metals and microbial cells is the plasma membrane. Plasma-membrane permeabilisation has been reported in a variety of microorganisms following cadmium exposure, and is considered one mechanism of cadmium toxicity in the yeast. In this work, using the yeast strain S. cerevisiae W303-WT, we have investigated the relationships between Cd uptake and release of cellular metal ions (K{sup +} and Na{sup +}) using neutron activation technique. The neutron activation was an easy, rapid and suitable technique for doing these metal determinations on yeast cells; was observed the change in morphology of the strains during the process of Cd accumulation, these alterations were observed by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM) during incorporation of cadmium. (author)

  12. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design...

  13. Evidence for Domesticated and Wild Populations of Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Saccharomyces cerevisiae is predominantly found in association with human activities, particularly the production of alcoholic beverages. S. paradoxus, the closest known relative of S. cerevisiae, is commonly found on exudates and bark of deciduous trees and in associated soils. This has lead to the idea that S. cerevisiae is a domesticated species, specialized for the fermentation of alcoholic beverages, and isolates of S. cerevisiae from other sources simply represent migrants from these fermentations. We have surveyed DNA sequence diversity at five loci in 81 strains of S. cerevisiae that were isolated from a variety of human and natural fermentations as well as sources unrelated to alcoholic beverage production, such as tree exudates and immunocompromised patients. Diversity within vineyard strains and within saké strains is low, consistent with their status as domesticated stocks. The oldest lineages and the majority of variation are found in strains from sources unrelated to wine production. We propose a model whereby two specialized breeds of S. cerevisiae have been created, one for the production of grape wine and one for the production of saké wine. We estimate that these two breeds have remained isolated from one another for thousands of years, consistent with the earliest archeological evidence for winemaking. We conclude that although there are clearly strains of S. cerevisiae specialized for the production of alcoholic beverages, these have been derived from natural populations unassociated with alcoholic beverage production, rather than the opposite.

  14. Initiation factor 2 stabilizes the ribosome in a semirotated conformation.

    Science.gov (United States)

    Ling, Clarence; Ermolenko, Dmitri N

    2015-12-29

    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  15. Chemical Genetics of Rapamycin-Insensitive TORC2 in S. cerevisiae

    Directory of Open Access Journals (Sweden)

    Joseph I. Kliegman

    2013-12-01

    Full Text Available Current approaches for identifying synergistic targets use cell culture models to see if the combined effect of clinically available drugs is better than predicted by their individual efficacy. New techniques are needed to systematically and rationally identify targets and pathways that may be synergistic targets. Here, we created a tool to screen and identify molecular targets that may synergize with new inhibitors of target of rapamycin (TOR, a conserved protein that is a major integrator of cell proliferation signals in the nutrient-signaling pathway. Although clinical results from TOR complex 1 (TORC1-specific inhibition using rapamycin analogs have been disappointing, trials using inhibitors that also target TORC2 have been promising. To understand this increased therapeutic efficacy and to discover secondary targets for combination therapy, we engineered Tor2 in S. cerevisiae to accept an orthogonal inhibitor. We used this tool to create a chemical epistasis miniarray profile (ChE-MAP by measuring interactions between the chemically inhibited Tor2 kinase and a diverse library of deletion mutants. The ChE-MAP identified known TOR components and distinguished between TORC1- and TORC2-dependent functions. The results showed a TORC2-specific interaction with the pentose phosphate pathway, a previously unappreciated TORC2 function that suggests a role for the complex in balancing the high energy demand required for ribosome biogenesis.

  16. Mechanism of Regulation of Intrachromatid Recombination and Long-Range Chromosome Interactions in Saccharomyces cerevisiae.

    Science.gov (United States)

    Zaman, Shamsu; Choudhury, Malay; Jiang, James C; Srivastava, Pankaj; Mohanty, Bidyut K; Danielson, Christopher; Humphrey, Sean J; Jazwinski, S Michal; Bastia, Deepak

    2016-05-15

    The NAD-dependent histone deacetylase Sir2 controls ribosomal DNA (rDNA) silencing by inhibiting recombination and RNA polymerase II-catalyzed transcription in the rDNA of Saccharomyces cerevisiae Sir2 is recruited to nontranscribed spacer 1 (NTS1) of the rDNA array by interaction between the RENT ( RE: gulation of N: ucleolar S: ilencing and T: elophase exit) complex and the replication terminator protein Fob1. The latter binds to its cognate sites, called replication termini (Ter) or replication fork barriers (RFB), that are located in each copy of NTS1. This work provides new mechanistic insights into the regulation of rDNA silencing and intrachromatid recombination by showing that Sir2 recruitment is stringently regulated by Fob1 phosphorylation at specific sites in its C-terminal domain (C-Fob1), which also regulates long-range Ter-Ter interactions. We show further that long-range Fob1-mediated Ter-Ter interactions in trans are downregulated by Sir2. These regulatory mechanisms control intrachromatid recombination and the replicative life span (RLS). PMID:26951198

  17. Stochastic kinetics of ribosomes: single motor properties and collective behavior

    CERN Document Server

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Synthesis of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an {\\it exact} analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a ``Michaelis-Menten-like'' equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechano-chemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a c...

  18. Systematic identification of novel, essential host genes affecting bromovirus RNA replication.

    Directory of Open Access Journals (Sweden)

    Brandi L Gancarz

    Full Text Available Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol levels were significantly increased in strains depleted for a heat shock protein (HSF1 or proteasome components (PRE1 and RPT6, suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.

  19. Probing glycolytic and membrane potential oscillations in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Poulsen, Allan K.; Andersen, Ann Zahle; Brasen, Jens Christian; Scharff-Poulsen, Anne Marie; Olsen, Lars Folke

    2008-01-01

    We have investigated glycolytic oscillations under semi-anaerobic conditions in Saccharomyces cerevisiae by means of NADH fluorescence, measurements of intracellular glucose concentration, and mitochondrial membrane potential. The glucose concentration was measured using an optical nanosensor...

  20. Evolutionary engineering of Saccharomyces cerevisiae for efficient aerobic xylose consumption

    DEFF Research Database (Denmark)

    Scalcinati, Gionata; Otero, José Manuel; Van Vleet, Jennifer R. H.;

    2012-01-01

    flux to biomass production. Such a platform may then be enhanced with complementary metabolic engineering strategies that couple biomass production with high value-added chemical. Saccharomyces cerevisiae, expressing xylose reductase, xylitol dehydrogenase and xylulose kinase, from the native xylose...

  1. Effect of Some Fermentation Parameters on Ethanol Production from Beet Molasses by Saccharomyces cerevisiae CAIM13

    OpenAIRE

    Awatif A. Al-Judaibi

    2011-01-01

    Problem statement: Some component of fermentation medium showed to reduce the Saccharomyces cerivisae production of ethanol. Approach: This study was designed to evaluate the role of some fermentation parameters in affecting ethanol productivity from beet molasses BM by Saccharomyces cerevisiae CAIM13. Results: Increase in cell concentration (inoculums size) of the yeast above 3.6×105 cells/100 mL decreased the ethanol yield. The yeast could tolerate ethanol ...

  2. POS5 Gene of Saccharomyces cerevisiae Encodes a Mitochondrial NADH Kinase Required for Stability of Mitochondrial DNA

    OpenAIRE

    Strand, Micheline K.; Stuart, Gregory R.; Longley, Matthew J.; Graziewicz, Maria A.; Dominick, Olivia C.; Copeland, William C.

    2003-01-01

    In a search for nuclear genes that affect mutagenesis of mitochondrial DNA in Saccharomyces cerevisiae, an ATP-NAD (NADH) kinase, encoded by POS5, that functions exclusively in mitochondria was identified. The POS5 gene product was overproduced in Escherichia coli and purified without a mitochondrial targeting sequence. A direct biochemical assay demonstrated that the POS5 gene product utilizes ATP to phosphorylate both NADH and NAD+, with a twofold preference for NADH. Disruption of POS5 inc...

  3. Identification of multiple interacting alleles conferring low glycerol and high ethanol yield in Saccharomyces cerevisiae ethanolic fermentation

    OpenAIRE

    Hubmann, Georg; Mathé, Lotte; Foulquié-Moreno, Maria R.; Duitama, Jorge; Nevoigt, Elke; Thevelein, Johan M.

    2013-01-01

    Background Genetic engineering of industrial microorganisms often suffers from undesirable side effects on essential functions. Reverse engineering is an alternative strategy to improve multifactorial traits like low glycerol/high ethanol yield in yeast fermentation. Previous rational engineering of this trait always affected essential functions like growth and stress tolerance. We have screened Saccharomyces cerevisiae biodiversity for specific alleles causing lower glycerol/higher ethanol y...

  4. The bacterial translocon SecYEG opens upon ribosome binding.

    Science.gov (United States)

    Knyazev, Denis G; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-06-21

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  5. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    Science.gov (United States)

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  6. Effects of ribosomal exit tunnel on protein's cotranslational folding

    International Nuclear Information System (INIS)

    In vivo, folding of many proteins occurs during their synthesis in the ribosome and continues after they have escaped from the ribosomal exit tunnel. In this research, we investigate the confinement effects of the ribosome on the cotranslational folding of three proteins, of PDB codes 1PGA, 1CRN and 2RJX, by using a coarse-grained model and molecular dynamics simulation. The exit tunnel is modeled as a hollow cylinder attached to a flat wall, whereas a Go-like model is adopted for the proteins. Our results show that the exit tunnel has a strong effect on the folding mechanism by setting an order by which the secondary and tertiary structures are formed. For protein 1PGA, the folding follows two different folding routes. The presence of the tunnel also improves the foldability of protein. (author)

  7. Molecular profiling of activated neurons by phosphorylated ribosome capture.

    Science.gov (United States)

    Knight, Zachary A; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L; Wysocki, Robert W; Emiliano, Ana; Ekstrand, Mats I; Friedman, Jeffrey M

    2012-11-21

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, thereby enriching directly for the mRNAs expressed in discrete subpopulations of activated cells. We use this approach to identify neurons in the hypothalamus regulated by changes in salt balance or food availability. We show that galanin neurons are activated by fasting and that prodynorphin neurons restrain food intake during scheduled feeding. These studies identify elements of the neural circuit that controls food intake and illustrate how the activity-dependent capture of cell-type-specific transcripts can elucidate the functional organization of a complex tissue. PMID:23178128

  8. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  9. Accumulation and chemical states of radiocesium by fungus Saccharomyces cerevisiae

    Science.gov (United States)

    Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozai, Naofumi; Yamasaki, Shinya; Yu, Qianqian

    2014-05-01

    After accident of Fukushima Daiichi Nuclear Power Plant, the fall-out radiocesium was deposited on the ground. Filamentous fungus is known to accumulate radiocesium in environment, even though many minerals are involved in soil. These facts suggest that fungus affect the migration behavior of radiocesium in the environment. However, accumulation mechanism of radiocesium by fungus is not understood. In the present study, accumulation and chemical states change of Cs by unicellular fungus of Saccharomyces cerevisiae have been studied to elucidate the role of microorganisms in the migration of radiocesium in the environment. Two different experimental conditions were employed; one is the accumulation experiments of radiocesium by S. cerevisiae from the agar medium containing 137Cs and a mineral of zeolite, vermiculite, smectite, mica, or illite. The other is the experiments using stable cesium to examine the chemical states change of Cs. In the former experiment, the cells were grown on membrane filter of 0.45 μm installed on the agar medium. After the grown cells were weighed, radioactivity in the cells was measured by an autoradiography technique. The mineral weight contents were changed from 0.1% to 1% of the medium. In the latter experiment, the cells were grown in the medium containing stable Cs between 1 mM and 10mM. The Cs accumulated cells were analyzed by SEM-EDS and EXAFS. The adsorption experiments of cesium by the cells under resting condition were also conducted to test the effect of cells metabolic activity. Without mineral in the medium, cells of S. cerevisiae accumulated 1.5x103 Bq/g from the medium containing 137Cs of 2.6x102 Bq/g. When mineral was added in the medium, concentration of 137Cs in the cells decreased. The concentration of 137Cs in the cells from the medium containing different minerals were in the following order; smectite, illite, mica > vermiculite > zeolite. This order was nearly the same as the inverse of distribution coefficient of

  10. Characterization of the Export of Bulk Poly(A)+ mRNA in Saccharomyces cerevisiae during the Wine-Making Process

    OpenAIRE

    Izawa, Shingo; Takemura, Reiko; Miki, Takeo; Inoue, Yoshiharu

    2005-01-01

    Ethanol stress affects the nuclear export of mRNA similarly to heat shock in Saccharomyces cerevisiae. However, we have little information about mRNA transport in actual alcoholic fermentation. Here we characterized the transport of mRNA during wine making and found that bulk poly(A)+ mRNA accumulated in the nucleus as fermentation progressed.

  11. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin

    2008-10-01

    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  12. Optimization of Real-Time PCR Assay for Rapid and Sensitive Detection of Eubacterial 16S Ribosomal DNA in Platelet Concentrates

    OpenAIRE

    T. Mohammadi; Reesink, H W; Vandenbroucke-Grauls, C. M. J. E.; Savelkoul, P. H. M.

    2003-01-01

    A real-time PCR assay was developed for rapid detection of eubacterial 16S ribosomal DNA in platelet concentrates. The sensitivity of this assay can be hampered by contaminating DNA in the PCR reagents. Digestion of the PCR reagents with Sau3AI prior to PCR amplification was effective in eliminating this contaminating DNA without affecting the sensitivity of the assay.

  13. Biosorption of 241Am by immobilized Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Americium-241 is one of the most serious radioactive contaminating nuclides due to its high toxicity and long half-life. The encouraging biosorption of 241Am from aqueous solutions by free Saccharomyces cerevisiae (S. cerevisiae) has been observed in our previous experiments. 241Am biosorption by immobilized S. cerevisiae and the effect of the various experimental conditions on the adsorption were investigated. The results indicated that the 241Am biosorption by immobilized S. cerevisiae is still very efficient, and immobilized S. cerevisiae can be used repeatedly or continuously. The biosorption equilibrium was achieved within 2 hours, and more than 92% of 241Am was removed by immobilized S. cerevisiae in the pH 1-4 range. No significant differences in 241Am biosorption were observed at 15-45 deg C. The immobilized S. cerevisiae, even after used repeatedly for 6 times, still could adsorb more than 90% of 241Am in solutions of 1.08 MBq/l (8.5 μg/l). At this moment, the total adsorption capacity for 241Am was more than 63.3 KBq/g globe (0.5 μg/g), but has not reached saturation yet. The 241Am left in solutions with initial concentration of 1.08 MBq/l (8.5 μg/l) was noted as low as ∼10 Bq/l (∼8.0 x 10-5 μg/l) after adsorption by the immobilized S. cerevisiae for 3 times. (author)

  14. Research on biosorption of uranium by saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    The effects of pH and the granularity of S. cerevisiae on the biosorption capacity were examined in order to study the properties of the biosorption of uranium from effluent by Saccharomyces cerevisiae. The isotherm was drawn. From the isotherm, the equations of Langmuir and Freundlich were achieved. The results showed the highest biosorption capacity was obtained when the pH value was about 6 and the granularity was 0.15-0.13 mm

  15. Glucose- and nitrogen sensing and regulatory mechanisms in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Rødkaer, Steven V; Færgeman, Nils J.

    2014-01-01

    steps and by numerous different regulators. As numerous of these regulating proteins, biochemical mechanisms, and cellular pathways are evolutionary conserved, complex biochemical information relevant to humans can be obtained by studying simple organisms. Thus, the yeast Saccharomyces cerevisiae has...... been recognized as a powerful model system to study fundamental biochemical processes. In the present review, we highlight central signaling pathways and molecular circuits conferring nitrogen- and glucose sensing in S. cerevisiae....

  16. Recovery of Saccharomyces cerevisiae from ethanol-induced growth inhibition.

    OpenAIRE

    Walker-Caprioglio, H M; Rodriguez, R J; Parks, L. W.

    1985-01-01

    Ethanol caused altered mobility of the lipophilic probe 1,6-diphenyl-1,3,5-hexatriene in plasma membrane preparations of Saccharomyces cerevisiae. Because lipids had been shown to protect yeast cells against ethanol toxicity, sterols, fatty acids, proteins, and combinations of these were tested; however, protection from growth inhibition was not seen. Ethanol-induced, prolonged lag periods and diminished growth rates in S. cerevisiae were reduced by an autoconditioning of the medium by the in...

  17. Isolation, identification and characterization of regional indigenous Saccharomyces cerevisiae strains

    OpenAIRE

    Hana Šuranská; Dana Vránová; Jiřina Omelková

    2016-01-01

    Abstract In the present work we isolated and identified various indigenous Saccharomyces cerevisiae strains and screened them for the selected oenological properties. These S. cerevisiae strains were isolated from berries and spontaneously fermented musts. The grape berries (Sauvignon blanc and Pinot noir) were grown under the integrated and organic mode of farming in the South Moravia (Czech Republic) wine region. Modern genotyping techniques such as PCR-fingerprinting and interdelta PCR typ...

  18. Isolation, identification and characterization of regional indigenous Saccharomyces cerevisiae strains

    OpenAIRE

    Šuranská, Hana; Vránová, Dana; Omelková, Jiřina

    2016-01-01

    In the present work we isolated and identified various indigenous Saccharomyces cerevisiae strains and screened them for the selected oenological properties. These S. cerevisiae strains were isolated from berries and spontaneously fermented musts. The grape berries (Sauvignon blanc and Pinot noir) were grown under the integrated and organic mode of farming in the South Moravia (Czech Republic) wine region. Modern genotyping techniques such as PCR-fingerprinting and interdelta PCR typing were ...

  19. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  20. Hurdle technology applied to prickly pear beverages for inhibiting Saccharomyces cerevisiae and Escherichia coli.

    Science.gov (United States)

    García-García, R; Escobedo-Avellaneda, Z; Tejada-Ortigoza, V; Martín-Belloso, O; Valdez-Fragoso, A; Welti-Chanes, J

    2015-06-01

    The effect of pH reduction (from 6·30-6·45 to 4·22-4·46) and the addition of antimicrobial compounds (sodium benzoate and potassium sorbate) on the inhibition of Saccharomyces cerevisiae and Escherichia coli in prickly pear beverages formulated with the pulp and peel of Villanueva (V, Opuntia albicarpa) and Rojo Vigor (RV, Opuntia ficus-indica) varieties during 14 days of storage at 25°C, was evaluated. RV variety presented the highest microbial inhibition. By combining pH reduction and preservatives, reductions of 6·2-log10 and 2·3-log10 for E. coli and S. cerevisiae were achieved respectively. Due to the low reduction of S. cerevisiae, pulsed electric fields (PEF) (11-15 μs/25-50 Hz/27-36 kV cm(-1)) was applied as another preservation factor. The combination of preservatives, pH reduction and PEF at 13-15 μs/25-50 Hz for V variety, and 11 μs/50 Hz, 13-15 μs/25-50 Hz for RV, had a synergistic effect on S. cerevisiae inhibition, achieving at least 3·4-log10 of microbial reduction immediately after processing, and more than 5-log10 at fourth day of storage at 25°C maintained this reduction during 21 days of storage (P > 0·05). Hurdle technology using PEF in combination with other factors is adequate to maintain stable prickly pear beverages during 21 days/25°C. Significance and impact of the study: Prickly pear is a fruit with functional value, with high content of nutraceuticals and antioxidant activity. Functional beverages formulated with the pulp and peel of this fruit represent an alternative for its consumption. Escherichia coli and Saccharomyces cerevisiae are micro-organisms that typically affect fruit beverage quality and safety. The food industry is looking for processing technologies that maintain quality without compromising safety. Hurdle technology, including pulsed electric fields (PEF) could be an option to achieve this. The combination of PEF, pH reduction and preservatives is an alternative to obtain safe and minimally processed

  1. Eukaryotic ribosomes that lack a 5.8S RNA

    Science.gov (United States)

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  2. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    OpenAIRE

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which ha...

  3. Ribosomal crystallography: from crystal growth to initial phasing

    Science.gov (United States)

    Thygesen, J.; Krumbholz, S.; Levin, I.; Zaytzev-Bashan, A.; Harms, J.; Bartels, H.; Schlünzen, F.; Hansen, H. A. S.; Bennett, W. S.; Volkmann, N.; Agmon, I.; Eisenstein, M.; Dribin, A.; Maltz, E.; Sagi, I.; Morlang, S.; Fua, M.; Franceschi, F.; Weinstein, S.; Böddeker, N.; Sharon, R.; Anagnostopoulos, K.; Peretz, M.; Geva, M.; Berkovitch-Yellin, Z.; Yonath, A.

    1996-10-01

    Preliminary phases were determined by the application of the isomorphous replacement method at low and intermediate resolution for structure factor amplitudes collected from crystals of large and small ribosomal subunits from halophilic and thermophilic bacteria. Derivatization was performed with dense heavy atom clusters, either by soaking or by specific covalent binding prior to the crystallization. The resulting initial electron density maps contain features comparable in size to those expected for the corresponding particles. The packing arrangements of these maps have been compared with motifs observed by electron microscopy in positively stained thin sections of embedded three-dimensional crystals, as well as with phase sets obtained by ab-initio computations. Aimed at higher resolution phasing, procedures are being developed for multi-site binding of relatively small dense metal clusters at selected locations. Potential sites are being inserted either by mutagenesis or by chemical modifications to facilitate cluster binding to the large halophilic and the small thermophilic ribosomal subunits which yield crystals diffracting to the highest resolution obtained so far for ribosomes, 2.9 and 7.3 Å, respectively. For this purpose the surfaces of these ribosomal particles have been characterized and conditions for quantitative reversible detachment of selected ribosomal proteins have been found. The corresponding genes are being cloned, sequenced, mutated to introduce the reactive side-groups (mainly cysteines) and overexpressed. To assist the interpretation of the anticipated electron density maps, sub-ribosomal stable complexes were isolated from H50S. One of these complexes is composed of two proteins and the other is made of a stretch of the rRNA and a protein. For exploiting the exposed parts of the surface of these complexes for heavy atom binding and for attempting the determination of their three-dimensional structure, their components are being produced

  4. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics

    OpenAIRE

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.

    2011-01-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid ...

  5. Isolation, identification and characterization of regional indigenous Saccharomyces cerevisiae strains

    Science.gov (United States)

    Šuranská, Hana; Vránová, Dana; Omelková, Jiřina

    2016-01-01

    In the present work we isolated and identified various indigenous Saccharomyces cerevisiae strains and screened them for the selected oenological properties. These S. cerevisiae strains were isolated from berries and spontaneously fermented musts. The grape berries (Sauvignon blanc and Pinot noir) were grown under the integrated and organic mode of farming in the South Moravia (Czech Republic) wine region. Modern genotyping techniques such as PCR-fingerprinting and interdelta PCR typing were employed to differentiate among indigenous S. cerevisiae strains. This combination of the methods provides a rapid and relatively simple approach for identification of yeast of S. cerevisiae at strain level. In total, 120 isolates were identified and grouped by molecular approaches and 45 of the representative strains were tested for selected important oenological properties including ethanol, sulfur dioxide and osmotic stress tolerance, intensity of flocculation and desirable enzymatic activities. Their ability to produce and utilize acetic/malic acid was examined as well; in addition, H2S production as an undesirable property was screened. The oenological characteristics of indigenous isolates were compared to a commercially available S. cerevisiae BS6 strain, which is commonly used as the starter culture. Finally, some indigenous strains coming from organically treated grape berries were chosen for their promising oenological properties and these strains will be used as the starter culture, because application of a selected indigenous S. cerevisiae strain can enhance the regional character of the wines. PMID:26887243

  6. Isolation, identification and characterization of regional indigenous Saccharomyces cerevisiae strains.

    Science.gov (United States)

    Šuranská, Hana; Vránová, Dana; Omelková, Jiřina

    2016-01-01

    In the present work we isolated and identified various indigenous Saccharomyces cerevisiae strains and screened them for the selected oenological properties. These S. cerevisiae strains were isolated from berries and spontaneously fermented musts. The grape berries (Sauvignon blanc and Pinot noir) were grown under the integrated and organic mode of farming in the South Moravia (Czech Republic) wine region. Modern genotyping techniques such as PCR-fingerprinting and interdelta PCR typing were employed to differentiate among indigenous S. cerevisiae strains. This combination of the methods provides a rapid and relatively simple approach for identification of yeast of S. cerevisiae at strain level. In total, 120 isolates were identified and grouped by molecular approaches and 45 of the representative strains were tested for selected important oenological properties including ethanol, sulfur dioxide and osmotic stress tolerance, intensity of flocculation and desirable enzymatic activities. Their ability to produce and utilize acetic/malic acid was examined as well; in addition, H2S production as an undesirable property was screened. The oenological characteristics of indigenous isolates were compared to a commercially available S. cerevisiae BS6 strain, which is commonly used as the starter culture. Finally, some indigenous strains coming from organically treated grape berries were chosen for their promising oenological properties and these strains will be used as the starter culture, because application of a selected indigenous S. cerevisiae strain can enhance the regional character of the wines. PMID:26887243

  7. Isolation, identification and characterization of regional indigenous Saccharomyces cerevisiae strains

    Directory of Open Access Journals (Sweden)

    Hana Šuranská

    2016-03-01

    Full Text Available Abstract In the present work we isolated and identified various indigenous Saccharomyces cerevisiae strains and screened them for the selected oenological properties. These S. cerevisiae strains were isolated from berries and spontaneously fermented musts. The grape berries (Sauvignon blanc and Pinot noir were grown under the integrated and organic mode of farming in the South Moravia (Czech Republic wine region. Modern genotyping techniques such as PCR-fingerprinting and interdelta PCR typing were employed to differentiate among indigenous S. cerevisiae strains. This combination of the methods provides a rapid and relatively simple approach for identification of yeast of S. cerevisiae at strain level. In total, 120 isolates were identified and grouped by molecular approaches and 45 of the representative strains were tested for selected important oenological properties including ethanol, sulfur dioxide and osmotic stress tolerance, intensity of flocculation and desirable enzymatic activities. Their ability to produce and utilize acetic/malic acid was examined as well; in addition, H2S production as an undesirable property was screened. The oenological characteristics of indigenous isolates were compared to a commercially available S. cerevisiae BS6 strain, which is commonly used as the starter culture. Finally, some indigenous strains coming from organically treated grape berries were chosen for their promising oenological properties and these strains will be used as the starter culture, because application of a selected indigenous S. cerevisiae strain can enhance the regional character of the wines.

  8. In vitro screening of probiotic properties of Saccharomyces cerevisiae var. boulardii and food-borne Saccharomyces cerevisiae strains

    DEFF Research Database (Denmark)

    van der Aa Kuhle, Alis; Skovgaard, Kerstin; Jespersen, Lene

    2005-01-01

    nontumorigenic porcine jejunal epithelial cell line (IPEC-J2) was investigated by incorporation of H-3-methionine into the yeast cells and use of liquid scintillation counting. Only few of the food-borne S. cerevisiae strains exhibited noteworthy adhesiveness with the strongest levels of adhesion (13...... effects hence indicating that food-borne strains of S. cerevisiae may possess probiotic properties in spite of low adhesiveness. © 2004 Elsevier B.V. All rights reserved....

  9. Shigella toxin inhibition of binding and translation of polyuridylic acid by Escherichia coli ribosomes.

    OpenAIRE

    Olenick, J G; Wolfe, A D

    1980-01-01

    Shigella toxin inhibits polyuridylic acid-directed polymerization of phenylalanine in ribosome-enzyme systems obtained from Escherichia coli or from Shigella dysenteriae. The inhibition is the result of toxin acting on ribosomes to prevent polyuridylic acid attachment.

  10. A Ribosomal Perspective on Proteostasis and Aging.

    Science.gov (United States)

    Steffen, Kristan K; Dillin, Andrew

    2016-06-14

    As the first and most direct process influencing the proteostasis capacity of a cell, regulation of translation influences lifespan across taxa. Here we highlight some of the newly discovered means by which translational regulation affects cellular proteostasis, with a focus on mechanisms that may ultimately impinge upon the aging process. PMID:27304502

  11. Ligation-free ribosome profiling of cell type-specific translation in the brain

    OpenAIRE

    Hornstein, Nicholas; Torres, Daniela; Das Sharma, Sohani; Tang, Guomei; Canoll, Peter; Sims, Peter A

    2016-01-01

    Ribosome profiling has emerged as a powerful tool for genome-wide measurements of translation, but library construction requires multiple ligation steps and remains cumbersome relative to more conventional deep-sequencing experiments. We report a new, ligation-free approach to ribosome profiling that does not require ligation. Library construction for ligation-free ribosome profiling can be completed in one day with as little as 1 ng of purified RNA footprints. We apply ligation-free ribosome...

  12. The Database of Ribosomal Cross-links: an update.

    OpenAIRE

    Baranov, P. V.; Kubarenko, A V; Gurvich, O L; Shamolina, T A; Brimacombe, R

    1999-01-01

    The Database of Ribosomal Cross-links (DRC) was created in 1997. Here we describe new data incorporated into this database and several new features of the DRC. The DRC is freely available via World Wide Web at http://visitweb.com/database/ or http://www. mpimg-berlin-dahlem.mpg.de/ approximately ag_ribo/ag_brimacombe/drc/

  13. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.; Meerwinck, W.; Stuhrmann, H.B.; Pedersen, J.S.; Koch, M.H.J.; Volkov, V.V.; Kozin, M.B.; Svergun, D.I.

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast-vari...

  14. The ribosome and the mechanism of protein synthesis

    International Nuclear Information System (INIS)

    In virtually all forms of life on earth, proteins in each cell are made according to a genetic blueprint, in the form of DNA. The translation of copies of this genetic blueprint (in the form of messenger RNA) into polypeptides is performed on the ribosome, a highly complex molecular machine composed of RNAs and proteins. To this end, special adaptor molecules called transfer RNAs are lined up by the ribosome in the sequence dictated by the genetic code, such that the amino acids carried by these molecules can be linked into a polypeptide. Several cofactors are involved in these processes, some of which require energy freed up by GTP hydrolysis. Although the ribosome was discovered more than 50 years ago, its structure has only been solved recently by X-ray crystallography. Another technique, cryo-electron microscopy, is starting to contribute toward our understanding of the ribosome's function, by portraying its conformational changes and binding interactions with the cofactors and tRNA

  15. The ABC of Ribosome-Related Antibiotic Resistance

    Science.gov (United States)

    Wilson, Daniel N.

    2016-01-01

    ABSTRACT The increase in multidrug-resistant pathogenic bacteria is limiting the utility of our current arsenal of antimicrobial agents. Mechanistically understanding how bacteria obtain antibiotic resistance is a critical first step to the development of improved inhibitors. One common mechanism for bacteria to obtain antibiotic resistance is by employing ATP-binding cassette (ABC) transporters to actively pump the drug from the cell. The ABC-F family includes proteins conferring resistance to a variety of clinically important ribosome-targeting antibiotics; however, controversy remains as to whether resistance is conferred via efflux like other ABC transporters or whether another mechanism, such as ribosome protection, is at play. A recent study by Sharkey and coworkers (L. K. Sharkey, T. A. Edwards, and A. J. O’Neill, mBio 7:e01975-15, 2016, http://dx.doi.org/10.1128/mBio.01975-15) provides strong evidence that ABC-F proteins conferring antibiotic resistance utilize ribosome protection mechanisms, namely, by interacting with the ribosome and displacing the drug from its binding site, thus revealing a novel role for ABC-F proteins in antibiotic resistance. PMID:27143393

  16. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.;

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  17. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin; Brunk, Elizabeth; Lechner, Anna; Zengler, Karsten; Palsson, Bernhard O.

