WorldWideScience

Sample records for cereus group genomics

  1. Comparative genome analysis of Bacillus cereus group genomes withBacillus subtilis

    Anderson, Iain; Sorokin, Alexei; Kapatral, Vinayak; Reznik, Gary; Bhattacharya, Anamitra; Mikhailova, Natalia; Burd, Henry; Joukov, Victor; Kaznadzey, Denis; Walunas, Theresa; D' Souza, Mark; Larsen, Niels; Pusch,Gordon; Liolios, Konstantinos; Grechkin, Yuri; Lapidus, Alla; Goltsman,Eugene; Chu, Lien; Fonstein, Michael; Ehrlich, S. Dusko; Overbeek, Ross; Kyrpides, Nikos; Ivanova, Natalia

    2005-09-14

    Genome features of the Bacillus cereus group genomes (representative strains of Bacillus cereus, Bacillus anthracis and Bacillus thuringiensis sub spp israelensis) were analyzed and compared with the Bacillus subtilis genome. A core set of 1,381 protein families among the four Bacillus genomes, with an additional set of 933 families common to the B. cereus group, was identified. Differences in signal transduction pathways, membrane transporters, cell surface structures, cell wall, and S-layer proteins suggesting differences in their phenotype were identified. The B. cereus group has signal transduction systems including a tyrosine kinase related to two-component system histidine kinases from B. subtilis. A model for regulation of the stress responsive sigma factor sigmaB in the B. cereus group different from the well studied regulation in B. subtilis has been proposed. Despite a high degree of chromosomal synteny among these genomes, significant differences in cell wall and spore coat proteins that contribute to the survival and adaptation in specific hosts has been identified.

  2. Differentiation of strains from the Bacillus cereus group by RFLP-PFGE genomic fingerprinting.

    Otlewska, Anna; Oltuszak-Walczak, Elzbieta; Walczak, Piotr

    2013-11-01

    Bacillus mycoides, Bacillus pseudomycoides, Bacillus weihenstephanensis, Bacillus anthracis, Bacillus thuringiensis, and Bacillus cereus belong to the B. cereus group. The last three species are characterized by different phenotype features and pathogenicity spectrum, but it has been shown that these species are genetically closely related. The macrorestriction analysis of the genomic DNA with the NotI enzyme was used to generate polymorphism of restriction profiles for 39 food-borne isolates (B. cereus, B. mycoides) and seven reference strains (B. mycoides, B. thuringiensis, B. weihenstephanensis, and B. cereus). The PFGE method was applied to differentiate the examined strains of the B. cereus group. On the basis of the unweighted pair group method with the arithmetic mean method and Dice coefficient, the strains were divided into five clusters (types A-E), and the most numerous group was group A (25 strains). A total of 21 distinct pulsotypes were observed. The RFLP-PFGE analysis was successfully used for the differentiation and characterization of B. cereus and B. mycoides strains isolated from different food products. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Extending the cereus group genomics to putative food-bornepathogens of different toxicity

    Lapidus, Alla; Goltsman, Eugene; Auger, Sandrine; Galleron,Nathalie; Segurens, Beatrice; Dossat, Carole; Land, Miriam L.; Broussole,Veronique; Brillard, Julien; Guinebretiere, Marie-Helene; Sanchis,Vincent; Nguen-the, Christophe; Lereclus, Didier; Richardson, Paul; Winker, Patrick; Weissenbach, Jean; Ehrlich, S.Dusko; Sorokin, Alexei

    2006-08-24

    The cereus group represents sporulating soil bacteriacontaining pathogenic strains which may cause diarrheic or emetic foodpoisoning outbreaks. Multiple locus sequence typing revealed a presencein natural samples of these bacteria of about thirty clonal complexes.Application of genomic methods to this group was however biased due tothe major interest for representatives closely related to B. anthracis.Albeit the most important food-borne pathogens were not yet defined,existing dataindicate that they are scattered all over the phylogenetictree. The preliminary analysis of the sequences of three genomesdiscussed in this paper narrows down the gaps in our knowledge of thecereus group. The strain NVH391-98 is a rare but particularly severefood-borne pathogen. Sequencing revealed that the strain must be arepresentative of a novel bacterial species, for which the name Bacilluscytotoxis is proposed. This strain has a reduced genome size compared toother cereus group strains. Genome analysis revealed absence of sigma Bfactor and the presence of genes encoding diarrheic Nhe toxin, notdetected earlier. The strain B. cereus F837/76 represents a clonalcomplex close to that of B. anthracis. Including F837/76, three such B.cereus strains had been sequenced. Alignment of genomes suggests that B.anthracis is their common ancestor. Since such strains often emerge fromclinical cases, they merit a special attention. The third strain, KBAB4,is a typical psychrotrophe characteristic to unbiased soil communities.Phylogenic studies show that in nature it is the most active group interms of gene exchange. Genomic sequence revealed high presence ofextra-chromosomal genetic material (about 530 kb) that may account forthis phenomenon. Genes coding Nhe-like toxin were found on a big plasmidin this strain. This may indicate a potential mechanism of toxicityspread from the psychrotrophic strain community. The results of thisgenomic work and ecological compartments of different strains incite

  4. Genome Sequencing of Bacillus subtilis SC-8, Antagonistic to the Bacillus cereus Group, Isolated from Traditional Korean Fermented-Soybean Food

    Yeo, In-Cheol; Lee, Nam Keun; Hahm, Young Tae

    2012-01-01

    Bacillus subtilis SC-8 is a Gram-positive bacterium displaying narrow antagonistic activity for the Bacillus cereus group. B. subtilis SC-8 was isolated from Korean traditional fermented-soybean food. Here we report the draft genome sequence of B. subtilis SC-8, including biosynthetic genes for antibiotics that may have beneficial effects for control of food-borne pathogens.

  5. Pan-genome and phylogeny of Bacillus cereus sensu lato

    Bazinet, Adam

    2017-01-01

    Background: Bacillus cereus sensu lato ( s . l .) is an ecologically diverse bacterial group of medical and agricultural significance. In this study, I use publicly available genomes to characterize the B. cereus s. l. pan-genome and perform the largest phylogenetic and population genetic analyses of this group to date in terms of the number of genes and taxa included. With these fundamental data in hand, I identify genes associated with particular phenotypic traits (i.e., "pan-GWAS" analysis...

  6. Pan-genome and phylogeny of Bacillus cereus sensu lato

    Bazinet, Adam L.

    2017-01-01

    Background Bacillus cereus sensu lato (s. l.) is an ecologically diverse bacterial group of medical and agricultural significance. In this study, I use publicly available genomes and novel bioinformatic workflows to characterize the B. cereus s. l. pan-genome and perform the largest phylogenetic and population genetic analyses of this group to date in terms of the number of genes and taxa included. With these fundamental data in hand, I identify genes associated with particular phenotypic tra...

  7. Pan-genome and phylogeny of Bacillus cereus sensu lato.

    Bazinet, Adam L

    2017-08-02

    Bacillus cereus sensu lato (s. l.) is an ecologically diverse bacterial group of medical and agricultural significance. In this study, I use publicly available genomes and novel bioinformatic workflows to characterize the B. cereus s. l. pan-genome and perform the largest phylogenetic and population genetic analyses of this group to date in terms of the number of genes and taxa included. With these fundamental data in hand, I identify genes associated with particular phenotypic traits (i.e., "pan-GWAS" analysis), and quantify the degree to which taxa sharing common attributes are phylogenetically clustered. A rapid k-mer based approach (Mash) was used to create reduced representations of selected Bacillus genomes, and a fast distance-based phylogenetic analysis of this data (FastME) was performed to determine which species should be included in B. cereus s. l. The complete genomes of eight B. cereus s. l. species were annotated de novo with Prokka, and these annotations were used by Roary to produce the B. cereus s. l. pan-genome. Scoary was used to associate gene presence and absence patterns with various phenotypes. The orthologous protein sequence clusters produced by Roary were filtered and used to build HaMStR databases of gene models that were used in turn to construct phylogenetic data matrices. Phylogenetic analyses used RAxML, DendroPy, ClonalFrameML, PAUP*, and SplitsTree. Bayesian model-based population genetic analysis assigned taxa to clusters using hierBAPS. The genealogical sorting index was used to quantify the phylogenetic clustering of taxa sharing common attributes. The B. cereus s. l. pan-genome currently consists of ≈60,000 genes, ≈600 of which are "core" (common to at least 99% of taxa sampled). Pan-GWAS analysis revealed genes associated with phenotypes such as isolation source, oxygen requirement, and ability to cause diseases such as anthrax or food poisoning. Extensive phylogenetic analyses using an unprecedented amount of data

  8. Data on genome sequencing, analysis and annotation of a pathogenic Bacillus cereus 062011msu

    Rashmi Rathy

    2018-04-01

    Full Text Available Bacillus species 062011 msu is a harmful pathogenic strain responsible for causing abscessation in sheep and goat population studied by Mariappan et al. (2012 [1]. The organism specifically targets the female sheep and goat population and results in the reduction of milk and meat production. In the present study, we have performed the whole genome sequencing of the pathogenic isolate using the Ion Torrent sequencing platform and generated 458,944 raw reads with an average length of 198.2 bp. The genome sequence was assembled, annotated and analysed for the genetic islands, metabolic pathways, orthologous groups, virulence factors and antibiotic resistance genes associated with the pathogen. Simultaneously the 16S rRNA sequencing study and genome sequence comparison data confirmed that the strain belongs to the species Bacillus cereus and exhibits 99% sequence homo;logy with the genomes of B. cereus ATCC 10987 and B. cereus FRI-35. Hence, we have renamed the organism as Bacillus cereus 062011msu. The Whole Genome Shotgun (WGS project has been deposited at DDBJ/ENA/GenBank under the accession NTMF00000000 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA404036(SAMN07629099. Keywords: Bacillus cereus, Genome sequencing, Abscessation, Virulence factors

  9. The Genetically Remote Pathogenic Strain NVH391-98 of the Bacillus cereus Group Represents the Cluster of Thermophilic Strains

    Auger, Sandrine; Galleron, Nathalie; Bidnenko, Elena; Ehrlich, S. Dusko; Lapidus, Alla; Sorokin, Alexei

    2007-10-02

    Bacteria of the Bacillus cereus group are known to cause food poisoning. A rare phylogenetically remote strain, NVH391-98, was recently characterized to encode a particularly efficient cytotoxin K presumably responsible for food poisoning. This pathogenic strain and its close relatives can be phenotypically distinguished from other strains of the B. cereus group by the inability to grow at temperatures below 17 degrees C and by the ability to grow at temperatures from 48 to 53 degrees C. A temperate phage, phBC391A2, residing in the genome of NVH391-98 allows us to distinguish the three known members of this thermophilic strain cluster.

  10. Polymerase chain reaction assay for the detection of Bacillus cereus group cells

    Hansen, Bjarne Munk; Leser, Thomas D.; Hendriksen, Niels Bohse

    2001-01-01

    of the B. cereus group in food and in the environment. Using 16S rDNA as target, a PCR assay for the detection of B. cereus group cells has been developed. Primers specific for the 16S rDNA of the B. cereus group bacteria were selected and used in combination with consensus primers for 165 rDNA as internal...... PCR procedure control. The PCR procedure was optimized with respect to annealing temperature. When DNA from the B. cereus group bacteria was present, the PCR assay yielded a B. cereus specific fragment, while when non-B. cereus prokaryotic DNA was present, the consensus 165 rDNA primers directed...

  11. Whole-Genome Sequences of 94 Environmental Isolates of Bacillus cereus Sensu Lato

    Feldgarden, Michael; Kolter, Roberto; Mahillon, Jacques

    2013-01-01

    Bacillus cereus sensu lato is a species complex that includes the anthrax pathogen Bacillus anthracis and other bacterial species of medical, industrial, and ecological importance. Their phenotypes of interest are typically linked to large plasmids that are closely related to the anthrax plasmids pXO1 and pXO2. Here, we present the draft genome sequences of 94 isolates of B. cereus sensu lato, which were chosen for their plasmid content and environmental origins. PMID:24092776

  12. A genomic region involved in the formation of adhesin fibers in Bacillus cereus biofilms

    Joaquín eCaro-Astorga

    2015-01-01

    Full Text Available Bacillus cereus is a bacterial pathogen that is responsible for many recurrent disease outbreaks due to food contamination. Spores and biofilms are considered the most important reservoirs of B. cereus in contaminated fresh vegetables and fruits. Biofilms are bacterial communities that are difficult to eradicate from biotic and abiotic surfaces because of their stable and extremely strong extracellular matrix. These extracellular matrixes contain exopolysaccharides, proteins, extracellular DNA, and other minor components. Although B. cereus can form biofilms, the bacterial features governing assembly of the protective extracellular matrix are not known. Using the well-studied bacterium B. subtilis as a model, we identified two genomic loci in B. cereus, which encodes two orthologs of the amyloid-like protein TasA of B. subtilis and a SipW signal peptidase. Deletion of this genomic region in B. cereus inhibited biofilm assembly; notably, mutation of the putative signal peptidase SipW caused the same phenotype. However, mutations in tasA or calY did not completely prevent biofilm formation; strains that were mutated for either of these genes formed phenotypically different surface attached biofilms. Electron microscopy studies revealed that TasA polymerizes to form long and abundant fibers on cell surfaces, whereas CalY does not aggregate similarly. Heterologous expression of this amyloid-like cassette in a B. subtilis strain lacking the factors required for the assembly of TasA amyloid-like fibers revealed i the involvement of this B. cereus genomic region in formation of the air-liquid interphase pellicles and ii the intrinsic ability of TasA to form fibers similar to the amyloid-like fibers produced by its B. subtilis ortholog.

  13. Draft Genome Sequences from a Novel Clade of Bacillus cereus Sensu Lato Strains, Isolated from the International Space Station

    Venkateswaran, Kasthuri; Checinska Sielaff, Aleksandra; Ratnayake, Shashikala; Pope, Robert K; Blank, Thomas E; Stepanov, Victor G; Fox, George E; van Tongeren, Sandra P; Torres, Clinton; Allen, Jonathan; Jaing, Crystal; Pierson, Duane; Perry, Jay; Koren, Sergey; Phillippy, Adam; Klubnik, Joy; Treangen, Todd J; Rosovitz, M J; Bergman, Nicholas H

    2017-01-01

    The draft genome sequences of six Bacillus strains, isolated from the International Space Station and belonging to the Bacillus anthracis-B. cereus-B. thuringiensis group, are presented here. These strains were isolated from the Japanese Experiment Module (one strain), U.S. Harmony Node 2 (three

  14. Isolation, Identification, Prevalence, and Genetic Diversity of Bacillus cereus Group Bacteria From Different Foodstuffs in Tunisia.

    Gdoura-Ben Amor, Maroua; Siala, Mariam; Zayani, Mariem; Grosset, Noël; Smaoui, Salma; Messadi-Akrout, Feriele; Baron, Florence; Jan, Sophie; Gautier, Michel; Gdoura, Radhouane

    2018-01-01

    Bacillus cereus group is widespread in nature and foods. Several members of this group are recognized as causing food spoilage and/or health issues. This study was designed to determine the prevalence and genetic diversity of the B. cereus group strains isolated in Tunisia from different foods (cereals, spices, cooked food, fresh-cut vegetables, raw and cooked poultry meats, seafood, canned, pastry, and dairy products). In total, 687 different samples were collected and searched for the presence of the B. cereus group after selective plating on MYP agar and enumeration of each sample. The typical pink-orange uniform colonies surrounded by a zone of precipitate were assumed to belong to the B. cereus group. One typical colony from each sample was subcultured and preserved as cryoculture. Overall, 191 (27.8%) food samples were found positive, giving rise to a collection of 191 B. cereus -like isolates. The concentration of B. cereus -like bacteria were below 10 3 cfu/g or ml in 77.5% of the tested samples. Higher counts (>10 4 cfu/g or ml) were found in 6.8% of samples including fresh-cut vegetables, cooked foods, cereals, and pastry products. To verify whether B. cereus -like isolates belonged to the B. cereus group, a PCR test targeting the sspE gene sequence specific of the group was carried out. Therefore, 174 isolates were found to be positive. Food samples were contaminated as follows: cereals (67.6%), pastry products (46.2%), cooked food (40.8%), cooked poultry meat (32.7%), seafood products (32.3%), spices (28.8%), canned products (16.7%), raw poultry meat (9.4%), fresh-cut vegetables (5.0%), and dairy products (4.8%). The 174 B. cereus isolates were characterized by partial sequencing of the panC gene, using a Sym'Previous software tool to assign them to different phylogenetic groups. Strains were distributed as follows: 61.3, 29.5, 7.5, and 1.7% in the group III, IV, II, and V, respectively. The genetic diversity was further assessed by ERIC-PCR and PFGE

  15. Isolation, Identification, Prevalence, and Genetic Diversity of Bacillus cereus Group Bacteria From Different Foodstuffs in Tunisia

    Maroua Gdoura-Ben Amor

    2018-03-01

    Full Text Available Bacillus cereus group is widespread in nature and foods. Several members of this group are recognized as causing food spoilage and/or health issues. This study was designed to determine the prevalence and genetic diversity of the B. cereus group strains isolated in Tunisia from different foods (cereals, spices, cooked food, fresh-cut vegetables, raw and cooked poultry meats, seafood, canned, pastry, and dairy products. In total, 687 different samples were collected and searched for the presence of the B. cereus group after selective plating on MYP agar and enumeration of each sample. The typical pink-orange uniform colonies surrounded by a zone of precipitate were assumed to belong to the B. cereus group. One typical colony from each sample was subcultured and preserved as cryoculture. Overall, 191 (27.8% food samples were found positive, giving rise to a collection of 191 B. cereus-like isolates. The concentration of B. cereus-like bacteria were below 103 cfu/g or ml in 77.5% of the tested samples. Higher counts (>104 cfu/g or ml were found in 6.8% of samples including fresh-cut vegetables, cooked foods, cereals, and pastry products. To verify whether B. cereus-like isolates belonged to the B. cereus group, a PCR test targeting the sspE gene sequence specific of the group was carried out. Therefore, 174 isolates were found to be positive. Food samples were contaminated as follows: cereals (67.6%, pastry products (46.2%, cooked food (40.8%, cooked poultry meat (32.7%, seafood products (32.3%, spices (28.8%, canned products (16.7%, raw poultry meat (9.4%, fresh-cut vegetables (5.0%, and dairy products (4.8%. The 174 B. cereus isolates were characterized by partial sequencing of the panC gene, using a Sym'Previous software tool to assign them to different phylogenetic groups. Strains were distributed as follows: 61.3, 29.5, 7.5, and 1.7% in the group III, IV, II, and V, respectively. The genetic diversity was further assessed by ERIC-PCR and PFGE

  16. Prevalence, PFGE typing, and antibiotic resistance of Bacillus cereus group isolated from food in Morocco.

    Merzougui, Souad; Lkhider, Mustapha; Grosset, Noel; Gautier, Michel; Cohen, Nozha

    2014-02-01

    This article reports the prevalence and antibiotic resistance of the Bacillus cereus group isolated from different foods (milk and dairy products, spices, and rice salad) in Morocco. In total, 402 different food samples collected from 2008 to 2010 were analyzed by microbiological methods to isolate B. cereus. The strains were subjected to a polymerase chain reaction test in order to verify whether they belonged to the B. cereus group. Sixty-four of all isolates (15.9%) were found to be positive. Among the sources, B. cereus strains from milk and dairy products constituted the largest proportion of isolates (33/64; 51.6%) followed by spices (22/64; 34.4%) and salad with rice (9/64; 14.1%). The genetic diversity of the strains of B. cereus group was examined by pulsed-field gel electrophoresis (PFGE) of chromosomal DNA digested with SmaI. The enzyme restriction profiles showed a high degree of polymorphism among the strains. The results showed that PFGE analysis could reveal the genetic differences among B. cereus strains. Investigation of antibiotic-resistance profiles showed that isolates were resistant to ampicillin (98.4%), tetracycline (90.6%), oxacillin (100%), cefepime (100%), and penicillin (100%), and were susceptible to chloramphenicol (67.2%), erythromycin (84.4%), and gentamicin (100%). The results of this study indicated that B. cereus could be a significant etiological agent of food poisoning in Morocco because of its high prevalence. Also, we demonstrated that the majority of strains came from milk and dairy products. However, additional research involving cytotoxicity tests is needed to more evaluate this sanitary risk.

  17. Isolation of Bacillus cereus Group from the Fecal Material of Endangered Wood Turtles.

    Nfor, Nancy Ngvumbo; Lapin, Carly N; McLaughlin, Richard William

    2015-10-01

    Members of the Bacillus cereus group are opportunistic human pathogens. They can be found in a broad range of foods. Diarrheal food poisoning and/or emetic type syndromes can result from eating contaminated food. In this study, seven B. cereus group members were isolated from the fecal material of Wood Turtles (Glyptemys insculpta). The isolates were then assessed for the presence of enterotoxin genes (nheA, entFM, hblC, and cytK) using PCR. The most prevalent is the nonhemolytic enterotoxin gene which was found in all seven isolates.

  18. The possibility of discriminating within the Bacillus cereus group using gyrB sequencing and PCR-RFLP

    Jensen, Gert B; Fisker, Niels; Sparsø, Thomas

    2005-01-01

    Based on a combination of PCR and restriction endonuclease (RE) digestion (PCR-RE digestion), we have examined the possibility of differentiating members of the Bacillus cereus group. Fragments of the gyrB gene (362 bp) from pure cultures of 12 B. cereus, 25 B. thuringiensis, 25 B. mycoides and two......, it was not possible to discriminate between the B. cereus and the B. thuringiensis strains using the methods described....

  19. Antimicrobial resistance among Pseudomonas spp. and the Bacillus cereus group isolated from Danish agricultural soil

    Jensen, Lars Bogø; Baloda, S.; Boye, Mette

    2001-01-01

    From four Danish pig farms, bacteria of Pseudomonas spp. and the Bacillus cereus group were isolated from soil and susceptibility towards selected antimicrobials was tested. From each farm, soil samples representing soil just before and after spread of animal waste and undisturbed agricultural so...... spp., and for bacitracin, erythromycin, penicillin and streptomycin for the B. cereus group. Variations in resistance levels were observed when soil before and after spread of animal waste was compared, indicating an effect from spread of animal waste.......From four Danish pig farms, bacteria of Pseudomonas spp. and the Bacillus cereus group were isolated from soil and susceptibility towards selected antimicrobials was tested. From each farm, soil samples representing soil just before and after spread of animal waste and undisturbed agricultural soil......, when possible, were collected. Soil from a well-characterized Danish farm soil (Hojbakkegaard) was collected for comparison. The Psudomonas spp. and B. cereus were chosen as representative for Gram-negative and Gram-positive indigenous soil bacteria to test the effect of spread of animal waste...

  20. The genome of a Bacillus isolate causing anthrax in chimpanzees combines chromosomal properties of B. cereus with B. anthracis virulence plasmids.

    Silke R Klee

    Full Text Available Anthrax is a fatal disease caused by strains of Bacillus anthracis. Members of this monophyletic species are non motile and are all characterized by the presence of four prophages and a nonsense mutation in the plcR regulator gene. Here we report the complete genome sequence of a Bacillus strain isolated from a chimpanzee that had died with clinical symptoms of anthrax. Unlike classic B. anthracis, this strain was motile and lacked the four prohages and the nonsense mutation. Four replicons were identified, a chromosome and three plasmids. Comparative genome analysis revealed that the chromosome resembles those of non-B. anthracis members of the Bacillus cereus group, whereas two plasmids were identical to the anthrax virulence plasmids pXO1 and pXO2. The function of the newly discovered third plasmid with a length of 14 kbp is unknown. A detailed comparison of genomic loci encoding key features confirmed a higher similarity to B. thuringiensis serovar konkukian strain 97-27 and B. cereus E33L than to B. anthracis strains. For the first time we describe the sequence of an anthrax causing bacterium possessing both anthrax plasmids that apparently does not belong to the monophyletic group of all so far known B. anthracis strains and that differs in important diagnostic features. The data suggest that this bacterium has evolved from a B. cereus strain independently from the classic B. anthracis strains and established a B. anthracis lifestyle. Therefore we suggest to designate this isolate as "B. cereus variety (var. anthracis".

  1. Identification, genetic diversity and cereulide producing ability of Bacillus cereus group strains isolated from Beninese traditional fermented food condiments

    Thorsen, Line; Azokpota, Paulin; Hansen, Bjarne Munk

    2010-01-01

    Bacillus cereus sensu lato is often detected in spontaneously fermented African foods but is rarely identified to species level. Only some of the B. cereus group species are reported to be pathogenic to humans and identification to species level is necessary to estimate the safety of these products...... (cluster 1). Highly similar PM13 profiles were obtained for seven of the isolates, one from afitin, one from iru and five from sonru (cluster 2). Four of the isolates, one from afitin and three from sonru, did not form any particular cluster. The PM13 profiles of cluster 2 isolates were identical to those...... which are specific to emetic toxin producers. Cereulide production of these isolates was confirmed by liquid chromatography mass spectrometry/mass spectrometry. This is the first report on cereulide producing B. cereus in African fermented foods. Occurrence of the opportunistic human pathogen B. cereus...

  2. Toxigenic genes, spoilage potential, and antimicrobial resistance of Bacillus cereus group strains from ice cream.

    Arslan, Seza; Eyi, Ayla; Küçüksarı, Rümeysa

    2014-02-01

    Bacillus spp. can be recovered from almost every environment. It is also found readily in foods, where it may cause food spoilage and/or food poisoning due to its toxigenic and pathogenic nature, and extracellular enzymes. In this study, 29 Bacillus cereus group strains from ice cream were examined for the presence of following virulence genes hblC, nheA, cytK and ces genes, and tested for a range of the extracellular enzymes, and antimicrobial susceptibility. The strains were found to produce extracellular enzymes: proteolytic and lipolytic activity, gelatin hydrolysis and lecithinase production (100%), DNase production (93.1%) and amylase activity (93.1%). Of 29 strains examined, 24 (82.8%) showed hemolytic activity on blood agar. Beta-lactamase enzyme was only produced by 20.7% of B. cereus group. Among 29 B. cereus group from ice cream, nheA was the most common virulence gene detected in 44.8% of the strains, followed by hblC gene with 17.2%. Four (13.8%) of the 29 strains were positive for both hblC gene and nheA gene. Contrarily, cytK and ces genes were not detected in any of the strains. Antimicrobial susceptibility of ice cream isolates was tested to 14 different antimicrobial agents using the disc diffusion method. We detected resistance to penicillin and ampicillin with the same rate of 89.7%. Thirty-one percent of the strains were multiresistant to three or more antibiotics. This study emphasizes that the presence of natural isolates of Bacillus spp. harboring one or more enterotoxin genes, producing extracellular enzymes which may cause spoilage and acquiring antibiotic resistance might hold crucial importance in the food safety and quality. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Conducting polymer based DNA biosensor for the detection of the Bacillus cereus group species

    Velusamy, Vijayalakshmi; Arshak, Khalil; Korostynska, Olga; Oliwa, Kamila; Adley, Catherine

    2009-05-01

    Biosensor designs are emerging at a significant rate and play an increasingly important role in foodborne pathogen detection. Conducting polymers are excellent tools for the fabrication of biosensors and polypyrrole has been used in the detection of biomolecules due to its unique properties. The prime intention of this paper was to pioneer the design and fabrication of a single-strand (ss) DNA biosensor for the detection of the Bacillus cereus (B.cereus) group species. Growth of B. cereus, results in production of several highly active toxins. Therefore, consumption of food containing >106 bacteria/gm may results in emetic and diarrhoeal syndromes. The most common source of this bacterium is found in liquid food products, milk powder, mixed food products and is of particular concern in the baby formula industry. The electrochemical deposition technique, such as cyclic voltammetry, was used to develop and test a model DNA-based biosensor on a gold electrode electropolymerized with polypyrrole. The electrically conducting polymer, polypyrrole is used as a platform for immobilizing DNA (1μg) on the gold electrode surface, since it can be more easily deposited from neutral pH aqueous solutions of pyrrolemonomers. The average current peak during the electrodeposition event is 288μA. There is a clear change in the current after hybridization of the complementary oligonucleotide (6.35μA) and for the noncomplementary oligonucleotide (5.77μA). The drop in current after each event was clearly noticeable and it proved to be effective.

  4. The identification of a tetracycline resistance gene tet(M), on a Tn916-like transposon, in the Bacillus cereus group

    Agersø, Yvonne; Jensen, Lars Bogø; Givskov, Michael Christian

    2002-01-01

    In order to investigate whether resistance genes present in bacteria in manure could transfer to indigenous soil bacteria, resistant isolates belonging to the Bacillus cereus group (Bacillus cereus, Bacillus anthracis and Bacillus thuringiensis) were isolated from farm soil (72 isolates) and manure...

  5. Genomic study of the cereolysin A and B genes in Bacillus cereus ...

    Hence study about existence of Bacillus cereus in pasteurized milk is very important due to probability of causing illness by Cereolysin gene products. Therefore, Different milk samples were collected from raw milk to pasteurized milk after various stages of producing pasteurized milk. Cultivation of milk samples in Mannitol ...

  6. Linking Bacillus cereus Genotypes and Carbohydrate Utilization Capacity.

    Alicja K Warda

    Full Text Available We characterised carbohydrate utilisation of 20 newly sequenced Bacillus cereus strains isolated from food products and food processing environments and two laboratory strains, B. cereus ATCC 10987 and B. cereus ATCC 14579. Subsequently, genome sequences of these strains were analysed together with 11 additional B. cereus reference genomes to provide an overview of the different types of carbohydrate transporters and utilization systems found in B. cereus strains. The combined application of API tests, defined growth media experiments and comparative genomics enabled us to link the carbohydrate utilisation capacity of 22 B. cereus strains with their genome content and in some cases to the panC phylogenetic grouping. A core set of carbohydrates including glucose, fructose, maltose, trehalose, N-acetyl-glucosamine, and ribose could be used by all strains, whereas utilisation of other carbohydrates like xylose, galactose, and lactose, and typical host-derived carbohydrates such as fucose, mannose, N-acetyl-galactosamine and inositol is limited to a subset of strains. Finally, the roles of selected carbohydrate transporters and utilisation systems in specific niches such as soil, foods and the human host are discussed.

  7. A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species.

    Hirohito Ogawa

    Full Text Available Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis.

  8. The Pathogenomic Sequence Analysis of B. cereus and B.thuringiensis Isolates Closely Related to Bacillus anthracis

    Han, Cliff S.; Xie, Gary; Challacombe, Jean F.; Altherr, MichaelR.; Smriti, B.; Bruce, David; Campbell, Connie S.; Campbell, Mary L.; Chen, Jin; Chertkov, Olga; Cleland, Cathy; Dimitrijevic-Bussod, M.; Doggett, Norman A.; Fawcett, John J.; Glavina, Tijana; Goodwin, Lynne A.; Hill, Karen K.; Hitchcock, Penny; Jackson, Paul J.; Keim, Paul; Kewalramani, Avinash Ramesh; Longmire, Jon; Lucas, Susan; Malfatti,Stephanie; McMurry, Kim; Meincke, Linda J.; Misra, Monica; Moseman,Bernice L.; Mundt, Mark; Munk, A. Christine; Okinaka, Richard T.; Parson-Quintana, B.; Reilly, Lee P.; Richardson, Paul; Robinson, DonnaL.; Rubin, Eddy; Saunders, Elizabeth; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Ticknor, Lawrence O.; Wills, Patti L.; Gilna, Payl; Brettin, Thomas S.

    2005-08-18

    The sequencing and analysis of two close relatives of Bacillus anthracis are reported. AFLP analysis of over 300 isolates of B.cereus, B. thuringiensis and B. anthracis identified two isolates as being very closely related to B. anthracis. One, a B. cereus, BcE33L, was isolated from a zebra carcass in Nambia; the second, a B. thuringiensis, 97-27, was isolated from a necrotic human wound. The B. cereus appears to be the closest anthracis relative sequenced to date. A core genome of over 3,900 genes was compiled for the Bacillus cereus group, including Banthracis. Comparative analysis of these two genomes with other members of the B. cereus group provides insight into the evolutionary relationships among these organisms. Evidence is presented that differential regulation modulates virulence, rather than simple acquisition of virulence factors. These genome sequences provide insight into the molecular mechanisms contributing to the host range and virulence of this group of organisms.

  9. Linking Bacillus cereus Genotypes and Carbohydrate Utilization Capacity

    Warda, Alicja K.; Siezen, Roland J.; Boekhorst, Jos; Wells-Bennik, Marjon H.J.; Jong, de Anne; Kuipers, Oscar P.; Nierop Groot, Masja N.; Abee, Tjakko

    2016-01-01

    We characterised carbohydrate utilisation of 20 newly sequenced Bacillus cereus strains isolated from food products and food processing environments and two laboratory strains, B. cereus ATCC 10987 and B. cereus ATCC 14579. Subsequently, genome sequences of these strains were analysed together with

  10. Group normalization for genomic data.

    Ghandi, Mahmoud; Beer, Michael A

    2012-01-01

    Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN), to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  11. Group normalization for genomic data.

    Mahmoud Ghandi

    Full Text Available Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN, to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  12. Functional Genomics Group. Program Description

    Burian, Dennis

    2008-01-01

    .... This article reviews mechanisms of gene regulation and discusses how genomics is changing the way medicine is practiced today as a means of demonstrating that molecular medicine is here to stay...

  13. Comparative transcriptional profiling of Bacillus cereus sensu lato strains during growth in CO2-bicarbonate and aerobic atmospheres.

    Karla D Passalacqua

    Full Text Available Bacillus species are spore-forming bacteria that are ubiquitous in the environment and display a range of virulent and avirulent phenotypes. This range is particularly evident in the Bacillus cereus sensu lato group; where closely related strains cause anthrax, food-borne illnesses, and pneumonia, but can also be non-pathogenic. Although much of this phenotypic range can be attributed to the presence or absence of a few key virulence factors, there are other virulence-associated loci that are conserved throughout the B. cereus group, and we hypothesized that these genes may be regulated differently in pathogenic and non-pathogenic strains.Here we report transcriptional profiles of three closely related but phenotypically unique members of the Bacillus cereus group--a pneumonia-causing B. cereus strain (G9241, an attenuated strain of B. anthracis (Sterne 34F(2, and an avirulent B. cereus strain (10987--during exponential growth in two distinct atmospheric environments: 14% CO(2/bicarbonate and ambient air. We show that the disease-causing Bacillus strains undergo more distinctive transcriptional changes between the two environments, and that the expression of plasmid-encoded virulence genes was increased exclusively in the CO(2 environment. We observed a core of conserved metabolic genes that were differentially expressed in all three strains in both conditions. Additionally, the expression profiles of putative virulence genes in G9241 suggest that this strain, unlike Bacillus anthracis, may regulate gene expression with both PlcR and AtxA transcriptional regulators, each acting in a different environment.We have shown that homologous and even identical genes within the genomes of three closely related members of the B. cereus sensu lato group are in some instances regulated very differently, and that these differences can have important implications for virulence. This study provides insights into the evolution of the B. cereus group, and

  14. Bacillus cereus Biovar Anthracis Causing Anthrax in Sub-Saharan Africa-Chromosomal Monophyly and Broad Geographic Distribution.

    Kym S Antonation

    2016-09-01

    Full Text Available Through full genome analyses of four atypical Bacillus cereus isolates, designated B. cereus biovar anthracis, we describe a distinct clade within the B. cereus group that presents with anthrax-like disease, carrying virulence plasmids similar to those of classic Bacillus anthracis. We have isolated members of this clade from different mammals (wild chimpanzees, gorillas, an elephant and goats in West and Central Africa (Côte d'Ivoire, Cameroon, Central African Republic and Democratic Republic of Congo. The isolates shared several phenotypic features of both B. anthracis and B. cereus, but differed amongst each other in motility and their resistance or sensitivity to penicillin. They all possessed the same mutation in the regulator gene plcR, different from the one found in B. anthracis, and in addition, carry genes which enable them to produce a second capsule composed of hyaluronic acid. Our findings show the existence of a discrete clade of the B. cereus group capable of causing anthrax-like disease, found in areas of high biodiversity, which are possibly also the origin of the worldwide distributed B. anthracis. Establishing the impact of these pathogenic bacteria on threatened wildlife species will require systematic investigation. Furthermore, the consumption of wildlife found dead by the local population and presence in a domestic animal reveal potential sources of exposure to humans.

  15. Comparative transcriptome and phenotype analysis of Bacillus cereus in response to disinfectant treatments

    Ceragioli, Mara; Mols, J.M.; Moezelaar, Roy; Ghelardi, Emilia; Senesi, Sonia; Abee, Tjakko

    2010-01-01

    Antimicrobial chemicals are widely applied to clean and disinfect food-contacting surfaces. However, the cellular response of bacteria, such as Bacillus cereus, to various disinfectants is unclear. In this study, the physiological and genome-wide transcriptional responses of B. cereus ATCC 14579

  16. Genome plasticity of Vibrio parahaemolyticus: microevolution of the 'pandemic group'

    Liu Xiumei

    2008-11-01

    Full Text Available Abstract Background Outbreak of V. parahaemolyticus infections occurred since 1996 was linked to a proposed clonal complex, the pandemic group. The whole genome sequence provides an unprecedented opportunity for dissecting genome plasticity and phylogeny of the populations of V. parahaemolyticus. In the present work, a whole-genome cDNA microarray was constructed to compare the genomic contents of a collection of 174 strains of V. parahaemolyticus. Results Genes that present variably in the genome accounted for about 22% of the whole gene pool on the genome. The phylogenetic analysis of microarray data generated a minimum spanning tree that depicted the phylogenetic structure of the 174 strains. Strains were assigned into five complexes (C1 to C5, and those in each complex were related genetically and phylogenetically. C3 and C4 represented highly virulent clinical clones. C2 and C3 constituted two different clonal complexes 'old-O3:K6 clone' and 'pandemic clone', respectively. C3 included all the 39 pandemic strains tested (trh-, tdh+ and GS-PCR+, while C2 contained 12 pre-1996 'old' O3:K6 strains (trh+, tdh- and GS-PCR- tested herein. The pandemic clone (post-1996 'new' O3:K6 and its derivates O4:K68, O1:K25, O1:KUT and O6:K18 might be emerged from the old-O3:K6 clone, which was promoted by acquisition of toxRS/new sequence and genomic islands. A phylogenetic intermediate O3:K6 clade (trh-, tdh- and GS-PCR+ was identified between the pandemic and old-O3:K6 clones. Conclusion A comprehensive overview of genomic contents in a large collection of global isolates from the microarray-based comparative genomic hybridization data enabled us to construct a phylogenetic structure of V. parahaemolyticus and an evolutionary history of the pandemic group (clone of this pathogen.

  17. Bacillus cereus and related species.

    Drobniewski, F A

    1993-10-01

    Bacillus cereus is a gram-positive aerobic or facultatively anaerobic spore-forming rod. It is a cause of food poisoning, which is frequently associated with the consumption of rice-based dishes. The organism produces an emetic or diarrheal syndrome induced by an emetic toxin and enterotoxin, respectively. Other toxins are produced during growth, including phospholipases, proteases, and hemolysins, one of which, cereolysin, is a thiol-activated hemolysin. These toxins may contribute to the pathogenicity of B. cereus in nongastrointestinal disease. B. cereus isolated from clinical material other than feces or vomitus was commonly dismissed as a contaminant, but increasingly it is being recognized as a species with pathogenic potential. It is now recognized as an infrequent cause of serious nongastrointestinal infection, particularly in drug addicts, the immunosuppressed, neonates, and postsurgical patients, especially when prosthetic implants such as ventricular shunts are inserted. Ocular infections are the commonest types of severe infection, including endophthalmitis, panophthalmitis, and keratitis, usually with the characteristic formation of corneal ring abscesses. Even with prompt surgical and antimicrobial agent treatment, enucleation of the eye and blindness are common sequelae. Septicemia, meningitis, endocarditis, osteomyelitis, and surgical and traumatic wound infections are other manifestations of severe disease. B. cereus produces beta-lactamases, unlike Bacillus anthracis, and so is resistant to beta-lactam antibiotics; it is usually susceptible to treatment with clindamycin, vancomycin, gentamicin, chloramphenicol, and erythromycin. Simultaneous therapy via multiple routes may be required.

  18. Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

    Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

    2016-01-01

    Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

  19. Group sparse canonical correlation analysis for genomic data integration.

    Lin, Dongdong; Zhang, Jigang; Li, Jingyao; Calhoun, Vince D; Deng, Hong-Wen; Wang, Yu-Ping

    2013-08-12

    The emergence of high-throughput genomic datasets from different sources and platforms (e.g., gene expression, single nucleotide polymorphisms (SNP), and copy number variation (CNV)) has greatly enhanced our understandings of the interplay of these genomic factors as well as their influences on the complex diseases. It is challenging to explore the relationship between these different types of genomic data sets. In this paper, we focus on a multivariate statistical method, canonical correlation analysis (CCA) method for this problem. Conventional CCA method does not work effectively if the number of data samples is significantly less than that of biomarkers, which is a typical case for genomic data (e.g., SNPs). Sparse CCA (sCCA) methods were introduced to overcome such difficulty, mostly using penalizations with l-1 norm (CCA-l1) or the combination of l-1and l-2 norm (CCA-elastic net). However, they overlook the structural or group effect within genomic data in the analysis, which often exist and are important (e.g., SNPs spanning a gene interact and work together as a group). We propose a new group sparse CCA method (CCA-sparse group) along with an effective numerical algorithm to study the mutual relationship between two different types of genomic data (i.e., SNP and gene expression). We then extend the model to a more general formulation that can include the existing sCCA models. We apply the model to feature/variable selection from two data sets and compare our group sparse CCA method with existing sCCA methods on both simulation and two real datasets (human gliomas data and NCI60 data). We use a graphical representation of the samples with a pair of canonical variates to demonstrate the discriminating characteristic of the selected features. Pathway analysis is further performed for biological interpretation of those features. The CCA-sparse group method incorporates group effects of features into the correlation analysis while performs individual feature

  20. Conserved genomic organisation of Group B Sox genes in insects.

    Woerfel Gertrud

    2005-05-01

    Full Text Available Abstract Background Sox domain containing genes are important metazoan transcriptional regulators implicated in a wide rage of developmental processes. The vertebrate B subgroup contains the Sox1, Sox2 and Sox3 genes that have early functions in neural development. Previous studies show that Drosophila Group B genes have been functionally conserved since they play essential roles in early neural specification and mutations in the Drosophila Dichaete and SoxN genes can be rescued with mammalian Sox genes. Despite their importance, the extent and organisation of the Group B family in Drosophila has not been fully characterised, an important step in using Drosophila to examine conserved aspects of Group B Sox gene function. Results We have used the directed cDNA sequencing along with the output from the publicly-available genome sequencing projects to examine the structure of Group B Sox domain genes in Drosophila melanogaster, Drosophila pseudoobscura, Anopheles gambiae and Apis mellifora. All of the insect genomes contain four genes encoding Group B proteins, two of which are intronless, as is the case with vertebrate group B genes. As has been previously reported and unusually for Group B genes, two of the insect group B genes, Sox21a and Sox21b, contain introns within their DNA-binding domains. We find that the highly unusual multi-exon structure of the Sox21b gene is common to the insects. In addition, we find that three of the group B Sox genes are organised in a linked cluster in the insect genomes. By in situ hybridisation we show that the pattern of expression of each of the four group B genes during embryogenesis is conserved between D. melanogaster and D. pseudoobscura. Conclusion The DNA-binding domain sequences and genomic organisation of the group B genes have been conserved over 300 My of evolution since the last common ancestor of the Hymenoptera and the Diptera. Our analysis suggests insects have two Group B1 genes, SoxN and

  1. Germination of Bacillus cereus spores : the role of germination receptors

    Hornstra, L.M.

    2007-01-01

    The Bacillus cereus sensu lato group forms a highly homogeneous subdivision of the genus Bacillus and comprises several species that are relevant for humans. Notorious is Bacillus anthracis, the cause of the often-lethal disease anthrax, while the insect pathogen Bacillus

  2. Molecular Epidemiology and Genomics of Group A Streptococcus

    Bessen, Debra E.; McShan, W. Michael; Nguyen, Scott V.; Shetty, Amol; Agrawal, Sonia; Tettelin, Hervé

    2014-01-01

    Streptococcus pyogenes (group A streptococcus; GAS) is a strict human pathogen with a very high prevalence worldwide. This review highlights the genetic organization of the species and the important ecological considerations that impact its evolution. Recent advances are presented on the topics of molecular epidemiology, population biology, molecular basis for genetic change, genome structure and genetic flux, phylogenomics and closely related streptococcal species, and the long- and short-term evolution of GAS. The application of whole genome sequence data to addressing key biological questions is discussed. PMID:25460818

  3. Bacillus cereus and related species.

    Drobniewski, F A

    1993-01-01

    Bacillus cereus is a gram-positive aerobic or facultatively anaerobic spore-forming rod. It is a cause of food poisoning, which is frequently associated with the consumption of rice-based dishes. The organism produces an emetic or diarrheal syndrome induced by an emetic toxin and enterotoxin, respectively. Other toxins are produced during growth, including phospholipases, proteases, and hemolysins, one of which, cereolysin, is a thiol-activated hemolysin. These toxins may contribute to the pa...

  4. Bacillus cereus in free-stall bedding.

    Magnusson, M; Svensson, B; Kolstrup, C; Christiansson, A

    2007-12-01

    To increase the understanding of how different factors affect the bacterial growth in deep sawdust beds for dairy cattle, the microbiological status of Bacillus cereus and coliforms in deep sawdust-bedded free stalls was investigated over two 14-d periods on one farm. High counts of B. cereus and coliforms were found in the entire beds. On average, 4.1 log(10) B. cereus spores, 5.5 log(10) B. cereus, and 6.7 log(10) coliforms per gram of bedding could be found in the upper layers of the sawdust likely to be in contact with the cows' udders. The highest counts of B. cereus spores, B. cereus, and coliforms were found in the bedding before fresh bedding was added, and the lowest immediately afterwards. Different factors of importance for the growth of B. cereus in the bedding material were explored in laboratory tests. These were found to be the type of bedding, pH, and the type and availability of nutrients. Alternative bedding material such as peat and mixtures of peat and sawdust inhibited the bacterial growth of B. cereus. The extent of growth of B. cereus in the sawdust was increased in a dose-dependent manner by the availability of feces. Urine added to different bedding material raised the pH and also led to bacterial growth of B. cereus in the peat. In sawdust, a dry matter content greater than 70% was needed to lower the water activity to 0.95, which is needed to inhibit the growth of B. cereus. In an attempt to reduce the bacterial growth of B. cereus and coliforms in deep sawdust beds on the farm, the effect of giving bedding daily or a full replacement of the beds was studied. The spore count of B. cereus in the back part of the free stalls before fresh bedding was added was 0.9 log units lower in stalls given daily bedding than in stalls given bedding twice weekly. No effect on coliform counts was found. Replacement of the entire sawdust bedding had an effect for a short period, but by 1 to 2 mo after replacement, the counts of B. cereus spores in the

  5. Proteomic evidences for rex regulation of metabolism in toxin-producing Bacillus cereus ATCC 14579.

    Sabrina Laouami

    Full Text Available The facultative anaerobe, Bacillus cereus, causes diarrheal diseases in humans. Its ability to deal with oxygen availability is recognized to be critical for pathogenesis. The B. cereus genome comprises a gene encoding a protein with high similarities to the redox regulator, Rex, which is a central regulator of anaerobic metabolism in Bacillus subtilis and other Gram-positive bacteria. Here, we showed that B. cereus rex is monocistronic and down-regulated in the absence of oxygen. The protein encoded by rex is an authentic Rex transcriptional factor since its DNA binding activity depends on the NADH/NAD+ ratio. Rex deletion compromised the ability of B. cereus to cope with external oxidative stress under anaerobiosis while increasing B. cereus resistance against such stress under aerobiosis. The deletion of rex affects anaerobic fermentative and aerobic respiratory metabolism of B. cereus by decreasing and increasing, respectively, the carbon flux through the NADH-recycling lactate pathway. We compared both the cellular proteome and exoproteome of the wild-type and Δrex cells using a high throughput shotgun label-free quantitation approach and identified proteins that are under control of Rex-mediated regulation. Proteomics data have been deposited to the ProteomeXchange with identifier PXD000886. The data suggest that Rex regulates both the cross-talk between metabolic pathways that produce NADH and NADPH and toxinogenesis, especially in oxic conditions.

  6. Influence of multi-year Bacillus thuringiensis subsp. israelensis on the abundance of B. cereus group populations in Swedish riparian wetland soils

    Hendriksen, Niels Bohse; Schneider, Salome; Tajrin, Tania

    -term Bti application affects the structure of indigenous Bcg communities as well as the overall abundance of Bti. Based on new primers, group-specific quantitative PCR assays for Bcg and Bti in environmental samples were developed. On six occasions during the vegetation season, soil samples were collected...

  7. One-day pulsed-field gel electrophoresis protocol for rapid determination of emetic Bacillus cereus isolates.

    Kaminska, Paulina S; Fiedoruk, Krzysztof; Jankowska, Dominika; Mahillon, Jacques; Nowosad, Karol; Drewicka, Ewa; Zambrzycka, Monika; Swiecicka, Izabela

    2015-04-01

    Bacillus cereus, the Gram-positive and spore-forming ubiquitous bacterium, may cause emesis as the result of food intoxication with cereulide, a heat-stable emetic toxin. Rapid determination of cereulide-positive B. cereus isolates is of highest importance due to consequences of this intoxication for human health and life. Here we present a 1-day pulsed-field gel electrophoresis for emetic B. cereus isolates, which allows rapid and efficient determination of their genomic relatedness and helps determining the source of intoxication in case of outbreaks caused by these bacilli. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The YvfTU Two-component System is involved in plcR expression in Bacillus cereus

    Brillard, Julien; Susanna, Kim; Michaud, Caroline; Dargaignaratz, Claire; Gohar, Michel; Nielsen-Leroux, Christina; Ramarao, Nalini; Kolsto, Anne-Brit; Nguyen-The, Christophe; Lereclus, Didier; Broussolle, Veronique

    2008-01-01

    Background: Most extracellular virulence factors produced by Bacillus cereus are regulated by the pleiotropic transcriptional activator PlcR. Among strains belonging to the B. cereus group, the plcR gene is always located in the vicinity of genes encoding the YvfTU two-component system. The putative

  9. [Characteristics of Bacillus cereus dissociants].

    Doroshenko, E V; Loĭko, N G; Il'inskaia, O N; Kolpakov, A I; Gornova, I B; Klimanova, E V; El'-Registan, G I

    2001-01-01

    The autoregulation of the phenotypic (populational) variability of the Bacillus cereus strain 504 was studied. The isolated colonial morphotypes of this bacterium were found to differ in their growth characteristics and the synthesis of extracellular proteases. The phenotypic variabilities of vegetative proliferating cells and those germinated from endospores and cystlike refractory cells were different. Bacterial variants also differed in the production of the d1 and d2 factors (the autoinducers of dormancy and autolysis, respectively) and sensitivity to them. The possible role of these factors in the dissociation of microorganisms is discussed.

  10. Fate of pathogenic Bacillus cereus spores after ingestion by protist grazers

    Winding, Anne; Santos, Susana; Hendriksen, Niels Bohse

    The aim of this study is to understand the symbiosis between bacterivorous protists and pathogenic bacterial spores, in order to gain insight on survival and dispersal of pathogenic bacteria in the environment. It is generally accepted that resistance to grazing by protists has contributed...... to the evolution of Bacillus cereus group bacteria (e.g. B. cereus, B. anthracis, B. thuringiensis) as a pathogen. It has been hypothesized that the spore stage protects against digestion by predating protists. Indeed, B. thuringiensis spores have been shown to be readily ingested by ciliated protists but failed...... to be digested (Manasherob et al 1998 AEM 64:1750-). Here we report how diverse protist grazers grow on both vegetative cells and spores of B. cereus and how the bacteria survive ingestion and digestion, and even proliferate inside the digestive vacuoles of ciliated protists. The survival ability of B. cereus...

  11. Comparative transcriptomic and phenotypic analysis of the responses of Bacillus cereus to various disinfectant treatments

    Ceragioli, M.; Mols, J.M.; Moezelaar, R.; Ghelardi, E.; Senesi, S.; Abee, T.

    2010-01-01

    Antimicrobial chemicals are widely applied to clean and disinfect food-contacting surfaces. However, the cellular response of bacteria to various disinfectants is unclear. In this study, the physiological and genome-wide transcriptional responses of Bacillus cereus ATCC 14579 exposed to four

  12. Toxin production ability of Bacillus cereus strains from food product of Ukraine

    I. Pylypenko

    2017-10-01

    Full Text Available Potential pathogens of foodborne toxic infections – bacterial contaminants Bacillus cereus isolated from plant raw materials and food products from the Ukrainian region were investigated. When determining of the proportion of isolated bacilli from the plant samples, it was established that the epidemiologically significant microorganisms of Bacillus cereus as agents of food poisoning are the second largest. The average value of contaminated samples of Ukrainian plant raw materials and processed products with Bacillus cereus is 36,2 %. The ability of Bacillus cereus strains identified by a complex of morphological, tinctorial, cultural and biochemical properties, to produce specific emetic and enterotoxins was studied. Molecular genetic diagnosis and detection of the toxin-producing ability of isolated 42 Bacillus cereus strains showed both the possibility of their rapid identification and the presence of specific toxicity genes. Multiplex polymerase chain reaction (PCR was carried out with specific primers to detect toxicity determined of various bacilli genes: nheA, hblD, cytK, cesВ. The distribution of toxigenic genes is significantly different among the Bacillus cereus isolates from various sources. The nheA, hblD and cytK enterotoxin genes were detected in 100, 83,3 and 61,9 % of the investigated strains of Bacillus cereus, respectively. The cesB gene encoding emetic toxin was detected in 4,8 % of  strains. Molecular-genetic PCR-method confirmed that all the isolated strains belong to the Bacillus cereus group, and the ability to produce toxins can be attributed to five groups. The main toxins that produce the investigated Bacillus cereus strains were nhe and hbl enterotoxins encoded by the corresponding genes of nheA and hblD. The enterotoxic type of Bacillus cereus was predominant in Ukrainian region.  Studies of domestic plant food raw materials and products have confirmed the need to improve microbiological control of product safety

  13. Growth of Bacillus cereus isolated from some traditional condiments ...

    USER

    2010-04-05

    Apr 5, 2010 ... (Kalogridou-vassiliodou, 1992) and food poisoning (Ynte et al., 2004). ... public health concern. B. cereus ... Effect of temperature on growth of Bacillus cereus. 5 ml sterile ..... Olutiola PO, Famurewa O, Sonntang HG (1991).

  14. Growth of Bacillus cereus isolated from some traditional condiments ...

    Growth of Bacillus cereus isolated from some traditional condiments under different regimens. ... African Journal of Biotechnology ... (fermented Prosopis africana seeds) and identified as B. cereus, B. subtilis, B. pumilus and B. lichenifomis.

  15. Cleaning and Disinfection of Bacillus cereus Biofilm.

    Deal, Amanda; Klein, Dan; Lopolito, Paul; Schwarz, John Spencer

    2016-01-01

    Methodology has been evolving for the testing of disinfectants against bacterial single-species biofilms, as the difficulty of biofilm remediation continues to gain much-needed attention. Bacterial single-species biofilm contamination presents a real risk to good manufacturing practice-regulated industries. However, mixed-species biofilms and biofilms containing bacterial spores remain an even greater challenge for cleaning and disinfection. Among spore-forming microorganisms frequently encountered in pharmaceutical manufacturing areas, the spores of Bacillus cereus are often determined to be the hardest to disinfect and eradicate. One of the reasons for the low degree of susceptibility to disinfection is the ability of these spores to be encapsulated within an exopolysachharide biofilm matrix. In this series of experiments, we evaluated the disinfectant susceptibility of B. cereus biofilms relative to disassociated B. cereus spores and biofilm from a non-spore-forming species. Further, we assessed the impact that pre-cleaning has on increasing that susceptibility. Methodology has been evolving for the testing of disinfectants against bacterial single-species biofilms, as the difficulty of biofilm remediation continues to gain much-needed attention. Bacterial single-species biofilm contamination presents a real risk to good manufacturing practice-regulated industries. However, mixed-species biofilms and biofilms containing bacterial spores remain an even greater challenge for cleaning and disinfection. Among spore-forming microorganisms frequently encountered in pharmaceutical manufacturing areas, the spores of Bacillus cereus are often determined to be the hardest to disinfect and eradicate. One of the reasons for the low degree of susceptibility to disinfection is the ability of these spores to be encapsulated within an exopolysachharide biofilm matrix. In this series of experiments, we evaluated the disinfectant susceptibility of B. cereus biofilms relative to

  16. Bacillus Cereus catheter related bloodstream infection in a patient in a patient with acute lymphblastic leukemia

    Lütfiye Öksüz

    2012-01-01

    Full Text Available Bacillus cereus infection is rarely associated with actual infection and for this reason single positive blood culture is usually regarded as contamination . However it may cause a number of infections, such catheter-related blood stream infections. Significant catheter-related bloodstream infections (CRBSI caused by Bacillus spp. are mainly due to B.cereus and have been predominantly reported in immunocompromised hosts1 . Catheter removal is generally advised for management of infection. In this report, catheter-related bacteremia caused by B.cereus in a patient with acute lymphoblastıc leukemia (ALL in Istanbul Medical Faculty was presented.A 44-year old man presented with fatigue, weight loss, epistaxis and high fever. A double-lumen Hickman–catheter (Bard 12.0 Fr, Round Dual Lumen was inserted by surgical cut-down to access the right subclavian vein which would be necessary for allogeneic stem cell transplantation. Three weeks later the patient presented with high fever and headache. Bacillus spp. was isolated from the cathether while blood culture obtained from the peripheral vein remained negative. The bacterial identification was confirmed as B.cereus using VITEK identification system It has been reported Bacillus cereus septicemia may be fatal in immunocompromised hosts despite broad-spectrum appropriate treatment10. Catheter removal is essential for prevention of recurrent bacteremia. Long-term cathater salvage should be reserved for appropriate patient group.