    2015-01-01

    the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time...... a high fraction of informative reads, all while retaining the high quality standards of the existing protocol....

  18. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...

  19. Lactococcus lactis YfiA is necessary and sufficient for ribosome dimerization

    NARCIS (Netherlands)

    Puri, Pranav; Eckhardt, Thomas H; Franken, Linda E; Fusetti, Fabrizia; Stuart, Marc C A; Boekema, Egbert J; Kuipers, Oscar P; Kok, Jan; Poolman, Berend

    2014-01-01

    Dimerization and inactivation of ribosomes in Escherichia coli is a two-step process that involves the binding of ribosome modulation factor (RMF) and hibernation promotion factor (HPF). Lactococcus lactisMG1363 expresses a protein, YfiA(Ll), which associates with ribosomes in the stationary phase o

  20. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  1. CK2 activity is modulated by growth rate in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Research highlights: → CK2 subunits are nuclear both in glucose and in ethanol growing yeast cells. → CK2 activity is modulated in S. cerevisiae. → CK2 activity is higher in conditions supporting higher growth rates. → Vmax is higher in faster growing cells, while Km is not affected. -- Abstract: CK2 is a highly conserved protein kinase controlling different cellular processes. It shows a higher activity in proliferating mammalian cells, in various types of cancer cell lines and tumors. The findings presented herein provide the first evidence of an in vivo modulation of CK2 activity, dependent on growth rate, in Saccharomyces cerevisiae. In fact, CK2 activity, assayed on nuclear extracts, is shown to increase in exponential growing batch cultures at faster growth rate, while localization of catalytic and regulatory subunits is not nutritionally modulated. Differences in intracellular CK2 activity of glucose- and ethanol-grown cells appear to depend on both increase in molecule number and kcat. Also in chemostat cultures nuclear CK2 activity is higher in faster growing cells providing the first unequivocal demonstration that growth rate itself can affect CK2 activity in a eukaryotic organism.

  2. Horizontally acquired oligopeptide transporters favour adaptation of Saccharomyces cerevisiae wine yeast to oenological environment.

    Science.gov (United States)

    Marsit, Souhir; Sanchez, Isabelle; Galeote, Virginie; Dequin, Sylvie

    2016-04-01

    In the past decade, horizontal gene transfer (HGT) has emerged as a major evolutionary process that has shaped the genome of Saccharomyces cerevisiae wine yeasts. We recently showed that a large Torulaspora microellipsoides genomic island carrying two oligopeptide transporters encoded by FOT genes increases the fitness of wine yeast during fermentation of grape must. However, the impact of these genes on the metabolic network of S. cerevisiae remained uncharacterized. Here we show that Fot-mediated peptide uptake substantially affects the glutamate node and the NADPH/NADP(+) balance, resulting in the delayed uptake of free amino acids and altered profiles of metabolites and volatile compounds. Transcriptome analysis revealed that cells using a higher amount of oligopeptides from grape must are less stressed and display substantial variation in the expression of genes in the central pathways of carbon and nitrogen metabolism, amino acid and protein biosynthesis, and the oxidative stress response. These regulations shed light on the molecular and metabolic mechanisms involved in the higher performance and fitness conferred by the HGT-acquired FOT genes, pinpointing metabolic effects that can positively affect the organoleptic balance of wines. PMID:26549518

  3. Differential effects of ribosomal proteins and Mg2+ ions on a conformational switch during 30S ribosome 5'-domain assembly.

    Science.gov (United States)

    Abeysirigunawardena, Sanjaya C; Woodson, Sarah A

    2015-11-01

    Ribosomal protein S4 nucleates assembly of the 30S ribosome 5' and central domains, which is crucial for the survival of cells. Protein S4 changes the structure of its 16S rRNA binding site, passing through a non-native intermediate complex before forming native S4-rRNA contacts. Ensemble FRET was used to measure the thermodynamic stability of non-native and native S4 complexes in the presence of Mg(2+) ions and other 5'-domain proteins. Equilibrium titrations of Cy3-labeled 5'-domain RNA with Cy5-labeled protein S4 showed that Mg(2+) ions preferentially stabilize the native S4-rRNA complex. In contrast, ribosomal proteins S20 and S16 act by destabilizing the non-native S4-rRNA complex. The full cooperative switch to the native complex requires S4, S16, and S20 and is achieved to a lesser degree by S4 and S16. The resulting thermodynamic model for assembly of the 30S body illustrates how ribosomal proteins selectively bias the equilibrium between alternative rRNA conformations, increasing the cooperativity of rRNA folding beyond what can be achieved by Mg(2+) ions alone. PMID:26354770

  4. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress.

    Science.gov (United States)

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L J

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  5. Reduced expression of ribosomal proteins relieves microRNA-mediated repression.

    Science.gov (United States)

    Janas, Maja M; Wang, Eric; Love, Tara; Harris, Abigail S; Stevenson, Kristen; Semmelmann, Karlheinz; Shaffer, Jonathan M; Chen, Po-Hao; Doench, John G; Yerramilli, Subrahmanyam V B K; Neuberg, Donna S; Iliopoulos, Dimitrios; Housman, David E; Burge, Christopher B; Novina, Carl D

    2012-04-27

    MicroRNAs (miRNAs) regulate physiological and pathological processes by inducing posttranscriptional repression of target messenger RNAs (mRNAs) via incompletely understood mechanisms. To discover factors required for human miRNA activity, we performed an RNAi screen using a reporter cell line of miRNA-mediated repression of translation initiation. We report that reduced expression of ribosomal protein genes (RPGs) dissociated miRNA complexes from target mRNAs, leading to increased polysome association, translation, and stability of miRNA-targeted mRNAs relative to untargeted mRNAs. RNA sequencing of polysomes indicated substantial overlap in sets of genes exhibiting increased or decreased polysomal association after Argonaute or RPG knockdowns, suggesting similarity in affected pathways. miRNA profiling of monosomes and polysomes demonstrated that miRNAs cosediment with ribosomes. RPG knockdowns decreased miRNAs in monosomes and increased their target mRNAs in polysomes. Our data show that most miRNAs repress translation and that the levels of RPGs modulate miRNA-mediated repression of translation initiation. PMID:22541556

  6. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    Science.gov (United States)

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  7. Removing cadmium from electroplating wastewater by waste saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    DAI Shu-juan; WEI De-zhou; ZHOU Dong-qin; JIA Chun-yun; WANG Yu-juan; LIU Wen-gang

    2008-01-01

    The appropriate condition and scheme of removing cadmium from electroplating wastewater were investigated by adsorption-precipitation method using waste saccharomyces cerevisiae(WSC) as sorbent. Effect factors on biosorption of cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae and precipitation process of waste saccharomyces cerevisiae after adsorbing cadmium were studied. The results show that removal rate of cadmium is over 88% after 30 min adsorbing under the condition of cadmium concentration 26 mg/L, the dosage of waste saccharomyces cerevisiae 16.25 g/L, temperature 18 ℃, pH 6.0 and precipitation time 4 h. Biosorption-precipitation method is effective to remove cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae. The SEM, infrared spectroscopy and Zeta-potential of the cells show that chemical chelating is the main adsorption form; electrostatic attraction, hydrogen bonding and van der Waals force all function in adsorption process; and ―NH2―,―C=O―,―C=O―NH―,―CH3, ―OH are the main adsorption groups.

  8. Divergence in wine characteristics produced by wild and domesticated strains of Saccharomyces cerevisiae

    OpenAIRE

    Katie E Hyma; Saerens, Sofie M; Verstrepen, Kevin J.; Justin C Fay

    2011-01-01

    The budding yeast Saccharomyces cerevisiae is the primary species used by wine makers to convert sugar into alcohol during wine fermentation. Saccharomyces cerevisiae is found in vineyards, but is also found in association with oak trees and other natural sources. Although wild strains of S. cerevisiae as well as other Saccharomyces species are also capable of wine fermentation, a genetically distinct group of S. cerevisiae strains is primarily used to produce wine, consistent with the idea t...

  9. Saccharomyces cerevisiae Tti2 Regulates PIKK Proteins and Stress Response

    Science.gov (United States)

    Hoffman, Kyle S.; Duennwald, Martin L.; Karagiannis, Jim; Genereaux, Julie; McCarton, Alexander S.; Brandl, Christopher J.

    2016-01-01

    The TTT complex is composed of the three essential proteins Tel2, Tti1, and Tti2. The complex is required to maintain steady state levels of phosphatidylinositol 3-kinase-related kinase (PIKK) proteins, including mTOR, ATM/Tel1, ATR/Mec1, and TRRAP/Tra1, all of which serve as regulators of critical cell signaling pathways. Due to their association with heat shock proteins, and with newly synthesized PIKK peptides, components of the TTT complex may act as cochaperones. Here, we analyze the consequences of depleting the cellular level of Tti2 in Saccharomyces cerevisiae. We show that yeast expressing low levels of Tti2 are viable under optimal growth conditions, but the cells are sensitive to a number of stress conditions that involve PIKK pathways. In agreement with this, depleting Tti2 levels decreased expression of Tra1, Mec1, and Tor1, affected their localization and inhibited the stress responses in which these molecules are involved. Tti2 expression was not increased during heat shock, implying that it does not play a general role in the heat shock response. However, steady state levels of Hsp42 increase when Tti2 is depleted, and tti2L187P has a synthetic interaction with exon 1 of the human Huntingtin gene containing a 103 residue polyQ sequence, suggesting a general role in protein quality control. We also find that overexpressing Hsp90 or its cochaperones is synthetic lethal when Tti2 is depleted, an effect possibly due to imbalanced stoichiometry of a complex required for PIKK assembly. These results indicate that Tti2 does not act as a general chaperone, but may have a specialized function in PIKK folding and/or complex assembly. PMID:27172216

  10. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation.

    Science.gov (United States)

    Filbin, Megan E; Vollmar, Breanna S; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S

    2013-02-01

    The internal ribosome entry site (IRES) of the hepatitis C virus (HCV) drives noncanonical initiation of protein synthesis necessary for viral replication. Functional studies of the HCV IRES have focused on 80S ribosome formation but have not explored its role after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit's decoding groove cause only a local perturbation in IRES structure and result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, the mutations decrease IRES activity by inhibiting the first ribosomal translocation event, and modeling results suggest that this effect occurs through an interaction with a single ribosomal protein. The ability of the HCV IRES to manipulate the ribosome provides insight into how the ribosome's structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  11. Directed Evolution towards Increased Isoprenoid Production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Carlsen, Simon; Nielsen, Michael Lynge; Kielland-Brandt, Morten;

    Due to declining drug discovery rates from organic synthetic libraries, pharmaceutical companies are turning their attention towards secondary metabolites. Isoprenoids, also known as terpenoids, constitute the largest known group of secondary metabolites isolated to date, encompassing more than 55...... pyrophosphate and geranylgeranyl pyrophosphate for large-scale microbial production of terpenoids. Saccharomyces cerevisiae was chosen as production platform due to its widespread use in industrial production and the waste number of molecular biology tools which is available for its manipulation. The effort...... for discovering new genetic perturbations, which would results in and increased production of isoprenoids by S. cerevisiae has been very limited. This project is focus on creating diversity within a lycopene producing S. cerevisiae strain by construction of gDNA-, cDNA-, and transposon-libraries. The diversified...

  12. The effect of Saccharomyces cerevisiae on digestion and mortality in the volcano rabbit (Romerolagus diazi)

    Institute of Scientific and Technical Information of China (English)

    Rogelio Campos-Morales; Germn D Mendoza; Javier Ojeda; Fernando X Plata; Jos A Martnez

    2015-01-01

    An experiment was conducted to evaluate whether supplementation with a probiotic could enhance digestion and reduce mortality in the volcano rabbit in captivity. Two enclosures at Chapultepec Zoo, Mexico (114 individuals) were used in a cross-over design (two periods of 60 days) with the fol owing treatments:control group and supplementation with Saccharomyces cerevisiae (2×108 CFU/exhibit/day). Supplementation with the probiotic negatively affected (P<0.01) the digestibility of dry matter, organic matter, neutral detergent ifber (NDF) and energy. Mortality increased (P<0.04) fol owing supplementation with the probiotic (4.26%vs. 8.89%), primarily in the juvenile rabbits. The results indicate that yeast supplementation in the volcano rabbit negatively affects digestion and mortality in captivity.

  13. Improvement of glucose uptake rate and production of target chemicals by overexpressing hexose transporters and transcriptional activator Gcr1 in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kim, Daehee; Song, Ji-Yoon; Hahn, Ji-Sook

    2015-12-01

    Metabolic engineering to increase the glucose uptake rate might be beneficial to improve microbial production of various fuels and chemicals. In this study, we enhanced the glucose uptake rate in Saccharomyces cerevisiae by overexpressing hexose transporters (HXTs). Among the 5 tested HXTs (Hxt1, Hxt2, Hxt3, Hxt4, and Hxt7), overexpression of high-affinity transporter Hxt7 was the most effective in increasing the glucose uptake rate, followed by moderate-affinity transporters Hxt2 and Hxt4. Deletion of STD1 and MTH1, encoding corepressors of HXT genes, exerted differential effects on the glucose uptake rate, depending on the culture conditions. In addition, improved cell growth and glucose uptake rates could be achieved by overexpression of GCR1, which led to increased transcription levels of HXT1 and ribosomal protein genes. All genetic modifications enhancing the glucose uptake rate also increased the ethanol production rate in wild-type S. cerevisiae. Furthermore, the growth-promoting effect of GCR1 overexpression was successfully applied to lactic acid production in an engineered lactic acid-producing strain, resulting in a significant improvement of productivity and titers of lactic acid production under acidic fermentation conditions. PMID:26431967

  14. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly.

    Science.gov (United States)

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra

    2016-08-16

    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  15. Understanding the 3-hydroxypropionic acid tolerance mechanism in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Kildegaard, Kanchana Rueksomtawin; Juncker, Agnieszka; Hallstrom, Bjorn; Jensen, Niels Bjerg; Maury, Jerome; Nielsen, Jen; Förster, Jochen; Borodina, Irina

    sustainable alternative for production of acrylic acid from renewable feedstocks. We are establishing Saccharomyces cerevisiae as an alternative host for 3HP production. However, 3HP also inhibits yeast grow th at level well below what is desired for commercial applications. Therefore, we are aiming to...... improve 3HP tolerance in S. cerevisiae by applying adaptive evolution approach. We have generated yeast strains with sign ificantly improved capacity for tolerating 3HP when compared to the wild-type. We will present physiolo gical characterization, genome re-sequencing, and transcriptome analysis of the...

  16. Accumulation of gold using Baker's yeast, Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Authors have reported preconcentration of 152Eu, a long-lived fission product, by yeast cells, Saccharomyces cerevisiae. Gold being a precious metal is used in electroplating, hydrogenation catalyst, etc. Heterogeneous composition of samples and low concentration offers renewed interest in its selective extraction of gold using various extractants. Gold can be recovered from different solutions using various chemical reagents like amines, organophosphorus compounds, and extractants containing sulphur as donor atom, etc. In the present work, two different strains of baker's yeast, Saccharomyces cerevisiae have been used to study the preconcentration of gold at various experimental conditions

  17. Structure of Ynk1 from the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    The crystal structure of Ynk1, an NDPK from the yeast Saccharomyces cerevisiae, has been solved at 3.1 Å resolution. Nucleoside diphosphate kinase (NDPK) catalyzes the transfer of the γ-phosphate from nucleoside triphosphates to nucleoside diphosphates. In addition to biochemical studies, a number of crystal structures of NDPK from various organisms, including both native proteins and complexes with nucleotides or nucleotide analogues, have been determined. Here, the crystal structure of Ynk1, an NDPK from the yeast Saccharomyces cerevisiae, has been solved at 3.1 Å resolution. Structural analysis strongly supports the oligomerization state of this protein being hexameric rather than tetrameric

  18. Optimization of feeding strategy for the ergosterol production by yeasts Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Mojmir Rychtera

    2010-08-01

    Full Text Available Objective of this study was to optimize ergosterol production by yeast strain Saccharomyces cerevisiae with the use of computer controlled feeding of cultivation medium. Baker´s yeasts strain of Saccharomyces cerevisiae originally modified and selected as mutant D7 was further applied in an industrial scale and also in this investigation. Composition of cultivation medium was optimized with the use of a modified Rosenbrock´s method with regard to following components: glucose, yeast extract, ammonium sulphate, potassium dihydrogen phosphate, magnesium sulphate and calcium chloride. Cultivation of yeast culture was performed in 7 L laboratory bioreactor with a working volume of 5 L equipped with a control unit and linked to a computer, with dissolved oxygen tension measurement, oxygen and carbon dioxide analyzers. BIOGENES prototype software was created from the commercial control system Genesis for Windows 3.0 (GFW, from Iconics and CLIPS 6.04 for the PC-Windows platform. From various factors affecting sterol biosynthesis a specific growth rate was chosen. Feed rate was controlled according to mathematical model. In this case it dealt with a design of optimal profile of specific growth rate with consequent calculation of carbon dioxide profile. Sterol concentration in the dry biomass increased from 1.0 % up to 3 %. Key words: Saccharomyces cerevisiae yeasts, ergosterol, fed-batch cultivation control, effect of the specific growth rate. Resumen: El objetivo de este estudio fue optimizar la producción de ergosterol por una cepa de levadura Saccharomyces cerevisiae, controlando la alimentación de medio de cultivo por computadora. La cepa de levadura panadera Saccharomyces cerevisiae originalmente modificada y seleccionada como mutante D7 fue posteriormente utilizada a escala industrial y también para esta investigación. La composición del medio de cultivo fue optimizada usando el método modificado de Rosenbrock respecto a los siguientes

  19. Evolution of Drosophila ribosomal protein gene core promoters

    OpenAIRE

    Ma, Xiaotu; Zhang, Kangyu; Li, Xiaoman

    2008-01-01

    The coordinated expression of ribosomal protein genes (RPGs) has been well documented in many species. Previous analyses of RPG promoters focus only on Fungi and mammals. Recognizing this gap and using a comparative genomics approach, we utilize a motif-finding algorithm that incorporates cross-species conservation to identify several significant motifs in Drosophila RPG promoters. As a result, significant differences of the enriched motifs in RPG promoter are found among Drosophila, Fungi, a...

  20. Revised phylogeny of whales suggested by mitochondrial ribosomal DNA sequences

    OpenAIRE

    Milinkovitch, M.C.; Orti, G.; Meyer, A.

    1993-01-01

    Living cetaceans are subdivided into two highly distinct suborders, Odontoceti (the echolocating toothed whales) and Mysticeti (the filter-feeding baleen whales), which are believed to have had a long independent history. Here we report the determination of DNA sequences from two mitochondrial ribosomal gene segments (930 base pairs per species) for 16 species of cetaceans, a perissodactyl and a sloth, and construct the first phylogeny for whales and dolphins based on explicit cladistic metho...

  1. Structural Insights into tRNA Dynamics on the Ribosome

    Directory of Open Access Journals (Sweden)

    Xabier Agirrezabala

    2015-04-01

    Full Text Available High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  2. Structural Insights into tRNA Dynamics on the Ribosome.

    Science.gov (United States)

    Agirrezabala, Xabier; Valle, Mikel

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  3. Structural Insights into tRNA Dynamics on the Ribosome

    OpenAIRE

    Xabier Agirrezabala; Mikel Valle

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation.

  4. Visualization of ribosomal RNA operon copy number distribution

    OpenAIRE

    DasGupta Indrani; Wu Martin; Rastogi Rajat; Fox George E

    2009-01-01

    Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tr...

  5. Poliovirus tropism and attenuation are determined after internal ribosome entry

    OpenAIRE

    Kauder, Steven E.; Racaniello, Vincent R

    2004-01-01

    Poliovirus replication is limited to a few organs, including the brain and spinal cord. This restricted tropism may be a consequence of organ-specific differences in translation initiation by the poliovirus internal ribosome entry site (IRES). A C-to-U mutation at base 472 in the IRES of the Sabin type 3 poliovirus vaccine strain, known to attenuate neurovirulence, may further restrict tropism by eliminating viral replication in the CNS. To determine the relationship between IRES-mediated tra...

  6. Ribosomal biosynthesis of α-amanitin in Galerina marginata

    OpenAIRE

    Luo, Hong; Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D

    2011-01-01

    Amatoxins, including α-amanitin, are bicyclic octapeptides found in mushrooms (Agaricomycetes, Agaricales) of certain species in the genera Amanita, Galerina, Lepiota, and Conocybe. Amatoxins and the chemically similar phallotoxins are synthesized on ribosomes in Amanita bisporigera, Amanita phalloides, and Amanita ocreata. In order to determine if amatoxins are synthesized by a similar mechanism in another, distantly related mushroom, we obtained genome survey sequence data from a monokaryot...

  7. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    Science.gov (United States)

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  8. Genome-Wide Analysis of the TORC1 and Osmotic Stress Signaling Network in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Jeremy Worley

    2016-02-01

    Full Text Available The Target of Rapamycin kinase Complex I (TORC1 is a master regulator of cell growth and metabolism in eukaryotes. Studies in yeast and human cells have shown that nitrogen/amino acid starvation signals act through Npr2/Npr3 and the small GTPases Gtr1/Gtr2 (Rags in humans to inhibit TORC1. However, it is unclear how other stress and starvation stimuli inhibit TORC1, and/or act in parallel with the TORC1 pathway, to control cell growth. To help answer these questions, we developed a novel automated pipeline and used it to measure the expression of a TORC1-dependent ribosome biogenesis gene (NSR1 during osmotic stress in 4700 Saccharomyces cerevisiae strains from the yeast knock-out collection. This led to the identification of 440 strains with significant and reproducible defects in NSR1 repression. The cell growth control and stress response proteins deleted in these strains form a highly connected network, including 56 proteins involved in vesicle trafficking and vacuolar function; 53 proteins that act downstream of TORC1 according to a rapamycin assay—including components of the HDAC Rpd3L, Elongator, and the INO80, CAF-1 and SWI/SNF chromatin remodeling complexes; over 100 proteins involved in signaling and metabolism; and 17 proteins that directly interact with TORC1. These data provide an important resource for labs studying cell growth control and stress signaling, and demonstrate the utility of our new, and easily adaptable, method for mapping gene regulatory networks.

  9. Transcriptome-wide mapping of pseudouridines: pseudouridine synthases modify specific mRNAs in S. cerevisiae.

    Directory of Open Access Journals (Sweden)

    Alexander F Lovejoy

    Full Text Available We developed a novel technique, called pseudouridine site identification sequencing (PSI-seq, for the transcriptome-wide mapping of pseudouridylation sites with single-base resolution from cellular RNAs based on the induced termination of reverse transcription specifically at pseudouridines following CMCT treatment. PSI-seq analysis of RNA samples from S. cerevisiae correctly detected all of the 43 known pseudouridines in yeast 18S and 25S ribosomal RNA with high specificity. Moreover, application of PSI-seq to the yeast transcriptome revealed the presence of site-specific pseudouridylation within dozens of mRNAs, including RPL11a, TEF1, and other genes implicated in translation. To identify the mechanisms responsible for mRNA pseudouridylation, we genetically deleted candidate pseudouridine synthase (Pus enzymes and reconstituted their activities in vitro. These experiments demonstrated that the Pus1 enzyme was necessary and sufficient for pseudouridylation of RPL11a mRNA, whereas Pus4 modified TEF1 mRNA, and Pus6 pseudouridylated KAR2 mRNA. Finally, we determined that modification of RPL11a at Ψ -68 was observed in RNA from the related yeast S. mikitae, and Ψ -239 in TEF1 mRNA was maintained in S. mikitae as well as S. pombe, indicating that these pseudouridylations are ancient, evolutionarily conserved RNA modifications. This work establishes that site-specific pseudouridylation of eukaryotic mRNAs is a genetically programmed RNA modification that naturally occurs in multiple yeast transcripts via distinct mechanisms, suggesting that mRNA pseudouridylation may provide an important novel regulatory function. The approach and strategies that we report here should be generally applicable to the discovery of pseudouridylation, or other RNA modifications, in diverse biological contexts.

  10. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    Directory of Open Access Journals (Sweden)

    Tan Bertrand

    2012-06-01

    Full Text Available Abstract Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters.

  11. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [3H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  12. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  13. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  14. Single Molecule Fluorescence Measurements of Ribosomal Translocation Dynamics

    Science.gov (United States)

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E.; Cooperman, Barry S.

    2011-01-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3 and Cy5 labeled tRNAs. Pre-translocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G·GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the post-translocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA·EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  15. Single-molecule fluorescence measurements of ribosomal translocation dynamics.

    Science.gov (United States)

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskarin; Cabral, Diana; Liu, Hanqing; Wang, Yuhong; Zhang, Haibo; Rosenblum, Gabriel; Smilansky, Zeev; Goldman, Yale E; Cooperman, Barry S

    2011-05-01

    We employ single-molecule fluorescence resonance energy transfer (smFRET) to study structural dynamics over the first two elongation cycles of protein synthesis, using ribosomes containing either Cy3-labeled ribosomal protein L11 and A- or P-site Cy5-labeled tRNA or Cy3- and Cy5-labeled tRNAs. Pretranslocation (PRE) complexes demonstrate fluctuations between classical and hybrid forms, with concerted motions of tRNAs away from L11 and from each other when classical complex converts to hybrid complex. EF-G⋅GTP binding to both hybrid and classical PRE complexes halts these fluctuations prior to catalyzing translocation to form the posttranslocation (POST) complex. EF-G dependent translocation from the classical PRE complex proceeds via transient formation of a short-lived hybrid intermediate. A-site binding of either EF-G to the PRE complex or of aminoacyl-tRNA⋅EF-Tu ternary complex to the POST complex markedly suppresses ribosome conformational lability. PMID:21549313

  16. Detecting actively translated open reading frames in ribosome profiling data.

    Science.gov (United States)

    Calviello, Lorenzo; Mukherjee, Neelanjan; Wyler, Emanuel; Zauber, Henrik; Hirsekorn, Antje; Selbach, Matthias; Landthaler, Markus; Obermayer, Benedikt; Ohler, Uwe

    2016-02-01

    RNA-sequencing protocols can quantify gene expression regulation from transcription to protein synthesis. Ribosome profiling (Ribo-seq) maps the positions of translating ribosomes over the entire transcriptome. We have developed RiboTaper (available at https://ohlerlab.mdc-berlin.de/software/), a rigorous statistical approach that identifies translated regions on the basis of the characteristic three-nucleotide periodicity of Ribo-seq data. We used RiboTaper with deep Ribo-seq data from HEK293 cells to derive an extensive map of translation that covered open reading frame (ORF) annotations for more than 11,000 protein-coding genes. We also found distinct ribosomal signatures for several hundred upstream ORFs and ORFs in annotated noncoding genes (ncORFs). Mass spectrometry data confirmed that RiboTaper achieved excellent coverage of the cellular proteome. Although dozens of novel peptide products were validated in this manner, few of the currently annotated long noncoding RNAs appeared to encode stable polypeptides. RiboTaper is a powerful method for comprehensive de novo identification of actively used ORFs from Ribo-seq data. PMID:26657557

  17. Influencia de la Peroxidación de Lípidos sobre el Daño Oxidativo Mitocondrial y la Integridad de Saccharomyces cerevisiae Influence of Lipoperoxidation over Mitochondrial Oxidative Damage and Integrity of Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Christian Cortés-Rojo

    2009-01-01

    Full Text Available Se ha estudiado la influencia de la peroxidación de lípidos sobre el daño oxidativo mitocondrial y la integridad de Saccharomyces cerevisiae. Para esto, se aumentó el grado de insaturación de las membranas celulares de S. cerevisiae con ácido α-linolénico (C18:3. Se obtuvieron esferoplastos para poder estudiar la función mitocondrial in situ. Se encontró que la peroxidación de lípidos, estimulada por la adición de Fe2+, incrementó únicamente en esferoplastos con C18:3, mientras que la función mitocondrial, medida como el consumo de oxígeno sensible a cianuro y la integridad celular, determinada por la exclusión del colorante azul de tripano, se ven afectadas de manera significativa sólo en esferoplastos con C18:3. Estos resultados muestran que la peroxidación de lípidos sensibiliza la integridad celular y la función mitocondrial hacia los daños por el estrés oxidativo.The influence of lipoperoxidation over mitochondrial oxidative damage and integrity of Saccharomyces cerevisiae has been studied. For this, the unsaturation degree of cell membranes from Saccharomyces cerevisiae was increased by adding α-linolenic acid (C18:3. Spheroplasts were obtained to evaluate in situ the mitochondrial function. Lipid peroxidation levels, stimulated by the treatment with Fe2+, increased only in spheroplasts with C18:3, while mitochondrial function, measured as cyanide-sensitive oxygen consumption, and cell integrity, determined by trypan blue exclusion, were affected significatively only in spheroplasts with C18:3. These results show that lipid peroxidation sensitizes cell integrity and mitochondrial function towards damaging effects of oxidative stress.

  18. Metabolic flux analysis during the exponential growth phase of Saccharomyces cerevisiae in wine fermentations.

    Directory of Open Access Journals (Sweden)

    Manuel Quirós

    Full Text Available As a consequence of the increase in global average temperature, grapes with the adequate phenolic and aromatic maturity tend to be overripe by the time of harvest, resulting in increased sugar concentrations and imbalanced C/N ratios in fermenting musts. This fact sets obvious additional hurdles in the challenge of obtaining wines with reduced alcohols levels, a new trend in consumer demands. It would therefore be interesting to understand Saccharomyces cerevisiae physiology during the fermentation of must with these altered characteristics. The present study aims to determine the distribution of metabolic fluxes during the yeast exponential growth phase, when both carbon and nitrogen sources are in excess, using continuous cultures. Two different sugar concentrations were studied under two different winemaking temperature conditions. Although consumption and production rates for key metabolites were severely affected by the different experimental conditions studied, the general distribution of fluxes in central carbon metabolism was basically conserved in all cases. It was also observed that temperature and sugar concentration exerted a higher effect on the pentose phosphate pathway and glycerol formation than on glycolysis and ethanol production. Additionally, nitrogen uptake, both quantitatively and qualitatively, was strongly influenced by environmental conditions. This work provides the most complete stoichiometric model used for Metabolic Flux Analysis of S. cerevisiae in wine fermentations employed so far, including the synthesis and release of relevant aroma compounds and could be used in the design of optimal nitrogen supplementation of wine fermentations.

  19. Tight Coupling of Metabolic Oscillations and Intracellular Water Dynamics in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Thoke, Henrik Seir; Tobiesen, Asger; Brewer, Jonathan R.;

    2015-01-01

    We detected very strong coupling between the oscillating concentration of ATP and the dynamics of intracellular water during glycolysis in Saccharomyces cerevisiae. Our results indicate that: i) dipolar relaxation of intracellular water is heterogeneous within the cell and different from dilute c......2O in a dose-dependent manner. These results offer a new insight into the coupling of an emergent intensive physicochemical property of the cell, i.e. cell-wide water dipolar relaxation, and a central metabolite (ATP) produced by a robustly oscillating metabolic process.......We detected very strong coupling between the oscillating concentration of ATP and the dynamics of intracellular water during glycolysis in Saccharomyces cerevisiae. Our results indicate that: i) dipolar relaxation of intracellular water is heterogeneous within the cell and different from dilute...... conditions, ii) water dipolar relaxation oscillates with glycolysis and in phase with ATP concentration, iii) this phenomenon is scale-invariant from the subcellular to the ensemble of synchronized cells and, iv) the periodicity of both glycolytic oscillations and dipolar relaxation are equally affected by D...

  20. Ethanol fermentation in a magnetically fluidized bed reactor with immobilized Saccharomyces cerevisiae in magnetic particles.

    Science.gov (United States)

    Liu, Chun-Zhao; Wang, Feng; Ou-Yang, Fan

    2009-01-01

    Ethanol fermentation by immobilized Saccharomyces cerevisiae cells in magnetic particles was successfully carried out in a magnetically stabilized fluidized bed reactor (MSFBR). These immobilized magnetic particles solidified in a 2 % CaCl(2) solution were stable and had high ethanol fermentation activity. The performance of ethanol fermentation of glucose in the MSFBR was affected by initial particle loading rate, feed sugar concentration and dilution rate. The ethanol theoretical yield, productivity and concentration reached 95.3%, 26.7 g/L h and 66 g/L, respectively, at a particle loading rate of 41% and a feed dilution rate of 0.4 h(-1) with a glucose concentration of 150 g/L when the magnetic field intensity was kept in the range of 85-120 Oe. In order to use this developed MSFBR system for ethanol production from cheap raw materials, cane molasses was used as the main fermentation substrate for continuous ethanol fermentation with the immobilized S. cerevisiae cells in the reactor system. Molasses gave comparative ethanol productivity in comparison with glucose in the MSFBR, and the higher ethanol production was observed in the MSFBR than in a fluidized bed reactor (FBR) without a magnetic field. PMID:18760598

  1. Nucleocytoplasmic transport of ribosomes in a eukaryotic system: Is there a facilitated transport process?

    International Nuclear Information System (INIS)

    The authors have examined the kinetics of the process by which ribosomes are exported from the nucleus to the cytoplasm using Xenopus laevis oocytes microinjected into the germinal vesicle with radiolabeled ribosomes or ribosomal subunits from X. laevis, Tetrahymena thermophila, or Escherichia coli. Microinjected eukaryotic mature ribosomes are redistributed into the oocyte cytoplasm by an apparent carrier-mediated transport process that exhibits saturation kinetics as increasing amounts of ribosomes are injected. T. thermophila ribosomes are competent to traverse the Xenopus nuclear envelope, suggesting that the basic mechanism underlying ribosome transport is evolutionarily conserved. Microinjected E. coli ribosomes are not transported in this system, indicating that prokaryotic ribosomes lack the signals required for transport. Surprisingly, coinjected small (40S) and large (60S) subunits from T. thermophila are transported significantly faster than individual subunits. These observations support a facilitated transport model for the translocation of ribosomal subunits as separate units across the nuclear envelope whereby the transport rate of 60S or 40S subunits is enhanced by the presence of the partner subunit. Although the basic features of the transport mechanism have been preserved through evolution, other aspects of the process may be mediated through species-specific interactions. They hypothesize that a species-specific nuclear 40S-60S subunit association may expedite the transport of individual subunits across the nuclear envelope

  2. Preparation of ribosomes for smFRET studies: A simplified approach.

    Science.gov (United States)

    Shebl, Bassem; Menke, Drew E; Pennella, Min; Poudyal, Raghav R; Burke, Donald H; Cornish, Peter V

    2016-08-01

    During the past decade, single-molecule studies of the ribosome have significantly advanced our understanding of protein synthesis. The broadest application of these methods has been towards the investigation of ribosome conformational dynamics using single-molecule Förster resonance energy transfer (smFRET). The recent advances in fluorescently labeled ribosomes and translation components have resulted in success of smFRET experiments. Various methods have been employed to target fluorescent dyes to specific locations within the ribosome. Primarily, these methods have involved additional steps including subunit dissociation and/or full reconstitution, which could result in ribosomes of reduced activity and translation efficiency. In addition, substantial time and effort are required to produce limited quantities of material. To enable rapid and large-scale production of highly active, fluorescently labeled ribosomes, we have developed a procedure that combines partial reconstitution with His-tag purification. This allows for a homogeneous single-step purification of mutant ribosomes and subsequent integration of labeled proteins. Ribosomes produced with this method are shown to be as active as ribosomes purified using classical methods. While we have focused on two labeling sites in this report, the method is generalizable and can in principle be extended to any non-essential ribosomal protein. PMID:27208427

  3. Mass spectrometric and bioinformatics approaches to characterizing of cyclic non-ribosomal peptides and ribosomally encoded peptide antibiotic

    OpenAIRE

    Liu, Wei-Ting

    2009-01-01

    Natural products are a crucial component in drug discovery because of their considerable pharmaceutical properties. Cyclic non-ribosomally peptides are one category of natural products featured by containing non-standard amino acids and lactam or lactone structures, thus increasing the complexity of the resulting tandem mass spectrometry data. Cyclosporin, microcystins and nodularins all are well-known examples and have notable pharmacologically importance. In this current work, by collaborat...

  4. Genetiese manipulering van die gis Saccharomyces cerevisiae betreffende polisakkariedbenutting

    Directory of Open Access Journals (Sweden)

    I. S. Pretoruis

    1992-07-01

    Full Text Available Die gis Saccharomyces cerevisiae word wêreldwyd as die belangrikste kommersiële mikro-organisme bestempel en geniet sogenaamde ABAV-status (Algemeen Beskou As Veilig weens dié gis se eeue lange verbintenis met voedselproduksie (bv. brood, wyn, bier, proteienaanvulling en geurstowwe.

  5. Interaction between Hanseniaspora uvarum and Saccharomyces cerevisiae during alcoholic fermentation.

    Science.gov (United States)

    Wang, Chunxiao; Mas, Albert; Esteve-Zarzoso, Braulio

    2015-08-01

    During wine fermentation, Saccharomyces clearly dominate over non-Saccharomyces wine yeasts, and several factors could be related to this dominance. However, the main factor causing the reduction of cultivable non-Saccharomyces populations has not yet been fully established. In the present study, various single and mixed fermentations were performed to evaluate some of the factors likely responsible for the interaction between Saccharomyces cerevisiae and Hanseniaspora uvarum. Alcoholic fermentation was performed in compartmented experimental set ups with ratios of 1:1 and 1:9 and the cultivable population of both species was followed. The cultivable H. uvarum population decreased sharply at late stages when S. cerevisiae was present in the other compartment, similarly to alcoholic fermentations in non-compartmented vessels. Thus, cell-to-cell contact did not seem to be the main cause for the lack of cultivability of H. uvarum. Other compounds related to fermentation performance (such as sugar and ethanol) and/or certain metabolites secreted by S. cerevisiae could be related to the sharp decrease in H. uvarum cultivability. When these factors were analyzed, it was confirmed that metabolites from S. cerevisiae induced lack of cultivability in H. uvarum, however ethanol and other possible compounds did not seem to induce this effect but played some role during the process. This study contributes to a new understanding of the lack of cultivability of H. uvarum populations during the late stages of wine fermentation. PMID:25956738

  6. Reconstitution of an efficient thymidine salvage pathway in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Vernis, L.; Piskur, Jure; Diffley, J.F.X.

    2003-01-01

    The budding yeast Saccharomyces cerevisiae is unable to incorporate exogenous nucleosides into DNA. We have made a number of improvements to existing strategies to reconstitute an efficient thymidine salvage pathway in yeast. We have constructed strains that express both a nucleoside kinase as well...

  7. Genetic Basis for Saccharomyces cerevisiae Biofilm in Liquid Medium

    DEFF Research Database (Denmark)

    Andersen, Kaj Scherz; Bojsen, Rasmus Kenneth; Gro Rejkjær Sørensen, Laura; Weiss Nielsen, Martin; Lisby, Michael; Folkesson, Sven Anders; Regenberg, Birgitte

    2014-01-01

    than free-living cells. We investigated the genetic basis for yeast, Saccharomyces cerevisiae, biofilm on solid surfaces in liquid medium by screening a comprehensive deletion mutant collection in the S1278b background and found 71 genes that were essential for biofilm development. Quantitative...

  8. Sucrose and Saccharomyces cerevisiae: a relationship most sweet.

    Science.gov (United States)

    Marques, Wesley Leoricy; Raghavendran, Vijayendran; Stambuk, Boris Ugarte; Gombert, Andreas Karoly

    2016-02-01

    Sucrose is an abundant, readily available and inexpensive substrate for industrial biotechnology processes and its use is demonstrated with much success in the production of fuel ethanol in Brazil. Saccharomyces cerevisiae, which naturally evolved to efficiently consume sugars such as sucrose, is one of the most important cell factories due to its robustness, stress tolerance, genetic accessibility, simple nutrient requirements and long history as an industrial workhorse. This minireview is focused on sucrose metabolism in S. cerevisiae, a rather unexplored subject in the scientific literature. An analysis of sucrose availability in nature and yeast sugar metabolism was performed, in order to understand the molecular background that makes S. cerevisiae consume this sugar efficiently. A historical overview on the use of sucrose and S. cerevisiae by humans is also presented considering sugarcane and sugarbeet as the main sources of this carbohydrate. Physiological aspects of sucrose consumption are compared with those concerning other economically relevant sugars. Also, metabolic engineering efforts to alter sucrose catabolism are presented in a chronological manner. In spite of its extensive use in yeast-based industries, a lot of basic and applied research on sucrose metabolism is imperative, mainly in fields such as genetics, physiology and metabolic engineering. PMID:26658003

  9. Analysis of the RNA Content of the Yeast "Saccharomyces Cerevisiae"

    Science.gov (United States)

    Deutch, Charles E.; Marshall, Pamela A.

    2008-01-01

    In this article, the authors describe an interconnected set of relatively simple laboratory experiments in which students determine the RNA content of yeast cells and use agarose gel electrophoresis to separate and analyze the major species of cellular RNA. This set of experiments focuses on RNAs from the yeast "Saccharomyces cerevisiae", a…

  10. Improving biomass sugar utilization by engineered Saccharomyces cerevisiae

    Science.gov (United States)

    The efficient utilization of all available sugars in lignocellulosic biomass, which is more abundant than available commodity crops and starch, represents one of the most difficult technological challenges for the production of bioethanol. The well-studied yeast Saccharomyces cerevisiae has played a...

  11. Reducing the genetic complexity of glycolysis in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Solis Escalante, D.

    2015-01-01

    Glycolysis, a biochemical pathway that oxidizes glucose to pyruvate, is at the core of sugar metabolism in Saccharomyces cerevisiae (bakers’ yeast). Glycolysis is not only a catabolic route involved in energy conservation, but also provides building blocks for anabolism. From an applied perspective,

  12. Metabolomic comparison of Saccharomyces cerevisiae and the cryotolerant species S. bayanus var. uvarum and S. kudriavzevii during wine fermentation at low temperature.

    Directory of Open Access Journals (Sweden)

    María López-Malo

    Full Text Available Temperature is one of the most important parameters affecting the length and rate of alcoholic fermentation and final wine quality. Wine produced at low temperature is often considered to have improved sensory qualities. However, there are certain drawbacks to low temperature fermentations such as reduced growth rate, long lag phase, and sluggish or stuck fermentations. To investigate the effects of temperature on commercial wine yeast, we compared its metabolome growing at 12 °C and 28 °C in a synthetic must. Some species of the Saccharomyces genus have shown better adaptation at low temperature than Saccharomyces cerevisiae. This is the case of the cryotolerant yeasts Saccharomyces bayanus var. uvarum and Saccharomyces kudriavzevii. In an attempt to detect inter-specific metabolic differences, we characterized the metabolome of these species growing at 12°C, which we compared with the metabolome of S. cerevisiae (not well adapted at low temperature at the same temperature. Our results show that the main differences between the metabolic profiling of S. cerevisiae growing at 12 °C and 28 °C were observed in lipid metabolism and redox homeostasis. Moreover, the global metabolic comparison among the three species revealed that the main differences between the two cryotolerant species and S. cerevisiae were in carbohydrate metabolism, mainly fructose metabolism. However, these two species have developed different strategies for cold resistance. S. bayanus var. uvarum presented elevated shikimate pathway activity, while S. kudriavzevii displayed increased NAD(+ synthesis.

  13. Saccharomyces cerevisiae as a model organism: a comparative study.

    Directory of Open Access Journals (Sweden)

    Hiren Karathia

    Full Text Available BACKGROUND: Model organisms are used for research because they provide a framework on which to develop and optimize methods that facilitate and standardize analysis. Such organisms should be representative of the living beings for which they are to serve as proxy. However, in practice, a model organism is often selected ad hoc, and without considering its representativeness, because a systematic and rational method to include this consideration in the selection process is still lacking. METHODOLOGY/PRINCIPAL FINDINGS: In this work we propose such a method and apply it in a pilot study of strengths and limitations of Saccharomyces cerevisiae as a model organism. The method relies on the functional classification of proteins into different biological pathways and processes and on full proteome comparisons between the putative model organism and other organisms for which we would like to extrapolate results. Here we compare S. cerevisiae to 704 other organisms from various phyla. For each organism, our results identify the pathways and processes for which S. cerevisiae is predicted to be a good model to extrapolate from. We find that animals in general and Homo sapiens in particular are some of the non-fungal organisms for which S. cerevisiae is likely to be a good model in which to study a significant fraction of common biological processes. We validate our approach by correctly predicting which organisms are phenotypically more distant from S. cerevisiae with respect to several different biological processes. CONCLUSIONS/SIGNIFICANCE: The method we propose could be used to choose appropriate substitute model organisms for the study of biological processes in other species that are harder to study. For example, one could identify appropriate models to study either pathologies in humans or specific biological processes in species with a long development time, such as plants.

  14. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna (Cornell); (UCB); (Duke)

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  15. Heat shock-induced accumulation of translation elongation and termination factors precedes assembly of stress granules in S. cerevisiae.

    Directory of Open Access Journals (Sweden)

    Tomas Grousl

    Full Text Available In response to severe environmental stresses eukaryotic cells shut down translation and accumulate components of the translational machinery in stress granules (SGs. Since they contain mainly mRNA, translation initiation factors and 40S ribosomal subunits, they have been referred to as dominant accumulations of stalled translation preinitiation complexes. Here we present evidence that the robust heat shock-induced SGs of S. cerevisiae also contain translation elongation factors eEF3 (Yef3p and eEF1Bγ2 (Tef4p as well as translation termination factors eRF1 (Sup45p and eRF3 (Sup35p. Despite the presence of the yeast prion protein Sup35 in heat shock-induced SGs, we found out that its prion-like domain is not involved in the SGs assembly. Factors eEF3, eEF1Bγ2 and eRF1 were accumulated and co-localized with Dcp2 foci even upon a milder heat shock at 42°C independently of P-bodies scaffolding proteins. We also show that eEF3 accumulations at 42°C determine sites of the genuine SGs assembly at 46°C. We suggest that identification of translation elongation and termination factors in SGs might help to understand the mechanism of the eIF2α factor phosphorylation-independent repression of translation and SGs assembly.

  16. Genome-wide high-resolution mapping of UV-induced mitotic recombination events in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Yi Yin

    2013-10-01

    Full Text Available In the yeast Saccharomyces cerevisiae and most other eukaryotes, mitotic recombination is important for the repair of double-stranded DNA breaks (DSBs. Mitotic recombination between homologous chromosomes can result in loss of heterozygosity (LOH. In this study, LOH events induced by ultraviolet (UV light are mapped throughout the genome to a resolution of about 1 kb using single-nucleotide polymorphism (SNP microarrays. UV doses that have little effect on the viability of diploid cells stimulate crossovers more than 1000-fold in wild-type cells. In addition, UV stimulates recombination in G1-synchronized cells about 10-fold more efficiently than in G2-synchronized cells. Importantly, at high doses of UV, most conversion events reflect the repair of two sister chromatids that are broken at approximately the same position whereas at low doses, most conversion events reflect the repair of a single broken chromatid. Genome-wide mapping of about 380 unselected crossovers, break-induced replication (BIR events, and gene conversions shows that UV-induced recombination events occur throughout the genome without pronounced hotspots, although the ribosomal RNA gene cluster has a significantly lower frequency of crossovers.

  17. Mammalian sperm translate nuclear-encoded proteins by mitochondrial-type ribosomes

    OpenAIRE

    Gur, Yael; Breitbart, Haim

    2006-01-01

    It is widely accepted that spermatozoa are translationally silent. The present study demonstrates, for the first time, incorporation of labeled amino acids into polypeptides during sperm capacitation, which was completely inhibited by mitochondrial translation inhibitors but not by the cytoplasmic translation inhibitor. Unlike 80S cytoplasmic ribosomes, 55S mitochondrial ribosomes were present in polysomal fractions, indicating that these ribosomes are actively involved in protein translation...

  18. Structural Basis for Ribosome Recruitment and Manipulation by a Viral IRES RNA

    OpenAIRE

    Pfingsten, Jennifer S; Costantino, David A.; Kieft, Jeffrey S.

    2006-01-01

    Canonical cap-dependent translation initiation requires a large number of protein factors that act in a stepwise assembly process. In contrast, internal ribosomal entry sites (IRESs) are cis-acting RNAs that in some cases completely supplant these factors by recruiting and activating the ribosome using a single structured RNA. Here we present the crystal structures of the ribosome-binding domain from a Dicistroviridae intergenic region IRES at 3.1 angstrom resolution, providing a view of the ...

  19. Engineering the rRNA decoding site of eukaryotic cytosolic ribosomes in bacteria

    OpenAIRE

    Hobbie, S N; Kalapala, S K; Akshay, S.; Bruell, C M; S. Schmidt; Dabow, S; Vasella, A; Sander, P; Böttger, E C

    2007-01-01

    Structural and genetic studies on prokaryotic ribosomes have provided important insights into fundamental aspects of protein synthesis and translational control and its interaction with ribosomal drugs. Comparable mechanistic studies in eukaryotes are mainly hampered by the absence of both high-resolution crystal structures and efficient genetic models. To study the interaction of aminoglycoside antibiotics with selected eukaryotic ribosomes, we replaced the bacterial drug binding site in 16S...

  20. Targeted proteomics reveals compositional dynamics of 60S pre-ribosomes after nuclear export

    OpenAIRE

    Altvater, Martin; Chang, Yiming; Melnik, Andre; Occhipinti, Laura; Schütz, Sabina; Rothenbusch, Ute; Picotti, Paola; Panse, Vikram Govind

    2012-01-01

    Construction and intracellular targeting of eukaryotic pre-ribosomal particles involve a multitude of diverse transiently associating trans-acting assembly factors, energy-consuming enzymes, and transport factors. The ability to rapidly and reliably measure co-enrichment of multiple factors with maturing pre-ribosomal particles presents a major biochemical bottleneck towards revealing their function and the precise contribution of >50 energy-consuming steps that drive ribosome assembly. Here,...

  1. Detecting Ricin: A Sensitive Luminescent Assay for Ricin A-chain Ribosome Depurination Kinetics+

    OpenAIRE

    Sturm, Matthew B.; Schramm, Vern L.

    2009-01-01

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic ribosomal RNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of elongation factor binding resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small ...

  2. Visualising ribosome profiling and using it for reading frame detection and exploration of eukaryotic translation initiation

    OpenAIRE

    Mannion Michel, Audrey

    2013-01-01

    Ribosome profiling (ribo-seq) is a recently developed technique that provides genomewide information on protein synthesis (GWIPS) in vivo. The high resolution of ribo-seq is one of the exciting properties of this technique. In Chapter 2, I present a computational method that utilises the sub-codon precision and triplet periodicity of ribosome profiling data to detect transitions in the translated reading frame. Application of this method to ribosome profiling data generated for human HeLa cel...

  3. Ribosome Profiling Provides Evidence that Large Noncoding RNAs Do Not Encode Proteins

    OpenAIRE

    Guttman, Mitchell; Russell, Pamela; Ingolia, Nicholas T.; Weissman, Jonathan S.; Lander, Eric S.; Lander, Eric S.

    2013-01-01

    Large noncoding RNAs are emerging as an important component in cellular regulation. Considerable evidence indicates that these transcripts act directly as functional RNAs rather than through an encoded protein product. However, a recent study of ribosome occupancy reported that many large intergenic ncRNAs (lincRNAs) are bound by ribosomes, raising the possibility that they are translated into proteins. Here, we show that classical noncoding RNAs and 5′ UTRs show the same ribosome occupancy a...

  4. Implications of macromolecular crowding and reducing conditions for in vitro ribosome construction

    OpenAIRE

    Fritz, Brian R; Jamil, Osman K.; Jewett, Michael C

    2015-01-01

    In vitro construction of Escherichia coli ribosomes could elucidate a deeper understanding of these complex molecular machines and make possible the production of synthetic variants with new functions. Toward this goal, we recently developed an integrated synthesis, assembly and translation (iSAT) system that allows for co-activation of ribosomal RNA (rRNA) transcription and ribosome assembly, mRNA transcription and protein translation without intact cells. Here, we discovered that macromolec...

  5. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [14C]CH3-methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  6. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  7. Various mechanisms in cyclopeptide production from precursors synthesized independently of non-ribosomal peptide synthetases

    Institute of Scientific and Technical Information of China (English)

    Wenyan Xu; Liling Li; Liangcheng Du; Ninghua Tan

    2011-01-01

    An increasing number of cyclopeptides have been discovered as products of ribosomal synthetic pathway.The biosynthetic study of these cyclopeptides has revealed interesting new mechanisms for cyclization.This review highlighted the recent discoveries in cyclization mechanisms for cyclopeptides synthesized independently of non-ribosomal peptide synthetases,including endopeptidase-catalyzed cyclization,intein-mediated cyclization,and peptide synthetase-catalyzed cyclization.This information may help to design hybrid ribosomal and non-ribosomal biosynthetic systems to produce novel cyclopeptides with various bioactivities.

  8. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg2+-content and γ-resistance is discussed. (orig.)

  9. Modeling of ribosome dynamics on a ds-mRNA under an external load

    Science.gov (United States)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  10. Modeling of Ribosome Dynamics on a ds-mRNA under an External Load

    CERN Document Server

    Shakiba, Bahareh; Mohammad-Rafiee, Farshid

    2016-01-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force, and translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  11. Determinants of Swe1p Degradation in Saccharomyces cerevisiae

    Science.gov (United States)

    McMillan, John N.; Theesfeld, Chandra L.; Harrison, Jacob C.; Bardes, Elaine S. G.; Lew, Daniel J.

    2002-01-01

    Swe1p, the sole Wee1-family kinase in Saccharomyces cerevisiae, is synthesized during late G1 and is then degraded as cells proceed through the cell cycle. However, Swe1p degradation is halted by the morphogenesis checkpoint, which responds to insults that perturb bud formation. The Swe1p stabilization promotes cell cycle arrest through Swe1p-mediated inhibitory phosphorylation of Cdc28p until the cells can recover from the perturbation and resume bud formation. Swe1p degradation involves the relocalization of Swe1p from the nucleus to the mother-bud neck, and neck targeting requires the Swe1p-interacting protein Hsl7p. In addition, Swe1p degradation is stimulated by its substrate, cyclin/Cdc28p, and Swe1p is thought to be a target of the ubiquitin ligase SCFMet30 acting with the ubiquitin-conjugating enzyme Cdc34p. The basis for regulation of Swe1p degradation by the morphogenesis checkpoint remains unclear, and in order to elucidate that regulation we have dissected the Swe1p degradation pathway in more detail, yielding several novel findings. First, we show here that Met30p (and by implication SCFMet30) is not, in fact, required for Swe1p degradation. Second, cyclin/Cdc28p does not influence Swe1p neck targeting, but can directly phosphorylate Swe1p, suggesting that it acts downstream of neck targeting in the Swe1p degradation pathway. Third, a screen for functional but nondegradable mutants of SWE1 identified two small regions of Swe1p that are key to its degradation. One of these regions mediates interaction of Swe1p with Hsl7p, showing that the Swe1p-Hsl7p interaction is critical for Swe1p neck targeting and degradation. The other region did not appear to affect interactions with known Swe1p regulators, suggesting that other as-yet-unknown regulators exist. PMID:12388757

  12. "Ant" and "grasshopper" life-history strategies in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Aymé Spor

    Full Text Available From the evolutionary and ecological points of view, it is essential to distinguish between the genetic and environmental components of the variability of life-history traits and of their trade-offs. Among the factors affecting this variability, the resource uptake rate deserves particular attention, because it depends on both the environment and the genetic background of the individuals. In order to unravel the bases of the life-history strategies in yeast, we grew a collection of twelve strains of Saccharomyces cerevisiae from different industrial and geographical origins in three culture media differing for their glucose content. Using a population dynamics model to fit the change of population size over time, we estimated the intrinsic growth rate (r, the carrying capacity (K, the mean cell size and the glucose consumption rate per cell. The life-history traits, as well as the glucose consumption rate, displayed large genetic and plastic variability and genetic-by-environment interactions. Within each medium, growth rate and carrying capacity were not correlated, but a marked trade-off between these traits was observed over the media, with high K and low r in the glucose rich medium and low K and high r in the other media. The cell size was tightly negatively correlated to carrying capacity in all conditions. The resource consumption rate appeared to be a clear-cut determinant of both the carrying capacity and the cell size in all media, since it accounted for 37% to 84% of the variation of those traits. In a given medium, the strains that consume glucose at high rate have large cell size and low carrying capacity, while the strains that consume glucose at low rate have small cell size but high carrying capacity. These two contrasted behaviors may be metaphorically defined as "ant" and "grasshopper" strategies of resource utilization. Interestingly, a strain may be "ant" in one medium and "grasshopper" in another. These life

  13. Heritability and Variability in Ribosomal RNA Genes of Vicia faba

    OpenAIRE

    Rogers, Scott O; Bendich, Arnold J.

    1987-01-01

    We have compared the restriction patterns and copy numbers of ribosomal RNA genes (rDNA) between and within individuals of Vicia faba . While the EcoRI blot-hybridization patterns changed only after one to two generations, copy number changes were found among different tissues of the same plant. Copy number differences among individuals in the population were as great as 95-fold, whereas as much as a 12-fold variation was seen among tissues of the same plant. Among individual F1 progeny from ...

  14. Physical, functional and structural characterization of the cell wall fractions from baker's yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Borchani, Chema; Fonteyn, Fabienne; Jamin, Guilhem; Paquot, Michel; Thonart, Philippe; Blecker, Christophe

    2016-03-01

    The yeast cell wall of Saccharomyces cerevisiae is an important source of β-d-glucan, a glucose homopolymer with many functional, nutritional and human health benefits. In the present study, the yeast cell wall fractionation process involving enzymatic treatments (savinase and lipolase enzymes) affected most of the physical and functional characteristics of extracted fractions. Thus, the fractionation process showed that β-d-glucan fraction F4 had significantly higher swelling power and fat binding capacity compared to other fractions (F1, F2 and F3). It also exhibited a viscosity of 652.12mPas and a high degree of brightness of extracted β-d-glucan fraction. Moreover, the fractionation process seemed to have an effect on structural and thermal properties of extracted fractions. Overall, results showed that yeast β-d-glucan had good potential for use as a prebiotic ingredient in food, as well as medicinal and pharmaceutical products. PMID:26471666

  15. Influence of α sex factor on the biosynthesis of the cell wall from Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Cells of Saccharomyces cerevisiae produce peptide hormones (a and α) which dramatically affect the physiology, structure, and behavior of cells from the opposite mating type, presumably in preparation for conjugation. Some cell division cycle mutants mimick several of the changes induced by α factor. Accordingly, conditional mutants cdc 28, cdc 36, cdc 37, and cdc 39 undergo arrest in G1, exhibit shmoo morphology and are able to mate when they are transferred to the restrictive temperature. Formation of shmoo cells would require increased synthesis of glycosyl transferases involved in the biosynthesis of cell wall polysaccharides. Accordingly, the authors investigated the effect of G1 arrest on the chemical composition of the cell wall and on the levels of glycosyl transferases. Arrest in G1 was obtained by two methods: addition of α factor, and transfer of a cdc 28 mutant to the restrictive temperature

  16. Cell wall dynamics modulate acetic acid-induced apoptotic cell death of Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    António Rego

    2014-08-01

    Full Text Available Acetic acid triggers apoptotic cell death in Saccharomyces cerevisiae, similar to mammalian apoptosis. To uncover novel regulators of this process, we analyzed whether impairing MAPK signaling affected acetic acid-induced apoptosis and found the mating-pheromone response and, especially, the cell wall integrity pathways were the major mediators, especially the latter, which we characterized further. Screening downstream effectors of this pathway, namely targets of the transcription factor Rlm1p, highlighted decreased cell wall remodeling as particularly important for acetic acid resistance. Modulation of cell surface dynamics therefore emerges as a powerful strategy to increase acetic acid resistance, with potential application in industrial fermentations using yeast, and in biomedicine to exploit the higher sensitivity of colorectal carcinoma cells to apoptosis induced by acetate produced by intestinal propionibacteria.

  17. Effects of the rad52 gene on recombination in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Effects of the rad52 mutation in Saccharomyces cerevisiae on meiotic, γ-ray-induced, uv-induced, and spontaneous mitotic recombination were studied. The rad52/rad52 diploids undergo premeiotic DNA synthesis; sporulation occurs but inviable spores are produced. Intra- and intergenic recombination during meiosis were examined in cells transferred from sporulation medium to vegetative medium at different time intervals. No intragenic recombination was observed at the hisl-1/hisl-315 and trp5-2/trp5-48 heteroalleles. Gene-centromere recombination was also not observed in rad52/rad52 diploids. No γ-ray-induced intragenic mitotic recombination is seen in rad52/rad52 diploids and uv-induced intragenic recombination is greatly reduced. However, spontaneous mitotic recombination is not similarly affected. The RAD52 gene thus functions in recombination in meiosis and in γ-ray and uv-induced mitotic recombination but not in spontaneous mitotic recombination

  18. Fermentation of grain sorghum starch by co-cultivation of Schwanniomyces occidentalis and Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Horn, C.H.; Preez, J.C. du; Kilian, S.G. (Orange Free State Univ., Bloemfontein (ZA). Dept. of Microbiology and Biochemistry)

    1992-01-01

    The amylases of a Schwanniomyces occidentalis mutant hydrolysed grain sorghum starch completely. Heat pretreatment to effect gelatinization was essential for total starch hydrolysis. Ethanol fermentations were conducted by using a stationary-phase culture of S. occidentalis in conjunction with Saccharomyces cerevisiae to ferment the sugars liberated from the grain sorghum starch by the amylases of S. occidentalis. Increasing the grain sorghum concentration from 8 to 28% (m/v) did not affect the final ethanol yield of 0.45 g ethanol/g glucose equivalents, although the fermentation rate decreased considerably at the higher slurry concentration, requiring 8 days for completion of the fermentation. A 28% grain sorghum slurry yielded 12.5% (w/v) ethanol, indicating that nearly 390 1 of ethanol could be produced per tonne grain sorghum, with about 430 kg residual biomass containing 43% crude protein. (Author).

  19. Influence of new generation fungicides on Saccharomyces cerevisiae growth, grape must fermentation and aroma biosynthesis.