  17. Diagnostic properties of three conventional selective plating media for selection of Bacillus cereus, B. thuringiensis and B. weihenstephanensis

    Hendriksen, Niels Bohse; Hansen, Bjarne Munk

    2011-01-01

    The aim of this study was to assess the diagnostic properties of the two selective plating media and a chromogenic medium for identification of Bacillus cereus. The 324 isolates were B. cereus (37%), Bacillus weihenstephanensis (45%) or Bacillus thuringiensis (18%), as identified by a new...... combination of techniques. All isolates were growing on mannitol–egg yolk–polymyxin agar (MYP), and they did not form acid from mannitol. However, a significant lower number of B. thuringiensis isolates did not show lecithinase activity. All isolates were also growing on polymyxin–egg yolk...... recommended selective plating media MYP and PEMBA for detection of B. cereus group bacteria both have their limitations for identification of some B. cereus, B. weihenstephanensis or B. thuringiensis. However, MYP is preferable compared to PEMBA. The chromogenic medium has its own advantages and limitations...

  18. Time to B. cereus about hot chocolate.

    Nelms, P K; Larson, O; Barnes-Josiah, D

    1997-01-01

    To determine the cause of illnesses experienced by employees of a Minneapolis manufacturing plant after drinking hot chocolate bought from a vending machine and to explore the prevalence of similar vending machine-related illnesses. The authors inspected the vending machines at the manufacturing plant where employees reported illnesses and at other locations in the city where hot chocolate beverages were sold in machines. Tests were performed on dry mix, water, and beverage samples and on machine parts. Laboratory analyses confirmed the presence of B. cereus in dispensed beverages at a concentration capable of causing illness (170,000 count/gm). In citywide testing of vending machines dispensing hot chocolate, 7 of the 39 licensed machines were found to be contaminated, with two contaminated machines having B. cereus levels capable of causing illness. Hot chocolate sold in vending machines may contain organisms capable of producing toxins that under favorable conditions, can induce illness. Such illnesses are likely to be underreported. Even low concentrations of B. cereus may be dangerous for vulnerable populations such as the aged or immunosuppressed. Periodic testing of vending machines is thus warranted. The relationship between cleaning practices and B. cereus contamination is an issue for further study.

  19. Production of nanodrug for Bacillus cereus isolated from HIV positive patient using Mallotus philippensis

    R. Bhuvaneswari

    2016-04-01

    Full Text Available The present investigation was aimed to synthesis of silver nanoparticles (AgNPs using Mallotus philippensis leaf extract and their antibacterial potential against Bacillus cereus isolated from HIV positive patient. In this, UV- Visible spectroscopy showed the high peak of absorption band at 450 nm. Based on XRD analysis, face centered cubic structure and average size of the AgNPs was around 16 nm. FTIR spectroscopy study revealed the seventeen functional groups of the AgNPs was observed. The morphology of AgNPs was spherical, oval shapes and diameter of the particle size ranges between 9 and 24 nm was measured using transmission electron microscopy (TEM. In addition to these green synthesized AgNPs were found to express the higher efficacy in inhibiting the growth of Bacillus cereus (B. cereus isolated from the HIV-positive patient.

  20. Genomic signatures of evolutionary transitions from solitary to group living

    Kapheim, Karen M.; Pan, Hailin; Li, Cai; Salzberg, Steven L.; Puiu, Daniela; Magoc, Tanja; Robertson, Hugh M.; Hudson, Matthew E.; Venkat, Aarti; Fischman, Brielle J.; Hernandez, Alvaro; Yandell, Mark; Ence, Daniel; Holt, Carson; Yocum, George D.; Kemp, William P.; Bosch, Jordi; Waterhouse, Robert M.; Zdobnov, Evgeny M.; Stolle, Eckart; Kraus, F. Bernhard; Helbing, Sophie; Moritz, Robin F. A.; Glastad, Karl M.; Hunt, Brendan G.; Goodisman, Michael A. D.; Hauser, Frank; Grimmelikhuijzen, Cornelis J. P.; Pinheiro, Daniel Guariz; Nunes, Francis Morais Franco; Soares, Michelle Prioli Miranda; Tanaka, Érica Donato; Simões, Zilá Luz Paulino; Hartfelder, Klaus; Evans, Jay D.; Barribeau, Seth M.; Johnson, Reed M.; Massey, Jonathan H.; Southey, Bruce R.; Hasselmann, Martin; Hamacher, Daniel; Biewer, Matthias; Kent, Clement F.; Zayed, Amro; Blatti, Charles; Sinha, Saurabh; Johnston, J. Spencer; Hanrahan, Shawn J.; Kocher, Sarah D.; Wang, Jun; Robinson, Gene E.; Zhang, Guojie

    2017-01-01

    The evolution of eusociality is one of the major transitions in evolution, but the underlying genomic changes are unknown. We compared the genomes of 10 bee species that vary in social complexity, representing multiple independent transitions in social evolution, and report three major findings. First, many important genes show evidence of neutral evolution as a consequence of relaxed selection with increasing social complexity. Second, there is no single road map to eusociality; independent evolutionary transitions in sociality have independent genetic underpinnings. Third, though clearly independent in detail, these transitions do have similar general features, including an increase in constrained protein evolution accompanied by increases in the potential for gene regulation and decreases in diversity and abundance of transposable elements. Eusociality may arise through different mechanisms each time, but would likely always involve an increase in the complexity of gene networks. PMID:25977371

  1. Contrasting evolutionary patterns of spore coat proteins in two Bacillus species groups are linked to a difference in cellular structure

    2013-01-01

    Background The Bacillus subtilis-group and the Bacillus cereus-group are two well-studied groups of species in the genus Bacillus. Bacteria in this genus can produce a highly resistant cell type, the spore, which is encased in a complex protective protein shell called the coat. Spores in the B. cereus-group contain an additional outer layer, the exosporium, which encircles the coat. The coat in B. subtilis spores possesses inner and outer layers. The aim of this study is to investigate whether differences in the spore structures influenced the divergence of the coat protein genes during the evolution of these two Bacillus species groups. Results We designed and implemented a computational framework to compare the evolutionary histories of coat proteins. We curated a list of B. subtilis coat proteins and identified their orthologs in 11 Bacillus species based on phylogenetic congruence. Phylogenetic profiles of these coat proteins show that they can be divided into conserved and labile ones. Coat proteins comprising the B. subtilis inner coat are significantly more conserved than those comprising the outer coat. We then performed genome-wide comparisons of the nonsynonymous/synonymous substitution rate ratio, dN/dS, and found contrasting patterns: Coat proteins have significantly higher dN/dS in the B. subtilis-group genomes, but not in the B. cereus-group genomes. We further corroborated this contrast by examining changes of dN/dS within gene trees, and found that some coat protein gene trees have significantly different dN/dS between the B subtilis-clade and the B. cereus-clade. Conclusions Coat proteins in the B. subtilis- and B. cereus-group species are under contrasting selective pressures. We speculate that the absence of the exosporium in the B. subtilis spore coat effectively lifted a structural constraint that has led to relaxed negative selection pressure on the outer coat. PMID:24283940

  2. Comparative Genomics of the Bacterial Genus Streptococcus Illuminates Evolutionary Implications of Species Groups

    Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; Klenk, Hans-Peter; Li, Wen-Jun

    2014-01-01

    Members of the genus Streptococcus within the phylum Firmicutes are among the most diverse and significant zoonotic pathogens. This genus has gone through considerable taxonomic revision due to increasing improvements of chemotaxonomic approaches, DNA hybridization and 16S rRNA gene sequencing. It is proposed to place the majority of streptococci into “species groups”. However, the evolutionary implications of species groups are not clear presently. We use comparative genomic approaches to yield a better understanding of the evolution of Streptococcus through genome dynamics, population structure, phylogenies and virulence factor distribution of species groups. Genome dynamics analyses indicate that the pan-genome size increases with the addition of newly sequenced strains, while the core genome size decreases with sequential addition at the genus level and species group level. Population structure analysis reveals two distinct lineages, one including Pyogenic, Bovis, Mutans and Salivarius groups, and the other including Mitis, Anginosus and Unknown groups. Phylogenetic dendrograms show that species within the same species group cluster together, and infer two main clades in accordance with population structure analysis. Distribution of streptococcal virulence factors has no obvious patterns among the species groups; however, the evolution of some common virulence factors is congruous with the evolution of species groups, according to phylogenetic inference. We suggest that the proposed streptococcal species groups are reasonable from the viewpoints of comparative genomics; evolution of the genus is congruent with the individual evolutionary trajectories of different species groups. PMID:24977706

  3. Prevalence of potentially pathogenic Bacillus cereus in food commodities in The Netherlands

    Wijnands, L.M.; Dufrenne, J.B.; Rombouts, F.M.; Veld, in 't P.H.; Leusden, van F.M.

    2006-01-01

    Randomly selected food commodities, categorized in product groups, were investigated for the presence and number of Bacillus cereus bacteria. If positive, and when possible, five separate colonies were isolated and investigated for the presence of four virulence factors: presence of genes encoding

  4. Butanol production under microaerobic conditions with a symbiotic system of Clostridium acetobutylicum and Bacillus cereus.

    Wu, Pengfei; Wang, Genyu; Wang, Gehua; Børresen, Børre Tore; Liu, Hongjuan; Zhang, Jianan

    2016-01-14

    One major problem of ABE (acetone, butanol and ethanol) fermentation is high oxygen sensitivity of Clostridium acetobutylicum. Currently, no single strain has been isolated or genetically engineered to produce butanol effectively under aerobic conditions. In our previous work, a symbiotic system TSH06 has been developed successfully by our group, and two strains, C. acetobutylicum TSH1 and Bacillus cereus TSH2, were isolated from TSH06. Compared with single culture, TSH06 showed promotion on cell growth and solvent accumulation under microaerobic conditions. To simulate TSH06, a new symbiotic system was successfully re-constructed by adding living cells of B. cereus TSH2 into C. acetobutylicum TSH1 cultures. During the fermentation process, the function of B. cereus TSH2 was found to deplete oxygen and provide anaerobic environment for C. acetobutylicum TSH1. Furthermore, inoculation ratio of C. acetobutylicum TSH1 and B. cereus TSH2 affected butanol production. In a batch fermentation with optimized inoculation ratio of 5 % C. acetobutylicum TSH1 and 0.5 % B. cereus TSH2, 11.0 g/L butanol and 18.1 g/L ABE were produced under microaerobic static condition. In contrast to the single culture of C. acetobutylicum TSH1, the symbiotic system became more aerotolerant and was able to produce 11.2 g/L butanol in a 5 L bioreactor even with continuous 0.15 L/min air sparging. In addition, qPCR assay demonstrated that the abundance of B. cereus TSH2 increased quickly at first and then decreased sharply to lower than 1 %, whereas C. acetobutylicum TSH1 accounted for more than 99 % of the whole population in solventogenic phase. The characterization of a novel symbiotic system on butanol fermentation was studied. The new symbiotic system re-constructed by co-culture of C. acetobutylicum TSH1 and B. cereus TSH2 showed excellent performance on butanol production under microaerobic conditions. B. cereus TSH2 was a good partner for C. acetobutylicum TSH1 by providing an anaerobic

  5. Comparison of hand hygiene procedures for removing Bacillus cereus spores.

    Sasahara, Teppei; Hayashi, Shunji; Hosoda, Kouichi; Morisawa, Yuji; Hirai, Yoshikazu

    2014-01-01

    Bacillus cereus is a spore-forming bacterium. B. cereus occasionally causes nosocomial infections, in which hand contamination with the spores plays an important role. Therefore, hand hygiene is the most important practice for controlling nosocomial B. cereus infections. This study aimed to determine the appropriate hand hygiene procedure for removing B. cereus spores. Thirty volunteers' hands were experimentally contaminated with B. cereus spores, after which they performed 6 different hand hygiene procedures. We compared the efficacy of the procedures in removing the spores from hands. The alcohol-based hand-rubbing procedures scarcely removed them. The soap washing procedures reduced the number of spores by more than 2 log10. Extending the washing time increased the spore-removing efficacy of the washing procedures. There was no significant difference in efficacy between the use of plain soap and antiseptic soap. Handwashing with soap is appropriate for removing B. cereus spores from hands. Alcohol-based hand-rubbing is not effective.

  6. Alignment-free genome tree inference by learning group-specific distance metrics.

    Patil, Kaustubh R; McHardy, Alice C

    2013-01-01

    Understanding the evolutionary relationships between organisms is vital for their in-depth study. Gene-based methods are often used to infer such relationships, which are not without drawbacks. One can now attempt to use genome-scale information, because of the ever increasing number of genomes available. This opportunity also presents a challenge in terms of computational efficiency. Two fundamentally different methods are often employed for sequence comparisons, namely alignment-based and alignment-free methods. Alignment-free methods rely on the genome signature concept and provide a computationally efficient way that is also applicable to nonhomologous sequences. The genome signature contains evolutionary signal as it is more similar for closely related organisms than for distantly related ones. We used genome-scale sequence information to infer taxonomic distances between organisms without additional information such as gene annotations. We propose a method to improve genome tree inference by learning specific distance metrics over the genome signature for groups of organisms with similar phylogenetic, genomic, or ecological properties. Specifically, our method learns a Mahalanobis metric for a set of genomes and a reference taxonomy to guide the learning process. By applying this method to more than a thousand prokaryotic genomes, we showed that, indeed, better distance metrics could be learned for most of the 18 groups of organisms tested here. Once a group-specific metric is available, it can be used to estimate the taxonomic distances for other sequenced organisms from the group. This study also presents a large scale comparison between 10 methods--9 alignment-free and 1 alignment-based.

  7. Phage morphology recapitulates phylogeny: the comparative genomics of a new group of myoviruses.

    André M Comeau

    Full Text Available Among dsDNA tailed bacteriophages (Caudovirales, members of the Myoviridae family have the most sophisticated virion design that includes a complex contractile tail structure. The Myoviridae generally have larger genomes than the other phage families. Relatively few "dwarf" myoviruses, those with a genome size of less than 50 kb such as those of the Mu group, have been analyzed in extenso. Here we report on the genome sequencing and morphological characterization of a new group of such phages that infect a diverse range of Proteobacteria, namely Aeromonas salmonicida phage 56, Vibrio cholerae phages 138 and CP-T1, Bdellovibrio phage φ1422, and Pectobacterium carotovorum phage ZF40. This group of dwarf myoviruses shares an identical virion morphology, characterized by usually short contractile tails, and have genome sizes of approximately 45 kb. Although their genome sequences are variable in their lysogeny, replication, and host adaption modules, presumably reflecting differing lifestyles and hosts, their structural and morphogenesis modules have been evolutionarily constrained by their virion morphology. Comparative genomic analysis reveals that these phages, along with related prophage genomes, form a new coherent group within the Myoviridae. The results presented in this communication support the hypothesis that the diversity of phages may be more structured than generally believed and that the innumerable phages in the biosphere all belong to discrete lineages or families.

  8. To Determine the Frequency of Bacillus cereus in Powdered Milk Infant Formula Consuming in Neonatal Intensive Care Unit (NICU in Tehran Hospitals in 2013-14

    Mohammad Mehdi Soltan Dallal

    2017-01-01

    Full Text Available Background: In recent years, changing the infant feeding methods and the growing trend of use powdered infant formula (PIF has raised concern about quality and health assessment among them. These products are contaminated with various pathogenic bacteria such as Bacillus cereus which the presence of this bacteria in PIF is important because of consumer age group and virulence of this bacteria in PIF. The aim of this study was to determine the frequency of Bacillus cereus in powdered milk infant formula consuming in neonatal intensive care unit (NICU in Tehran hospitals in 2013-14. Material and Methods: In this cross-sectional study, 125 samples of powdered infant formula milk which were used in Neonatal Intensive Care Unit (NICU were surveyed during 8 month in 2014. Isolation and identification of microorganisms (including Bacillus cereus were carried out according to FDA standard protocol (FDA method on B. cereus selective agar (MYP Agar.   Results: The results of present study showed that of 125 samples from of consumable powdered infant formula milk, 84 (67.2% samples were contaminated with B.cereus and also 18 (14.4% samples were contaminated by more than one B.cereus species. Conclusion: As regards pasteurization process is not effective on the spore of B.cereus., The spores of these bacteria can remain in PIF and can cause food poisoning in infants. For this purpose, more attention to quality control of production units and imported powder milk is recommended in Iranian infant foods.

  9. Prevalence of enterotoxigenic Bacillus Cereus and Its enterotoxins ...

    Objectives: To determine the prevalence of enterotoxigenic Bacillus cereus (B. cereus) and enterotoxins in milk and milk products. Design: A random sampling of milk products was carried out. Setting: Market milk and milk products were collected from retail shops in Nairobi and analysed for contamination with ...

  10. Identification of multidrug-resistant bacteria and Bacillus cereus from ...

    However, B. cereus was isolated from the hands of three. HCWs. Table 1 shows species of bacteria isolated from. HCWs and ES in Elkhomes hospital. B. cereus is a Gram-positive spore-forming facultative- anaerobic rod-shaped organism that can be found in different types of soils and widely distributed in the environment.

  11. 'LABNOTE', a laboratory notebook system designed for academic genomics groups.

    Imbert, M C; Nguyen, V K; Granjeaud, S; Nguyen, C; Jordan, B R

    1999-01-15

    We have developed a relational laboratory database system, adapted to the daily book-keeping needs of laboratories that must keep track of information acquired on hundreds or thousands of clones in an effective and user-friendly fashion. Data, whether final or related to experiments in progress, can be accessed in many different ways, e.g. by clone name, by gene, by experiment or through DNA sequence. Updating, import and export of results is made easier by specially developed tools. This system, in network version, serves several groups in our Institute and (over the Internet) elsewhere, and is instrumental in collaborative studies based on expression profiling. It can be used in many similar situations involving progressiveaccumulation of information on sets of clones or related objects.

  12. Bacillus Cereus catheter related bloodstream infection in a patient in a patient with acute lymphblastic leukemia

    Lütfiye Öksüz

    2012-01-01

    Full Text Available

    Bacillus cereus infection is rarely associated with actual infection and for this reason single positive blood culture is usually regarded as contamination . However it may cause a number of infections, such catheter-related blood stream infections. Significant catheter-related bloodstream infections (CRBSI caused by Bacillus spp. are mainly due to B.cereus and have been predominantly reported in immunocompromised hosts1 . Catheter removal is generally advised for management of infection. In this report, catheter-related bacteremia caused by B.cereus in a patient with acute lymphoblastıc leukemia (ALL in Istanbul Medical Faculty was presented.A 44-year old man presented with fatigue, weight loss, epistaxis and high fever. A double-lumen Hickman–catheter (Bard 12.0 Fr, Round Dual Lumen was inserted by surgical cut-down to access the right subclavian vein which would be necessary for allogeneic stem cell transplantation. Three weeks later the patient presented with high fever and headache. Bacillus spp. was isolated from the cathether while blood culture obtained from the peripheral vein remained negative. The bacterial identification was confirmed as B.cereus using VITEK identification system

    It has been reported Bacillus cereus septicemia may be fatal in immunocompromised hosts despite broad-spectrum appropriate treatment10. Catheter removal is essential for prevention of recurrent bacteremia. Long-term cathater salvage should be reserved for appropriate patient group.

  13. Novel giant siphovirus from Bacillus anthracis features unusual genome characteristics.

    Holly H Ganz

    Full Text Available Here we present vB_BanS-Tsamsa, a novel temperate phage isolated from Bacillus anthracis, the agent responsible for anthrax infections in wildlife, livestock and humans. Tsamsa phage is a giant siphovirus (order Caudovirales, featuring a long, flexible and non-contractile tail of 440 nm (not including baseplate structure and an isometric head of 82 nm in diameter. We induced Tsamsa phage in samples from two different carcass sites in Etosha National Park, Namibia. The Tsamsa phage genome is the largest sequenced Bacillus siphovirus, containing 168,876 bp and 272 ORFs. The genome features an integrase/recombinase enzyme, indicative of a temperate lifestyle. Among bacterial strains tested, the phage infected only certain members of the Bacillus cereus sensu lato group (B. anthracis, B. cereus and B. thuringiensis and exhibited moderate specificity for B. anthracis. Tsamsa lysed seven out of 25 B. cereus strains, two out of five B. thuringiensis strains and six out of seven B. anthracis strains tested. It did not lyse B. anthracis PAK-1, an atypical strain that is also resistant to both gamma phage and cherry phage. The Tsamsa endolysin features a broader lytic spectrum than the phage host range, indicating possible use of the enzyme in Bacillus biocontrol.

  14. StreptoBase: An Oral Streptococcus mitis Group Genomic Resource and Analysis Platform.

    Wenning Zheng

    Full Text Available The oral streptococci are spherical Gram-positive bacteria categorized under the phylum Firmicutes which are among the most common causative agents of bacterial infective endocarditis (IE and are also important agents in septicaemia in neutropenic patients. The Streptococcus mitis group is comprised of 13 species including some of the most common human oral colonizers such as S. mitis, S. oralis, S. sanguinis and S. gordonii as well as species such as S. tigurinus, S. oligofermentans and S. australis that have only recently been classified and are poorly understood at present. We present StreptoBase, which provides a specialized free resource focusing on the genomic analyses of oral species from the mitis group. It currently hosts 104 S. mitis group genomes including 27 novel mitis group strains that we sequenced using the high throughput Illumina HiSeq technology platform, and provides a comprehensive set of genome sequences for analyses, particularly comparative analyses and visualization of both cross-species and cross-strain characteristics of S. mitis group bacteria. StreptoBase incorporates sophisticated in-house designed bioinformatics web tools such as Pairwise Genome Comparison (PGC tool and Pathogenomic Profiling Tool (PathoProT, which facilitate comparative pathogenomics analysis of Streptococcus strains. Examples are provided to demonstrate how StreptoBase can be employed to compare genome structure of different S. mitis group bacteria and putative virulence genes profile across multiple streptococcal strains. In conclusion, StreptoBase offers access to a range of streptococci genomic resources as well as analysis tools and will be an invaluable platform to accelerate research in streptococci. Database URL: http://streptococcus.um.edu.my.

  15. StreptoBase: An Oral Streptococcus mitis Group Genomic Resource and Analysis Platform.

    Zheng, Wenning; Tan, Tze King; Paterson, Ian C; Mutha, Naresh V R; Siow, Cheuk Chuen; Tan, Shi Yang; Old, Lesley A; Jakubovics, Nicholas S; Choo, Siew Woh

    2016-01-01

    The oral streptococci are spherical Gram-positive bacteria categorized under the phylum Firmicutes which are among the most common causative agents of bacterial infective endocarditis (IE) and are also important agents in septicaemia in neutropenic patients. The Streptococcus mitis group is comprised of 13 species including some of the most common human oral colonizers such as S. mitis, S. oralis, S. sanguinis and S. gordonii as well as species such as S. tigurinus, S. oligofermentans and S. australis that have only recently been classified and are poorly understood at present. We present StreptoBase, which provides a specialized free resource focusing on the genomic analyses of oral species from the mitis group. It currently hosts 104 S. mitis group genomes including 27 novel mitis group strains that we sequenced using the high throughput Illumina HiSeq technology platform, and provides a comprehensive set of genome sequences for analyses, particularly comparative analyses and visualization of both cross-species and cross-strain characteristics of S. mitis group bacteria. StreptoBase incorporates sophisticated in-house designed bioinformatics web tools such as Pairwise Genome Comparison (PGC) tool and Pathogenomic Profiling Tool (PathoProT), which facilitate comparative pathogenomics analysis of Streptococcus strains. Examples are provided to demonstrate how StreptoBase can be employed to compare genome structure of different S. mitis group bacteria and putative virulence genes profile across multiple streptococcal strains. In conclusion, StreptoBase offers access to a range of streptococci genomic resources as well as analysis tools and will be an invaluable platform to accelerate research in streptococci. Database URL: http://streptococcus.um.edu.my.

  16. Towards understanding the first genome sequence of a crenarchaeon by genome annotation using clusters of orthologous groups of proteins (COGs).

    Natale, D A; Shankavaram, U T; Galperin, M Y; Wolf, Y I; Aravind, L; Koonin, E V

    2000-01-01

    Standard archival sequence databases have not been designed as tools for genome annotation and are far from being optimal for this purpose. We used the database of Clusters of Orthologous Groups of proteins (COGs) to reannotate the genomes of two archaea, Aeropyrum pernix, the first member of the Crenarchaea to be sequenced, and Pyrococcus abyssi. A. pernix and P. abyssi proteins were assigned to COGs using the COGNITOR program; the results were verified on a case-by-case basis and augmented by additional database searches using the PSI-BLAST and TBLASTN programs. Functions were predicted for over 300 proteins from A. pernix, which could not be assigned a function using conventional methods with a conservative sequence similarity threshold, an approximately 50% increase compared to the original annotation. A. pernix shares most of the conserved core of proteins that were previously identified in the Euryarchaeota. Cluster analysis or distance matrix tree construction based on the co-occurrence of genomes in COGs showed that A. pernix forms a distinct group within the archaea, although grouping with the two species of Pyrococci, indicative of similar repertoires of conserved genes, was observed. No indication of a specific relationship between Crenarchaeota and eukaryotes was obtained in these analyses. Several proteins that are conserved in Euryarchaeota and most bacteria are unexpectedly missing in A. pernix, including the entire set of de novo purine biosynthesis enzymes, the GTPase FtsZ (a key component of the bacterial and euryarchaeal cell-division machinery), and the tRNA-specific pseudouridine synthase, previously considered universal. A. pernix is represented in 48 COGs that do not contain any euryarchaeal members. Many of these proteins are TCA cycle and electron transport chain enzymes, reflecting the aerobic lifestyle of A. pernix. Special-purpose databases organized on the basis of phylogenetic analysis and carefully curated with respect to known and

  17. Crystallization and preliminary crystallographic analysis of the NheA component of the Nhe toxin from Bacillus cereus

    Phung, Danh; Ganash, Magdah; Sedelnikova, Svetlana E.; Lindbäck, Toril; Granum, Per Einar; Artymiuk, Peter J.

    2012-01-01

    The NheA component of the B. cereus Nhe toxin was overexpressed in E. coli, purified and crystallized. Diffraction data were collected and processed to 2.05 Å resolution. The nonhaemolytic enterotoxin (Nhe) of Bacillus cereus plays a key role in cases of B. cereus food poisoning. The toxin is comprised of three different proteins: NheA, NheB and NheC. Here, the expression in Escherichia coli, purification and crystallization of the NheA protein are reported. The protein was crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The crystals of NheA diffracted to 2.05 Å resolution and belonged to space group C2, with unit-cell parameters a = 308.7, b = 58.2, c = 172.9 Å, β = 110.6°. Calculation of V M values suggests that there are approximately eight protein molecules per asymmetric unit

  18. Whole-genome phylogeny of Escherichia coli/Shigella group by feature frequency profiles (FFPs)

    Sims, Gregory E.; Kim, Sung-Hou

    2011-01-01

    A whole-genome phylogeny of the Escherichia coli/Shigella group was constructed by using the feature frequency profile (FFP) method. This alignment-free approach uses the frequencies of l-mer features of whole genomes to infer phylogenic distances. We present two phylogenies that accentuate different aspects of E. coli/Shigella genomic evolution: (i) one based on the compositions of all possible features of length l = 24 (∼8.4 million features), which are likely to reveal the phenetic grouping and relationship among the organisms and (ii) the other based on the compositions of core features with low frequency and low variability (∼0.56 million features), which account for ∼69% of all commonly shared features among 38 taxa examined and are likely to have genome-wide lineal evolutionary signal. Shigella appears as a single clade when all possible features are used without filtering of noncore features. However, results using core features show that Shigella consists of at least two distantly related subclades, implying that the subclades evolved into a single clade because of a high degree of convergence influenced by mobile genetic elements and niche adaptation. In both FFP trees, the basal group of the E. coli/Shigella phylogeny is the B2 phylogroup, which contains primarily uropathogenic strains, suggesting that the E. coli/Shigella ancestor was likely a facultative or opportunistic pathogen. The extant commensal strains diverged relatively late and appear to be the result of reductive evolution of genomes. We also identify clade distinguishing features and their associated genomic regions within each phylogroup. Such features may provide useful information for understanding evolution of the groups and for quick diagnostic identification of each phylogroup. PMID:21536867

  19. Whole-genome pyrosequencing of an epidemic multidrug-resistant Acinetobacter baumannii strain belonging to the European clone II group

    Iacono, M.; Villa, L.; Fortini, D.

    2008-01-01

    The whole-genome sequence of an epidemic, multidrug-resistant Acinetobacter baumannii strain (strain ACICU) belonging to the European clone II group and carrying the plasmid-mediated bla(OXA-58) carbapenem resistance gene was determined. The A. baumannii ACICU genome was compared with the genomes...

  20. Complete genome sequence of the bioleaching bacterium Leptospirillum sp. group II strain CF-1.

    Ferrer, Alonso; Bunk, Boyke; Spröer, Cathrin; Biedendieck, Rebekka; Valdés, Natalia; Jahn, Martina; Jahn, Dieter; Orellana, Omar; Levicán, Gloria

    2016-03-20

    We describe the complete genome sequence of Leptospirillum sp. group II strain CF-1, an acidophilic bioleaching bacterium isolated from an acid mine drainage (AMD). This work provides data to gain insights about adaptive response of Leptospirillum spp. to the extreme conditions of bioleaching environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. "Is It Worth Knowing?" Focus Group Participants' Perceived Utility of Genomic Preconception Carrier Screening.

    Schneider, Jennifer L; Goddard, Katrina A B; Davis, James; Wilfond, Benjamin; Kauffman, Tia L; Reiss, Jacob A; Gilmore, Marian; Himes, Patricia; Lynch, Frances L; Leo, Michael C; McMullen, Carmit

    2016-02-01

    As genome sequencing technology advances, research is needed to guide decision-making about what results can or should be offered to patients in different clinical settings. We conducted three focus groups with individuals who had prior preconception genetic testing experience to explore perceived advantages and disadvantages of genome sequencing for preconception carrier screening, compared to usual care. Using a discussion guide, a trained qualitative moderator facilitated the audio-recorded focus groups. Sixteen individuals participated. Thematic analysis of transcripts started with a grounded approach and subsequently focused on participants' perceptions of the value of genetic information. Analysis uncovered two orientations toward genomic preconception carrier screening: "certain" individuals desiring all possible screening information; and "hesitant" individuals who were more cautious about its value. Participants revealed valuable information about barriers to screening: fear/anxiety about results; concerns about the method of returning results; concerns about screening necessity; and concerns about partner participation. All participants recommended offering choice to patients to enhance the value of screening and reduce barriers. Overall, two groups of likely users of genome sequencing for preconception carrier screening demonstrated different perceptions of the advantages or disadvantages of screening, suggesting tailored approaches to education, consent, and counseling may be warranted with each group.

  2. Whole genome sequencing as a tool for phylogenetic analysis of clinical strains of Mitis group streptococci

    Rasmusen, L. H.; Dargis, R.; Iversen, Katrine Højholt

    2016-01-01

    observed in single gene analyses. Species identification based on single gene analysis showed their limitations when more strains were included. In contrast, analyses incorporating more sequence data, like MLSA, SNPs and core-genome analyses, provided more distinct clustering. The core-genome tree showed......Identification of Mitis group streptococci (MGS) to the species level is challenging for routine microbiology laboratories. Correct identification is crucial for the diagnosis of infective endocarditis, identification of treatment failure, and/or infection relapse. Eighty MGS from Danish patients...

  3. Purification, crystallization and preliminary X-ray crystallographic analysis of chitinase from Bacillus cereus NCTU2

    Kuo, Chueh-Yuan [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Wu, Yue-Jin [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Hsieh, Yin-Cheng; Guan, Hong-Hsiang [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Tsai, Huei-Ju [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Lin, Yi-Hung; Huang, Yen-Chieh; Liu, Ming-Yih [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Li, Yaw-Kuen, E-mail: ykl@cc.nctu.edu.tw [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Chen, Chun-Jung, E-mail: ykl@cc.nctu.edu.tw [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Department of Physics, National Tsing-Hua University, Hsinchu 30013,Taiwan (China)

    2006-09-01

    The crystallization of B. cereus chitinase is reported. Chitinases (EC 3.2.1.14) are found in a broad range of organisms, including bacteria, fungi and higher plants, and play different roles depending on their origin. A chitinase from Bacillus cereus NCTU2 (ChiNCTU2) capable of hydrolyzing chitin as a carbon and nitrogen nutrient has been identified as a member of the family 18 glycoside hydrolases. ChiNCTU2 of molecular weight 36 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of chitinase crystals at 1.10 Å resolution, the crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 50.79, b = 48.79, c = 66.87 Å, β = 99.31°. Preliminary analysis indicates there is one chitinase molecule in the asymmetric unit, with a solvent content of 43.4%.

  4. Adaptation in Bacillus cereus: from stress to disease

    Catherine Duport

    2016-10-01

    Full Text Available Bacillus cereus is a foodborne pathogen that causes diarrheal disease in humans. After ingestion B. cereus experiences in the human gastro-intestinal tract abiotic physical variables encountered in food, such as acidic pH in the stomach and changing oxygen conditions in the human intestine. B. cereus responds to environmental changing conditions (stress by reversibly adjusting its physiology to maximize resource utilization while maintaining structural and genetic integrity by repairing and minimizing damage to cellular infrastructure. As reviewed in this article, B. cereus adapts to acidic pH and changing oxygen conditions through diverse regulatory mechanisms and then exploits its metabolic flexibility to grow and produce enterotoxins. We then focus on the intricate link between metabolism, redox homeostasis and enterotoxins, which are recognized as important contributors of food-borne disease.

  5. effluent by bacillus cereus and clostridium butyricum using

    user

    Double-chambered MFCs was used for the study and operated ..... The third one is wire electron transfer, which uses ... phase indicates that the Bacillus cereus and Clostridium butyricum ..... Improving Start Up Performance With Carbon Mesh.

  6. Bacterial succession and metabolite changes during flax (Linum usitatissimum L.) retting with Bacillus cereus HDYM-02.

    Zhao, Dan; Liu, Pengfei; Pan, Chao; Du, Renpeng; Ping, Wenxiang; Ge, Jingping

    2016-09-02

    High-throughput sequencing and GC-MS (gas chromatography-mass spectrometry) were jointly used to reveal the bacterial succession and metabolite changes during flax (Linum usitatissimum L.) retting. The inoculation of Bacillus cereus HDYM-02 decreased bacterial richness and diversity. This inoculum led to the replacement of Enterobacteriaceae by Bacillaceae. The level of aerobic Pseudomonadaceae (mainly Azotobacter) and anaerobic Clostridiaceae_1 gradually increased and decreased, respectively. Following the addition of B. cereus HDYM-02, the dominant groups were all degumming enzyme producers or have been proven to be involved in microbial retting throughout the entire retting period. These results could be verified by the metabolite changes, either degumming enzymes or their catalytic products galacturonic acid and reducing sugars. The GC-MS data showed a clear separation between flax retting with and without B. cereus HDYM-02, particularly within the first 72 h. These findings reveal the important bacterial groups that are involved in fiber retting and will facilitate improvements in the retting process.

  7. Australians' views on personal genomic testing: focus group findings from the Genioz study.

    Metcalfe, Sylvia A; Hickerton, Chriselle; Savard, Jacqueline; Terrill, Bronwyn; Turbitt, Erin; Gaff, Clara; Gray, Kathleen; Middleton, Anna; Wilson, Brenda; Newson, Ainsley J

    2018-04-30

    Personal genomic testing provides healthy individuals with access to information about their genetic makeup for purposes including ancestry, paternity, sporting ability and health. Such tests are available commercially and globally, with accessibility expected to continue to grow, including in Australia; yet little is known of the views/expectations of Australians. Focus groups were conducted within a multi-stage, cross-disciplinary project (Genioz) to explore this. In mid-2015, 56 members of the public participated in seven focus groups, allocated into three age groups: 18-24, 25-49, and ≥50 years. Three researchers coded transcripts independently and generated themes. Awareness of personal genomic testing was low, but most could deduce what "personal genomics" might entail. Very few had heard of the term "direct-to-consumer" testing, which has implications for organisations developing information to support individuals in their decision-making. Participants' understanding of genetics was varied and drawn from several sources. There were diverse perceptions of the relative influence of genetics and environment on health, mental health, behavior, talent, or personality. Views about having a personal genomic test were mixed, with greater interest in health-related tests if they believed there was a reason for doing so. However, many expressed scepticisms about the types of tests available, and how the information might be used; concerns were also raised about privacy and the potential for discrimination. These exploratory findings inform subsequent stages of the Genioz study, thereby contributing to strategies of supporting Australians to understand and make meaningful and well-considered decisions about the benefits, harms, and implications of personal genomic tests.

  8. A genomic insight into diversity among tribal and nontribal population groups of Manipur, India.

    Saraswathy, K N; Kiranmala, Naorem; Murry, Benrithung; Sinha, Ekata; Saksena, Deepti; Kaur, Harpreet; Sachdeva, M P; Kalla, A K

    2009-10-01

    Twenty autosomal markers, including linked markers at two gene markers, are used to understand the genomic similarity and diversity among three tribal (Paite, Thadou, and Kom) and one nontribal communities of Manipur (Northeast India). Two of the markers (CD4 and HB9) are monomorphic in Paite and one (the CD4 marker) in Kom. Data suggest the Meitei (nontribal groups) stand apart from the three tribal groups with respect to higher heterozygosity (0.366) and presence of the highest ancestor haplotypes of DRD2 markers (0.228); this is also supported by principal co-ordinate analysis. These populations are found to be genomically closer to the Chinese population than to other Indian populations.

  9. Acidobacteria form a coherent but highly diverse group within the bacterial domain: evidence from environmental genomics

    Quaiser, Achim; Ochsenreiter, Torsten; Lanz, Christa

    2003-01-01

    fragments differed between 2.3% and 19.9% and were placed into two different subgroups of Acidobacteria (groups III and V). Although partial co-linearity was found between genomic fragments, the gene content around the rRNA operons was generally not conserved. Phylogenetic reconstructions with orthologues......Acidobacteria have been established as a novel phylum of Bacteria that is consistently detected in many different habitats around the globe by 16S rDNA-based molecular surveys. The phylogenetic diversity, ubiquity and abundance of this group, particularly in soil habitats, suggest an important...... palustris and Bradyrhizobium japonicum, including a conserved two-component system. Phylogenetic analysis of the putative response regulator confirmed that this similarity between Rhizobiales and Acidobacteria might be due to a horizontal gene transfer. In total, our data give first insight into the genome...

  10. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. The role of pili in Bacillus cereus intraocular infection.

    Callegan, Michelle C; Parkunan, Salai Madhumathi; Randall, C Blake; Coburn, Phillip S; Miller, Frederick C; LaGrow, Austin L; Astley, Roger A; Land, Craig; Oh, So-Young; Schneewind, Olaf

    2017-06-01

    Bacterial endophthalmitis is a potentially blinding intraocular infection. The bacterium Bacillus cereus causes a devastating form of this disease which progresses rapidly, resulting in significant inflammation and loss of vision within a few days. The outer surface of B. cereus incites the intraocular inflammatory response, likely through interactions with innate immune receptors such as TLRs. This study analyzed the role of B. cereus pili, adhesion appendages located on the bacterial surface, in experimental endophthalmitis. To test the hypothesis that the presence of pili contributed to intraocular inflammation and virulence, we analyzed the progress of experimental endophthalmitis in mouse eyes infected with wild type B. cereus (ATCC 14579) or its isogenic pilus-deficient mutant (ΔbcpA-srtD-bcpB or ΔPil). One hundred CFU were injected into the mid-vitreous of one eye of each mouse. Infections were analyzed by quantifying intraocular bacilli and retinal function loss, and by histology from 0 to 12 h postinfection. In vitro growth and hemolytic phenotypes of the infecting strains were also compared. There was no difference in hemolytic activity (1:8 titer), motility, or in vitro growth (p > 0.05, every 2 h, 0-18 h) between wild type B. cereus and the ΔPil mutant. However, infected eyes contained greater numbers of wild type B. cereus than ΔPil during the infection course (p ≤ 0.05, 3-12 h). Eyes infected with wild type B. cereus experienced greater losses in retinal function than eyes infected with the ΔPil mutant, but the differences were not always significant. Eyes infected with ΔPil or wild type B. cereus achieved similar degrees of severe inflammation. The results indicated that the intraocular growth of pilus-deficient B. cereus may have been better controlled, leading to a trend of greater retinal function in eyes infected with the pilus-deficient strain. Although this difference was not enough to significantly alter the severity

  12. Draft genome comparison of representatives of the three dominant genotype groups of dairy Bacillus licheniformis strains.

    Dhakal, Rajat; Seale, R Brent; Deeth, Hilton C; Craven, Heather; Turner, Mark S

    2014-06-01

    The spore-forming bacterium Bacillus licheniformis is a common contaminant of milk and milk products. Strains of this species isolated from dairy products can be differentiated into three major groups, namely, G, F1, and F2, using random amplification of polymorphic DNA (RAPD) analysis; however, little is known about the genomic differences between these groups and the identity of the fragments that make up their RAPD profiles. In this work we obtained high-quality draft genomes of representative strains from each of the three RAPD groups (designated strain G-1, strain F1-1, and strain F2-1) and compared them to each other and to B. licheniformis ATCC 14580 and Bacillus subtilis 168. Whole-genome comparison and multilocus sequence typing revealed that strain G-1 contains significant sequence variability and belongs to a lineage distinct from the group F strains. Strain G-1 was found to contain genes coding for a type I restriction modification system, urease production, and bacitracin synthesis, as well as the 8-kbp plasmid pFL7, and these genes were not present in strains F1-1 and F2-1. In agreement with this, all isolates of group G, but no group F isolates, were found to possess urease activity and antimicrobial activity against Micrococcus. Identification of RAPD band sequences revealed that differences in the RAPD profiles were due to differences in gene lengths, 3' ends of predicted primer binding sites, or gene presence or absence. This work provides a greater understanding of the phylogenetic and phenotypic differences observed within the B. licheniformis species.

  13. Proteomics identifies Bacillus cereus EntD as a pivotal protein for the production of numerous virulence factors

    Hélène eOmer

    2015-10-01

    Full Text Available Bacillus cereus is a gram-positive pathogen that causes a wide variety of diseases in humans. It secretes into the extracellular milieu proteins that may contribute directly or indirectly to its virulence. EntD is a novel exoprotein identified by proteogenomics of B. cereus ATCC 14579. We constructed a ΔentD mutant and analyzed the impact of entD disruption on the cellular proteome and exoproteome isolated from early, late and stationary-phase cultures. We identified 308 and 79 proteins regulated by EntD in the cellular proteome and the exoproteome, respectively. The contribution of these proteins to important virulence-associated functions, including central metabolism, cell structure, antioxidative ability, cell motility and toxin production, are presented. The proteomic data were correlated with the growth defect, cell morphology change, reduced motility and reduced cytotoxicity of the ΔentD mutant strain. We conclude that EntD is an important player in B. cereus virulence. The function of EntD and the putative EntD-dependent regulatory network are discussed. To our knowledge, this study is the first characterization of an Ent family protein in a species of the B. cereus group.

  14. The YvfTU Two-component System is involved in plcR expression in Bacillus cereus

    Nguyen-the Christophe

    2008-10-01

    Full Text Available Abstract Background Most extracellular virulence factors produced by Bacillus cereus are regulated by the pleiotropic transcriptional activator PlcR. Among strains belonging to the B. cereus group, the plcR gene is always located in the vicinity of genes encoding the YvfTU two-component system. The putative role of YvfTU in the expression of the PlcR regulon was therefore investigated. Results Expression of the plcR gene was monitored using a transcriptional fusion with a lacZ reporter gene in a yvfTU mutant and in its B. cereus ATCC 14579 parental strain. Two hours after the onset of the stationary phase, a stage at which the PlcR regulon is highly expressed, the plcR expression in the yvfTU mutant was only 50% of that of its parental strain. In addition to the reduced plcR expression in the yvfTU mutant, a few members of the PlcR regulon showed a differential expression, as revealed by transcriptomic and proteomic analyses. The virulence of the yvfTU mutant in a Galleria mellonella insect model was slightly lower than that of the parental strain. Conclusion The YvfTU two-component system is not required for the expression of most of the virulence factors belonging to the PlcR regulon. However, YvfTU is involved in expression of plcR, a major regulator of virulence in B. cereus.

  15. Bacillus cereus in personal care products: risk to consumers.

    Pitt, T L; McClure, J; Parker, M D; Amézquita, A; McClure, P J

    2015-04-01

    Bacillus cereus is ubiquitous in nature and thus occurs naturally in a wide range of raw materials and foodstuffs. B. cereus spores are resistant to desiccation and heat and able to survive dry storage and cooking. Vegetative cells produce several toxins which on ingestion in sufficient numbers can cause vomiting and/or diarrhoea depending on the toxins produced. Gastrointestinal disease is commonly associated with reheated or inadequately cooked foods. In addition to being a rare cause of several acute infections (e.g. pneumonia and septicaemia), B. cereus can also cause localized infection of post-surgical or trauma wounds and is a rare but significant pathogen of the eye where it may result in severe endophthalmitis often leading to loss of vision. Key risk factors in such cases are trauma to the eye and retained contaminated intraocular foreign bodies. In addition, rare cases of B. cereus-associated keratitis (inflammation of the cornea) have been linked to contact lens use. Bacillus cereus is therefore a microbial contaminant that could adversely affect product safety of cosmetic and facial toiletries and pose a threat to the user if other key risk factors are also present. The infective dose in the human eye is unknown, but as few as 100 cfu has been reported to initiate infection in a susceptible animal model. However, we are not aware of any reports in the literature of B. cereus infections in any body site linked with use of personal care products. Low levels of B. cereus spores may on occasion be present in near-eye cosmetics, and these products have been used by consumers for many years. In addition, exposure to B. cereus is more likely to occur through other routes (e.g. dustborne contamination) due to its ubiquity and resistance properties of spores. The organism has been recovered from the eyes of healthy individuals. Therefore, although there may be a perceived hazard, the risk of severe eye infections as a consequence of exposure through

  16. Kefiran antagonizes cytopathic effects of Bacillus cereus extracellular factors.

    Medrano, Micaela; Pérez, Pablo Fernando; Abraham, Analía Graciela

    2008-02-29

    Kefiran, the polysaccharide produced by microorganisms present in kefir grains, is a water-soluble branched glucogalactan containing equal amounts of D-glucose and D-galactose. In this study, the effect of kefiran on the biological activity of Bacillus cereus strain B10502 extracellular factors was assessed by using cultured human enterocytes (Caco-2 cells) and human erythrocytes. In the presence of kefiran concentrations ranging from 300 to 1000 mg/L, the ability of B. cereus B10502 spent culture supernatants to detach and damage cultured human enterocytes was significantly abrogated. In addition, mitochondrial dehydrogenase activity was higher when kefiran was present during the cell toxicity assays. Protection was also demonstrated in hemolysis and apoptosis/necrosis assays. Scanning electron microscopy showed the protective effect of kefiran against structural cell damages produced by factors synthesized by B. cereus strain B10502. Protective effect of kefiran depended on strain of B. cereus. Our findings demonstrate the ability of kefiran to antagonize key events of B. cereus B10502 virulence. This property, although strain-specific, gives new perspectives for the role of bacterial exopolysaccharides in functional foods.

  17. New Insights into the genetic diversity of Clostridium botulinum Group III through extensive genome exploration

    Cédric eWoudstra

    2016-05-01

    Full Text Available Animal botulism is caused by group III Clostridium botulinum strains producing type C and D toxins, or their chimeric forms C/D and D/C. Animal botulism is considered an emerging disease in Europe, notably in poultry production. Before our study, 14 genomes from different countries were available in the public database, but none were from France. In order to investigate the genetic relationship of French strains with different geographical areas and find new potential typing targets, 17 strains of C. botulinum group III were sequenced (16 from France and one from New Caledonia. Fourteen were type C/D strains isolated from chickens, ducks, guinea fowl and turkeys and three were type D/C strains isolated from cattle. The New Caledonian strain was a type D/C strain. Whole genome sequence analysis showed the French strains to be closely related to European strains from C. botulinum group III lineages Ia and Ib. The investigation of CRISPR sequences as genetic targets for differentiating strains in group III proved to be irrelevant for type C/D due to a deficient CRISPR/Cas mechanism, but not for type D/C. Conversely, the extrachromosomal elements of type C/D strains could be used to generate a genetic ID card. The highest level of discrimination was achieved with SNP core phylogeny, which allowed differentiation up to strain level and provide the most relevant information for genetic epidemiology studies and discrimination.

  18. The chromosomal distributions of Ty1-copia group retrotransposable elements in higher plants and their implications for genome evolution

    J.S. (Pat) Heslop-Harrison; Andrea Brandes; Shin Taketa; Thomas Schmidt; Alexander V. Vershinin; Elena G. Alkhimova; Anette Kamm; Robert L. Doudrick; . [and others

    1997-01-01

    Retrotransposons make up a major fraction - sometimes more than 40% - of all plant genomes investigated so far. We have isolated the reverse transcriptase domains of theTyl-copia group elements from several species, ranging in genome size from some 100 Mbp to 23,000 Mbp, and determined the distribution patterns of these retrotransposons on metaphase chromosomes and...

  19. Identification of copy number variants defining genomic differences among major human groups.

    Lluís Armengol

    Full Text Available BACKGROUND: Understanding the genetic contribution to phenotype variation of human groups is necessary to elucidate differences in disease predisposition and response to pharmaceutical treatments in different human populations. METHODOLOGY/PRINCIPAL FINDINGS: We have investigated the genome-wide profile of structural variation on pooled samples from the three populations studied in the HapMap project by comparative genome hybridization (CGH in different array platforms. We have identified and experimentally validated 33 genomic loci that show significant copy number differences from one population to the other. Interestingly, we found an enrichment of genes related to environment adaptation (immune response, lipid metabolism and extracellular space within these regions and the study of expression data revealed that more than half of the copy number variants (CNVs translate into gene-expression differences among populations, suggesting that they could have functional consequences. In addition, the identification of single nucleotide polymorphisms (SNPs that are in linkage disequilibrium with the copy number alleles allowed us to detect evidences of population differentiation and recent selection at the nucleotide variation level. CONCLUSIONS: Overall, our results provide a comprehensive view of relevant copy number changes that might play a role in phenotypic differences among major human populations, and generate a list of interesting candidates for future studies.

  20. Characterization of a group of MITEs with unusual features from two coral genomes.

    Shi Wang

    Full Text Available BACKGROUND: Miniature inverted-repeat transposable elements (MITEs, which are common in eukaryotic genomes, are small non-coding elements that transpose by utilizing transposases encoded by autonomous transposons. Recent genome-wide analyses and cross-mobilization assays have greatly improved our knowledge on MITE proliferation, however, specific mechanisms for the origin and evolution of MITEs are still unclear. PRINCIPAL FINDINGS: A group of coral MITEs called CMITE were identified from two corals, Acropora millepora and Acropora palmata. CMITEs conform to many common characteristics of MITEs, but also present several unusual features. The most unusual feature of CMITEs is conservation of the internal region, which is more conserved between MITE families than the TIRs. The origin of this internal region remains unknown, although we found one CMITE family that seems to be derived from a piggyBac-like transposon in A. millepora. CMITEs can form tandem arrays, suggesting an unconventional way for MITEs to increase copy numbers. We also describe a case in which a novel transposable element was created by a CMITE insertion event. CONCLUSIONS: To our knowledge, this is the first report of identification of MITEs from coral genomes. Proliferation of CMITEs seems to be related to the transposition machinery of piggyBac-like autonomous transposons. The highly conserved internal region of CMITEs suggests a potential role for this region in their successful transposition. However, the origin of these unusual features in CMITEs remains unclear, and thus represents an intriguing topic for future investigations.

  1. Characterization of a group of MITEs with unusual features from two coral genomes.

    Wang, Shi; Zhang, Lingling; Meyer, Eli; Matz, Mikhail V

    2010-05-18

    Miniature inverted-repeat transposable elements (MITEs), which are common in eukaryotic genomes, are small non-coding elements that transpose by utilizing transposases encoded by autonomous transposons. Recent genome-wide analyses and cross-mobilization assays have greatly improved our knowledge on MITE proliferation, however, specific mechanisms for the origin and evolution of MITEs are still unclear. A group of coral MITEs called CMITE were identified from two corals, Acropora millepora and Acropora palmata. CMITEs conform to many common characteristics of MITEs, but also present several unusual features. The most unusual feature of CMITEs is conservation of the internal region, which is more conserved between MITE families than the TIRs. The origin of this internal region remains unknown, although we found one CMITE family that seems to be derived from a piggyBac-like transposon in A. millepora. CMITEs can form tandem arrays, suggesting an unconventional way for MITEs to increase copy numbers. We also describe a case in which a novel transposable element was created by a CMITE insertion event. To our knowledge, this is the first report of identification of MITEs from coral genomes. Proliferation of CMITEs seems to be related to the transposition machinery of piggyBac-like autonomous transposons. The highly conserved internal region of CMITEs suggests a potential role for this region in their successful transposition. However, the origin of these unusual features in CMITEs remains unclear, and thus represents an intriguing topic for future investigations.

  2. A Case Series and Review of Bacillus Cereus Endocarditis from India.

    Gopinathan, Anusha; Kumar, Anil; Sen, Amitabh C; Sudha, Srisruthy; Varma, Praveen; Gs, Sunil; Eapen, Malini; Dinesh, Kavitha R

    2018-01-01

    Bacillus cereus is a gram positive bacilli found commonly in the soil and environment. It is a bacteria rarely associated with endocarditis. Intravenous drug abuse, presence of valvular defects, pacemakers, immunodeficiency are some of the known risk factors for B.cereus endocarditis. We present here a case series of two patients with B.cereus endocarditis along with a review of the literature. This is the first report of B.cereus endocarditis from India to the best of our knowledge.

  3. Comparative transcriptome and phenotype analysis of acid-stressed Bacillus cereus strain ATCC 14579

    Mols, J.M.; Kranenburg, van Richard; Melis, van Clint; Moezelaar, Roy; Abee, Tjakko

    2009-01-01

    The food-borne human pathogen Bacillus cereus is found in environments that often have a low pH, such as food and soil. The physiological response upon exposure to several levels of acidity were investigated of B. cereus model strain ATCC 14579, to elucidate the response of B. cereus to acid stress.

  4. Comparative transcriptome and phenotype analysis of acid-stressed Bacillus cereus strain ATCC 10987

    Mols, J.M.; Kranenburg, van Richard; Melis, van Clint; Moezelaar, Roy; Abee, Tjakko

    2009-01-01

    The food-borne human pathogen Bacillus cereus is found in environments that often have a low pH, such as food and soil. The physiological response upon exposure to several levels of acidity were investigated of B. cereus model strain ATCC 10987, to elucidate the response of B. cereus to acid stress.

  5. Bacillus cereus panophthalmitis associated with intraocular gas bubble.

    al-Hemidan, A; Byrne-Rhodes, K A; Tabbara, K F

    1989-01-01

    It has become increasingly apparent that Bacillus cereus can cause a severe and devastating form of endophthalmitis following penetrating trauma by a metallic object. B. cereus is an uncommon aetiological agent in non-clostridial gas-forming infections. The patient studied in this single case report showed evidence of intraocular gas mimicking gas gangrene infection. The physiology of non-clostridial bacteria producing gas from anaerobic metabolic conditions is reviewed. Further intraocular and systemic complications which may be avoided by accurate and early diagnosis and the use of recommended treatment with antibiotics such as clindamycin. Images PMID:2493262

  6. Proliferation of group II introns in the chloroplast genome of the green alga Oedocladium carolinianum (Chlorophyceae

    Jean-Simon Brouard

    2016-10-01

    Full Text Available Background The chloroplast genome sustained extensive changes in architecture during the evolution of the Chlorophyceae, a morphologically and ecologically diverse class of green algae belonging to the Chlorophyta; however, the forces driving these changes are poorly understood. The five orders recognized in the Chlorophyceae form two major clades: the CS clade consisting of the Chlamydomonadales and Sphaeropleales, and the OCC clade consisting of the Oedogoniales, Chaetophorales, and Chaetopeltidales. In the OCC clade, considerable variations in chloroplast DNA (cpDNA structure, size, gene order, and intron content have been observed. The large inverted repeat (IR, an ancestral feature characteristic of most green plants, is present in Oedogonium cardiacum (Oedogoniales but is lacking in the examined members of the Chaetophorales and Chaetopeltidales. Remarkably, the Oedogonium 35.5-kb IR houses genes that were putatively acquired through horizontal DNA transfer. To better understand the dynamics of chloroplast genome evolution in the Oedogoniales, we analyzed the cpDNA of a second representative of this order, Oedocladium carolinianum. Methods The Oedocladium cpDNA was sequenced and annotated. The evolutionary distances separating Oedocladium and Oedogonium cpDNAs and two other pairs of chlorophycean cpDNAs were estimated using a 61-gene data set. Phylogenetic analysis of an alignment of group IIA introns from members of the OCC clade was performed. Secondary structures and insertion sites of oedogonialean group IIA introns were analyzed. Results The 204,438-bp Oedocladium genome is 7.9 kb larger than the Oedogonium genome, but its repertoire of conserved genes is remarkably similar and gene order differs by only one reversal. Although the 23.7-kb IR is missing the putative foreign genes found in Oedogonium, it contains sequences coding for a putative phage or bacterial DNA primase and a hypothetical protein. Intergenic sequences are 1.5-fold

  7. Characterization of germination receptors of Bacillus cereus ATCC 14579

    Hornstra, L.M.; Vries, de Y.P.; Wells-Bennik, M.H.J.; Vos, de W.M.; Abee, T.

    2006-01-01

    Specific amino acids, purine ribonucleosides, or a combination of the two is required for efficient germination of endospores of Bacillus cereus ATCC 14579. A survey including 20 different amino acids showed that L-alanine, L-cysteine, L-threonine, and L-glutamine are capable of initiating the

  8. Increasing the alkaline protease activity of Bacillus cereus and ...

    User

    2011-05-09

    May 9, 2011 ... cereus and Bacillus polymyxa simultaneously with the start of sporulation phase as a ... microbial forms to inactivation by chemical or physical agents. .... alkaline pH, 9, 10 and 11 and the pH of the culture media was optimized with .... incubation temperature for alkaline protease production by Bacillus ...

  9. Purification and characterization of protease from Bacillus cereus ...

    chitti

    2013-09-16

    Sep 16, 2013 ... Purification and characterization of protease from. Bacillus cereus SU12 isolated from oyster. Saccostrea cucullata. S. Umayaparvathi*, S. Meenakshi, M. Arumugam and T. Balasubramanian. Centre of Advanced Study in Marine Biology, Faculty of Marine Sciences, Annamalai University, Parangipettai - 608.

  10. [Bacillus cereus endocarditis and a probable cutaneous gateway].

    Soudet, S; Becquart, C; Dezoteux, F; Faure, K; Staumont-Salle, D; Delaporte, E

    2017-01-01

    Bacillus cereus is a ubiquitous telluric organism. B. cereus endocarditis is a rare condition seen mostly in prosthetic heart valves and among intravenous drug users. We report a new case of a patient without risk factors and with a good clinical outcome not requiring valve replacement. In October 2014, a 50-year-old woman was referred to the dermatology department of Lille University Hospital for lower-limb wounds developing 6 months earlier. She presented fever without clinical signs of infection, except for the lower-limbs wounds. Blood cultures revealed the presence of B. cereus. Transesophageal echocardiography was performed and revealed two foci of aortic valve vegetation with a diameter of 5mm. After bacterial sensitivity testing, rifampicin and levofloxacin treatment was given for six weeks, with complete remission. A skin graft was performed and good improvement was seen. Nineteen cases of B. cereus endocarditis have been described previously, only one of which was without risk factors. We described a case of complete remission after a 6-week course of antibiotics. Our case demonstrates that BC should not be considered as a blood culture contamination, and that treatment may be complex due to antibiotic resistance. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. Genomes

    Brown, T. A. (Terence A.)

    2002-01-01

    ... of genome expression and replication processes, and transcriptomics and proteomics. This text is richly illustrated with clear, easy-to-follow, full color diagrams, which are downloadable from the book's website...

  12. Genomic analysis reveals the molecular basis for capsule loss in the group B Streptococcus population.

    Roberto Rosini

    Full Text Available The human and bovine bacterial pathogen Streptococcus agalactiae (Group B Streptococcus, GBS expresses a thick polysaccharide capsule that constitutes a major virulence factor and vaccine target. GBS can be classified into ten distinct serotypes differing in the chemical composition of their capsular polysaccharide. However, non-typeable strains that do not react with anti-capsular sera are frequently isolated from colonized and infected humans and cattle. To gain a comprehensive insight into the molecular basis for the loss of capsule expression in GBS, a collection of well-characterized non-typeable strains was investigated by genome sequencing. Genome based phylogenetic analysis extended to a wide population of sequenced strains confirmed the recently observed high clonality among GBS lineages mainly containing human strains, and revealed a much higher degree of diversity in the bovine population. Remarkably, non-typeable strains were equally distributed in all lineages. A number of distinct mutations in the cps operon were identified that were apparently responsible for inactivation of capsule synthesis. The most frequent genetic alterations were point mutations leading to stop codons in the cps genes, and the main target was found to be cpsE encoding the portal glycosyl transferase of capsule biosynthesis. Complementation of strains carrying missense mutations in cpsE with a wild-type gene restored capsule expression allowing the identification of amino acid residues essential for enzyme activity.

  13. Final report of the group research. Genome analysis on the biological effects of radiation. Second research group of NIRS

    2001-10-01

    This report concerns investigations on the title conducted by 5 subgroups of National Institute of Radiological Sciences (NIRS) during the period of 1993-2001. The report involves the organization of research teams and summary reports from the subgroups for Genome sequencing and informatics, Genome analysis on model organisms, The genome analysis on the specific chromosomal region related to radiation-sensitivity, Molecular analysis on the structure and function of particular regions of human genome, and Generation and characterization of DNA repair-deficient model mice. Significant results are as follows: Sequencing of the radiation sensitivity gene ATM, finding of a novel cell cycle regulator gene NPAT and regulation of gene expression of ATM/NPAT; Findings that the cause of the variability related to instability of human genome is derived from particular repeat structures of 5 and 35 bases and of the instability mutation, from the mutation of EPILS (mRNA synthase gene); Program development for novel human genome finding in the DNA sequences and making novel human gene as a resource by polymerase chain reaction (PCR) technique; and generation of the highly UV-sensitive mouse model for human xeroderma pigmentosum G. Conclusion is that findings will contribute for better understanding of the genes functioning radiation sensitivity and also biodefense mechanism against radiation and other environmental stress. (N.I.)

  14. Assignment of simian rotavirus SA11 temperature-sensitive mutant groups B and E to genome segments

    Gombold, J.L.; Estes, M.K.; Ramig, R.F.

    1985-01-01

    Recombinant (reassortant) viruses were selected from crosses between temperature-sensitive (ts) mutants of simian rotavirus SA11 and wild-type human rotavirus Wa. The double-stranded genome RNAs of the reassortants were examined by electrophoresis in Tris-glycine-buffered polyacrylamide gels and by dot hybridization with a cloned DNA probe for genome segment 2. Analysis of replacements of genome segments in the reassortants allowed construction of a map correlating genome segments providing functions interchangeable between SA11 and Wa. The reassortants revealed a functional correspondence in order of increasing electrophoretic mobility of genome segments. Analysis of the parental origin of genome segments in ts+ SA11/Wa reassortants derived from the crosses SA11 tsB(339) X Wa and SA11 tsE(1400) X Wa revealed that the group B lesion of tsB(339) was located on genome segment 3 and the group E lesion of tsE(1400) was on segment 8

  15. Assignment of simian rotavirus SA11 temperature-sensitive mutant groups B and E to genome segments

    Gombold, J.L.; Estes, M.K.; Ramig, R.F.

    1985-05-01

    Recombinant (reassortant) viruses were selected from crosses between temperature-sensitive (ts) mutants of simian rotavirus SA11 and wild-type human rotavirus Wa. The double-stranded genome RNAs of the reassortants were examined by electrophoresis in Tris-glycine-buffered polyacrylamide gels and by dot hybridization with a cloned DNA probe for genome segment 2. Analysis of replacements of genome segments in the reassortants allowed construction of a map correlating genome segments providing functions interchangeable between SA11 and Wa. The reassortants revealed a functional correspondence in order of increasing electrophoretic mobility of genome segments. Analysis of the parental origin of genome segments in ts+ SA11/Wa reassortants derived from the crosses SA11 tsB(339) X Wa and SA11 tsE(1400) X Wa revealed that the group B lesion of tsB(339) was located on genome segment 3 and the group E lesion of tsE(1400) was on segment 8.

  16. 77 FR 75425 - Interagency Working Group on Plant Genomics (IWGPG): The National Plant Genome Initiative-What's...

    2012-12-20

    ... Genome Initiative--What's Next? AGENCY: Office of Science, Office of Biological and Environmental... INFORMATION CONTACT: Dr. Catherine Ronning, U.S. Department of Energy, Office of Science, Office of Biological... 20585-1290. Phone 301-903-9549, fax (301) 903-5051, email: [email protected]science.doe.gov ; Dr. Jane...

  17. Mob/oriT, a mobilizable site-specific recombination system for unmarked genetic manipulation in Bacillus thuringiensis and Bacillus cereus.

    Wang, Pengxia; Zhu, Yiguang; Zhang, Yuyang; Zhang, Chunyi; Xu, Jianyi; Deng, Yun; Peng, Donghai; Ruan, Lifang; Sun, Ming

    2016-06-10

    Bacillus thuringiensis and Bacillus cereus are two important species in B. cereus group. The intensive study of these strains at the molecular level and construction of genetically modified bacteria requires the development of efficient genetic tools. To insert genes into or delete genes from bacterial chromosomes, marker-less manipulation methods were employed. We present a novel genetic manipulation method for B. thuringiensis and B. cereus strains that does not leave selection markers. Our approach takes advantage of the relaxase Mob02281 encoded by plasmid pBMB0228 from Bacillus thuringiensis. In addition to its mobilization function, this Mob protein can mediate recombination between oriT sites. The Mob02281 mobilization module was associated with a spectinomycin-resistance gene to form a Mob-Spc cassette, which was flanked by the core 24-bp oriT sequences from pBMB0228. A strain in which the wild-type chromosome was replaced with the modified copy containing the Mob-Spc cassette at the target locus was obtained via homologous recombination. Thus, the spectinomycin-resistance gene can be used to screen for Mob-Spc cassette integration mutants. Recombination between the two oriT sequences mediated by Mob02281, encoded by the Mob-Spc cassette, resulted in the excision of the Mob-Spc cassette, producing the desired chromosomal alteration without introducing unwanted selection markers. We used this system to generate an in-frame deletion of a target gene in B. thuringiensis as well as a gene located in an operon of B. cereus. Moreover, we demonstrated that this system can be used to introduce a single gene or an expression cassette of interest in B. thuringiensis. The Mob/oriT recombination system provides an efficient method for unmarked genetic manipulation and for constructing genetically modified bacteria of B. thuringiensis and B. cereus. Our method extends the available genetic tools for B. thuringiensis and B. cereus strains.

  18. Corrosion effect of Bacillus cereus on X80 pipeline steel in a Beijing soil environment.

    Wan, Hongxia; Song, Dongdong; Zhang, Dawei; Du, Cuiwei; Xu, Dake; Liu, Zhiyong; Ding, De; Li, Xiaogang

    2018-06-01

    The corrosion of X80 pipeline steel in the presence of Bacillus cereus (B. cereus) was studied through electrochemical and surface analyses and live/dead staining. Scanning electron microscopy and live/dead straining results showed that a number of B. cereus adhered to the X80 steel. Electrochemical impedance spectroscopy showed that B. cereus could accelerate the corrosion of X80 steel. In addition, surface morphology observations indicated that B. cereus could accelerate pitting corrosion in X80 steel. The depth of the largest pits due to B. cereus was approximately 11.23μm. Many pits were found on the U-shaped bents and cracks formed under stress after 60days of immersion in the presence of B. cereus. These indicate that pitting corrosion can be accelerated by B. cereus. X-ray photoelectron spectroscopy results revealed that NH 4 + existed on the surface of X80 steel. B. cereus is a type of nitrate-reducing bacteria and hence the corrosion mechanism of B. cereus may involve nitrate reduction on the X80 steel. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo. PMID:26559182

  20. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome.

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo.

  1. Novel phage group infecting Lactobacillus delbrueckii subsp. lactis, as revealed by genomic and proteomic analysis of bacteriophage Ldl1.

    Casey, Eoghan; Mahony, Jennifer; Neve, Horst; Noben, Jean-Paul; Dal Bello, Fabio; van Sinderen, Douwe

    2015-02-01

    Ldl1 is a virulent phage infecting the dairy starter Lactobacillus delbrueckii subsp. lactis LdlS. Electron microscopy analysis revealed that this phage exhibits a large head and a long tail and bears little resemblance to other characterized phages infecting Lactobacillus delbrueckii. In vitro propagation of this phage revealed a latent period of 30 to 40 min and a burst size of 59.9 +/- 1.9 phage particles. Comparative genomic and proteomic analyses showed remarkable similarity between the genome of Ldl1 and that of Lactobacillus plantarum phage ATCC 8014-B2. The genomic and proteomic characteristics of Ldl1 demonstrate that this phage does not belong to any of the four previously recognized L. delbrueckii phage groups, necessitating the creation of a new group, called group e, thus adding to the knowledge on the diversity of phages targeting strains of this industrially important lactic acid bacterial species.

  2. Naphthalene degradation and biosurfactant activity by Bacillus cereus 28BN

    Tuleva, B.; Christova, N. [Inst. of Microbiology, Bulgarian Academy of Sciences, Sofia (Bulgaria); Jordanov, B.; Nikolova-Damyanova, B. [Inst. of Organic Chemistry, Sofia (Bulgaria); Petrov, P. [National Center of Infectious and Parasitic Diseases, Sofia (Bulgaria)

    2005-08-01

    Biosurfactant activity and naphthalene degradation by a new strain identified as Bacillus cereus 28BN were studied. The strain grew well and produced effective biosurfactants in the presence of n-alkanes, naphthalene, crude oil and vegetable oils. The biosurfactants were detected by the surface tension lowering of the medium, thin layer chromatography and infrared spectra analysis. With (2%) naphthalene as the sole carbon source, high levels of rhamnolipids at a concentration of 2.3 g l{sup -1} were determined in the stationary growth. After 20 d of incubation 72 {+-} 4% of the initial naphthalene was degraded. This is the first report for a Bacillus cereus rhamnolipid producing strain that utilized naphthalene under aerobic conditions. The strain looks promising for application in environmental technologies. (orig.)

  3. YwdL in Bacillus cereus: its role in germination and exosporium structure.

    Cassandra Terry

    Full Text Available In members of the Bacillus cereus group the outermost layer of the spore is the exosporium, which interacts with hosts and the environment. Efforts have been made to identify proteins of the exosporium but only a few have so far been characterised and their role in determining spore architecture and spore function is still poorly understood. We have characterised the exosporium protein, YwdL. ΔywdL spores have a more fragile exosporium, subject to damage on repeated freeze-thawing, although there is no evidence of altered resistance properties, and coats appear intact. Immunogold labelling and Western blotting with anti-YwdL antibodies identified YwdL to be located exclusively on the inner surface of the exosporium of B. cereus and B. thuringiensis. We conclude that YwdL is important for formation of a robust exosporium but is not required to maintain the crystalline assembly within the basal layer or for attachment of the hairy nap structure. ΔywdL spores are unable to germinate in response to CaDPA, and have altered germination properties, a phenotype that confirms the expected defect in localization of the cortex lytic enzyme CwlJ in the coat.

  4. Northeast African genomic variation shaped by the continuity of indigenous groups and Eurasian migrations.

    Nina Hollfelder

    2017-08-01

    Full Text Available Northeast Africa has a long history of human habitation, with fossil-finds from the earliest anatomically modern humans, and housing ancient civilizations. The region is also the gate-way out of Africa, as well as a portal for migration into Africa from Eurasia via the Middle East and the Arabian Peninsula. We investigate the population history of northeast Africa by genotyping ~3.9 million SNPs in 221 individuals from 18 populations sampled in Sudan and South Sudan and combine this data with published genome-wide data from surrounding areas. We find a strong genetic divide between the populations from the northeastern parts of the region (Nubians, central Arab populations, and the Beja and populations towards the west and south (Nilotes, Darfur and Kordofan populations. This differentiation is mainly caused by a large Eurasian ancestry component of the northeast populations likely driven by migration of Middle Eastern groups followed by admixture that affected the local populations in a north-to-south succession of events. Genetic evidence points to an early admixture event in the Nubians, concurrent with historical contact between North Sudanese and Arab groups. We estimate the admixture in current-day Sudanese Arab populations to about 700 years ago, coinciding with the fall of Dongola in 1315/1316 AD, a wave of admixture that reached the Darfurian/Kordofanian populations some 400-200 years ago. In contrast to the northeastern populations, the current-day Nilotic populations from the south of the region display little or no admixture from Eurasian groups indicating long-term isolation and population continuity in these areas of northeast Africa.

  5. Northeast African genomic variation shaped by the continuity of indigenous groups and Eurasian migrations.

    Hollfelder, Nina; Schlebusch, Carina M; Günther, Torsten; Babiker, Hiba; Hassan, Hisham Y; Jakobsson, Mattias

    2017-08-01

    Northeast Africa has a long history of human habitation, with fossil-finds from the earliest anatomically modern humans, and housing ancient civilizations. The region is also the gate-way out of Africa, as well as a portal for migration into Africa from Eurasia via the Middle East and the Arabian Peninsula. We investigate the population history of northeast Africa by genotyping ~3.9 million SNPs in 221 individuals from 18 populations sampled in Sudan and South Sudan and combine this data with published genome-wide data from surrounding areas. We find a strong genetic divide between the populations from the northeastern parts of the region (Nubians, central Arab populations, and the Beja) and populations towards the west and south (Nilotes, Darfur and Kordofan populations). This differentiation is mainly caused by a large Eurasian ancestry component of the northeast populations likely driven by migration of Middle Eastern groups followed by admixture that affected the local populations in a north-to-south succession of events. Genetic evidence points to an early admixture event in the Nubians, concurrent with historical contact between North Sudanese and Arab groups. We estimate the admixture in current-day Sudanese Arab populations to about 700 years ago, coinciding with the fall of Dongola in 1315/1316 AD, a wave of admixture that reached the Darfurian/Kordofanian populations some 400-200 years ago. In contrast to the northeastern populations, the current-day Nilotic populations from the south of the region display little or no admixture from Eurasian groups indicating long-term isolation and population continuity in these areas of northeast Africa.

  6. Cereus peruvianus (Koubo) new cactus fruit for the world

    Mizrahi, Yosef

    2014-01-01

    Several different species of the columnar cacti of the genera Stenocereus and Pachycereus, were introduced into different semi-arid ecozones in Israel and most of these efforts were of disappointing outcomes, the only exception being the Cereus peruvianus (L.) Miller,which bore plenty of fruits, some of them of good taste. The original seeds of this plant were obtained from the late Mr. Amram (Ron) Kodish, who collected seeds from various private gardens in Southern California which bore frui...

  7. Production of Alpha Amylase by Bacillus cereus in Submerged Fermentation

    Helen H. Raplong

    2014-09-01

    Full Text Available Microorganisms have the ability to secrete enzymes when they are grown in the presence of certain substrates. Amylases are among the most important industrial enzymes and are of great significance in biotechnological studies. Bacteria belonging to the genus Bacillus were isolated using mannitol egg yolk polymyxin B (MYP agar a highly selective media for Bacillus cereus isolation. The isolates were tested for α-amylase production on nutrient agar supplemented with starch and in submerged fermentation. The bacteria isolated and identified (using the Microgen Bacillus identification kit were all Bacillus cereus and SB2 had the largest zone of hydrolysis of 12mm on nutrient agar supplemented with starch as well as the highest enzyme activity of 1.62U/ml. Amylase activity of 2.56U/ml was obtained after 24 hours incubation in submerged fermentation. When amylase enzyme production parameters where optimized, maximum amylase activity was obtained at a pH of 6.5, temperature of 350C, incubation time of 24 hours and 4% inoculums concentration. Bacillus cereus SB2 is a potential isolate for alpha-amylase production with soluble starch as the sole carbon source in submerged fermentation.

  8. Investigation of equilibrium and kinetics of Cr(VI) adsorption by dried Bacillus cereus using response surface methodology.

    Yang, Kai; Zhang, Jing; Yang, Tao; Wang, Hongyu

    2016-01-01

    In this study, response surface methodology (RSM) based on three-variable-five-level central composite rotatable design was used to analyze the effects of combined and individual operating parameters (biomass dose, initial concentration of Cr(VI) and pH) on the Cr(VI) adsorption capacity of dried Bacillus cereus. A quadratic polynomial equation was obtained to predict the adsorbed Cr(VI) amount. Analysis of variance showed that the effect of biomass dose was the key factor in the removal of Cr(VI). The maximum adsorbed Cr(VI) amount (30.93 mg g(-1)) was found at 165.30 mg L(-1), 2.96, and 3.01 g L(-1) for initial Cr(VI) concentration, pH, and biosorbent dosage, respectively. The surface chemical functional groups and microstructure of unloaded and Cr(VI)-loaded dried Bacillus cereus were identified by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM), respectively. Besides, the results gained from these studies indicated that Langmuir isotherm and the second-order rate expression were suitable for the removal of Cr(VI) from wastewater. The results revealed RSM was an effective method for optimizing biosorption process, and dried Bacillus cereus had a remarkable performance on the removal of Cr(VI) from wastewater.

  9. Detecting non-orthology in the COGs database and other approaches grouping orthologs using genome-specific best hits.

    Dessimoz, Christophe; Boeckmann, Brigitte; Roth, Alexander C J; Gonnet, Gaston H

    2006-01-01

    Correct orthology assignment is a critical prerequisite of numerous comparative genomics procedures, such as function prediction, construction of phylogenetic species trees and genome rearrangement analysis. We present an algorithm for the detection of non-orthologs that arise by mistake in current orthology classification methods based on genome-specific best hits, such as the COGs database. The algorithm works with pairwise distance estimates, rather than computationally expensive and error-prone tree-building methods. The accuracy of the algorithm is evaluated through verification of the distribution of predicted cases, case-by-case phylogenetic analysis and comparisons with predictions from other projects using independent methods. Our results show that a very significant fraction of the COG groups include non-orthologs: using conservative parameters, the algorithm detects non-orthology in a third of all COG groups. Consequently, sequence analysis sensitive to correct orthology assignments will greatly benefit from these findings.

  10. In Silico Genomic Fingerprints of the Bacillus anthracis Group Obtained by Virtual Hybridization

    Hueman Jaimes-Díaz

    2015-02-01

    Full Text Available In this study we evaluate the capacity of Virtual Hybridization to identify between highly related bacterial strains. Eight genomic fingerprints were obtained by virtual hybridization for the Bacillus anthracis genome set, and a set of 15,264 13-nucleotide short probes designed to produce genomic fingerprints unique for each organism. The data obtained from each genomic fingerprint were used to obtain hybridization patterns simulating a DNA microarray. Two virtual hybridization methods were used: the Direct and the Extended method to identify the number of potential hybridization sites and thus determine the minimum sensitivity value to discriminate between genomes with 99.9% similarity. Genomic fingerprints were compared using both methods and phylogenomic trees were constructed to verify that the minimum detection value is 0.000017. Results obtained from the genomic fingerprints suggest that the distribution in the trees is correct, as compared to other taxonomic methods. Specific virtual hybridization sites for each of the genomes studied were also identified.

  11. Comparative genomics and functional analysis of the 936 group of lactococcal Siphoviridae phages

    Murphy, James; Bottacini, Francesca; Mahony, Jennifer; Kelleher, Philip; Neve, Horst; Zomer, Aldert; Nauta, Arjen; van Sinderen, Douwe

    2016-01-01

    Genome sequencing and comparative analysis of bacteriophage collections has greatly enhanced our understanding regarding their prevalence, phage-host interactions as well as the overall biodiversity of their genomes. This knowledge is very relevant to phages infecting Lactococcus lactis, since they

  12. The MICROBE Project, A Report from the Interagency Working Group on Microbial Genomics

    2001-01-01

    functional genomics tools (gene chips, technologies, etc.), comparative genomics, proteomics tools, novel culture techniques, in situ analyses, and...interested in supporting microarray/chip development for gene expression analysis for agricultural microbes, bioinformatics, and proteomics , and the...including one fungus ) in various stages of progress. The closely integrated Natural and Accelerated Bioremediation Research Program in the Office of

  13. Effects of racial and ethnic group and health literacy on responses to genomic risk information in a medically underserved population.

    Kaphingst, Kimberly A; Stafford, Jewel D; McGowan, Lucy D'Agostino; Seo, Joann; Lachance, Christina R; Goodman, Melody S

    2015-02-01

    Few studies have examined how individuals respond to genomic risk information for common, chronic diseases. This randomized study examined differences in responses by type of genomic information (genetic test/family history) and disease condition (diabetes/heart disease), and by race/ethnicity in a medically underserved population. 1,057 English-speaking adults completed a survey containing 1 of 4 vignettes (2-by-2 randomized design). Differences in dependent variables (i.e., interest in receiving genomic assessment, discussing with doctor or family, changing health habits) by experimental condition and race/ethnicity were examined using chi-squared tests and multivariable regression analysis. No significant differences were found in dependent variables by type of genomic information or disease condition. In multivariable models, Hispanics were more interested in receiving a genomic assessment than Whites (OR = 1.93; p literacy had greater interest than those with adequate health literacy. Blacks (OR = 1.78; p = .001) and Hispanics (OR = 1.85; p = .001) had greater interest in discussing information with family than Whites. Non-Hispanic Blacks (OR = 1.45; p = .04) had greater interest in discussing genomic information with a doctor than Whites. Blacks (β = -0.41; p literacy was negatively associated with number of health habits participants intended to change. Findings suggest that race/ethnicity may affect responses to genomic risk information. Additional research could examine how cognitive representations of this information differ across racial/ethnic groups. Health literacy is also critical to consider in developing approaches to communicating genomic information.

  14. The Water Cycle, a Potential Source of the Bacterial Pathogen Bacillus cereus

    Julien Brillard

    2015-01-01

    Full Text Available The behaviour of the sporulating soil-dwelling Bacillus cereus sensu lato (B. cereus sl which includes foodborne pathogenic strains has been extensively studied in relation to its various animal hosts. The aim of this environmental study was to investigate the water compartments (rain and soil water, as well as groundwater closely linked to the primary B. cereus sl reservoir, for which available data are limited. B. cereus sl was present, primarily as spores, in all of the tested compartments of an agricultural site, including water from rain to groundwater through soil. During rain events, leachates collected after transfer through the soil eventually reached the groundwater and were loaded with B. cereus sl. In groundwater samples, newly introduced spores of a B. cereus model strain were able to germinate, and vegetative cells arising from this event were detected for up to 50 days. This first B. cereus sl investigation in the various types of interrelated environments suggests that the consideration of the aquatic compartment linked to soil and to climatic events should provide a better understanding of B. cereus sl ecology and thus be relevant for a more accurate risk assessment of food poisoning caused by B. cereus sl pathogenic strains.

  15. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes.

    Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S; Allard, Marc W; Strain, Errol A; Brown, Eric W

    2016-10-15

    Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST clusters were congruent with MLST-defined clonal groups, which had various degrees of diversity at the whole-genome level. Notably, cgMLST could distinguish among outbreak strains and epidemiologically unrelated strains of the same clonal group, which could not be achieved using classic MLST schemes. The precise selection of cgMLST gene targets may not be critical for the general identification of clonal groups and outbreak strains. cgMLST analyses further identified outbreak strains, including those associated with recent outbreaks linked to contaminated French-style cheese, Hispanic-style cheese, stone fruit, caramel apple, ice cream, and packaged leafy green salad, as belonging to major clonal groups. We further developed lineage-specific cgMLST schemes, which can include accessory genes when core genomes do not possess sufficient diversity, and this provided additional resolution over species-specific cgMLST. Analyses of isolates from different common-source listeriosis outbreaks revealed various degrees of diversity, indicating that the numbers of allelic differences should always be combined with cgMLST clustering and epidemiological evidence to define a listeriosis outbreak. Classic multilocus sequence typing (MLST) schemes targeting internal fragments of 6 to 8 genes that define clonal complexes or epidemic clones have been widely employed to study L. monocytogenes biodiversity and its relation to pathogenicity potential and epidemiology. We demonstrated that core genome MLST

  16. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes

    Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S.; Allard, Marc W.; Strain, Errol A.; Brown, Eric W.

    2016-01-01

    ABSTRACT Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST...

  17. Complete genome sequence of Lactobacillus plantarum LZ95, a potential probiotic strain producing bacteriocins and B-group vitamin riboflavin.

    Li, Ping; Gu, Qing

    2016-07-10

    Lactobacillus plantarum LZ95 is a potential probiotic isolated from newborn infant fecal and it is identified to produce riboflavin with great antimicrobial activity. The complete genome sequence of this strain was reported in the present study. The genome contains a 3,261,418-bp chromosome and two plasmids. Genes, related to the biosynthesis of bacteriocins and riboflavin, were identified. This work will facilitate to reveal the biosynthetic mechanism of bacteriocins and B-group vitamins in lactic acid bacteria and provide evidence for its potential application in food industry. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Genomic resources for multiple species in the Drosophila ananassae species group.

    Signor, Sarah; Seher, Thaddeus; Kopp, Artyom

    2013-01-01

    The development of genomic resources in non-model taxa is essential for understanding the genetic basis of biological diversity. Although the genomes of many Drosophila species have been sequenced, most of the phenotypic diversity in this genus remains to be explored. To facilitate the genetic analysis of interspecific and intraspecific variation, we have generated new genomic resources for seven species and subspecies in the D. ananassae species subgroup. We have generated large amounts of transcriptome sequence data for D. ercepeae, D. merina, D. bipectinata, D. malerkotliana malerkotliana, D. m. pallens, D. pseudoananassae pseudoananassae, and D. p. nigrens. de novo assembly resulted in contigs covering more than half of the predicted transcriptome and matching an average of 59% of annotated genes in the complete genome of D. ananassae. Most contigs, corresponding to an average of 49% of D. ananassae genes, contain sequence polymorphisms that can be used as genetic markers. Subsets of these markers were validated by genotyping the progeny of inter- and intraspecific crosses. The ananassae subgroup is an excellent model system for examining the molecular basis of speciation and phenotypic evolution. The new genomic resources will facilitate the genetic analysis of inter- and intraspecific differences in this lineage. Transcriptome sequencing provides a simple and cost-effective way to identify molecular markers at nearly single-gene density, and is equally applicable to any non-model taxa.

  19. Genomic analysis of Melioribacter roseus, facultatively anaerobic organotrophic bacterium representing a novel deep lineage within Bacteriodetes/Chlorobi group.

    Vitaly V Kadnikov

    Full Text Available Melioribacter roseus is a moderately thermophilic facultatively anaerobic organotrophic bacterium representing a novel deep branch within Bacteriodetes/Chlorobi group. To better understand the metabolic capabilities and possible ecological functions of M. roseus and get insights into the evolutionary history of this bacterial lineage, we sequenced the genome of the type strain P3M-2(T. A total of 2838 open reading frames was predicted from its 3.30 Mb genome. The whole proteome analysis supported phylum-level classification of M. roseus since most of the predicted proteins had closest matches in Bacteriodetes, Proteobacteria, Chlorobi, Firmicutes and deeply-branching bacterium Caldithrix abyssi, rather than in one particular phylum. Consistent with the ability of the bacterium to grow on complex carbohydrates, the genome analysis revealed more than one hundred glycoside hydrolases, glycoside transferases, polysaccharide lyases and carbohydrate esterases. The reconstructed central metabolism revealed pathways enabling the fermentation of complex organic substrates, as well as their complete oxidation through aerobic and anaerobic respiration. Genes encoding the photosynthetic and nitrogen-fixation machinery of green sulfur bacteria, as well as key enzymes of autotrophic carbon fixation pathways, were not identified. The M. roseus genome supports its affiliation to a novel phylum Ignavibateriae, representing the first step on the evolutionary pathway from heterotrophic ancestors of Bacteriodetes/Chlorobi group towards anaerobic photoautotrophic Chlorobi.

  20. Modelling the number of viable vegetative cells of Bacillus cereus passing through the stomach

    Wijnands, L.M.; Pielaat, A.; Dufrenne, J.B.; Zwietering, M.H.; Leusden, van F.M.

    2009-01-01

    Aims: Model the number of viable vegetative cells of B. cereus surviving the gastric passage after experiments in simulated gastric conditions. Materials and Methods: The inactivation of stationary and exponential phase vegetative cells of twelve different strains of Bacillus cereus, both mesophilic

  1. Minimizing the level of Bacillus cereus spores in farm tank milk

    Vissers, M.M.M.; Giffel, M.C.T.; Driehuis, F.; Jong, de P.; Lankveld, J.M.G.

    2007-01-01

    In a year-long survey on 24 Dutch farms, Bacillus cereus spore concentrations were measured in farm tank milk (FTM), feces, bedding material, mixed grass and corn silage, and soil from the pasture. The aim of this study was to determine, in practice, factors affecting the concentration of B. cereus

  2. Identification of proteins involved in the heat stress response of Bacillus cereus ATCC 14579

    Periago, P.M.; Schaik, van W.; Abee, T.; Wouters, J.A.

    2002-01-01

    To monitor the ability of the food-borne opportunistic pathogen Bacillus cereus to survive during minimal processing of food products, we determined its heat-adaptive response. During pre-exposure to 42°C, B. cereus ATCC 14579 adapts to heat exposure at the lethal temperature of 50°C (maximum

  3. Concerted action of sphingomyelinase and non-hemolytic enterotoxin in pathogenic Bacillus cereus.

    Viktoria M Doll

    Full Text Available Bacillus cereus causes food poisoning and serious non-gastrointestinal-tract infections. Non-hemolytic enterotoxin (Nhe, which is present in most B. cereus strains, is considered to be one of the main virulence factors. However, a B. cereus ΔnheBC mutant strain lacking Nhe is still cytotoxic to intestinal epithelial cells. In a screen for additional cytotoxic factors using an in vitro model for polarized colon epithelial cells we identified B. cereus sphingomyelinase (SMase as a strong inducer of epithelial cell death. Using single and double deletion mutants of sph, the gene encoding for SMase, and nheBC in B. cereus we demonstrated that SMase is an important factor for B. cereus cytotoxicity in vitro and pathogenicity in vivo. SMase substantially complemented Nhe induced cytotoxicity in vitro. In addition, SMase but not Nhe contributed significantly to the mortality rate of larvae in vivo in the insect model Galleria mellonella. Our study suggests that the role of B. cereus SMase as a secreted virulence factor for in vivo pathogenesis has been underestimated and that Nhe and SMase complement each other significantly to cause full B. cereus virulence hence disease formation.

  4. The alternative sigma factor sigmaB and the stress response of Bacillus cereus

    Schaik, van W.

    2005-01-01

    cum laude graduation (with distinction) The bacterium Bacillus cereus is responsible for a large number of cases of foodborne illness across the world. It is also an important cause of spoilage of food, in particular of milk and dairy-products. The growth and survival of B. cereus in food or during

  5. Air-liquid interface biofilms of Bacillus cereus: formation, sporulation, and dispersion

    Wijman, J.G.E.; Leeuw, de P.P.L.A.; Moezelaar, R.; Zwietering, M.H.; Abee, T.

    2007-01-01

    Biofilm formation by Bacillus cereus was assessed using 56 strains of B. cereus, including the two sequenced strains, ATCC 14579 and ATCC 10987. Biofilm production in microtiter plates was found to be strongly dependent on incubation time, temperature, and medium, as well as the strain used, with

  6. The impact of oxygen availability on stress survival and radical formation of Bacillus cereus

    Mols, J.M.; Pier, I.; Zwietering, M.H.; Abee, T.

    2009-01-01

    Both the growth and stress survival of two model Bacillus cereus strains, ATCC 14579 and ATCC 10987, were tested in three different conditions varying in oxygen availability, i.e., aerobic, microaerobic and anaerobic conditions. Both B. cereus strains displayed highest growth rates and yields under

  7. Dynamic predictive model for growth of Bacillus cereus from spores in cooked beans

    Kinetic growth data of Bacillus cereus from spores in cooked beans at several isothermal conditions (between 10 to 49C) were collected. Samples were inoculated with approximately 2 log CFU/g of heat-shocked (80C/10 min) spores and stored at isothermal temperatures. B. cereus populations were deter...

  8. Bacillus cereus un patógeno importante en el control microbiológico de los alimentos / Bacillus cereus an important pathogen the microbiological control of food

    Jennifer Sánchez

    2016-05-01

    Full Text Available Resumen Bacillus cereus es una bacteria genéticamente diversa que se encuentra comúnmente en el ambiente. Contamina los alimentos afectando la salud humana, al ingerir el microorganismo y/o sus toxinas, la emética o las enterotoxinas. En Colombia son escasos los reportes de intoxicación por B. cereus y se estima que hay un gran subregistro. Por lo anterior, se recomienda aumentar la vigilancia de este patógeno y realizar estudios sobre aspectos relevantes que permitan aplicar medidas de control para disminuir las intoxicaciones por B. cereus. El objetivo de esta revisión bibliográfica es presentar información actualizada sobre B. cereus, que incluye aspectos de su biología, taxonomía, toxinas, alimentos que contamina y metodologías para detectar, prevenir y controlar este microorganismo. La información presentada es de utilidad para el público en general, especialmente personas vinculadas al sector de alimentos, inocuidad alimentaria y control de procesos. / Abstract Bacillus cereus is a genetically diverse bacterium commonly found in the environment. It contaminates food, thus affecting human health upon ingestion of the microorganism and/or its toxins, the emetic or enterotoxins. In Colombia, reports of intoxication by B. cereus are scarce and under-registration is presumed. Because of this, it is recommended to increase surveillance of this pathogen and to develop studies on relevant aspects that allow the application of control measures to reduce intoxications by B. cereus. The aim of this review is to present current information on B. cereus, including aspects of its biology, taxonomy, toxins, food that it contaminates and methodologies for the detection, prevention and control of this microorganism. This information is useful for the general public, especially people involved with the food sector, food safety and process control.

  9. Detection of presumptive Bacillus cereus in the Irish dairy farm environment

    O’Connell A.

    2016-12-01

    Full Text Available The objective of the study was to isolate potential Bacillus cereus sensu lato (B. cereus s.l. from a range of farm environments. Samples of tap water, milking equipment rinse water, milk sediment filter, grass, soil and bulk tank milk were collected from 63 farms. In addition, milk liners were swabbed at the start and the end of milking, and swabs were taken from cows’ teats prior to milking. The samples were plated on mannitol egg yolk polymyxin agar (MYP and presumptive B. cereus s.l. colonies were isolated and stored in nutrient broth with 20% glycerol and frozen at -80 °C. These isolates were then plated on chromogenic medium (BACARA and colonies identified as presumptive B. cereus s.l. on this medium were subjected to 16S ribosomal RNA (rRNA sequencing. Of the 507 isolates presumed to be B. cereus s.l. on the basis of growth on MYP, only 177 showed growth typical of B. cereus s.l. on BACARA agar. The use of 16S rRNA sequencing to identify isolates that grew on BACARA confirmed that the majority of isolates belonged to B. cereus s.l. A total of 81 of the 98 isolates sequenced were tentatively identified as presumptive B. cereus s.l. Pulsed-field gel electrophoresis was carried out on milk and soil isolates from seven farms that were identified as having presumptive B. cereus s.l. No pulsotype was shared by isolates from soil and milk on the same farm. Presumptive B. cereus s.l. was widely distributed within the dairy farm environment.

  10. Genomic analysis of NAC transcription factors in banana (Musa acuminata) and definition of NAC orthologous groups for monocots and dicots.

    Cenci, Albero; Guignon, Valentin; Roux, Nicolas; Rouard, Mathieu

    2014-05-01

    Identifying the molecular mechanisms underlying tolerance to abiotic stresses is important in crop breeding. A comprehensive understanding of the gene families associated with drought tolerance is therefore highly relevant. NAC transcription factors form a large plant-specific gene family involved in the regulation of tissue development and responses to biotic and abiotic stresses. The main goal of this study was to set up a framework of orthologous groups determined by an expert sequence comparison of NAC genes from both monocots and dicots. In order to clarify the orthologous relationships among NAC genes of different species, we performed an in-depth comparative study of four divergent taxa, in dicots and monocots, whose genomes have already been completely sequenced: Arabidopsis thaliana, Vitis vinifera, Musa acuminata and Oryza sativa. Due to independent evolution, NAC copy number is highly variable in these plant genomes. Based on an expert NAC sequence comparison, we propose forty orthologous groups of NAC sequences that were probably derived from an ancestor gene present in the most recent common ancestor of dicots and monocots. These orthologous groups provide a curated resource for large-scale protein sequence annotation of NAC transcription factors. The established orthology relationships also provide a useful reference for NAC function studies in newly sequenced genomes such as M. acuminata and other plant species.

  11. Two New Secreted Proteases Generate a Casein-Derived Antimicrobial Peptide in Bacillus cereus Food Born Isolate Leading to Bacterial Competition in Milk

    Awatef Ouertani

    2018-06-01

    Full Text Available Milk and dairy products harbor a wide variety of bacterial species that compete for both limited resources and space. Under these competitive conditions, bacteria develop specialized mechanisms to protect themselves during niche colonization and nutrient acquisition processes. The bacterial antagonism mechanisms include the production of antimicrobial agents or molecules that facilitate competitor dispersal. In the present work, a bacterial strain designated RC6 was isolated from Ricotta and identified as Bacillus cereus. It generates antimicrobial peptide (AMP when grown in the presence of casein. The AMP was active against several species of Bacillus and Listeria monocytogenes. MALDI-TOF analysis of the RP-HPLC purified fractions and amino acid sequencing revealed a molecular mass of 751 Da comprised of a 6-residue sequence, YPVEPF. BLAST analysis showed that the AMP corresponds to the fractions 114–119 of bovine β-casein and represents the product of a specific proteolysis. Analysis of the purified proteolytic fractions from the B. cereus RC6 culture supernatant indicated that the presence of at least two different endoproteases is crucial for the generation of the AMP. Indeed, we were able to identify two new candidate endoproteases by means of genome sequencing and functional assignment using a 3D structural model and molecular docking of misannotated hypothetical proteins. In this light, the capacity of B. cereus RC6 to generate antimicrobial peptides from casein, through the production of extracellular enzymes, presents a new model of antagonistic competition leading to niche colonization. Hence, as a dairy product contaminant, this strategy may enable proteolytic B. cereus RC6 niche specialization in milk matrices.

  12. Effect of diet supplementation with Toyocerin (R) (Bacillus cereus var. toyoi) on performance and health of growing rabbits.

    Trocino, A.; Xiccato, G.; Carraro, L.; Jimenez, G.

    2005-01-01

    Two trials were performed to evaluate the effect of a dietary supplementation with Bacillus cereus var. toyoi on performance and health of growing rabbits. The studies were conducted in two commercial farms using the same experimental diets. In the first trial, 216 rabbits were controlled from 35 d (weaning) until 70 d of age. In the second trial, 180 rabbits were controlled from 37 until 79 d of age. At weaning, rabbits were put into bicellular cages, divided into three groups and fed the ex...

  13. Complete genome sequence and comparative genomic analysis of Mycobacterium massiliense JCM 15300 in the Mycobacterium abscessus group reveal a conserved genomic island MmGI-1 related to putative lipid metabolism.

    Tsuyoshi Sekizuka

    Full Text Available Mycobacterium abscessus group subsp., such as M. massiliense, M. abscessus sensu stricto and M. bolletii, are an environmental organism found in soil, water and other ecological niches, and have been isolated from respiratory tract infection, skin and soft tissue infection, postoperative infection of cosmetic surgery. To determine the unique genetic feature of M. massiliense, we sequenced the complete genome of M. massiliense type strain JCM 15300 (corresponding to CCUG 48898. Comparative genomic analysis was performed among Mycobacterium spp. and among M. abscessus group subspp., showing that additional ß-oxidation-related genes and, notably, the mammalian cell entry (mce operon were located on a genomic island, M. massiliense Genomic Island 1 (MmGI-1, in M. massiliense. In addition, putative anaerobic respiration system-related genes and additional mycolic acid cyclopropane synthetase-related genes were found uniquely in M. massiliense. Japanese isolates of M. massiliense also frequently possess the MmGI-1 (14/44, approximately 32% and three unique conserved regions (26/44; approximately 60%, 34/44; approximately 77% and 40/44; approximately 91%, as well as isolates of other countries (Malaysia, France, United Kingdom and United States. The well-conserved genomic island MmGI-1 may play an important role in high growth potential with additional lipid metabolism, extra factors for survival in the environment or synthesis of complex membrane-associated lipids. ORFs on MmGI-1 showed similarities to ORFs of phylogenetically distant M. avium complex (MAC, suggesting that horizontal gene transfer or genetic recombination events might have occurred within MmGI-1 among M. massiliense and MAC.

  14. Social evolution. Genomic signatures of evolutionary transitions from solitary to group living.

    Kapheim, Karen M; Pan, Hailin; Li, Cai; Salzberg, Steven L; Puiu, Daniela; Magoc, Tanja; Robertson, Hugh M; Hudson, Matthew E; Venkat, Aarti; Fischman, Brielle J; Hernandez, Alvaro; Yandell, Mark; Ence, Daniel; Holt, Carson; Yocum, George D; Kemp, William P; Bosch, Jordi; Waterhouse, Robert M; Zdobnov, Evgeny M; Stolle, Eckart; Kraus, F Bernhard; Helbing, Sophie; Moritz, Robin F A; Glastad, Karl M; Hunt, Brendan G; Goodisman, Michael A D; Hauser, Frank; Grimmelikhuijzen, Cornelis J P; Pinheiro, Daniel Guariz; Nunes, Francis Morais Franco; Soares, Michelle Prioli Miranda; Tanaka, Érica Donato; Simões, Zilá Luz Paulino; Hartfelder, Klaus; Evans, Jay D; Barribeau, Seth M; Johnson, Reed M; Massey, Jonathan H; Southey, Bruce R; Hasselmann, Martin; Hamacher, Daniel; Biewer, Matthias; Kent, Clement F; Zayed, Amro; Blatti, Charles; Sinha, Saurabh; Johnston, J Spencer; Hanrahan, Shawn J; Kocher, Sarah D; Wang, Jun; Robinson, Gene E; Zhang, Guojie

    2015-06-05

    The evolution of eusociality is one of the major transitions in evolution, but the underlying genomic changes are unknown. We compared the genomes of 10 bee species that vary in social complexity, representing multiple independent transitions in social evolution, and report three major findings. First, many important genes show evidence of neutral evolution as a consequence of relaxed selection with increasing social complexity. Second, there is no single road map to eusociality; independent evolutionary transitions in sociality have independent genetic underpinnings. Third, though clearly independent in detail, these transitions do have similar general features, including an increase in constrained protein evolution accompanied by increases in the potential for gene regulation and decreases in diversity and abundance of transposable elements. Eusociality may arise through different mechanisms each time, but would likely always involve an increase in the complexity of gene networks. Copyright © 2015, American Association for the Advancement of Science.

  15. A core phylogeny of Dictyostelia inferred from genomes representative of the eight major and minor taxonomic divisions of the group.

    Singh, Reema; Schilde, Christina; Schaap, Pauline

    2016-11-17

    Dictyostelia are a well-studied group of organisms with colonial multicellularity, which are members of the mostly unicellular Amoebozoa. A phylogeny based on SSU rDNA data subdivided all Dictyostelia into four major groups, but left the position of the root and of six group-intermediate taxa unresolved. Recent phylogenies inferred from 30 or 213 proteins from sequenced genomes, positioned the root between two branches, each containing two major groups, but lacked data to position the group-intermediate taxa. Since the positions of these early diverging taxa are crucial for understanding the evolution of phenotypic complexity in Dictyostelia, we sequenced six representative genomes of early diverging taxa. We retrieved orthologs of 47 housekeeping proteins with an average size of 890 amino acids from six newly sequenced and eight published genomes of Dictyostelia and unicellular Amoebozoa and inferred phylogenies from single and concatenated protein sequence alignments. Concatenated alignments of all 47 proteins, and four out of five subsets of nine concatenated proteins all produced the same consensus phylogeny with 100% statistical support. Trees inferred from just two out of the 47 proteins, individually reproduced the consensus phylogeny, highlighting that single gene phylogenies will rarely reflect correct species relationships. However, sets of two or three concatenated proteins again reproduced the consensus phylogeny, indicating that a small selection of genes suffices for low cost classification of as yet unincorporated or newly discovered dictyostelid and amoebozoan taxa by gene amplification. The multi-locus consensus phylogeny shows that groups 1 and 2 are sister clades in branch I, with the group-intermediate taxon D. polycarpum positioned as outgroup to group 2. Branch II consists of groups 3 and 4, with the group-intermediate taxon Polysphondylium violaceum positioned as sister to group 4, and the group-intermediate taxon Dictyostelium polycephalum

  16. Isolation and characterization of Bacillus cereus IST105 from electroplating effluent for detoxification of hexavalent chromium.

    Naik, Umesh Chandra; Srivastava, Shaili; Thakur, Indu Shekhar

    2011-08-01

    Electroplating industries are the main sources of heavy metals, chromium, nickel, lead, zinc, cadmium and copper. The highest concentrations of chromium (VI) in the effluent cause a direct hazards to human and animals. Therefore, there is a need of an effective and affordable biotechnological solution for removal of chromium from electroplating effluent. Bacterial strains were isolated from electroplating effluent to find out higher tolerant isolate against chromate. The isolate was identified by 16S rDNA sequence analysis. Absorbed chromium level of bacterium was determined by inductively coupled plasma-atomic emission spectrometer (ICP-AES), atomic absorption spectrophotometer (AAS), scanning electron microscope (SEM), transmission electron microscope (TEM) and energy dispersive X-ray analysis (EDX). Removal of metals by bacterium from the electroplating effluent eventually led to the detoxification of effluent confirmed by MTT assay. Conformational changes of functional groups of bacterial cell surface were studied through Fourier transform infrared spectroscopy. The chromate tolerant isolate was identified as Bacillus cereus. Bacterium has potency to remove more than 75% of chromium as measured by ICP-AES and AAS. The study indicated the accumulation of chromium (VI) on bacterial cell surface which was confirmed by the SEM-EDX and TEM analysis. The biosorption of metals from the electroplating effluent eventually led to the detoxification of effluent. The increased survivability of Huh7 cells cultured with treated effluent also confirmed the detoxification as examined by MTT assay. Isolated strain B. cereus was able to remove and detoxify chromium (VI). It would be an efficient tool of the biotechnological approach in mitigating the heavy metal pollutants.

  17. Arthromitus (Bacillus cereus) symbionts in the cockroach Blaberus giganteus: dietary influences on bacterial development and population density

    Feinberg, L.; Jorgensen, J.; Haselton, A.; Pitt, A.; Rudner, R.; Margulis, L.

    1999-01-01

    The filamentous spore-forming bacterium Arthromitus, discovered in termites, millipedes, sow bugs and other soil-dwelling arthropods by Leidy (1850), is the intestinal stage of Bacillus cereus. We extend the range of Arthromitus habitats to include the hindgut of Blaberus giganteus, the large tropical American cockroach. The occurrence and morphology of the intestinal form of the bacillus were compared in individual cockroaches (n=24) placed on four different diet regimes: diurnally maintained insects fed (1) dog food, (2) soy protein only, (3)purified cellulose only, and (4) a dog food-fed group maintained in continuous darkness. Food quality exerted strong influence on population densities and developmental stages of the filamentous bacterium and on fecal pellet composition. The most dramatic rise in Arthromitus populations, defined as the spore-forming filament intestinal stage, occurred in adult cockroaches kept in the dark on a dog food diet. Limited intake of cellulose or protein alone reduced both the frequency of Arthromitus filaments and the rate of weight gain of the insects. Spores isolated from termites, sow bugs, cockroaches and moths, grown on various hard surfaces display a branching mobility and resistance to antibiotics characteristic to group I Bacilli whose members include B. cereus, B. circulans, B. alvei and B. macerans. DNA isolated from pure cultures of these bacilli taken from the guts of Blaberus giganteus (cockroach), Junonia coenia (moth), Porcellio scaber (sow bug) and Cryptotermes brevis (termite) and subjected to Southern hybridization with a 23S-5S B. subtilis ribosomal sequence probe verified that they are indistinguishable from laboratory strains of Bacillus cereus.

  18. Genetic diversity of clinical isolates of Bacillus cereus using multilocus sequence typing

    Pruckler James M

    2008-11-01

    Full Text Available Abstract Background Bacillus cereus is most commonly associated with foodborne illness (diarrheal and emetic but is also an opportunistic pathogen that can cause severe and fatal infections. Several multilocus sequence typing (MLST schemes have recently been developed to genotype B. cereus and analysis has suggested a clonal or weakly clonal population structure for B. cereus and its close relatives B. anthracis and B. thuringiensis. In this study we used MLST to determine if B. cereus isolates associated with illnesses of varying severity (e.g., severe, systemic vs. gastrointestinal (GI illness were clonal or formed clonal complexes. Results A retrospective analysis of 55 clinical B. cereus isolates submitted to the Centers for Disease Control and Prevention between 1954 and 2004 was conducted. Clinical isolates from severe infections (n = 27, gastrointestinal (GI illness (n = 18, and associated isolates from food (n = 10 were selected for analysis using MLST. The 55 isolates were diverse and comprised 38 sequence types (ST in two distinct clades. Of the 27 isolates associated with serious illness, 13 clustered in clade 1 while 14 were in clade 2. Isolates associated with GI illness were also found throughout clades 1 and 2, while no isolates in this study belonged to clade 3. All the isolates from this study belonging to the clade 1/cereus III lineage were associated with severe disease while isolates belonging to clade1/cereus II contained isolates primarily associated with severe disease and emetic illness. Only three STs were observed more than once for epidemiologically distinct isolates. Conclusion STs of clinical B. cereus isolates were phylogenetically diverse and distributed among two of three previously described clades. Greater numbers of strains will need to be analyzed to confirm if specific lineages or clonal complexes are more likely to contain clinical isolates or be associated with specific illness, similar to B. anthracis and

  19. Influencing governance of a public-private partnership in plant genomics: The societal interface group as a new instrument for public involvement

    Hanssen, L.; Gremmen, B.

    2013-01-01

    The Centre for BioSystems Genomics (CBSG) is a Dutch public-private partnership in plant genomics active in potato and tomato research and exploitation. Its Societal Interface Group (SIG) has been developed to inform its communication strategy and governance practice. This new instrument identifies

  20. Direct detection of toxigenic Bacillus cereus in dietary complement for children and cassava starch

    Jnnifer A. Sánchez; Margarita M. Correa; Ángel E. Aceves Dies; Laura M. Castañeda Sandoval

    2014-01-01

    Bacillus cereus is a food contaminant and a known human pathogen that can cause emetic and diarrheal syndromes. In this study we evaluated the presence of toxigenic B. cereus by multiplex PCR directly in dietary complement for children and cassava starch samples collected on Medellin, Colombia. Of 75 dietary complement for children samples evaluated, 70.7% were contaminated with toxigenic B. cereus and four different toxigenic consortia were detected: I: nheA, hblC, cytK (9.8%), II: nheA, hbl...

  1. Exploring the Potential Emotional and Behavioural Impact of Providing Personalised Genomic Risk Information to the Public: A Focus Group Study.

    Smit, Amelia K; Keogh, Louise A; Newson, Ainsley J; Hersch, Jolyn; Butow, Phyllis; Cust, Anne E

    2015-01-01

    To explore the potential emotional and behavioural impact of providing information on personalised genomic risk to the public, using melanoma as an example, to aid research translation. We conducted four focus groups in which 34 participants were presented with a hypothetical scenario of an individual's lifetime genomic risk of melanoma (using the term 'genetic risk'). We asked about understanding of genetic risk, who would choose to receive this risk information, potential emotional and behavioural impacts, and other concerns or potential benefits. Data were analysed thematically. Participants thought this risk information could potentially motivate preventive behaviours such as sun protection and related it to screening for other diseases including breast cancer. Factors identified as influencing the decision to receive genetic risk information included education level, children, age and gender. Participants identified potential negative impacts on the recipient such as anxiety and worry, and proposed that this could be mitigated by providing additional explanatory and prevention information, and contact details of a health professional for further discussion. Participants' concerns included workplace and insurance discrimination. Participants recognised the potential for both positive and negative emotional and behavioural impacts related to receiving information on the personalised genomic risk of melanoma. © 2015 S. Karger AG, Basel.

  2. Cereus peruvianus (Koubo new cactus fruit for the world

    Yosef Mizrahi

    2014-03-01

    Full Text Available Several different species of the columnar cacti of the genera Stenocereus and Pachycereus, were introduced into different semi-arid ecozones in Israel and most of these efforts were of disappointing outcomes, the only exception being the Cereus peruvianus (L. Miller,which bore plenty of fruits, some of them of good taste. The original seeds of this plant were obtained from the late Mr. Amram (Ron Kodish, who collected seeds from various private gardens in Southern California which bore fruits of reasonable qualities. The initial success of this species led us to initiate an intensive research study, and today it is already fruit-crop, marketed mainly in Israel under the name " Koubo" . This paper will describe our work of domestication of this new cactus fruit crop in Israel.

  3. Recent research progress with phospholipase C from Bacillus cereus.

    Lyu, Yan; Ye, Lidan; Xu, Jun; Yang, Xiaohong; Chen, Weiwei; Yu, Hongwei

    2016-01-01

    Phospholipase C (PLC) catalyzes the hydrolysis of phospholipids to produce phosphate monoesters and diacylglycerol. It has many applications in the enzymatic degumming of plant oils. PLC Bc , a bacterial PLC from Bacillus cereus, is an optimal choice for this activity in terms of its wide substrate spectrum, high activity, and approved safety. Unfortunately, its large-scale production and reliable high-throughput screening of PLC Bc remain challenging. Herein, we summarize the research progress regarding PLC Bc with emphasis on the screening methods, expression systems, catalytic mechanisms and inhibitor of PLC Bc . This review hopefully will inspire new achievements in related areas, to promote the sustainable development of PLC Bc and its application.

  4. Food poisoning potential of Bacillus cereus strains from Norwegian dairies.

    Stenfors Arnesen, Lotte P; O'sullivan, Kristin; Granum, Per Einar

    2007-05-10

    Characteristics concerning diarrhoeal potential were investigated in B. cereus dairy strains. The thirty-nine strains, isolated from whipping cream, were tested for cytotoxicity after culturing at human body temperature as well as 25 degrees C and 32 degrees C. At 37 degrees C, none of the strains were highly cytotoxic. This observation suggests that those strains should be considered to pose a minor risk with regard to diarrhoeal food poisoning. However, some strains were moderately or highly cytotoxic when grown at 25 degrees C and 32 degrees C. While the majority of the strains were able to grow at refrigeration temperatures, only four B. weihenstephanensis strains were identified among them when subjected to discriminative PCR assays and growth temperatures which delimit this species.

  5. Population genomic analysis of strain variation in Leptospirillum group II bacteria involved in acid mine drainage formation.

    Simmons, Sheri L; Dibartolo, Genevieve; Denef, Vincent J; Goltsman, Daniela S Aliaga; Thelen, Michael P; Banfield, Jillian F

    2008-07-22

    Deeply sampled community genomic (metagenomic) datasets enable comprehensive analysis of heterogeneity in natural microbial populations. In this study, we used sequence data obtained from the dominant member of a low-diversity natural chemoautotrophic microbial community to determine how coexisting closely related individuals differ from each other in terms of gene sequence and gene content, and to uncover evidence of evolutionary processes that occur over short timescales. DNA sequence obtained from an acid mine drainage biofilm was reconstructed, taking into account the effects of strain variation, to generate a nearly complete genome tiling path for a Leptospirillum group II species closely related to L. ferriphilum (sampling depth approximately 20x). The population is dominated by one sequence type, yet we detected evidence for relatively abundant variants (>99.5% sequence identity to the dominant type) at multiple loci, and a few rare variants. Blocks of other Leptospirillum group II types ( approximately 94% sequence identity) have recombined into one or more variants. Variant blocks of both types are more numerous near the origin of replication. Heterogeneity in genetic potential within the population arises from localized variation in gene content, typically focused in integrated plasmid/phage-like regions. Some laterally transferred gene blocks encode physiologically important genes, including quorum-sensing genes of the LuxIR system. Overall, results suggest inter- and intrapopulation genetic exchange involving distinct parental genome types and implicate gain and loss of phage and plasmid genes in recent evolution of this Leptospirillum group II population. Population genetic analyses of single nucleotide polymorphisms indicate variation between closely related strains is not maintained by positive selection, suggesting that these regions do not represent adaptive differences between strains. Thus, the most likely explanation for the observed patterns of

  6. Population genomic analysis of strain variation in Leptospirillum group II bacteria involved in acid mine drainage formation.