    Science.gov (United States)

    Noguerol-Pato, R; Torrado-Agrasar, A; González-Barreiro, C; Cancho-Grande, B; Simal-Gándara, J

    2014-03-01

    The influence of ten new generation fungicides (ametoctradin, benthiavalicarb-isopropyl, boscalid, cyazofamid, dimethomorph, fenhexamid, kresoxim-methyl, mepanipyrim, metrafenone, and pyraclostrobin) on the fermentative activity of Saccharomyces cerevisiae yeast was initially evaluated in pasteurised red must. The presence of ametoctradin, dimethomorph and mepanipyrim seemed to affect sugars-to-ethanol yield in the stationary phase. The same fermentation experiments were carried out for these three fungicides in ecological red must from Vitis vinifera cv. Tempranillo. When ecological must was unfiltered, the fermentative activity of yeasts was unaffected by the presence of these selected fungicides. However, when ecological must was filtered beforehand, a slight decrease of biomass and ethanol production (in terms of biomass-to-ethanol yield and sugars-to-ethanol yield, respectively), as well as a decrease in fruity aroma, were registered with respect to the control wine. PMID:24176337

  20. The F-Box Protein Rcy1p Is Involved in Endocytic Membrane Traffic and Recycling Out of an Early Endosome in Saccharomyces cerevisiae

    OpenAIRE

    Wiederkehr, Andreas; Avaro, Sandrine; Prescianotto-Baschong, Cristina; Haguenauer-Tsapis, Rosine; Riezman, Howard

    2000-01-01

    In Saccharomyces cerevisiae, endocytic material is transported through different membrane-bound compartments before it reaches the vacuole. In a screen for mutants that affect membrane trafficking along the endocytic pathway, we have identified a novel mutant disrupted for the gene YJL204c that we have renamed RCY1 (recycling 1). Deletion of RCY1 leads to an early block in the endocytic pathway before the intersection with the vacuolar protein sorting pathway. Mutation of RCY1 leads to the ac...

  1. Characteristics of Saccharomyces cerevisiae yeasts exhibiting rough colonies and pseudohyphal morphology with respect to alcoholic fermentation

    Directory of Open Access Journals (Sweden)

    Vanda Renata Reis

    2013-12-01

    Full Text Available Among the native yeasts found in alcoholic fermentation, rough colonies associated with pseudohyphal morphology belonging to the species Saccharomyces cerevisiae are very common and undesirable during the process. The aim of this work was to perform morphological and physiological characterisations of S. cerevisiae strains that exhibited rough and smooth colonies in an attempt to identify alternatives that could contribute to the management of rough colony yeasts in alcoholic fermentation. Characterisation tests for invasiveness in Agar medium, killer activity, flocculation and fermentative capacity were performed on 22 strains (11 rough and 11 smooth colonies. The effects of acid treatment at different pH values on the growth of two strains ("52" -rough and "PE-02" smooth as well as batch fermentation tests with cell recycling and acid treatment of the cells were also evaluated. Invasiveness in YPD Agar medium occurred at low frequency; ten of eleven rough yeasts exhibited flocculation; none of the strains showed killer activity; and the rough strains presented lower and slower fermentative capacities compared to the smooth strains in a 48-h cycle in a batch system with sugar cane juice. The growth of the rough strain was severely affected by the acid treatment at pH values of 1.0 and 1.5; however, the growth of the smooth strain was not affected. The fermentative efficiency in mixed fermentation (smooth and rough strains in the same cell mass proportion did not differ from the efficiency obtained with the smooth strain alone, most likely because the acid treatment was conducted at pH 1.5 in a batch cell-recycle test. A fermentative efficiency as low as 60% was observed with the rough colony alone.

  2. Evaluation of cytochrome P-450 concentration in Saccharomyces cerevisiae strains

    Directory of Open Access Journals (Sweden)

    Míriam Cristina Sakuragui Matuo

    2010-09-01

    Full Text Available Saccharomyces cerevisiae has been widely used in mutagenicity tests due to the presence of a cytochrome P-450 system, capable of metabolizing promutagens to active mutagens. There are a large number of S. cerevisiae strains with varying abilities to produce cytochrome P-450. However, strain selection and ideal cultivation conditions are not well defined. We compared cytochrome P-450 levels in four different S. cerevisiae strains and evaluated the cultivation conditions necessary to obtain the highest levels. The amount of cytochrome P-450 produced by each strain varied, as did the incubation time needed to reach the maximum level. The highest cytochrome P-450 concentrations were found in media containing fermentable sugars. The NCYC 240 strain produced the highest level of cytochrome P-450 when grown in the presence of 20 % (w/v glucose. The addition of ethanol to the media also increased cytochrome P-450 synthesis in this strain. These results indicate cultivation conditions must be specific and well-established for the strain selected in order to assure high cytochrome P-450 levels and reliable mutagenicity results.Linhagens de Saccharomyces cerevisiae tem sido amplamente empregadas em testes de mutagenicidade devido à presença de um sistema citocromo P-450 capaz de metabolizar substâncias pró-mutagênicas à sua forma ativa. Devido à grande variedade de linhagens de S. cerevisiae com diferentes capacidades de produção de citocromo P-450, torna-se necessária a seleção de cepas, bem como a definição das condições ideais de cultivo. Neste trabalho, foram comparados os níveis de citocromo P-450 em quatro diferentes linhagens de S. cerevisiae e avaliadas as condições de cultivo necessárias para obtenção de altas concentrações deste sistema enzimático. O maior nível enzimático foi encontrado na linhagem NCYC 240 em presença de 20 % de glicose (p/v. A adição de etanol ao meio de cultura também produziu um aumento na s

  3. Preferential translation of chloroplast ribosomal proteins in Chlamydomonas reinhardtti

    International Nuclear Information System (INIS)

    The nuclear cr-1 mutant of C. reinhardtii is deficient in the 30S subunit of the chloroplast (cp) ribosome and in cp protein synthesis. The cp spectinomycin resistant mutant, spr-u-1-27-3, has a normal level of 70S ribosomes but only a low rate of cp protein synthesis with spectinomycin present. In both mutants there is little accumulation of the large subunit of ribulose 1,5-bisphosphate carboxylase (Rubisco LSU), but near wild-type levels of cp synthesized r-proteins. In cells pulse-labelled with 35SO4 and immunoprecipitated with specific antisera, the ratio of the rate of synthesis of cp r-proteins to that of Rubisco LSU is 7 times greater in both mutants than in wild-type. No difference in the rate of turnover between r-proteins and Rubisco LSU in mutant and wild-type cells was observed during a one hour chase. The mRNA levels for r-protein L1 and Rubisco LSU actually increase slightly in the mutants. These data suggest that C. reinhardtii has a translation mechanism for preferential synthesis of cp r-proteins that operates under conditions of reduced total cp protein synthesis

  4. Ribosomal small subunit domains radiate from a central core

    Science.gov (United States)

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  5. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  6. Dissecting ribosome assembly and transport in budding yeast.

    Science.gov (United States)

    Altvater, Martin; Schütz, Sabina; Chang, Yiming; Panse, Vikram Govind

    2014-01-01

    Construction of the eukaryotic ribosome begins in the nucleolus and requires >300 evolutionarily conserved nonribosomal trans-acting factors, which transiently associate with preribosomal subunits at distinct assembly stages. A subset of trans-acting and transport factors passage assembled preribosomal subunits in a functionally inactive state through the nuclear pore complexes (NPC) into the cytoplasm, where they undergo final maturation before initiating translation. Here, we summarize the repertoire of tools developed in the model organism budding yeast that are spearheading the functional analyses of trans-acting factors involved in the assembly and intracellular transport of preribosomal subunits. We elaborate on different GFP-tagged ribosomal protein reporters and a pre-rRNA reporter that reliably monitors the movement of preribosomal particles from the nucleolus to cytoplasm. We discuss the powerful yeast heterokaryon assay, which can be employed to uncover shuttling trans-acting factors that need to accompany preribosomal subunits to the cytoplasm to be released prior to initiating translation. Moreover, we present two biochemical approaches, namely sucrose gradient analyses and tandem affinity purification, that are rapidly facilitating the uncovering of regulatory processes that control the compositional dynamics of trans-acting factors on maturing preribosomal particles. Altogether, these approaches when combined with traditional analytical biochemistry, targeted proteomics and structural methodologies, will contribute to the dissection of the assembly and intracellular transport of preribosomal subunits, as well as other macromolecular assemblies that influence diverse biological pathways. PMID:24857742

  7. Investigation of nutrient sensing in the yeast Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine

    2006-01-01

    Gæren Saccharomyces cerevisiae har udviklet komplekse regulatoriske systemer til at kontrollere ekspression af de proteiner, der importerer næringsstoffer, således at disse kun bliver produceret, når der er brug for dem. Dette er tilfældet for hexose-transportører samt aminosyre-transportører (di......Gæren Saccharomyces cerevisiae har udviklet komplekse regulatoriske systemer til at kontrollere ekspression af de proteiner, der importerer næringsstoffer, således at disse kun bliver produceret, når der er brug for dem. Dette er tilfældet for hexose-transportører samt aminosyre...

  8. Applied systems biology - vanillin production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Strucko, Tomas; Eriksen, Carsten; Nielsen, J.;

    2012-01-01

    Vanillin is the most important aroma compound based on market value, and natural vanillin is extracted from the cured seed pods of the Vanilla orchid. Most of the world’s vanillin, however, is obtained by chemical synthesis from petrochemicals or wood pulp lignins. As an alternative, de novo...... biosynthesis of vanillin in baker’s yeast Saccharomyces cerevisiae was recently demonstrated by successfully introducing the metabolic pathway for vanillin production in yeast. Nevertheless, the amount of vanillin produced in this S. cerevisiae strain is insufficient for commercial production and improvements...... need to be done. We have introduced the genes necessary for vanillin production in an identical manner in two different yeast strains S288c and CEN.PK,where comprehensive – omics datasets are available, hence, allowing vanillin production in the two strain backgrounds to be evaluated and compared in a...

  9. Membrane Protein Production in the Yeast, S. cerevisiae.

    Science.gov (United States)

    Cartwright, Stephanie P; Mikaliunaite, Lina; Bill, Roslyn M

    2016-01-01

    The first crystal structures of recombinant mammalian membrane proteins were solved in 2005 using protein that had been produced in yeast cells. One of these, the rabbit Ca(2+)-ATPase SERCA1a, was synthesized in Saccharomyces cerevisiae. All host systems have their specific advantages and disadvantages, but yeast has remained a consistently popular choice in the eukaryotic membrane protein field because it is quick, easy and cheap to culture, whilst being able to post-translationally process eukaryotic membrane proteins. Very recent structures of recombinant membrane proteins produced in S. cerevisiae include those of the Arabidopsis thaliana NRT1.1 nitrate transporter and the fungal plant pathogen lipid scramblase, TMEM16. This chapter provides an overview of the methodological approaches underpinning these successes. PMID:27485327

  10. Advanced biofuel production by the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Buijs, Nicolaas A; Siewers, Verena; Nielsen, Jens

    2013-06-01

    Replacement of conventional transportation fuels with biofuels will require production of compounds that can cover the complete fuel spectrum, ranging from gasoline to kerosene. Advanced biofuels are expected to play an important role in replacing fossil fuels because they have improved properties compared with ethanol and some of these may have the energy density required for use in heavy duty vehicles, ships, and aviation. Moreover, advanced biofuels can be used as drop-in fuels in existing internal combustion engines. The yeast cell factory Saccharomyces cerevisiae can be turned into a producer of higher alcohols (1-butanol and isobutanol), sesquiterpenes (farnesene and bisabolene), and fatty acid ethyl esters (biodiesel), and here we discusses progress in metabolic engineering of S. cerevisiae for production of these advanced biofuels. PMID:23628723

  11. Effects of electroacupuncture on the expression of p70 ribosomal protein S6 kinase and ribosomal protein S6 in the hippocampus of rats with vascular dementia

    Institute of Scientific and Technical Information of China (English)

    Yanzhen Zhu; Xuan Wang; Xiaobao Ye; Changhua Gao; Wei Wang

    2012-01-01

    This study investigated the mechanism underlying electroacupuncture therapy for vascular dementia through electroacupuncture at the acupoints of Baihui (DU20), Dazhui (DU14), and bilateral Shenshu (BL23) in a rat model of vascular dementia produced by bilateral middle cerebral artery occlusion. Morris water maze test showed that electroacupuncture improved the learning ability of vascular dementia rats. Western blot assay revealed that the expression of p70 ribosomal protein S6 kinase and ribosomal protein S6 in vascular dementia rats was significantly increased after electroacupuncture, compared with the model group that was not treated with acupuncture. The average escape latency was also shortened after electroacupuncture, and escape strategies in the spatial probe test improved from edge and random searches, to linear and trending swim pathways. The experimental findings indicate that electroacupuncture improves learning and memory ability by up-regulating expression of p70 ribosomal protein S6 kinase and ribosomal protein S6 in the hippocampus of vascular dementia rats.

  12. L-Histidine Inhibits Biofilm Formation and FLO11-Associated Phenotypes in Saccharomyces cerevisiae Flor Yeasts

    OpenAIRE

    Marc Bou Zeidan; Giacomo Zara; Carlo Viti; Francesca Decorosi; Ilaria Mannazzu; Marilena Budroni; Luciana Giovannetti; Severino Zara

    2014-01-01

    Flor yeasts of Saccharomyces cerevisiae have an innate diversity of FLO11 which codes for a highly hydrophobic and anionic cell-wall glycoprotein with a fundamental role in biofilm formation. In this study, 380 nitrogen compounds were administered to three S. cerevisiae flor strains handling FLO11 alleles with different expression levels. S. cerevisiae strain S288c was used as the reference strain as it cannot produce FLO11p. The flor strains generally metabolized amino acids and ...

  13. Isolation of the catalase T structural gene of Saccharomyces cerevisiae by functional complementation.

    OpenAIRE

    Spevak, W; Fessl, F; Rytka, J; Traczyk, A; Skoneczny, M; Ruis, H

    1983-01-01

    The catalase T structural gene of Saccharomyces cerevisiae was cloned by functional complementation of a mutation causing specific lack of the enzyme (cttl). Catalase T-deficient mutants were obtained by UV mutagenesis of an S. cerevisiae strain bearing the cas1 mutation, which causes insensitivity of catalase T to glucose repression. Since the second catalase protein of S. cerevisiae, catalase A, is completely repressed on 10% glucose, catalase T-deficient mutant colonies could be detected u...

  14. L-Histidine Inhibits Biofilm Formation and FLO11-Associated Phenotypes in Saccharomyces cerevisiae Flor Yeasts

    OpenAIRE

    Marc Bou Zeidan; Giacomo Zara; Carlo Viti; Francesca Decorosi; Ilaria Mannazzu; Marilena Budroni; Luciana Giovannetti; Severino Zara

    2014-01-01

    Flor yeasts of Saccharomyces cerevisiae have an innate diversity of Flo11p which codes for a highly hydrophobic and anionic cell-wall glycoprotein with a fundamental role in biofilm formation. In this study, 380 nitrogen compounds were administered to three S. cerevisiae flor strains handling Flo11p alleles with different expression levels. S. cerevisiae strain S288c was used as the reference strain as it cannot produce Flo11p. The flor strains generally metabolized amino acids and dipeptides...

  15. Construction of Killer Industrial Yeast Saccharomyces Cerevisiae Hau-1 and its Fermentation Performance

    OpenAIRE

    Bajaj, Bijender K.; S Sharma

    2010-01-01

    Saccharomyces cerevisiae HAU-1, a time tested industrial yeast possesses most of the desirable fermentation characteristics like fast growth and fermentation rate, osmotolerance, high ethanol tolerance, ability to ferment molasses, and to ferment at elevated temperatures etc. However, this yeast was found to be sensitive against the killer strains of Saccharomyces cerevisiae. In the present study, killer trait was introduced into Saccharomyces cerevisiae HAU-1 by protoplast fusion with Saccha...

  16. Construction of killer industrial yeast Saccharomyces cerevisiae HAU-1 and its fermentation performance

    OpenAIRE

    Bajaj, Bijender K.; S Sharma

    2010-01-01

    Saccharomyces cerevisiae HAU-1, a time tested industrial yeast possesses most of the desirable fermentation characteristics like fast growth and fermentation rate, osmotolerance, high ethanol tolerance, ability to ferment molasses, and to ferment at elevated temperatures etc. However, this yeast was found to be sensitive against the killer strains of Saccharomyces cerevisiae. In the present study, killer trait was introduced into Saccharomyces cerevisiae HAU-1 by protoplast fusion with Saccha...

  17. Studies of the Saccharomyces cerevisiae Cultivation under Oscillatory Mixing Conditions

    OpenAIRE

    M?ris Rikmanis; Stoyan Tzonkov; Uldis Viesturs; Andr?js B?rzi??

    2005-01-01

    Saccharomyces cerevisiae was cultivated under non-aerated conditions in a 5 l laboratory bioreactor. Using the experimental data and the regression analysis method, some mathematical correlations for stirrer rotational speed oscillation frequency and the reaction of the yeast were established. It has been found that different growth parameters are influenced variously by stirrer rotational speed and stirrer rotational speed oscillation frequency. Stirring oscillations can be among the methods...

  18. Intracellular ethanol accumulation in Saccharomyces cerevisiae during fermentation.

    OpenAIRE

    D'Amore, T; C.J. Panchal; Stewart, G G

    1988-01-01

    An intracellular accumulation of ethanol in Saccharomyces cerevisiae was observed during the early stages of fermentation (3 h). However, after 12 h of fermentation, the intracellular and extracellular ethanol concentrations were similar. Increasing the osmotic pressure of the medium caused an increase in the ratio of intracellular to extracellular ethanol concentrations at 3 h of fermentation. As in the previous case, the intracellular and extracellular ethanol concentrations were similar af...

  19. Applied systems biology - vanillin production in Saccharomyces cerevisiae

    OpenAIRE

    Strucko, Tomas; Eriksen, Carsten; Nielsen, J.; Mortensen, Uffe Hasbro

    2012-01-01

    Vanillin is the most important aroma compound based on market value, and natural vanillin is extracted from the cured seed pods of the Vanilla orchid. Most of the world’s vanillin, however, is obtained by chemical synthesis from petrochemicals or wood pulp lignins. As an alternative, de novo biosynthesis of vanillin in baker’s yeast Saccharomyces cerevisiae was recently demonstrated by successfully introducing the metabolic pathway for vanillin production in yeast. Nevertheless, the amount of...

  20. Calcium dependence of Eugenol tolerance and toxicity in Saccharomyces cerevisiae

    OpenAIRE

    Roberts, Stephen K.; Martin McAinsh; Hanna Cantopher; Sean Sandison

    2014-01-01

    Eugenol is a plant-derived phenolic compound which has recognised therapeutical potential as an antifungal agent. However little is known of either its fungicidal activity or the mechanisms employed by fungi to tolerate eugenol toxicity. A better exploitation of eugenol as a therapeutic agent will therefore depend on addressing this knowledge gap. Eugenol initiates increases in cytosolic Ca2+ in Saccharomyces cerevisiae which is partly dependent on the plasma membrane calcium channel, Cch1p. ...

  1. The plasma membrane of Saccharomyces cerevisiae: structure, function, and biogenesis.

    OpenAIRE

    van der Rest, M E; Kamminga, A H; Nakano, A.; Anraku, Y; Poolman, B; Konings, W N

    1995-01-01

    The composition of phospholipids, sphingolipids, and sterols in the plasma membrane has a strong influence on the activity of the proteins associated or embedded in the lipid bilayer. Since most lipid-synthesizing enzymes in Saccharomyces cerevisiae are located in intracellular organelles, an extensive flux of lipids from these organelles to the plasma membrane is required. Although the pathway of protein traffic to the plasma membrane is similar to that of most of the lipids, the bulk flow o...

  2. The Plasma Membrane of Saccharomyces cerevisiae: Structure, Function, and Biogenesis

    OpenAIRE

    VANDERREST, ME; KAMMINGA, AH; Nakano, A.; Anraku, Y; Poolman, B; KONINGS, WN

    1995-01-01

    The composition of phospholipids, sphingolipids, and sterols in the plasma membrane has a strong influence on the activity of the proteins associated or embedded in the lipid bilayer. Since most lipid-synthesizing enzymes in Saccharomyces cerevisiae are located in intracellular organelles, an extensive pur of lipids fi om these organelles to the plasma membrane is required. Although the pathway of protein traffic to the plasma membrane is similar to that of most of the lipids, the bulk flow o...

  3. Magnetically altered ethanol fermentation capacity of Saccharomyces cerevisiae

    OpenAIRE

    Galonja-Corghill Tamara; Kostadinović Ljiljana M.; Bojat Nenad C.

    2009-01-01

    We studied the effect of static magnetic fields on ethanol production by yeast Saccharomyces cerevisiae 424A (LNH-ST) using sugar cane molasses during the fermentation in an enclosed bioreactor. Two static NdFeB magnets were attached to a cylindrical tube reactor with their opposite poles (north to south), creating 150 mT magnetic field inside the reactor. Comparable differences emerged between the results of these two experimental conditions. We found ethanol productivity to be 15% higher in...

  4. Mead production: selection and characterization assays of Saccharomyces cerevisiae

    OpenAIRE

    de Pereira, Ana Paula; Dias, Teresa; Andrade, João Verdial; Ramalhosa, Elsa; Mendes-Ferreira, Ana; Mendes-Faia, Arlete; Leticia M. Estevinho

    2009-01-01

    Mead is a traditional alcoholic drink which results from the fermentation of diluted honey. Yeasts used in mead production are, usually, wine Saccharomyces cerevisiae strains. Most of these yeasts are not adapted to the conditions of mead production namely, high sugar levels, low pH values and reduced nitrogen concentrations. The inability of yeast strains to respond and adapt to unfavorable stressful growth conditions, leads to several problems, such as lack of uniformity of the final ...

  5. Expression of Pneumocystis jirovecii Major Surface Glycoprotein in Saccharomyces cerevisiae

    OpenAIRE

    Kutty, Geetha; England, Katherine J.; Kovacs, Joseph A.

    2013-01-01

    The major surface glycoprotein (Msg), which is the most abundant protein expressed on the cell surface of Pneumocystis organisms, plays an important role in the attachment of this organism to epithelial cells and macrophages. In the present study, we expressed Pneumocystis jirovecii Msg in Saccharomyces cerevisiae, a phylogenetically related organism. Full-length P. jirovecii Msg was expressed with a DNA construct that used codons optimized for expression in yeast. Unlike in Pneumocystis orga...

  6. Comprehensive polymorphism survey elucidates population structure of S. cerevisiae

    OpenAIRE

    Schacherer, Joseph; Shapiro, Joshua A.; Ruderfer, Douglas M.; Kruglyak, Leonid

    2009-01-01

    Comprehensive identification of polymorphisms among individuals within a species is essential both for studying the genetic basis of phenotypic differences and for elucidating the evolutionary history of the species. Large-scale polymorphism surveys have recently been reported for human1, mouse2, and Arabidopsis thaliana3. Here we report a nucleotide-level survey of genome variation in a diverse collection of 63 S. cerevisiae strains sampled from different ecological niches (beer, bread, vine...

  7. Shuttle mutagenesis: a method of transposon mutagenesis for Saccharomyces cerevisiae.

    OpenAIRE

    Seifert, H S; Chen, E Y; So, M; Heffron, F

    1986-01-01

    We have extended the method of transposon mutagenesis to the eukaryote, Saccharomyces cerevisiae. A bacterial transposon containing a selectable yeast gene can be transposed into a cloned fragment of yeast DNA in Escherichia coli, and the transposon insertion can be returned to the yeast genome by homologous recombination. Initially, the cloned yeast DNA fragment to be mutagenized was transformed into an E. coli strain containing an F factor derivative carrying the transposable element. The c...

  8. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems

    OpenAIRE

    DiCarlo, James; Norville, Julie; Mali, Prashant; Rios Villanueva, Xavier; Aach, John Dennis; Church, George McDonald

    2013-01-01

    Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) systems in bacteria and archaea use RNA-guided nuclease activity to provide adaptive immunity against invading foreign nucleic acids. Here, we report the use of type II bacterial CRISPR-Cas system in Saccharomyces cerevisiae for genome engineering. The CRISPR-Cas components, Cas9 gene and a designer genome targeting CRISPR guide RNA (gRNA), show robust and specific RNA-guided endonuclease activity a...

  9. Engineering Saccharomyces cerevisiae toward n‐butanol production

    OpenAIRE

    Swidah, Reem

    2016-01-01

    Biobutanol represents a second generation biofuel, which can be producedfrom renewable resources by microorganisms. A Saccharomyces cerevisiae strainbearing the five butanol synthetic genes (hbd, adhe2, crt, ccr and ERG10) wasconstructed, where the hbd, adhe2, crt and ccr genes are derived from Clostridiumbeijerinckii, while ERG10 is a yeast gene. The genes were transformed individually onsingle cassettes, which integrated into specific chromosomal sites. The single integrantstrains were back...

  10. Hydrogen peroxide removal with magnetically responsive Saccharomyces cerevisiae cells

    Czech Academy of Sciences Publication Activity Database

    Šafařík, Ivo; Maděrová, Zdeňka; Šafaříková, Miroslava

    2008-01-01

    Roč. 56, - (2008), s. 7925-7928. ISSN 0021-8561 R&D Projects: GA MPO 2A-1TP1/094; GA MŠk OC 157 Institutional research plan: CEZ:AV0Z60870520 Keywords : magnetic alginate beads * catalase * magnetic separation * Saccharomyces cerevisiae cells * hydrogen peroxide Subject RIV: GM - Food Processing Impact factor: 2.562, year: 2008

  11. The enantioselective b-keto ester reductions by Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    HASSAN TAJIK

    2006-09-01

    Full Text Available The enantioselective yeast reduction of aromatic b-keto esters, by use of potassium dihydrogen phosphate, calcium phosphate (monobasic, magnesium sulfate and ammonium tartrate (diammonium salt (10:1:1:50 in water at pH 7 as a buffer for 72–120 h with 45–90 % conversion to the corresponding aromatic -hydroxy esters was achieved by means of Saccharomyces cerevisiae.

  12. Regulation of Maltose Transport and Metabolism in Saccharomyces cerevisiae

    OpenAIRE

    Novak, Srđan; Zechner-Krpan, Vesna; Marić, Vladimir

    2004-01-01

    Maltose metabolism in the yeast Saccharomyces cerevisiae is of great importance both for academic and industrial researchers. It requires the presence of at least one of five independent MAL loci: MAL1, MAL2, MAL3, MAL4 and MAL6. Each active locus is made of three genes: two structural genes that encode intracellular enzyme maltase and transport protein for maltose, and the third gene that encodes positive regulatory protein. Maltose is transported unchanged into the cell with the help of spe...

  13. A novel selection system for chromosome translocations in Saccharomyces cerevisiae.

    OpenAIRE

    Tennyson, Rachel B; Ebran, Nathalie; Herrera, Anissa E; Lindsley, Janet E.

    2002-01-01

    Chromosomal translocations are common genetic abnormalities found in both leukemias and solid tumors. While much has been learned about the effects of specific translocations on cell proliferation, much less is known about what causes these chromosome rearrangements. This article describes the development and use of a system that genetically selects for rare translocation events using the yeast Saccharomyces cerevisiae. A translocation YAC was created that contains the breakpoint cluster regi...

  14. Glucose induces rapid changes in the secretome of Saccharomyces cerevisiae

    OpenAIRE

    Giardina, Bennett J.; Stanley, Bruce A.; Chiang, Hui-Ling

    2014-01-01

    Background Protein secretion is a fundamental process in all living cells. Proteins can either be secreted via the classical or non-classical pathways. In Saccharomyces cerevisiae, gluconeogenic enzymes are in the extracellular fraction/periplasm when cells are grown in media containing low glucose. Following a transfer of cells to high glucose media, their levels in the extracellular fraction are reduced rapidly. We hypothesized that changes in the secretome were not restricted to gluconeoge...

  15. Biogeographical characterization of Saccharomyces cerevisiae wine yeast by molecular methods

    OpenAIRE

    Tofalo, Rosanna; Perpetuini, Giorgia; Schirone, Maria; Fasoli, Giuseppe; Aguzzi, Irene; Corsetti, Aldo; Suzzi, Giovanna

    2013-01-01

    Biogeography is the descriptive and explanatory study of spatial patterns and processes involved in the distribution of biodiversity. Without biogeography, it would be difficult to study the diversity of microorganisms because there would be no way to visualize patterns in variation. Saccharomyces cerevisiae, “the wine yeast,” is the most important species involved in alcoholic fermentation, and in vineyard ecosystems, it follows the principle of “everything is everywhere.” Agricultural pract...

  16. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3′ end of nonstop mRNA

    Science.gov (United States)

    Ikeuchi, Ken; Inada, Toshifumi

    2016-01-01

    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3′ ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3′ end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3′ end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  17. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    OpenAIRE

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-01-01

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  18. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [35S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [32P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  19. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  20. A protein residing at the subunit interface of the bacterial ribosome.

    Science.gov (United States)

    Agafonov, D E; Kolb, V A; Nazimov, I V; Spirin, A S

    1999-10-26

    Surface labeling of Escherichia coli ribosomes with the use of the tritium bombardment technique has revealed a minor unidentified ribosome-bound protein (spot Y) that is hidden in the 70S ribosome and becomes highly labeled on dissociation of the 70S ribosome into subunits. In the present work, the N-terminal sequence of the protein Y was determined and its gene was identified as yfia, an ORF located upstream the phe operon of E. coli. This 12.7-kDa protein was isolated and characterized. An affinity of the purified protein Y for the 30S subunit, but not for the 50S ribosomal subunit, was shown. The protein proved to be exposed on the surface of the 30S subunit. The attachment of the 50S subunit resulted in hiding the protein Y, thus suggesting the protein location at the subunit interface in the 70S ribosome. The protein was shown to stabilize ribosomes against dissociation. The possible role of the protein Y as ribosome association factor in translation is discussed. PMID:10535924

  1. Participation of deoxyribonucleic acid polymerase alpha in amplification of ribosomal deoxyribonucleic acid in Xenopus laevis.

    OpenAIRE

    Zimmermann, W.; Weissbach, A

    1981-01-01

    Aphidicolin, a known inhibitor of eucaryotic deoxyribonucleic acid (DNA) polymerase alpha, efficiently inhibited amplification of ribosomal DNA during oogenesis in Xenopus laevis. DNA polymerase alpha, but not DNA polymerase gamma, as isolated from ovaries, was sensitive to aphidicolin. DNA polymerase beta was not detectable in Xenopus ovary extracts. Therefore, DNA polymerase alpha plays a major role in ribosomal ribonucleic acid gene amplification.

  2. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    Science.gov (United States)

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.

    1986-08-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  3. Autogenous regulation of splicing of the transcript of a yeast ribosomal protein gene.

    OpenAIRE

    Dabeva, M. D.; Post-Beittenmiller, M A; Warner, J R

    1986-01-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  4. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    NARCIS (Netherlands)

    Essers, Paul B; Nonnekens, Julie; Goos, Yvonne J; Betist, Marco C; Viester, Marjon D; Mossink, Britt; Lansu, Nico; Korswagen, Hendrik C; Jelier, Rob; Brenkman, Arjan B; MacInnes, Alyson W

    2015-01-01

    The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs

  5. Irradiation effects on the alcohol fermentation ability of saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Irradiation effects on the alcohol fermentation ability of saccharomyces cerevisiae. S. cerevisiae suspensions of 1.5x108 clls/ml were exposed to single and fractionated doses of gamma irradiation, i.e. 0; 0.30; 0.60; 0.90; and 1.20 kGy in aerobic condition at dose rate of 1.63 kGy/hour. The fractionated doses were given with time interval of 15, 30 and 45 minutes. The fermentation was held at 300C for 40 hours. It is seen that an increase of alcohol production was obtained when cells were irradiated at 0.60 kGy, although the result has no significant difference statistically with control. At the dose of 1.20 kGy the alcohol fermentation ability of S. cerevisiae decreased drastically as compared to control. Irradiation using single or fractionated doses with time interval of 15-45 minutes did not influence the alcohol production. Comparing the time interval of 45 minutes at 0.60 kGy and at 1.20 kGy, it appeared that the yield of alcohol was different. (author). 17 refs.; 4 figs

  6. Biogeographical characterisation of Saccharomyces cerevisiae wine yeast by molecular methods

    Directory of Open Access Journals (Sweden)

    RosannaTofalo

    2013-06-01

    Full Text Available Biogeography is the descriptive and explanatory study of spatial patterns and processes involved in the distribution of biodiversity. Without biogeography, it would be difficult to study the diversity of microorganisms because there would be no way to visualise patterns in variation. Saccharomyces cerevisiae, “the wine yeast”, is the most important species involved in alcoholic fermentation, and in vineyard ecosystems, it follows the principle of “everything is everywhere”. Agricultural practices such as farming (organic versus conventional and floor management systems have selected different populations within this species that are phylogenetically distinct. In fact, recent ecological and geographic studies highlighted that unique strains are associated with particular grape varieties in specific geographical locations. These studies also highlighted that significant diversity and regional character, or ‘terroir’, have been introduced into the winemaking process via this association. This diversity of wild strains preserves typicity, the high quality and the unique flavour of wines. Recently, different molecular methods were developed to study population dynamics of S. cerevisiae strains in both vineyards and wineries. In this review, we will provide an update on the current molecular methods used to reveal the geographical distribution of S. cerevisiae wine yeast.

  7. Osmo-, thermo- and ethanol- tolerances of Saccharomyces cerevisiae S1

    Directory of Open Access Journals (Sweden)

    Sandrasegarampillai Balakumar

    2012-03-01

    Full Text Available Saccharomyces cerevisiae S1, which is a locally isolated and improved strain showed viability at 40, 45 and 50ºC and produced ethanol at 40, 43 and 45ºC. When the cells were given heat shock at 45ºC for 30min and grown at 40ºC, 100% viability was observed for 60h, and addition of 200gl-1 ethanol has led to complete cell death at 30h. Heat shock given at 45ºC (for 30min has improved the tolerance to temperature induced ethanol shock leading to 37% viability at 30h. when the cells were subjected to ethanol (200gl-1 for 30 min and osmotic shock (sorbitol 300gl-1, trehalose contents in the cells were increased. The heat shocked cells showed better viability in presence of added ethanol. Soy flour supplementation has improved the viability of S. cerevisiae S1 to 80% in presence of 100gl-1 added ethanol and to 60% in presence of 300gl-1 sorbitol. In presence of sorbitol (200gl-1 and ethanol (50gl-1 at 40ºC, 46% viability was retained by S. cerevisiae S1 at 48h and it was improved to 80% by soy flour supplementation.

  8. Early manifestations of replicative aging in the yeast Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Maksim I. Sorokin

    2014-01-01

    Full Text Available The yeast Saccharomyces cerevisiae is successfully used as a model organism to find genes responsible for lifespan control of higher organisms. As functional decline of higher eukaryotes can start as early as one quarter of the average lifespan, we asked whether S. cerevisiae can be used to model this manifestation of aging. While the average replicative lifespan of S. cerevisiae mother cells ranges between 15 and 30 division cycles, we found that resistances to certain stresses start to decrease much earlier. Looking into the mechanism, we found that knockouts of genes responsible for mitochondriato-nucleus (retrograde signaling, RTG1 or RTG3, significantly decrease the resistance of cells that generated more than four daughters, but not of the younger ones. We also found that even young mother cells frequently contain mitochondria with heterogeneous transmembrane potential and that the percentage of such cells correlates with replicative age. Together, these facts suggest that retrograde signaling starts to malfunction in relatively young cells, leading to accumulation of heterogeneous mitochondria within one cell. The latter may further contribute to a decline in stress resistances.

  9. Combinatorial metabolic engineering of Saccharomyces cerevisiae for terminal alkene production.

    Science.gov (United States)

    Chen, Binbin; Lee, Dong-Yup; Chang, Matthew Wook

    2015-09-01

    Biological production of terminal alkenes has garnered a significant interest due to their industrial applications such as lubricants, detergents and fuels. Here, we engineered the yeast Saccharomyces cerevisiae to produce terminal alkenes via a one-step fatty acid decarboxylation pathway and improved the alkene production using combinatorial engineering strategies. In brief, we first characterized eight fatty acid decarboxylases to enable and enhance alkene production. We then increased the production titer 7-fold by improving the availability of the precursor fatty acids. We additionally increased the titer about 5-fold through genetic cofactor engineering and gene expression tuning in rich medium. Lastly, we further improved the titer 1.8-fold to 3.7 mg/L by optimizing the culturing conditions in bioreactors. This study represents the first report of terminal alkene biosynthesis in S. cerevisiae, and the abovementioned combinatorial engineering approaches collectively increased the titer 67.4-fold. We envision that these approaches could provide insights into devising engineering strategies to improve the production of fatty acid-derived biochemicals in S. cerevisiae. PMID:26164646

  10. Membrane Trafficking in the Yeast Saccharomyces cerevisiae Model

    Directory of Open Access Journals (Sweden)

    Serge Feyder

    2015-01-01

    Full Text Available The yeast Saccharomyces cerevisiae is one of the best characterized eukaryotic models. The secretory pathway was the first trafficking pathway clearly understood mainly thanks to the work done in the laboratory of Randy Schekman in the 1980s. They have isolated yeast sec mutants unable to secrete an extracellular enzyme and these SEC genes were identified as encoding key effectors of the secretory machinery. For this work, the 2013 Nobel Prize in Physiology and Medicine has been awarded to Randy Schekman; the prize is shared with James Rothman and Thomas Südhof. Here, we present the different trafficking pathways of yeast S. cerevisiae. At the Golgi apparatus newly synthesized proteins are sorted between those transported to the plasma membrane (PM, or the external medium, via the exocytosis or secretory pathway (SEC, and those targeted to the vacuole either through endosomes (vacuolar protein sorting or VPS pathway or directly (alkaline phosphatase or ALP pathway. Plasma membrane proteins can be internalized by endocytosis (END and transported to endosomes where they are sorted between those targeted for vacuolar degradation and those redirected to the Golgi (recycling or RCY pathway. Studies in yeast S. cerevisiae allowed the identification of most of the known effectors, protein complexes, and trafficking pathways in eukaryotic cells, and most of them are conserved among eukaryotes.

  11. Horizontal and vertical growth of S. cerevisiae metabolic network.

    KAUST Repository

    Grassi, Luigi

    2011-10-14

    BACKGROUND: The growth and development of a biological organism is reflected by its metabolic network, the evolution of which relies on the essential gene duplication mechanism. There are two current views about the evolution of metabolic networks. The retrograde model hypothesizes that a pathway evolves by recruiting novel enzymes in a direction opposite to the metabolic flow. The patchwork model is instead based on the assumption that the evolution is based on the exploitation of broad-specificity enzymes capable of catalysing a variety of metabolic reactions. RESULTS: We analysed a well-studied unicellular eukaryotic organism, S. cerevisiae, and studied the effect of the removal of paralogous gene products on its metabolic network. Our results, obtained using different paralog and network definitions, show that, after an initial period when gene duplication was indeed instrumental in expanding the metabolic space, the latter reached an equilibrium and subsequent gene duplications were used as a source of more specialized enzymes rather than as a source of novel reactions. We also show that the switch between the two evolutionary strategies in S. cerevisiae can be dated to about 350 million years ago. CONCLUSIONS: Our data, obtained through a novel analysis methodology, strongly supports the hypothesis that the patchwork model better explains the more recent evolution of the S. cerevisiae metabolic network. Interestingly, the effects of a patchwork strategy acting before the Euascomycete-Hemiascomycete divergence are still detectable today.

  12. Copper oxide nanoparticles inhibit the metabolic activity of Saccharomyces cerevisiae.

    Science.gov (United States)

    Mashock, Michael J; Kappell, Anthony D; Hallaj, Nadia; Hristova, Krassimira R

    2016-01-01

    Copper oxide nanoparticles (CuO NPs) are used increasingly in industrial applications and consumer products and thus may pose risk to human and environmental health. The interaction of CuO NPs with complex media and the impact on cell metabolism when exposed to sublethal concentrations are largely unknown. In the present study, the short-term effects of 2 different sized manufactured CuO NPs on metabolic activity of Saccharomyces cerevisiae were studied. The role of released Cu(2+) during dissolution of NPs in the growth media and the CuO nanostructure were considered. Characterization showed that the 28 nm and 64 nm CuO NPs used in the present study have different primary diameter, similar hydrodynamic diameter, and significantly different concentrations of dissolved Cu(2+) ions in the growth media released from the same initial NP mass. Exposures to CuO NPs or the released Cu(2+) fraction, at doses that do not have impact on cell viability, showed significant inhibition on S. cerevisiae cellular metabolic activity. A greater CuO NP effect on the metabolic activity of S. cerevisiae growth under respiring conditions was observed. Under the tested conditions the observed metabolic inhibition from the NPs was not explained fully by the released Cu ions from the dissolving NPs. PMID:26178758

  13. Can yeast (S. cerevisiae) metabolic volatiles provide polymorphic signaling?

    Science.gov (United States)

    Arguello, J Roman; Sellanes, Carolina; Lou, Yann Ru; Raguso, Robert A

    2013-01-01

    Chemical signaling between organisms is a ubiquitous and evolutionarily dynamic process that helps to ensure mate recognition, location of nutrients, avoidance of toxins, and social cooperation. Evolutionary changes in chemical communication systems progress through natural variation within the organism generating the signal as well as the responding individuals. A promising yet poorly understood system with which to probe the importance of this variation exists between D. melanogaster and S. cerevisiae. D. melanogaster relies on yeast for nutrients, while also serving as a vector for yeast cell dispersal. Both are outstanding genetic and genomic models, with Drosophila also serving as a preeminent model for sensory neurobiology. To help develop these two genetic models as an ecological model, we have tested if - and to what extent - S. cerevisiae is capable of producing polymorphic signaling through variation in metabolic volatiles. We have carried out a chemical phenotyping experiment for 14 diverse accessions within a common garden random block design. Leveraging genomic sequences for 11 of the accessions, we ensured a genetically broad sample and tested for phylogenetic signal arising from phenotypic dataset. Our results demonstrate that significant quantitative differences for volatile blends do exist among S. cerevisiae accessions. Of particular ecological relevance, the compounds driving the blend differences (acetoin, 2-phenyl ethanol and 3-methyl-1-butanol) are known ligands for D. melanogasters chemosensory receptors, and are related to sensory behaviors. Though unable to correlate the genetic and volatile measurements, our data point clear ways forward for behavioral assays aimed at understanding the implications of this variation. PMID:23990899

  14. [Production of β-carotene by metabolically engineered Saccharomyces cerevisiae].

    Science.gov (United States)

    Wang, Beibei; Shi, Mingyu; Wang, Dong; Xu, Jiaoyang; Liu, Yi; Yang, Hongjiang; Dai, Zhubo; Zhang, Xueli

    2014-08-01

    β-carotene has a wide range of application in food, pharmaceutical and cosmetic industries. For microbial production of β-carotene in Saccharomyces cerevisiae, the supply of geranylgeranyl diphosphate (GGPP) was firstly increased in S. cerevisiae BY4742 to obtain strain BY4742-T2 through over-expressing truncated 3-hydroxy-3-methylglutaryl-CoA reductase (tHMGR), which is the major rate-limiting enzyme in the mevalonate (MVA) pathway, and GGPP synthase (GGPS), which is a key enzyme in the diterpenoid synthetic pathway. The β-carotene synthetic genes of Pantoea agglomerans and Xanthophyllomyces dendrorhous were further integrated into strain BY4742-T2 for comparing β-carotene production. Over-expression of tHMGR and GGPS genes led to 26.0-fold increase of β-carotene production. In addition, genes from X. dendrorhous was more efficient than those from P. agglomerans for β-carotene production in S. cerevisiae. Strain BW02 was obtained which produced 1.56 mg/g (dry cell weight) β-carotene, which could be used further for constructing cell factories for β-carotene production. PMID:25507473

  15. Expression of native and mutant extracellular lipases fromYarrowia lipolytica in Saccharomyces cerevisiae

    OpenAIRE

    Darvishi, Farshad

    2012-01-01

    Summary Saccharomyces cerevisiae cannot produce extracellular lipase and utilize low‐cost lipid substrates. This study aimed to express extracellular lipase from Yarrowia lipolytica in S. cerevisiae, construct recombinant oily substrate consumer strains, and compare the roles of native and mutant Y. lipolytica extracellular lipases in S. cerevisiae. The LIP2 gene of Y. lipolytica DSM3286 and its mutant Y. lipolytica U6 were isolated and cloned by expression vector in S. cerevisiae. New recomb...

  16. AMIODARONE INDUCES THE SYNTHESIS OF HSPS IN SACCHAROMYCES CEREVISIAE AND ARABIDOPSIS THALIANA CELLS

    Directory of Open Access Journals (Sweden)

    Pyatrikas D.V.

    2012-08-01

    Full Text Available Many biotic and abiotic stresses cause an increase of cytosolic Ca2+ level in cells. Calcium is one of the most important second messengers, regulating many various activities in the cell and was known to affect expression of stress activated genes. Mild heat shock induces the expression of heat shock proteins (Hsps which protect cell from drastic heat shock exposure. There are some literature data permitting to suggest that transient elevation of cytosolic Ca2+ level in plant cells is important for activation of Hsps expression. On the other hand mitochondria are known to regulate the intracellular calcium and reactive oxygen species signaling. It has been shown recently that mild heat shock induces hyperpolarization of inner mitochondrial membrane in plant and yeast cells and this event is critically important for activation of Hsps expression. To reveal the relationship between mitochondrial activity, intracellular calcium homeostasis and Hsps expression an antiarrhythmic drug amiodarone (AMD have been used. AMD is known to cause transient increase of cytosolic Ca2+ level in Saccharomyces cerevisiae. Obtained results have showed that AMD treatment induced the synthesis of Hsp104p in S. cerevisiae cells and Hsp101p in A. thaliana cell culture. Induction of Hsp104p synthesis leads to enhanced yeast capability to survive lethal heat shock exposure. Development of S. cerevisiae thermotolerance depended significantly on the presence of Hsp104p. Elevation of Hsp104p level in the result of AMD treatment was shown to be governed by activity of Msn2p and Msn4p transcription factors. Deletion of the MSN2 and MSN4 genes abrogated the AMD ability to induce Hsp104p synthesis. Mild heat shock and AMD treatment induced the hyperpolarization of the inner mitochondrial membrane in yeast and Arabidopsis cells which accompanied by HSP synthesis and development of thermotolerance. It was suggested that increase of cytosolic Ca2+ level after AMD treatment

  17. Traffic of interacting ribosomes: effects of single-machine mechano-chemistry on protein synthesis

    CERN Document Server

    Basu, A; Basu, Aakash; Chowdhury, Debashish

    2006-01-01

    Many ribosomes simultaneously move on the same messenger RNA (mRNA), each synthesizing a protein. Earlier models of ribosome traffic represent each ribosome by a ``self-propelled particle'' and capture the dynamics by an extension of the totally asymmetric simple exclusion process. In contrast, here we develope a ``unified'' theoretical model that not only incorporates the mutual exclusions of the interacting ribosomes, but also describes explicitly the mechano-chemistry of each of these individual cyclic machines during protein synthesis. Using a combination of analytical and numerical techniques of non-equilibrium statistical mechanics, we analyze this model and illustrate its power by making experimentally testable predictions on the rate of protein synthesis and the density profile of the ribosomes on some mRNAs in E-Coli.

  18. Ribosome collisions and Translation efficiency: Optimization by codon usage and mRNA destabilization

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Sneppen, Kim; Pedersen, Steen

    2008-01-01

    collisions and queues are inevitable consequences of a stochastic translation mechanism that reduce the translation efficiency substantially on natural mRNAs. The cells minimize collisions by having its mRNAs being unstable and by a highly selected codon usage in the start of the mRNA. The cost of m......Individual mRNAs are translated by multiple ribosomes that initiate translation with an interval of a few seconds. The ribosome speed is codon dependent, and ribosome queuing has been suggested to explain specific data for translation of some mRNAs in vivo. By modeling the stochastic translation...... process as a traffic problem, we here analyze conditions and consequences of collisions and queuing. The model allowed us to determine the on-rate (0.8 to 1.1 initiations/s) and the time (1 s) the preceding ribosome occludes initiation for Escherichia coli lacZ mRNA in vivo. We find that ribosome...

  19. Structure of the GTP Form of Elongation Factor 4 (EF4) Bound to the Ribosome.

    Science.gov (United States)

    Kumar, Veerendra; Ero, Rya; Ahmed, Tofayel; Goh, Kwok Jian; Zhan, Yin; Bhushan, Shashi; Gao, Yong-Gui

    2016-06-17

    Elongation factor 4 (EF4) is a member of the family of ribosome-dependent translational GTPase factors, along with elongation factor G and BPI-inducible protein A. Although EF4 is highly conserved in bacterial, mitochondrial, and chloroplast genomes, its exact biological function remains controversial. Here we present the cryo-EM reconstitution of the GTP form of EF4 bound to the ribosome with P and E site tRNAs at 3.8-Å resolution. Interestingly, our structure reveals an unrotated ribosome rather than a clockwise-rotated ribosome, as observed in the presence of EF4-GDP and P site tRNA. In addition, we also observed a counterclockwise-rotated form of the above complex at 5.7-Å resolution. Taken together, our results shed light on the interactions formed between EF4, the ribosome, and the P site tRNA and illuminate the GTPase activation mechanism at previously unresolved detail. PMID:27137929

  20. Redox balancing in recombinant strains of Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Anderlund, M.

    1998-09-01

    In metabolically engineered Saccharomyces cerevisiae expressing Pichia stipitis XYL1 and XYL2 genes, encoding xylose reductase (XR) and xylitol dehydrogenase (XDH), respectively, xylitol is excreted as the major product during anaerobic xylose fermentation and only low yields of ethanol are produced. This has been interpreted as a result of the dual cofactor dependence of XR and the exclusive use of NAD{sup +} by XDH. The excretion of xylitol was completely stopped and the formation of glycerol and acetic acid were reduced in xylose utilising S. cerevisiae strains cultivated in oxygen-limited conditions by expressing lower levels of XR than of XDH. The expression level of XYL1 and XYL2 were controlled by changing the promoters and transcription directions of the genes. A new functional metabolic pathway was established when Thermus thermophilus xylA gene was expressed in S. cerevisiae. The recombinant strain was able to ferment xylose to ethanol when cultivated on a minimal medium containing xylose as only carbon source. In order to create a channeled metabolic transfer in the two first steps of the xylose metabolism, XYL1 and XYL2 were fused in-frame and expressed in S. cerevisiae. When the fusion protein, containing a linker of three amino acids, was co expressed together with native XR and XDH monomers, enzyme complexes consisting of chimeric and native subunits were formed. The total activity of these complexes exhibited 10 and 9 times higher XR and XDH activity, respectively, than the original conjugates, consisting of only chimeric subunits. This strain produced less xylitol and the xylitol yield was lower than with strains only expressing native XR and XDH monomers. In addition, more ethanol and less acetic acid were formed. A new gene encoding the cytoplasmic transhydrogenase from Azotobacter vinelandii was cloned. The enzyme showed high similarity to the family of pyridine nucleotide-disulphide oxidoreductase. To analyse the physiological effect of

  1. The Listeria monocytogenes Hibernation-Promoting Factor Is Required for the Formation of 100S Ribosomes, Optimal Fitness, and Pathogenesis

    OpenAIRE

    Kline, Benjamin C.; McKay, Susannah L.; Tang, William W.; Portnoy, Daniel A.

    2014-01-01

    During exposure to certain stresses, bacteria dimerize pairs of 70S ribosomes into translationally silent 100S particles in a process called ribosome hibernation. Although the biological roles of ribosome hibernation are not completely understood, this process appears to represent a conserved and adaptive response that contributes to optimal survival during stress and post-exponential-phase growth. Hibernating ribosomes are formed by the activity of one or more highly conserved proteins; gamm...

  2. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome

    OpenAIRE

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns

    2016-01-01

    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of rib...

  3. Decreased ribosomal DNA transcription in dorsal raphe nucleus neurons is specific for suicide regardless of psychiatric diagnosis.

    Science.gov (United States)

    Krzyżanowska, Marta; Steiner, Johann; Brisch, Ralf; Mawrin, Christian; Busse, Stefan; Karnecki, Karol; Jankowski, Zbigniew; Gos, Tomasz

    2016-07-30

    The dorsal raphe nucleus (DRN) is the main source of serotonergic innervation of forebrain limbic structures disturbed in suicidal behaviour. We have evaluated the transcriptional activity of ribosomal DNA (rDNA) in DRN neurons by AgNOR silver staining method. The cohort (containing 24 suicidal and 20 non-suicidal patients, and 28 controls) was previously analysed regarding diagnosis-related differences between schizophrenia and affective disorders. Significant decreases in both AgNOR and nuclear areas suggestive of attenuated rDNA activity were currently found in suicidal versus non-suicidal patients. This effect, which was more accentuated in affective disorders patients, was not explained by antidepressant and antipsychotic medication. PMID:27155286

  4. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing.

    Science.gov (United States)

    Balzer, M; Wagner, R

    1998-02-27

    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  5. Ribosome-Inactivating Proteins: From Plant Defense to Tumor Attack

    Directory of Open Access Journals (Sweden)

    Maria Serena Fabbrini

    2010-11-01

    Full Text Available Ribosome-inactivating proteins (RIPs are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential.

  6. A ribosome-inactivating protein in a Drosophila defensive symbiont.

    Science.gov (United States)

    Hamilton, Phineas T; Peng, Fangni; Boulanger, Martin J; Perlman, Steve J

    2016-01-12

    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  7. A coniferyl aldehyde dehydrogenase gene from Pseudomonas sp. strain HR199 enhances the conversion of coniferyl aldehyde by Saccharomyces cerevisiae.

    Science.gov (United States)

    Adeboye, Peter Temitope; Olsson, Lisbeth; Bettiga, Maurizio

    2016-07-01

    The conversion of coniferyl aldehyde to cinnamic acids by Saccharomyces cerevisiae under aerobic growth conditions was previously observed. Bacteria such as Pseudomonas have been shown to harbor specialized enzymes for converting coniferyl aldehyde but no comparable enzymes have been identified in S. cerevisiae. CALDH from Pseudomonas was expressed in S. cerevisiae. An acetaldehyde dehydrogenase (Ald5) was also hypothesized to be actively involved in the conversion of coniferyl aldehyde under aerobic growth conditions in S. cerevisiae. In a second S. cerevisiae strain, the acetaldehyde dehydrogenase (ALD5) was deleted. A prototrophic control strain was also engineered. The engineered S. cerevisiae strains were cultivated in the presence of 1.1mM coniferyl aldehyde under aerobic condition in bioreactors. The results confirmed that expression of CALDH increased endogenous conversion of coniferyl aldehyde in S. cerevisiae and ALD5 is actively involved with the conversion of coniferyl aldehyde in S. cerevisiae. PMID:27070284

  8. Study on the development of high yielding alcohol resistant strain of Saccharomyces cerevisiae and the Influence of Magnetic field on Saccharomyces cerevisiae Inoculum for the production of Alcohol and Vinegar from apple juice.

    Directory of Open Access Journals (Sweden)

    Rabiul Haque

    2014-12-01

    Full Text Available Natural vinegar is one of the fermented products which has some potentiality with respect to a nutraceutical standpoint. The present study is an optimization of the fermentation conditions for apple juice vinegar production from aple juice wine, this biochemical process being aided by Acetobacter aceti.We have studied on the development of high yielding alcohol resistant strain of Saccharomyces cerevisiae for the production of alcohol. Overflow metabolism is an undesirable characteristic of aerobic cultures of Saccharomyces cerevisiae during biomassdirected processes. It results from elevated apple juice containing sugar consumption rates that cause a high substrate conversion to ethanol and other bi-products, severely affecting cell physiology, bioprocess performance, and biomass yields. Fed-batch culture, where sucrose consumption rates are controlled by the external addition of sugar aiming at its low concentrations in the fermentor, is the classical bioprocessing alternative to prevent sugar fermentation by yeasts. However, fed-batch fermentations present drawbacks that could be overcome by simpler batch cultures at relatively high initial sugar concentrations From the results it is clear that strain T2. which has been exposed to 15% alcohol for 18 hrs is the high yielding strain, as it gives 16% alcohol after distillation. We also find that as the exposure is increased, that is, with increasing exposure to 20% alcohol for 5 hrs, 18 hrs, and 20 hrs, the production of alcohol decreases. Saccharomyces cerevisiae yeast cells strain T2. which has been exposed to 15% alcohol for 18 hrs were exposed to a homogenous static magnetic field of 125 mT for periods of 24, 48 or 72 hours and then used as inoculum for the alcoholic fermentation. The exposure to the magnetic field improved the fermentation process kinetics. Biomass and ethanol yields of fermentations inoculated with treated inoculum were higher than those in the control fermentation, which

  9. A rapid and simple pipeline for synthesis of mRNA-ribosome-V(H)H complexes used in single-domain antibody ribosome display.

    Science.gov (United States)

    Bencurova, Elena; Pulzova, Lucia; Flachbartova, Zuzana; Bhide, Mangesh

    2015-06-01

    The single-domain antibody (VHH) is a promising building block for a number of antibody-based applications. Ribosome display can successfully be used in the production of VHH. However, the construction of the expression cassette, confirmation of the translation and proper folding of the nascent chain, and the purification of the ribosome complexes, remain cumbersome tasks. Additionally, selection of the most suitable expression system can be challenging. We have designed primers that will amplify virtually all Camelidae VHH. With the help of a double-overlap extension (OE) polymerase chain reaction (PCR) we have fused VHH with the F1 fragment (T7 promoter and species-independent translation sequence) and the F2 fragment (mCherry, Myc-tag, tether, SecM arrest sequence and 3' stem loop) to generate a full-length DNA cassette. OE-PCR generated fragments were incubated directly with cell-free lysates (Leishmania torentolae, rabbit reticulocyte or E. coli) for the synthesis of mRNA-VHH-mCherry-ribosome complexes in vitro. Alternatively, the cassette was ligated in pQE-30 vector and transformed into E. coli to produce ribosome complexes in vivo. The results showed that the same expression cassette could be used to synthesize ribosome complexes with different expression systems. mCherry reporter served to confirm the synthesis and proper folding of the nascent chain, Myc-tag was useful in the rapid purification of ribosome complexes, and combination of the SecM sequence and 3' stem loop made the cassette universal, both for cells-free and E. coli in vivo. This rapid and universal pipeline can effectively be used in antibody ribosome display and VHH production. PMID:25902394

  10. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  11. DNAJC21 Mutations Link a Cancer-Prone Bone Marrow Failure Syndrome to Corruption in 60S Ribosome Subunit Maturation.

    Science.gov (United States)

    Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom

    2016-07-01

    A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. PMID:27346687

  12. Spontaneous clearance of chronic hepatitis C infection is associated with an internal ribosomal entry site IIId stem loop structure variant

    Directory of Open Access Journals (Sweden)

    N G Bader El Din

    2015-01-01

    Full Text Available Aim: To investigate if any mutations in hepatitis C virus (HCV internal ribosome entry site (IRES can inhibit the translation of viral polyprotein. Materials and Methods: A 26-year-old male patient infected with HCV 10 years ago was followed up. After 9 years of chronic infection. The patient had managed to resolve the infection for a period of 9 months, after which the patient experienced a viral recurrence characterized by high viral load and diverse HCV quasispecies. The IRES structures of the viral strains that disappeared were comparable with those that are currently active using structural mutational analysis. Results: A novo mutational position 254 combined with a rarely observed mutation at position 253 in the stem of the IIId subdomain were observed and the new conformation had an octa-apical loop (AGUGUUGG and a shift in the 3 ` GU from the loop to the stem. Conclusions: These mutations were found to be highly deleterious, and they affected the direct binding of the IIId loop to the 40S ribosomal subunit with a subsequent inhibition of translation of viral polyprotein and clearance of the virus.

  13. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  14. Translation by polysome: theory of ribosome profile on a single mRNA transcript

    CERN Document Server

    Sharma, Ajeet K

    2011-01-01

    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called {\\it translation}. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, {\\it polysome}). Experimentally measured {\\it polysome profile} gives the distribution of polysome {\\it sizes}. Recently a breakthrough in determining the instantaneous {\\it positions} of the ribosomes on a given mRNA track has been achieved and the technique is called {\\it ribosome profiling} \\cite{ingolia10,guo10}. Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere \\cite{sharma11}. This extended version of our model incorporates not only (i) mechano-chemical cycle of indivi...

  15. YsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stability

    Directory of Open Access Journals (Sweden)

    García-Lara Jorge

    2009-12-01

    Full Text Available Abstract Background Bacterial growth and division requires a core set of essential proteins, several of which are still of unknown function. They are also attractive targets for the development of new antibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with a possible ribosome associated function. Results Here, we demonstrate by the creation of a conditional lethal mutant that ysxC is apparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translational fusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enabling Tandem Affinity Purification (TAP of YsxC-interacting partners. These included the ribosomal proteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shown to copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxC depletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosome assembly and/or stability in S. aureus. Conclusions In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, is crucial for ribosomal stability and is apparently essential for the life of S. aureus.

  16. Identification of novel functional domains of Rad52 in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Plate, Iben

    2006-01-01

    . cerevisiae er desuden nem at manipulere genetisk og der eksisterer sofistikerede in vivo assays som muliggør visualisering af reparationsprocessen ved hjælp af fluorescensmikroskopi. Rad52 er et vigtigt protein til reparation af DNA DSB i S. cerevisiae og rad52Δ celler har en alvorlig fænotype med langsom...

  17. Engineering of carbon catabolite repression in recombinant xylose fermenting Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Roca, Christophe Francois Aime; Haack, Martin Brian; Olsson, Lisbeth

    2004-01-01

    Two xylose-fermenting glucose-derepressed Saccharomyces cerevisiae strains were constructed in order to investigate the influence of carbon catabolite repression on xylose metabolism. S. cerevisiae CPB.CR2 (Deltamig1, XYL1, XYL2, XKS1) and CPB.MBH2 (Deltamig1, Deltamig2, XYL1, XYL2, XKS1) were...

  18. Enhancing sesquiterpene production in Saccharomyces cerevisiae through in silico driven metabolic engineering

    DEFF Research Database (Denmark)

    Asadollahi, Mohammadali; Maury, Jerome; Patil, Kiran Raosaheb;

    2009-01-01

    A genome-scale metabolic model was used to identify new target genes for enhanced biosynthesis of sesquiterpenes in the yeast Saccharomyces cerevisiae. The effect of gene deletions on the flux distributions in the metabolic model of S. cerevisiae was assessed using OptGene as the modeling framewo...