    Sheri L Simmons

    2008-07-01

    Full Text Available Deeply sampled community genomic (metagenomic datasets enable comprehensive analysis of heterogeneity in natural microbial populations. In this study, we used sequence data obtained from the dominant member of a low-diversity natural chemoautotrophic microbial community to determine how coexisting closely related individuals differ from each other in terms of gene sequence and gene content, and to uncover evidence of evolutionary processes that occur over short timescales. DNA sequence obtained from an acid mine drainage biofilm was reconstructed, taking into account the effects of strain variation, to generate a nearly complete genome tiling path for a Leptospirillum group II species closely related to L. ferriphilum (sampling depth approximately 20x. The population is dominated by one sequence type, yet we detected evidence for relatively abundant variants (>99.5% sequence identity to the dominant type at multiple loci, and a few rare variants. Blocks of other Leptospirillum group II types ( approximately 94% sequence identity have recombined into one or more variants. Variant blocks of both types are more numerous near the origin of replication. Heterogeneity in genetic potential within the population arises from localized variation in gene content, typically focused in integrated plasmid/phage-like regions. Some laterally transferred gene blocks encode physiologically important genes, including quorum-sensing genes of the LuxIR system. Overall, results suggest inter- and intrapopulation genetic exchange involving distinct parental genome types and implicate gain and loss of phage and plasmid genes in recent evolution of this Leptospirillum group II population. Population genetic analyses of single nucleotide polymorphisms indicate variation between closely related strains is not maintained by positive selection, suggesting that these regions do not represent adaptive differences between strains. Thus, the most likely explanation for the

  7. Admixture patterns and genetic differentiation in negrito groups from West Malaysia estimated from genome-wide SNP data.

    Jinam, Timothy A; Phipps, Maude E; Saitou, Naruya

    2013-01-01

    Southeast Asia houses various culturally and linguistically diverse ethnic groups. In Malaysia, where the Malay, Chinese, and Indian ethnic groups form the majority, there exist minority groups such as the "negritos" who are believed to be descendants of the earliest settlers of Southeast Asia. Here we report patterns of genetic substructure and admixture in two Malaysian negrito populations (Jehai and Kensiu), using ~50,000 genome-wide single-nucleotide polymorphism (SNP) data. We found traces of recent admixture in both the negrito populations, particularly in the Jehai, with the Malay through principal component analysis and STRUCTURE analysis software, which suggested that the admixture was as recent as one generation ago. We also identified significantly differentiated nonsynonymous SNPs and haplotype blocks related to intracellular transport, metabolic processes, and detection of stimulus. These results highlight the different levels of admixture experienced by the two Malaysian negritos. Delineating admixture and differentiated genomic regions should be of importance in designing and interpretation of molecular anthropology and disease association studies. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.

  8. Genomic Analysis of the Emergence and Rapid Global Dissemination of the Clonal Group 258 Klebsiella pneumoniae Pandemic.

    Jolene R Bowers

    Full Text Available Multidrug-resistant Klebsiella pneumoniae producing the KPC carbapenemase have rapidly spread throughout the world, causing severe healthcare-associated infections with limited antimicrobial treatment options. Dissemination of KPC-producing K. pneumoniae is largely attributed to expansion of a single dominant strain, ST258. In this study, we explore phylogenetic relationships and evolution within ST258 and its clonal group, CG258, using whole genome sequence analysis of 167 isolates from 20 countries collected over 17 years. Our results show a common ST258 ancestor emerged from its diverse parental clonal group around 1995 and likely acquired blaKPC prior to dissemination. Over the past two decades, ST258 has remained highly clonal despite diversity in accessory elements and divergence in the capsule polysaccharide synthesis locus. Apart from the large recombination event that gave rise to ST258, few mutations set it apart from its clonal group. However, one mutation occurs in a global transcription regulator. Characterization of outer membrane protein sequences revealed a profile in ST258 that includes a truncated OmpK35 and modified OmpK37. Our work illuminates potential genomic contributors to the pathogenic success of ST258, helps us better understand the global dissemination of this strain, and identifies genetic markers unique to ST258.

  9. iTRAQ-based proteomic analysis of LI-F type peptides produced by Paenibacillus polymyxa JSa-9 mode of action against Bacillus cereus.

    Han, Jinzhi; Gao, Peng; Zhao, Shengming; Bie, Xiaomei; Lu, Zhaoxin; Zhang, Chong; Lv, Fengxia

    2017-01-06

    LI-F type peptides (AMP-jsa9) produced by Paenibacillus polymyxa JSa-9 are a group of cyclic lipodepsipeptide antibiotics that exhibit a broad antimicrobial spectrum against Gram-positive bacteria and filamentous fungi, especially Bacillus cereus and Fusarium moniliforme. In this study, to better understand the antibacterial mechanism of AMP-jsa9 against B. cereus, the ultrastructure of AMP-jsa9-treated B. cereus cells was observed by both atomic force microscopy and transmission electron microscopy, and quantitative proteomic analysis was performed on proteins extracted from treated and untreated bacterial cells by using isobaric tag for relative and absolute quantitation (iTRAQ) labeling and LC-MS/MS analysis to access differentially expressed proteins. Furthermore, multiple experiments were conducted to validate the results of the proteomic analysis, including determinations of ATP, NAD (+) H, NADP (+) H, reactive oxygen species (ROS), the activities of catalase (CAT) and superoxide dismutase (SOD), and the relative expression of target genes by quantitative real-time PCR. Bacterial cells exposed to AMP-jsa9 showed irregular surfaces with bleb projections and concaves; we hypothesize that AMP-jsa9 penetrated the cell wall and was anchored on the cytoplasmic membrane and that ROS accumulated in the cell membrane after treatment with AMP-jsa9, modulating the bacterial membrane properties and increasing membrane permeability. Consequently, the blebs were formed on the cell wall by the impulsive force of the leakage of intercellular contents. iTRAQ-based proteomic analysis detected a total of 1317 proteins, including 176 differentially expressed proteins (75 upregulated (fold >2) and 101 downregulated (fold AMP-jsa9 action against B. cereus can be summarized as: (i) inhibition of bacterial sporulation, thiamine biosynthesis, energy metabolism, DNA transcription and translation, and cell wall biosynthesis, through direct regulation of protein levels; and (ii

  10. Frugivory and seed dispersal by birds in Cereus jamacaru DC. ssp. jamacaru (Cactaceae) in the Caatinga of Northeastern Brazil.

    Gomes, V G N; Quirino, Z G M; Araujo, H F P

    2014-02-01

    Studies of the dispersal modes of plants aid our understanding of the dynamics of resource and its availability for dispersal agents. The present work sought to characterize the fruiting patterns of the native Caatinga (dryland) cactus Cereus jamacaru, identify its principal dispersers, and evaluate the effects of seed passage through digestive tract of dispersers on its germination. Cereus jamacaru present an annual fruiting pattern and fruiting peaks occurred during June/2009 and February/2010. A total of 135 visits by nine species of resident Caatinga bird species were recorded. The most frequent visiting bird species were Paroaria dominicana and Euphonia chlorotica. Length of bird visits varied from 15 seconds to 4 minutes and seeds removed by birds travelled 10.6 ± 11.2 m until dispersers make the first landing perch, in some cases more than 40 meters away. Germination tests show birds had a high quantity of viable seeds of C. jamacaru in its feces. Seeds that passed through the digestive tract of birds showed a similar germinability of the seeds of the control group. However, the seeds dispersed by birds showed lowest mean germination time related to the control group seeds. This study highlights the potential role of birds as seed dispersers of C. jamacaru, swallowing the whole seeds and defecating intact seeds, accelerating the germination process and transporting seeds away from the mother plant.

  11. Biodegradation and corrosion behavior of manganese oxidizer Bacillus cereus ACE4 in diesel transporting pipeline

    Rajasekar, A.; Ganesh Babu, T.; Karutha Pandian, S.; Maruthamuthu, S.; Palaniswamy, N.; Rajendran, A.

    2007-01-01

    The degradation problem of petroleum products arises since hydrocarbon acts as an excellent food source for a wide variety of microorganisms. Microbial activity leads to unacceptable level of turbidity, corrosion of pipeline and souring of stored product. The present study emphasizes the role of Bacillus cereus ACE4 on degradation of diesel and its influence on corrosion of API 5LX steel. A demonstrating bacterial strain ACE4 was isolated from corrosion products and 16S rRNA gene sequence analysis showed that it has more than 99% similarity with B. cereus. The biodegradation and corrosion studies revealed that B. cereus degraded the aliphatic protons and aromatic protons in diesel and is capable of oxidizing ferrous/manganese into oxides. This is the first report that discloses the involvement of manganese oxidizer B. cereus ACE4 on biodegradation of diesel and its influence on corrosion in a tropical country pipeline

  12. High-density spore production of a B. cereus aquaculture biological agent by nutrient supplementation

    Lalloo, R

    2009-05-01

    Full Text Available Previous studies have demonstrated the efficacy of our Bacillus cereus isolate (NRRL 100132) in reducing concentrations of nitrogenous wastes and inhibiting growth of fish pathogens. In vivo efficacy and tolerance to a range of physiological...

  13. RNA-seq analysis of antibiotic-producing Bacillus subtilis SC-8 in response to signal peptide PapR of Bacillus cereus.

    Yeo, In-Cheol; Lee, Nam Keun; Yang, Byung Wook; Hahm, Young Tae

    2014-01-01

    Bacillus subtilis SC-8 produces an antibiotic that has narrow antagonistic activity against bacteria in the Bacillus cereus group. In B. cereus group bacteria, peptide-activating PlcR (PapR) plays a significant role in regulating the transcription of virulence factors. When B. subtilis SC-8 and B. cereus are co-cultured, PapR is assumed to stimulate antibiotic production by B. subtilis SC-8. To better understand the effect of PapR on this interspecies interaction, the global transcriptome profile of B. subtilis SC-8 was analyzed in the presence of PapR. Significant changes were detected in 12.8 % of the total transcripts. Genes related to amino acid transport and metabolism (16.5 %) and transcription (15 %) were mainly upregulated, whereas genes involved in carbohydrate transport and metabolism (12.7 %) were markedly downregulated. The expression of genes related to transcription, including several transcriptional regulators and proteins involved in tRNA biosynthesis, was increased. The expression levels of genes associated with several transport systems, such as antibiotic, cobalt, and iron complex transporters, was also significantly altered. Among the downregulated genes were transcripts associated with spore formation, the subtilosin A gene cluster, and nitrogen metabolism.

  14. PENGARUH EKSTRAK ANDALIMAN (Zanthoxyium acanthopodium DC TERHADAP PERMEABILITAS DAN HIDROFOBISITAS Bacillus cereus [Effect of Andaliman (Zanthoxylum acanthopodium DC Extracts upon Permeability and Hidrophobicity of Bacillus cereus

    Sedarnawati Yasni2

    2005-04-01

    Full Text Available Andaliman spice is usually added as one of main spices in cooked fish and meat. Andaliman seeds were extracted using maceration method with nonpolar, semipolar and polar solvents. The result showed that the three kinds of andaliman extract had antibacterial activity on Bacillus cereus, especially during exponential phase (8 hour incubation period. Ethyl-acetate extract of Andaliman showed the highest antibacterial activity toward B. cereus with MIC and MBC values being 0.2% and 0.8% respectively. The permeability of B. cereus was observed at the dose of 2.5 MIC and 60.30% hydrophobicity leakage was obtained at 6% andaliman extracted by ethyl-acetate.

  15. Occurrence and significance of Bacillus cereus and Bacillus thuringiensis in ready-to-eat food

    Rosenquist, Hanne; Ørum-Smidt, Lasse; Andersen, Sigrid R

    2005-01-01

    Among 48,901 samples of ready-to-eat food products at the Danish retail market, 0.5% had counts of Bacillus cereus-like bacteria above 10(4) cfu g(-1). The high counts were most frequently found in starchy, cooked products, but also in fresh cucumbers and tomatoes. Forty randomly selected strains....../or content of cry genes. Thus, a large proportion of the B. cereus-like organisms present in food may belong to B. thuringiensis....

  16. Competitive exclusion as a mode of action of a novel Bacillus cereus aquaculture biological agent

    Lalloo, R

    2010-01-01

    Full Text Available et al. 2001, Irianto and Austin, 2002, Hong et al. 2005). Many 12 of these mechanisms only apply to probiotics added to feed, but the latter three are relevant to 13 water borne additives such as B. cereus. 14 15 The bioremediation capability... its attractiveness as a probiotic 10 and biological agent for aquaculture. The siderophore producing capability of the B. cereus 11 isolate addresses the severe shortage of probiotics able to facilitate competitive exclusion based 12 on iron...

  17. Genomic identification of WRKY transcription factors in carrot (Daucus carota) and analysis of evolution and homologous groups for plants.

    Li, Meng-Yao; Xu, Zhi-Sheng; Tian, Chang; Huang, Ying; Wang, Feng; Xiong, Ai-Sheng

    2016-03-15

    WRKY transcription factors belong to one of the largest transcription factor families. These factors possess functions in plant growth and development, signal transduction, and stress response. Here, we identified 95 DcWRKY genes in carrot based on the carrot genomic and transcriptomic data, and divided them into three groups. Phylogenetic analysis of WRKY proteins from carrot and Arabidopsis divided these proteins into seven subgroups. To elucidate the evolution and distribution of WRKY transcription factors in different species, we constructed a schematic of the phylogenetic tree and compared the WRKY family factors among 22 species, which including plants, slime mold and protozoan. An in-depth study was performed to clarify the homologous factor groups of nine divergent taxa in lower and higher plants. Based on the orthologous factors between carrot and Arabidopsis, 38 DcWRKY proteins were calculated to interact with other proteins in the carrot genome. Yeast two-hybrid assay showed that DcWRKY20 can interact with DcMAPK1 and DcMAPK4. The expression patterns of the selected DcWRKY genes based on transcriptome data and qRT-PCR suggested that those selected DcWRKY genes are involved in root development, biotic and abiotic stress response. This comprehensive analysis provides a basis for investigating the evolution and function of WRKY genes.

  18. Phylogeographic and genome-wide investigations of Vietnam ethnic groups reveal signatures of complex historical demographic movements.

    Pischedda, S; Barral-Arca, R; Gómez-Carballa, A; Pardo-Seco, J; Catelli, M L; Álvarez-Iglesias, V; Cárdenas, J M; Nguyen, N D; Ha, H H; Le, A T; Martinón-Torres, F; Vullo, C; Salas, A

    2017-10-03

    The territory of present-day Vietnam was the cradle of one of the world's earliest civilizations, and one of the first world regions to develop agriculture. We analyzed the mitochondrial DNA (mtDNA) complete control region of six ethnic groups and the mitogenomes from Vietnamese in The 1000 Genomes Project (1000G). Genome-wide data from 1000G (~55k SNPs) were also investigated to explore different demographic scenarios. All Vietnamese carry South East Asian (SEA) haplotypes, which show a moderate geographic and ethnic stratification, with the Mong constituting the most distinctive group. Two new mtDNA clades (M7b1a1f1 and F1f1) point to historical gene flow between the Vietnamese and other neighboring countries. Bayesian-based inferences indicate a time-deep and continuous population growth of Vietnamese, although with some exceptions. The dramatic population decrease experienced by the Cham 700 years ago (ya) fits well with the Nam tiến ("southern expansion") southwards from their original heartland in the Red River Delta. Autosomal SNPs consistently point to important historical gene flow within mainland SEA, and add support to a main admixture event occurring between Chinese and a southern Asian ancestral composite (mainly represented by the Malay). This admixture event occurred ~800 ya, again coinciding with the Nam tiến.

  19. Torix group Rickettsia are widespread in Culicoides biting midges (Diptera: Ceratopogonidae), reach high frequency and carry unique genomic features.

    Pilgrim, Jack; Ander, Mats; Garros, Claire; Baylis, Matthew; Hurst, Gregory D D; Siozios, Stefanos

    2017-10-01

    There is increasing interest in the heritable bacteria of invertebrate vectors of disease as they present novel targets for control initiatives. Previous studies on biting midges (Culicoides spp.), known to transmit several RNA viruses of veterinary importance, have revealed infections with the endosymbiotic bacteria, Wolbachia and Cardinium. However, rickettsial symbionts in these vectors are underexplored. Here, we present the genome of a previously uncharacterized Rickettsia endosymbiont from Culicoides newsteadi (RiCNE). This genome presents unique features potentially associated with host invasion and adaptation, including genes for the complete non-oxidative phase of the pentose phosphate pathway, and others predicted to mediate lipopolysaccharides and cell wall modification. Screening of 414 Culicoides individuals from 29 Palearctic or Afrotropical species revealed that Rickettsia represent a widespread but previously overlooked association, reaching high frequencies in midge populations and present in 38% of the species tested. Sequence typing clusters the Rickettsia within the Torix group of the genus, a group known to infect several aquatic and hematophagous taxa. FISH analysis indicated the presence of Rickettsia bacteria in ovary tissue, indicating their maternal inheritance. Given the importance of biting midges as vectors, a key area of future research is to establish the impact of this endosymbiont on vector competence. © 2017 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Framework for development of physician competencies in genomic medicine: report of the Competencies Working Group of the Inter-Society Coordinating Committee for Physician Education in Genomics.

    Korf, Bruce R; Berry, Anna B; Limson, Melvin; Marian, Ali J; Murray, Michael F; O'Rourke, P Pearl; Passamani, Eugene R; Relling, Mary V; Tooker, John; Tsongalis, Gregory J; Rodriguez, Laura L

    2014-11-01

    Completion of the Human Genome Project, in conjunction with dramatic reductions in the cost of DNA sequencing and advances in translational research, is gradually ushering genomic discoveries and technologies into the practice of medicine. The rapid pace of these advances is opening up a gap between the knowledge available about the clinical relevance of genomic information and the ability of clinicians to include such information in their medical practices. This educational gap threatens to be rate limiting to the clinical adoption of genomics in medicine. Solutions will require not only a better understanding of the clinical implications of genetic discoveries but also training in genomics at all levels of professional development, including for individuals in formal training and others who long ago completed such training. The National Human Genome Research Institute has convened the Inter-Society Coordinating Committee for Physician Education in Genomics (ISCC) to develop and share best practices in the use of genomics in medicine. The ISCC has developed a framework for development of genomics practice competencies that may serve as a starting point for formulation of competencies for physicians in various medical disciplines.

  1. Metabolomic analysis of cooperative adaptation between co-cultured Bacillus cereus and Ketogulonicigenium vulgare.

    Ming-Zhu Ding

    Full Text Available The cooperative adaptation of subcultivated Bacillus cereus and Ketogulonicigenium vulgare significantly increased the productivity of 2-keto-L-gulonic acid, the precursor of vitamin C. The mechanism of cooperative adaptation of the serial subcultivated B. cereus and K. vulgare was investigated in this study by culturing the two strains orthogonally on agar plates. It was found that the swarming distance of B. cereus along the trace of K. vulgare on the plate decreased after 150 days' subcultivation. Metabolomic analysis on these co-cultured B. cereus and K. vulgare strains showed that their cooperative adaptation was accomplished by three key events: (i the ability of nutrients (e.g., amino acids and purines searching and intaking, and proteins biosynthesis is increased in the evolved B. cereus; (ii the capability of protein degradation and amino acids transportation is enhanced in evolved K. vulgare; (iii the evolved B. cereus was found to provide more nutrients (mostly amino acids and purines to K. vulgare, thus strengthening the oxidation and energy generation of K. vulgare. Our results provided novel insights into the systems-level understanding of the cooperative adaptation between strains in synergistic consortium.

  2. Bacillus cereus: a competent plant growth promoting bacterium of saline sodic field

    Hassan, T.; Naz, I.; Hussain, M.

    2018-01-01

    The effects of Bacillus cereus were investigated on wheat in the presence or absence of L-tryptophan, in a saline sodic field. An aqueous solution of L-tryptophan was added to the rhizosphere soil at 1 µg/L, after 8d of seeds germination with irrigated water. The survival efficiency measured as colony forming unit revealed that B. cereus was salt tolerant to rhizosphere soil filtrate and in NaCl. Bio-inoculation of B. cereus significantly decreased Electrical conductivity (EC), Na and Cl contents by 35%, and increased K, NO3-N, P, and organic matter by (25%) over control. Tryptophan addition assisted B. cereus to further decrease Na, Cl, sodium absorption ratio (SAR) and Na/K by 80%. Inoculation of B. cereus alone and with tryptophan significantly increased proline, antioxidant enzymes, phytohormones and yield attributes. The results revealed that tryptophan addition augmented the potential of B. cereus in improving crop growth and productivity which was mediated by the salinity alleviation. (author)

  3. Prevalence and antimicrobial resistance of Bacillus cereus isolated from beef products in Egypt

    Reyad Shawish

    2017-12-01

    Full Text Available Foodborne pathogens have the main concern in public health and food safety. Bacillus cereus food poisoning is one of the most important foodborne pathogens worldwide. In the present study, a total of 200 random beef product samples were collected from different supermarkets located at Menofia and Cairo governorates were examined for the presence of B. cereus. In addition, the presence of some virulence encoding genes was evaluated using Multiplex PCR. Finally, the antibiogram testing was conveyed to illustrate the resistance pattern of the confirmed B. cereus. The data showed that B. cereus was recovered from 22.5%, 30%, 25%, 37.5% and 15% of the minced meat, burger, sausage, kofta, and luncheon respectively. Among the 20 examined isolates 18/20 (90% were harbor hblC enterotoxin encoding gene compared with 20/20 (100 were have cytK enterotoxin encoding gene. The isolated strains of B. cereus were resistant to penicillin G and sensitive to oxacillin, clindamycin, vancomycin, erythromycin, gentamicin, ciprofloxacin, and ceftriaxone. In all, the obtained data showed the importance of emerging B. cereus in disease control and prevention programs, and in regular clinical and food quality control laboratories in Egypt.

  4. Direct detection of toxigenic Bacillus cereus in dietary complement for children and cassava starch

    Jnnifer A. Sánchez

    2014-05-01

    Full Text Available Bacillus cereus is a food contaminant and a known human pathogen that can cause emetic and diarrheal syndromes. In this study we evaluated the presence of toxigenic B. cereus by multiplex PCR directly in dietary complement for children and cassava starch samples collected on Medellin, Colombia. Of 75 dietary complement for children samples evaluated, 70.7% were contaminated with toxigenic B. cereus and four different toxigenic consortia were detected: I: nheA, hblC, cytK (9.8%, II: nheA, hblC (2%, III: hblC, cytK (41.2%, IV: hblC (47%. Of 75 cassava starch samples, 44% were contaminated with toxigenic B. cereus and four different toxigenic consortia were determined: I: nheA, hblC, cytK (48.5%, II: nheA, hblC, cytK, cesB (3%, III: hblC, cytK (30.3%, IV: hblC (18.2%. In general, in dietary complement for children only enterotoxigenic consortia were detected while in cassava starch the enterotoxigenic consortia predominated over the emetic. Multiplex PCR was useful to detect toxigenic B. cereus contamination allowing direct and imultaneous detection of all toxin genes in foods. This study is the first in Colombia to evaluate toxigenic B. cereus, providing information of importance for microbiological risk evaluation in dried foods.

  5. Growth and enterotoxin production of Bacillus cereus in cow, goat, and sheep milk

    Lenka Necidová

    2014-01-01

    Full Text Available The aim of this study was to compare Bacillus cereus growth rates and diarrhoeal enterotoxin production in raw and pasteurized goat, sheep, and cow milk in terms of storage conditions. Milk samples were inoculated with B. cereus (CCM 2010, which produces diarrhoeal enterotoxins. Enterotoxin production was tested by ELISA (Enzyme-Linked Immunosorbent Assay, and the count of B. cereus was determined by the plate method. With raw cow milk, B. cereus growth and enterotoxin production can be completely suppressed; in raw goat and sheep milk, enterotoxin was produced at 22 °C. In pasteurized cow, goat, and sheep milk, the B. cereus count increased under all storage conditions, with more rapid growth being observed at 15 °C (sheep milk and 22 °C (cow and goat milk. Enterotoxin presence was detected at 15 °C and 22 °C, and with pasteurized cow milk also at 8 °C. Our model experiments have determined that B. cereus multiplication and subsequent enterotoxin production depend on storage temperature and milk type.

  6. Modeling of Bacillus cereus distribution in pasteurized milk at the time of consumption

    Ľubomír Valík

    2013-02-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE Modelling of Bacillus cereus distribution, using data from pasteurized milk produced in Slovakia, at the time of consumption was performed in this study. The Modular Process Risk Model (MPRM methodology was applied to over all the consecutive steps in the food chain. The main factors involved in the risk of being exposed to unacceptable levels of B. cereus (model output were the initial density of B. cereus after milk pasteurization, storage temperatures and times (model input. Monte Carlo simulations were used for probability calculation of B. cereus density. By applying the sensitivity analysis influence of the input factors and their threshold values on the final count of B. cereus were determined. The results of the general case exposure assessment indicated that almost 14 % of Tetra Brik cartons can contain > 104 cfu/ml of B. cereus at the temperature distribution taken into account and time of pasteurized milk consumption. doi:10.5219/264

  7. Formation of flavone di-O-glucosides using a glycosyltransferase from Bacillus cereus.

    Ahn, Byoung Chan; Kim, Bong Gyu; Jeon, Young Min; Lee, Eun Jeong; Lim, Yoongho; Ahn, Joong-Hoon

    2009-04-01

    Microbial UDP-glycosyltransferases can convert many small lipophilic compounds into glycons using uridinediphosphate- activated sugars. The glycosylation of flavonoids affects solubility, stability, and bioavailability. The gene encoding the UDP-glycosyltransferase from Bacillus cereus, BcGT-3, was cloned by PCR and sequenced. BcGT-3 was expressed in Escherichia coli BL21 (DE3) with a glutathione S-transferase tag and purified using a glutathione Stransferase affinity column. BcGT-3 was tested for activity on several substrates including genistein, kaempferol, luteolin, naringenin, and quercetin. Flavonols were the best substrates for BcGT-3. The enzyme dominantly glycosylated the 3-hydroxyl group, but the 7-hydroxyl group was glycosylated when the 3-hydroxyl group was not available. The kaempferol reaction products were identified as kaempferol-3-O-glucoside and kaempferol- 3,7-O-diglucoside. Kaempferol was the most effective substrate tested. Based on HPLC, LC/MS, and NMR analyses of the reaction products, we conclude that BcGT-3 can be used for the synthesis of kaempferol 3,7-O-diglucose.

  8. Determining the source of Bacillus cereus and Bacillus licheniformis isolated from raw milk, pasteurized milk and yoghurt.

    Banykó, J; Vyletelová, M

    2009-03-01

    Strain-specific detection of Bacillus cereus and Bacillus licheniformis in raw and pasteurized milk, and yoghurt during processing. Randomly selected isolates of Bacillus spp. were subjected to PCR analysis, where single primer targeting to the repetitive sequence Box elements was used to fingerprint the species. The isolates were separated into six different fingerprint patterns. The results show that isolates clustered together at about the 57% similarity level with two main groups at the 82% and 83% similarity levels, respectively. Contamination with identical strains both of B. cereus and B. licheniformis in raw and pasteurized milk was found as well as contaminated with different strains (in the case of raw milk and yoghurt/pasteurized milk and yoghurt). Several BOX types traced in processed milk samples were not discovered in the original raw milk. BOX-PCR fingerprinting is useful for characterizing Bacillus populations in a dairy environment. It can be used to confirm environmental contamination, eventually clonal transfer of Bacillus strains during the technological processing of milk. Despite the limited number of strains analysed, the two Bacillus species yielded adequately detectable banding profiles, permitting differentiation of bacteria at the strain level and showing their diversity throughout dairy processing.

  9. Sigma Virus (DMelSV Incidence in Lines of Drosophila melanogaster Selected for Survival following Infection with Bacillus cereus

    Meghan L. Bentz

    2017-01-01

    Full Text Available The immune response of Drosophila melanogaster is complex and involves both specific and general responses to parasites. In this study we tested for cross-immunity for bacteria and viruses by scoring the incidence of infection with the vertically transmitted Sigma virus (DMelSV in the progeny of a cross between females transmitting DMelSV at high frequencies and males from lines subjected to three selection regimes related to resistance to Bacillus cereus. There was no significant difference in transmission of DMelSV among selection regimes, though results suggest that the B. cereus selected lines had lower rates of infection by DMelSV. We found a significant difference in viral infection with respect to the sex of the progeny, with males consistently less likely to be infected than females. Given a finite energy budget, flies that have experienced immune system challenge may show alterations in other life history traits. Later eclosing progeny were also less likely to be infected than earlier eclosing progeny, indicating a relationship with development time. Finally, there was a significant interaction between the timing of collection and the sex of the progeny, such that later eclosing males were the most resistant group. Increased development time is sometimes associated with increased energy acquisition; from this perspective, increased development time may be associated with acquiring sufficient resources for effective resistance.

  10. Insights from the Genome Sequence of Acidovorax citrulli M6, a Group I Strain of the Causal Agent of Bacterial Fruit Blotch of Cucurbits.

    Eckshtain-Levi, Noam; Shkedy, Dafna; Gershovits, Michael; Da Silva, Gustavo M; Tamir-Ariel, Dafna; Walcott, Ron; Pupko, Tal; Burdman, Saul

    2016-01-01

    Acidovorax citrulli is a seedborne bacterium that causes bacterial fruit blotch of cucurbit plants including watermelon and melon. A. citrulli strains can be divided into two major groups based on DNA fingerprint analyses and biochemical properties. Group I strains have been generally isolated from non-watermelon cucurbits, while group II strains are closely associated with watermelon. In the present study, we report the genome sequence of M6, a group I model A. citrulli strain, isolated from melon. We used comparative genome analysis to investigate differences between the genome of strain M6 and the genome of the group II model strain AAC00-1. The draft genome sequence of A. citrulli M6 harbors 139 contigs, with an overall approximate size of 4.85 Mb. The genome of M6 is ∼500 Kb shorter than that of strain AAC00-1. Comparative analysis revealed that this size difference is mainly explained by eight fragments, ranging from ∼35-120 Kb and distributed throughout the AAC00-1 genome, which are absent in the M6 genome. In agreement with this finding, while AAC00-1 was found to possess 532 open reading frames (ORFs) that are absent in strain M6, only 123 ORFs in M6 were absent in AAC00-1. Most of these M6 ORFs are hypothetical proteins and most of them were also detected in two group I strains that were recently sequenced, tw6 and pslb65. Further analyses by PCR assays and coverage analyses with other A. citrulli strains support the notion that some of these fragments or significant portions of them are discriminative between groups I and II strains of A. citrulli. Moreover, GC content, effective number of codon values and cluster of orthologs' analyses indicate that these fragments were introduced into group II strains by horizontal gene transfer events. Our study reports the genome sequence of a model group I strain of A. citrulli, one of the most important pathogens of cucurbits. It also provides the first comprehensive comparison at the genomic level between the

  11. Coalescent-Based Analyses of Genomic Sequence Data Provide a Robust Resolution of Phylogenetic Relationships among Major Groups of Gibbons

    Shi, Cheng-Min; Yang, Ziheng

    2018-01-01

    Abstract The phylogenetic relationships among extant gibbon species remain unresolved despite numerous efforts using morphological, behavorial, and genetic data and the sequencing of whole genomes. A major challenge in reconstructing the gibbon phylogeny is the radiative speciation process, which resulted in extremely short internal branches in the species phylogeny and extensive incomplete lineage sorting with extensive gene-tree heterogeneity across the genome. Here, we analyze two genomic-scale data sets, with ∼10,000 putative noncoding and exonic loci, respectively, to estimate the species tree for the major groups of gibbons. We used the Bayesian full-likelihood method bpp under the multispecies coalescent model, which naturally accommodates incomplete lineage sorting and uncertainties in the gene trees. For comparison, we included three heuristic coalescent-based methods (mp-est, SVDQuartets, and astral) as well as concatenation. From both data sets, we infer the phylogeny for the four extant gibbon genera to be (Hylobates, (Nomascus, (Hoolock, Symphalangus))). We used simulation guided by the real data to evaluate the accuracy of the methods used. Astral, while not as efficient as bpp, performed well in estimation of the species tree even in presence of excessive incomplete lineage sorting. Concatenation, mp-est and SVDQuartets were unreliable when the species tree contains very short internal branches. Likelihood ratio test of gene flow suggests a small amount of migration from Hylobates moloch to H. pileatus, while cross-genera migration is absent or rare. Our results highlight the utility of coalescent-based methods in addressing challenging species tree problems characterized by short internal branches and rampant gene tree-species tree discordance. PMID:29087487

  12. Influencing governance of a public-private partnership in plant genomics: The societal interface group as a new instrument for public involvement.

    Hanssen, Lucien; Gremmen, Bart

    2013-08-01

    The Centre for BioSystems Genomics (CBSG) is a Dutch public-private partnership in plant genomics active in potato and tomato research and exploitation. Its Societal Interface Group (SIG) has been developed to inform its communication strategy and governance practice. This new instrument identifies and discusses early signals from society by bringing together people from different societal backgrounds with members of CBSG management. This interactive learning process facilitates the inclusion of public concerns and needs in scientific developments in the field of plant genomics, and simultaneously enables genomics scientists to search for more societal aims, meanings, and starting points for their research agenda. Analysis of the SIG sessions revealed that the input of public expertise is not threatening or irrational, but provides the opportunity to harness the creative potential of future users highly relevant for the development of societal practices in which plant genomics plays a role.

  13. The Transcriptome of the Reference Potato Genome Solanum tuberosum Group Phureja Clone DM1-3 516R44

    Massa, Alicia N.; Childs, Kevin L.; Lin, Haining; Bryan, Glenn J.; Giuliano, Giovanni; Buell, C. Robin

    2011-01-01

    Advances in molecular breeding in potato have been limited by its complex biological system, which includes vegetative propagation, autotetraploidy, and extreme heterozygosity. The availability of the potato genome and accompanying gene complement with corresponding gene structure, location, and functional annotation are powerful resources for understanding this complex plant and advancing molecular breeding efforts. Here, we report a reference for the potato transcriptome using 32 tissues and growth conditions from the doubled monoploid Solanum tuberosum Group Phureja clone DM1-3 516R44 for which a genome sequence is available. Analysis of greater than 550 million RNA-Seq reads permitted the detection and quantification of expression levels of over 22,000 genes. Hierarchical clustering and principal component analyses captured the biological variability that accounts for gene expression differences among tissues suggesting tissue-specific gene expression, and genes with tissue or condition restricted expression. Using gene co-expression network analysis, we identified 18 gene modules that represent tissue-specific transcriptional networks of major potato organs and developmental stages. This information provides a powerful resource for potato research as well as studies on other members of the Solanaceae family. PMID:22046362

  14. Genome analysis of Elusimicrobium minutum, the first cultivated representative of the Elusimicrobia phylum (formerly Termite Group 1)

    Herlemann, D. P. R.; Geissinger, O.; Ikeda-Ohtsubo, W.; Kunin, V.; Sun, H.; Lapidus, A.; Hugenholtz, P.; Brune, A.

    2009-02-01

    The candidate phylum Termite group 1 (TG1), is regularly 1 encountered in termite hindguts but is present also in many other habitats. Here we report the complete genome sequence (1.64 Mbp) of Elusimicrobium minutum strain Pei191{sup T}, the first cultured representative of the TG1 phylum. We reconstructed the metabolism of this strictly anaerobic bacterium isolated from a beetle larva gut and discuss the findings in light of physiological data. E. minutum has all genes required for uptake and fermentation of sugars via the Embden-Meyerhof pathway, including several hydrogenases, and an unusual peptide degradation pathway comprising transamination reactions and leading to the formation of alanine, which is excreted in substantial amounts. The presence of genes encoding lipopolysaccharide biosynthesis and the presence of a pathway for peptidoglycan formation are consistent with ultrastructural evidence of a Gram-negative cell envelope. Even though electron micrographs showed no cell appendages, the genome encodes many genes putatively involved in pilus assembly. We assigned some to a type II secretion system, but the function of 60 pilE-like genes remains unknown. Numerous genes with hypothetical functions, e.g., polyketide synthesis, non-ribosomal peptide synthesis, antibiotic transport, and oxygen stress protection, indicate the presence of hitherto undiscovered physiological traits. Comparative analysis of 22 concatenated single-copy marker genes corroborated the status of Elusimicrobia (formerly TG1) as a separate phylum in the bacterial domain, which was so far based only on 16S rRNA sequence analysis.

  15. Direct anthelmintic effects of Cereus jamacaru (Cactaceae) on trichostrongylid nematodes of sheep: in vivo studies.

    Vatta, A F; Kandu-Lelo, C; Ademola, I O; Eloff, J N

    2011-08-25

    Following claims of anthelmintic activity of Cereus jamacaru DC (Cactaceae) by a commercial farmer, in vivo studies were conducted to determine the possible direct anthelmintic effects of the plant on ovine gastrointestinal nematodes. Eighteen sheep were infected with 4000 Haemonchus contortus and 6000 Trichostrongylus colubriformis larvae given in three divided doses over a period of three days. Once the infections were patent, the sheep were allocated to three groups and were drenched once a week for six weeks with fresh blended C. jamacaru plant material at a single (32.3g/sheep) or double dose (64.6g/sheep) or they remained as undrenched controls. Faeces were collected from individual animals on the day of treatment and three days thereafter on a weekly basis for seven weeks for faecal egg count. While there were no statistically significant differences in the egg counts between the groups, a double dose of C. jamacaru was effective in reducing the egg counts in the sheep by 18-65% over the 49 days of the experiment. Given that all animals remained in good health throughout the course of the experiment, with no adverse events occurring during the study, further experiments using higher doses or administering the plant material for a longer period of time than in the present study would be warranted. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Vacuum Distillation Residue Upgrading by an Indigenous Bacillus Cereus

    Mitra Sadat Tabatabaee

    2013-07-01

    Full Text Available Background:Biological processing of heavy fractions of crude oils offers less severe process conditions and higher selectivity for refining. Biochemical Processes are expected to be low demand energy processes and certainly ecofriendly.Results:A strain of biosurfactant producing bacterium was isolated from an oil contaminated soil at Tehran refinery distillation unit. Based on selected phenotypic and genotypic characteristic including morphology, biochemical proprety, and 16 SrRNA sequencing identified as a novel strain of Bacillus cereus (JQ178332. This bacterium endures a wide range of pH, salinity and temperature. This specific strain utilizes both paraffin and anthracene as samples of aliphatic and polycyclic aromatic hydrocarbons. The ability of this bacterium to acquire all its energy and chemical requirements from Vacuum Distillation Residue (VR, as a net sample of problematic hydrocarbons in refineries, was studied. SARA test ASTM D4124-01 revealed 65.5% decrease in asphaltenic, 22.1% in aliphatics and 30.3% in Aromatics content of the VR in MSM medium. Further results with 0.9% saline showed 55% decrease in asphaltene content and 2.1% Aromatics respectively.Conclusion:Remarkable abilities of this microorganism propose its application in an ecofriendly technology to upgrade heavy crude oils.

  17. Vacuum distillation residue upgrading by an indigenous Bacillus cereus.

    Tabatabaee, Mitra Sadat; Mazaheri Assadi, Mahnaz

    2013-07-16

    Biological processing of heavy fractions of crude oils offers less severe process conditions and higher selectivity for refining. Biochemical Processes are expected to be low demand energy processes and certainly ecofriendly. A strain of biosurfactant producing bacterium was isolated from an oil contaminated soil at Tehran refinery distillation unit. Based on selected phenotypic and genotypic characteristic including morphology, biochemical proprety, and 16 SrRNA sequencing identified as a novel strain of Bacillus cereus (JQ178332). This bacterium endures a wide range of pH, salinity and temperature. This specific strain utilizes both paraffin and anthracene as samples of aliphatic and polycyclic aromatic hydrocarbons. The ability of this bacterium to acquire all its energy and chemical requirements from Vacuum Distillation Residue (VR), as a net sample of problematic hydrocarbons in refineries, was studied. SARA test ASTM D4124-01 revealed 65.5% decrease in asphaltenic, 22.1% in aliphatics and 30.3% in Aromatics content of the VR in MSM medium. Further results with 0.9% saline showed 55% decrease in asphaltene content and 2.1% Aromatics respectively. Remarkable abilities of this microorganism propose its application in an ecofriendly technology to upgrade heavy crude oils.

  18. Integrative Sparse K-Means With Overlapping Group Lasso in Genomic Applications for Disease Subtype Discovery.

    Huo, Zhiguang; Tseng, George

    2017-06-01

    Cancer subtypes discovery is the first step to deliver personalized medicine to cancer patients. With the accumulation of massive multi-level omics datasets and established biological knowledge databases, omics data integration with incorporation of rich existing biological knowledge is essential for deciphering a biological mechanism behind the complex diseases. In this manuscript, we propose an integrative sparse K -means (is- K means) approach to discover disease subtypes with the guidance of prior biological knowledge via sparse overlapping group lasso. An algorithm using an alternating direction method of multiplier (ADMM) will be applied for fast optimization. Simulation and three real applications in breast cancer and leukemia will be used to compare is- K means with existing methods and demonstrate its superior clustering accuracy, feature selection, functional annotation of detected molecular features and computing efficiency.

  19. Developing a common framework for evaluating the implementation of genomic medicine interventions in clinical care: the IGNITE Network's Common Measures Working Group.

    Orlando, Lori A; Sperber, Nina R; Voils, Corrine; Nichols, Marshall; Myers, Rachel A; Wu, R Ryanne; Rakhra-Burris, Tejinder; Levy, Kenneth D; Levy, Mia; Pollin, Toni I; Guan, Yue; Horowitz, Carol R; Ramos, Michelle; Kimmel, Stephen E; McDonough, Caitrin W; Madden, Ebony B; Damschroder, Laura J

    2018-06-01

    PurposeImplementation research provides a structure for evaluating the clinical integration of genomic medicine interventions. This paper describes the Implementing Genomics in Practice (IGNITE) Network's efforts to promote (i) a broader understanding of genomic medicine implementation research and (ii) the sharing of knowledge generated in the network.MethodsTo facilitate this goal, the IGNITE Network Common Measures Working Group (CMG) members adopted the Consolidated Framework for Implementation Research (CFIR) to guide its approach to identifying constructs and measures relevant to evaluating genomic medicine as a whole, standardizing data collection across projects, and combining data in a centralized resource for cross-network analyses.ResultsCMG identified 10 high-priority CFIR constructs as important for genomic medicine. Of those, eight did not have standardized measurement instruments. Therefore, we developed four survey tools to address this gap. In addition, we identified seven high-priority constructs related to patients, families, and communities that did not map to CFIR constructs. Both sets of constructs were combined to create a draft genomic medicine implementation model.ConclusionWe developed processes to identify constructs deemed valuable for genomic medicine implementation and codified them in a model. These resources are freely available to facilitate knowledge generation and sharing across the field.

  20. Identification and antibiogram pattern of Bacillus cereus from the milk and milk products in and around Jammu region

    Yusuf, Umar; Kotwal, S. K.; Gupta, Sanjolly; Ahmed, Touqeer

    2018-01-01

    Aim: The aims of the present study were to assess the prevalence, identification, and antibiogram pattern of Bacillus cereus from 215 samples of different milk and milk products in and around Jammu region. Materials and Methods: In the present study, 215 samples of milk, rasgulla, burfi, rasmalai, kalaari, paneer, ice cream, and pastry were collected and analyzed for the isolation of the B. cereus using PEMBA, and antibiogram pattern was observed for all the milk and milk products. Results: B. cereus was detected in 61/215 samples with an overall prevalence of 28.37%. Biotyping revealed predominantly 5, 7, and 2 biotypes in raw milk. Burfi and ice cream revealed 2, 3, 5, and 7 biotypes. Rasgulla had 2, 3, and 5 biotypes; paneer and rasmalai had biotypes 2 and 5, while kalaari revealed biotype 5. Antibiogram pattern revealed that isolates were highly sensitive to gentamicin (100%), intermediate to ampicillin (40.98%), tetracycline (31.14%), erythromycin (29.50%), and amoxicillin (26.22%), and high resistance against penicillin G (100%). Adulteration of starch was detected in 16.66 % raw milk samples. All starch positive samples were positive for B. cereus. However, 12 starch negative samples also yielded B. cereus. Conclusion: From this study, it was concluded that highest prevalence of B. cereus was found in ice cream. Several isolates of B. cereus showed toxigenic activity, so the presence of B. cereus in milk and milk products may be of public health hazard. The antibiogram pattern of B. cereus isolates showed sensitivity to gentamicin, ciprofloxacin, chloramphenicol, streptomycin, and resistance to penicillin-G and cephalexin. The presence of B. cereus in milk and milk products showed a strong association besides establishing the fact that starch adulteration can be indicative of the presence of B. cereus. PMID:29657402

  1. Gamma radiation effect on Bacillus cereus spores inoculated in black pepper

    Froehlich, Angela; Axeredo, Raquel M.C.; Vanetti, Maria Cristina D.

    2000-01-01

    It had been analyzed 37 samples of worn out black pepper and in 85% of these samples was observed the presence of Bacillus cereus in numbers of up to 4,6 x 10 4 UFC/g. The population of aerobic mesofilis bacteria varied of 2,8 x 10 5 the 1,9 x 10 8 UFC/g. The black pepper used during the experiment was evaluated, evidencing the aerobic presence of one aerobic mesofilis microbiota of, approximately, 2,6 x 10 6 UFC/g, consisting, mainly, for species of the Bacillus sort. It was observed that the absence of B. cereus, coliforms, filamentous fungus and leavenings. The evaluation of the irradiation of the black pepper inoculated with 10 6 UFC/g of B. cereus spores of with doses of gamma radiation varying between 2 and 10 kGy evidenced that doses up to 5 kGy had been enough to reduce the counting of, approximately, 10 6 UFC/g of aerobic mesofilis organisms and 10 4 UFC/g of B. cereus spores the not detectable numbers by the used methodology. The dose of reduction decimal (D 10 ) for the inoculated B. cereus spores in black pepper was of 1,78 kGy

  2. Simultaneous removal of chlorothalonil and nitrate by Bacillus cereus strain NS1

    Zhang Yiqiang; Lu Jianhang; Wu Laosheng; Chang, Andrew; Frankenberger, William T.

    2007-01-01

    Elevated NO 3 - and chlorothalonil (CTN) have been found in production nursery recycling ponds. Bacillus cereus strain NS1 isolated from nursery recycling pond sediment was assessed for its ability to reduce NO 3 - and degrade CTN in a mineral medium. The results showed that the efficiency of NO 3 - reduction and CTN degradation by B. cereus strain NS1 were related to the nature of organic carbon sources added to the medium. In the medium amended with 100 mg/L yeast extract, 86% of NO 3 - (100 mg/L) and 99% of CTN (78 μg/L) were simultaneously removed by B. cereus strain NS1 during the first day of the experiment. It took 6 days for the removal of 82-93% of NO 3 - and 87-91% of CTN in the media containing glucose and acetate. B. cereus strain NS1 needed organic carbon as energy sources and electron donors to respire NO 3 - , and simultaneously degrade CTN. These results suggest that B. cereus strain NS1 may have great potential to remediate NO 3 - and CTN contaminated water in nursery recycling ponds

  3. Detection of toxin genes and RAPD analysis of bacillus cereus isolates from different soil types

    Savic Dejana

    2015-01-01

    Full Text Available The aim of this study was to detect genes for enterotoxins (hbla, entFM and bceT and for emetic toxin (cer, to determine antibiotic resistance, and to estimate intraspecies diversity in B. cereus isolates by RAPD analysis. B. cereus was identified in 12 out of 117 indigenous Bacillus spp. using the classical microbiological methods and PCR. All isolates were resistant to penicillin and ampicillin, two to tetracyclin and four to trimethoprim-sulphamethoxazole. Also, all isolates produced inducible penicillinases and β-lactamase. Toxin genes were detected with PCR. EntFM and cer genes were present in all isolates, hbla in all, but two, and bceT in none. RAPD analysis was performed with four different primers, two of them designed for this study. The intraspecies diversity revealed 10 different patterns at the 90% similarity level. Two separate clusters were formed regardless of a soil type or utilization. The detection of genes encoding toxins in all B. cereus isolates indicated these bacteria as potentially pathogenic and seriously for human health. Regardless of a soil type or utilization, the RAPD analysis showed high intraspecies heterogeneity in B. cereus isolates. To the best of our knowledge, this is the first study to analyse the presence of entero- and emetic toxin genes and genetic heterogeneity in B. cereus isolates from different soil types and different soil utilization in Serbia. [Projekat Ministarstva nauke Republike Srbije, br. TR37006

  4. The CodY-dependent clhAB2 operon is involved in cell shape, chaining and autolysis in Bacillus cereus ATCC 14579.

    Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier

    2017-01-01

    The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.

  5. Whole genome sequencing of group A Streptococcus: development and evaluation of an automated pipeline for emmgene typing

    Georgia Kapatai

    2017-04-01

    Full Text Available Streptococcus pyogenes group A Streptococcus (GAS is the most common cause of bacterial throat infections, and can cause mild to severe skin and soft tissue infections, including impetigo, erysipelas, necrotizing fasciitis, as well as systemic and fatal infections including septicaemia and meningitis. Estimated annual incidence for invasive group A streptococcal infection (iGAS in industrialised countries is approximately three per 100,000 per year. Typing is currently used in England and Wales to monitor bacterial strains of S. pyogenes causing invasive infections and those isolated from patients and healthcare/care workers in cluster and outbreak situations. Sequence analysis of the emm gene is the currently accepted gold standard methodology for GAS typing. A comprehensive database of emm types observed from superficial and invasive GAS strains from England and Wales informs outbreak control teams during investigations. Each year the Bacterial Reference Department, Public Health England (PHE receives approximately 3,000 GAS isolates from England and Wales. In April 2014 the Bacterial Reference Department, PHE began genomic sequencing of referred S. pyogenes isolates and those pertaining to selected elderly/nursing care or maternity clusters from 2010 to inform future reference services and outbreak analysis (n = 3, 047. In line with the modernizing strategy of PHE, we developed a novel bioinformatics pipeline that can predict emmtypes using whole genome sequence (WGS data. The efficiency of this method was measured by comparing the emmtype assigned by this method against the result from the current gold standard methodology; concordance to emmsubtype level was observed in 93.8% (2,852/3,040 of our cases, whereas in 2.4% (n = 72 of our cases concordance was observed to emm type level. The remaining 3.8% (n = 117 of our cases corresponded to novel types/subtypes, contamination, laboratory sample transcription errors or problems arising

  6. Characteristics and phylogeny of Bacillus cereus strains isolated from Maari, a traditional West African food condiment

    Thorsen, Line; Kando, Christine Kere; Sawadogo, Hagrétou

    2015-01-01

    light on the succession and pathogenic potential of B. cereus species in traditional West African food condiment and clarifies their phylogenetic relatedness to B. cereus biovar anthracis. Future implementation of GMP and HACCP and development of starter cultures for controlled Maari fermentations...

  7. Toxin profiles of Bacillus cereus occurring in high numbers in spontaneously fermented African locust beans (Parkia biglobosa)

    Thorsen, Line; Azokpota, Paulin; Hansen, Bjarne Munk

    The microbiology of the naturally fermented African condiments Afiitin, iru and sonru produced in Benin from locust beans, has recently been studied showing high Bacillus cereus counts of log7CFU/g (Azokpota, 2005). A total of 19 B. cereus strains isolated from the three condiments showed...

  8. Monitoring the ethanol stress response of a sigM deletion strain of B. cereus ATCC 14579.

    Voort, van der M.

    2008-01-01

    Here, the role of σM and its regulon in stress response and survival of B. cereus ATCC 14579 was assessed by comparative transciptome and phenotypic analysis of this strain and its sigM deletion strain. Exposure of B. cereus ATCC 14579 to a wide range of stresses revealed expression of sigM,

  9. Relapsing peritonitis with Bacillus cereus in a patient on continuous ambulatory peritoneal dialysis

    Magnussen, Eyð Tausen; Vang, Amanda Gratton; á Steig, Torkil

    2016-01-01

    We present a case where Bacillus cereus was determined to be the causative agent of relapsing peritonitis in a patient on continuous ambulatory peritoneal dialysis (CAPD). The patient, a 70-year-old man from the Faroe Islands, was admitted with relapsing peritonitis four times over a 3-month period....... Peritoneal cultures were positive for growth of B. cereus, a rare bacterial cause of peritonitis. The cultures demonstrated susceptibility to vancomycin, and therefore the patient was treated with intraperitoneal vancomycin, intraperitoneal gentamycin and oral ciprofloxacin. As a result of the relapsing B....... cereus peritonitis diagnosis and a CT scan showing contraction of the peritoneum after longstanding inflammation, the peritoneal catheter was removed and the patient converted to haemodialysis. To date, the patient has not been readmitted due to peritonitis. A lack of proper hygiene when changing...

  10. Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation

    2013-01-01

    Background The Streptococcus Anginosus Group (SAG) represents three closely related species of the viridans group streptococci recognized as commensal bacteria of the oral, gastrointestinal and urogenital tracts. The SAG also cause severe invasive infections, and are pathogens during cystic fibrosis (CF) pulmonary exacerbation. Little genomic information or description of virulence mechanisms is currently available for SAG. We conducted intra and inter species whole-genome comparative analyses with 59 publically available Streptococcus genomes and seven in-house closed high quality finished SAG genomes; S. constellatus (3), S. intermedius (2), and S. anginosus (2). For each SAG species, we sequenced at least one numerically dominant strain from CF airways recovered during acute exacerbation and an invasive, non-lung isolate. We also evaluated microevolution that occurred within two isolates that were cultured from one individual one year apart. Results The SAG genomes were most closely related to S. gordonii and S. sanguinis, based on shared orthologs and harbor a similar number of proteins within each COG category as other Streptococcus species. Numerous characterized streptococcus virulence factor homologs were identified within the SAG genomes including; adherence, invasion, spreading factors, LPxTG cell wall proteins, and two component histidine kinases known to be involved in virulence gene regulation. Mobile elements, primarily integrative conjugative elements and bacteriophage, account for greater than 10% of the SAG genomes. S. anginosus was the most variable species sequenced in this study, yielding both the smallest and the largest SAG genomes containing multiple genomic rearrangements, insertions and deletions. In contrast, within the S. constellatus and S. intermedius species, there was extensive continuous synteny, with only slight differences in genome size between strains. Within S. constellatus we were able to determine important SNPs and changes in

  11. A hospital cafeteria-related food-borne outbreak due to Bacillus cereus: unique features.

    Baddour, L M; Gaia, S M; Griffin, R; Hudson, R

    1986-09-01

    Although Bacillus cereus is a well-known cause of food-borne illness, hospital-related outbreaks of food-borne disease due to B. cereus have rarely been documented. We report a hospital employee cafeteria outbreak due to foods contaminated with B. cereus in which an outside caterer was employed to prepare the suspect meals. Data were collected from 249 of 291 employees who had eaten either of the two meals. With a mean incubation period of 12.5 hours, 64% (160 of 249) of employees manifested illness. Symptoms, which averaged 24.3 hours in duration, included diarrhea (96.3%), abdominal cramps (90%), nausea (50.6%), weakness (24.7%), and vomiting (13.8%). Eighty-seven employees sought medical attention, 84 of whom were seen in an emergency room. Although a significant difference was not demonstrated in food-specific attack rates, B. cereus was cultured from both rice and chicken items that were served at both meals. Sixty-three employees submitted stools for culture that grew no enteric pathogens, but none were examined for B. cereus. This food-borne outbreak demonstrates: the need for hospital kitchen supervisors to ensure proper handling of food when outside caterers are employed; that significant differences in food-specific attack rates may not be demonstrated in outbreaks, which may be related to several factors; and the importance of notifying microbiology laboratory personnel when B. cereus is a suspect enteric pathogen, since many laboratories do not routinely attempt to identify this organism in stool specimens.

  12. Spore prevalence and toxigenicity of Bacillus cereus and Bacillus thuringiensis isolates from U.S. retail spices.

    Hariram, Upasana; Labbé, Ronald

    2015-03-01

    Recent incidents of foodborne illness associated with spices as the vehicle of transmission prompted this examination of U.S. retail spices with regard to Bacillus cereus. This study focused on the levels of aerobic-mesophilic spore-forming bacteria and B cereus spores associated with 247 retail spices purchased from five states in the United States. Samples contained a wide range of aerobic-mesophilic bacterial spore counts (spices had high levels of aerobic spores (> 10(7) CFU/g). Using a novel chromogenic agar, B. cereus and B. thuringiensis spores were isolated from 77 (31%) and 11 (4%) samples, respectively. Levels of B. cereus were spice isolates to form spores, produce diarrheal toxins, and grow at moderately abusive temperatures makes retail spices an important potential vehicle for foodborne illness caused by B. cereus strains, in particular those that produce diarrheal toxins.