  19. Functional co-operation between the nuclei of Saccharomyces cerevisiae and mitochondria from other yeast species

    DEFF Research Database (Denmark)

    Spirek, M.; Horvath, A.; Piskur, Jure;

    2000-01-01

    We elaborated a simple method that allows the transfer of mitochondria from collection yeasts to Saccharomyces cerevisiae. Protoplasts prepared from different yeasts were fused to the protoplasts of the ade2-1, ura3-52, kar1-1, rho (0) strain of S. cerevisiae and were selected for respiring cybrids...

  20. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    both fermentable and non-fermentable carbon sources the only presence of two copies of HAP2/3/4/5-binding site is sufficient. However, activation of AAC3-lacZ expression by two copies of HAP2/3/4/5-binding site is very low. We can conclude that the presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to get strong activation of AAC2 gene. A gene homologous to Saccharomyces cerevisiae AAC genes coding for mitochondrial ADP/ATP carriers has been cloned from pathogenic yeast Candida parapsilosis. The cloned gene was sequenced and found to encode a polypeptide of 303 amino acids that shows homology with other yeast and mammal mitochondrial ADP/ATP carriers. The gene was designed CpAAC1 and was able to complement the growth phenotype of S. cerevisiae double deletion mutant (Δaac2Δaac3). The expression of the CpAAC1 gene was affected at normal aerobic conditions by the nature of carbon source used for growth. The concentration of oxygen had no effect to the expression of this gene. Hybridization experiments indicate that C. parapsilosis possesses a single gene encoding a mitochondrial ADP/ ATP carrier. (author)

  1. β-Puromycin selection of modified ribosomes for in vitro incorporation of β-amino acids.

    Science.gov (United States)

    Dedkova, Larisa M; Fahmi, Nour Eddine; Paul, Rakesh; del Rosario, Melissa; Zhang, Liqiang; Chen, Shengxi; Feder, Glen; Hecht, Sidney M

    2012-01-10

    Ribosomally mediated protein biosynthesis is limited to α-L-amino acids. A strong bias against β-L-amino acids precludes their incorporation into proteins in vivo and also in vitro in the presence of misacylated β-aminoacyl-tRNAs. Nonetheless, earlier studies provide some evidence that analogues of aminoacyl-tRNAs bearing β-amino acids can be accommodated in the ribosomal A-site. Both functional and X-ray crystallographic data make it clear that the exclusion of β-L-amino acids as participants in protein synthesis is a consequence of the architecture of the ribosomal peptidyltransferase center (PTC). To enable the reorganization of ribosomal PTC architecture through mutagenesis of 23S rRNA, a library of modified ribosomes having modifications in two regions of the 23S rRNA (2057-2063 and 2496-2507 or 2582-2588) was prepared. A dual selection procedure was used to obtain a set of modified ribosomes able to carry out protein synthesis in the presence β-L-amino acids and to provide evidence for the utilization of such amino acids, in addition to α-L-amino acids. β-Puromycin, a putative mimetic for β-aminoacyl-tRNAs, was used to select modified ribosome variants having altered PTC architectures, thus potentially enabling incorporation of β-L-amino acids. Eight types of modified ribosomes altered within the PTC have been selected by monitoring improved sensitivity to β-puromycin in vivo. Two of the modified ribosomes, having 2057AGCGUGA2063 and 2502UGGCAG2507 or 2502AGCCAG2507, were able to suppress UAG codons in E. coli dihydrofolate reductase (DHFR) and scorpion Opisthorcanthus madagascariensis peptide IsCT mRNAs in the presence of β-alanyl-tRNA(CUA). PMID:22145951

  2. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  3. Auxin-induced changes in the incorporation of /sup 3/H-amino acids into soybean ribosomal proteins

    Energy Technology Data Exchange (ETDEWEB)

    Travis, R.L.; Key, J.L.

    1976-06-01

    Auxin-induced activation of 80S ribosomes and polyribosome formation in mature soybean (Glycine max var. Hawkeye) hypocotyl (R. L. Travis, J. M. Anderson, and J. L. Key. 1973. Plant Physiol. 52: 608-612) in the presence of a mixture of radioactive amino acids correlates with an increased specific radioactivity of at least three ribosomal proteins; the labeling of one of these increased severalfold above the control level. Results of experiments with 5-fluorouracil and cycloheximide indicated that the proteins in question were synthesized in response to auxin and became associated with pre-existing ribosomes. Ribosome dissociation experiments indicated that these proteins were associated with the 60S ribosome subunit.

  4. Impact of P-Site tRNA and antibiotics on ribosome mediated protein folding: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Surojit Mondal

    Full Text Available BACKGROUND: The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3' -CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA also displays chaperoning activity. RESULTS: The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin and macrolide antibiotics (erythromycin and josamycin on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3'-CCA end of P/P-site tRNA with the PTC is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA to be important for its chaperoning ability. CONCLUSION: Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions.

  5. Transcription-independent role for human mitochondrial RNA polymerase in mitochondrial ribosome biogenesis

    OpenAIRE

    Surovtseva, Yulia V; Shadel, Gerald S.

    2013-01-01

    Human mitochondrial RNA polymerase, POLRMT, is required for mitochondrial DNA (mtDNA) transcription and forms initiation complexes with human mitochondrial transcription factor B2 (h-mtTFB2). However, POLRMT also interacts with the paralogue of h-mtTFB2, h-mtTFB1, which is a 12S ribosomal RNA methyltransferase required for small (28S) mitochondrial ribosome subunit assembly. Herein, we show that POLRMT associates with h-mtTFB1 in 28S mitochondrial ribosome complexes that are stable in the abs...

  6. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †

    OpenAIRE

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L; Cooper, Rebecca E.; Wilson, Lindsay A; Stoneley, Mark; Coldwell, Mark J; Poncet, Didier; Shen, Ya-Ching; Morley, Simon; Bushell, Martin; Willis, Anne E.

    2009-01-01

    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5' end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5' untranslated region (5'-UTR) of the mRNA. However, it is not well understood how cellular I...

  7. Hyperaccurate and error-prone ribosomes exploit distinct mechanisms during tRNA selection

    OpenAIRE

    Zaher, Hani S.; Green, Rachel

    2010-01-01

    Escherichia coli strains displaying hyper-accurate (restrictive) and ribosomal ambiguity (ram) phenotypes have long been associated with alterations in rpsL and rpsD/rpsE, respectively. Crystallographic evidence shows the ribosomal proteins S12 and S4/S5 (corresponding to these genes) to be located in separate regions of the small ribosomal subunit that are important for domain-closure thought to take place during tRNA selection. Mechanistically, the process of tRNA selection is separated int...

  8. Identical ribosomal DNA sequence data from Pfiesteria piscicida (Dinophyceae) isolates with different toxicity phenotypes

    International Nuclear Information System (INIS)

    Complete small subunit ribosomal RNA, internal transcribed spacer 1 and 2, 5.8S, and partial large subunit ribosomal RNA gene sequences were generated from multiple isolates of Pfiesteria piscicida. Sequences were derived from isolates that have been shown to be ichthyotoxic as well as isolates that have no history of toxic behavior. All of the sequences generated were identical for the different cultures, and we therefore conclude that differences in toxicity seen between isolates of P. piscicida are linked to factors other than genetic strain variation detectable by ribosomal gene sequence analyses

  9. Properties of the ribosome-inactivating proteins gelonin, Momordica charantia inhibitor, and dianthins.

    Science.gov (United States)

    Falasca, A; Gasperi-Campani, A; Abbondanza, A; Barbieri, L; Stirpe, F

    1982-12-01

    The amino acid and sugar compositions of four ribosome-inactivating proteins (gelonin, Momordica charantia inhibitor, dianthin 30 and dianthin 32) were determined. The proteins are all basic glycoproteins (pI greater than 8) containing mannose (more abundant in gelonin), glucose, xylose, fucose (absent from gelonin) and glucosamine. The ribosome-inactivating properties of the proteins examined are not modified by pretreatment with N-ethylmaleimide. Precipitating and inactivating antibodies can be raised against ribosome-inactivating proteins; a weak cross-reaction was observed only between dianthin 30 and dianthin 32. PMID:6819861

  10. Horizontal gene transfer of zinc and non-zinc forms of bacterial ribosomal protein S4

    OpenAIRE

    Luthey-Schulten Zaida; Roberts Elijah; Chen Ke

    2009-01-01

    Abstract Background The universal ribosomal protein S4 is essential for the initiation of small subunit ribosomal assembly and translational accuracy. Being part of the information processing machinery of the cell, the gene for S4 is generally thought of as being inherited vertically and has been used in concatenated gene phylogenies. Here we report the evolution of ribosomal protein S4 in relation to a broad sharing of zinc/non-zinc forms of the gene and study the scope of horizontal gene tr...

  11. Oral administration of myostatin-specific recombinant Saccharomyces cerevisiae vaccine in rabbit.

    Science.gov (United States)

    Liu, Zhongtian; Zhou, Gang; Ren, Chonghua; Xu, Kun; Yan, Qiang; Li, Xinyi; Zhang, Tingting; Zhang, Zhiying

    2016-04-29

    Yeast is considered as a simple and cost-effective host for protein expression, and our previous studies have proved that Saccharomyces cerevisiae can deliver recombinant protein and DNA into mouse dendritic cells and can further induce immune responses as novel vaccines. In order to know whether similar immune responses can be induced in rabbit by oral administration of such recombinant S. cerevisiae vaccine, we orally fed the rabbits with heat-inactivated myostatin-recombinant S. cerevisiae for 5 weeks, and then myostatin-specific antibody in serum was detected successfully by western blotting and ELISA assay. The rabbits treated with myostatin-recombinant S. cerevisiae vaccine grew faster and their muscles were much heavier than that of the control group. As a common experimental animal and a meat livestock with great economic value, rabbit was proved to be the second animal species that have been successfully orally immunized by recombinant S. cerevisiae vaccine after mice. PMID:27005809

  12. Construction of killer industrial yeast Saccharomyces cerevisiae HAU-1 and its fermentation performance

    Directory of Open Access Journals (Sweden)

    Bijender K. Bajaj

    2010-06-01

    Full Text Available Saccharomyces cerevisiae HAU-1, a time tested industrial yeast possesses most of the desirable fermentation characteristics like fast growth and fermentation rate, osmotolerance, high ethanol tolerance, ability to ferment molasses, and to ferment at elevated temperatures etc. However, this yeast was found to be sensitive against the killer strains of Saccharomyces cerevisiae. In the present study, killer trait was introduced into Saccharomyces cerevisiae HAU-1 by protoplast fusion with Saccharomyces cerevisiae MTCC 475, a killer strain. The resultant fusants were characterized for desirable fermentation characteristics. All the technologically important characteristics of distillery yeast Saccharomyces cerevisiae HAU-1 were retained in the fusants, and in addition the killer trait was also introduced into them. Further, the killer activity was found to be stably maintained during hostile conditions of ethanol fermentations in dextrose or molasses, and even during biomass recycling.

  13. High level secretion of cellobiohydrolases by Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Ahlgren Simon

    2011-09-01

    Full Text Available Abstract Background The main technological impediment to widespread utilization of lignocellulose for the production of fuels and chemicals is the lack of low-cost technologies to overcome its recalcitrance. Organisms that hydrolyze lignocellulose and produce a valuable product such as ethanol at a high rate and titer could significantly reduce the costs of biomass conversion technologies, and will allow separate conversion steps to be combined in a consolidated bioprocess (CBP. Development of Saccharomyces cerevisiae for CBP requires the high level secretion of cellulases, particularly cellobiohydrolases. Results We expressed various cellobiohydrolases to identify enzymes that were efficiently secreted by S. cerevisiae. For enhanced cellulose hydrolysis, we engineered bimodular derivatives of a well secreted enzyme that naturally lacks the carbohydrate-binding module, and constructed strains expressing combinations of cbh1 and cbh2 genes. Though there was significant variability in the enzyme levels produced, up to approximately 0.3 g/L CBH1 and approximately 1 g/L CBH2 could be produced in high cell density fermentations. Furthermore, we could show activation of the unfolded protein response as a result of cellobiohydrolase production. Finally, we report fermentation of microcrystalline cellulose (Avicel™ to ethanol by CBH-producing S. cerevisiae strains with the addition of beta-glucosidase. Conclusions Gene or protein specific features and compatibility with the host are important for efficient cellobiohydrolase secretion in yeast. The present work demonstrated that production of both CBH1 and CBH2 could be improved to levels where the barrier to CBH sufficiency in the hydrolysis of cellulose was overcome.

  14. Human G protein-coupled receptor studies in Saccharomyces cerevisiae.

    Science.gov (United States)

    Liu, Rongfang; Wong, Winsy; IJzerman, Adriaan P

    2016-08-15

    G protein-coupled receptors (GPCRs) are one of the largest families of membrane proteins, with approximately 800 different GPCRs in the human genome. Signaling via GPCRs regulates many biological processes, such as cell proliferation, differentiation, and development. In addition, many receptors have a pivotal role in immunophysiology. Many hormones and neurotransmitters are ligands for these receptors, and hence it is not surprising that many drugs, either mimicking or blocking the action of the bodily substances, have been developed. It is estimated that 30-40% of current drugs on the market target GPCRs. Further identifying and elucidating the functions of GPCRs will provide opportunities for novel drug discovery, including for immunotherapy. The budding yeast Saccharomyces cerevisiae (S. cerevisiae) is a very important and useful platform in this respect. There are many advantages of using a yeast assay system, as it is cheap, safe and stable; it is also convenient for rapid feasibility and optimization studies. Moreover, it offers a "null" background when studying human GPCRs. New developments regarding human GPCRs expressed in a yeast platform are providing insight into GPCR activation and signaling, and facilitate agonist and antagonist identification. In this review we summarize the latest findings regarding human G-protein-coupled receptors in studies using S. cerevisiae, ever since the year 2005 when we last published a review on this topic. We describe 11 families of GPCRs in detail, while including the principles and developments of each yeast system applied to these different GPCRs and highlight and generalize the experimental findings of GPCR function in these systems. PMID:26920251

  15. On cycles in the transcription network of Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Berman Piotr

    2008-01-01

    Full Text Available Abstract Background We investigate the cycles in the transcription network of Saccharomyces cerevisiae. Unlike a similar network of Escherichia coli, it contains many cycles. We characterize properties of these cycles and their place in the regulatory mechanism of the cell. Results Almost all cycles in the transcription network of Saccharomyces cerevisiae are contained in a single strongly connected component, which we call LSCC (L for "largest", except for a single cycle of two transcription factors. The fact that LSCC includes almost all cycles is well explained by the properties of a random graph with the same in- and out-degrees of the nodes. Among different physiological conditions, cell cycle has the most significant relationship with LSCC, as the set of 64 transcription interactions that are active in all phases of the cell cycle has overlap of 27 with the interactions of LSCC (of which there are 49. Conversely, if we remove the interactions that are active in all phases of the cell cycle (25% of interactions to transcription factors, the LSCC would have only three nodes and 5 edges, many fewer than expected. This subgraph of the transcription network consists mostly of interactions that are active only in the stress response subnetwork. We also characterize the role of LSCC in the topology of the network. We show that LSCC can be used to define a natural hierarchy in the network and that in every physiological subnetwork LSCC plays a pivotal role. Conclusion Apart from those well-defined conditions, the transcription network of Saccharomyces cerevisiae is devoid of cycles. It was observed that two conditions that were studied and that have no cycles of their own are exogenous: diauxic shift and DNA repair, while cell cycle and sporulation are endogenous. We claim that in a certain sense (slow recovery stress response is endogenous as well.

  16. Heterologous expression of cellulase genes in natural Saccharomyces cerevisiae strains.

    Science.gov (United States)

    Davison, Steffi A; den Haan, Riaan; van Zyl, Willem Heber

    2016-09-01

    Enzyme cost is a major impediment to second-generation (2G) cellulosic ethanol production. One strategy to reduce enzyme cost is to engineer enzyme production capacity in a fermentative microorganism to enable consolidated bio-processing (CBP). Ideally, a strain with a high secretory phenotype, high fermentative capacity as well as an innate robustness to bioethanol-specific stressors, including tolerance to products formed during pre-treatment and fermentation of lignocellulosic substrates should be used. Saccharomyces cerevisiae is a robust fermentative yeast but has limitations as a potential CBP host, such as low heterologous protein secretion titers. In this study, we evaluated natural S. cerevisiae isolate strains for superior secretion activity and other industrially relevant characteristics needed during the process of lignocellulosic ethanol production. Individual cellulases namely Saccharomycopsis fibuligera Cel3A (β-glucosidase), Talaromyces emersonii Cel7A (cellobiohydrolase), and Trichoderma reesei Cel5A (endoglucanase) were utilized as reporter proteins. Natural strain YI13 was identified to have a high secretory phenotype, demonstrating a 3.7- and 3.5-fold higher Cel7A and Cel5A activity, respectively, compared to the reference strain S288c. YI13 also demonstrated other industrially relevant characteristics such as growth vigor, high ethanol titer, multi-tolerance to high temperatures (37 and 40 °C), ethanol (10 % w/v), and towards various concentrations of a cocktail of inhibitory compounds commonly found in lignocellulose hydrolysates. This study accentuates the value of natural S. cerevisiae isolate strains to serve as potential robust and highly productive chassis organisms for CBP strain development. PMID:27470141

  17. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech;

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached to the ribos......The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...... to the ribosome through the P0 protein. The "stalk" is essential for the ribosome activity, taking part in the interaction with elongation factors.In this report, we have shown that the subcellular distribution of the human P proteins does not fall into standard behavior of regular ribosomal proteins. We have...... used two approaches to assess the distribution of the P proteins, in vivo experiments with GFP fusion proteins and in vitro one with anti-P protein antibodies. In contrast to standard r-proteins, the P1 and P2 proteins are not actively transported into the nucleus compartment, remaining predominantly...

  18. Mechanistic Analysis of the Saccharomyces cerevisiae Kinesin Kar3*S

    OpenAIRE

    Mackey, Andrew T.; Sproul, Lisa R.; Sontag, Christopher A.; Satterwhite, Lisa L.; Correia, John J.; Gilbert, Susan P.

    2004-01-01

    Kar3 is a minus-end-directed microtubule motor that is implicated in meiotic and mitotic spindle function in Saccharomyces cerevisiae. To date, the only truncated protein of Kar3 that has been reported to promote unidirectional movement in vitro is GSTKar3. This motor contains an NH2-terminal glutathione S-transferase (GST) tag followed by the Kar3 sequence that is predicted to form an extended α-helical coiled-coil. The α-helical domain leads into the neck linker and COOH-terminal motor doma...

  19. Studies of the Saccharomyces cerevisiae Cultivation under Oscillatory Mixing Conditions

    Directory of Open Access Journals (Sweden)

    M?ris Rikmanis

    2005-12-01

    Full Text Available Saccharomyces cerevisiae was cultivated under non-aerated conditions in a 5 l laboratory bioreactor. Using the experimental data and the regression analysis method, some mathematical correlations for stirrer rotational speed oscillation frequency and the reaction of the yeast were established. It has been found that different growth parameters are influenced variously by stirrer rotational speed and stirrer rotational speed oscillation frequency. Stirring oscillations can be among the methods for stimulation of biotechnological processes. The obtained results can be used for designing bioreactors and optimizing working conditions.

  20. Heat shock response improves heterologous protein secretion in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hou, Jin; Österlund, Tobias; Liu, Zihe;

    2013-01-01

    The yeast Saccharomyces cerevisiae is a widely used platform for the production of heterologous proteins of medical or industrial interest. However, heterologous protein productivity is often low due to limitations of the host strain. Heat shock response (HSR) is an inducible, global, cellular...... the accumulation of mis-folded or aggregated proteins. In this work, we over-expressed a mutant HSF1 gene HSF1-R206S which can constitutively activate HSR, so the heat shock response was induced at different levels, and we studied the impact of HSR on heterologous protein secretion. We found that moderate and high...

  1. Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Kron, S J; Styles, C. A.; Fink, G R

    1994-01-01

    Laboratory strains of Saccharomyces cerevisiae are dimorphic; in response to nitrogen starvation they switch from a yeast form (YF) to a filamentous pseudohyphal (PH) form. Time-lapse video microscopy of dividing cells reveals that YF and PH cells differ in their cell cycles and budding polarity. The YF cell cycle is controlled at the G1/S transition by the cell-size checkpoint Start. YF cells divide asymmetrically, producing small daughters from full-sized mothers. As a result, mothers and d...

  2. RNAi-Assisted Genome Evolution (RAGE) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Si, Tong; Zhao, Huimin

    2016-01-01

    RNA interference (RNAi)-assisted genome evolution (RAGE) applies directed evolution principles to engineer Saccharomyces cerevisiae genomes. Here, we use acetic acid tolerance as a target trait to describe the key steps of RAGE. Briefly, iterative cycles of RNAi screening are performed to accumulate multiplex knockdown modifications, enabling directed evolution of the yeast genome and continuous improvement of a target phenotype. Detailed protocols are provided on the reconstitution of RNAi machinery, creation of genome-wide RNAi libraries, identification and integration of beneficial knockdown cassettes, and repeated RAGE cycles. PMID:27581294

  3. Magnetically altered ethanol fermentation capacity of Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Galonja-Corghill Tamara

    2009-01-01

    Full Text Available We studied the effect of static magnetic fields on ethanol production by yeast Saccharomyces cerevisiae 424A (LNH-ST using sugar cane molasses during the fermentation in an enclosed bioreactor. Two static NdFeB magnets were attached to a cylindrical tube reactor with their opposite poles (north to south, creating 150 mT magnetic field inside the reactor. Comparable differences emerged between the results of these two experimental conditions. We found ethanol productivity to be 15% higher in the samples exposed to 150 mT magnetic field.

  4. Production of ethanol from blackstrap molasses by saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Blackstrap molasses was analyzed for its composition and its fermentation was brought about by the yeast S. cerevisiae at predetermined optimal environmental conditions such as pH, temperature, Sugar concentration, and incubation period. The results revealed that sugar concentration 17%, pH 4.5, temperature 30 C and incubation period of 72 hours were the optimal conditions for producing maximum (73 g/l) ethanol. Clearance of molasses by 20% single superphosphate enhanced ethanol production by only 0.2%. (author)

  5. Determinants of Swe1p Degradation in Saccharomyces cerevisiae

    OpenAIRE

    McMillan, John N.; Theesfeld, Chandra L.; Harrison, Jacob C.; Bardes, Elaine S.G.; Lew, Daniel J.

    2002-01-01

    Swe1p, the sole Wee1-family kinase in Saccharomyces cerevisiae, is synthesized during late G1 and is then degraded as cells proceed through the cell cycle. However, Swe1p degradation is halted by the morphogenesis checkpoint, which responds to insults that perturb bud formation. The Swe1p stabilization promotes cell cycle arrest through Swe1p-mediated inhibitory phosphorylation of Cdc28p until the cells can recover from the perturbation and resume bud formation. Swe1p degradation involves the...

  6. Non-Coding RNA Prediction and Verification in Saccharomyces cerevisiae

    OpenAIRE

    Kavanaugh, Laura A.; Dietrich, Fred S.

    2009-01-01

    Non-coding RNA (ncRNA) play an important and varied role in cellular function. A significant amount of research has been devoted to computational prediction of these genes from genomic sequence, but the ability to do so has remained elusive due to a lack of apparent genomic features. In this work, thermodynamic stability of ncRNA structural elements, as summarized in a Z-score, is used to predict ncRNA in the yeast Saccharomyces cerevisiae. This analysis was coupled with comparative genomics ...

  7. Understanding the 3-hydroxypropionic acid tolerance mechanism in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Kildegaard, Kanchana Rueksomtawin; Juncker, Agnieszka; Hallstrom, Bjorn; Jensen, Niels Bjerg; Maury, Jerome; Nielsen, Jen; Förster, Jochen; Borodina, Irina

    3-Hydroxypropionic acid (3HP) is an important platform chemical that can be converted into other valuable chemicals such as acrylic acid and its derivatives that are used in baby diap ers, various plastics, and paints. With the oil and gas resources becoming limiting, biotechnolo gy offers a sust...... evolved strains. Conseq uently, mechanism underlying 3HP tolerance will be investigated....... improve 3HP tolerance in S. cerevisiae by applying adaptive evolution approach. We have generated yeast strains with sign ificantly improved capacity for tolerating 3HP when compared to the wild-type. We will present physiolo gical characterization, genome re-sequencing, and transcriptome analysis of the...

  8. Identification of the mitochondrial receptor complex in Saccharomyces cerevisiae

    OpenAIRE

    Moczko, Martin; Dietmeier, Klaus A.; Söllner, Thomas; Segui-Real, Bartolome; Steger, Heinrich F.; Neupert, Walter; Pfanner, Nikolaus

    1992-01-01

    Mitochondrial protein import involves the recognition of preproteins by receptors and their subsequent translocation across the outer membrane. In Neurospora crassa, the two import receptors, MOM19 and MOM72, were found in a complex with the general insertion protein, GIP (formed by MOM7, MOM8, MOM30 and MOM38) and MOM22. We isolated a complex out of S. cerevisiae mitochondria consisting of MOM38/ISP42, the receptor MOM72, and five new yeast proteins, the putative equivalents of N. crassa MOM...

  9. Use of bimolecular fluorescence complementation in yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Skarp, Kari-Pekka; Zhao, Xueqiang; Weber, Marion; Jantti, Jussi

    2008-01-01

    Visualization of protein-protein interactions in vivo offers a powerful tool to resolve spatial and temporal aspects of cellular functions. Bimolecular fluorescence complementation (BiFC) makes use of nonfluorescent fragments of green fluorescent protein or its variants that are added as "tags" to target proteins under study. Only upon target protein interaction is a fluorescent protein complex assembled and the site of interaction can be monitored by microscopy. In this chapter, we describe the method and tools for use of BiFC in the yeast Saccharomyces cerevisiae. PMID:19066026

  10. A novel mutant of the Sup35 protein of Saccharomyces cerevisiae defective in translation termination and in GTPase activity still supports cell viability

    Directory of Open Access Journals (Sweden)

    Gillet Sylvie

    2008-02-01

    Full Text Available Abstract Background When a stop codon is located in the ribosomal A-site, the termination complex promotes release of the polypeptide and dissociation of the 80S ribosome. In eukaryotes two proteins eRF1 and eRF3 play a crucial function in the termination process. The essential GTPase Sup35p, the eRF3 release factor of Saccharomyces cerevisiae is highly conserved. In particular, we observed that all eRF3 homologs share a potential phosphorylation site at threonine 341, suggesting a functional role for this residue. The goal of this study was to determine whether this residue is actually phosphorylated in yeast and if it is involved in the termination activity of the protein. Results We detected no phosphorylation of the Sup35 protein in vivo. However, we show that it is phosphorylated by the cAMP-dependent protein kinase A on T341 in vitro. T341 was mutated to either alanine or to aspartic acid to assess the role of this residue in the activity of the protein. Both mutant proteins showed a large decrease of GTPase activity and a reduced interaction with eRF1/Sup45p. This was correlated with an increase of translational readthrough in cells carrying the mutant alleles. We also show that this residue is involved in functional interaction between the N- and C-domains of the protein. Conclusion Our results point to a new critical residue involved in the translation termination activity of Sup35 and in functional interaction between the N- and C-domains of the protein. They also raise interesting questions about the relation between GTPase activity of Sup35 and its essential function in yeast.

  11. Local isolate of Saccharomyces cerevisiae as biocompetitive agent of Aspergillus flavus

    Directory of Open Access Journals (Sweden)

    Eni Kusumaningtyas

    2006-12-01

    Full Text Available Aspergillus flavus is a toxigenic fungus that contaminates feed and influences the animal health. Saccharomyces cerevisiae can be used as a biocompetitive agent to control the contamination. The ability of local isolate of S. cerevisiae as a biocompetitive agent for A. flavus was evaluated. A. flavus (30ml was swept on Sabouraud dextrose agar (SDA, while S. cerevisiae was swept on its left and right. Plates were incubated at 28oC for nine days. Lytic activity of S. cerevisiae was detected by pouring its suspension on the centre of the cross streaks of A. flavus. Plates were incubated at 28oC for five days. Growth inhibition of A. flavus by S. cerevisiae was determined by mixing the two fungi on Potato dextrose broth and incubated at 28oC for 24 hours. Total colony of A. flavus were then observed at incubation time of 2, 4, 6 and 24 hours by pour plates method on the SDA plates and incubated on 28oC for two days. Growth of hyphae of A. flavus sweep were inhibited with the swept of S. cerevisiae. The width of A. flavus colony treated with S. cerevisiae is narrower (3,02 cm than that of control ( 4,60 cm. The growth of A. flavus was also inhibited on the centre of cross streak where the S. cerevisiae poured. S. cerevisiae gradually reduced the colony number of A. flavus in the mixed culture of broth fungi ie. 14 x 103 CFU/ml while colony number of control is 80 x 103 CFU/ml. Results showed that S. cerevisiae could be used as biocompetitive agent of A. flavus.

  12. Global functional analysis of nucleophosmin in Taxol response, cancer, chromatin regulation, and ribosomal DNA transcription

    International Nuclear Information System (INIS)

    Analysis of lung cancer response to chemotherapeutic agents showed the accumulation of a Taxol-induced protein that reacted with an anti-phospho-MEK1/2 antibody. Mass spectroscopy identified the protein as nucleophosmin/B23 (NPM), a multifunctional protein with diverse roles: ribosome biosynthesis, p53 regulation, nuclear-cytoplasmic shuttling, and centrosome duplication. Our work demonstrates that following cellular exposure to mitosis-arresting agents, NPM is phosphorylated and its chromatographic property is altered, suggesting changes in function during mitosis. To determine the functional relevance of NPM, its expression in tumor cells was reduced by siRNA. Cells with reduced NPM were treated with Taxol followed by microarray profiling accompanied by gene/protein pathway analyses. These studies demonstrate several expected and unexpected consequences of NPM depletion. The predominant downstream effectors of NPM are genes involved in cell proliferation, cancer, and the cell cycle. In congruence with its role in cancer, NPM is over-expressed in primary malignant lung cancer tissues. We also demonstrate a role for NPM in the expression of genes encoding SET (TAF1β) and the histone methylase SET8. Additionally, we show that NPM is required for a previously unobserved G2/M upregulation of TAF1A, which encodes the rDNA transcription factor TAFI48. These results demonstrate multi-faceted functions of NPM that can affect cancer cells

  13. Elderberries: A Source of Ribosome-Inactivating Proteins with Lectin Activity

    Directory of Open Access Journals (Sweden)

    Jesús Tejero

    2015-01-01

    Full Text Available Sambucus (Adoxaceae species have been used for both food and medicine purposes. Among these, Sambucus nigra L. (black elder, Sambucus ebulus L. (dwarf elder, and Sambucus sieboldiana L. are the most relevant species studied. Their use has been somewhat restricted due to the presence of bioactive proteins or/and low molecular weight compounds whose ingestion could trigger deleterious effects. Over the last few years, the chemical and pharmacological characteristics of Sambucus species have been investigated. Among the proteins present in Sambucus species both type 1, and type 2 ribosome-inactivating proteins (RIPs, and hololectins have been reported. The biological role played by these proteins remains unknown, although they are conjectured to be involved in defending plants against insect predators and viruses. These proteins might have an important impact on the nutritional characteristics and food safety of elderberries. Type 2 RIPs are able to interact with gut cells of insects and mammals triggering a number of specific and mostly unknown cell signals in the gut mucosa that could significantly affect animal physiology. In this paper, we describe all known RIPs that have been isolated to date from Sambucus species, and comment on their antiviral and entomotoxic effects, as well as their potential uses.

  14. Ribosomal genes of Histoplasma capsulatum var. duboisii and var. farciminosum.

    Science.gov (United States)

    Okeke, C N; Kappe, R; Zakikhani, S; Nolte, O; Sonntag, H G

    1998-11-01

    A total of 1704 basepairs of the 18S rDNA of Histoplasma capsulatum var. duboisii (HCD, strain CBS175.57) and H. capsulatum var. farciminosum (HCF, strain CBS478.64) were sequenced (EMBL accession no. Z75306 and no. Z75307). The 18S rDNA of HCD was 100% identical to a published sequence of H. capsulatum var. capsulatum (HCC). The 18S rDNA of HCF showed one transversional point mutation at the nucleotide position 114 (ref. Saccharomyces cerevisiae). Hybridization confirmed that, in the 18S rDNA of two out of five strains of HCF, guanine was substituted for cytosine at the nucleotide position 114. Furthermore, identical group 1C1 introns (403 bp) were found to be inserted after position 1165 in four out of five strains of HCF, including the two strains with point mutations in the 18S rDNA, and a slightly different group 1C1 intron (408 bp) was detected in one strain of HCC without this point mutation. Intraspecific sequence variability in the highly conserved 18S rDNA because of occurrence of introns and mutations as a possible source of error in molecular diagnostics is discussed. In addition, internal transcribed spacer regions between the 18S rDNA and the 5.8S rDNA (ITS1) of three strains of HCF, and one strain each of HCC and HCD showed significant sequence variability between varieties and strains of H. capsulatum. PMID:9916456

  15. Effects of Dietary Yeast (Saccharomyces cerevisia Supplementation in Practical Diets of Tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    José E. P. Cyrino

    2012-01-01

    Full Text Available A 51-day feeding trial was carried out to determine the effects of various dietary levels of brewer’s yeast, Saccharomyces cerevisiae, in the growth performance, body composition and nutrient utilization in Nile tilapia, Oreochromis niloticus, juveniles. Fish (7.6 ± 0.3 g were stocked into eighteen 1,000-L tanks (100 fish per tank; n = 3 and fed to apparent satiation six isonitrogenous (27% crude protein and isoenergetic (19 kJ/g diets, formulated to contain different dried yeast levels (0%, 10%, 15%, 20%, 30% or 40% diet in substitution to fishmeal. Body weight tripled at the end of the feeding trial for fish fed up to 20% dietary yeast incorporation. Daily growth coefficient (DGC, % body weight/day decreased with increasing dietary yeast level (P < 0.0001. Voluntary feed intake (VFI, %BW/day did not vary significantly with increasing yeast level. Fish fed 40% yeast showed significant reduction in protein efficiency rate, protein retention and nitrogen gain. Increasing levels of dietary yeast did not significantly affect protein or lipid digestibility. Dietary dried yeast was seemingly palatable to tilapia juveniles and was suitable up to 15% inclusion to promote growth and efficient diet utilization, without affecting body composition.

  16. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A.; Donohue, John P.; Noller, Harry F.; Kieft, Jeffrey S. (UCSC); (Colorado)

    2011-08-24

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA-mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines.

  17. An organic acid-tolerant HAA1-overexpression mutant of an industrial bioethanol strain of Saccharomyces cerevisiae and its application to the production of bioethanol from sugarcane molasses.

    Science.gov (United States)

    Inaba, Takuya; Watanabe, Daisuke; Yoshiyama, Yoko; Tanaka, Koichi; Ogawa, Jun; Takagi, Hiroshi; Shimoi, Hitoshi; Shima, Jun

    2013-01-01

    Bacterial contamination is known as a major cause of the reduction in ethanol yield during bioethanol production by Saccharomyces cerevisiae. Acetate is an effective agent for the prevention of bacterial contamination, but it negatively affects the fermentation ability of S. cerevisiae. We have proposed that the combined use of organic acids including acetate and lactate and yeast strains tolerant to organic acids may be effective for the elimination of principally lactic acid bacterial (LAB) contamination. In a previous study employing laboratory S. cerevisiae strains, we showed that overexpression of the HAA1 gene, which encodes a transcriptional activator, could be a useful molecular breeding method for acetate-tolerant yeast strains. In the present study, we constructed a HAA1-overexpressing diploid strain (MATa/α, named ER HAA1-OP) derived from the industrial bioethanol strain Ethanol Red (ER). ER HAA1-OP showed tolerance not only to acetate but also to lactate, and this tolerance was dependent on the increased expression of HAA1 gene. The ethanol production ability of ER HAA1-OP was almost equivalent to that of the parent strain during the bioethanol production process from sugarcane molasses in the absence of acetate. The addition of acetate at 0.5% (w/v, pH 4.5) inhibited the fermentation ability of the parent strain, but such an inhibition was not observed in the ethanol production process using ER HAA1-OP. PMID:24373204

  18. Effect of 905 MHz microwave radiation on colony growth of the yeast Saccharomyces cerevisiae strains FF18733, FF1481 and D7

    International Nuclear Information System (INIS)

    The aim of this study was to evaluate the effect of weak radiofrequency microwave (RF/MW) radiation emitted by mobile phones on colony growth of the yeast Saccharomyces cerevisiae. S. cerevisiae strains FF18733 (wild-type), FF1481 (rad1 mutant) and D7 (commonly used to detect reciprocal and nonreciprocal mitotic recombinations) were exposed to a 905 MHz electromagnetic field that closely matched the Global System for Mobile Communication (GSM) pulse modulation signals for mobile phones at a specific absorption rate (SAR) of 0.12 W/kg. Following 15-, 30- and 60-minutes exposure to RF/MW radiation, strain FF18733 did not show statistically significant changes in colony growth compared to the control sample. The irradiated strains FF1481 and D7 demonstrated statistically significant reduction of colony growth compared to non-irradiated strains after all exposure times. Furthermore, strain FF1481 was more sensitive to RF/MW radiation than strain D7. The findings indicate that pulsed RF/MW radiation at a low SAR level can affect the rate of colony growth of different S. cerevisiae strains

  19. Microaerobic conversion of xylose to ethanol in recombinant Saccharomyces cerevisiae SX6(MUT) expressing cofactor-balanced xylose metabolic enzymes and deficient in ALD6.

    Science.gov (United States)

    Jo, Sung-Eun; Seong, Yeong-Je; Lee, Hyun-Soo; Lee, Soo Min; Kim, Soo-Jung; Park, Kyungmoon; Park, Yong-Cheol

    2016-06-10

    Xylose is a major monosugar in cellulosic biomass and should be utilized for cost-effective ethanol production. In this study, xylose-converting ability of recombinant Saccharomyces cerevisiae SX6(MUT) expressing NADH-preferring xylose reductase mutant (R276H) and other xylose-metabolic enzymes, and deficient in aldehyde dehydrogenase 6 (Ald6p) were characterized at microaerobic conditions using various sugar mixtures. The reduction of air supply from 0.5vvm to 0.1vvm increased specific ethanol production rate by 75% and did not affect specific xylose consumption rate. In batch fermentations using various concentrations of xylose (50-104g/L), higher xylose concentration enhanced xylose consumption rate and ethanol productivity but reduced ethanol yield, owing to the accumulation of xylitol and glycerol from xylose. SX6(MUT) consumed monosugars in pitch pine hydrolysates and produced 23.1g/L ethanol from 58.7g/L sugars with 0.39g/g ethanol yield, which was 14% higher than the host strain of S. cerevisiae D452-2 without the xylose assimilating enzymes. In conclusion, S. cerevisiae SX6(MUT) was characterized to possess high xylose-consuming ability in microaerobic conditions and a potential for ethanol production from cellulosic biomass. PMID:27059482

  20. Production of ribosome-inactivating protein from hairy root cultures of Luffa cylindrica (L.) Roem.

    Science.gov (United States)

    di Toppi, L S; Gorini, P; Properzi, G; Barbieri, L; Spanò, L

    1996-09-01

    Transformed root lines of Luffa cylindrica (L.) Roem. (Cucurbitaceae) were established by inoculation of in vitro grown plantlets with wild type Agrobacterium rhizogenes strain 1855. Cloned lines of hairy roots were tested for the presence of ribosome-inactivating proteins; crude extracts inhibited protein synthesis in a reaction mixture based on rabbit reticulocyte lysate. Inhibitory activity increased during culture period, reaching a maximum value in the stationary phase. No activity could be detected in the culture medium, nor in extracts from callus and/or suspension cultures. A ribosome-inactivating protein having specific activity of 62,100 U mg protein(-1) and a molecular mass of 26-28,000 Da was purified to homogeneity. The protein showed N-glycosidase activity on rat liver ribosomes. The results demonstrate that hairy root cultures can be successfully utilized for the in vitro production of ribosome-inactivating proteins. PMID:24178273

  1. Affinity chromatography and capillary electrophoresis for analysis of the yeast ribosomal proteins

    Directory of Open Access Journals (Sweden)

    Miriam S. Goyder

    2012-04-01

    Full Text Available We present a top down separation platform for yeast ribosomalproteins using affinity chromatography and capillary electrophoresiswhich is designed to allow deposition of proteins ontoa substrate. FLAG tagged ribosomes were affinity purified, andrRNA acid precipitation was performed on the ribosomes followedby capillary electrophoresis to separate the ribosomalproteins. Over 26 peaks were detected with excellent reproducibility(<0.5% RSD migration time. This is the first reportedseparation of eukaryotic ribosomal proteins using capillaryelectrophoresis. The two stages in this workflow, affinity chromatographyand capillary electrophoresis, share the advantagesthat they are fast, flexible and have small sample requirementsin comparison to more commonly used techniques. This methodis a remarkably quick route from cell to separation that hasthe potential to be coupled to high throughput readout platformsfor studies of the ribosomal proteome. [BMB reports2012; 45(4: 233-238

  2. Changes in ribosomal proteins in wheat embryos in the course of grain development and maturation

    Directory of Open Access Journals (Sweden)

    Stanisław Weidner

    2014-02-01

    Full Text Available It was found, by comparing the densitometric profiles of ribosomal proteins of wheat embryos in milk and full grain ripeness, that in the process of development and ripening of caryopses the percentual proportion of low molecular weight proteins increases at the cost of those of high molecular weight. This concerns both acidic and basic proteins. In electrophoretic separation of ribosomal proteins from embryos of fully ripe seeds by the method of two-dimensional electrophoresis the appearance of three new low molecular weight proteins - an acidic one and two basic ones - was observed. These proteins were not found in the embryos of caryopses of milk ripeness. These results indicate that with development and ripening of wheat caryopses new low molecular weight ribosomal proteins are built into the ribosomes in the embryo. These changes are both quantitative and qualitative.

  3. Crystal Structures of EF-G-Ribosome Complexes Trapped in Intermediate States of Translocation

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jie; Lancaster, Laura; Donohue, John Paul; Noller, Harry F. [UCSC

    2013-11-12

    Translocation of messenger and transfer RNA (mRNA and tRNA) through the ribosome is a crucial step in protein synthesis, whose mechanism is not yet understood. The crystal structures of three Thermus ribosome-tRNA-mRNA–EF-G complexes trapped with β,γ-imidoguanosine 5'-triphosphate (GDPNP) or fusidic acid reveal conformational changes occurring during intermediate states of translocation, including large-scale rotation of the 30S subunit head and body. In all complexes, the tRNA acceptor ends occupy the 50S subunit E site, while their anticodon stem loops move with the head of the 30S subunit to positions between the P and E sites, forming chimeric intermediate states. Two universally conserved bases of 16S ribosomal RNA that intercalate between bases of the mRNA may act as “pawls” of a translocational ratchet. These findings provide new insights into the molecular mechanism of ribosomal translocation.

  4. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk;

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23....... We therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could...... purified by Protein G Sepharose affinity chromatography. The purified antibodies were used to evaluate the separation of ribosomes from GFP, streptavidin, murine interleukin-6, a phagedisplay antibody and yeast elongation factor 1A by centrifugation, when ribosomes with covalently coupled target protein...

  5. Study of the Ribosomal Stress Pathway in Pluripotency, Cancer and Disease

    OpenAIRE

    Morgado Palacín, Lucía

    2016-01-01

    Tesis Doctoral inédita leída en la Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Biología Molecular La vía de estrés ribosomal se describió hace más de una década como una nueva vía activadora de p53. Dicha vía monitoriza la homeostasis de la biogénesis ribosomal. Perturbaciones en cualquiera de las etapas de la biosíntesis del ribosoma, transcripción del DNA ribosomal, procesamiento del RNA ribosomal, ensamblaje o transporte nuclear, conllevan un exceso de prote...

  6. Molecular basis for the ribosome functioning as an L-tryptophan sensor.

    Science.gov (United States)

    Bischoff, Lukas; Berninghausen, Otto; Beckmann, Roland

    2014-10-23

    Elevated levels of the free amino acid L-tryptophan (L-Trp) trigger expression of the tryptophanase tnaCAB operon in E. coli. Activation depends on tryptophan-dependent ribosomal stalling during translation of the upstream TnaC peptide. Here, we present a cryoelectron microscopy (cryo-EM) reconstruction at 3.8 Å resolution of a ribosome stalled by the TnaC peptide. Unexpectedly, we observe two L-Trp molecules in the ribosomal exit tunnel coordinated within composite hydrophobic pockets formed by the nascent TnaC peptide and the tunnel wall. As a result, the peptidyl transferase center (PTC) adopts a distinct conformation that precludes productive accommodation of release factor 2 (RF2), thereby inducing translational stalling. Collectively, our results demonstrate how the translating ribosome can act as a small molecule sensor for gene regulation. PMID:25310980

  7. Molecular Basis for the Ribosome Functioning as an L-Tryptophan Sensor

    Directory of Open Access Journals (Sweden)

    Lukas Bischoff

    2014-10-01

    Full Text Available Elevated levels of the free amino acid L-tryptophan (L-Trp trigger expression of the tryptophanase tnaCAB operon in E. coli. Activation depends on tryptophan-dependent ribosomal stalling during translation of the upstream TnaC peptide. Here, we present a cryoelectron microscopy (cryo-EM reconstruction at 3.8 Å resolution of a ribosome stalled by the TnaC peptide. Unexpectedly, we observe two L-Trp molecules in the ribosomal exit tunnel coordinated within composite hydrophobic pockets formed by the nascent TnaC peptide and the tunnel wall. As a result, the peptidyl transferase center (PTC adopts a distinct conformation that precludes productive accommodation of release factor 2 (RF2, thereby inducing translational stalling. Collectively, our results demonstrate how the translating ribosome can act as a small molecule sensor for gene regulation.

  8. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position. PMID:26926435

  9. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes.

    Science.gov (United States)

    Viero, Gabriella; Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia; Quattrone, Alessandro

    2015-03-01

    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure. PMID:25713412

  10. The human mitochondrial ribosome recycling factor is essential for cell viability.

    NARCIS (Netherlands)

    Rorbach, J.; Richter, R.; Wessels, H.J.; Wydro, M.; Pekalski, M.; Farhoud, M.; Kuhl, I.; Gaisne, M.; Bonnefoy, N.; Smeitink, J.A.M.; Lightowlers, R.N.; Chrzanowska-Lightowlers, Z.M.

    2008-01-01

    The molecular mechanism of human mitochondrial translation has yet to be fully described. We are particularly interested in understanding the process of translational termination and ribosome recycling in the mitochondrion. Several candidates have been implicated, for which subcellular localization

  11. Characteristics of Zn2+ Biosorption by Saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective To investigate the characteristics of Zn2+ biosorption and the release of cations during the process of Zn2+biosorption by intact cells of Saccharomyces cerevisiae. Methods The batch adsorption test was used to study the biosorption equilibrium and isotherm. Zn2+ concentration was measured with atomic adsorption spectrophotometer (AAS) AAS 6.Vario. Results When the initial concentration of Zn2+ ranged between 0.08 and 0.8 mmol/L, the initial pH was natural (about 5.65), the sorbent concentration was about 1 g/L and the capacity of Zn2+ biosorption was from 74.8 to 654.8 μmol/g. The pH value increased by 0.55-1.28 and the intracellular cations (K+, Mg2+, Na+, Ca2+) of the cells were released during the process of Zn2+ biosorption. Conclusion Ion exchange was one of the mechanisms for Zn2+ biosorption. The biomass of Saccharomyces cerevisiae is a potential biosorbent for the removal of Zn2+ from aqueous solution. More work needs to be done before putting it into practical application.

  12. Reciprocal translocations in Saccharomyces cerevisiae formed by nonhomologous end joining.

    Science.gov (United States)

    Yu, Xin; Gabriel, Abram

    2004-02-01

    Reciprocal translocations are common in cancer cells, but their creation is poorly understood. We have developed an assay system in Saccharomyces cerevisiae to study reciprocal translocation formation in the absence of homology. We induce two specific double-strand breaks (DSBs) simultaneously on separate chromosomes with HO endonuclease and analyze the subsequent chromosomal rearrangements among surviving cells. Under these conditions, reciprocal translocations via nonhomologous end joining (NHEJ) occur at frequencies of approximately 2-7 x 10(-5)/cell exposed to the DSBs. Yku80p is a component of the cell's NHEJ machinery. In its absence, reciprocal translocations still occur, but the junctions are associated with deletions and extended overlapping sequences. After induction of a single DSB, translocations and inversions are recovered in wild-type and rad52 strains. In these rearrangements, a nonrandom assortment of sites have fused to the DSB, and their junctions show typical signs of NHEJ. The sites tend to be between open reading frames or within Ty1 LTRs. In some cases the translocation partner is formed by a break at a cryptic HO recognition site. Our results demonstrate that NHEJ-mediated reciprocal translocations can form in S. cerevisiae as a consequence of DSB repair. PMID:15020464

  13. Mead production: selection and characterization assays of Saccharomyces cerevisiae strains.

    Science.gov (United States)

    Pereira, Ana Paula; Dias, Teresa; Andrade, João; Ramalhosa, Elsa; Estevinho, Letícia M

    2009-08-01

    Mead is a traditional drink, which results from the alcoholic fermentation of diluted honey carried out by yeasts. However, when it is produced in a homemade way, mead producers find several problems, namely, the lack of uniformity in the final product, delayed and arrested fermentations, and the production of "off-flavours" by the yeasts. These problems are usually associated with the inability of yeast strains to respond and adapt to unfavourable and stressful growth conditions. The main objectives of this work were to evaluate the capacity of Saccharomyces cerevisiae strains, isolated from honey of the Trás-os-Montes (Northeast Portugal), to produce mead. Five strains from honey, as well as one laboratory strain and one commercial wine strain, were evaluated in terms of their fermentation performance under ethanol, sulphur dioxide and osmotic stress. All the strains showed similar behaviour in these conditions. Two yeasts strains isolated from honey and the commercial wine strain were further tested for mead production, using two different honey (a dark and a light honey), enriched with two supplements (one commercial and one developed by the research team), as fermentation media. The results obtained in this work show that S. cerevisiae strains isolated from honey, are appropriate for mead production. However it is of extreme importance to take into account the characteristics of the honey, and supplements used in the fermentation medium formulation, in order to achieve the best results in mead production. PMID:19481129

  14. Structure of the Glycosyltransferase Ktr4p from Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Dominik D D Possner

    Full Text Available In the yeast Saccharomyces cerevisiae, members of the Kre2/Mnt1 protein family have been shown to be α-1,2-mannosyltransferases or α-1,2-mannosylphosphate transferases, utilising an Mn2+-coordinated GDP-mannose as the sugar donor and a variety of mannose derivatives as acceptors. Enzymes in this family are localised to the Golgi apparatus, and have been shown to be involved in both N- and O-linked glycosylation of newly-synthesised proteins, including cell wall glycoproteins. Our knowledge of the nine proteins in this family is however very incomplete at present. Only one family member, Kre2p/Mnt1p, has been studied by structural methods, and three (Ktr4p, Ktr5p, Ktr7p are completely uncharacterised and remain classified only as putative glycosyltransferases. Here we use in vitro enzyme activity assays to provide experimental confirmation of the predicted glycosyltransferase activity of Ktr4p. Using GDP-mannose as the donor, we observe activity towards the acceptor methyl-α-mannoside, but little or no activity towards mannose or α-1,2-mannobiose. We also present the structure of the lumenal catalytic domain of S. cerevisiae Ktr4p, determined by X-ray crystallography to a resolution of 2.2 Å, and the complex of the enzyme with GDP to 1.9 Å resolution.

  15. CRISPR-Cas9 Genome Engineering in Saccharomyces cerevisiae Cells.

    Science.gov (United States)

    Ryan, Owen W; Poddar, Snigdha; Cate, Jamie H D

    2016-01-01

    This protocol describes a method for CRISPR-Cas9-mediated genome editing that results in scarless and marker-free integrations of DNA into Saccharomyces cerevisiae genomes. DNA integration results from cotransforming (1) a single plasmid (pCAS) that coexpresses the Cas9 endonuclease and a uniquely engineered single guide RNA (sgRNA) expression cassette and (2) a linear DNA molecule that is used to repair the chromosomal DNA damage by homology-directed repair. For target specificity, the pCAS plasmid requires only a single cloning modification: replacing the 20-bp guide RNA sequence within the sgRNA cassette. This CRISPR-Cas9 protocol includes methods for (1) cloning the unique target sequence into pCAS, (2) assembly of the double-stranded DNA repair oligonucleotides, and (3) cotransformation of pCAS and linear repair DNA into yeast cells. The protocol is technically facile and requires no special equipment. It can be used in any S. cerevisiae strain, including industrial polyploid isolates. Therefore, this CRISPR-Cas9-based DNA integration protocol is achievable by virtually any yeast genetics and molecular biology laboratory. PMID:27250940

  16. Genetic determinants for enhanced glycerol growth of Saccharomyces cerevisiae.

    Science.gov (United States)

    Swinnen, Steve; Ho, Ping-Wei; Klein, Mathias; Nevoigt, Elke

    2016-07-01

    The yeast Saccharomyces cerevisiae generally shows a low natural capability to utilize glycerol as the sole source of carbon, particularly when synthetic medium is used and complex supplements are omitted. Nevertheless, wild type isolates have been identified that show a moderate growth under these conditions. In the current study we made use of intraspecies diversity to identify targets suitable for reverse metabolic engineering of the non-growing laboratory strain CEN.PK113-1A. A genome-wide genetic mapping experiment using pooled-segregant whole-genome sequence analysis was conducted, and one major and several minor genetic loci were identified responsible for the superior glycerol growth phenotype of the previously selected S. cerevisiae strain CBS 6412-13A. Downscaling of the major locus by fine-mapping and reciprocal hemizygosity analysis allowed the parallel identification of two superior alleles (UBR2CBS 6412-13A and SSK1CBS 6412-13A). These alleles together with the previously identified GUT1CBS 6412-13A allele were used to replace the corresponding alleles in the strain CEN.PK113-1A. In this way, glycerol growth could be established reaching a maximum specific growth rate of 0.08h(-1). Further improvement to a maximum specific growth rate of 0.11h(-1) could be achieved by heterologous expression of the glycerol facilitator FPS1 from Cyberlindnera jadinii. PMID:26971668

  17. The evolution of gene expression QTL in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    James Ronald

    Full Text Available Understanding the evolutionary forces that influence patterns of gene expression variation will provide insights into the mechanisms of evolutionary change and the molecular basis of phenotypic diversity. To date, studies of gene expression evolution have primarily been made by analyzing how gene expression levels vary within and between species. However, the fundamental unit of heritable variation in transcript abundance is the underlying regulatory allele, and as a result it is necessary to understand gene expression evolution at the level of DNA sequence variation. Here we describe the evolutionary forces shaping patterns of genetic variation for 1206 cis-regulatory QTL identified in a cross between two divergent strains of Saccharomyces cerevisiae. We demonstrate that purifying selection against mildly deleterious alleles is the dominant force governing cis-regulatory evolution in S. cerevisiae and estimate the strength of selection. We also find that essential genes and genes with larger codon bias are subject to slightly stronger cis-regulatory constraint and that positive selection has played a role in the evolution of major trans-acting QTL.

  18. Metabolomic approach for improving ethanol stress tolerance in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ohta, Erika; Nakayama, Yasumune; Mukai, Yukio; Bamba, Takeshi; Fukusaki, Eiichiro

    2016-04-01

    The budding yeast Saccharomyces cerevisiae is widely used for brewing and ethanol production. The ethanol sensitivity of yeast cells is still a serious problem during ethanol fermentation, and a variety of genetic approaches (e.g., random mutant screening under selective pressure of ethanol) have been developed to improve ethanol tolerance. In this study, we developed a strategy for improving ethanol tolerance of yeast cells based on metabolomics as a high-resolution quantitative phenotypic analysis. We performed gas chromatography-mass spectrometry analysis to identify and quantify 36 compounds on 14 mutant strains including knockout strains for transcription factor and metabolic enzyme genes. A strong relation between metabolome of these mutants and their ethanol tolerance was observed. Data mining of the metabolomic analysis showed that several compounds (such as trehalose, valine, inositol and proline) contributed highly to ethanol tolerance. Our approach successfully detected well-known ethanol stress related metabolites such as trehalose and proline thus, to further prove our strategy, we focused on valine and inositol as the most promising target metabolites in our study. Our results show that simultaneous deletion of LEU4 and LEU9 (leading to accumulation of valine) or INM1 and INM2 (leading to reduction of inositol) significantly enhanced ethanol tolerance. This study shows the potential of the metabolomic approach to identify target genes for strain improvement of S. cerevisiae with higher ethanol tolerance. PMID:26344121

  19. Data on dynamic study of cytoophidia in Saccharomyces cerevisiae.

    Science.gov (United States)

    Li, Hui; Huang, Yong; Wang, Peng-Ye; Ye, Fangfu; Liu, Ji-Long

    2016-09-01

    The data in this paper are related to the research article entitled "Filamentation of metabolic enzymes in Saccharomyces cerevisiae" Q.J. Shen et al. (2016) [1]. Cytoophidia are filamentous structures discovered in fruit flies (doi:10.1016/S1673-8527(09)60046-1) J.L. Liu (2010) [2], bacteria (doi:10.1038/ncb2087) M. Ingerson-Mahar et al. (2010) [3], yeast (doi:10.1083/jcb.201003001; doi:10.1242/bio.20149613) C. Noree et al. (2010) and J. Zhang, L. Hulme, J.L. Liu (2014) [4], [5] and human cells (doi:10.1371/journal.pone.0029690; doi:10.1016/j.jgg.2011.08.004) K. Chen et al. (2011) and W.C. Carcamo et al. (2011) ( [6], [7]. However, there is little research on the motility of the cytoophidia. Here we selected cytoophidia formed by 6 filament-forming proteins in the budding yeast S. cerevisiae, and performed living-cell imaging of cells expressing the proteins fused with GFP. The dynamic features of the six types of cytoophidia were analyzed. In the data, both raw movies and analysed results of the dynamics of cytoophidia are presented. PMID:27274529

  20. Long-chain alkane production by the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Buijs, Nicolaas A; Zhou, Yongjin J; Siewers, Verena; Nielsen, Jens

    2015-06-01

    In the past decade industrial-scale production of renewable transportation biofuels has been developed as an alternative to fossil fuels, with ethanol as the most prominent biofuel and yeast as the production organism of choice. However, ethanol is a less efficient substitute fuel for heavy-duty and maritime transportation as well as aviation due to its low energy density. Therefore, new types of biofuels, such as alkanes, are being developed that can be used as drop-in fuels and can substitute gasoline, diesel, and kerosene. Here, we describe for the first time the heterologous biosynthesis of long-chain alkanes by the yeast Saccharomyces cerevisiae. We show that elimination of the hexadecenal dehydrogenase Hfd1 and expression of a redox system are essential for alkane biosynthesis in yeast. Deletion of HFD1 together with expression of an alkane biosynthesis pathway resulted in the production of the alkanes tridecane, pentadecane, and heptadecane. Our study provides a proof of principle for producing long-chain alkanes in the industrial workhorse S. cerevisiae, which was so far limited to bacteria. We anticipate that these findings will be a key factor for further yeast engineering to enable industrial production of alkane based drop-in biofuels, which can allow the biofuel industry to diversify beyond bioethanol. PMID:25545362

  1. Phosphorylation in vivo of non-ribosomal proteins from native 40 S ribosomal particles of Krebs II mouse ascites-tumour cells

    DEFF Research Database (Denmark)

    Schuck, J; Reichert, G; Issinger, O G

    1981-01-01

    Four non-ribosomal proteins from native 40 S ribosomal subunits with mol.wts. of 110 000, 84 000, 68 000 and 26 000 were phosphorylated in vivo when ascites cells were incubated in the presence of [32P]Pi. The 110 000-, 84 000- and 26 000-dalton proteins are identical with phosphorylated products...... from native 40 S subunits after phosphorylation in vitro by a cyclic nucleotide-independent protein kinase. Phosphoserine was the major phosphorylated amino acid of the proteins phosphorylated in vivo and in vitro....

  2. A dynamic RNA loop in an IRES affects multiple steps of elongation factor-mediated translation initiation.

    Science.gov (United States)

    Ruehle, Marisa D; Zhang, Haibo; Sheridan, Ryan M; Mitra, Somdeb; Chen, Yuanwei; Gonzalez, Ruben L; Cooperman, Barry S; Kieft, Jeffrey S

    2015-01-01

    Internal ribosome entry sites (IRESs) are powerful model systems to understand how the translation machinery can be manipulated by structured RNAs and for exploring inherent features of ribosome function. The intergenic region (IGR) IRESs from the Dicistroviridae family of viruses are structured RNAs that bind directly to the ribosome and initiate translation by co-opting the translation elongation cycle. These IRESs require an RNA pseudoknot that mimics a codon-anticodon interaction and contains a conformationally dynamic loop. We explored the role of this loop and found that both the length and sequence are essential for translation in different types of IGR IRESs and from diverse viruses. We found that loop 3 affects two discrete elongation factor-dependent steps in the IRES initiation mechanism. Our results show how the IRES directs multiple steps after 80S ribosome placement and highlights the often underappreciated significance of discrete conformationally dynamic elements within the context of structured RNAs. PMID:26523395

  3. Automated genome mining of ribosomal peptide natural products

    Energy Technology Data Exchange (ETDEWEB)

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  4. Visualization of ribosomal RNA operon copy number distribution

    Directory of Open Access Journals (Sweden)

    DasGupta Indrani

    2009-09-01

    Full Text Available Abstract Background Results of microbial ecology studies using 16S rRNA sequence information can be deceiving due to differences in rRNA operon copy number and genome size of the detected organisms. It therefore will be useful for investigators to have a better understanding of how these two parameters differ in various organism types. In this study, the number of ribosomal operons and genome size were separately mapped onto a Bacterial phylogenetic tree. Results A representative Bacterial tree was constructed using 31 marker genes found in 578 bacterial genome sequences. Organism names are displayed on the trees using graduations of color such that similar colors indicate similar numbers of operons or genome size. The resulting images provide an intuitive understanding of how copy number and genome size vary in different Bacterial phyla. Conclusion Once the phylogenetic position of a novel organism is known the number of rRNA operons, and to a lesser extent the genome size, can be estimated by examination of the colored maps. Further detail can then be obtained for members of relevant taxa from the rrnDB database.