  13. The Genomics Education Partnership: Successful Integration of Research into Laboratory Classes at a Diverse Group of Undergraduate Institutions

    Shaffer, Christopher D.; Alvarez, Consuelo; Bailey, Cheryl; Barnard, Daron; Bhalla, Satish; Chandrasekaran, Chitra; Chandrasekaran, Vidya; Chung, Hui-Min; Dorer, Douglas R.; Du, Chunguang; Eckdahl, Todd T.; Poet, Jeff L.; Frohlich, Donald; Goodman, Anya L.; Gosser, Yuying; Hauser, Charles; Hoopes, Laura L.M.; Johnson, Diana; Jones, Christopher J.; Kaehler, Marian; Kokan, Nighat; Kopp, Olga R.; Kuleck, Gary A.; McNeil, Gerard; Moss, Robert; Myka, Jennifer L.; Nagengast, Alexis; Morris, Robert; Overvoorde, Paul J.; Shoop, Elizabeth; Parrish, Susan; Reed, Kelynne; Regisford, E. Gloria; Revie, Dennis; Rosenwald, Anne G.; Saville, Ken; Schroeder, Stephanie; Shaw, Mary; Skuse, Gary; Smith, Christopher; Smith, Mary; Spana, Eric P.; Spratt, Mary; Stamm, Joyce; Thompson, Jeff S.; Wawersik, Matthew; Wilson, Barbara A.; Youngblom, Jim; Leung, Wilson; Buhler, Jeremy; Mardis, Elaine R.; Lopatto, David

    2010-01-01

    Genomics is not only essential for students to understand biology but also provides unprecedented opportunities for undergraduate research. The goal of the Genomics Education Partnership (GEP), a collaboration between a growing number of colleges and universities around the country and the Department of Biology and Genome Center of Washington University in St. Louis, is to provide such research opportunities. Using a versatile curriculum that has been adapted to many different class settings, GEP undergraduates undertake projects to bring draft-quality genomic sequence up to high quality and/or participate in the annotation of these sequences. GEP undergraduates have improved more than 2 million bases of draft genomic sequence from several species of Drosophila and have produced hundreds of gene models using evidence-based manual annotation. Students appreciate their ability to make a contribution to ongoing research, and report increased independence and a more active learning approach after participation in GEP projects. They show knowledge gains on pre- and postcourse quizzes about genes and genomes and in bioinformatic analysis. Participating faculty also report professional gains, increased access to genomics-related technology, and an overall positive experience. We have found that using a genomics research project as the core of a laboratory course is rewarding for both faculty and students. PMID:20194808

  14. Enrichment and genome sequence of the group I.1a ammonia-oxidizing Archaeon "Ca. Nitrosotenuis uzonensis" representing a clade globally distributed in thermal habitats.

    Elena V Lebedeva

    Full Text Available The discovery of ammonia-oxidizing archaea (AOA of the phylum Thaumarchaeota and the high abundance of archaeal ammonia monooxygenase subunit A encoding gene sequences in many environments have extended our perception of nitrifying microbial communities. Moreover, AOA are the only aerobic ammonia oxidizers known to be active in geothermal environments. Molecular data indicate that in many globally distributed terrestrial high-temperature habits a thaumarchaeotal lineage within the Nitrosopumilus cluster (also called "marine" group I.1a thrives, but these microbes have neither been isolated from these systems nor functionally characterized in situ yet. In this study, we report on the enrichment and genomic characterization of a representative of this lineage from a thermal spring in Kamchatka. This thaumarchaeote, provisionally classified as "Candidatus Nitrosotenuis uzonensis", is a moderately thermophilic, non-halophilic, chemolithoautotrophic ammonia oxidizer. The nearly complete genome sequence (assembled into a single scaffold of this AOA confirmed the presence of the typical thaumarchaeotal pathways for ammonia oxidation and carbon fixation, and indicated its ability to produce coenzyme F420 and to chemotactically react to its environment. Interestingly, like members of the genus Nitrosoarchaeum, "Candidatus N. uzonensis" also possesses a putative artubulin-encoding gene. Genome comparisons to related AOA with available genome sequences confirmed that the newly cultured AOA has an average nucleotide identity far below the species threshold and revealed a substantial degree of genomic plasticity with unique genomic regions in "Ca. N. uzonensis", which potentially include genetic determinants of ecological niche differentiation.

  15. Enrichment and genome sequence of the group I.1a ammonia-oxidizing Archaeon "Ca. Nitrosotenuis uzonensis" representing a clade globally distributed in thermal habitats.

    Lebedeva, Elena V; Hatzenpichler, Roland; Pelletier, Eric; Schuster, Nathalie; Hauzmayer, Sandra; Bulaev, Aleksandr; Grigor'eva, Nadezhda V; Galushko, Alexander; Schmid, Markus; Palatinszky, Marton; Le Paslier, Denis; Daims, Holger; Wagner, Michael

    2013-01-01

    The discovery of ammonia-oxidizing archaea (AOA) of the phylum Thaumarchaeota and the high abundance of archaeal ammonia monooxygenase subunit A encoding gene sequences in many environments have extended our perception of nitrifying microbial communities. Moreover, AOA are the only aerobic ammonia oxidizers known to be active in geothermal environments. Molecular data indicate that in many globally distributed terrestrial high-temperature habits a thaumarchaeotal lineage within the Nitrosopumilus cluster (also called "marine" group I.1a) thrives, but these microbes have neither been isolated from these systems nor functionally characterized in situ yet. In this study, we report on the enrichment and genomic characterization of a representative of this lineage from a thermal spring in Kamchatka. This thaumarchaeote, provisionally classified as "Candidatus Nitrosotenuis uzonensis", is a moderately thermophilic, non-halophilic, chemolithoautotrophic ammonia oxidizer. The nearly complete genome sequence (assembled into a single scaffold) of this AOA confirmed the presence of the typical thaumarchaeotal pathways for ammonia oxidation and carbon fixation, and indicated its ability to produce coenzyme F420 and to chemotactically react to its environment. Interestingly, like members of the genus Nitrosoarchaeum, "Candidatus N. uzonensis" also possesses a putative artubulin-encoding gene. Genome comparisons to related AOA with available genome sequences confirmed that the newly cultured AOA has an average nucleotide identity far below the species threshold and revealed a substantial degree of genomic plasticity with unique genomic regions in "Ca. N. uzonensis", which potentially include genetic determinants of ecological niche differentiation.

  16. Genome Target Evaluator (GTEvaluator: A workflow exploiting genome dataset to measure the sensitivity and specificity of genetic markers.

    Arnaud Felten

    Full Text Available Most of the bacterial typing methods used to discriminate isolates in medical or food safety microbiology are based on genetic markers used as targets in PCR or hybridization experiments. These DNA typing methods are important tools for studying prevalence and epidemiology, for conducting surveillance, investigations and control of biological hazard sources. In that perspective, it is crucial to insure that the chosen genetic markers have the greatest specificity and sensitivity. The wealth of whole-genome sequences available for many bacterial species offers the opportunity to evaluate the performance of these genetic markers. In the present study, we have developed GTEvaluator, a bioinformatics workflow which ranks genetic markers depending on their sensitivity and specificity towards groups of well-defined genomes. GTEvaluator identifies the most performant genetic markers to target individuals among a population. The individuals (i.e. a group of genomes within a collection are defined by any kind of particular phenotypic or biological properties inside a related population (i.e. collection of genomes. The performance of the genetic markers is computed by a distance value which takes into account both sensitivity and specificity. In this study we report two examples of GTEvaluator application. In the first example Bacillus phenotypic markers were evaluated for their capacity to distinguish B. cereus from B. thuringiensis. In the second experiment, GTEvaluator measured the performance of genetic markers dedicated to the molecular serotyping of Salmonella enterica. In one in silico experiment it was possible to test 64 markers onto 134 genomes corresponding to 14 different serotypes.

  17. Inhibition of Bacillus cereus Strains by Antimicrobial Metabolites from Lactobacillus johnsonii CRL1647 and Enterococcus faecium SM21.

    Soria, M Cecilia; Audisio, M Carina

    2014-12-01

    Bacillus cereus is an endospore-forming, Gram-positive bacterium able to cause foodborne diseases. Lactic acid bacteria (LAB) are known for their ability to synthesize organic acids and bacteriocins, but the potential of these compounds against B. cereus has been scarcely documented in food models. The present study has examined the effect of the metabolites produced by Lactobacillus johnsonii CRL1647 and Enterococcus faecium SM21 on the viability of select B. cereus strains. Furthermore, the effect of E. faecium SM21 metabolites against B. cereus strains has also been investigated on a rice food model. L. johnsonii CRL1647 produced 128 mmol/L of lactic acid, 38 mmol/L of acetic acid and 0.3 mmol/L of phenyl-lactic acid. These organic acids reduced the number of vegetative cells and spores of the B. cereus strains tested. However, the antagonistic effect disappeared at pH 6.5. On the other hand, E. faecium SM21 produced only lactic and acetic acid (24.5 and 12.2 mmol/L, respectively) and was able to inhibit both vegetative cells and spores of the B. cereus strains, at a final fermentation pH of 5.0 and at pH 6.5. This would indicate the action of other metabolites, different from organic acids, present in the cell-free supernatant. On cooked rice grains, the E. faecium SM21 bacteriocin(s) were tested against two B. cereus strains. Both of them were significantly affected within the first 4 h of contact; whereas B. cereus BAC1 cells recovered after 24 h, the effect on B. cereus 1 remained up to the end of the assay. The LAB studied may thus be considered to define future strategies for biological control of B. cereus.

  18. Complete genome sequence of the bacteriochlorophyll a-containing Roseibacterium elongatum type strain (DSM 19469(T)), a representative of the Roseobacter group isolated from Australian coast sand.

    Riedel, Thomas; Fiebig, Anne; Göker, Markus; Klenk, Hans-Peter

    2014-06-15

    Roseibacterium elongatum Suzuki et al. 2006 is a pink-pigmented and bacteriochlorophyll a-producing representative of the Roseobacter group within the alphaproteobacterial family Rhodobacteraceae. Representatives of the marine 'Roseobacter group' were found to be abundant in the ocean and play an important role in global and biogeochemical processes. In the present study we describe the features of R. elongatum strain OCh 323(T) together with its genome sequence and annotation. The 3,555,102 bp long genome consists of one circular chromosome with no extrachromosomal elements and is one of the smallest known Roseobacter genomes. It contains 3,540 protein-coding genes and 59 RNA genes. Genome analysis revealed the presence of a photosynthetic gene cluster, which putatively enables a photoheterotrophic lifestyle. Gene sequences associated with quorum sensing, motility, surface attachment, and thiosulfate and carbon monoxide oxidation could be detected. The genome was sequenced as part of the activities of the Transregional Collaborative Research Centre 51 (TRR51) funded by the German Research Foundation (DFG).

  19. The complete genomic sequence of lytic bacteriophage gh-1 infecting Pseudomonas putida--evidence for close relationship to the T7 group

    Kovalyova, Irina V.; Kropinski, Andrew M.

    2003-01-01

    The genome of the lytic Pseudomonas putida bacteriophage gh-1 is linear double-stranded DNA containing 37,359 bp with 216-bp direct terminal repeats. Like other members of the T7 group, the gh-1 genome contains regions of high homology to T7 interspersed with nonhomologous regions that contain small open reading frames of unknown function. The genome shares 31 genes in common with other members of the T7 group, including RNA polymerase, and an additional 12 unique putative genes. A major difference between gh-1 and other members of this group is the absence of any open reading frames between the left direct terminal repeat and gene 1. Sequence analysis of the gh-1 genome also revealed the presence of 10 putative phage promoters with a consensus sequence similar to the promoters of T3 and phiYeO3-12 (consensus: TAAAAACCCTCACTRTGGCHSCM). P. putida mutants resistant to gh-1 were demonstrated to have an altered lipopolysaccharide structure, indicating that members of this group use lipopolysaccharide as their cellular receptor

  20. Whole-Genome Sequences of Four Strains Closely Related to Members of the Mycobacterium chelonae Group, Isolated from Biofilms in a Drinking Water Distribution System Simulator

    We report the draft genome sequences of four Mycobacterium chelonae group strains from biofilms obtained after a ‘chlorine burn’ in a chloraminated drinking water distribution system simulator. These opportunistic pathogens have been detected in drinking and hospital water distr...

  1. Mechanism and site of inhibition of Bacillus cereus spore outgrowth by nitrosothiols

    Morris, S.L.

    1982-01-01

    Structure vs. activity studies demonstrate that nitrosothiols inhibit outgrowth of B. cereus spores by reversible covalent bond formation with sensitive spore components. Kinetic studies of the binding of nitrosothiols and iodoacetate, a known sulfhydryl reagent, show that they complete for the same spore sites. Since two other nitrite derivatives, the Perigo factor and the transferrin inhibitor, interfere with iodoacetate label uptake in a kinetically similar fashion, all of these compounds may inhibit spore outgrowth by interacting with the same spore thiol groups. Disruption of spores which have been inhibited by radioactive iodoacetate demonstrates that much of the label is incorporated into a membrane-rich fraction that sediments as a single peak on a sucrose density gradient. SDS gel electrophoresis and autofluorography allows the identification of four intensely labelled proteins with molecular weights of 13,000, 28,000, 29,000, and 30,000. If the iodoacetate labelling is carried out in the presence of nitrosothiol, incorporation is greatly reduced into all components. When germinating spores are labelled with succinate or the lactose analog, o-nitrophenylgalactopyranoside, a significant reduction in the amount of label bound is also observed suggesting that two iodoacetate-reactive sites may be the succinate and lactose permease systems. Severe decreases in the transport of succinate and lactose into iodoacetate and nitrosothiol inhibited spores further implicates a nitrosothiol (iodoacetate) permease interaction. Iodoacetate and nitrosothiols therefore may exert their inhibitory effects by interfering with critical membrane protein sulfhydryl groups, possibly by a a covalent modification mechanism. Some of these sensitive thiols may be involved in active transport processes

  2. Genome-wide Association for Major Depression Through Age at Onset Stratification: Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium.

    Power, Robert A; Tansey, Katherine E; Buttenschøn, Henriette Nørmølle; Cohen-Woods, Sarah; Bigdeli, Tim; Hall, Lynsey S; Kutalik, Zoltán; Lee, S Hong; Ripke, Stephan; Steinberg, Stacy; Teumer, Alexander; Viktorin, Alexander; Wray, Naomi R; Arolt, Volker; Baune, Bernard T; Boomsma, Dorret I; Børglum, Anders D; Byrne, Enda M; Castelao, Enrique; Craddock, Nick; Craig, Ian W; Dannlowski, Udo; Deary, Ian J; Degenhardt, Franziska; Forstner, Andreas J; Gordon, Scott D; Grabe, Hans J; Grove, Jakob; Hamilton, Steven P; Hayward, Caroline; Heath, Andrew C; Hocking, Lynne J; Homuth, Georg; Hottenga, Jouke J; Kloiber, Stefan; Krogh, Jesper; Landén, Mikael; Lang, Maren; Levinson, Douglas F; Lichtenstein, Paul; Lucae, Susanne; MacIntyre, Donald J; Madden, Pamela; Magnusson, Patrik K E; Martin, Nicholas G; McIntosh, Andrew M; Middeldorp, Christel M; Milaneschi, Yuri; Montgomery, Grant W; Mors, Ole; Müller-Myhsok, Bertram; Nyholt, Dale R; Oskarsson, Hogni; Owen, Michael J; Padmanabhan, Sandosh; Penninx, Brenda W J H; Pergadia, Michele L; Porteous, David J; Potash, James B; Preisig, Martin; Rivera, Margarita; Shi, Jianxin; Shyn, Stanley I; Sigurdsson, Engilbert; Smit, Johannes H; Smith, Blair H; Stefansson, Hreinn; Stefansson, Kari; Strohmaier, Jana; Sullivan, Patrick F; Thomson, Pippa; Thorgeirsson, Thorgeir E; Van der Auwera, Sandra; Weissman, Myrna M; Breen, Gerome; Lewis, Cathryn M

    2017-02-15

    Major depressive disorder (MDD) is a disabling mood disorder, and despite a known heritable component, a large meta-analysis of genome-wide association studies revealed no replicable genetic risk variants. Given prior evidence of heterogeneity by age at onset in MDD, we tested whether genome-wide significant risk variants for MDD could be identified in cases subdivided by age at onset. Discovery case-control genome-wide association studies were performed where cases were stratified using increasing/decreasing age-at-onset cutoffs; significant single nucleotide polymorphisms were tested in nine independent replication samples, giving a total sample of 22,158 cases and 133,749 control subjects for subsetting. Polygenic score analysis was used to examine whether differences in shared genetic risk exists between earlier and adult-onset MDD with commonly comorbid disorders of schizophrenia, bipolar disorder, Alzheimer's disease, and coronary artery disease. We identified one replicated genome-wide significant locus associated with adult-onset (>27 years) MDD (rs7647854, odds ratio: 1.16, 95% confidence interval: 1.11-1.21, p = 5.2 × 10 -11 ). Using polygenic score analyses, we show that earlier-onset MDD is genetically more similar to schizophrenia and bipolar disorder than adult-onset MDD. We demonstrate that using additional phenotype data previously collected by genetic studies to tackle phenotypic heterogeneity in MDD can successfully lead to the discovery of genetic risk factor despite reduced sample size. Furthermore, our results suggest that the genetic susceptibility to MDD differs between adult- and earlier-onset MDD, with earlier-onset cases having a greater genetic overlap with schizophrenia and bipolar disorder. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  3. Use of Fatty Acid Methyl Ester Profiles for Discrimination of Bacillus cereus T-Strain Spores Grown on Different Media▿

    Ehrhardt, Christopher J.; Chu, Vivian; Brown, TeeCie; Simmons, Terrie L.; Swan, Brandon K.; Bannan, Jason; Robertson, James M.

    2010-01-01

    The goal of this study was to determine if cellular fatty acid methyl ester (FAME) profiling could be used to distinguish among spore samples from a single species (Bacillus cereus T strain) that were prepared on 10 different medium formulations. To analyze profile differences and identify FAME biomarkers diagnostic for the chemical constituents in each sporulation medium, a variety of statistical techniques were used, including nonmetric multidimensional scaling (nMDS), analysis of similarities (ANOSIM), and discriminant function analysis (DFA). The results showed that one FAME biomarker, oleic acid (18:1 ω9c), was exclusively associated with spores grown on Columbia agar supplemented with sheep blood and was indicative of blood supplements that were present in the sporulation medium. For spores grown in other formulations, multivariate comparisons across several FAME biomarkers were required to discern profile differences. Clustering patterns in nMDS plots and R values from ANOSIM revealed that dissimilarities among FAME profiles were most pronounced when spores grown with disparate sources of complex additives or protein supplements were compared (R > 0.8), although other factors also contributed to FAME differences. DFA indicated that differentiation could be maximized with a targeted subset of FAME variables, and the relative contributions of branched FAME biomarkers to group dissimilarities changed when different media were compared. When taken together, these analyses indicate that B. cereus spore samples grown in different media can be resolved with FAME profiling and that this may be a useful technique for providing intelligence about the production methods of Bacillus organisms in a forensic investigation. PMID:20097814

  4. Use of fatty acid methyl ester profiles for discrimination of Bacillus cereus T-strain spores grown on different media.

    Ehrhardt, Christopher J; Chu, Vivian; Brown, TeeCie; Simmons, Terrie L; Swan, Brandon K; Bannan, Jason; Robertson, James M

    2010-03-01

    The goal of this study was to determine if cellular fatty acid methyl ester (FAME) profiling could be used to distinguish among spore samples from a single species (Bacillus cereus T strain) that were prepared on 10 different medium formulations. To analyze profile differences and identify FAME biomarkers diagnostic for the chemical constituents in each sporulation medium, a variety of statistical techniques were used, including nonmetric multidimensional scaling (nMDS), analysis of similarities (ANOSIM), and discriminant function analysis (DFA). The results showed that one FAME biomarker, oleic acid (18:1 omega9c), was exclusively associated with spores grown on Columbia agar supplemented with sheep blood and was indicative of blood supplements that were present in the sporulation medium. For spores grown in other formulations, multivariate comparisons across several FAME biomarkers were required to discern profile differences. Clustering patterns in nMDS plots and R values from ANOSIM revealed that dissimilarities among FAME profiles were most pronounced when spores grown with disparate sources of complex additives or protein supplements were compared (R > 0.8), although other factors also contributed to FAME differences. DFA indicated that differentiation could be maximized with a targeted subset of FAME variables, and the relative contributions of branched FAME biomarkers to group dissimilarities changed when different media were compared. When taken together, these analyses indicate that B. cereus spore samples grown in different media can be resolved with FAME profiling and that this may be a useful technique for providing intelligence about the production methods of Bacillus organisms in a forensic investigation.

  5. Complete mtDNA genomes of Filipino ethnolinguistic groups: a melting pot of recent and ancient lineages in the Asia-Pacific region

    Delfin, Frederick; Min-Shan Ko, Albert; Li, Mingkun; Gunnarsdóttir, Ellen D; Tabbada, Kristina A; Salvador, Jazelyn M; Calacal, Gayvelline C; Sagum, Minerva S; Datar, Francisco A; Padilla, Sabino G; De Ungria, Maria Corazon A; Stoneking, Mark

    2014-01-01

    The Philippines is a strategic point in the Asia-Pacific region for the study of human diversity, history and origins, as it is a cross-road for human migrations and consequently exhibits enormous ethnolinguistic diversity. Following on a previous in-depth study of Y-chromosome variation, here we provide new insights into the maternal genetic history of Filipino ethnolinguistic groups by surveying complete mitochondrial DNA (mtDNA) genomes from a total of 14 groups (11 groups in this study and 3 groups previously published) including previously published mtDNA hypervariable segment (HVS) data from Filipino regional center groups. Comparison of HVS data indicate genetic differences between ethnolinguistic and regional center groups. The complete mtDNA genomes of 14 ethnolinguistic groups reveal genetic aspects consistent with the Y-chromosome, namely: diversity and heterogeneity of groups, no support for a simple dichotomy between Negrito and non-Negrito groups, and different genetic affinities with Asia-Pacific groups that are both ancient and recent. Although some mtDNA haplogroups can be associated with the Austronesian expansion, there are others that associate with South Asia, Near Oceania and Australia that are consistent with a southern migration route for ethnolinguistic group ancestors into the Asia-Pacific, with a timeline that overlaps with the initial colonization of the Asia-Pacific region, the initial colonization of the Philippines and a possible separate post-colonization migration into the Philippine archipelago. PMID:23756438

  6. Modeling heterogeneous (co)variances from adjacent-SNP groups improves genomic prediction for milk protein composition traits

    Gebreyesus, Grum; Lund, Mogens Sandø; Buitenhuis, Albert Johannes

    2017-01-01

    Accurate genomic prediction requires a large reference population, which is problematic for traits that are expensive to measure. Traits related to milk protein composition are not routinely recorded due to costly procedures and are considered to be controlled by a few quantitative trait loci...... of large effect. The amount of variation explained may vary between regions leading to heterogeneous (co)variance patterns across the genome. Genomic prediction models that can efficiently take such heterogeneity of (co)variances into account can result in improved prediction reliability. In this study, we...... developed and implemented novel univariate and bivariate Bayesian prediction models, based on estimates of heterogeneous (co)variances for genome segments (BayesAS). Available data consisted of milk protein composition traits measured on cows and de-regressed proofs of total protein yield derived for bulls...

  7. Comparative transcriptome analysis of biofilm and planktonic cells of Bacillus cereus ATCC 14579

    Wijman, Janneke; Mols, M.; Tempelaars, Marcel; Abee, Tjakko

    2015-01-01

    Planktonic and biofilm cells of Bacillus cereus ATCC 14579 and ATCC 10987 were studied using microscopy and transcriptome analysis. By microscopy, clear differences could be observed between biofilm and planktonic cells as well as between the two strains. By using hierarchical clustering of the

  8. Comparative transcriptome analysis of biofilm and planktonic cells of Bacillus cereus ATCC 10987

    Wijman, Janneke; Mols, M.; Tempelaars, Marcel; Abee, Tjakko

    2015-01-01

    Planktonic and biofilm cells of Bacillus cereus ATCC 14579 and ATCC 10987 were studied using microscopy and transcriptome analysis. By microscopy, clear differences could be observed between biofilm and planktonic cells as well as between the two strains. By using hierarchical clustering of the

  9. Role of ureolytic activity in Bacillus cereus nitrogen metabolism and acid survival

    Mols, J.M.; Abee, T.

    2008-01-01

    The presence and activities of urease genes were investigated in 49 clinical, food, and environmental Bacillus cereus isolates. Ten strains were shown to have urease genes, with eight of these strains showing growth on urea as the sole nitrogen source. Two of the urease-positive strains, including

  10. Predictive modeling of Bacillus cereus spores in farm tank milk during grazing and housing periods

    Vissers, M.M.M.; Giffel, M.C.T.; Driehuis, F.; Jong, de P.; Lankveld, J.M.G.

    2007-01-01

    The shelf life of pasteurized dairy products depends partly on the concentration of Bacillus cereus spores in raw milk. Based on a translation of contamination pathways into chains of unit-operations, 2 simulation models were developed to quantitatively identify factors that have the greatest effect

  11. Sporulation dynamics and spore heat resistance in wet and dry biofilms of Bacillus cereus

    Hayrapetyan, Hasmik; Abee, Tjakko; Nierop Groot, Masja

    2016-01-01

    Environmental conditions and growth history can affect the sporulation process as well as subsequent properties of formed spores. The sporulation dynamics was studied in wet and air-dried biofilms formed on stainless steel (SS) and polystyrene (PS) for Bacillus cereus ATCC 10987 and the

  12. Partial Characterisation of Bacteriocins Produced by Bacillus cereus Isolates from Milk and Milk Products

    Bojana Bogović Matijašić

    2003-01-01

    Full Text Available Thirty one (19.2 % out of 161 Bacillus cereus isolates from raw milk and milk products were found to produce proteinaceous substances which inhibit the growth of other B. cereus isolates. The detection of antibacterial activity depended on medium and method used. Bactericidal activity was detected in 23 (14 % or 19 (12 % of the tested strains on the triptic soya agar and brain-heart infusion with glucose, respectively, while 11 (7 % of the strains produced bactericidal substances on both media. Nineteen percent of isolates from raw milk and 20 % of isolates from milk products were found to produce bacteriocins. Four B. cereus isolates inhibited the growth of individual test strains belonging to B. licheniformis, B. subtilis, Enterococcus faecalis, Escherichia coli, Staphylococcus aureus, Lactobacillus helveticus and L. casei species. The bacteriocins of four B. cereus isolates were studied in more detail. The production and activity of these substances were detected in stationary- phase of bacterial culture. Two of them were stable after heating at 60 °C, while only one was stable after heating at 75 °C for 15 minutes. All of them were active over a range of pH=3–10. The apparent molecular weights of four bacteriocins detected by SDS-PAGE electrophoresis were in the range of 1 to 8 kDa.

  13. Isolation, identification and characterization of Bacillus cereus from the dairy environment

    Giffel, te M.

    1997-01-01

    In this thesis the occurrence of Bacillus cereus in the milk production and processing environment was investigated. Isolates were identified biochemically and by DNA probes based on the variable regions of 16S rRNA. Further characterization was carried out using

  14. Lessons learnt from a birthday party: a Bacillus cereus outbreak, Bari, Italy, January 2012

    Domenico Martinelli

    2013-12-01

    Full Text Available INTRODUCTION: Bacillus cereus, a ubiquitous bacterium, can be isolated in various starchy food items, causing both emetic and diarrhoeal disease. The real burden of B. cereus outbreaks is actually poorly known in Italy. We report a B. cereus foodborne outbreak that occurred in a pub in Bari (Italy on January 22nd 2012 during a birthday party, promptly reported by the pub owner. MATERIALS AND METHODS: Between January 22nd and 24th 2012, we performed a retrospective cohort study among the guests of the party to identify risk factors associated with illness. Leftovers of different meals were available for microbiological analysis. Faecal specimens were collected from cases. RESULTS: A total of 12 cases among the 13 customers (attack rate: 92% were reported. All cases had consumed basmati rice and sweet and sour vegetables (aetiological fraction: 100%. B. cereus was isolated from both basmati rice served during the party and faecal specimens. DISCUSSION: The close collaboration between the pub owner and the public health officers and the possibility to test food leftovers and stool samples contributed to prevent further cases.

  15. Population and Whole Genome Sequence Based Characterization of Invasive Group A Streptococci Recovered in the United States during 2015

    Sopio Chochua

    2017-09-01

    Full Text Available Group A streptococci (GAS are genetically diverse. Determination of strain features can reveal associations with disease and resistance and assist in vaccine formulation. We employed whole-genome sequence (WGS-based characterization of 1,454 invasive GAS isolates recovered in 2015 by Active Bacterial Core Surveillance and performed conventional antimicrobial susceptibility testing. Predictions were made for genotype, GAS carbohydrate, antimicrobial resistance, surface proteins (M family, fibronectin binding, T, R28, secreted virulence proteins (Sda1, Sic, exotoxins, hyaluronate capsule, and an upregulated nga operon (encodes NADase and streptolysin O promoter (Pnga3. Sixty-four M protein gene (emm types were identified among 69 clonal complexes (CCs, including one CC of Streptococcus dysgalactiae subsp. equisimilis. emm types predicted the presence or absence of active sof determinants and were segregated into sof-positive or sof-negative genetic complexes. Only one “emm type switch” between strains was apparent. sof-negative strains showed a propensity to cause infections in the first quarter of the year, while sof+ strain infections were more likely in summer. Of 1,454 isolates, 808 (55.6% were Pnga3 positive and 637 (78.9% were accounted for by types emm1, emm89, and emm12. Theoretical coverage of a 30-valent M vaccine combined with an M-related protein (Mrp vaccine encompassed 98% of the isolates. WGS data predicted that 15.3, 13.8, 12.7, and 0.6% of the isolates were nonsusceptible to tetracycline, erythromycin plus clindamycin, erythromycin, and fluoroquinolones, respectively, with only 19 discordant phenotypic results. Close phylogenetic clustering of emm59 isolates was consistent with recent regional emergence. This study revealed strain traits informative for GAS disease incidence tracking, outbreak detection, vaccine strategy, and antimicrobial therapy.

  16. Study of the antibacterial effects of chitosans on Bacillus cereus (and its spores) by atomic force microscopy imaging and nanoindentation

    Fernandes, Joao C. [Escola Superior de Biotecnologia, Universidade Catolica Portuguesa, Rua Dr. Antonio Bernardino de Almeida, 4200-072 Porto (Portugal); Eaton, Peter, E-mail: peter.eaton@fc.up.pt [REQUIMTE, Departamento de Quimica, Faculdade de Ciencias da Universidade do Porto, Rua do Campo Alegre, 4169-007 Porto (Portugal); Gomes, Ana M.; Pintado, Manuela E.; Xavier Malcata, F. [Escola Superior de Biotecnologia, Universidade Catolica Portuguesa, Rua Dr. Antonio Bernardino de Almeida, 4200-072 Porto (Portugal)

    2009-07-15

    Bacillus cereus is a Gram-positive, spore-forming bacterium that is widely distributed in nature. Its intrinsic thermal resistance coupled with the extraordinary resistance against common food preservation techniques makes it one of the most frequent food-poisoning microorganisms causing both intoxications and infections. In order to control B. cereus growth/sporulation, and hence minimize the aforementioned hazards, several antimicrobial compounds have been tested. The aim of this work was to assess by atomic force microscopy (AFM) the relationship between the molecular weight (MW) of chitosan and its antimicrobial activity upon both vegetative and resistance forms of B. cereus. The use of AFM imaging studies helped us to understand how chitosans with different MW act differently upon B. cereus. Higher MW chitosans (628 and 100 kDa) surrounded both forms of B. cereus cells by forming a polymer layer-which eventually led to the death of the vegetative form by preventing the uptake of nutrients yet did not affect the spores since these can survive for extended periods without nutrients. Chitooligosaccharides (COS) (<3 kDa), on the other hand, provoked more visible damages in the B. cereus vegetative form-most probably due to the penetration of the cells by the COS. The use of COS by itself on B. cereus spores was not enough for the destruction of a large number of cells, but it may well weaken the spore structure and its ability to contaminate, by inducing exosporium loss.

  17. Bacillus subtilis HJ18-4 from traditional fermented soybean food inhibits Bacillus cereus growth and toxin-related genes.

    Eom, Jeong Seon; Lee, Sun Young; Choi, Hye Sun

    2014-11-01

    Bacillus subtilis HJ18-4 isolated from buckwheat sokseongjang, a traditional Korean fermented soybean food, exhibits broad-spectrum antimicrobial activity against foodborne pathogens, including Bacillus cereus. In this study, we investigated the antibacterial efficacy and regulation of toxin gene expression in B. cereus by B. subtilis HJ18-4. Expression of B. cereus toxin-related genes (groEL, nheA, nheC, and entFM) was downregulated by B. subtilis HJ18-4, which also exhibited strong antibacterial activity against B. cereus. We also found that water extracts of soy product fermented with B. subtilis HJ18-4 significantly inhibited the growth of B. cereus and toxin expression. These results indicate that B. subtilis HJ18-4 could be used as an antimicrobial agent to control B. cereus in the fermented soybean food industry. Our findings also provide an opportunity to develop an efficient biological control agent against B. cereus. © 2014 The Authors. Journal of Food Science published by Wiley Periodicals, Inc. on behalf of Institute of Food Technologists®

  18. Study of the antibacterial effects of chitosans on Bacillus cereus (and its spores) by atomic force microscopy imaging and nanoindentation

    Fernandes, Joao C.; Eaton, Peter; Gomes, Ana M.; Pintado, Manuela E.; Xavier Malcata, F.

    2009-01-01

    Bacillus cereus is a Gram-positive, spore-forming bacterium that is widely distributed in nature. Its intrinsic thermal resistance coupled with the extraordinary resistance against common food preservation techniques makes it one of the most frequent food-poisoning microorganisms causing both intoxications and infections. In order to control B. cereus growth/sporulation, and hence minimize the aforementioned hazards, several antimicrobial compounds have been tested. The aim of this work was to assess by atomic force microscopy (AFM) the relationship between the molecular weight (MW) of chitosan and its antimicrobial activity upon both vegetative and resistance forms of B. cereus. The use of AFM imaging studies helped us to understand how chitosans with different MW act differently upon B. cereus. Higher MW chitosans (628 and 100 kDa) surrounded both forms of B. cereus cells by forming a polymer layer-which eventually led to the death of the vegetative form by preventing the uptake of nutrients yet did not affect the spores since these can survive for extended periods without nutrients. Chitooligosaccharides (COS) (<3 kDa), on the other hand, provoked more visible damages in the B. cereus vegetative form-most probably due to the penetration of the cells by the COS. The use of COS by itself on B. cereus spores was not enough for the destruction of a large number of cells, but it may well weaken the spore structure and its ability to contaminate, by inducing exosporium loss.

  19. Complete genome sequence of the bacteriochlorophyll a-containing Roseibacterium elongatum type strain (DSM 19469T), a representative of the Roseobacter group isolated from Australian coast sand

    Riedel, Thomas; Fiebig, Anne; Göker, Markus; Klenk, Hans-Peter

    2014-01-01

    Roseibacterium elongatum Suzuki et al. 2006 is a pink-pigmented and bacteriochlorophyll a-producing representative of the Roseobacter group within the alphaproteobacterial family Rhodobacteraceae. Representatives of the marine ‘Roseobacter group’ were found to be abundant in the ocean and play an important role in global and biogeochemical processes. In the present study we describe the features of R. elongatum strain OCh 323T together with its genome sequence and annotation. The 3,555,102 bp long genome consists of one circular chromosome with no extrachromosomal elements and is one of the smallest known Roseobacter genomes. It contains 3,540 protein-coding genes and 59 RNA genes. Genome analysis revealed the presence of a photosynthetic gene cluster, which putatively enables a photoheterotrophic lifestyle. Gene sequences associated with quorum sensing, motility, surface attachment, and thiosulfate and carbon monoxide oxidation could be detected. The genome was sequenced as part of the activities of the Transregional Collaborative Research Centre 51 (TRR51) funded by the German Research Foundation (DFG). PMID:25197467

  20. Prevalence, Virulence Genes, Antimicrobial Susceptibility, and Genetic Diversity of Bacillus cereus Isolated From Pasteurized Milk in China

    Tiantian Gao

    2018-03-01

    Full Text Available Bacillus cereus is a common and important food-borne pathogen that can be found in various food products. Due to low-temperature sterilization for a short period of time, pasteurization is not sufficient for complete elimination of B. cereus in milk, thereby cause severe economic loss and food safety problems. It is therefore of paramount importance to perform risk assessment of B. cereus in pasteurized milk. In this study, we isolated B. cereus from pasteurized milk samples in different regions of China, and evaluated the contamination situation, existence of virulence genes, antibiotic resistance profile and genetic polymorphism of B. cereus isolates. Intriguingly, 70 samples (27% were found to be contaminated by B. cereus and the average contamination level was 111 MPN/g. The distribution of virulence genes was assessed toward 10 enterotoxigenic genes (hblA, hblC, hblD, nheA, nheB, nheC, cytK, entFM, bceT, and hlyII and one emetic gene (cesB. Forty five percent strains harbored enterotoxigenic genes hblACD and 93% isolates contained nheABC gene cluster. The positive rate of cytK, entFM, bceT, hlyII, and cesB genes were 73, 96, 75, 54, and 5%, respectively. Antibiotic susceptibility assessment showed that most of the isolates were resistant to β-lactam antibiotics and rifampicin, but susceptible to other antibiotics such as ciprofloxacin, gentamicin and chloramphenicol. Total multidrug-resistant population was about 34%. In addition, B. cereus isolates in pasteurized milk showed a high genetic diversity. In conclusion, our findings provide the first reference on the prevalence, contamination level and characteristics of B. cereus isolated from pasteurized milk in China, suggesting a potential high risk of B. cereus to public health and dairy industry.

  1. Inactivation of Bacillus cereus vegetative cells by gastric acid and bile during in vitro gastrointestinal transit

    Ceuppens Siele

    2012-10-01

    Full Text Available Abstract Background The foodborne pathogen Bacillus cereus can cause diarrhoeal food poisoning by production of enterotoxins in the small intestine. The prerequisite for diarrhoeal disease is thus survival during gastrointestinal passage. Methods Vegetative cells of 3 different B. cereus strains were cultivated in a real composite food matrix, lasagne verde, and their survival during subsequent simulation of gastrointestinal passage was assessed using in vitro experiments simulating transit through the human upper gastrointestinal tract (from mouth to small intestine. Results No survival of vegetative cells was observed, despite the high inoculum levels of 7.0 to 8.0 log CFU/g and the presence of various potentially protective food components. Significant fractions (approx. 10% of the consumed inoculum of B. cereus vegetative cells survived gastric passage, but they were subsequently inactivated by bile exposure in weakly acidic intestinal medium (pH 5.0. In contrast, the low numbers of spores present (up to 4.0 log spores/g showed excellent survival and remained viable spores throughout the gastrointestinal passage simulation. Conclusion Vegetative cells are inactivated by gastric acid and bile during gastrointestinal passage, while spores are resistant and survive. Therefore, the physiological form (vegetative cells or spores of the B. cereus consumed determines the subsequent gastrointestinal survival and thus the infective dose, which is expected to be much lower for spores than vegetative cells. No significant differences in gastrointestinal survival ability was found among the different strains. However, considerable strain variability was observed in sporulation tendency during growth in laboratory medium and food, which has important implications for the gastrointestinal survival potential of the different B. cereus strains.

  2. Inactivation of Enterobacter sakazakii, Bacillus cereus, and Salmonella typhimurium in powdered weaning food by electron-beam irradiation

    Hong, Yun-Hee; Park, Ji-Yong; Park, Jong-Hyun; Chung, Myong-Soo; Kwon, Ki-Sung; Chung, Kyungsook; Won, Misun; Song, Kyung-Bin

    2008-09-01

    Inactivation of Enterobacter sakazakii, Bacillus cereus, and Salmonella typhimurium were evaluated in powdered weaning food using electron-beam irradiation. E. sakazakii, B. cereus, and S. typhimurium were eliminated by irradiation at 16, 8, and 8 kGy, respectively. The D10-vlaues of E. sakazakii, B. cereus, and S. typhimurium inoculated on powdered weaning food were 4.83, 1.22, and 0.98 kGy, respectively. The results suggest that electron-beam irradiation should inhibit the growth of pathogenic bacteria on baby food without impairing qualities.

  3. Inactivation of Enterobacter sakazakii, Bacillus cereus, and Salmonella typhimurium in powdered weaning food by electron-beam irradiation

    Hong, Yun-Hee [Department of Food Science and Technology, College of Agriculture and Life Science, Chungnam National University, Yuseong-Gu, Daejeon 305-764 (Korea, Republic of); Park, Ji-Yong [Department of Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Park, Jong-Hyun [Department of Food Science and Biotechnology, Kyungwon University, Sungnam 461-701 (Korea, Republic of); Chung, Myong-Soo [Department of Food Science, Ehwa Women' s University, Seoul 120-750 (Korea, Republic of); Kwon, Ki-Sung [Center for Food safety Evaluation, Korea Food and Drug Administration, Seoul 122-704 (Korea, Republic of); Chung, Kyungsook; Won, Misun [Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-333 (Korea, Republic of); Song, Kyung-Bin [Department of Food Science and Technology, College of Agriculture and Life Science, Chungnam National University, Yuseong-Gu, Daejeon 305-764 (Korea, Republic of)], E-mail: kbsong@cnu.ac.kr

    2008-09-15

    Inactivation of Enterobacter sakazakii, Bacillus cereus, and Salmonella typhimurium were evaluated in powdered weaning food using electron-beam irradiation. E. sakazakii, B. cereus, and S. typhimurium were eliminated by irradiation at 16, 8, and 8 kGy, respectively. The D{sub 10}-vlaues of E. sakazakii, B. cereus, and S. typhimurium inoculated on powdered weaning food were 4.83, 1.22, and 0.98 kGy, respectively. The results suggest that electron-beam irradiation should inhibit the growth of pathogenic bacteria on baby food without impairing qualities.

  4. Inactivation of Enterobacter sakazakii, Bacillus cereus, and Salmonella typhimurium in powdered weaning food by electron-beam irradiation

    Hong, Yun-Hee; Park, Ji-Yong; Park, Jong-Hyun; Chung, Myong-Soo; Kwon, Ki-Sung; Chung, Kyungsook; Won, Misun; Song, Kyung-Bin

    2008-01-01

    Inactivation of Enterobacter sakazakii, Bacillus cereus, and Salmonella typhimurium were evaluated in powdered weaning food using electron-beam irradiation. E. sakazakii, B. cereus, and S. typhimurium were eliminated by irradiation at 16, 8, and 8 kGy, respectively. The D 10 -vlaues of E. sakazakii, B. cereus, and S. typhimurium inoculated on powdered weaning food were 4.83, 1.22, and 0.98 kGy, respectively. The results suggest that electron-beam irradiation should inhibit the growth of pathogenic bacteria on baby food without impairing qualities

  5. Prevalence, virulence factor genes and antibiotic resistance of Bacillus cereus sensu lato isolated from dairy farms and traditional dairy products

    Owusu-Kwarteng, James; Wuni, Alhassan; Akabanda, Fortune

    2017-01-01

    of B. cereus sensu lato isolated from cattle grazing soils and dairy products in Ghana. A total of 114 samples made up of 25 soil collected from cattle grazing farm land, 30 raw milk, 28 nunu (yoghurt-like product) and 31 woagashie (West African soft cheese). Ninety-six B. cereus sensu lato isolates......%), oxacillin (92%), penicillin (100%), amoxicillin (100%), and cefepime (100%) but susceptible to other antibiotics tested. Conclusions: Bacillus cereus s. l. is prevalent in soil, raw milk and dairy products in Ghana. However, loads are at levels considered to be safe for consumption. Various enterotoxin...

  6. Crystallization and preliminary X-ray crystallographic analysis of peptide deformylase (PDF) from Bacillus cereus in ligand-free and actinonin-bound forms

    Park, Joon Kyu; Moon, Jin Ho; Kim, Jae-Hong; Kim, Eunice EunKyeong

    2004-01-01

    Peptide deformylase (PDF) from B. cereus has been overexpressed, purified and crystallized in ligand-free and actinonin-bound forms. Diffraction data have been collected from these crystals to 1.7 and 2.0 Å resolution, respectively. In bacteria, protein expression initiates with an N-formyl group and this needs to be removed in order to ensure proper bacterial growth. These formylation and deformylation processes are unique to eubacteria; therefore, inhibition of these would provide a novel antibacterial therapy. Deformylation is carried out by peptide deformylase (PDF). PDF from Bacillus cereus, one of the major pathogenic bacteria, was cloned into expression plasmid pET-28a (Novagen), overexpressed in Escherichia coli BL21 (DE3) and purified to high quality. Crystals have been obtained of both ligand-free PDF and PDF to which actinonin, a highly potent naturally occurring inhibitor, is bound. Both crystals belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 42.72, b = 44.04, c = 85.19 Å and a = 41.31, b = 44.56, c = 84.47 Å, respectively. Diffraction data were collected to 1.7 Å resolution for the inhibitor-free crystals and to 2.0 Å resolution for the actinonin-bound crystals

  7. The T box regulatory element controlling expression of the class I lysyl-tRNA synthetase of Bacillus cereus strain 14579 is functional and can be partially induced by reduced charging of asparaginyl-tRNAAsn

    Foy, Niall

    2010-07-22

    Abstract Background Lysyl-tRNA synthetase (LysRS) is unique within the aminoacyl-tRNA synthetase family in that both class I (LysRS1) and class II (LysRS2) enzymes exist. LysRS1 enzymes are found in Archaebacteria and some eubacteria while all other organisms have LysRS2 enzymes. All sequenced strains of Bacillus cereus (except AH820) and Bacillus thuringiensis however encode both a class I and a class II LysRS. The lysK gene (encoding LysRS1) of B. cereus strain 14579 has an associated T box element, the first reported instance of potential T box control of LysRS expression. Results A global study of 891 completely sequenced bacterial genomes identified T box elements associated with control of LysRS expression in only four bacterial species: B. cereus, B. thuringiensis, Symbiobacterium thermophilum and Clostridium beijerinckii. Here we investigate the T box element found in the regulatory region of the lysK gene in B. cereus strain 14579. We show that this T box element is functional, responding in a canonical manner to an increased level of uncharged tRNALys but, unusually, also responding to an increased level of uncharged tRNAAsn. We also show that B. subtilis strains with T box regulated expression of the endogenous lysS or the heterologous lysK genes are viable. Conclusions The T box element controlling lysK (encoding LysRS1) expression in B. cereus strain 14579 is functional, but unusually responds to depletion of charged tRNALys and tRNAAsn. This may have the advantage of making LysRS1 expression responsive to a wider range of nutritional stresses. The viability of B. subtilis strains with a single LysRS1 or LysRS2, whose expression is controlled by this T box element, makes the rarity of the occurrence of such control of LysRS expression puzzling.

  8. Sensitivity of Spores of Eight Bacillus Cereus Strains to Pressure-Induced Germination by Moderate Hydrostatic Pressure, Time and Temperature

    Kalchayanand, Norasak; Ray, Bibek; Dunne, C. P; Sikes, Anthony

    2005-01-01

    The spores of eight Bacillus cereus strains were pressurized at 138 to 483 MPa for 5 to 20 min at 25 to 70 C in order to determine the sensitive and the resistant strains to pressure-induced germination...

  9. ENUMERATION OF Bacillus cereus IN “FUBÁ” OF CORN (Zea mays. L. ENUMERAÇÃO DE Bacillus cereus EM FUBÁ DE MILHO (Zea mays L.

    Albenones José de Mesquita

    2007-09-01

    Full Text Available

    A hundred (100 samples of “fubá” were examined, in relation to the incidence of Bacillus cereus, obtained by different technological processes (common “fubá” and previously cooked “fubá” and sold in the retail market in Goiânia - GO. The results of the examination showed that 23% of the samples was contaminated, of this percentual, 39.1% of the contaminations occurred in samples of previously cooked “fubá” and 60.9% in samples of common “fubá”. This in relation of the two products clearly showed the more accurate technological process that the previously cooked “fubá” was brought under. It was also observed that the totality of the analyzed samples showed enumerations below the limit established by the Brazilian microbiologic standard that establishes a limit of 10³ cells of Bacillus cereus for a gram of the food.

    Foram examinadas 100 amostras de fubá de milho, em relação à incidência de Bacillus cereus, obtidas através de processamentos tecnológicos diferentes (fubá comum e fubá pré-cozido e comercializadas no mercado varejista de Goiânia - GO. Os resultados revelaram que 23% das amostras estavam contaminadas, deste percentual, 39,1% das contaminações ocorreram em amostras de fubá pré-cozido e 60,9%, em amostras de fubá comum. Esta considerável diferença, observada em termos percentuais em relação aos dois produtos evidenciou o processamento tecnológico mais rigoroso a que foi submetido o fubá pré-cozido. Observou-se, também, que a totalidade das amostras analisadas apresentou enumerações abaixo do limite estabelecido pelo padrão microbiológico brasileiro que determina um limite de 10³ células de B. cereus por gama do alimento.

  10. Effects of nisin and temperature on survival, growth, and enterotoxin production characteristics of psychrotrophic Bacillus cereus in beef gravy.

    Beuchat, L R; Clavero, M R; Jaquette, C B

    1997-01-01

    The presence of psychrotrophic enterotoxigenic Bacillus cereus in ready-to-serve meats and meat products that have not been subjected to sterilization treatment is a public health concern. A study was undertaken to determine the survival, growth, and diarrheal enterotoxin production characteristics of four strains of psychrotrophic B. cereus in brain heart infusion (BHI) broth and beef gravy as affected by temperature and supplementation with nisin. A portion of unheated vegetative cells from...

  11. A Study To Assess the Numbers and Prevalence of Bacillus cereus and Its Toxins in Pasteurized Fluid Milk.

    Saleh-Lakha, Saleema; Leon-Velarde, Carlos G; Chen, Shu; Lee, Susan; Shannon, Kelly; Fabri, Martha; Downing, Gavin; Keown, Bruce

    2017-07-01

    Bacillus cereus is a pathogenic adulterant of raw milk and can persist as spores and grow in pasteurized milk. The objective of this study was to determine the prevalence of B. cereus and its enterotoxins in pasteurized milk at its best-before date when stored at 4, 7, and 10°C. More than 5.5% of moderately temperature-abused products (stored at 7°C) were found to contain >10 5 CFU/mL B. cereus , and about 4% of them contained enterotoxins at a level that may result in foodborne illness; in addition, more than 31% of the products contained >10 5 CFU/mL B. cereus and associated enterotoxins when stored at 10°C. Results from a growth kinetic study demonstrated that enterotoxin production by B. cereus in pasteurized milk can occur in as short as 7 to 8 days of storage at 7°C. The higher B. cereus counts were associated with products containing higher butterfat content or with those produced using the conventional high-temperature, short-time pasteurization process. Traditional indicators, aerobic colony counts and psychrotrophic counts, were found to have no correlation with level of B. cereus in milk. The characterization of 17 representative B. cereus isolates from pasteurized milk revealed five toxigenic gene patterns, with all the strains carrying genes encoding for diarrheal toxins but not for an emetic toxin, and with one strain containing all four diarrheal enterotoxin genes (nheA, entFM, hblC, and cytK). The results of this study demonstrate the risks associated even with moderately temperature-abused pasteurized milk and the necessity of a controlled cold chain throughout the shelf life of fluid milk to enhance product safety and minimize foodborne illness.

  12. Lactobacillus delbrueckii subsp lactis CIDCA 133 modulates response of human epithelial and dendritic cells infected with Bacillus cereus.

    Rolny, I S; Tiscornia, I; Racedo, S M; Pérez, P F; Bollati-Fogolín, M

    2016-11-30

    It is known that probiotic microorganisms are able to modulate pathogen virulence. This ability is strain dependent and involves multiple interactions between microorganisms and relevant host's cell populations. In the present work we focus on the effect of a potentially probiotic lactobacillus strain (Lactobacillus delbrueckii subsp. lactis CIDCA 133) in an in vitro model of Bacillus cereus infection. Our results showed that infection of intestinal epithelial HT-29 cells by B. cereus induces nuclear factor kappa B (NF-κB) pathway. Noteworthy, the presence of strain L. delbrueckii subsp.lactis CIDCA 133 increases stimulation. However, B. cereus-induced interleukin (IL)-8 production by epithelial cells is partially abrogated by L. delbrueckii subsp. lactis CIDCA 133. These findings suggest that signalling pathways other than that of NF-κB are involved. In a co-culture system (HT-29 and monocyte-derived dendritic cells), B. cereus was able to translocate from the epithelial (upper) to the dendritic cell compartment (lower). This translocation was partially abrogated by the presence of lactobacilli in the upper compartment. In addition, infection of epithelial cells in the co-culture model, led to an increase in the expression of CD86 by dendritic cells. This effect could not be modified in the presence of lactobacilli. Interestingly, infection of enterocytes with B. cereus triggers production of proinflammatory cytokines by dendritic cells (IL-8, IL-6 and tumour necrosis factor alpha (TNF-α)). The production of TNF-α (a protective cytokine in B. cereus infections) by dendritic cells was increased in the presence of lactobacilli. The present work demonstrates for the first time the effect of L. delbrueckii subsp. lactis CIDCA 133, a potentially probiotic strain, in an in vitro model of B. cereus infection. The presence of the probiotic strain modulates cell response both in infected epithelial and dendritic cells thus suggesting a possible beneficial effect of

  13. Root exudate-induced alterations in Bacillus cereus cell wall contribute to root colonization and plant growth promotion.

    Swarnalee Dutta

    Full Text Available The outcome of an interaction between plant growth promoting rhizobacteria and plants may depend on the chemical composition of root exudates (REs. We report the colonization of tobacco, and not groundnut, roots by a non-rhizospheric Bacillus cereus (MTCC 430. There was a differential alteration in the cell wall components of B. cereus in response to the REs from tobacco and groundnut. Attenuated total reflectance infrared spectroscopy revealed a split in amide I region of B. cereus cells exposed to tobacco-root exudates (TRE, compared to those exposed to groundnut-root exudates (GRE. In addition, changes in exopolysaccharides and lipid-packing were observed in B. cereus grown in TRE-amended minimal media that were not detectable in GRE-amended media. Cell-wall proteome analyses revealed upregulation of oxidative stress-related alkyl hydroperoxide reductase, and DNA-protecting protein chain (Dlp-2, in response to GRE and TRE, respectively. Metabolism-related enzymes like 2-amino-3-ketobutyrate coenzyme A ligase and 2-methylcitrate dehydratase and a 60 kDa chaperonin were up-regulated in response to TRE and GRE. In response to B. cereus, the plant roots altered their exudate-chemodiversity with respect to carbohydrates, organic acids, alkanes, and polyols. TRE-induced changes in surface components of B. cereus may contribute to successful root colonization and subsequent plant growth promotion.

  14. Model comparison on genomic predictions using high-density markers for different groups of bulls in the Nordic Holstein population

    Gao, Hongding; Su, Guosheng; Janss, Luc

    2013-01-01

    This study compared genomic predictions based on imputed high-density markers (~777,000) in the Nordic Holstein population using a genomic BLUP (GBLUP) model, 4 Bayesian exponential power models with different shape parameters (0.3, 0.5, 0.8, and 1.0) for the exponential power distribution...... relationship with the training population. Groupsmgs had both the sire and the maternal grandsire (MGS), Groupsire only had the sire, Groupmgs only had the MGS, and Groupnon had neither the sire nor the MGS in the training population. Reliability of DGV was measured as the squared correlation between DGV...... and DRP divided by the reliability of DRP for the bulls in validation data set. Unbiasedness of DGV was measured as the regression of DRP on DGV. The results indicated that DGV were more accurate and less biased for animals that were more related to the training population. In general, the Bayesian...

  15. Kefiran protects Caco-2 cells from cytopathic effects induced by Bacillus cereus infection.

    Medrano, Micaela; Hamet, Maria F; Abraham, Analía G; Pérez, Pablo F

    2009-11-01

    The aim of this work was to evaluate the ability of kefiran to antagonize cytopathic effects triggered by Bacillus cereus strain B10502 on cultured human enterocytes (Caco-2 cells). Cell damage was evaluated by F-actin labelling, scanning electron microscopy and determination of ratios of necrotic and detached cells. To assess the interaction between kefiran and bacteria or eukaryotic cells, flow cytometric analysis was conducted with FITC-labelled kefiran. Kefiran significantly protected infected cells from cytopathic effects induced by B. cereus such as cell necrosis, F-actin disorganisation and microvilli effacement, although presence of kefiran did not modify the adhesion of microorganisms to cultured human enterocytes. Results could be ascribed to the ability of kefiran to interact with both bacteria and eukaryotic cells thus antagonizing interactions necessary for maximal biological effects. Our findings encourage further research on the use of bacterial exopolysaccharides to antagonize virulence factors associated to direct bacteria-cell interactions.

  16. Genomic Comparison of Two Family-Level Groups of the Uncultivated NAG1 Archaeal Lineage from Chemically and Geographically Disparate Hot Springs

    Eric D. Becraft

    2017-10-01

    Full Text Available Recent progress based on single-cell genomics and metagenomic investigations of archaea in a variety of extreme environments has led to significant advances in our understanding of the diversity, evolution, and metabolic potential of archaea, yet the vast majority of archaeal diversity remains undersampled. In this work, we coordinated single-cell genomics with metagenomics in order to construct a near-complete genome from a deeply branching uncultivated archaeal lineage sampled from Great Boiling Spring (GBS in the U.S. Great Basin, Nevada. This taxon is distantly related (distinct families to an archaeal genome, designated “Novel Archaeal Group 1” (NAG1, which was extracted from a metagenome recovered from an acidic iron spring in Yellowstone National Park (YNP. We compared the metabolic predictions of the NAG1 lineage to better understand how these archaea could inhabit such chemically distinct environments. Similar to the NAG1 population previously studied in YNP, the NAG1 population from GBS is predicted to utilize proteins as a primary carbon source, ferment simple carbon sources, and use oxygen as a terminal electron acceptor under oxic conditions. However, GBS NAG1 populations contained distinct genes involved in central carbon metabolism and electron transfer, including nitrite reductase, which could confer the ability to reduce nitrite under anaerobic conditions. Despite inhabiting chemically distinct environments with large variations in pH, GBS NAG1 populations shared many core genomic and metabolic features with the archaeon identified from YNP, yet were able to carve out a distinct niche at GBS.