  5. Folding and escape of nascent proteins at ribosomal exit tunnel

    Science.gov (United States)

    Bui, Phuong Thuy; Hoang, Trinh Xuan

    2016-03-01

    We investigate the interplay between post-translational folding and escape of two small single-domain proteins at the ribosomal exit tunnel by using Langevin dynamics with coarse-grained models. It is shown that at temperatures lower or near the temperature of the fastest folding, folding proceeds concomitantly with the escape process, resulting in vectorial folding and enhancement of foldability of nascent proteins. The concomitance between the two processes, however, deteriorates as temperature increases. Our folding simulations as well as free energy calculation by using umbrella sampling show that, at low temperatures, folding at the tunnel follows one or two specific pathways without kinetic traps. It is shown that the escape time can be mapped to a one-dimensional diffusion model with two different regimes for temperatures above and below the folding transition temperature. Attractive interactions between amino acids and attractive sites on the tunnel wall lead to a free energy barrier along the escape route of the protein. It is suggested that this barrier slows down the escape process and consequently promotes correct folding of the released nascent protein.

  6. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    Science.gov (United States)

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-01-01

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well. PMID:27084079

  7. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides.

    Science.gov (United States)

    Doi, Yohei; Arakawa, Yoshichika

    2007-07-01

    Methylation of 16S ribosomal RNA (rRNA) has recently emerged as a new mechanism of resistance against aminoglycosides among gram-negative pathogens belonging to the family Enterobacteriaceae and glucose-nonfermentative microbes, including Pseudomonas aeruginosa and Acinetobacter species. This event is mediated by a newly recognized group of 16S rRNA methylases, which share modest similarity to those produced by aminoglycoside-producing actinomycetes. Their presence confers a high level of resistance to all parenterally administered aminoglycosides that are currently in clinical use. The responsible genes are mostly located on transposons within transferable plasmids, which provides them with the potential to spread horizontally and may in part explain the already worldwide distribution of this novel resistance mechanism. Some of these organisms have been found to coproduce extended-spectrum beta-lactamases or metallo-beta-lactamases, contributing to their multidrug-resistant phenotypes. A 2-tiered approach, consisting of disk diffusion tests followed by confirmation with polymerase chain reaction, is recommended for detection of 16S rRNA methylase-mediated resistance. PMID:17554708

  8. Sensitivity of ribosomes of the hyperthermophilic bacterium Aquifex pyrophilus to aminoglycoside antibiotics.

    OpenAIRE

    Bocchetta, M; Huber, R.; Cammarano, P

    1996-01-01

    A poly(U)-programmed cell-free system from the hyperthermophilic bacterium Aquifex pyrophilus has been developed, and the susceptibility of Aquifex ribosomes to the miscoding-inducing and inhibitory actions of all known classes of aminoglycoside antibiotics has been assayed at temperatures (75 to 80 degrees C) close to the physiological optimum for cell growth. Unlike Thermotoga maritima ribosomes, which are systematically refractory to all known classes of aminoglycoside compounds (P. Londei...

  9. KIF4 Mediates Anterograde Translocation and Positioning of Ribosomal Constituents to Axons*S⃞

    OpenAIRE

    Bisbal, Mariano; Wojnacki, José; Peretti, Diego; Ropolo, Andrea; Sesma, Juliana; Jausoro, Ignacio; Cáceres, Alfredo

    2009-01-01

    In this study, we have used a combination of biochemical and molecular biology techniques to demonstrate that the C-terminal tail domain of KIF4 directly interacts with P0, a major protein component of ribosomes. Besides, in dorsal root ganglion neurons, KIF4 and P0, as well as other ribosomal constituents, colocalize in clusters distributed along axons and neuritic tips. RNA interference suppression of KIF4 or expression of KIF4 variants lacking the tail domain or mut...

  10. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    OpenAIRE

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  11. Cytoplasmic long noncoding RNAs are frequently bound to and degraded at ribosomes in human cells

    OpenAIRE

    Carlevaro-Fita, Joana; Rahim, Anisa; Guigó, Roderic; Vardy, Leah A.; Johnson, Rory

    2016-01-01

    Recent footprinting studies have made the surprising observation that long noncoding RNAs (lncRNAs) physically interact with ribosomes. However, these findings remain controversial, and the overall proportion of cytoplasmic lncRNAs involved is unknown. Here we make a global, absolute estimate of the cytoplasmic and ribosome-associated population of stringently filtered lncRNAs in a human cell line using polysome profiling coupled to spike-in normalized microarray analysis. Fifty-four percent ...

  12. Structural and Functional Characterization of Ribosomal Protein Gene Introns in Sponges

    OpenAIRE

    Perina, Dragutin; Korolija, Marina; Mikoč, Andreja; Roller Milošević, Maša; Pleše, Bruna; Imešek, Mirna; Morrow, Christine; Batel, Renato; Ćetković, Helena

    2012-01-01

    Ribosomal protein genes (RPGs) are a powerful tool for studying intron evolution. They exist in all three domains of life and are much conserved. Accumulating genomic data suggest that RPG introns in many organisms abound with non-protein-coding-RNAs (ncRNAs). These ancient ncRNAs are small nucleolar RNAs (snoRNAs) essential for ribosome assembly. They are also mobile genetic elements and therefore probably important in diversification and enrichment of transcriptomes through various mechanis...

  13. Internal ribosome entry sequence-mediated translation initiation triggers nonsense-mediated decay

    OpenAIRE

    Holbrook, Jill A; Neu-Yilik, Gabriele; Gehring, Niels H; Kulozik, Andreas E.; Hentze, Matthias W.

    2006-01-01

    In eukaryotes, a surveillance pathway known as nonsense-mediated decay (NMD) regulates the abundance of messenger RNAs containing premature termination codons (PTCs). In mammalian cells, it has been asserted that the NMD-relevant first round of translation is special and involves initiation by a specific protein heterodimer, the nuclear cap-binding complex (CBC). Arguing against a requirement for CBC-mediated translation initiation, we show that ribosomal recruitment by the internal ribosomal...

  14. Tight binding of clarithromycin, its 14-(R)-hydroxy metabolite, and erythromycin to Helicobacter pylori ribosomes.

    OpenAIRE

    Goldman, R.C. (Robert C.); Zakula, D; Flamm, R; Beyer, J; Capobianco, J.

    1994-01-01

    Clarithromycin is a recently approved macrolide with improved pharmacokinetics, antibacterial activity, and efficacy in treating bacterial infections including those caused by Helicobacter pylori, an agent implicated in various forms of gastric disease. We successfully isolated ribosomes from H. pylori and present the results of a study of their interaction with macrolides. Kinetic data were obtained by using 14C-labeled macrolides to probe the ribosomal binding site. Clarithromycin, its pare...

  15. Evidence that ribosomal protein S10 participates in control of transcription termination.

    OpenAIRE

    Friedman, D I; Schauer, A T; Baumann, M R; Baron, L S; Adhya, S L

    1981-01-01

    We report the isolation of an Escherichia coli K-12 strain with a mutation, nusE71, that results in a change in ribosomal protein S10. Phage lambda fails to grow in hosts carrying the nusE71 mutation because the lambda N gene product is not active. The N product regulates phage gene expression by altering transcription complexes so that they can overcome termination barriers. This suggests that a ribosomal protein is involved in antitermination of transcription.

  16. Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis

    International Nuclear Information System (INIS)

    When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were 3H-labeled in vitro and injected back into X. laevis oocytes, most 3H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, 3H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of 3H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide, a cysteine protease inhibitor, resulting in the accumulation of 3H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus

  17. Translation Initiation is Controlled by RNA Folding Kinetics via a Ribosome Drafting Mechanism.

    Science.gov (United States)

    Espah Borujeni, Amin; Salis, Howard M

    2016-06-01

    RNA folding plays an important role in controlling protein synthesis as well as other cellular processes. Existing models have focused on how RNA folding energetics control translation initiation rate under equilibrium conditions but have largely ignored the effects of nonequilibrium RNA folding. We introduce a new mechanism, called "ribosome drafting", that explains how a mRNA's folding kinetics and the ribosome's binding rate collectively control its translation initiation rate. During cycles of translation, ribosome drafting emerges whenever successive ribosomes bind to a mRNA faster than the mRNA can refold, maintaining it in a nonequilibrium state with an acceleration of protein synthesis. Using computational design, time-correlated single photon counting, and expression measurements, we demonstrate that slow-folding and fast-folding RNA structures with equivalent folding energetics can vary protein synthesis rates by 1000-fold. We determine the necessary conditions for ribosome drafting by characterizing mRNAs with rationally designed ribosome binding rates, folding kinetics, and folding energetics, confirming the predictions of a nonequilibrium Markov model of translation. Our results have widespread implications, illustrating how competitive folding and assembly kinetics can shape the gene expression machinery's sequence-structure-function relationship inside cells. PMID:27199273

  18. A Long Noncoding RNA on the Ribosome Is Required for Lifespan Extension

    Directory of Open Access Journals (Sweden)

    Paul B. Essers

    2015-01-01

    Full Text Available The biogenesis of ribosomes and their coordination of protein translation consume an enormous amount of cellular energy. As such, it has been established that the inhibition of either process can extend eukaryotic lifespan. Here, we used next-generation sequencing to compare ribosome-associated RNAs from normal strains of Caenorhabditis elegans to those carrying the life-extending daf-2 mutation. We found a long noncoding RNA (lncRNA, transcribed telomeric sequence 1 (tts-1, on ribosomes of the daf-2 mutant. Depleting tts-1 in daf-2 mutants increases ribosome levels and significantly shortens their extended lifespan. We find tts-1 is also required for the longer lifespan of the mitochondrial clk-1 mutants but not the feeding-defective eat-2 mutants. In line with this, the clk-1 mutants express more tts-1 and fewer ribosomes than the eat-2 mutants. Our results suggest that the expression of tts-1 functions in different longevity pathways to reduce ribosome levels in a way that promotes life extension.

  19. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Yingang, E-mail: fengyg@qibebt.ac.cn [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Song, Xiaxia [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Lin, Jinzhong [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Xuan, Jinsong [Department of Biological Science and Engineering, School of Chemical and Biological Engineering, University of Science and Technology Beijing, Beijing 100083 (China); Cui, Qiu [Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, Shandong 266101 (China); Wang, Jinfeng [National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)

    2014-07-18

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae.

  20. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    International Nuclear Information System (INIS)

    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae

  1. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  2. Ribosomal protein methylation in Escherichia coli: the gene prmA, encoding the ribosomal protein L11 methyltransferase, is dispensable.

    Science.gov (United States)

    Vanet, A; Plumbridge, J A; Guérin, M F; Alix, J H

    1994-12-01

    The prmA gene, located at 72 min on the Escherichia coli chromosome, is the genetic determinant of ribosomal protein L11-methyltransferase activity. Mutations at this locus, prmA1 and prmA3, result in a severely undermethylated form of L11. No effect, other than the lack of methyl groups on L11, has been ascribed to these mutations. DNA sequence analysis of the mutant alleles prmA1 and prmA3 detected point mutations near the C-terminus of the protein and plasmids overproducing the wild-type and the two mutant proteins have been constructed. The wild-type PrmA protein could be crosslinked to its radiolabelled substrate, S-adenosyl-L-methionine (SAM), by u.v. irradiation indicating that it is the gene for the methyltransferase rather than a regulatory protein. One of the mutant proteins, PrmA3, was also weakly crosslinked to SAM. Both mutant enzymes when expressed from the overproducing plasmids were capable of catalysing the incorporation of 3H-labelled methyl groups from SAM to L11 in vitro. This confirmed the observation that the mutant proteins possess significant residual activity which could account for their lack of growth phenotype. However, a strain carrying an in vitro-constructed null mutation of the prmA gene, transferred to the E. coli chromosome by homologous recombination, was perfectly viable. PMID:7715456

  3. Biosorption of 241Am by Saccharomyces cerevisiae. Preliminary investigation on mechanism

    International Nuclear Information System (INIS)

    As an important radioisotope in nuclear industry and other fields, 241Am is one of the most serious contamination concerns due to its high radiation toxicity and long half-life. The encouraging biosorption of 241Am from aqueous solutions by free or immobilized Saccharomyces cerevisiae (S. cerevisiae) has been observed in our previous experiments. In this study, the preliminary evaluation on mechanism was further explored via chemical or biological modification of S. cerevisiae, and using europium as a substitute for americium. The results indicated that the culture times of more than 16 hours for S. cerevisiae was suitable and the efficient adsorption of 241Am by the S. cerevisiae was able to achieve. The pH value in solutions decreased gradually with the uptake of 241Am in the S. cerevisiae, implying that H+ released from S. cerevisiae via ion-exchange. The biosorption of 241Am by the decomposed cell wall, protoplasm or cell membrane of S. cerevisiae was same efficient as by the intact fungus. However, the adsorption ratio for 241Am by the deproteinized or deacylated S. cerevisiae dropped obviously, implying that protein or carboxyl functional groups of S. cerevisiaece play an important role in the biosorption of 241Am. Most of the investigated acidic ions have no significant influence on the 241Am adsorption, while the saturated EDTA can strong inhibit the biosorption of 241Am on S. cerevisiae. When the concentrations of coexistent Eu3+, Nd3+ were 100 times more than that of 241Am, the adsorption ratios would decrease to 65% from more than 95%. It could be noted by transmission electron microscope (TEM) analysis that the adsorbed Eu is almost scattered in the whole fungus, while Rutherford backscattering spectrometry (RBS) analysis indicated that Ca in S. cerevisiae have been replaced by Eu via ion-exchange. All the results implied that the adsorption mechanism of 241Am on S. cerevisiae is very complicated and at least involved in ion exchange, complexation

  4. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka;

    2012-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several...

  5. Mimicking Ribosomal Unfolding of RNA Pseudoknot in a Protein Channel.

    Science.gov (United States)

    Zhang, Xinyue; Xu, Xiaojun; Yang, Zhiyu; Burcke, Andrew J; Gates, Kent S; Chen, Shi-Jie; Gu, Li-Qun

    2015-12-23

    Pseudoknots are a fundamental RNA tertiary structure with important roles in regulation of mRNA translation. Molecular force spectroscopic approaches such as optical tweezers can track the pseudoknot's unfolding intermediate states by pulling the RNA chain from both ends, but the kinetic unfolding pathway induced by this method may be different from that in vivo, which occurs during translation and proceeds from the 5' to 3' end. Here we developed a ribosome-mimicking, nanopore pulling assay for dissecting the vectorial unfolding mechanism of pseudoknots. The pseudoknot unfolding pathway in the nanopore, either from the 5' to 3' end or in the reverse direction, can be controlled by a DNA leader that is attached to the pseudoknot at the 5' or 3' ends. The different nanopore conductance between DNA and RNA translocation serves as a marker for the position and structure of the unfolding RNA in the pore. With this design, we provided evidence that the pseudoknot unfolding is a two-step, multistate, metal ion-regulated process depending on the pulling direction. Most notably, unfolding in both directions is rate-limited by the unzipping of the first helix domain (first step), which is Helix-1 in the 5' → 3' direction and Helix-2 in the 3' → 5' direction, suggesting that the initial unfolding step in either pulling direction needs to overcome an energy barrier contributed by the noncanonical triplex base-pairs and coaxial stacking interactions for the tertiary structure stabilization. These findings provide new insights into RNA vectorial unfolding mechanisms, which play an important role in biological functions including frameshifting. PMID:26595106

  6. Affect Regulation

    DEFF Research Database (Denmark)

    Pedersen, Signe Holm; Poulsen, Stig Bernt; Lunn, Susanne

    2014-01-01

    Gergely and colleagues’ state that their Social Biofeedback Theory of Parental Affect Mirroring” can be seen as a kind of operationalization of the classical psychoanalytic concepts of holding, containing and mirroring. This article examines to what extent the social biofeedback theory of parenta...

  7. The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

    Science.gov (United States)

    Root-Bernstein, Robert; Root-Bernstein, Meredith

    2016-05-21

    We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their

  8. A residue substitution in the plastid ribosomal protein L12/AL1 produces defective plastid ribosome and causes early seedling lethality in rice.

    Science.gov (United States)

    Zhao, Dong-Sheng; Zhang, Chang-Quan; Li, Qian-Feng; Yang, Qing-Qing; Gu, Ming-Hong; Liu, Qiao-Quan

    2016-05-01

    The plastid ribosome is essential for chloroplast biogenesis as well as seedling formation. As the plastid ribosome closely resembles the prokaryotic 70S ribosome, many plastid ribosomal proteins (PRPs) have been identified in higher plants. However, their assembly in the chloroplast ribosome in rice remains unclear. In the present study, we identified a novel rice mutant, albino lethal 1 (al1), from a chromosome segment substitution line population. The al1 mutant displayed an albino phenotype at the seedling stage and did not survive past the three-leaf stage. No other apparent differences in plant morphology were observed in the al1 mutant. The albino phenotype of the al1 mutant was associated with decreased chlorophyll content and abnormal chloroplast morphology. Using fine mapping, AL1 was shown to encode the PRPL12, a protein localized in the chloroplasts of rice, and a spontaneous single-nucleotide mutation (C/T), resulting in a residue substitution from leucine in AL1 to phenylalanine in al1, was found to be responsible for the early seedling lethality. This point mutation is located at the L10 interface feature of the L12/AL1 protein. Yeast two-hybrid analysis showed that there was no physical interaction between al1 and PRPL10. In addition, the mutation had little effect on the transcript abundance of al1, but had a remarkable effect on the protein abundance of al1 and transcript abundance of chloroplast biogenesis-related and photosynthesis-related genes. These results provide a first glimpse into the molecular details of L12's function in rice. PMID:26873698

  9. Localisation of the ribosomal proteins L2, L14 and L24 of the E. coli ribosome by means of nuclear spin contrast variation

    International Nuclear Information System (INIS)

    Ribosomes are ribonucleo-protein complexes, which are the site of the protein synthesis, one of the most important steps during the translation of the genetic code from the DNA to the proteins. The proteins L2, L14 and L24 in the 50S subunit and the protein L2 in the 70S ribosome of the E. coli bacterium were localised by means of nuclear spin contrast variation. The contrast created by isotopic substitution is increased by almost a factor of three provided that polarised neutrons are scattered by polarised hydrogen spins of the sample. To get additional information about the in situ structure of the proteins the shapes were described by a two or three sphere model. Within the project of mapping the 50S subunit of the E. coli ribosome the protein L24 is localised for the first time. L24 is one of the initiator protein for the assembly of the 50S subunit therefore the knowledge of the position is of great interest for the understanding of this process. With the localisation of the protein L14, which is one of the most conserved protein in the ribosome, new hints are given in respect of the protein function which was until now unknown. The localisation of the protein L2, which is one of the candidates of the area of the central step in protein synthesis was done both in the 50S subunit and in the whole 70S ribosome. This allows to investigate conformational changes during the association of the subunits. (orig.)

  10. Saccharomyces cerevisiae: a potential biosorbent for biosorption of uranium.

    Directory of Open Access Journals (Sweden)

    PROF. RAJESH DHANKHAR

    2011-06-01

    Full Text Available This paper projects the potential of Saccharomyces cerevisiae in biosorbing U (VI ion on nonliving biomass of specie in batch system with respect to pH, Biosorbent dose, Initial metal concentration, Contact time and Particle size. From the batch studies, it was found that the fungal biomass exhibited the optimum Uranium uptake at pH 5 and 100 μm particle size, adsorbent dose of 10g/L and initial metal concentration of 100mg/L. Maximum uptake was observed after the Contact time of 75 minutes. Sorption isotherms were interpreted interms of Langmuir and Freundlich models. Equilibrium data fitted well to Langmuir model and Uptake kinetic followed pseudo-second order model. Base treatment was found to enhance the metal removal ability of untreated biomass. The mechanism of process was gained by FTIR and SEM. IR spectra analysis revealed that Carbonyl and amino groups have played important role in U (VI biosorption.

  11. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  12. Exposure to benzene metabolites causes oxidative damage in Saccharomyces cerevisiae.

    Science.gov (United States)

    Raj, Abhishek; Nachiappan, Vasanthi

    2016-06-01

    Hydroquinone (HQ) and benzoquinone (BQ) are known benzene metabolites that form reactive intermediates such as reactive oxygen species (ROS). This study attempts to understand the effect of benzene metabolites (HQ and BQ) on the antioxidant status, cell morphology, ROS levels and lipid alterations in the yeast Saccharomyces cerevisiae. There was a reduction in the growth pattern of wild-type cells exposed to HQ/BQ. Exposure of yeast cells to benzene metabolites increased the activity of the anti-oxidant enzymes catalase, superoxide dismutase and glutathione peroxidase but lead to a decrease in ascorbic acid and reduced glutathione. Increased triglyceride level and decreased phospholipid levels were observed with exposure to HQ and BQ. These results suggest that the enzymatic antioxidants were increased and are involved in the protection against macromolecular damage during oxidative stress; presumptively, these enzymes are essential for scavenging the pro-oxidant effects of benzene metabolites. PMID:27016252

  13. ACTIVITY OF SUPEROXIDE DISMUTASE ENZYME IN YEAST SACCHAROMYCES CEREVISIAE

    Directory of Open Access Journals (Sweden)

    Blažena Lavová

    2014-02-01

    Full Text Available Reactive oxygen species (ROS with reactive nitrogen species (RNS are known to play dual role in biological systems, they can be harmful or beneficial to living systems. ROS can be important mediators of damage to cell structures, including proteins, lipids and nucleic acids termed as oxidative stress. The antioxidant enzymes protect the organism against the oxidative damage caused by active oxygen forms. The role of superoxide dismutase (SOD is to accelerate the dismutation of the toxic superoxide radical, produced during oxidative energy processes, to hydrogen peroxide and molecular oxygen. In this study, SOD activity of three yeast strains Saccharomyces cerevisiae was determined. It was found that SOD activity was the highest (23.7 U.mg-1 protein in strain 612 after 28 hours of cultivation. The lowest SOD activity from all tested strains was found after 56 hours of cultivation of strain Gyöng (0.7 U.mg-1 protein.

  14. Domestication and Divergence of Saccharomyces cerevisiae Beer Yeasts.

    Science.gov (United States)

    Gallone, Brigida; Steensels, Jan; Prahl, Troels; Soriaga, Leah; Saels, Veerle; Herrera-Malaver, Beatriz; Merlevede, Adriaan; Roncoroni, Miguel; Voordeckers, Karin; Miraglia, Loren; Teiling, Clotilde; Steffy, Brian; Taylor, Maryann; Schwartz, Ariel; Richardson, Toby; White, Christopher; Baele, Guy; Maere, Steven; Verstrepen, Kevin J

    2016-09-01

    Whereas domestication of livestock, pets, and crops is well documented, it is still unclear to what extent microbes associated with the production of food have also undergone human selection and where the plethora of industrial strains originates from. Here, we present the genomes and phenomes of 157 industrial Saccharomyces cerevisiae yeasts. Our analyses reveal that today's industrial yeasts can be divided into five sublineages that are genetically and phenotypically separated from wild strains and originate from only a few ancestors through complex patterns of domestication and local divergence. Large-scale phenotyping and genome analysis further show strong industry-specific selection for stress tolerance, sugar utilization, and flavor production, while the sexual cycle and other phenotypes related to survival in nature show decay, particularly in beer yeasts. Together, these results shed light on the origins, evolutionary history, and phenotypic diversity of industrial yeasts and provide a resource for further selection of superior strains. PAPERCLIP. PMID:27610566

  15. Functional attributes of the Saccharomyces cerevisiae meiotic recombinase Dmc1.

    Science.gov (United States)

    Busygina, Valeria; Gaines, William A; Xu, Yuanyuan; Kwon, Youngho; Williams, Gareth J; Lin, Sheng-Wei; Chang, Hao-Yen; Chi, Peter; Wang, Hong-Wei; Sung, Patrick

    2013-09-01

    The role of Dmc1 as a meiosis-specific general recombinase was first demonstrated in Saccharomyces cerevisiae. Progress in understanding the biochemical mechanism of ScDmc1 has been hampered by its tendency to form inactive aggregates. We have found that the inclusion of ATP during protein purification prevents Dmc1 aggregation. ScDmc1 so prepared is capable of forming D-loops and responsive to its accessory factors Rad54 and Rdh54. Negative staining electron microscopy and iterative helical real-space reconstruction revealed that the ScDmc1-ssDNA nucleoprotein filament harbors 6.5 protomers per turn with a pitch of ∼106Å. The ScDmc1 purification procedure and companion molecular analyses should facilitate future studies on this recombinase. PMID:23769192

  16. Genetic Basis for Saccharomyces cerevisiae Biofilm in Liquid Medium

    DEFF Research Database (Denmark)

    Andersen, Kaj Scherz; Bojsen, Rasmus Kenneth; Gro Rejkjær Sørensen, Laura; Weiss Nielsen, Martin; Lisby, Michael; Folkesson, Sven Anders; Regenberg, Birgitte

    2014-01-01

    Biofilm-forming microorganisms switch between two forms: free-living planktonic and sessile multicellular. Sessile communities of yeast biofilms in liquid medium provide a primitive example of multicellularity and are clinically important because biofilms tend to have other growth characteristics...... than free-living cells. We investigated the genetic basis for yeast, Saccharomyces cerevisiae, biofilm on solid surfaces in liquid medium by screening a comprehensive deletion mutant collection in the S1278b background and found 71 genes that were essential for biofilm development. Quantitative...... functioned specifically in biofilm and mat formation. In a tpk3 mutant, transcription of FLO11 was induced three-fold compared with wild-type, but biofilm development and cell–cell adhesion was absent, suggesting that Tpk3p regulates FLO11 positive posttranscriptionally and negative transcriptionally. The...

  17. Responses of Saccharomyces cerevisiae to nitrogen starvation in wine alcoholic fermentation.

    Science.gov (United States)

    Tesnière, Catherine; Brice, Claire; Blondin, Bruno

    2015-09-01

    Nitrogen is an important nutrient in alcoholic fermentation because its starvation affects both fermentation kinetics and the formation of yeast metabolites. In most alcoholic fermentations, yeasts have to ferment in nitrogen-starved conditions, which requires modifications of cell functions to maintain a high sugar flux and enable cell survival for long periods in stressful conditions. In this review, we present an overview of our current understanding of the responses of the wine yeast Saccharomyces cerevisiae to variations of nitrogen availability. Adaptation to nitrogen starvation involves changes in the activity of signaling pathways such as target of rapamycin (TOR) and nitrogen catabolite repression (NCR), which are important for the remodeling of gene expression and the establishment of stress responses. Upon starvation, protein degradation pathways involving autophagy and the proteasome play a major role in nitrogen recycling and the adjustment of cellular activity. Recent progress in the understanding of the role of these mechanisms should enable advances in fermentation management and the design of novel targets for the selection or improvement of yeast strains. PMID:26201494

  18. Synthetic Transcription Amplifier System for Orthogonal Control of Gene Expression in Saccharomyces cerevisiae

    Science.gov (United States)

    Rantasalo, Anssi; Czeizler, Elena; Virtanen, Riitta; Rousu, Juho; Lähdesmäki, Harri; Penttilä, Merja

    2016-01-01

    This work describes the development and characterization of a modular synthetic expression system that provides a broad range of adjustable and predictable expression levels in S. cerevisiae. The system works as a fixed-gain transcription amplifier, where the input signal is transferred via a synthetic transcription factor (sTF) onto a synthetic promoter, containing a defined core promoter, generating a transcription output signal. The system activation is based on the bacterial LexA-DNA-binding domain, a set of modified, modular LexA-binding sites and a selection of transcription activation domains. We show both experimentally and computationally that the tuning of the system is achieved through the selection of three separate modules, each of which enables an adjustable output signal: 1) the transcription-activation domain of the sTF, 2) the binding-site modules in the output promoter, and 3) the core promoter modules which define the transcription initiation site in the output promoter. The system has a novel bidirectional architecture that enables generation of compact, yet versatile expression modules for multiple genes with highly diversified expression levels ranging from negligible to very strong using one synthetic transcription factor. In contrast to most existing modular gene expression regulation systems, the present system is independent from externally added compounds. Furthermore, the established system was minimally affected by the several tested growth conditions. These features suggest that it can be highly useful in large scale biotechnology applications. PMID:26901642

  19. Proteomic analysis reveals a novel function of the kinase Sat4p in Saccharomyces cerevisiae mitochondria.

    Directory of Open Access Journals (Sweden)

    Uta Gey

    Full Text Available The Saccharomyces cerevisiae kinase Sat4p has been originally identified as a protein involved in salt tolerance and stabilization of plasma membrane transporters, implicating a cytoplasmic localization. Our study revealed an additional mitochondrial (mt localization, suggesting a dual function for Sat4p. While no mt related phenotype was observed in the absence of Sat4p, its overexpression resulted in significant changes of a specific mitochondrial subproteome. As shown by a comparative two dimensional difference gel electrophoresis (2D-DIGE approach combined with mass spectrometry, particularly two groups of proteins were affected: the iron-sulfur containing aconitase-type proteins (Aco1p, Lys4p and the lipoamide-containing subproteome (Lat1p, Kgd2p and Gcv3p. The lipoylation sites of all three proteins could be assigned by nanoLC-MS/MS to Lys75 (Lat1p, Lys114 (Kgd2p and Lys102 (Gcv3p, respectively. Sat4p overexpression resulted in accumulation of the delipoylated protein variants and in reduced levels of aconitase-type proteins, accompanied by a decrease in the activities of the respective enzyme complexes. We propose a regulatory role of Sat4p in the late steps of the maturation of a specific subset of mitochondrial iron-sulfur cluster proteins, including Aco1p and lipoate synthase Lip5p. Impairment of the latter enzyme may account for the observed lipoylation defects.

  20. Cane molasses fermentation for continuous ethanol production in an immobilized cells reactor by Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Ghorbani, Farshid; Younesi, Habibollah; Esmaeili Sari, Abbas [Department of Environmental Science, Faculty of Natural Resources and Marine Sciences, Tarbiat Modares University, Noor, P.O. Box: 64414-356 (Iran); Najafpour, Ghasem [Department of Chemical Engineering, Faculty of Engineering, Noshirvani University of Technology, Babol (Iran)

    2011-02-15

    Sodium-alginate immobilized yeast was employed to produce ethanol continuously using cane molasses as a carbon source in an immobilized cell reactor (ICR). The immobilization of Saccharomyces cerevisiae was performed by entrapment of the cell cultured media harvested at exponential growth phase (16 h) with 3% sodium alginate. During the initial stage of operation, the ICR was loaded with fresh beads of mean diameter of 5.01 mm. The ethanol production was affected by the concentration of the cane molasses (50, 100 and 150 g/l), dilution rates (0.064, 0.096, 0.144 and 0.192 h{sup -1}) and hydraulic retention time (5.21, 6.94, 10.42 and 15.63 h) of the media. The pH of the feed medium was set at 4.5 and the fermentation was carried out at an ambient temperature. The maximum ethanol production, theoretical yield (Y{sub E/S}), volumetric ethanol productivity (Q{sub P}) and total sugar consumption was 19.15 g/l, 46.23%, 2.39 g l{sup -1} h{sup -1} and 96%, respectively. (author)