  17. Inactivation of Bacillus cereus by Na-chlorophyllin-based photosensitization on the surface of packaging.

    Luksiene, Z; Buchovec, I; Paskeviciute, E

    2010-11-01

    This study was focused on the possibility to inactivate food-borne pathogen Bacillus cereus by Na-chlorophyllin (Na-Chl)-based photosensitization in vitro and after attachment to the surface of packaging material. Bacillus cereus in vitro or attached to the packaging was incubated with Na-Chl (7·5×10(-8) to 7·5×10(-5) mol l(-1) ) for 2-60min in phosphate buffer saline. Photosensitization was performed by illuminating cells under a light with a λ of 400nm and an energy density of 20mW cm(-2) . The illumination time varied 0-5min and subsequently the total energy dose was 0-6J cm(-2) . The results show that B. cereus vegetative cells in vitro or attached to the surface of packaging after incubation with 7·5×10(-7) mol l(-1) Na-Chl and following illumination were inactivated by 7log. The photoinactivation of B. cereus spores in vitro by 4log required higher (7·5×10(-6) mol l(-1) ) Na-Chl concentration. Decontamination of packaging material from attached spores by photosensitization reached 5log at 7·5×10(-5) mol l(-1) Na-Chl concentration. Comparative analysis of different packaging decontamination treatments indicates that washing with water can diminish pathogen population on the surface by packaging material. Spores are more resistant than vegetative cells to photosensitization-based inactivation. Comparison of different surface decontamination treatments indicates that Na-Chl-based photosensitization is much more effective antibacterial tool than washing with water or 200ppm Na-hypochlorite. Our data support the idea that Na-Chl-based photosensitization has great potential for future application as an environment-friendly, nonthermal surface decontamination technique. © 2010 The Authors. Journal of Applied Microbiology © 2010 The Society for Applied Microbiology.

  18. An outbreak of Bacillus cereus implicating a part-time banquet caterer.

    Gaulin, Colette; Viger, Yv Bonnier; Fillion, Lise

    2002-01-01

    In the aftermath of a party, 70% (25 of 36) of attendees had gastroenteritis. The objectives of this study were to identify a risk factor associated with the food during the banquet and to identify measures of control for avoiding this kind of outbreak in the future. A retrospective cohort study was used. We tried to reach by telephone all guests who had attended this banquet. A standardized questionnaire was used to provide information about identification of a risk factor, especially in relation to food. The cohort study has shown that potato salad served at the party was significantly associated with the disease. The mayonnaise used to prepare the salad was analyzed and Bacillus cereus was isolated (10(3) bacteria per gram). Bacillus microorganisms are usually found in decaying organic matter, dust, soil, vegetables and water. The bacteria has a remarkable ability to survive strong environmental stresses. There are strains of B. cereus that can cause food poisoning episodes with infective doses as low as 10(3) to 10(4) bacteria per gram. B. cereus is an infrequently reported cause of foodborne illnesses in Quebec and in North America but this may be due to underreporting of episodes. In this outbreak, bacterial multiplication was facilitated at several points in the interval between the preparation of the meal and the consumption of the banquet by the guests. Because the spores are ubiquitous and resistant to inactivation with most food grade disinfectants, temperature control should be the main focus of B. cereus outbreak prevention. The meal was prepared by a restaurateur who was inexperienced in catering services and temperature control in particular when food is served outside the restaurant. This outbreak underscores the importance of maintaining meticulous hygienic procedures in food processing. Restaurateurs who offer catering services should be familiar with the constraints that are specific to this sector of the food industry.

  19. Response of Bacillus cereus ATCC 14579 to challenges with sublethal concentrations of enterocin AS-48

    Gálvez Antonio

    2009-10-01

    Full Text Available Abstract Background Enterocin AS-48 is produced by Enterococcus faecalis S48 to compete with other bacteria in their environment. Due to its activity against various Gram positive and some Gram negative bacteria it has clear potential for use as a food preservative. Here, we studied the effect of enterocin AS-48 challenges on vegetative cells of Bacillus cereus ATCC 14579 by use of transcriptome analysis. Results Of the 5200 genes analysed, expression of 24 genes was found to change significantly after a 30 min treatment with a subinhibitory bacteriocin concentration of 0.5 μg/ml. Most of up-regulated genes encode membrane-associated or secreted proteins with putative transmembrane segments or signal sequences, respectively. One operon involved in arginine metabolism was significantly downregulated. The BC4206-BC4207 operon was found to be the most upregulated target in our experiments. BC4206 codes for a PadR type transcriptional regulator, while BC4207 codes for a hypothetical membrane protein. The operon structure and genes are conserved in B. cereus and B. thuringiensis species, but are not present in B. anthracis and B. subtilis. Using real-time qPCR, we show that these genes are upregulated when we treated the cells with AS-48, but not upon nisin treatment. Upon overexpression of BC4207 in B. cereus, we observed an increased resistance against AS-48. Expression of BC4207 in B. subtilis 168, which lacks this operon also showed increased resistance against AS-48. Conclusion BC4207 membrane protein is involved in the resistance mechanism of B. cereus cells against AS-48.

  20. Effect of Ultrasonic Waves on the Heat Resistance of Bacillus cereus and Bacillus licheniformis Spores

    Burgos, J.; Ordóñez, J. A.; Sala, F.

    1972-01-01

    Heat resistance of Bacillus cereus and Bacillus licheniformis spores in quarter-strength Ringer solution decreases markedly after ultrasonic treatments which are unable to kill a significant proportion of the spore population. This effect does not seem to be caused by a loss of Ca2+ or dipicolinic acid. The use of ultrasonics to eliminate vegetative cells or to break aggregates in Bacillus spore suspensions to be used subsequently in heat resistance experiments appears to be unadvisable. PMID:4627969

  1. An outbreak of Bacillus cereus food poisoning--are caterers supervised sufficiently.

    Slaten, D D; Oropeza, R I; Werner, S B

    1992-01-01

    Bacillus cereus is an uncommonly reported cause of foodborne illness in the United States. In May 1989, an outbreak of B. cereus gastroenteritis occurred among 140 guests who had attended a catered wedding reception in Napa, CA. Investigation established Cornish game hens served at the event as the vehicle for disease transmission (OR = 29, P = 0.0001). Although the spores of B. cereus are ubiquitous, large numbers of toxin-producing organisms (more than 10(5) per gram of food) are required for illness to occur. In the Napa outbreak, bacterial multiplication was facilitated at several points during the preparation and transportation of the food. While a licensed restaurant kitchen was used, the facilities were clearly inadequate for the event. At present, the California Health and Safety Code does not address the scope of catering operations. As caterers increase in number, there will be a growing need for governmental oversight to ensure that food production on a large scale is conducted safely. PMID:1641447

  2. Formation of cereulide and enterotoxins by Bacillus cereus in fermented African locust beans

    Thorsen, Line; Azokpota, Paulin; Munk Hansen, Bjarne

    2011-01-01

    Afitin, iru and sonru are three spontaneously fermented African locust bean Benin condiments. The fermentation processes are exothermic, with temperatures mostly being above 40 °C. A total of 19 predominant Bacillus cereus isolates from afitin, iru and sonru, were investigated. The enterotoxin...... genes nhe (A, B, C) were present in all 19 isolates, the hbl (A, C, D) in one (afitin), and the cytK gene in three isolates (afitin). Levels of cytotoxicity to Vero cells and NheA production in BHI-broth was within the range of known diarrheal outbreak strains. Autoclaved cooked African locust beans...... inoculated with emetic (cereulide producing) B. cereus Ba18H2/RIF supported growth at 25, 30 and 40 °C with highly different maximum cereulide productions of 6 ± 5, 97 ± 3 and 0.04 ± 0.02 μg/g beans, respectively (48 h). For non-autoclaved cooked beans inoculated with 2, 4 and 6 log10 B. cereus Ba18H2/RIF...

  3. Biosurfactants production potential of native strains of Bacillus cereus and their antimicrobial, cytotoxic and antioxidant activities.

    Basit, Madiha; Rasool, Muhammad Hidayat; Naqvi, Syed Ali Raza; Waseem, Muhammad; Aslam, Bilal

    2018-01-01

    Present study was designed to evaluate the biosurfactant production potential by native strains of Bacillus cereus as well as determine their antimicrobial and antioxidant activities. The strains isolated from garden soil were characterized as B. cereus MMIC 1, MMIC 2 and MMIC 3. Biosurfactants were extracted as grey white precipitates. Optimum conditions for biosurfactant production were 37°C, the 7th day of incubation, 0.5% NaCl, pH 7.0. Moreover, corn steep liquor was the best carbon source. Biuret test, Thin Layer Chromatography (TLC), agar double diffusion and Fourier Transform Infrared Spectroscopy (FTIR) characterized the biosurfactants as cationic lipopeptides. Biosurfactants exhibited significant antibacterial and antifungal activity against S. aureus, E. coli, P. aeruginosa, K. pneumoniae, A. niger and C. albicans at 30 mg/ml. Moreover, they also possessed antiviral activity against NDV at 10 mg/ml. Cytotoxicity assay in BHK-21 cell lines revealed 63% cell survival at 10 mg/ml of biosurfactants and thus considered as safe. They also showed very good antioxidant activity by ferric-reducing activity and DPPH scavenging activity at 2 mg/ml. Consequently, the study offers an insight for the exploration of new bioactive molecules from the soil. It was concluded that lipopeptide biosurfactants produced from native strains of B. cereus may be recommended as safe antimicrobial, emulsifier and antioxidant agent.

  4. Dynamic Analysis of the Evolution of Cereus peruvianus (Cactaceae Areas Attacked by Phoma sp.

    Gyorgy FESZT

    2009-12-01

    Full Text Available Cereus Peruvianus (night blooming Cereus, or peruvian apple is one of the sensitive species to Phoma attack. Photographic images can intercept a certain phytopathology, at a certain moment. The computerized analysis of such an image turns into a value the spread which the phytopathological process has at that moment. The purpose of this study is to assimilate the technique of achieving successions of digital photos of Cereus peruvianus f. monstruosa attacked by Phoma sp. Parallely with recording the images, with the help of Rhythm digital temperature humidity controller, were recorded data about the green house microclimate (air humidity-minimum and maximum, temperature-minimum and maximum. In the first stage of the study, the attack presents small fluctuations, reaching a high level in days with low temperatures. So, the most significant growths were recorded in the periods: 10. 02. 2005-20. 02. 2005 with an affected area of 10.97-8.82 = 2.15 and 11. 03. 2005-22. 04. 2005 with growth differences of 14.67-13.32 = 1.35. Generally, the affected areas grow in days with low minimum temperatures. The great advantage of this technique is represented by the possibility of using in situ in home areas of species or crop plants in fields. Repeated images, achieved in time, then overlapped, can provide important data on the evolution of affected areas.

  5. Time dynamics of the Bacillus cereus exoproteome are shaped by cellular oxidation

    Jean-Paul eMadeira

    2015-04-01

    Full Text Available At low density, Bacillus cereus cells release a large variety of proteins into the extracellular medium when cultivated in pH-regulated, glucose-containing minimal medium, either in the presence or absence of oxygen. The majority of these exoproteins are putative virulence factors, including toxin-related proteins. Here, B. cereus exoproteome time courses were monitored by nanoLC-MS/MS under low-oxidoreduction potential (ORP anaerobiosis, high-ORP anaerobiosis, and aerobiosis, with a specific focus on oxidative-induced post-translational modifications of methionine residues. Principal component analysis (PCA of the exoproteome dynamics indicated that toxin-related proteins were the most representative of the exoproteome changes, both in terms of protein abundance and their methionine sulfoxide (Met(O content. PCA also revealed an interesting interconnection between toxin-, metabolism-, and oxidative stress–related proteins, suggesting that the abundance level of toxin-related proteins, and their Met(O content in the B. cereus exoproteome, reflected the cellular oxidation under both aerobiosis and anaerobiosis.

  6. Extended genetic analysis of Brazilian isolates of Bacillus cereus and Bacillus thuringiensis

    Viviane Zahner

    2013-02-01

    Full Text Available Multiple locus sequence typing (MLST was undertaken to extend the genetic characterization of 29 isolates of Bacillus cereus and Bacillus thuringiensis previously characterized in terms of presence/absence of sequences encoding virulence factors and via variable number tandem repeat (VNTR. Additional analysis involved polymerase chain reaction for the presence of sequences (be, cytK, inA, pag, lef, cya and cap, encoding putative virulence factors, not investigated in the earlier study. MLST analysis ascribed novel and unique sequence types to each of the isolates. A phylogenetic tree was constructed from a single sequence of 2,838 bp of concatenated loci sequences. The strains were not monophyletic by analysis of any specific housekeeping gene or virulence characteristic. No clear association in relation to source of isolation or to genotypic profile based on the presence or absence of putative virulence genes could be identified. Comparison of VNTR profiling with MLST data suggested a correlation between these two methods of genetic analysis. In common with the majority of previous studies, MLST was unable to provide clarification of the basis for pathogenicity among members of the B. cereus complex. Nevertheless, our application of MLST served to reinforce the notion that B. cereus and B. thuringiensis should be considered as the same species.

  7. Prevalence of Bacillus cereus in milk and rice grains collected from great Cairo

    Abo State, M.A.M.; Youssef, B.M.

    2012-01-01

    Sixty two Samples of heat treated milk, raw rice grains and Cheetos (XO-Snacks) were collected from supermarkets of great Cairo. Seventeen out of 25 milk samples (68%) gave detectable count of B. cereus on MYP medium. These positive samples count was ranging from 1.5 X 10 1 cfu/ml to 11.3X10 2 cfu/ml. Eighteen out of 25 Samples of raw rice grains (72%) gave also detectable count on MYP medium also. The count of positive rice grains was ranging from 2.0X10 1 cfu/g to 11.5X10 3 cfu /ml. However one Sample out of 12 Samples (8%) of Cheetos (Snacks) was positive with count 3.0X10 2 cfu /g. Gamma irradiation reduced the total bacterial count and B. cereus count gradually. Eight kGy reduced total bacterial count and Bacillus cereus count by 3.1 and 2.2 log cycles respectively.

  8. Bacillus cereus as indicator in the sterilization of residual water with high energy electrons

    Mejia Z, E.

    2000-01-01

    One of the main causes of water pollution is the presence of microorganisms that provoke infections, moreover of chemical substances. The processes of residual water treatment finally require of the disinfection for its use or final disposition. The radiation technology for the residual water treatment by mean of electron beams is an innovator process because as well as decomposing the chemical substance or to degrade them, also it provokes a disinfection by which this is proposed as alternative for disinfection of residual water, with the purpose in reusing the water treated in the agriculture, recreation and industry among others secondary activities, solving environmental or health problems. The objective of this work is to evaluate the use of Bacillus cereus as biological indicator in the disinfection by radiation, using High Energy Electrons. To fulfil with this objective, the work was developed in three stages, the first one consisted in the acquisition, propagation and conservation of the Bacillus cereus stumps, considering Escherichia coli and Salmonella typhimurium as pathogenic germs present in residual water. Moreover, the inocule standardization and the conditions of the Electron accelerator Type Pelletron. In the second stage it was performed the irradiation of aqueous samples of the microorganisms simulating biological pollution and the application to problem samples of a treatment plant sited in the Lerma River zone of mixed residual water. And in the third stage was performed a regression analysis to the reported survival for each kind of microorganisms. The results obtained show that with the use of Electron beams was reduced 6 logarithmic units de E. coli at 129 Gy, for S. typhimurium it was reduced 8 logarithmic units at 383 Gy and the B. cereus at 511 Gy was reduced 6.8 logarithmic units. Of the problem samples irradiated at 500 Gy, the concentration of the total account diminished from 8.70 x 10 7 UFC/ml to 550 UFC/ml, the presence of B. Cereus

  9. A new group in the Leptospirillum clade: cultivation-independent community genomics, proteomics and transcriptomics of the new species Leptospirillum group IV UBA BS.

    Goltsman, Daniela [University of California, Berkeley; Dasari, Mauna [University of California, Berkeley; Thomas, BC [University of California, Berkeley; Shah, Manesh B [ORNL; Verberkmoes, Nathan C [ORNL; Hettich, Robert {Bob} L [ORNL; Banfield, Jillian F. [University of California, Berkeley

    2013-01-01

    Leptospirillum spp. are widespread members of acidophilic microbial communities that catalyze ferrous iron oxidation, thereby increasing sulfide mineral dissolution rates. These bacteria play important roles in environmental acidification and are harnessed for bioleaching-based metal recovery. Known members of the Leptospirillum clade of the Nitrospira phylum are Leptospirillum ferrooxidans (group I), Leptospirillum ferriphilum and Leptospirillum rubarum (group II), and Leptospirillum ferrodiazotrophum (group III). In the Richmond Mine acid mine drainage (AMD) system, biofilm formation is initiated by L. rubarum; L. ferrodiazotrophum appears in later developmental stages. Here we used community metagenomic data from unusual, thick floating biofilms to identify distinguishing metabolic traits in a rare and uncultivated community member, the new species Leptospirillum group IV UBA BS. These biofilms typically also contain a variety of Archaea, Actinobacteria, and a few other Leptospirillum spp. The Leptospirillum group IV UBA BS species shares 98% 16S rRNA sequence identity and 70% average amino acid identity between orthologs with its closest relative, L. ferrodiazotrophum. The presence of nitrogen fixation and reverse tricarboxylic acid (TCA) cycle proteins suggest an autotrophic metabolism similar to that of L. ferrodiazotrophum, while hydrogenase proteins suggest anaerobic metabolism. Community transcriptomic and proteomic analyses demonstrate expression of a multicopper oxidase unique to this species, as well as hydrogenases and core metabolic genes. Results suggest that the Leptospirillum group IV UBA BS species might play important roles in carbon fixation, nitrogen fixation, hydrogen metabolism, and iron oxidation in some acidic environments.

  10. Genic non-coding microsatellites in the rice genome: characterization, marker design and use in assessing genetic and evolutionary relationships among domesticated groups

    Singh Nagendra

    2009-03-01

    Full Text Available Abstract Background Completely sequenced plant genomes provide scope for designing a large number of microsatellite markers, which are useful in various aspects of crop breeding and genetic analysis. With the objective of developing genic but non-coding microsatellite (GNMS markers for the rice (Oryza sativa L. genome, we characterized the frequency and relative distribution of microsatellite repeat-motifs in 18,935 predicted protein coding genes including 14,308 putative promoter sequences. Results We identified 19,555 perfect GNMS repeats with densities ranging from 306.7/Mb in chromosome 1 to 450/Mb in chromosome 12 with an average of 357.5 GNMS per Mb. The average microsatellite density was maximum in the 5' untranslated regions (UTRs followed by those in introns, promoters, 3'UTRs and minimum in the coding sequences (CDS. Primers were designed for 17,966 (92% GNMS repeats, including 4,288 (94% hypervariable class I types, which were bin-mapped on the rice genome. The GNMS markers were most polymorphic in the intronic region (73.3% followed by markers in the promoter region (53.3% and least in the CDS (26.6%. The robust polymerase chain reaction (PCR amplification efficiency and high polymorphic potential of GNMS markers over genic coding and random genomic microsatellite markers suggest their immediate use in efficient genotyping applications in rice. A set of these markers could assess genetic diversity and establish phylogenetic relationships among domesticated rice cultivar groups. We also demonstrated the usefulness of orthologous and paralogous conserved non-coding microsatellite (CNMS markers, identified in the putative rice promoter sequences, for comparative physical mapping and understanding of evolutionary and gene regulatory complexities among rice and other members of the grass family. The divergence between long-grained aromatics and subspecies japonica was estimated to be more recent (0.004 Mya compared to short

  11. Evolution in an autopolyploid group displaying predominantly bivalent pairing at meiosis: genomic similarity of diploid Vaccinium darrowi and autotetraploid V. corymbosum (Ericaceae).

    Qu, L; Hancock, J; Whallon, J

    1998-05-01

    The genomic relationship between V. darrowi Camp (2n = 2x = 24) and V. corymbosum L. (2n = 4x = 48) was examined using an interspecific tetraploid hybrid, US 75, and representatives of the parental species. Two features in the background of US 75 led to the prediction that it was an allopolyploid: (1) the parental species are quite distinct morphologically and geographically, and (2) the diploid genome was incorporated into US 75 via an unreduced gamete. However, US 75 recently was shown to display tetrasomic inheritance using molecular markers. In the present cytological study, US 75 was found to have a lower than expected number of multivalents for an autopolyploid, although it had a significantly higher number of quadrivalents than its autotetraploid parent, V. corymbosum. Normal chromosome distributions were observed at anaphase I and II, and pollen viability was high. Our findings suggest that little genomic divergence has developed between the Vaccinium species and that the polyploids may freely exchange genes with sympatric diploid species via unreduced gametes. This pattern of hybridization could be an important component of evolution in all autopolyploid groups, making them much more dynamic than traditionally assumed.

  12. Progress toward characterization of the group A Streptococcus metagenome: complete genome sequence of a macrolide-resistant serotype M6 strain.

    Banks, David J; Porcella, Stephen F; Barbian, Kent D; Beres, Stephen B; Philips, Lauren E; Voyich, Jovanka M; DeLeo, Frank R; Martin, Judith M; Somerville, Greg A; Musser, James M

    2004-08-15

    We describe the genome sequence of a macrolide-resistant strain (MGAS10394) of serotype M6 group A Streptococcus (GAS). The genome is 1,900,156 bp in length, and 8 prophage-like elements or remnants compose 12.4% of the chromosome. A 8.3-kb prophage remnant encodes the SpeA4 variant of streptococcal pyrogenic exotoxin A. The genome of strain MGAS10394 contains a chimeric genetic element composed of prophage genes and a transposon encoding the mefA gene conferring macrolide resistance. This chimeric element also has a gene encoding a novel surface-exposed protein (designated "R6 protein"), with an LPKTG cell-anchor motif located at the carboxyterminus. Surface expression of this protein was confirmed by flow cytometry. Humans with GAS pharyngitis caused by serotype M6 strains had antibody against the R6 protein present in convalescent, but not acute, serum samples. Our studies add to the theme that GAS prophage-encoded extracellular proteins contribute to host-pathogen interactions in a strain-specific fashion.

  13. Novel association of ABO histo-blood group antigen with soluble ICAM-1: results of a genome-wide association study of 6,578 women.

    Guillaume Paré

    2008-07-01

    Full Text Available While circulating levels of soluble Intercellular Adhesion Molecule 1 (sICAM-1 have been associated with diverse conditions including myocardial infarction, stroke, malaria, and diabetes, comprehensive analysis of the common genetic determinants of sICAM-1 is not available. In a genome-wide association study conducted among 6,578 participants in the Women's Genome Health Study, we find that three SNPs at the ICAM1 (19p13.2 locus (rs1799969, rs5498 and rs281437 are non-redundantly associated with plasma sICAM-1 concentrations at a genome-wide significance level (P<5x10(-8, thus extending prior results from linkage and candidate gene studies. We also find that a single SNP (rs507666, P = 5.1x10(-29 at the ABO (9q34.2 locus is highly correlated with sICAM-1 concentrations. The novel association at the ABO locus provides evidence for a previously unknown regulatory role of histo-blood group antigens in inflammatory adhesion processes.

  14. The Mitochondrial Genome of the Prasinophyte Prasinoderma coloniale Reveals Two Trans-Spliced Group I Introns in the Large Subunit rRNA Gene

    Pombert, Jean-François; Otis, Christian; Turmel, Monique; Lemieux, Claude

    2013-01-01

    Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI), we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V). This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl) at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI). Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF) occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the possible implications

  15. The mitochondrial genome of the prasinophyte Prasinoderma coloniale reveals two trans-spliced group I introns in the large subunit rRNA gene.

    Jean-François Pombert

    Full Text Available Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI, we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V. This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI. Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the

  16. A Children's Oncology Group and TARGET initiative exploring the genetic landscape of Wilms tumor. | Office of Cancer Genomics

    We performed genome-wide sequencing and analyzed mRNA and miRNA expression, DNA copy number, and DNA methylation in 117 Wilms tumors, followed by targeted sequencing of 651 Wilms tumors. In addition to genes previously implicated in Wilms tumors (WT1, CTNNB1, AMER1, DROSHA, DGCR8, XPO5, DICER1, SIX1, SIX2, MLLT1, MYCN, and TP53), we identified mutations in genes not previously recognized as recurrently involved in Wilms tumors, the most frequent being BCOR, BCORL1, NONO, MAX, COL6A3, ASXL1, MAP3K4, and ARID1A.

  17. A novel non prophage(-like) gene-intervening element within gerE that is reconstituted during sporulation in Bacillus cereus ATCC10987.

    Abe, Kimihiro; Shimizu, Shin-Ya; Tsuda, Shuhei; Sato, Tsutomu

    2017-09-12

    Gene rearrangement is a widely-shared phenomenon in spore forming bacteria, in which prophage(-like) elements interrupting sporulation-specific genes are excised from the host genome to reconstitute the intact gene. Here, we report a novel class of gene-intervening elements, named gin, inserted in the 225 bp gerE-coding region of the B. cereus ATCC10987 genome, which generates a sporulation-specific rearrangement. gin has no phage-related genes and possesses three site-specific recombinase genes; girA, girB, and girC. We demonstrated that the gerE rearrangement occurs at the middle stage of sporulation, in which site-specific DNA recombination took place within the 9 bp consensus sequence flanking the disrupted gerE segments. Deletion analysis of gin uncovered that GirC and an additional factor, GirX, are responsible for gerE reconstitution. Involvement of GirC and GirX in DNA recombination was confirmed by an in vitro recombination assay. These results broaden the definition of the sporulation-specific gene rearrangement phenomenon: gene-intervening elements are not limited to phage DNA but may include non-viral genetic elements that carry a developmentally-regulated site-specific recombination system.

  18. Characterization of Exopolysaccharides Produced by Bacillus cereus and Brachybacterium sp. Isolated from Asian Sea Bass (Lates calcarifer

    Mohamed Orsod

    2012-09-01

    Full Text Available Aims: EPS extracted from marine bacteria, which associated with Asian sea bass has potential antimicrobial activities.Methodology and Results: Two marine Bacteria were isolated from Asian sea bass (Lates calcarifer obtained from aquaculture farm, located at Johor bahru Malaysia. 16S rRNA analysis for bacteria identity revealed that bacteria ors1 had 99 % identity to Bacillus cereus and ors2 had 96 % identity with Brachybacterium sp. All bacteria shared many similarities and variation in terms of biochemical reactions and microscopic observation. Exopolysaccharides (EPSs were extracted and purified from bacteria as they produced mucous colonies. Average analysis of EPS components showed 50 % carbohydrates, 26 % protein and 24 % fatty acids. The FTIR analysis confirmed the functional groups of the EPS. Screening for antimicrobial activities assays using Kirby-Bauer methods against both grams positive and negative had shown presence of inhibition zones.Conclusion, significance and impact of study: This study recommends that bacteria isolated from Asian sea bass are having antimicrobial activities and could be used as a potential source for the development of marine drugs.

  19. Production and Characterization of Thermostable Bioplastic (Poly-beta-Hydroxybutyrate) from Bacillus Cereus NRRL-B-3711

    Asad-ur-Rehman, M.; Aslam, A.; Masood, R.; Aftab, M. N.; Ajmal, R.; Haq, I. U.

    2016-01-01

    The poly-beta-hydroxybutyrate (PHB) is a thermostable and biocompatible polyester produced by several bacteria under unbalanced nutritional conditions. Among Gram-positive bacteria, which are not well exploited for PHB production on industrial scale, Bacillus appears to be a prospective candidate due to its excellent biopolymer yield and less rigorous fermentation conditions. Batch culture fermentation was carried out for PHB production. The Bacillus cereus NRRL-B-3711 was the most efficient producer of PHB out of five Bacillus species. The optimized production was achieved with 2% glucose, 37 degree C, pH value of 8 and ammonium sulfate (2.5 g/L) as a nitrogen source. Carbon to nitrogen ratio of 10 significantly affects the PHB accumulation. The selected specie was able to accumulate PHB up to 56% (14.2) 0.07 g/L) on dry cell weight basis after optimization. This corresponds to a 1.87 folds increase in the production. The optical microscopy showed extremely flat surface of bioplastic thin film indicating the brittle failure of PHB under tensile loading. The FTIR analysis revealed C=O and -CH groups, with thermal properties e.g. Tg; 2 degree C, Tc; 54 degree C, Tm;162 degree C and percent crystallinity of 51.3 by differential scanning calorimeter (DSC), thus confirming the presence of PHB bioplastic and enhancing its industrial applications.The results surpassed those reported in the literature for PHB production. (author)

  20. Outbreak of Bacillus cereus infections in a neonatal intensive care unit traced to balloons used in manual ventilation.

    Van Der Zwet, W C; Parlevliet, G A; Savelkoul, P H; Stoof, J; Kaiser, A M; Van Furth, A M; Vandenbroucke-Grauls, C M

    2000-11-01

    In 1998, an outbreak of systemic infections caused by Bacillus cereus occurred in the Neonatal Intensive Care Unit of the University Hospital Vrije Universiteit, Amsterdam, The Netherlands. Three neonates developed sepsis with positive blood cultures. One neonate died, and the other two neonates recovered. An environmental survey, a prospective surveillance study of neonates, and a case control study were performed, in combination with molecular typing, in order to identify potential sources and transmission routes of infection. Genotypic fingerprinting by amplified-fragment length polymorphism (AFLP) showed that the three infections were caused by a single clonal type of B. cereus. The same strain was found in trachea aspirate specimens of 35 other neonates. The case control study showed mechanical ventilation with a Sensormedics ventilation machine to be a risk factor for colonization and/or infection (odds ratio, 9.8; 95% confidence interval, 1.1 to 88.2). Prospective surveillance showed that colonization with B. cereus occurred exclusively in the respiratory tract of mechanically ventilated neonates. The epidemic strain of B. cereus was found on the hands of nursing staff and in balloons used for manual ventilation. Sterilization of these balloons ended the outbreak. We conclude that B. cereus can cause outbreaks of severe opportunistic infection in neonates. Typing by AFLP proved very useful in the identification of the outbreak and in the analysis of strains recovered from the environment to trace the cause of the epidemic.

  1. Dynamic Predictive Model for Growth of Bacillus cereus from Spores in Cooked Beans.

    Juneja, Vijay K; Mishra, Abhinav; Pradhan, Abani K

    2018-02-01

    Kinetic growth data for Bacillus cereus grown from spores were collected in cooked beans under several isothermal conditions (10 to 49°C). Samples were inoculated with approximately 2 log CFU/g heat-shocked (80°C for 10 min) spores and stored at isothermal temperatures. B. cereus populations were determined at appropriate intervals by plating on mannitol-egg yolk-polymyxin agar and incubating at 30°C for 24 h. Data were fitted into Baranyi, Huang, modified Gompertz, and three-phase linear primary growth models. All four models were fitted to the experimental growth data collected at 13 to 46°C. Performances of these models were evaluated based on accuracy and bias factors, the coefficient of determination ( R 2 ), and the root mean square error. Based on these criteria, the Baranyi model best described the growth data, followed by the Huang, modified Gompertz, and three-phase linear models. The maximum growth rates of each primary model were fitted as a function of temperature using the modified Ratkowsky model. The high R 2 values (0.95 to 0.98) indicate that the modified Ratkowsky model can be used to describe the effect of temperature on the growth rates for all four primary models. The acceptable prediction zone (APZ) approach also was used for validation of the model with observed data collected during single and two-step dynamic cooling temperature protocols. When the predictions using the Baranyi model were compared with the observed data using the APZ analysis, all 24 observations for the exponential single rate cooling were within the APZ, which was set between -0.5 and 1 log CFU/g; 26 of 28 predictions for the two-step cooling profiles also were within the APZ limits. The developed dynamic model can be used to predict potential B. cereus growth from spores in beans under various temperature conditions or during extended chilling of cooked beans.

  2. An antibiotic, heavy metal resistant and halotolerant Bacillus cereus SIU1 and its thermoalkaline protease

    Vikram Surendra

    2010-07-01

    Full Text Available Abstract Background Many workers have reported halotolerant bacteria from saline conditions capable of protease production. However, antibiotic resistance and heavy metal tolerance pattern of such organisms is not documented very well. Similarly, only a few researchers have reported the pattern of pH change of fermentation medium during the course of protease production. In this study, we have isolated a halotolerant Bacillus cereus SIU1 strain from a non-saline environment and studied its antibiotic and heavy metal resistance pattern. The isolate produces a thermoalkaline protease and changes the medium pH during the course of fermentation. Thermostability of protease was also studied for 30 min. Results Seventy bacterial strains isolated from the soils of Eastern Uttar Pradesh, India were screened for protease production. All of them exhibited protease activity. However, 40% bacterial isolates were found good protease producers as observed by caseinolytic zones on milk agar plates. Among them, culture S-4 was adjudged as the best protease producer, and was identified as Bacillus cereus by morphological, biochemical and 16 S rDNA sequence analyses. The isolate was resistant to heavy metals (As2+, Pb2+, Cs1+ and antibiotics (penicillin, lincomycin, cloxacillin, pefloxacin. Its growth behavior and protease production was studied at 45°C and pH 9.0. The protease units of 88 ml-1 were noted in unoptimized modified glucose yeast extract (GYE medium during early stationary phase at 20 h incubation period. The enzyme was stable in the temperature range of 35°-55°C. Conclusions An antibiotic and heavy metal resistant, halotolerant Bacillus cereus isolate is capable of producing thermoalkaline protease, which is active and stable at pH 9.0 and 35°-55°C. This isolate may be useful in several industrial applications owing to its halotolerance and antibiotic and heavy metal resistance characteristics.

  3. Effective identification of Lactobacillus casei group species: genome-based selection of the gene mutL as the target of a novel multiplex PCR assay.

    Bottari, Benedetta; Felis, Giovanna E; Salvetti, Elisa; Castioni, Anna; Campedelli, Ilenia; Torriani, Sandra; Bernini, Valentina; Gatti, Monica

    2017-07-01

    Lactobacillus casei,Lactobacillus paracasei and Lactobacillusrhamnosus form a closely related taxonomic group (the L. casei group) within the facultatively heterofermentative lactobacilli. Strains of these species have been used for a long time as probiotics in a wide range of products, and they represent the dominant species of nonstarter lactic acid bacteria in ripened cheeses, where they contribute to flavour development. The close genetic relationship among those species, as well as the similarity of biochemical properties of the strains, hinders the development of an adequate selective method to identify these bacteria. Despite this being a hot topic, as demonstrated by the large amount of literature about it, the results of different proposed identification methods are often ambiguous and unsatisfactory. The aim of this study was to develop a more robust species-specific identification assay for differentiating the species of the L. casei group. A taxonomy-driven comparative genomic analysis was carried out to select the potential target genes whose similarity could better reflect genome-wide diversity. The gene mutL appeared to be the most promising one and, therefore, a novel species-specific multiplex PCR assay was developed to rapidly and effectively distinguish L. casei, L. paracasei and L. rhamnosus strains. The analysis of a collection of 76 wild dairy isolates, previously identified as members of the L. casei group combining the results of multiple approaches, revealed that the novel designed primers, especially in combination with already existing ones, were able to improve the discrimination power at the species level and reveal previously undiscovered intraspecific biodiversity.

  4. Differentiation between probiotic and wild-type Bacillus cereus isolates by antibiotic susceptibility test and Fourier transform infrared spectroscopy (FT-IR).

    Mietke, Henriette; Beer, W; Schleif, Julia; Schabert, G; Reissbrodt, R

    2010-05-30

    Animal feed often contains probiotic Bacillus strains used as feed additives. Spores of the non-pathogenic B. cereus var. toyoi (product name Toyocerin) are used. Distinguishing between toxic wild-type Bacillus cereus strains and this probiotic strain is essential for evaluating the quality and risk of feed. Bacillus cereus CIP 5832 (product name Paciflor was used as probiotic strain until 2001. The properties of the two probiotic strains are quite similar. Differentiating between probiotic strains and wild-type B. cereus strains is not easy. ss-lactam antibiotics such as penicillin and cefamandole exhibit an inhibition zone in the agar diffusion test of probiotic B. cereus strains which are not seen for wild-type strains. Therefore, performing the agar diffusion test first may make sense before FT-IR testing. When randomly checking these strains by Fourier transform infrared spectroscopy (FT-IR), the probiotic B. cereus strains were separated from wild-type B. cereus/B. thuringiensis/B. mycoides/B. weihenstephanensis strains by means of hierarchical cluster analysis. The discriminatory information was contained in the spectral windows 3000-2800 cm(-1) ("fatty acid region"), 1200-900 cm(-1) ("carbohydrate region") and 900-700 cm(-1) ("fingerprint region"). It is concluded that FT-IR spectroscopy can be used for the rapid quality control and risk analysis of animal feed containing probiotic B. cereus strains. (c) 2010 Elsevier B.V. All rights reserved.

  5. Identification of the sigmaB regulon of Bacillus cereus and conservation of sigmaB-regulated genes in low-GC-content gram-positive bacteria

    Schaik, van W.; Voort, van der M.; Molenaar, D.; Moezelaar, R.; Vos, de W.M.; Abee, T.

    2007-01-01

    The alternative sigma factor B has an important role in the acquisition of stress resistance in many gram-positive bacteria, including the food-borne pathogen Bacillus cereus. Here, we describe the identification of the set of B-regulated genes in B. cereus by DNA microarray analysis of the

  6. A transposon mutant library of Bacillus cereus ATCC 10987 reveals novel genes required for biofilm formation and implicates motility as an important factor for pellicle-biofilm formation

    Okshevsky, Mira; Louw, Matilde Greve; Lamela, Elena Otero

    2018-01-01

    Bacillus cereus is one of the most common opportunistic pathogens causing foodborne illness, as well as a common source of contamination in the dairy industry. B. cereus can form robust biofilms on food processing surfaces, resulting in food contamination due to shedding of cells and spores. Desp...

  7. Population Genomic Analysis of 1,777 Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolates, Houston, Texas: Unexpected Abundance of Clonal Group 307

    S. Wesley Long

    2017-05-01

    Full Text Available Klebsiella pneumoniae is a major human pathogen responsible for high morbidity and mortality rates. The emergence and spread of strains resistant to multiple antimicrobial agents and documented large nosocomial outbreaks are especially concerning. To develop new therapeutic strategies for K. pneumoniae, it is imperative to understand the population genomic structure of strains causing human infections. To address this knowledge gap, we sequenced the genomes of 1,777 extended-spectrum beta-lactamase-producing K. pneumoniae strains cultured from patients in the 2,000-bed Houston Methodist Hospital system between September 2011 and May 2015, representing a comprehensive, population-based strain sample. Strains of largely uncharacterized clonal group 307 (CG307 caused more infections than those of well-studied epidemic CG258. Strains varied markedly in gene content and had an extensive array of small and very large plasmids, often containing antimicrobial resistance genes. Some patients with multiple strains cultured over time were infected with genetically distinct clones. We identified 15 strains expressing the New Delhi metallo-beta-lactamase 1 (NDM-1 enzyme that confers broad resistance to nearly all beta-lactam antibiotics. Transcriptome sequencing analysis of 10 phylogenetically diverse strains showed that the global transcriptome of each strain was unique and highly variable. Experimental mouse infection provided new information about immunological parameters of host-pathogen interaction. We exploited the large data set to develop whole-genome sequence-based classifiers that accurately predict clinical antimicrobial resistance for 12 of the 16 antibiotics tested. We conclude that analysis of large, comprehensive, population-based strain samples can assist understanding of the molecular diversity of these organisms and contribute to enhanced translational research.

  8. A 10-year follow-up of a child with mild case of xeroderma pigmentosum complementation group D diagnosed by whole-genome sequencing.

    Ono, Ryusuke; Masaki, Taro; Mayca Pozo, Franklin; Nakazawa, Yuka; Swagemakers, Sigrid M A; Nakano, Eiji; Sakai, Wataru; Takeuchi, Seiji; Kanda, Fumio; Ogi, Tomoo; van der Spek, Peter J; Sugasawa, Kaoru; Nishigori, Chikako

    2016-07-01

    Most patients with xeroderma pigmentosum complementation group D (XP-D) from Western countries suffer from neurological symptoms, whereas Japanese patients display only skin manifestations without neurological symptoms. We have previously suggested that these differences in clinical manifestations in XP-D patients are attributed partly to a predominant mutation in ERCC2, and the allele frequency of S541R is highest in Japan. We diagnosed a child with mild case of XP-D by the evaluation of DNA repair activity and whole-genome sequencing, and followed her ten years. Skin cancer, mental retardation, and neurological symptoms were not observed. Her minimal erythema dose was 41 mJ/cm(2) , which was slightly lower than that of healthy Japanese volunteers. The patient's cells showed sixfold hypersensitivity to UV in comparison with normal cells. Post-UV unscheduled DNA synthesis was 20.4%, and post-UV recovery of RNA synthesis was 58% of non-irradiated samples, which was lower than that of normal fibroblasts. Genome sequence analysis indicated that the patient harbored a compound heterozygous mutation of c.1621A>C and c.591_594del, resulting in p.S541R and p.Y197* in ERCC2: then, patient was diagnosed with XP-D. Y197* has not been described before. Her mild skin manifestations might be attributed to the mutational site on her genome and daily strict sun protection. c.1621A>C might be a founder mutation of ERCC2 among Japanese XP-D patients, as it was identified most frequently in Japanese XP-D patients and it has not been found elsewhere outside Japan. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Field evaluation of a bioregulator containing live Bacillus cereus spores on health status and performance of sows and their litters.

    Alexopoulos, C; Karagiannidis, A; Kritas, S K; Boscos, C; Georgoulakis, I E; Kyriakis, S C

    2001-04-01

    The efficacy of Paciflor, a bioregulator containing live Bacillus cereus CIP 5832 spores, was assessed in sows during late pregnancy and lactation, as well as in their piglets up to the growing phase. Two groups each of 30 pregnant gilts and sows received normal feed (T1 group), or feed with 85 g Paciflor per ton feed (T2 group), from 15 days prior to farrowing up to the end of the lactation period. Furthermore, 15 litters of the T1 group and 15 litters of the T2 group, were offered normal feed from the 5th to the 70th days of life (T1.1 and T2.1 groups, respectively), while the remaining 15 litters each of the T1 and T2 groups received the same feed but including Paciflor at a dose of 100 g/ton (from day 5 to day 49) and 50 g/ton (from day 50 to day 70). These pig litters were T1.2 and T2.2, respectively. No differences were seen between the T1 and T2 groups with respect to the clinical observations (loss of appetite, fever, mastitis, metritis and returns to oestrus, treatments applied, deaths, or removals to the slaughterhouse), gestation length, bodyweight of sows at farrowing or litter-size at birth. However, during lactation, the fat content of the dam's milk was increased (0.46% more fat), the body weight loss of sows was reduced and the number of weaned pigs per sow was increased (0.6 more pigs per litter) after administration of Paciflor (P T2.2 groups) showed less incidence of scours and lower mortality compared to the untreated piglets (T1.1 and T2.1 groups), particularly those pigs originating from Paciflor-treated dams (T2.2 group) (P T2.2 and T1.2) was significantly improved compared to that of the untreated piglets (T2.1 and T1.1) (P T2.2) were 0.56 kg heavier than those born to untreated dams (T1.2) (P < 0.05). It is concluded that administration of Paciflor in dams during the end of pregnancy and during lactation, as well as to their offspring during suckling and the flat-deck period is beneficial for the survival and growth of the piglets.

  10. Population Genomic Analysis of 1,777 Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolates, Houston, Texas: Unexpected Abundance of Clonal Group 307.

    Long, S Wesley; Olsen, Randall J; Eagar, Todd N; Beres, Stephen B; Zhao, Picheng; Davis, James J; Brettin, Thomas; Xia, Fangfang; Musser, James M

    2017-05-16

    Klebsiella pneumoniae is a major human pathogen responsible for high morbidity and mortality rates. The emergence and spread of strains resistant to multiple antimicrobial agents and documented large nosocomial outbreaks are especially concerning. To develop new therapeutic strategies for K. pneumoniae , it is imperative to understand the population genomic structure of strains causing human infections. To address this knowledge gap, we sequenced the genomes of 1,777 extended-spectrum beta-lactamase-producing K. pneumoniae strains cultured from patients in the 2,000-bed Houston Methodist Hospital system between September 2011 and May 2015, representing a comprehensive, population-based strain sample. Strains of largely uncharacterized clonal group 307 (CG307) caused more infections than those of well-studied epidemic CG258. Strains varied markedly in gene content and had an extensive array of small and very large plasmids, often containing antimicrobial resistance genes. Some patients with multiple strains cultured over time were infected with genetically distinct clones. We identified 15 strains expressing the New Delhi metallo-beta-lactamase 1 (NDM-1) enzyme that confers broad resistance to nearly all beta-lactam antibiotics. Transcriptome sequencing analysis of 10 phylogenetically diverse strains showed that the global transcriptome of each strain was unique and highly variable. Experimental mouse infection provided new information about immunological parameters of host-pathogen interaction. We exploited the large data set to develop whole-genome sequence-based classifiers that accurately predict clinical antimicrobial resistance for 12 of the 16 antibiotics tested. We conclude that analysis of large, comprehensive, population-based strain samples can assist understanding of the molecular diversity of these organisms and contribute to enhanced translational research. IMPORTANCE Klebsiella pneumoniae causes human infections that are increasingly difficult to

  11. TU-CD-BRB-07: Identification of Associations Between Radiologist-Annotated Imaging Features and Genomic Alterations in Breast Invasive Carcinoma, a TCGA Phenotype Research Group Study

    Rao, A; Net, J [University of Miami, Miami, Florida (United States); Brandt, K [Mayo Clinic, Rochester, Minnesota (United States); Huang, E [National Cancer Institute, NIH, Bethesda, MD (United States); Freymann, J; Kirby, J [Leidos Biomedical Research Inc., Frederick, MD (United States); Burnside, E [University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin (United States); Morris, E; Sutton, E [Memorial Sloan Kettering Cancer Center, New York, NY (United States); Bonaccio, E [Roswell Park Cancer Institute, Buffalo, NY (United States); Giger, M; Jaffe, C [Univ Chicago, Chicago, IL (United States); Ganott, M; Zuley, M [University of Pittsburgh Medical Center - Magee Womens Hospital, Pittsburgh, Pennsylvania (United States); Le-Petross, H [MD Anderson Cancer Center, Houston, TX (United States); Dogan, B [UT MDACC, Houston, TX (United States); Whitman, G [UTMDACC, Houston, TX (United States)

    2015-06-15

    Purpose: To determine associations between radiologist-annotated MRI features and genomic measurements in breast invasive carcinoma (BRCA) from the Cancer Genome Atlas (TCGA). Methods: 98 TCGA patients with BRCA were assessed by a panel of radiologists (TCGA Breast Phenotype Research Group) based on a variety of mass and non-mass features according to the Breast Imaging Reporting and Data System (BI-RADS). Batch corrected gene expression data was obtained from the TCGA Data Portal. The Kruskal-Wallis test was used to assess correlations between categorical image features and tumor-derived genomic features (such as gene pathway activity, copy number and mutation characteristics). Image-derived features were also correlated with estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2/neu) status. Multiple hypothesis correction was done using Benjamini-Hochberg FDR. Associations at an FDR of 0.1 were selected for interpretation. Results: ER status was associated with rim enhancement and peritumoral edema. PR status was associated with internal enhancement. Several components of the PI3K/Akt pathway were associated with rim enhancement as well as heterogeneity. In addition, several components of cell cycle regulation and cell division were associated with imaging characteristics.TP53 and GATA3 mutations were associated with lesion size. MRI features associated with TP53 mutation status were rim enhancement and peritumoral edema. Rim enhancement was associated with activity of RB1, PIK3R1, MAP3K1, AKT1,PI3K, and PIK3CA. Margin status was associated with HIF1A/ARNT, Ras/ GTP/PI3K, KRAS, and GADD45A. Axillary lymphadenopathy was associated with RB1 and BCL2L1. Peritumoral edema was associated with Aurora A/GADD45A, BCL2L1, CCNE1, and FOXA1. Heterogeneous internal nonmass enhancement was associated with EGFR, PI3K, AKT1, HF/MET, and EGFR/Erbb4/neuregulin 1. Diffuse nonmass enhancement was associated with HGF/MET/MUC20/SHIP

  12. Cephalopod genomics

    Albertin, Caroline B.; Bonnaud, Laure; Brown, C. Titus

    2012-01-01

    The Cephalopod Sequencing Consortium (CephSeq Consortium) was established at a NESCent Catalysis Group Meeting, ``Paths to Cephalopod Genomics-Strategies, Choices, Organization,'' held in Durham, North Carolina, USA on May 24-27, 2012. Twenty-eight participants representing nine countries (Austria......, Australia, China, Denmark, France, Italy, Japan, Spain and the USA) met to address the pressing need for genome sequencing of cephalopod mollusks. This group, drawn from cephalopod biologists, neuroscientists, developmental and evolutionary biologists, materials scientists, bioinformaticians and researchers...... active in sequencing, assembling and annotating genomes, agreed on a set of cephalopod species of particular importance for initial sequencing and developed strategies and an organization (CephSeq Consortium) to promote this sequencing. The conclusions and recommendations of this meeting are described...

  13. Genetic relatedness of indigenous ethnic groups in northern Borneo to neighboring populations from Southeast Asia, as inferred from genome-wide SNP data.

    Yew, Chee Wei; Hoque, Mohd Zahirul; Pugh-Kitingan, Jacqueline; Minsong, Alexander; Voo, Christopher Lok Yung; Ransangan, Julian; Lau, Sophia Tiek Ying; Wang, Xu; Saw, Woei Yuh; Ong, Rick Twee-Hee; Teo, Yik-Ying; Xu, Shuhua; Hoh, Boon-Peng; Phipps, Maude E; Kumar, S Vijay

    2018-07-01

    The region of northern Borneo is home to the current state of Sabah, Malaysia. It is located closest to the southern Philippine islands and may have served as a viaduct for ancient human migration onto or off of Borneo Island. In this study, five indigenous ethnic groups from Sabah were subjected to genome-wide SNP genotyping. These individuals represent the "North Borneo"-speaking group of the great Austronesian family. They have traditionally resided in the inland region of Sabah. The dataset was merged with public datasets, and the genetic relatedness of these groups to neighboring populations from the islands of Southeast Asia, mainland Southeast Asia and southern China was inferred. Genetic structure analysis revealed that these groups formed a genetic cluster that was independent of the clusters of neighboring populations. Additionally, these groups exhibited near-absolute proportions of a genetic component that is also common among Austronesians from Taiwan and the Philippines. They showed no genetic admixture with Austro-Melanesian populations. Furthermore, phylogenetic analysis showed that they are closely related to non-Austro-Melansian Filipinos as well as to Taiwan natives but are distantly related to populations from mainland Southeast Asia. Relatively lower heterozygosity and higher pairwise genetic differentiation index (F ST ) values than those of nearby populations indicate that these groups might have experienced genetic drift in the past, resulting in their differentiation from other Austronesians. Subsequent formal testing suggested that these populations have received no gene flow from neighboring populations. Taken together, these results imply that the indigenous ethnic groups of northern Borneo shared a common ancestor with Taiwan natives and non-Austro-Melanesian Filipinos and then isolated themselves on the inland of Sabah. This isolation presumably led to no admixture with other populations, and these individuals therefore underwent

  14. The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister-group to protostomes

    Helfenbein, Kevin G.; Fourcade, H. Matthew; Vanjani, Rohit G.; Boore, Jeffrey L.

    2004-05-01

    We report the first complete mitochondrial (mt) DNA sequence from a member of the phylum Chaetognatha (arrow worms). The Paraspadella gotoi mtDNA is highly unusual, missing 23 of the genes commonly found in animal mtDNAs, including atp6, which has otherwise been found universally to be present. Its 14 genes are unusually arranged into two groups, one on each strand. One group is punctuated by numerous non-coding intergenic nucleotides, while the other group is tightly packed, having no non-coding nucleotides, leading to speculation that there are two transcription units with differing modes of expression. The phylogenetic position of the Chaetognatha within the Metazoa has long been uncertain, with conflicting or equivocal results from various morphological analyses and rRNA sequence comparisons. Comparisons here of amino acid sequences from mitochondrially encoded proteins gives a single most parsimonious tree that supports a position of Chaetognatha as sister to the protostomes studied here. From this, one can more clearly interpret the patterns of evolution of various developmental features, especially regarding the embryological fate of the blastopore.

  15. Effect of Bacillus cereus Enzymes on Milk Quality following Ultra High Temperature Processing

    B. Janštová

    2006-01-01

    Full Text Available Using a model case of contamination of long-life semi-skimmed milk with the spores of six B. cereus strains, isolated from the farm environment and raw milk, proteolysis was monitored by measuring changes in protein content by infra-red spectroscopy; free tyrosine was measured by the Lowry method according to Juffs, and the reduction in casein fractions by SDS-PAGE. Lipolysis was monitored by the dilution extractive method. At a storage temperature of 4 °C for 4 months no enzyme processes were observed, whereas at a storage temperature of 24 °C a marked enzyme activity was found during maximum 3 weeks as well as sensory changes of UHT milk. After three weeks of storage, a reduction in protein content from 34.55 g l-1 milk to 29.46 ± 2.00 g l-1 milk, and a reduction in the free tyrosine from 0.65 to 2.13 ± 0.28 mg ml-1 was found, as well as increased molar contents of free fatty acids (FFA from 41.97 to 1617.22 ± 68.17 mmol kg-1 milk fat. After six days of storage, α-casein, β-casein and κ-casein dropped to 69 ± 10%, 56 ± 16% and 43 ± 10%, respectively. Majority of changes in UHT milk depended on the B. cereus strain used, initial microbial counts and the method of heat inactivation of spores.

  16. Production of Bio polymer (PHB) from Whey by Local Strain of Bacillus cereus

    Abdel Kareem, H.; Hamed, D.; Omar, S.; Gebreel, H.; Khalaf, M.; El-M-Mahalawy, A.

    2008-01-01

    The local strain Bacillus cereus S 3 , which isolated from the soil attached to the rice root, was employed for PHB production from whey and soya extract as the main carbon and nitrogen sources. Some supplements such as (0.5 g) tryptone and (0.5 g) NaCl were added to 75 ml whey and 25 ml soya extract to optimize the PHB accumulation medium. Different parameters including; initial ph of the medium, working volume, NaCl concentration and inoculum age and size; were carried out under shaking flask conditions (150 rpm) at 30 degree C for 48 h of incubation to enhance the PHB accumulation. The maximum PHB accumulation (2.42 gl -1 ) was achieved at ph 6, 100 ml working volume, (0.5-2%) NaCl, at 60 h and 4 ml inoculum age and size, respectively. An experiment was conducted to investigate the effect of gamma irradiation on the activity of B. cereus S 3 towards PHB accumulation. At dose level 1.5 kGy the maximum PHB accumulation obtained was 3.2 gl -1

  17. Evaluation of the Sporicidal Activity of Ethanol Extract of Arctium lappa Root against Bacillus cereus

    Vajihe Karbasizade

    2014-10-01

    Full Text Available Background: Bacillus cereus is one of the most common causes of food spoilage, keratitis, endophthalmitis, and panophthalmitis. These bacteria produce spores which are resistant to chemical and physical agents. Nowadays, the sporicidal properties of plants have been considered as alternatives to chemical sporicidal agents. Materials and Methods: In this empirical-experimental study the effect of ethanol extract of edible burdock (Arctium lappa root has been studied on Bacillus cereus spores. In this investigation, the suspensions of tested microorganisms were cultured in sporulating agar. Sporulation process was assessed by optical microscopy following the staining of spores. Then the produced spores were exposed to various concentrations (100, 150, 200, 250, 300 mg/mL of ethanol extract of edible burdock (Arctium lappa root and finally the remaining spores were counted. With increasing concentrations of ethanol extract, the number of spores declined. Results: Pearson correlation showed inverse relation between the spores count and concentration of ethanol extract of edible burdock (Arctium lappa root (r=-0.765, p<0.001. The most effective extract concentration was 300 mg /mL. Conclusion: Ethanol extract of edible burdock (Arctium lappa root, has sporicidal activity. Only, the sporicidal nature of ethanol extract has been evaluated by this study; therefore, the assessment of other extracts and essences is necessary.

  18. Effective Thermal Inactivation of the Spores of Bacillus cereus Biofilms Using Microwave.

    Park, Hyong Seok; Yang, Jungwoo; Choi, Hee Jung; Kim, Kyoung Heon

    2017-07-28

    Microwave sterilization was performed to inactivate the spores of biofilms of Bacillus cereus involved in foodborne illness. The sterilization conditions, such as the amount of water and the operating temperature and treatment time, were optimized using statistical analysis based on 15 runs of experimental results designed by the Box-Behnken method. Statistical analysis showed that the optimal conditions for the inactivation of B. cereus biofilms were 14 ml of water, 108°C of temperature, and 15 min of treatment time. Interestingly, response surface plots showed that the amount of water is the most important factor for microwave sterilization under the present conditions. Complete inactivation by microwaves was achieved in 5 min, and the inactivation efficiency by microwave was obviously higher than that by conventional steam autoclave. Finally, confocal laser scanning microscopy images showed that the principal effect of microwave treatment was cell membrane disruption. Thus, this study can contribute to the development of a process to control food-associated pathogens.

  19. Production and characterization of poly-3-hydroxybutyrate from Bacillus cereus PS 10.

    Sharma, Priyanka; Bajaj, Bijender Kumar

    2015-11-01

    Usage of renewable raw materials for production of fully degradable bioplastics (bacterial poly-3-hydroxybutyrate, PHB) has gained immense research impetus considering recalcitrant nature of petroleum based plastics, dwindling fossil fuel feed stocks, and associated green house gas emissions. However, high production cost of PHB is the major bottleneck for its wide range industrial applications. In current study, Bacillus cereus PS 10, a recent isolate, efficiently utilized molasses, an abundantly available by-product from sugar industries as sole carbon source for growth and PHB production. Most influential bioprocess variables i.e. molasses, pH and NH4Cl were identified based on Plackett-Burman-designed experiments. Design of experiment approach (response surface methodology) was further employed for optimization of these bioprocess variables, and an enhanced PHB yield (57.5%) was obtained. PHB produced by Bacillus cereus PS 10 was investigated using various physico-chemical approaches viz. thermogravimetric analysis, proton and carbon NMR ((1)H and (13)C) spectroscopy, melting point, elemental analysis and polarimetry for its detail characterization, and assessment for industrial application potential. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Isolation and Characterisation of a Reserve Protein from the Seeds of Cereus jamacaru (Cactaceae

    Itayguara Ribeiro da Costa

    2001-12-01

    Full Text Available We describe here the isolation and characterisation of a major reserve protein from the seeds of Cereus jamacaru. (Cactaceae. This protein has a molecular mass of 5319 kDa and was isolated by a combination of gel filtration chromatography and reverse phase HPLC. The amino acid composition of the protein was determined and it was shown to have similarities with the amino acid composition of several proteins from the 2S albumin storage protein family. The usefulness of this protein as a molecular marker in the Cactaceae is also discussed.A proteína de reserva mais abundante das sementes de Cereus jamacaru (Cactaceae foi isolada e caracterizada. Esta proteína tem uma massa molecular de 5319 kDa e foi isolada através de uma combinação de técnicas de filtração em gel e HPLC de fase reversa. A composição de aminoácidos da proteína foi determinada e possui similaridade com a composição de aminoácidos de diversas proteínas de reserva de sementes que pertencem à família das albuminas. A utilidade desta proteína como um marcador molecular para as cactáceas é também discutida.

  1. Bacillus cereus AR156 primes induced systemic resistance by suppressing miR825/825* and activating defense-related genes in Arabidopsis.

    Niu, Dongdong; Xia, Jing; Jiang, Chunhao; Qi, Beibei; Ling, Xiaoyu; Lin, Siyuan; Zhang, Weixiong; Guo, Jianhua; Jin, Hailing; Zhao, Hongwei

    2016-04-01

    Small RNAs play an important role in plant immune responses. However, their regulatory function in induced systemic resistance (ISR) is nascent. Bacillus cereus AR156 is a plant growth-promoting rhizobacterium that induces ISR in Arabidopsis against bacterial infection. Here, by comparing small RNA profiles of Pseudomonas syringae pv. tomato (Pst) DC3000-infected Arabidopsis with and without AR156 pretreatment, we identified a group of Arabidopsis microRNAs (miRNAs) that are differentially regulated by AR156 pretreatment. miR825 and miR825* are two miRNA generated from a single miRNA gene. Northern blot analysis indicated that they were significantly downregulated in Pst DC3000-infected plants pretreated with AR156, in contrast to the plants without AR156 pretreatment. miR825 targets two ubiquitin-protein ligases, while miR825* targets toll-interleukin-like receptor (TIR)-nucleotide binding site (NBS) and leucine-rich repeat (LRR) type resistance (R) genes. The expression of these target genes negatively correlated with the expression of miR825 and miR825*. Moreover, transgenic plants showing reduced expression of miR825 and miR825* displayed enhanced resistance to Pst DC3000 infection, whereas transgenic plants overexpressing miR825 and miR825* were more susceptible. Taken together, our data indicates that Bacillus cereus AR156 pretreatment primes ISR to Pst infection by suppressing miR825 and miR825* and activating the defense related genes they targeted. © 2015 Institute of Botany, Chinese Academy of Sciences.

  2. Influence of glutamate on growth, sporulation, and spore properties of Bacillus cereus ATCC 14579 in defined medium

    Vries, de Y.P.; Atmadja, R.D.; Hornstra, L.M.; Vos, de W.M.; Abee, T.

    2005-01-01

    A chemically defined medium in combination with an airlift fermentor system was used to study the growth and sporulation of Bacillus cereus ATCC 14579. The medium contained six amino acids and lactate as the main carbon sources. The amino acids were depleted during exponential growth, while lactate

  3. Destruction of Bacillus cereus spores in a thick soy bean paste (doenjang) by continuous ohmic heating with five sequential electrodes.

    Ryang, J H; Kim, N H; Lee, B S; Kim, C T; Rhee, M S

    2016-07-01

    This study selected spores from Bacillus cereus FSP-2 strain (the isolate from a commercial doenjang processing line) as the test strain which showed significantly higher thermal resistance (P 1·5 National Bureau of Standards units), treatment at 105°C for 60 s was selected and applied on a large scale (500 kg of product). Reliable and reproducible destruction of B. cereus spores occurred; the reductions achieved (to < 4 log CFU g(-1) ) met the Korean national standards. Scanning electron microscopy revealed microstructural alterations in the spores (shrinkage and a distorted outer spore coat). OH is an effective method for destroying B. cereus spores to ensure the microbiological quality and safety of a thick, highly viscous sauce. This study shows that an ohmic heating (OH) using a five sequential electrode system can effectively destroy highly heat-resistant Bacillus cereus spores which have been frequently found in a commercial doenjang processing line without perceivable quality change in the product. In addition, it may demonstrate high potential of the unique OH system used in this study that will further contribute to ensure microbiological quality and safety of crude sauces containing high levels of electrolyte other than doenjang as well. © 2016 The Society for Applied Microbiology.

  4. Growth and sporulation of Bacillus cereus ATCC 14579 under defined conditions: temporal expression of genes for key sigma factors

    Vries, de Y.P.; Hornstra, L.M.; Vos, de W.M.; Abee, T.

    2004-01-01

    An airlift fermentor system allowing precise regulation of pH and aeration combined with a chemically defined medium was used to study growth and sporulation of Bacillus cereus ATCC 14579. Sporulation was complete and synchronous. Expression of sigA, sigB, sigF, and sigG was monitored with real-time

  5. Comparative analysis of biofilm formation by Bacillus cereus reference strains and undomesticated food isolates and the effect of free iron

    Hayrapetyan, H.; Muller, L.K.; Tempelaars, M.H.; Abee, T.; Nierop Groot, M.N.

    2015-01-01

    Biofilm formation of Bacillus cereus reference strains ATCC 14579 and ATCC 10987 and 21 undomesticated food isolates was studied on polystyrene and stainless steel as contact surfaces. For all strains, the biofilm forming capacity was significantly enhanced when in contact with stainless steel (SS)

  6. Direct-Imaging-Based Quantification of Bacillus cereus ATCC 14579 Population Heterogeneity at a Low Incubation Temperature

    Besten, den H.M.W.; Garcia, D.; Moezelaar, R.; Zwietering, M.H.; Abee, T.

    2010-01-01

    Bacillus cereus ATCC 14579 was cultured in microcolonies on Anopore strips near its minimum growth temperature to directly image and quantify its population heterogeneity at an abusive refrigeration temperature. Eleven percent of the microcolonies failed to grow during low-temperature incubation,

  7. Sporulation environment of emetic toxin-producing Bacillus cereus strains determines spore size, heat resistance and germination capacity

    Voort, van der M.; Abee, T.

    2013-01-01

    Aim Heat resistance, germination and outgrowth capacity of Bacillus cereus spores in processed foods are major factors in causing the emetic type of gastrointestinal disease. In this study, we aim to identify the impact of different sporulation conditions on spore properties of emetic

  8. A probability model for enterotoxin production of Bacillus cereus as a function of pH and temperature

    Bacillus cereus is frequently isolated from a variety of foods including vegetables, dairy products, meat, and other raw and processed foods. The bacterium is capable of producing enterotoxin and emetic toxin that can cause severe nausea, vomiting and diarrhea. The objectives of this study were to a...

  9. Purification, Characterization, and Mode of Action of Plantaricin GZ1-27, a Novel Bacteriocin against Bacillus cereus.

    Du, Hechao; Yang, Jie; Lu, Xiaohong; Lu, Zhaoxin; Bie, Xiaomei; Zhao, Haizhen; Zhang, Chong; Lu, Fengxia

    2018-05-09

    Bacillus cereus is an opportunistic pathogen that causes foodborne diseases. We isolated a novel bacteriocin, designated plantaricin GZ1-27, and elucidated its mode of action against B. cereus. Plantaricin GZ1-27 was purified using ammonium sulfate precipitation, gel-filtration chromatography, and RP-HPLC. MALDI-TOF/MS revealed that its molecular mass was 975 Da, and Q-TOF-MS/MS analysis predicted the amino acid sequence as VSGPAGPPGTH. Plantaricin GZ1-27 showed thermostability and pH stability. The antibacterial mechanism was investigated using flow cytometry, confocal laser-scanning microscopy, scanning and transmission electron microscopy, and RT-PCR, which revealed that GZ1-27 increased cell membrane permeability, triggered K + leakage and pore formation, damaged cell membrane integrity, altered cell morphology and intracellular organization, and reduced the expression of genes related to cytotoxin production, peptidoglycan synthesis, and cell division. These results suggest that plantaricin GZ1-27 effectively inhibits B. cereus at both the cellular and the molecular levels and is a potential natural food preservative targeting B. cereus.

  10. Combined effects of plant extracts in inhibiting the growth of Bacillus cereus in reconstituted infant rice cereal.

    Jun, Hyejung; Kim, Jinsol; Bang, Jihyun; Kim, Hoikyung; Beuchat, Larry R; Ryu, Jee-Hoon

    2013-01-01

    A study was done to determine the potential use of plant extracts to inhibit the growth of Bacillus cereus in reconstituted infant rice cereal. A total of 2116 extracts were screened for inhibitory activity against B. cereus using an agar well diffusion assay. The minimal inhibitory concentrations (MIC) and minimal lethal concentrations (MLC) of 14 promising extracts in tryptic soy broth (TSB) were determined. Dryopteris erythrosora (autumn fern) root extract showed the lowest MIC (0.0156 mg/ml), followed by Siegesbeckia glabrescens (Siegesbeckia herb) leaf (0.0313 mg/ml), Morus alba (white mulberry) cortex (0.0313 mg/ml), Carex pumila (sand sedge) root (0.0625 mg/ml), and Citrus paradisi (grapefruit) seed (0.0625 mg/ml) extracts. The order of MLCs of extracts was D. erythrosora root (0.0156 mg/ml)extracts against B. cereus in TSB were determined using a checkerboard assay. A combination of D. erythrosora and C. pumila extracts showed a partial synergistic inhibition, with a fractional inhibitory concentration index (FICI) of 0.75. Single and combined inhibitory activities of selected plant extracts against B. cereus in reconstituted infant rice cereal were investigated. The MICs of S. glabrescens, M. alba, D. erythrosora, and C. pumila extracts against B. cereus were 1.0, 2.0, 2.0, and 8.0mg/ml, respectively. A combination of D. erythrosora (1.00 mg/ml) and C. pumila (1.00 mg/ml) extracts showed a partial synergistic effect (FICI 0.63) in inhibiting the growth of B. cereus. Results indicate that by combining extracts, the amounts of D. erythrosora and C. pumila extracts can be reduced by 50% and 87.5%, respectively, compared with individual extracts, and give similar inhibitory activity in reconstituted infant rice cereal. Sensory evaluation showed that supplementing reconstituted infant rice cereal with plant extracts reduces sensorial quality. These observations will be useful when developing and applying interventions using natural plant extracts to inhibit B

  11. Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

    Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

    2018-04-01

    The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

  12. Antagonistics against pathogenic Bacillus cereus in milk fermentation by Lactobacillus plantarum ZDY2013 and its anti-adhesion effect on Caco-2 cells against pathogens.

    Zhang, Zhihong; Tao, Xueying; Shah, Nagendra P; Wei, Hua

    2016-04-01

    Lactobacillus plantarum ZDY2013 is a potential probiotic isolated from fermented bean acid. In this study, we aimed to evaluate the in vitro antimicrobial activity of this organism against Bacillus cereus in milk fermentation, the antiadhesion ability on intestinal epithelial cells, as well as its ability to abrogate the cytotoxic effect and expression levels of genes. We found no antimicrobial activity produced by L. plantarum once the pH was adjusted to 6.0 and 7.0. The pH decreased continuously when L. plantarum and B. cereus were co-incubated during milk fermentation, which caused a decrease in the B. cereus counts. Antiadhesion assays showed that L. plantarum can significantly inhibit the adhesion of enterotoxin-producing B. cereus ATCC14579 and pathogenic B. cereus HN001 by inhibition, competition, and displacement. The supernatants of B. cereus, either alone or in conjunction with L. plantarum, caused damage to the membrane integrity of Caco-2 cells to release lactate dehydrogenase. In addition, L. plantarum tended to attenuate proinflammatory cytokine and oxidative stress gene expression on Caco-2 cells, inducing with B. cereus HN001 supernatants. This study provided systematic insights into the antagonistic effect of L. plantarum ZDY2013, and the information may be helpful to explore potential control measures for preventing food poisoning by lactic acid bacteria. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Genomic analysis reveals multi-drug resistance clusters in Group B Streptococcus CC17 hypervirulent isolates causing neonatal invasive disease in southern mainland China

    Edmondo Campisi

    2016-08-01

    Full Text Available Neonatal invasive disease caused by group B Streptococcus (GBS represents a significant public health care concern globally. However, data related to disease burden, serotype distribution and molecular epidemiology in China and other Asian countries are very few and specifically relative to confined regions. The aim of this study was to investigate the genetic characteristics of GBS isolates recovered from neonates with invasive disease during 2013-2014 at Guangzhou and Changsha hospitals in southern mainland China. We assessed the capsular polysaccharide (CPS type, pilus islands (PIs distribution and hvgA gene presence in a panel of 26 neonatal clinical isolates, of which 8 were recovered from Early Onset Disease (EOD and 18 from Late Onset Disease (LOD. Among 26 isolates examined, five serotypes were identified. Type III was the most represented (15 cases, particularly among LOD strains (n=11, followed by types Ib (n=5, V (n=3, Ia (n=2 and II (n=1. We performed whole-genome sequencing (WGS analysis and antimicrobial susceptibility testing on the 14 serotype III isolates belonging to the hypervirulent Clonal Complex 17 (serotype III-CC17.The presence of PI-2b alone was associated with 13 out of 14 serotype III-CC17 strains. Genome analysis led us to identify two multi-drug resistance gene clusters harbored in two new versions of integrative and conjugative elements (ICEs, carrying five or eight antibiotic resistance genes, respectively. These ICEs replaced the 16 kb-locus that normally contains the PI-1 operon. All isolates harboring the identified ICEs showed multiple resistances to aminoglycoside, macrolide and tetracycline antibiotic classes. In conclusion, we report the first whole-genome sequence analysis of 14 GBS serotype III-CC17 strains isolated in China, representing the most prevalent lineage causing neonatal invasive disease. The acquisition of newly identified ICEs conferring multiple antibiotic resistances could in part explain

  14. Genomics:GTL Contractor-Grantee Workshop IV and Metabolic Engineering Working Group Inter-Agency Conference on Metabolic Engineering 2006

    Mansfield, Betty Kay [ORNL; Martin, Sheryl A [ORNL

    2006-02-01

    Welcome to the 2006 joint meeting of the fourth Genomics:GTL Contractor-Grantee Workshop and the six Metabolic Engineering Working Group Inter-Agency Conference. The vision and scope of the Genomics:GTL program continue to expand and encompass research and technology issues from diverse scientific disciplines, attracting broad interest and support from researchers at universities, DOE national laboratories, and industry. Metabolic engineering's vision is the targeted and purposeful alteration of metabolic pathways to improve the understanding and use of cellular pathways for chemical transformation, energy transduction, and supramolecular assembly. These two programs have much complementarity in both vision and technological approaches, as reflected in this joint workshop. GLT's challenge to the scientific community remains the further development and use of a broad array of innovative technologies and computational tools to systematically leverage the knowledge and capabilities brought to us by DNA sequencing projects. The goal is to seek a broad and predictive understanding of the functioning and control of complex systems--individual microbes, microbial communities, and plants. GTL's prominent position at the interface of the physical, computational, and biological sciences is both a strength and challenge. Microbes remain GTL's principal biological focus. In the complex 'simplicity' of microbes, they find capabilities needed by DOE and the nation for clean and secure energy, cleanup of environmental contamination, and sequestration of atmospheric carbon dioxide that contributes to global warming. An ongoing challenge for the entire GTL community is to demonstrate that the fundamental science conducted in each of your research projects brings us a step closer to biology-based solutions for these important national energy and environmental needs.

  15. Structural basis of the phospholipase C activity in neutral sphingomyelinase from Bacillus cereus

    Ago, Hideo; Miyano, Masashi

    2007-01-01

    Degradation of cell membrane and mucosa, of which phospholipids are major components, and production of lipid mediators are roles of phospholipases from pathogenic bacteria to grow, survive and spread in the host organism. The studies on the enzymes the important for the pathobiology of bacterial infectious disease. The crystal structure of Sphingomyelinase from Bacillus cereus revealed the structure basis of the phospholipase C and hemolysis activities in a divalent cation dependent manner. The water-bridged double divalent cations were concluded to be the catalytic architecture to the phospholipase C activity. In addition, the β-hairpin structure with aromatic amino acid residues was shown to be involved in the membrane binding of the enzyme as a part of the hemolysis activity. (author)

  16. Effects of Aronia melanocarpa Constituents on Biofilm Formation of Escherichia coli and Bacillus cereus

    Marie Bräunlich

    2013-12-01

    Full Text Available Many bacteria growing on surfaces form biofilms. Adaptive and genetic changes of the microorganisms in this structure make them resistant to antimicrobial agents. Biofilm-forming organisms on medical devices can pose serious threats to human health. Thus, there is a need for novel prevention and treatment strategies. This study aimed to evaluate the ability of Aronia melanocarpa extracts, subfractions and compounds to prevent biofilm formation and to inhibit bacterial growth of Escherichia coli and Bacillus cereus in vitro. It was found that several aronia substances possessed anti-biofilm activity, however, they were not toxic to the species screened. This non-toxic inhibition may confer a lower potential for resistance development compared to conventional antimicrobials.

  17. Mutation effect of MeV protons on bioflocculant bacteria Bacillus cereus

    Yang, Y.N.; Ren, N.; Xue, J.M.; Yang, J.; Rong, B.L.

    2007-01-01

    A 3.2 MeV proton beam was used to irradiate bioflocculant bacteria (Bacillus cereus) to achieve mutation. The ion fluence ranged from 10 11 to 10 14 /cm 2 . Most of the bacteria were killed when the ion fluence reached 10 12 ions/cm 2 . The survival ratio drops in an exponential way on further increasing the ion fluence. The flocculating activity of 7 samples out of 51 showed a positive change, and a perfect mutant C7-23 with a stable high capacity of bioflocculant production was found. RAPD measurements showed that a new lane appears in this sample. The flocculating activity of the C7-23 bacteria increased by factors of 22%, 54% and 217% under pH values of 4, 7 or 10, respectively

  18. Influence of heat and radiation on the germinability and viability of B. cereus BIS-59 spores

    Kamat, A.S.; Lewis, N.F.

    1983-01-01

    Spores of Bicillus cereus BIS-59, isolated in this laboratory from shrimps, exhibited an exponential gamma radiation survival curve with a d 10 value of 400 krad as compared with a D 10 value of 30 krad for the vegetative cells. The D 10 value of DPA-depleted spores was also 400 krad indicating that DPA does not influence the radiation response of these spores. Maximum germination monitored with irradiated spores was 60 percent as compared with 80 percent in case of unirradiated spores. Radiation-induced inhibition of the germination processes was not dose dependent. Heat treatment (15 min at 80 C) to spores resulted in activation of the germination process; however, increase in heating time (30 min and 60 min) increased the germination lag period. DPA-depleted spores were less heat resistant than normal spores and exhibited biphasic exponential inactivation. (author)

  19. Characterization of a methionine-rich protein from the seeds of Cereus jamacaru Mill. (Cactaceae

    T.C.F.R. Aragão

    2000-08-01

    Full Text Available We describe here the isolation and characterization of a major albumin from the seeds of Cereus jamacaru (Cactaceae, to which we gave the trivial name of cactin. This protein has a molecular mass of 11.3 kDa and is formed by a light chain (3.67 kDa and a heavy chain (7.63 kDa. This protein was isolated using a combination of gel filtration chromatography and reverse-phase HPLC. The amino acid composition of cactin was determined and found to resemble that of the 2S seed reserve protein from the Brazil nut, a protein remarkable for its high methionine content. The usefulness of cactin as a molecular marker in the taxonomy of the Cactaceae is discussed.

  20. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    Dessanti, Paola [Cornell University, Ithaca, NY 14853-1301 (United States); Università di Sassari, (Italy); Zhang, Yang [Cornell University, Ithaca, NY 14853-1301 (United States); Allegrini, Simone [Università di Sassari, (Italy); Tozzi, Maria Grazia [Università di Pisa, (Italy); Sgarrella, Francesco [Università di Sassari, (Italy); Ealick, Steven E., E-mail: see3@cornell.edu [Cornell University, Ithaca, NY 14853-1301 (United States)

    2012-03-01

    Adenosine phosphorylase from B. cereus shows a strong preference for adenosine over other 6-oxopurine nucleosides. Mutation of Asp204 to asparagine reduces the efficiency of adenosine cleavage but does not affect inosine cleavage, effectively reversing the substrate specificity. The structures of D204N complexes explain these observations. Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2′-deoxy)nucleosides, generating the corresponding free base and (2′-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2–1.4 Å). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  1. Isolation and characterization of a furfural-degrading bacterium Bacillus cereus sp. strain DS1.

    Zheng, Dan; Bao, Jianguo; Lu, Jueming; Gao, Chunlei

    2015-02-01

    Furfural was found to be the main organic pollutant in the wastewater coming from the Diosgenin factory. This substance is derived from acidic pentosan in Dioscorea zingiberensis and is also found in a variety of agricultural byproducts, including corncobs, oat, wheat bran, and sawdust. It is regarded as a toxicant and an inhibitor to the growth of microorganism in both sewage disposal and biological fermentation. A furfural-degrading strain (DS1) was isolated from activated sludge of wastewater treatment plant in a diosgenin factory by continuous enrichment culture. The strain was identified as Bacillus cereus based on morphological, physiological tests, as well as on 16S rDNA sequence and Biolog analyses. The capacity of this strain to grow on a mineral salt medium, utilizing furfural as the sole carbon and energy source to degrade furfural, was investigated in this study. Under the condition of pH 9.0, temperature 35 °C, with rotating speed of 150 rpm, and an inoculum of 6 %, the strain showed that the furfural degradation capacity reaches 35 % in 7 days, as measured by high-performance liquid chromatography. The addition of inorganic carbon sources could bring down the biodegradation efficiency of the furfural. The strain DS1 showed better furfural removal capacity, as compared to other inorganic carbon sources in the media. Furthermore, a furfural concentration of as high as 4,000 mg L(-1) was tolerated by the culture. The capacity to degrade furfural was demonstrated for the first time by using the genus B. cereus. This study suggests the possible application in biodegradation strategies.

  2. Identification of novel nitroreductases from Bacillus cereus and their interaction with the CB1954 prodrug.

    Gwenin, Vanessa V; Poornima, Paramasivan; Halliwell, Jennifer; Ball, Patrick; Robinson, George; Gwenin, Chris D

    2015-12-01

    Directed enzyme prodrug therapy is a form of cancer chemotherapy in which bacterial prodrug-activating enzymes, or their encoding genes, are directed to the tumour before administration of a prodrug. The prodrug can then be activated into a toxic drug at the tumour site, reducing off-target effects. The bacterial nitroreductases are a class of enzymes used in this therapeutic approach and although very promising, the low turnover rate of prodrug by the most studied nitroreductase enzyme, NfnB from Escherichia coli (NfnB_Ec), is a major limit to this technology. There is a continual search for enzymes with greater efficiency, and as part of the search for more efficient bacterial nitroreductase enzymes, two novel enzymes from Bacillus cereus (strain ATCC 14579) have been identified and shown to reduce the CB1954 (5-(aziridin-1-yl)-2,4-dinitrobenzamide) prodrug to its respective 2'-and 4'-hydroxylamine products. Both enzymes shared features characteristic of the nitro-FMN-reductase superfamily including non-covalently associated FMN, requirement for the NAD(P)H cofactor, homodimeric, could be inhibited by Dicoumarol (3,3'-methylenebis(4-hydroxy-2H-chromen-2-one)), and displayed ping pong bi bi kinetics. Based on the biochemical characteristics and nucleotide alignment with other nitroreductase enzymes, one enzyme was named YdgI_Bc and the other YfkO_Bc. Both B. cereus enzymes had greater turnover for the CB1954 prodrug compared with NfnB_Ec, and in the presence of added NADPH cofactor, YfkO_Bc had superior cell killing ability, and produced mainly the 4'-hydroxylamine product at low prodrug concentration. The YfkO_Bc was identified as a promising candidate for future enzyme prodrug therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Characterization of Potential Antimicrobial Targets in Bacillus spp. II. Branched-Chain Aminotransferase and Methionine Regeneration in B. cereus and B. anthracis

    Berger, B

    2002-01-01

    .... Four putative family III aminotransferases, two with homology to branched-chain amino acid aminotransferases and two with homology to D- amino acid aminotransferases, were cloned from B. cereus...

  4. Effects of nisin and temperature on survival, growth, and enterotoxin production characteristics of psychrotrophic Bacillus cereus in beef gravy.

    Beuchat, L R; Clavero, M R; Jaquette, C B

    1997-05-01

    The presence of psychrotrophic enterotoxigenic Bacillus cereus in ready-to-serve meats and meat products that have not been subjected to sterilization treatment is a public health concern. A study was undertaken to determine the survival, growth, and diarrheal enterotoxin production characteristics of four strains of psychrotrophic B. cereus in brain heart infusion (BHI) broth and beef gravy as affected by temperature and supplementation with nisin. A portion of unheated vegetative cells from 24-h BHI broth cultures was sensitive to nisin as evidenced by an inability to form colonies on BHI agar containing 10 micrograms of nisin/ml. Heat-stressed cells exhibited increased sensitivity to nisin. At concentrations as low as 1 microgram/ml, nisin was lethal to B. cereus, the effect being more pronounced in BHI broth than in beef gravy. The inhibitory effect of nisin (1 microgram/ml) was greater on vegetative cells than on spores inoculated into beef gravy and was more pronounced at 8 degrees C than at 15 degrees C. Nisin, at a concentration of 5 or 50 micrograms/ml, inhibited growth in gravy inoculated with vegetative cells and stored at 8 or 15 degrees C, respectively, for 14 days. Growth of vegetative cells and spores of B. cereus after an initial period of inhibition is attributed to loss of activity of nisin. One of two test strains produced diarrheal enterotoxin in gravy stored at 8 or 15 degrees C within 9 or 3 days, respectively. Enterotoxin production was inhibited in gravy supplemented with 1 microgram of nisin/ml and stored at 8 degrees C for 14 days; 5 micrograms of nisin/ml was required for inhibition at 15 degrees C. Enterotoxin was not detected in gravy in which less than 5.85 log10 CFU of B. cereus/ml had grown. Results indicate that as little as 1 microgram of nisin/ml may be effective in inhibiting or retarding growth of and diarrheal enterotoxin production by vegetative cells and spores of psychrotrophic B. cereus in beef gravy at 8 degrees C, a

  5. A taxonomic framework for emerging groups of ecologically important marine gammaproteobacteria based on the reconstruction of evolutionary relationships using genome-scale data

    Stefan eSpring

    2015-04-01

    Full Text Available In recent years a large number of isolates were obtained from saline environments that are phylogenetically related to distinct clades of oligotrophic marine gammaproteobacteria, which were originally identified in seawater samples using cultivation independent methods and are characterized by high seasonal abundances in coastal environments. To date a sound taxonomic framework for the classification of these ecologically important isolates and related species in accordance with their evolutionary relationships is missing.In this study we demonstrate that a reliable allocation of members of the oligotrophic marine gammaproteobacteria (OMG group and related species to higher taxonomic ranks is possible by phylogenetic analyses of whole proteomes but also of the RNA polymerase beta subunit, whereas phylogenetic reconstructions based on 16S rRNA genes alone resulted in unstable tree topologies with only insignificant bootstrap support. The identified clades could be correlated with distinct phenotypic traits illustrating an adaptation to common environmental factors in their evolutionary history. Genome wide gene-content analyses revealed the existence of two distinct ecological guilds within the analyzed lineage of marine gammaproteobacteria which can be distinguished by their trophic strategies. Based on our results a novel order within the class Gammaproteobacteria is proposed, which is designated Cellvibrionales ord. nov. and comprises the five novel families Cellvibrionaceae fam. nov., Halieaceae fam. nov., Microbulbiferaceae fam. nov., Porticoccaceae fam. nov., and Spongiibacteraceae fam. nov.

  6. Enterotoxigenic gene profiles of Bacillus cereus and Bacillus megaterium isolates recovered from honey Búsqueda de factores de virulencia en cepas de Bacillus cereus y de Bacillus megaterium aisladas de miel

    A. C. López

    2010-09-01

    Full Text Available One hundred and thirty two Bacillus cereus and 52 Bacillus megaterium isolates from honeys were evaluated for the presence of genes encoding enterotoxin HBL, enterotoxin-T, cytotoxin K and the NHE complex, respectively. The relationship between hemolytic and coagulase activity and its correlation with the presence of the four mentioned enterotoxins was determined by principal component analysis (PCA. PCA in B. cereus revealed a positive correlation among free coagulase, hemolysis and the presence of genes hblA, hblB, hblC, hblD (HBL complex and bceT (enterotoxin-T, but no correlation with the clumping factor (bound coagulase and the presence of sequences of the NHE complex. On the other hand, PCA in B. megaterium showed a high positive correlation between coagulase (bound and free and the haemolytic activity but no correlation in relation to the presence of genes of the HBL complex, cytotoxin K, enterotoxin T and the NHE complex. To our knowledge, this is the first report of the detection of cytotoxin K and of the NHE complex genes in B. megaterium. The relationship between the coagulase activity and the presence of virulence factors has not been described before in the genus Bacillus, being this work the first report of this correlation. Interestingly, the presence of the cytK gene was almost independent of the presence of the rest of virulence factors herein analyzed both in B. cereus and B. megaterium populations. Our results suggest that honey could be a possible vehicle for foodborne illness due to the presence of toxigenic B. cereus and B. megaterium strains containing different virulence factors.Se evaluaron 132 aislamientos de Bacillus cereus y 52 de Bacillus megaterium provenientes de mieles de distintos orígenes geográficos para investigar la presencia de secuencias de ADN relacionadas con genes de virulencia y su posible correlación con la actividad hemolítica y coagulasa. Con respecto a los genes de virulencia, se analizaron por

  7. Effect of Electrolyzed Water on the Disinfection of Bacillus cereus Biofilms: The Mechanism of Enhanced Resistance of Sessile Cells in the Biofilm Matrix.

    Hussain, Mohammad Shakhawat; Kwon, Minyeong; Tango, Charles Nkufi; Oh, Deog Hwan

    2018-05-01

    This study examined the disinfection efficacy and mechanism of electrolyzed water (EW) on Bacillus cereus biofilms. B. cereus strains, ATCC 14579 and Korean Collection for Type Cultures (KCTC) 13153 biofilms, were formed on stainless steel (SS) and plastic slide (PS) coupons. Mature biofilms were treated with slightly acidic EW (SAEW), acidic EW (AEW), and basic EW (BEW). SAEW (available chlorine concentration, 25 ± 1.31 mg L -1 ; pH 5.71 ± 0.16; and oxidation reduction potential, 818 to 855 mV) reduced ATCC 14579 biofilms on plastic slides to below the detection limit within 30 s. However, biofilms on SS coupons showed a higher resistance to the SAEW treatment. When the disinfection activities of three types of EW on biofilms were compared, AEW showed a higher bactericidal activity, followed by SAEW and BEW. In contrast, BEW showed a significantly ( P biofilm dispersal activity than AEW and SAEW. SAEW disinfection of the B. cereus biofilms was due to the disruption of the B. cereus plasma membrane. The higher resistance of biofilms formed on the SS coupon might be due to the higher number of attached cells and extracellular polymeric substances formation that reacts with the active chlorine ions, such as hypochlorous acid and hypochlorite ion of SAEW, which decreased the disinfection efficacy of SAEW. This study showed that the EW treatment effectively disinfected B. cereus biofilms, providing insight into the potential use of EW in the food processing industry to control the biofilm formation of B. cereus.

  8. Outbreak of Bacillus cereus Infections in a Neonatal Intensive Care Unit Traced to Balloons Used in Manual Ventilation

    Van Der Zwet, Wil C.; Parlevliet, Gerard A.; Savelkoul, Paul H.; Stoof, Jeroen; Kaiser, Annie M.; Van Furth, A. Marceline; Vandenbroucke-Grauls, Christina M.

    2000-01-01

    In 1998, an outbreak of systemic infections caused by Bacillus cereus occurred in the Neonatal Intensive Care Unit of the University Hospital Vrije Universiteit, Amsterdam, The Netherlands. Three neonates developed sepsis with positive blood cultures. One neonate died, and the other two neonates recovered. An environmental survey, a prospective surveillance study of neonates, and a case control study were performed, in combination with molecular typing, in order to identify potential sources ...

  9. Use of Fatty Acid Methyl Ester Profiles for Discrimination of Bacillus cereus T-Strain Spores Grown on Different Media▿

    Ehrhardt, Christopher J.; Chu, Vivian; Brown, TeeCie; Simmons, Terrie L.; Swan, Brandon K.; Bannan, Jason; Robertson, James M.

    2010-01-01

    The goal of this study was to determine if cellular fatty acid methyl ester (FAME) profiling could be used to distinguish among spore samples from a single species (Bacillus cereus T strain) that were prepared on 10 different medium formulations. To analyze profile differences and identify FAME biomarkers diagnostic for the chemical constituents in each sporulation medium, a variety of statistical techniques were used, including nonmetric multidimensional scaling (nMDS), analysis of similarit...

  10. Comparative analysis of biofilm formation by Bacillus cereus reference strains and undomesticated food isolates and the effect of free iron.

    Hayrapetyan, Hasmik; Muller, Lisette; Tempelaars, Marcel; Abee, Tjakko; Nierop Groot, Masja

    2015-05-04

    Biofilm formation of Bacillus cereus reference strains ATCC 14579 and ATCC 10987 and 21 undomesticated food isolates was studied on polystyrene and stainless steel as contact surfaces. For all strains, the biofilm forming capacity was significantly enhanced when in contact with stainless steel (SS) as a surface as compared to polystyrene (PS). For a selection of strains, the total CFU and spore counts in biofilms were determined and showed a good correlation between CFU counts and total biomass of these biofilms. Sporulation was favoured in the biofilm over the planktonic state. To substantiate whether iron availability could affect B. cereus biofilm formation, the free iron availability was varied in BHI by either the addition of FeCl3 or by depletion of iron with the scavenger 2,2-Bipyridine. Addition of iron resulted in increased air-liquid interface biofilm on polystyrene but not on SS for strain ATCC 10987, while the presence of Bipyridine reduced biofilm formation for both materials. Biofilm formation was restored when excess FeCl3 was added in combination with the scavenger. Further validation of the iron effect for all 23 strains in microtiter plate showed that fourteen strains (including ATCC10987) formed a biofilm on PS. For eight of these strains biofilm formation was enhanced in the presence of added iron and for eleven strains it was reduced when free iron was scavenged. Our results show that stainless steel as a contact material provides more favourable conditions for B. cereus biofilm formation and maturation compared to polystyrene. This effect could possibly be linked to iron availability as we show that free iron availability affects B. cereus biofilm formation. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Iron Acquisition in Bacillus cereus: The Roles of IlsA and Bacillibactin in Exogenous Ferritin Iron Mobilization

    Buisson, Christophe; Daou, Nadine; Kallassy, Mireille; Lereclus, Didier; Arosio, Paolo; Bou-Abdallah, Fadi; Nielsen Le Roux, Christina

    2014-01-01

    In host-pathogen interactions, the struggle for iron may have major consequences on the outcome of the disease. To overcome the low solubility and bio-availability of iron, bacteria have evolved multiple systems to acquire iron from various sources such as heme, hemoglobin and ferritin. The molecular basis of iron acquisition from heme and hemoglobin have been extensively studied; however, very little is known about iron acquisition from host ferritin, a 24-mer nanocage protein able to store thousands of iron atoms within its cavity. In the human opportunistic pathogen Bacillus cereus, a surface protein named IlsA (Iron-regulated leucine rich surface protein type A) binds heme, hemoglobin and ferritin in vitro and is involved in virulence. Here, we demonstrate that IlsA acts as a ferritin receptor causing ferritin aggregation on the bacterial surface. Isothermal titration calorimetry data indicate that IlsA binds several types of ferritins through direct interaction with the shell subunits. UV-vis kinetic data show a significant enhancement of iron release from ferritin in the presence of IlsA indicating for the first time that a bacterial protein might alter the stability of the ferritin iron core. Disruption of the siderophore bacillibactin production drastically reduces the ability of B. cereus to utilize ferritin for growth and results in attenuated bacterial virulence in insects. We propose a new model of iron acquisition in B. cereus that involves the binding of IlsA to host ferritin followed by siderophore assisted iron uptake. Our results highlight a possible interplay between a surface protein and a siderophore and provide new insights into host adaptation of B. cereus and general bacterial pathogenesis. PMID:24550730

  12. Iron acquisition in Bacillus cereus: the roles of IlsA and bacillibactin in exogenous ferritin iron mobilization.

    Diego Segond

    2014-02-01

    Full Text Available In host-pathogen interactions, the struggle for iron may have major consequences on the outcome of the disease. To overcome the low solubility and bio-availability of iron, bacteria have evolved multiple systems to acquire iron from various sources such as heme, hemoglobin and ferritin. The molecular basis of iron acquisition from heme and hemoglobin have been extensively studied; however, very little is known about iron acquisition from host ferritin, a 24-mer nanocage protein able to store thousands of iron atoms within its cavity. In the human opportunistic pathogen Bacillus cereus, a surface protein named IlsA (Iron-regulated leucine rich surface protein type A binds heme, hemoglobin and ferritin in vitro and is involved in virulence. Here, we demonstrate that IlsA acts as a ferritin receptor causing ferritin aggregation on the bacterial surface. Isothermal titration calorimetry data indicate that IlsA binds several types of ferritins through direct interaction with the shell subunits. UV-vis kinetic data show a significant enhancement of iron release from ferritin in the presence of IlsA indicating for the first time that a bacterial protein might alter the stability of the ferritin iron core. Disruption of the siderophore bacillibactin production drastically reduces the ability of B. cereus to utilize ferritin for growth and results in attenuated bacterial virulence in insects. We propose a new model of iron acquisition in B. cereus that involves the binding of IlsA to host ferritin followed by siderophore assisted iron uptake. Our results highlight a possible interplay between a surface protein and a siderophore and provide new insights into host adaptation of B. cereus and general bacterial pathogenesis.

  13. Probiotic actions of Bacillus cereus var. toyoi and Saccharomyces boulardii in silver catfish (Rhamdia quelen larvae culture

    Diego Moreira de Souza

    2012-03-01

    Full Text Available The objective of this study was to evaluate the use of Bacillus cereus var. toyoi and Saccharomyces boulardii as probiotics to improve Rhamdia quelen culture. Six hundred larvaes (0.16±0.07 g were divided in three replicate tanks (25-L recirculation, 20 ºC, photoperiod of 12 h light/12 h darkness per treatment and were randomly assigned to the following treatments: Bacillus cereus var. toyoi; Saccharomyces boulardii; B. toyoi and S. boulardii; and control (without probiotic addition for a period of 30 days. The fish were fed five times daily (56% crude protein - Supra alevino inicial® and the probiotics were applied in water once a day. The doses of probiotics were 5 × 10(8 and 2 × 10(9 CFU (colony forming unit/mL for B. cereus var. toyoi and S. boulardii, respectively. Both probiotics have an inhibitory effect in vitro against Vibrio carchariae and are able to grow in media prepared with fishery water; however, no effect was observed on growth parameters when they were administered to Rhamdia quelen larvae.

  14. Isolation and Molecular Characterization of Potential Plant Growth Promoting Bacillus cereus GGBSTD1 and Pseudomonas spp. GGBSTD3 from Vermisources

    Balayogan Sivasankari

    2014-01-01

    Full Text Available Vermicompost was prepared from leaf materials of Gliricidia sepium + Cassia auriculata + Leucaena leucocephala with cow dung (1 : 1 : 2 using Eudrilus eugeniae (Kinberg and Eisenia fetida for 60 days. Nineteen bacterial strains which have the capability to fix nitrogen, solubilize inorganic phosphate, and produce phytohormones were isolated from vermicompost, vermisources, and earthworm (fore, mid, and hind guts and tested for plant growth studies. Among the bacterial strains only five strains had both activities; among the five Bacillus spp. showed more nitrogen fixing activity and Pseudomonas spp. showed more phosphate solubilizing activity. Hence these bacterial strains were selected for further molecular analysis and identified Bacillus cereus GGBSTD1 and Pseudomonas spp. GGBSTD3. Plant growth studies use these two organisms separately and as consortium (Bacillus cereus + Pseudomonas spp. in (1 : 1 ratio at different concentrations using Vigna unguiculata (L. Walp. at different day intervals. The germination percent, shoot length, root length, leaf area, chlorophyll a content of the leaves, chlorophyll b content of the leaves, total chlorophyll content of the leaves, fresh weight of the whole plant, and dry weight of the whole plant were significantly enhanced by the consortium (Bacillus cereus + Pseudomonas spp. of two organisms at 5 mL concentrations on the 15th day compared to others.

  15. Prevalence, isolation and characterization of Bacillus cereus strains from rice of local cultivators of Sabah, Sarawak, and Peninsular Malaysia

    Sawei, Jelin; Sani, Norrakiah Abdullah

    2016-11-01

    Bacillus cereus is a spore-forming, facultative anaerobic, motile microorganism that has been identified as a causative agent of two types of gastrointestinal diseases such as emetic and diarrhea. This foodborne pathogen is found in both vegetative cells and endospores form in foods such as rice either raw or cooked. The aim of this study is to investigate and determine the prevalence, characterize and identify the isolation of vegetative cells and endospores of B. cereus in thirty varieties (n=3) of raw rice from Sabah, Sarawak and Peninsular Malaysia. A total of 90 (n=90) raw rice were examined and 84 (93.33%) samples were positive to vegetative cells of B. cereus. However, only 32 (35.56%) samples were positive for endospore cells that able to germinate after samples were heated at 75°C for 15 mins. The mean log cfu/g for vegetative cells were higher range (0.00 - 4.1533) than visible endospores (0.00 - 3.7533 mean log cfu/g). Sample of raw red rice (UKMRC9) had significantly higher contamination by both vegetative cells and endospores at p<0.05, than the other raw rice samples.

  16. Photoproduct formation and repair capacity in a mutant of Bacillus cereus 569 producing UV-sensitive spores

    Weinberger, S.; Evenchik, Z.; Hertman, I.; Bar-Ilan Univ., Ramat-Gan

    1982-01-01

    A mutant of Bacillus cereus 569 UV sensitive in both vegetative and sporal stages was isolated by N-methyl-N'-nitro-N-nitrosoguanidine (NTG) mutagenesis followed by selection on mitomycin C. The UV-sensitive mutant designated as B. cereus 2422 exhibited normal content of dipicolinic acid (DPA) and resistance to X-rays and ethyl methanesulphonate. The photoproduct type and amount, induced by a given UV dose, was similar in either cells or spores of both the mutant 2422 and the wild-type ancestor. The mutant 2422 excised cyclobutane thymine dimers only to a limited extent (20%) as compared with 80% removal in the wild type. Removal of a spore-specific photoproduct (TDHT) during germination proceeded to a similar extent in B. cereus 2422 and the wild-type parent. However, under growing conditions, an additional removal of the TDHT was observed only in the wild-type strain. Liquid holding recovery occurred in irradiated wild-type cells, but not in mutant cells. Spontaneous revertants were isolated that regained UV resistance simultaneously in both the vegetative and sporal stage. (orig./AJ)

  17. Impacts of sporulation temperature, exposure to compost matrix and temperature on survival of Bacillus cereus spores during livestock mortality composting.

    Stanford, K; Reuter, T; Gilroyed, B H; McAllister, T A

    2015-04-01

    To investigate impact of sporulation and compost temperatures on feasibility of composting for disposal of carcasses contaminated with Bacillus anthracis. Two strains of B. cereus, 805 and 1391, were sporulated at either 20 or 37°C (Sporulation temperature, ST) and 7 Log10 CFU g(-1) spores added to autoclaved manure in nylon bags (pore size 50 μm) or in sealed vials. Vials and nylon bags were embedded into compost in either a sawdust or manure matrix each containing 16 bovine mortalities (average weight 617 ± 33 kg), retrieved from compost at intervals over 217 days and survival of B. cereus spores assessed. A ST of 20°C decreased spore survival by 1·4 log10 CFU g(-1) (P Compost temperatures >55°C reduced spore survival (P compost temperatures were key factors influencing survival of B. cereus spores in mortality compost. Composting may be most appropriate for the disposal of carcasses infected with B. anthracis at ambient temperatures ≤20°C under thermophillic composting conditions (>55°C). © 2015 The Society for Applied Microbiology.

  18. Molecular characterization of the probiotic strain Bacillus cereus var. toyoi NCIMB 40112 and differentiation from food poisoning strains.

    Klein, Günter

    2011-07-01

    Bacillus cereus var. toyoi strain NCIMB 40112 (Toyocerin), a probiotic authorized in the European Union as feed additive for swine, bovines, poultry, and rabbits, was characterized by DNA fingerprinting applying pulsed-field gel electrophoresis and multilocus sequence typing and was compared with reference strains (of clinical and environmental origins). The probiotic strain was clearly characterized by pulsed-field gel electrophoresis using the restriction enzymes Apa I and Sma I resulting in unique DNA patterns. The comparison to the clinical reference strain B. cereus DSM 4312 was done with the same restriction enzymes, and again a clear differentiation of the two strains was possible by the resulting DNA patterns. The use of the restriction enzymes Apa I and Sma I is recommended for further studies. Furthermore, multilocus sequence typing analysis revealed a sequence type (ST 111) that was different from all known STs of B. cereus strains from food poisoning incidents. Thus, a strain characterization and differentiation from food poisoning strains for the probiotic strain was possible. Copyright ©, International Association for Food Protection

  19. Glucose 6P binds and activates HlyIIR to repress Bacillus cereus haemolysin hlyII gene expression.

    Elisabeth Guillemet

    Full Text Available Bacillus cereus is a Gram-positive spore-forming bacterium causing food poisoning and serious opportunistic infections. These infections are characterized by bacterial accumulation despite the recruitment of phagocytic cells. We have previously shown that B. cereus Haemolysin II (HlyII induces macrophage cell death by apoptosis. In this work, we investigated the regulation of the hlyII gene. We show that HlyIIR, the negative regulator of hlyII expression in B. cereus, is especially active during the early bacterial growth phase. We demonstrate that glucose 6P directly binds to HlyIIR and enhances its activity at a post-transcriptional level. Glucose 6P activates HlyIIR, increasing its capacity to bind to its DNA-box located upstream of the hlyII gene, inhibiting its expression. Thus, hlyII expression is modulated by the availability of glucose. As HlyII induces haemocyte and macrophage death, two cell types that play a role in the sequestration of nutrients upon infection, HlyII may induce host cell death to allow the bacteria to gain access to carbon sources that are essential components for bacterial growth.

  20. Bacillus cereus as indicator in the sterilization of residual water with high energy electrons; Bacillus cereus como indicador en la desinfeccion de aguas residuales con electrones de alta energia

    Mejia Z, E

    2000-07-01

    One of the main causes of water pollution is the presence of microorganisms that provoke infections, moreover of chemical substances. The processes of residual water treatment finally require of the disinfection for its use or final disposition. The radiation technology for the residual water treatment by mean of electron beams is an innovator process because as well as decomposing the chemical substance or to degrade them, also it provokes a disinfection by which this is proposed as alternative for disinfection of residual water, with the purpose in reusing the water treated in the agriculture, recreation and industry among others secondary activities, solving environmental or health problems. The objective of this work is to evaluate the use of Bacillus cereus as biological indicator in the disinfection by radiation, using High Energy Electrons. To fulfil with this objective, the work was developed in three stages, the first one consisted in the acquisition, propagation and conservation of the Bacillus cereus stumps, considering Escherichia coli and Salmonella typhimurium as pathogenic germs present in residual water. Moreover, the inocule standardization and the conditions of the Electron accelerator Type Pelletron. In the second stage it was performed the irradiation of aqueous samples of the microorganisms simulating biological pollution and the application to problem samples of a treatment plant sited in the Lerma River zone of mixed residual water. And in the third stage was performed a regression analysis to the reported survival for each kind of microorganisms. The results obtained show that with the use of Electron beams was reduced 6 logarithmic units de E. coli at 129 Gy, for S. typhimurium it was reduced 8 logarithmic units at 383 Gy and the B. cereus at 511 Gy was reduced 6.8 logarithmic units. Of the problem samples irradiated at 500 Gy, the concentration of the total account diminished from 8.70 x 10{sup 7} UFC/ml to 550 UFC/ml, the presence of B

  1. Radiogenomics of High-Grade Serous Ovarian Cancer: Multireader Multi-Institutional Study from the Cancer Genome Atlas Ovarian Cancer Imaging Research Group.

    Vargas, Hebert Alberto; Huang, Erich P; Lakhman, Yulia; Ippolito, Joseph E; Bhosale, Priya; Mellnick, Vincent; Shinagare, Atul B; Anello, Maria; Kirby, Justin; Fevrier-Sullivan, Brenda; Freymann, John; Jaffe, C Carl; Sala, Evis

    2017-11-01

    Purpose To evaluate interradiologist agreement on assessments of computed tomography (CT) imaging features of high-grade serous ovarian cancer (HGSOC), to assess their associations with time-to-disease progression (TTP) and HGSOC transcriptomic profiles (Classification of Ovarian Cancer [CLOVAR]), and to develop an imaging-based risk score system to predict TTP and CLOVAR profiles. Materials and Methods This study was a multireader, multi-institutional, institutional review board-approved, HIPAA-compliant retrospective analysis of 92 patients with HGSOC (median age, 61 years) with abdominopelvic CT before primary cytoreductive surgery available through the Cancer Imaging Archive. Eight radiologists from the Cancer Genome Atlas Ovarian Cancer Imaging Research Group developed and independently recorded the following CT features: characteristics of primary ovarian mass(es), presence of definable mesenteric implants and infiltration, presence of other implants, presence and distribution of peritoneal spread, presence and size of pleural effusions and ascites, lymphadenopathy, and distant metastases. Interobserver agreement for CT features was assessed, as were univariate and multivariate associations with TTP and CLOVAR mesenchymal profile (worst prognosis). Results Interobserver agreement for some features was strong (eg, α = .78 for pleural effusion and ascites) but was lower for others (eg, α = .08 for intraparenchymal splenic metastases). Presence of peritoneal disease in the right upper quadrant (P = .0003), supradiaphragmatic lymphadenopathy (P = .0004), more peritoneal disease sites (P = .0006), and nonvisualization of a discrete ovarian mass (P = .0037) were associated with shorter TTP. More peritoneal disease sites (P = .0025) and presence of pouch of Douglas implants (P = .0045) were associated with CLOVAR mesenchymal profile. Combinations of imaging features contained predictive signal for TTP (concordance index = 0.658; P = .0006) and CLOVAR profile (mean

  2. Influence of food matrix on outgrowth heterogeneity of heat damaged Bacillus cereus spores.

    Warda, Alicja K; den Besten, Heidy M W; Sha, Na; Abee, Tjakko; Nierop Groot, Masja N

    2015-05-18

    Spoilage of heat treated foods can be caused by the presence of surviving spore-formers. It is virtually impossible to prevent contamination at the primary production level as spores are ubiquitous present in the environment and can contaminate raw products. As a result spore inactivation treatments are widely used by food producing industries to reduce the microbial spore loads. However consumers prefer mildly processed products that have less impact on its quality and this trend steers industry towards milder preservation treatments. Such treatments may result in damaged instead of inactivated spores, and these spores may germinate, repair, and grow out, possibly leading to quality and safety issues. The ability to repair and grow out is influenced by the properties of the food matrix. In the current communication we studied the outgrowth from heat damaged Bacillus cereus ATCC 14579 spores on Anopore membrane, which allowed following outgrowth heterogeneity of individual spores on broccoli and rice-based media as well as standard and mildly acidified (pH 5.5) meat-based BHI. Rice, broccoli and BHI pH 5.5 media resulted in delayed outgrowth from untreated spores, and increased heterogeneity compared to BHI pH 7.4, with the most pronounced effect in rice media. Exposure to wet heat for 1 min at 95 °C caused 2 log inactivation and approximately 95% of the spores in the surviving fraction were damaged resulting in substantial delay in outgrowth based on the time required to reach a maximum microcolony size of 256 cells. The delay was most pronounced for heat-treated spores on broccoli medium followed by spores on rice media (both untreated and treated). Interestingly, the increase in outgrowth heterogeneity of heat treated spores on BHI pH 7.4 was more pronounced than on rice, broccoli and BHI pH 5.5 conceivably reflecting that conditions in BHI pH 7.4 better support spore damage repair. This study compares the effects of three main factors, namely heat treatment, p

  3. UJI AKTIVITAS ANTIBAKTERI EKSTRAK KASAR LIPID Ulva fasciata TERHADAP Bacillus cereus

    Riong Seulina Panjaitan

    2017-01-01

    Full Text Available Abstract: The increasing of antimicrobial resistance in medical field has become a serious problem which is have to be solved by exploring raw material on natural product. Seaweed or macroalgae is one of marine natural wealth of Indonesia’s sea. In this research, lipid extraction of seaweed (macroalgae Ulva fasciata has been done according to Folch method by using sochlet and mixure of solvent namely chloroform:methanol (2:1/ (v/v. The result gave two phase namely chloroform phase (0,6% (v/b and methanol phase (7,79% (v/b. Furthermore, both of phase of crude extract lipid Ulva fasciata were tested their antibacterial activities against Bacillus cereus bacterial which is three times. Tetracyclin is used as positive control and the solvent (methanol-chloroform is used as negative control. The results were both of phase gave antibacterial activity namely 0,02 mm/ μg extract for chloroform phase and 0,02 mm/ μg extract for methanol phase.Abstrak: Peningkatan kasus resistensi antimikroba pada dunia medis telah menjadi masalah yang serius sehingga perlu dilakukan pengeksplorasian bahan baku untuk antibiotik khususnya dari bahan alam. Rumput laut (makroalga merupakan salah satu kekayaan alam hayati laut Indonesia yang memiliki kandungan lipid. Pada penelitian ini dilakukan ekstraksi lipid rumput laut (makroalga Ulva fasciata berdasarkan metode Folch dengan menggunakan sokhlet dan campuran pelarut yang digunakan yaitu kloroform:metanol (2:1/ (v/v. Hasil ekstraksi lipid Ulva fasciata menghasilkan dua fasa yaitu fasa kloroform sebanyak 0,6 % (v/b dan fasa metanol sebanyak 7,79 % (v/b. Selanjutnya kedua fasa ekstrak kasar lipid Ulva fasciata tersebut diuji aktivitas antibakterinya terhadap bakteri Bacillus cereus sebanyak tiga kali pengulangan. Kontrol positif yang digunakan adalah tetrasiklin dan kontrol negatifnya adalah pelarut yaitu kloroform dan metanol. Hasil penelitian menunjukkan bahwa kedua fasa tersebut memberikan aktivitas antibakteri

  4. National Human Genome Research Institute

    ... Care Genomic Medicine Working Group New Horizons and Research Patient Management Policy and Ethics Issues Quick Links for Patient Care Education All About the Human Genome Project Fact Sheets Genetic Education Resources for ...

  5. Evidence of mercury trapping in biofilm-EPS and mer operon-based volatilization of inorganic mercury in a marine bacterium Bacillus cereus BW-201B.

    Dash, Hirak R; Basu, Subham; Das, Surajit

    2017-04-01

    Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.

  6. Crystallization and preliminary X-ray crystallographic analysis of peptide deformylase (PDF) from Bacillus cereus in ligand-free and actinonin-bound forms.

    Park, Joon Kyu; Moon, Jin Ho; Kim, Jae-Hong; Kim, Eunice EunKyeong

    2005-01-01

    In bacteria, protein expression initiates with an N-formyl group and this needs to be removed in order to ensure proper bacterial growth. These formylation and deformylation processes are unique to eubacteria; therefore, inhibition of these would provide a novel antibacterial therapy. Deformylation is carried out by peptide deformylase (PDF). PDF from Bacillus cereus, one of the major pathogenic bacteria, was cloned into expression plasmid pET-28a (Novagen), overexpressed in Escherichia coli BL21 (DE3) and purified to high quality. Crystals have been obtained of both ligand-free PDF and PDF to which actinonin, a highly potent naturally occurring inhibitor, is bound. Both crystals belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 42.72, b = 44.04, c = 85.19 A and a = 41.31, b = 44.56, c = 84.47 A, respectively. Diffraction data were collected to 1.7 A resolution for the inhibitor-free crystals and to 2.0 A resolution for the actinonin-bound crystals.

  7. Spectroscopic studies of the iron and manganese reconstituted tyrosyl radical in Bacillus cereus ribonucleotide reductase R2 protein.

    Ane B Tomter

    Full Text Available Ribonucleotide reductase (RNR catalyzes the rate limiting step in DNA synthesis where ribonucleotides are reduced to the corresponding deoxyribonucleotides. Class Ib RNRs consist of two homodimeric subunits: R1E, which houses the active site; and R2F, which contains a metallo cofactor and a tyrosyl radical that initiates the ribonucleotide reduction reaction. We studied the R2F subunit of B. cereus reconstituted with iron or alternatively with manganese ions, then subsequently reacted with molecular oxygen to generate two tyrosyl-radicals. The two similar X-band EPR spectra did not change significantly over 4 to 50 K. From the 285 GHz EPR spectrum of the iron form, a g(1-value of 2.0090 for the tyrosyl radical was extracted. This g(1-value is similar to that observed in class Ia E. coli R2 and class Ib R2Fs with iron-oxygen cluster, suggesting the absence of hydrogen bond to the phenoxyl group. This was confirmed by resonance Raman spectroscopy, where the stretching vibration associated to the radical (C-O, ν(7a = 1500 cm(-1 was found to be insensitive to deuterium-oxide exchange. Additionally, the (18O-sensitive Fe-O-Fe symmetric stretching (483 cm(-1 of the metallo-cofactor was also insensitive to deuterium-oxide exchange indicating no hydrogen bonding to the di-iron-oxygen cluster, and thus, different from mouse R2 with a hydrogen bonded cluster. The HF-EPR spectrum of the manganese reconstituted RNR R2F gave a g(1-value of ∼2.0094. The tyrosyl radical microwave power saturation behavior of the iron-oxygen cluster form was as observed in class Ia R2, with diamagnetic di-ferric cluster ground state, while the properties of the manganese reconstituted form indicated a magnetic ground state of the manganese-cluster. The recent activity measurements (Crona et al., (2011 J Biol Chem 286: 33053-33060 indicates that both the manganese and iron reconstituted RNR R2F could be functional. The manganese form might be very important, as it has 8

  8. Changes in sugars, acids, and volatiles during ripening of koubo [Cereus peruvianus (L.) Miller] fruits.

    Ninio, Racheli; Lewinsohn, Efraim; Mizrahi, Yosef; Sitrit, Yaron

    2003-01-29

    The columnar cactus Cereus peruvianus (L.) Miller, Cactaceae (koubo), is grown commercially in Israel. The unripe fruits are green, and the color changes to violet and then to red when the fruit is fully ripe. The content of soluble sugars was found to increase 5-fold during ripening. Glucose and fructose were the main sugars accumulated in the fruit pulp, and each increased from 0.5 to 5.5 g/100 g fresh weight during ripening. The polysaccharides content decreased during ripening from 1.4 to 0.4 g/100 g fresh weight. The titratable acidity decreased and the pH increased during ripening. The major organic acid found in the fruit was malic acid, which decreased from 0.75 g/100 g fresh weight at the mature green stage to 0.355 g/100 g fresh weight in ripe fruits. Citric, succinic, and oxalic acids were found in concentrations lower than 0.07 g/100 g fresh weight. Prominent accumulation of aroma volatiles occurred toward the end of the ripening process. The main volatile found in the ripe fruit was linalool, reaching concentrations of 1.5-3.5 microg/g fresh weight.

  9. Isolation and characterization of a novel analyte from Bacillus subtilis SC-8 antagonistic to Bacillus cereus.

    Lee, Nam Keun; Yeo, In-Cheol; Park, Joung Whan; Kang, Byung-Sun; Hahm, Young Tae

    2010-09-01

    In this study, an effective substance was isolated from Bacillus subtilis SC-8, which was obtained from traditionally fermented soybean paste, cheonggukjang. The substance was purified by HPLC, and its properties were analyzed. It had an adequate antagonistic effect on Bacilluscereus, and its spectrum of activity was narrow. When tested on several gram-negative and gram-positive foodborne pathogenic bacteria such as Salmonella enterica, Salmonella enteritidis, Staphylococcus aureus, and Listeria monocytogenes, no antagonistic effect was observed. Applying the derivative from B. subtilis SC-8 within the same genus did not inhibit the growth of major soybean-fermenting bacteria such as Bacillus subtilis, Bacillus licheniformis, and Bacillus amyloquefaciens. The range of pH stability of the purified antagonistic substance was wide (from 4.0 to >10.0), and the substance was thermally stable up to 60 degrees C. In the various enzyme treatments, the antagonistic activity of the purified substance was reduced with proteinase K, protease, and lipase; its activity was partially destroyed with esterase. Spores of B. cereus did not grow at all in the presence of 5mug/mL of the purified antagonistic substance. The isolated antagonistic substance was thought to be an antibiotic-like lipopeptidal compound and was tentatively named BSAP-254 because it absorbed to UV radiation at 254nm. Copyright 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Estudo do crescimento inicial de plântulas de Cereus jamacaru DC em diferentes substratos

    Wanderlucia Silva Rodrigues

    2014-12-01

    Full Text Available O presente trabalho objetivou avaliar o desenvolvimento de mudas de Cereus jamacaru DC, em substratos a base de fibra de coco e casca de arroz carbonizada. Os tratamentos utilizados foram dispostos em um delineamento inteiramente casualizado constituídos por cinco substratos a base de fibra de coco (FC e casca de arroz carbonizado (CAC, misturados com diferentes proporções volumétricas. Os tratamentos constituíram-se dos substratos 100% FC (T1, 100% CAC (T2, 75%FC+25%CAC (T3, 50%FC+50%CAC (T4, e 25%FC+75%CAC (T5. Cada tratamento foi composto por 14 repetições com 2 plantas por tratamento. Caixas de plástico transparente foram utilizados como recipientes. Aos 125 dias após o transplantio, foram avaliadas as seguintes variáveis das plântulas: comprimento, número, massa fresco e massa seco de raiz; massa fresco e massa seco da parte aérea; comprimento da parte aérea. Nas condições do experimento, conclui-se que o substrato composto somente por fibra de coco apresentou melhores resultados em todas as variáveis analisadas.

  11. Inhibition of toxicogenic Bacillus cereus in rice-based foods by enterocin AS-48.

    Grande, Maria J; Lucas, Rosario; Abriouel, Hikmate; Valdivia, Eva; Omar, Nabil Ben; Maqueda, Mercedes; Martínez-Bueno, Manuel; Martínez-Cañamero, Magdalena; Gálvez, Antonio

    2006-02-01

    The antimicrobial effect of the broad-spectrum bacteriocin enterocin AS-48 against the toxicogenic psychrotrophic strain Bacillus cereus LWL1 has been investigated in a model food system consisting of boiled rice and in a commercial infant rice-based gruel dissolved in whole milk stored at temperatures of 37 degrees C, 15 degrees C and 6 degrees C. In food samples supplemented with enterocin AS-48 (in a concentration range of 20-35 mug/ml), viable cell counts decreased rapidly over incubation time, depending on the bacteriocin concentration, the temperature of incubation and the food sample. Enterotoxin production at 37 degrees C was also inhibited. Heat sensitivity of endospores increased markedly in food samples supplemented with enterocin AS-48: inactivation of endospores was achieved by heating for 1 min at 90 degrees C in boiled rice or at 95 degrees C in rice-based gruel. Activity of enterocin AS-48 in rice gruel was potentiated by sodium lactate in a concentration-dependent way.

  12. Adhesion and removal kinetics of Bacillus cereus biofilms on Ni-PTFE modified stainless steel.

    Huang, Kang; McLandsborough, Lynne A; Goddard, Julie M

    2016-01-01

    Biofilm control remains a challenge to food safety. A well-studied non-fouling coating involves codeposition of polytetrafluoroethylene (PTFE) during electroless plating. This coating has been reported to reduce foulant build-up during pasteurization, but opportunities remain in demonstrating its efficacy in inhibiting biofilm formation. Herein, the initial adhesion, biofilm formation, and removal kinetics of Bacillus cereus on Ni-PTFE-modified stainless steel (SS) are characterized. Coatings lowered the surface energy of SS and reduced biofilm formation by > 2 log CFU cm(-2). Characterization of the kinetics of biofilm removal during cleaning demonstrated improved cleanability on the Ni-PTFE coated steel. There was no evidence of biofilm after cleaning by either solution on the Ni-PTFE coated steel, whereas more than 3 log and 1 log CFU cm(-2) of bacteria remained on the native steel after cleaning with water and an alkaline cleaner, respectively. This work demonstrates the potential application of Ni-PTFE non-fouling coatings on SS to improve food safety by reducing biofilm formation and improving the cleaning efficiency of food processing equipment.

  13. Structural basis of the substrate specificity of Bacillus cereus adenosine phosphorylase

    Dessanti, Paola; Zhang, Yang; Allegrini, Simone; Tozzi, Maria Grazia; Sgarrella, Francesco; Ealick, Steven E. (Cornell); (Sassari); (Pisa)

    2012-10-08

    Purine nucleoside phosphorylases catalyze the phosphorolytic cleavage of the glycosidic bond of purine (2{prime}-deoxy)nucleosides, generating the corresponding free base and (2{prime}-deoxy)ribose 1-phosphate. Two classes of PNPs have been identified: homotrimers specific for 6-oxopurines and homohexamers that accept both 6-oxopurines and 6-aminopurines. Bacillus cereus adenosine phosphorylase (AdoP) is a hexameric PNP; however, it is highly specific for 6-aminopurines. To investigate the structural basis for the unique substrate specificity of AdoP, the active-site mutant D204N was prepared and kinetically characterized and the structures of the wild-type protein and the D204N mutant complexed with adenosine and sulfate or with inosine and sulfate were determined at high resolution (1.2-1.4 {angstrom}). AdoP interacts directly with the preferred substrate through a hydrogen-bond donation from the catalytically important residue Asp204 to N7 of the purine base. Comparison with Escherichia coli PNP revealed a more optimal orientation of Asp204 towards N7 of adenosine and a more closed active site. When inosine is bound, two water molecules are interposed between Asp204 and the N7 and O6 atoms of the nucleoside, thus allowing the enzyme to find alternative but less efficient ways to stabilize the transition state. The mutation of Asp204 to asparagine led to a significant decrease in catalytic efficiency for adenosine without affecting the efficiency of inosine cleavage.

  14. Antioxidant and DNA Damage Protecting Activity of Exopolysaccharides from the Endophytic Bacterium Bacillus cereus SZ1

    Li Ping Zheng

    2016-02-01

    Full Text Available An endophytic bacterium was isolated from the Chinese medicinal plant Artemisia annua L. The phylogenetic and physiological characterization indicated that the isolate, strain SZ-1, was Bacillus cereus. The endophyte could produce an exopolysaccharide (EPS at 46 mg/L. The 1,1-diphenyl-2-picrylhydracyl (DPPH radical scavenging activity of the EPS reached more than 50% at 3–5 mg/mL. The EPS was also effective in scavenging superoxide radical in a concentration dependent fashion with an EC50 value of 2.6 mg/mL. The corresponding EC50 for scavenging hydroxyl radical was 3.1 mg/mL. Moreover, phenanthroline-copper complex-mediated chemiluminescent emission of DNA damage was both inhibited and delayed by EPS. The EPS at 0.7–1.7 mg/mL also protected supercoiled DNA strands in plasmid pBR322 against scission induced by Fenton-mediated hydroxyl radical. The preincubation of PC12 cells with the EPS prior to H2O2 exposure increased the cell survival and glutathione (GSH level and catalase (CAT activities, and decreased the level of malondialdehyde (MDA and lactate dehydrogenase (LDH activity in a dose-dependent manner, suggesting a pronounced protective effect against H2O2-induced cytotoxicity. Our study indicated that the EPS could be useful for preventing oxidative DNA damage and cellular oxidation in pharmaceutical and food industries.

  15. Lineage-specific evolutionary rate in plants: Contributions of a screening for Cereus (Cactaceae)1

    Romeiro-Brito, Monique; Moraes, Evandro M.; Taylor, Nigel P.; Zappi, Daniela C.; Franco, Fernando F.

    2016-01-01

    Premise of the study: Predictable chloroplast DNA (cpDNA) sequences have been listed for the shallowest taxonomic studies in plants. We investigated whether plastid regions that vary between closely allied species could be applied for intraspecific studies and compared the variation of these plastid segments with two nuclear regions. Methods: We screened 16 plastid and two nuclear intronic regions for species of the genus Cereus (Cactaceae) at three hierarchical levels (species from different clades, species of the same clade, and allopatric populations). Results: Ten plastid regions presented interspecific variation, and six of them showed variation at the intraspecific level. The two nuclear regions showed both inter- and intraspecific variation, and in general they showed higher levels of variability in almost all hierarchical levels than the plastid segments. Discussion: Our data suggest no correspondence between variation of plastid regions at the interspecific and intraspecific level, probably due to lineage-specific variation in cpDNA, which appears to have less effect in nuclear data. Despite the heterogeneity in evolutionary rates of cpDNA, we highlight three plastid segments that may be considered in initial screenings in plant phylogeographic studies. PMID:26819857

  16. Lineage-specific evolutionary rate in plants: Contributions of a screening for Cereus (Cactaceae).

    Romeiro-Brito, Monique; Moraes, Evandro M; Taylor, Nigel P; Zappi, Daniela C; Franco, Fernando F

    2016-01-01

    Predictable chloroplast DNA (cpDNA) sequences have been listed for the shallowest taxonomic studies in plants. We investigated whether plastid regions that vary between closely allied species could be applied for intraspecific studies and compared the variation of these plastid segments with two nuclear regions. We screened 16 plastid and two nuclear intronic regions for species of the genus Cereus (Cactaceae) at three hierarchical levels (species from different clades, species of the same clade, and allopatric populations). Ten plastid regions presented interspecific variation, and six of them showed variation at the intraspecific level. The two nuclear regions showed both inter- and intraspecific variation, and in general they showed higher levels of variability in almost all hierarchical levels than the plastid segments. Our data suggest no correspondence between variation of plastid regions at the interspecific and intraspecific level, probably due to lineage-specific variation in cpDNA, which appears to have less effect in nuclear data. Despite the heterogeneity in evolutionary rates of cpDNA, we highlight three plastid segments that may be considered in initial screenings in plant phylogeographic studies.

  17. Ocorrência de Bacillus cereus em leite integral e capacidade enterotoxigênica das cepas isoladas Occurrence of Bacillus cereus in Whole milk and enterotoxigenic potential of the isolated strains

    N.C.M. Rezende-Lago

    2007-12-01

    Full Text Available Pesquisaram-se a presença de Bacillus cereus e a produção de enterotoxinas produzidas por esses microrganismos em 120 amostras de diversos tipos de leite. Bacillus cereus foi isolado e identificado em 22 (73,3%, 15 (50,0%, 29 (96,7% e quatro (13,3% amostras de leite em pó, cru, pasteurizado e UAT (longa vida, respectivamente. Para a detecção de enterotoxinas pela técnica da alça ligada de coelho, foram positivos, respectivamente, três (13,6%, um (7,1% e 10 (35,7% microrganismos isolados das amostras de leite em pó, leite cru e leite pasteurizado. Pelo teste de aumento de permeabilidade vascular, dois (9,1%, um (7,1%, um (3,6% e um (4,0% microrganismos isolados de leite em pó, cru, pasteurizado e UAT apresentaram-se enterotoxigênicos, respectivamente. O uso da técnica de aglutinação passiva em látex demonstrou a produção da toxina diarréica por três (33,3%, sete (63,6%, quatro (30,8% e oito (80,0% microrganismos isolados, respectivamente, de leite em pó, cru, pasteurizado e UAT. Os resultados indicam um risco potencial, podendo colocar em risco a saúde dos consumidores desses produtos.A hundred and twenty samples of different types of milk were examined to the presence of Bacillus cereus and the enterotoxigenic potential of the isolated strains. Bacillus cereus was isolated and identified in 22 (73.0%, 15 (50.0%, 29 (96.7% and four (13.3% samples of powder, raw, pasteurized and UHT milk, respectively. The enterotoxigenicity detection using the rabbit ileal loop assay showed positive, respectively, three (13.6%, one (7.1% and 10 (35.7% isolated strains from powder, raw and pasteurized milk. Using vascular permeability activity assay two (9.1%, one (7.1%, one (3.6% and one (4.0% isolated strains from powder, raw, pasteurized and UHT milk were positive, respectively. The reversed passive latex agglutination test showed diarrheal toxin production by three (33.3%, seven (63.6%, four (30.8% and eight (80.0% strains isolated from

  18. HIDROFOBICIDADE DE RIBOTIPOS DE BACILLUS CEREUS ISOLADOS DE INDÚSTRIA DE LATICÍNIOS

    Emiliane Andrade ARAÚJO

    2010-03-01

    Full Text Available

    A contaminação de superfícies por microrganismos deterioradores e patogênicos é causa de preocupação na indústria de alimentos. Desenvolvimento de biofilmes em ambientes de processamento de alimentos resulta na deterioração do produto e em possíveis riscos para a saúde pública, além de criar sérios problemas nas operações de processamento do fl uido. A adesão da bactéria à superfície é um dos primeiros passos para a formação do biofilme e propriedades físico-químicas da interface bacteriana infl uenciam o processo de adesão microbiana e, consequentemente, os procedimentos operacionais de higienização. A estrutura do biofilme e as características fisiológicas do microrganismo podem conferir resistência aos agentes antimicrobianos, como por exemplo, aos sanitizantes usados no procedimento de higienização. Dentre os fatores que infl uenciam o processo de adesão, as características de hidrofobicidade do microrganismo e da superfície apresentam grande importância nos mecanismos de adesão. As técnicas da medição do ângulo de contato e da coluna de interação hidrofóbica, para determinação da hidrofobicidade de superfícies de ribotipos de Bacillus cereus isolados de indústria de laticínios, foram avaliadas. Observou-se que as quatro superfícies dos ribotipos avaliados apresentaram a mesma classificação quanto à hidrofobicidade tanto pela medida do ângulo de contato com a água quanto pela determinação da energia livre de interação hidrofóbica (ΔGsas TOT. Três ribotipos foram considerados hidrofílicos e um hidrofóbico. Já a técnica da coluna de interação hidrofóbica não mostrou diferença (p>0,05 no percentual de células retidas na coluna, sugerindo que as superfícies dos ribotipos apresentam as mesmas características quanto à hidrofobicidade. Os resultados indicam que a técnica da medição do ângulo de contato é a mais indicada para avaliar a

  19. Gold nanoparticles having dipicolinic acid imprinted nanoshell for Bacillus cereus spores recognition

    Gueltekin, Aytac; Ersoez, Arzu; Huer, Deniz; Sarioezlue, Nalan Yilmaz; Denizli, Adil; Say, Ridvan

    2009-01-01

    Taking into account the recognition element for sensors linked to molecular imprinted polymers (MIPs), a proliferation of interest has been witnessed by those who are interested in this subject. Indeed, MIP nanoparticles are theme which recently has come to light in the literature. In this study, we have proposed a novel thiol ligand-capping method with polymerizable methacryloylamidocysteine (MAC) attached to gold nanoparticles, reminiscent of a self-assembled monolayer. Furthermore, a surface shell by synthetic host polymers based on molecular imprinting method for recognition has been reconstructed. In this method, methacryloyl iminodiacetic acid-chrome (MAIDA-Cr(III)) has been used as a new metal-chelating monomer via metal coordination-chelation interactions and dipicolinic acid (DPA) which is the main participant of Bacillus cereus spores has been used as a template. Nanoshell sensors with templates produce a cavity that is selective for DPA. The DPA can simultaneously chelate to Cr(III) metal ion and fit into the shape-selective cavity. Thus, the interaction between Cr(III) ion and free coordination spheres has an effect on the binding ability of the gold nanoparticles nanosensor. The interactions between DPA and MIP particles were studied observing fluorescence measurements. DPA addition caused significant decreases in fluorescence intensity because they induced photoluminescence emission from Au nanoparticles through the specific binding to the recognition sites of the crosslinked nanoshell polymer matrix. The binding affinity of the DPA imprinted nanoparticles has been explored by using the Langmuir and Scatchard methods and the analysis of the quenching results has been performed in terms of the Stern-Volmer equation.

  20. Uptake and Persistence of Homologous and Heterologous Zooxanthellae in the Temperate Sea Anemone Cereus pedunculatus (Pennant).

    Davy, S K; Lucas, I A N; Turner, J R

    1997-04-01

    The uptake and persistence of symbiotic dinoflagellates (zooxanthellae) were measured in the temperate sea anemone Cereus pedunculatus (Pennant). Aposymbiotic specimens of C. pedunculatus were inoculated with zooxanthellae freshly isolated from a range of temperate and subtropical Anthozoa. Each inoculate consisted of zooxanthellae from a single host species and was either homologous (zooxanthellae from a host of the same species as the one being inoculated) or heterologous (from a host of a different species than the one being inoculated). The densities of zooxanthellae in host tissues were determined at regular intervals. C. pedunculatus took up homologous and heterologous zooxanthellae to similar degrees, except for zooxanthellae from the temperate Anthopleura ballii, which were taken up to a lesser extent. The densities of all zooxanthellae declined between 4 hours and 4 days after uptake, indicating that zooxanthellae were expelled, digested, or both during this period. The densities of all zooxanthellae increased between 2 and 8 weeks after inoculation, indicating zooxanthella growth. Over the entire 8-week period after uptake, densities of homologous zooxanthellae were always greater than those of heterologous zooxanthellae. Between 8 and 36 weeks after infection, densities of homologous zooxanthellae declined markedly and densities of some heterologous zooxanthellae increased further, resulting in homologous and heterologous zooxanthella densities being the same at 36 weeks. These densities were the same as those in naturally infected C. pedunculatus of similar size. The results suggest that zooxanthellae from a range of host species and environments can establish symbioses with C. pedunculatus and that, over long periods under laboratory conditions, heterologous zooxanthellae may populate C. pedunculatus to the same extent as homologous zooxanthellae.

  1. Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

    Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

    2013-01-01

    Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

  2. Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution.

    Tao Zhan

    Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.

  3. Carvacrol suppresses high pressure high temperature inactivation of Bacillus cereus spores.

    Luu-Thi, Hue; Corthouts, Jorinde; Passaris, Ioannis; Grauwet, Tara; Aertsen, Abram; Hendrickx, Marc; Michiels, Chris W

    2015-03-16

    The inactivation of bacterial spores generally proceeds faster and at lower temperatures when heat treatments are conducted under high pressure, and high pressure high temperature (HPHT) processing is, therefore, receiving an increased interest from food processors. However, the mechanisms of spore inactivation by HPHT treatment are poorly understood, particularly at moderately elevated temperature. In the current work, we studied inactivation of the spores of Bacillus cereus F4430/73 by HPHT treatment for 5 min at 600MPa in the temperature range of 50-100°C, using temperature increments of 5°C. Additionally, we investigated the effect of the natural antimicrobial carvacrol on spore germination and inactivation under these conditions. Spore inactivation by HPHT was less than about 1 log unit at 50 to 70°C, but gradually increased at higher temperatures up to about 5 log units at 100°C. DPA release and loss of spore refractility in the spore population were higher at moderate (≤65°C) than at high (≥70°C) treatment temperatures, and we propose that moderate conditions induced the normal physiological pathway of spore germination resulting in fully hydrated spores, while at higher temperatures this pathway was suppressed and replaced by another mechanism of pressure-induced dipicolinic acid (DPA) release that results only in partial spore rehydration, probably because spore cortex hydrolysis is inhibited. Carvacrol strongly suppressed DPA release and spore rehydration during HPHT treatment at ≤65°C and also partly inhibited DPA release at ≥65°C. Concomitantly, HPHT spore inactivation was reduced by carvacrol at 65-90°C but unaffected at 95-100°C. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. SpoVT: From Fine-Tuning Regulator in Bacillus subtilis to Essential Sporulation Protein in Bacillus cereus.

    Eijlander, Robyn T; Holsappel, Siger; de Jong, Anne; Ghosh, Abhinaba; Christie, Graham; Kuipers, Oscar P

    2016-01-01

    Sporulation is a highly sophisticated developmental process adopted by most Bacilli as a survival strategy to withstand extreme conditions that normally do not support microbial growth. A complicated regulatory cascade, divided into various stages and taking place in two different compartments of the cell, involves a number of primary and secondary regulator proteins that drive gene expression directed toward the formation and maturation of an endospore. Such regulator proteins are highly conserved among various spore formers. Despite this conservation, both regulatory and phenotypic differences are observed between different species of spore forming bacteria. In this study, we demonstrate that deletion of the regulatory sporulation protein SpoVT results in a severe sporulation defect in Bacillus cereus , whereas this is not observed in Bacillus subtilis . Although spores are initially formed, the process is stalled at a later stage in development, followed by lysis of the forespore and the mother cell. A transcriptomic investigation of B. cereus Δ spoVT shows upregulation of genes involved in germination, potentially leading to premature lysis of prespores formed. Additionally, extreme variation in the expression of species-specific genes of unknown function was observed. Introduction of the B. subtilis SpoVT protein could partly restore the sporulation defect in the B. cereus spoVT mutant strain. The difference in phenotype is thus more than likely explained by differences in promoter targets rather than differences in mode of action of the conserved SpoVT regulator protein. This study stresses that evolutionary variances in regulon members of sporulation regulators can have profound effects on the spore developmental process and that mere protein homology is not a foolproof predictor of similar phenotypes.

  5. Radiosensibilisation of bacteria on beef minced by essential oils with special reference to the spores of Bacillus cereus ATCC 7004

    Ayari, Samia

    2007-01-01

    The radiosensitization of Bacillus Cereus ATCC 7004 spores was evaluated in the presence of thymol, thyme, D-L menthol, trans-cinnamaldehyde and eugenol in ground beef. Meat cattle minced (5 % fat) was inoculated with spores of Bacillus Cereus (10 5 - 10 6 CFU / g), and each compound was added separately at various concentrations. The antimicrobial potential was evaluated in unirradiated meat by determining the MIC in percentage (wt / wt) after 24 h of storage at 4± 1C. Results showed that the best antimicrobial compound was the trans-cinnamaldehyde with MIC of 1.47%, wt/wt. In presence of cinnamaldehyde, the addition of sodium pyrophosphate decahydrate (0.1%, wt/wt) increased significantly (p < 0.05) the relative sensitivity of Bacillus Cereus spores 2 times. However, the presence of ascorbic acid in the media reduced significantly (p < 0.05) the radiosensitivity of bacteria. The combined effect of gamma irradiation in presence of cinnamaldehyde, added with ascorbic acid or sodium pyrophosphate decahydrate, on the microbiological and physico-chemical characteristic of meat samples was evaluated at 2 kGy under air. The use of the active compounds with the irradiation reduced significantly (p < 0.05) the count of total bacteria with a concomitant effect in the extension periods of shelf life. The addition of the cinnamaldehyde induced a significant reduction (p < 0.05) in TVN and free amino acids of irradiated samples. In presence of ascorbic acid the thiobarbituric acid-reactive substances (TBARS) concentration was significantly reduced (P...0.05). A significant reduction (p < 0.05) of a* and C* of color values and a significant increase (p < 0.05 ) of b* value were obtained for the samples treated by the cinnamaldehyde. The application of bioactive films for the immobilization of the essential oils is a good alternate to check their stability during storage time. (Author). 155 refs

  6. Genome sequence of the pink-pigmented marine bacterium Loktanella hongkongensis type strain (UST950701-009P(T)), a representative of the Roseobacter group.

    Lau, Stanley Ck; Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Petersen, Jörn; Ivanova, Natalia N; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C; Klenk, Hans-Peter; Qian, Pei-Yuan

    2015-01-01

    Loktanella hongkongensis UST950701-009P(T) is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492(T) together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-coding genes and 57 RNA genes. The two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.

  7. A transposon mutant library of Bacillus cereus ATCC 10987 reveals novel genes required for biofilm formation and implicates motility as an important factor for pellicle-biofilm formation

    Okshevsky, Mira Ursula; Louw, Matilde Greve; Otero Lamela, Elena

    2018-01-01

    Bacillus cereus is one of the most common opportunistic pathogens causing foodborne illness, as well as a common source of contamination in the dairy industry. B. cereus can form robust biofilms on food processing surfaces, resulting in food contamination due to shedding of cells and spores. Desp...

  8. Diversidade de fungos endofíticos de mandacaru (Cereus jamacaru DC., Cactaceae) em áreas sucessionais de Caatinga

    BEZERRA, Jadson Diogo Pereira

    2013-01-01

    Fungos endofíticos vivem dentro dos tecidos sadios de plantas e podem promover tolerância das espécies hospedeiras para diferentes estresses ambientais. No entanto, a maioria dos estudos tem sido de plantas em ambientes úmidos e são poucos os relatos dos benefícios de tais associações com plantas de ambientes extremos. O objetivo deste trabalho foi analisar a diversidade de fungos endofíticos de Cereus jamacaru em três diferentes áreas de sucessão ecológica da floresta tropical seca brasileir...

  9. A transposon mutant library of Bacillus cereus ATCC 10987 reveals novel genes required for biofilm formation and implicates motility as an important factor for pellicle-biofilm formation.

    Okshevsky, Mira; Louw, Matilde Greve; Lamela, Elena Otero; Nilsson, Martin; Tolker-Nielsen, Tim; Meyer, Rikke Louise

    2018-04-01

    Bacillus cereus is one of the most common opportunistic pathogens causing foodborne illness, as well as a common source of contamination in the dairy industry. B. cereus can form robust biofilms on food processing surfaces, resulting in food contamination due to shedding of cells and spores. Despite the medical and industrial relevance of this species, the genetic basis of biofilm formation in B. cereus is not well studied. In order to identify genes required for biofilm formation in this bacterium, we created a library of 5000 +  transposon mutants of the biofilm-forming strain B. cereusATCC 10987, using an unbiased mariner transposon approach. The mutant library was screened for the ability to form a pellicle biofilm at the air-media interface, as well as a submerged biofilm at the solid-media interface. A total of 91 genes were identified as essential for biofilm formation. These genes encode functions such as chemotaxis, amino acid metabolism and cellular repair mechanisms, and include numerous genes not previously known to be required for biofilm formation. Although the majority of disrupted genes are not directly responsible for motility, further investigations revealed that the vast majority of the biofilm-deficient mutants were also motility impaired. This observation implicates motility as a pivotal factor in the formation of a biofilm by B. cereus. These results expand our knowledge of the fundamental molecular mechanisms of biofilm formation by B. cereus. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  10. The Exosporium of B.cereus Contains a Binding Site for gC1qR/p33: Implication in Spore Attachment and/or Entry.

    GHEBREHIWET,B.; TANTRAL, L.; TITMUS, M.A.; PANESSA-WARREN, B.J.; TORTORA, G.T.; WONG, S.S.; WARREN, J.B.

    2008-01-01

    B. cereus, is a member of a genus of aerobic, gram-positive, spore-forming rod-like bacilli, which includes the deadly, B. anthracis. Preliminary experiments have shown that gC1qR binds to B.cereus spores that have been attached to microtiter plates. The present studies were therefore undertaken, to examine if cell surface gC1qR plays a role in B.cereus spore attachment and/or entry. Monolayers of human colon carcinoma (Caco-2) and lung cells were grown to confluency on 6 mm coverslips in shell vials with gentle swirling in a shaker incubator. Then, 2 {micro}l of a suspension of strain SB460 B.cereus spores (3x10{sup 8}/ml, in sterile water), were added and incubated (1-4 h; 36{sup 0} C) in the presence or absence of anti-gC1qR mAb-carbon nanoloops. Examination of these cells by EM revealed that: (1) When B. cereus endospores contacted the apical Caco-2 cell surface, or lung cells, gClqR was simultaneously detectable, indicating upregulation of the molecule. (2) In areas showing spore contact with the cell surface, gClqR expression was often adjacent to the spores in association with microvilli (Caco-2 cells) or cytoskeletal projections (lung cells). (3) Furthermore, the exosporia of the activated and germinating spores were often decorated with mAb-nanoloops. These observations were further corroborated by experiments in which B.cereus spores were readily taken up by monocytes and neutrophils, and this uptake was partially inhibited by mAb 60.11, which recognizes the C1q binding site on gC1qR. Taken together, the data suggest a role, for gC1qR at least in the initial stages of spore attachment and/or entry.

  11. The Sequenced Angiosperm Genomes and Genome Databases.

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology.

  12. Genome size analyses of Pucciniales reveal the largest fungal genomes.

    Tavares, Sílvia; Ramos, Ana Paula; Pires, Ana Sofia; Azinheira, Helena G; Caldeirinha, Patrícia; Link, Tobias; Abranches, Rita; Silva, Maria do Céu; Voegele, Ralf T; Loureiro, João; Talhinhas, Pedro

    2014-01-01

    Rust fungi (Basidiomycota, Pucciniales) are biotrophic plant pathogens which exhibit diverse complexities in their life cycles and host ranges. The completion of genome sequencing of a few rust fungi has revealed the occurrence of large genomes. Sequencing efforts for other rust fungi have been hampered by uncertainty concerning their genome sizes. Flow cytometry was recently applied to estimate the genome size of a few rust fungi, and confirmed the occurrence of large genomes in this order (averaging 225.3 Mbp, while the average for Basidiomycota was 49.9 Mbp and was 37.7 Mbp for all fungi). In this work, we have used an innovative and simple approach to simultaneously isolate nuclei from the rust and its host plant in order to estimate the genome size of 30 rust species by flow cytometry. Genome sizes varied over 10-fold, from 70 to 893 Mbp, with an average genome size value of 380.2 Mbp. Compared to the genome sizes of over 1800 fungi, Gymnosporangium confusum possesses the largest fungal genome ever reported (893.2 Mbp). Moreover, even the smallest rust genome determined in this study is larger than the vast majority of fungal genomes (94%). The average genome size of the Pucciniales is now of 305.5 Mbp, while the average Basidiomycota genome size has shifted to 70.4 Mbp and the average for all fungi reached 44.2 Mbp. Despite the fact that no correlation could be drawn between the genome sizes, the phylogenomics or the life cycle of rust fungi, it is interesting to note that rusts with Fabaceae hosts present genomes clearly larger than those with Poaceae hosts. Although this study comprises only a small fraction of the more than 7000 rust species described, it seems already evident that the Pucciniales represent a group where genome size expansion could be a common characteristic. This is in sharp contrast to sister taxa, placing this order in a relevant position in fungal genomics research.

  13. Effect of iodoacetic acid on 59Fe uptake and aconitase aivity during sporulation of Bacillus cereus T

    Twari, B.K.; Sharma, D.

    1975-01-01

    Iodoacetic acid (IAA), a well known inhibitor of glycolysis, inhibited sporulation of B. cereus T when added to the culture just prior to the transition stage at 2-2.5 hr. In the inhibited culture, no considerable aconitase activity and 59 Fe uptake were observed. Time studies with IAA in modified G-medium had shown that whenever it was added it prevented further glycolysis of glucose. Addition of IAA at zero hr had no effect on aconitase activity and 59 Fe uptake whether glucose was present or absent from the medium. IAA added at rising pH at 3 hr. i.e. after transition period had no effect on the pH characteristics and sporulation of the organism. IAA seems to inhibit the induction of metal transport system. There exists a considerable correlation between aconitase activity and 59 Fe uptake during growth and sporulation of B. cereus T in modified G-medium in the presence and absence of glucose. (author)

  14. Influence of food matrix on inactivation of Bacillus cereus by combinations of nisin, pulsed electric field treatment, and carvacrol.

    Pol, I E; Mastwujk, H C; Slump, R A; Popa, M E; Smid, E J

    2001-07-01

    Carvacrol was used as a third preservative factor to enhance further the synergy between nisin and pulsed electric field (PEF) treatment against vegetative cells of Bacillus cereus. When applied simultaneously with nisin (0.04 microg/ml), carvacrol (0.5 mM) enhanced the synergy found between nisin and PEF treatment (16.7 kV/cm, 30 pulses) in potassium-N-2-hydroxyethylpiperazine-N-ethanesulfonic acid (HEPES) buffer. The influence of food ingredients on bactericidal activity was tested using skimmed milk that was diluted to 20% with sterile demineralized water. The efficacy of PEF treatment was not affected by the presence of proteins, and results found in HEPES buffer correlated well with results in milk (20%). Nisin showed less activity against B. cereus in milk. Carvacrol was not able to enhance the synergy between nisin and PEF treatment in milk, unless used in high concentrations (1.2 mM). This concentration in itself did not influence the viable count. Carvacrol did act synergistically with PEF treatment in milk, however not in HEPES buffer. This synergy was not influenced by proteins in milk, as 5% milk still allows synergy between carvacrol and PEF treatment to the same extent as 20% milk.

  15. ANTIBACTERIAL EFFECT OF GARLIC (ALLIUM SATIVUM AND GINGER (ZINGIBER OFFICINALE AGAINST STAPHYLOCOCCUS AUREUS, SALMONELLA TYPHI, ESCHERICHIA COLI AND BACILLUS CEREUS

    Bandna Chand

    2013-02-01

    Full Text Available Antibacterial activity of extracts of Allium sativum (garlic and Zingiber officinale (ginger has been evaluated against four different bacteria namely Escherichia coli, Salmonella Typhi, Staphylococcus aureus and Bacillus cereus. Two methods were used to determine the antimicrobial activity of garlic and ginger extracts namely disk diffusion method and agar well diffusion method. Garlic extract exhibited excellent antibacterial activity against all four test organisms while ginger extract showed antibacterial activity against Bacillus cereus and Staphylococcus aureus only. In addition, agar well diffusion method showed higher zone in inhibition when compared with the zone of inhibition produced by the spice of same concentration against the test microorganism by disk diffusion method. Antibiotic sensitivity of the four different bacteria was tested with commercially available antibiotics namely Ciprofloxacin; Oxytetracycline; Vancomycin; Streptomycin; Gentamicin; Tetracycline; Novobiocin; Amikacin and Penicillin G. Penicillin G produced the highest zone of inhibition of 40.00±0.00against Staphylococcus aureus and the lowest zone of inhibition of 0.00±0.00against Escherichia coli.

  16. Use of Frequency Distribution Functions to Establish Safe Conditions in Relation to the Foodborne Pathogen Bacillus cereus

    Begoña Delgado

    2005-01-01

    Full Text Available Minimal processing implementation greatly depends on a detailed knowledge of the effects of preservation factors and their combinations on the spoilage and foodborne pathogenic microorganisms. The effectiveness of mild preservation conditions will become increasingly dependent on a more stochastic approach linking microbial physiological factors with product preservation factors. In this study, the validity of frequency distributions to efficiently describe the inactivation and growth of Bacillus cereus in the presence of natural antimicrobials (essential oils has been studied. For this purpose, vegetative cells were exposed to 0.6 mM of thymol or cymene, obtaining survival curves that were best described by the distribution of Weibull, since a tailing effect was observed. B. cereus was also exposed in a growth medium to a low concentration (0.1 mM of both antimicrobials, separately or combined, and the lag times obtained were fitted to a normal distribution, which allowed a description of dispersion of the start of growth. This allowed a more efficient evaluation of the experimental data to establish safe processing conditions according to accurate parameters and their implementation in risk assessment.

  17. Musa sebagai Model Genom

    RITA MEGIA

    2005-12-01

    Full Text Available During the meeting in Arlington, USA in 2001, the scientists grouped in PROMUSA agreed with the launching of the Global Musa Genomics Consortium. The Consortium aims to apply genomics technologies to the improvement of this important crop. These genome projects put banana as the third model species after Arabidopsis and rice that will be analyzed and sequenced. Comparing to Arabidopsis and rice, banana genome provides a unique and powerful insight into structural and in functional genomics that could not be found in those two species. This paper discussed these subjects-including the importance of banana as the fourth main food in the world, the evolution and biodiversity of this genetic resource and its parasite.

  18. Single-Cell Genome and Group-Specific dsrAB Sequencing Implicate Marine Members of the Class Dehalococcoidia (Phylum Chloroflexi) in Sulfur Cycling

    Wasmund, Kenneth; Cooper, Myriel; Schreiber, Lars

    2016-01-01

    The marine subsurface sediment biosphere is widely inhabited by bacteria affiliated with the class Dehalococcoidia (DEH), phylum Chloroflexi, and yet little is known regarding their metabolisms. In this report, genomic content from a single DEH cell (DEH-C11) with a 16S rRNA gene that was affilia......The marine subsurface sediment biosphere is widely inhabited by bacteria affiliated with the class Dehalococcoidia (DEH), phylum Chloroflexi, and yet little is known regarding their metabolisms. In this report, genomic content from a single DEH cell (DEH-C11) with a 16S rRNA gene...... that was affiliated with a diverse cluster of 16S rRNA gene sequences prevalent in marine sediments was obtained from sediments of Aarhus Bay, Denmark. The distinctive gene content of this cell suggests metabolic characteristics that differ from those of known DEH and Chloroflexi. The presence of genes encoding...... dissimilatory sulfite reductase (Dsr) suggests that DEH could respire oxidized sulfur compounds, although Chloroflexi have never been implicated in this mode of sulfur cycling. Using long-range PCR assays targeting DEH dsr loci, dsrAB genes were amplified and sequenced from various marine sediments. Many...

  19. BLAST screening of chlamydial genomes to identify signature proteins that are unique for the Chlamydiales, Chlamydiaceae, Chlamydophila and Chlamydia groups of species

    Gupta Radhey S

    2006-01-01

    Full Text Available Abstract Background Chlamydiae species are of much importance from a clinical viewpoint. Their diversity both in terms of their numbers as well as clinical involvement are presently believed to be significantly underestimated. The obligate intracellular nature of chlamydiae has also limited their genetic and biochemical studies. Thus, it is of importance to develop additional means for their identification and characterization. Results We have carried out analyses of available chlamydiae genomes to identify sets of unique proteins that are either specific for all Chlamydiales genomes, or different Chlamydiaceae family members, or members of the Chlamydia and Chlamydophila genera, or those unique to Protochlamydia amoebophila, but which are not found in any other bacteria. In total, 59 Chlamydiales-specific proteins, 79 Chlamydiaceae-specific proteins, 20 proteins each that are specific for both Chlamydia and Chlamydophila and 445 ORFs that are Protochlamydia-specific were identified. Additionally, 33 cases of possible gene loss or lateral gene transfer were also detected. Conclusion The identified chlamydiae-lineage specific proteins, many of which are highly conserved, provide novel biomarkers that should prove of much value in the diagnosis of these bacteria and in exploration of their prevalence and diversity. These conserved protein sequences (CPSs also provide novel therapeutic targets for drugs that are specific for these bacteria. Lastly, functional studies on these chlamydiae or chlamydiae subgroup-specific proteins should lead to important insights into lineage-specific adaptations with regards to development, infectivity and pathogenicity.

  20. Extreme genomes

    DeLong, Edward F

    2000-01-01

    The complete genome sequence of Thermoplasma acidophilum, an acid- and heat-loving archaeon, has recently been reported. Comparative genomic analysis of this 'extremophile' is providing new insights into the metabolic machinery, ecology and evolution of thermophilic archaea.

  1. Grass genomes

    Bennetzen, Jeffrey L.; SanMiguel, Phillip; Chen, Mingsheng; Tikhonov, Alexander; Francki, Michael; Avramova, Zoya

    1998-01-01

    For the most part, studies of grass genome structure have been limited to the generation of whole-genome genetic maps or the fine structure and sequence analysis of single genes or gene clusters. We have investigated large contiguous segments of the genomes of maize, sorghum, and rice, primarily focusing on intergenic spaces. Our data indicate that much (>50%) of the maize genome is composed of interspersed repetitive DNAs, primarily nested retrotransposons that in...

  2. Cancer genomics

    Norrild, Bodil; Guldberg, Per; Ralfkiær, Elisabeth Methner

    2007-01-01

    Almost all cells in the human body contain a complete copy of the genome with an estimated number of 25,000 genes. The sequences of these genes make up about three percent of the genome and comprise the inherited set of genetic information. The genome also contains information that determines whe...

  3. De-mercurization of wastewater by Bacillus cereus (JUBT1): Growth kinetics, biofilm reactor study and field emission scanning electron microscopic analysis

    Ghoshal, Sanjukta; Bhattacharya, Pinaki; Chowdhury, Ranjana

    2011-01-01

    Graphical abstract: The assembly of biofilm reactor, based on attached growth of Bacillus cereus (JUBT1) on rice husk packing, and an activated carbon filter has been able to ensure the removal of mercury up to near-zero level. Highlights: → A new mercury resistant bacterial strain, Bacillus cereus (JUBT1), has been isolated. → Growth kinetics has been determined. → Biofilm reactor using attached growth of bacteria ensures near-zero level of mercury. → Confinement of mercury is confirmed through energy dispersive spectrometric analysis. - Abstract: Removal of mercuric ions by a mercury resistant bacteria, called Bacillus cereus (JUBT1), isolated from the sludge of a local chlor-alkali industry, has been investigated. Growth kinetics of the bacteria have been determined. A multiplicative, non-competitive relationship between sucrose and mercury ions has been observed with respect to bacterial growth. A combination of biofilm reactor, using attached growth of Bacillus cereus (JUBT1) on rice husk packing, and an activated carbon filter has been able to ensure the removal of mercury up to near-zero level. Energy dispersive spectrometry analysis of biofilm and the activated carbon has proved the transformation of Hg 2+ to Hg 0 and its confinement in the system.

  4. Effect of low-dose irradiation on growth of and toxin production by Staphylococcus aureus and Bacillus cereus in roast beef and gravy.

    Grant, I R; Nixon, C R; Patterson, M F

    1993-03-01

    The effect of irradiation (2 kGy) on growth of and toxin production by Staphylococcus aureus and Bacillus cereus in roast beef and gravy during storage at abuse temperatures (15 and 22 degrees C) was assessed by inoculation studies. Irradiation resulted in a 3-4 log10 reduction in numbers of both pathogens. Whenever B. cereus and S. aureus numbers reached 10(6) and 10(7) cfu/g, respectively, during storage their toxins were detectable. As the time taken to attain these levels was longer in irradiated than in unirradiated samples, toxin production by both pathogens was delayed by irradiation. When samples initially containing low levels (10(2)/g) of S. aureus were irradiated no toxin was produced during subsequent storage at 15 or 22 degrees C. Diarrhoeal toxin produced by B. cereus was detected after 2 days at 22 degrees C, but not at 15 degrees C, in samples containing 10(2) cells/g prior to irradiation. When higher numbers (10(6)/g) of either pathogen were present prior to irradiation, toxins were produced by both pathogens at 22 degrees C, but not at 15 degrees C. Microbial competition had an effect on the growth of B. cereus and S. aureus after irradiation when a low initial inoculum was applied. However, when a higher inoculum was used the pathogens outnumbered their competitors and competition effects were less important. It was concluded that low-dose irradiation would improve the microbiological safety of roast beef and gravy.

  5. Influence of Cooling Rate on Growth of Bacillus cereus from Spore Inocula in Cooked Rice, Beans, Pasta, and Combination Products Containing Meat or Poultry.

    Juneja, Vijay K; Mohr, Tim B; Silverman, Meryl; Snyder, O Peter

    2018-02-23

    The objective of this study was to assess the ability of Bacillus cereus spores to germinate and grow in order to determine a safe cooling rate for cooked rice, beans, and pasta, rice-chicken (4:1), rice-chicken-vegetables (3:1:1), rice-beef (4:1), and rice-beef-vegetables (3:1:1). Samples were inoculated with a cocktail of four strains of heat-shocked (80°C for 10 min) B. cereus spores (NCTC 11143, 935A/74, Brad 1, and Mac 1) to obtain a final spore concentration of approximately 2 log CFU/g. Thereafter, samples were exponentially cooled through the temperature range of 54.5 to 7.2°C in 6, 9, 12, 15, 18, and 21 h. At the end of the cooling period, samples were removed and plated on mannitol egg yolk polymyxin agar. The plates were incubated at 30°C for 24 h. The net B. cereus growth from spores in beans was beans, pasta, rice-chicken, rice-chicken-vegetables, rice-beef, and rice-beef-vegetables to guard against the hazards associated with B. cereus.

  6. Enhanced Agarose and Xylan Degradation for Production of Polyhydroxyalkanoates by Co-Culture of Marine Bacterium, Saccharophagus degradans and Its Contaminant, Bacillus cereus

    Shailesh S. Sawant

    2017-02-01

    Full Text Available Over reliance on energy or petroleum products has raised concerns both in regards to the depletion of their associated natural resources as well as their increasing costs. Bioplastics derived from microbes are emerging as promising alternatives to fossil fuel derived petroleum plastics. The development of a simple and eco-friendly strategy for bioplastic production with high productivity and yield, which is produced in a cost effective manner utilising abundantly available renewable carbon sources, would have the potential to result in an inexhaustible global energy source. Here we report the biosynthesis of bioplastic polyhydroxyalkanoates (PHAs in pure cultures of marine bacterium, Saccharophagus degradans 2-40 (Sde 2-40, its contaminant, Bacillus cereus, and a co-culture of these bacteria (Sde 2-40 and B. cereus degrading plant and algae derived complex polysaccharides. Sde 2-40 degraded the complex polysaccharides agarose and xylan as sole carbon sources for biosynthesis of PHAs. The ability of Sde 2-40 to degrade agarose increased after co-culturing with B. cereus. The association of Sde 2-40 with B. cereus resulted in increased cell growth and higher PHA production (34.5% of dry cell weight from xylan as a carbon source in comparison to Sde 2-40 alone (22.7% of dry cell weight. The present study offers an innovative prototype for production of PHA through consolidated bioprocessing of complex carbon sources by pure and co-culture of microorganisms.

  7. Influence of cooling rate on growth of Bacillus cereus from spore inocula in cooked rice, beans, pasta, and combination products containing meat or poultry

    The objective of this study was to assess the ability of B. cereus spores to germinate and grow in order to determine a safe cooling rate for cooked rice, beans, and pasta, rice/chicken (4:1), rice/chicken/vegetables (3:1:1), rice/beef (4:1), and rice/beef/vegetables (3:1:1). Samples were inoculate...

  8. Inactivation kinetics of spores of Bacillus cereus strains treated by a peracetic acid-based disinfectant at different concentrations and temperatures.

    Sudhaus, Nadine; Pina-Pérez, Maria Consuelo; Martínez, Antonio; Klein, Günter

    2012-05-01

    The purpose of this study was to assess the effect of a commercial peracetic acid-based disinfectant against spores of Bacillus cereus, to identify the most influential factor for the final number of microorganisms after different disinfection procedures, and to evaluate the nature of the inactivation kinetics. The spores of four different strains of B. cereus (DSM 318, 4312, 4313, and 4384) were treated with five different disinfectant concentrations (0.25%, 0.5%, 1.0%, 1.5%, and 2.0% [w/v]) at three different temperatures (10°C, 15°C, and 20°C) with or without protein load. A higher temperature and PES 15/23 concentration resulted in a higher inactivation. Inactivation of B. cereus strain 4312 was around 2 log₁₀ cycles at 10°C and around 7 log₁₀ at 20°C (conc=1% [w/v] PAA; t=60 min; without protein). The protein load at higher concentrations did not significantly reduce the efficacy of the disinfectant (p>0.05). This article indicates the applicability of the Weibull model to fit the B. cereus disinfectant survival curves. A Monte Carlo simulation was used to carry out a sensitivity analysis, which revealed the most influential factors affecting the final number of microorganisms after the disinfection process.

  9. Fate and effect of ingested Bacillus cereus spores and vegetative cells in the intestinal tract of human-flora-associated rats

    Wilcks, Andrea; Hansen, Bjarne Munk; Hendriksen, Niels Bohse

    2006-01-01

    The fate and effect of Bacillus cereus F4433/73R in the intestine of human-flora-associated rats was studied using bacteriological culturing techniques and PCR-denaturing gradient gel electrophoresis in combination with cell assays and immunoassays for detection of enterotoxins. In faecal samples...

  10. Characterization of Enterotoxigenic Bacillus cereus sensu lato and Staphylococcus aureus Isolates and Associated Enterotoxin Production Dynamics in Milk or Meat-Based Broth.

    Walker-York-Moore, Laura; Moore, Sean C; Fox, Edward M

    2017-07-15

    Bacillus cereus sensu lato species, as well as Staphylococcus aureus , are important pathogenic bacteria which can cause foodborne illness through the production of enterotoxins. This study characterised enterotoxin genes of these species and examined growth and enterotoxin production dynamics of isolates when grown in milk or meat-based broth. All B. cereus s. l. isolates harboured nheA , hblA and entFM toxin genes, with lower prevalence of bceT and hlyII . When grown at 16 °C, toxin production by individual B. cereus s. l. isolates varied depending on the food matrix; toxin was detected at cell densities below 5 log 10 (CFU/mL). At 16 °C no staphylococcal enterotoxin C (SEC) production was detected by S. aureus isolates, although low levels of SED production was noted. At 30 °C all S. aureus isolates produced detectable enterotoxin in the simulated meat matrix, whereas SEC production was significantly reduced in milk. Relative to B. cereus s. l. toxin production, S. aureus typically required reaching higher cell numbers to produce detectable levels of enterotoxin. Phylogenetic analysis of the sec and sel genes suggested population evolution which correlated with animal host adaptation, with subgroups of bovine isolates or caprine/ovine isolates noted, which were distinct from human isolates. Taken together, this study highlights the marked differences in the production of enterotoxins both associated with different growth matrices themselves, but also in the behaviour of individual strains when exposed to different food matrices.

  11. Control of bacillus cereus spore germination and outgrowth in cooked rice during chilling by nonorganic and organic appled, orange, and potato peel powders

    The inhibition of Bacillus cereus spore germination and outgrowth in cooked rice by nine fruit and vegetable peel powders prepared from store-bought conventional (nonorganic) and organic apples, oranges, and potatoes was investigated. The powders were mixed into rice at 10% (wt/wt) along with heat ...

  12. Genomic taxonomy of vibrios

    Iida Tetsuya

    2009-10-01

    Full Text Available Abstract Background Vibrio taxonomy has been based on a polyphasic approach. In this study, we retrieve useful taxonomic information (i.e. data that can be used to distinguish different taxonomic levels, such as species and genera from 32 genome sequences of different vibrio species. We use a variety of tools to explore the taxonomic relationship between the sequenced genomes, including Multilocus Sequence Analysis (MLSA, supertrees, Average Amino Acid Identity (AAI, genomic signatures, and Genome BLAST atlases. Our aim is to analyse the usefulness of these tools for species identification in vibrios. Results We have generated four new genome sequences of three Vibrio species, i.e., V. alginolyticus 40B, V. harveyi-like 1DA3, and V. mimicus strains VM573 and VM603, and present a broad analyses of these genomes along with other sequenced Vibrio species. The genome atlas and pangenome plots provide a tantalizing image of the genomic differences that occur between closely related sister species, e.g. V. cholerae and V. mimicus. The vibrio pangenome contains around 26504 genes. The V. cholerae core genome and pangenome consist of 1520 and 6923 genes, respectively. Pangenomes might allow different strains of V. cholerae to occupy different niches. MLSA and supertree analyses resulted in a similar phylogenetic picture, with a clear distinction of four groups (Vibrio core group, V. cholerae-V. mimicus, Aliivibrio spp., and Photobacterium spp.. A Vibrio species is defined as a group of strains that share > 95% DNA identity in MLSA and supertree analysis, > 96% AAI, ≤ 10 genome signature dissimilarity, and > 61% proteome identity. Strains of the same species and species of the same genus will form monophyletic groups on the basis of MLSA and supertree. Conclusion The combination of different analytical and bioinformatics tools will enable the most accurate species identification through genomic computational analysis. This endeavour will culminate in

  13. High-level expression and characterization of two chitinases, ChiCH and ChiCW, of Bacillus cereus 28-9 in Escherichia coli

    Huang, C.-J.; Chen, C.-Y.

    2005-01-01

    Many chitinase genes have been cloned and sequenced from prokaryotes and eukaryotes but overexpression of chitinases in Escherichia coli cells was less reported. ChiCH and ChiCW of Bacillus cereus 28-9 belong to two distinct groups based on their amino acid sequences of catalytic domains, and in addition, domain structures of two enzymes are different. In this study, we established an ideal method for high-level expression of chitinases in E. coli as glutathione-S-transferase fusion proteins using pGEX-6P-1 vector. Both ChiCH and ChiCW were successfully highly expressed in E. coli cells as soluble GST-chitinase fusion proteins, and recombinant native ChiCH and ChiCW could be purified after cleavage with PreScission protease to remove GST tag. Purified chitinases were used for biochemical characterization of kinetics, hydrolysis products, and binding activities. The results indicate that ChiCW is an endo-chitinase and effectively hydrolyzes chitin and chito-multimers to chito-oligomers and the end product chitobiose, and ChiCH is an exo-chitinase and degrades chito-oligomers to produce chitobiose. Furthermore, due to higher affinity of ChiCW toward colloidal chitin than Avicel, C-terminal domain of ChiCW should be classified as a chitin-binding domain not a cellulose-binding domain although that was revealed as a cellulose-binding domain by conserved domain analysis. Therefore, the method of high-level expression of chitinases is helpful to studies and applications of chitinases

  14. Presensitization of microorganisms by essential oils treatments to low dose gamma irradiation with special reference to Bacillus cereus ATCC 7004

    Ayari, Samia; Jerbi, Taieb; Hamdi, M.; Lacroix, M.

    2008-01-01

    The radiosensitization of B.cereus ATCC 7004 spores was evaluated in the presence of thymol, thyme, D-L menthol, trans-cinnamaldehyde and eugenol in ground beef. Cattle minced meat (5% fat) was inoculated with spores of B.cereus (10 5 - 10 6 CFU/g), and each compound was added separately at various concentrations. The antimicrobial potential was evaluated in unirradiated meat by determining the MIC in percentage (wt/wt) after 24 h of storage at 4 ± 1 C. Results showed that the best antimicrobial compound was the trans-cinnamaldehyde with MIC of 1.47%, wt/wt. In presence of cinnamaldehyde, the addition of sodium pyrophosphate decahydrate (0.1% wt/wt) increased significantly (P < 0.05) the relative sensitivity of B.cereus spores 2 times. However, the presence of ascorbic acid in the media reduced significantly (p<0.05) the radiosensitivity of bacteria. The combined effect of gamma irradiation in presence of cinnamaldehyde, added with ascorbic acid or sodium pyrophosphate decahydrate, on the microbiological and physicochemical characteristic of meat samples was evaluated at 2kGy under air. The use of the active compounds with the irradiation reduced significantly (p<0.05) the count of total bacteria with a concomitant effect in the extension periods of shelf life. The addition of the cinnamaldehyde induced a significant reduction (p<0.05) in TVN and free amino acids of irradiated samples. In presence of ascorbic acid the thiobarbituric acid-reactive amino acids of irradiated samples. In presence of ascorbic acid the thiobarbiturate acid-reactive substances (TBARS) concentration was significantly reduced (p<0.05). A significant reduction (p<0.05) of a* and c* of color values and a significant increase (p<0.05) of b* value were obtained for the samples treated by the cinnamaldehyde. The application of bioactive films for the immobilization of the essential oils is a good alternate to check their stability during storage time

  15. PENGARUH UMPAN TAMBAHAN PADA AKUMULASI POLIHIDROKSIBUTIRAT (PHB OLEH Bacillus cereus IFO 13690 MENGGUNAKAN SUBSTRAT TAPIOKA The Effects of Feeding on Accumulation of Polyhydroxybutyrate (PHB from Tapioca by Bacillus cereus IFO 13690

    Margono Margono

    2012-05-01

    Full Text Available Bacillus cereus IFO 13690 is Gram positive bacteria that produces polyhydroxybutyrate (PHB. It has amylolytic characteristic that can be cultured using cassava starch. This research reported the ability of B. cereus IFO 13690 on accumulating PHB and the effects of starch and ammonium feeding on cell and PHB productivity. Batch process was conducted with initial starch of 18 g/l, medium pH of 5.6 and medium temperature of 30 oC. Fed batch process was conducted in the same conditions of the optimum batch process with feeding of 2.1 l/hat 7th ­7.65thhours of exponential growth and 1.86 l/hat 10th­10.8thhours of exponential growth. The feeding compositions were starch of 70 g/l and am­ monium sulfate of 20 g/l. The results of batch process showed that the highest accumulation of PHB was achieved with initial ammonium of 1.20 g/l and dissolved oxygen of 5 % air saturation. The highest PHB accumulation of 0.13 g/l was achieved after 29 hours of fermentation. It was similar to 0.005 g/l.h productivity and the PHB content was 2.42%. The productivity of cell and PHB in fed batch process was double compared to the batch process, i.e. 0.39 g/l.h and0.01 g/l.h, respectively. The PHB content in cell dry weight was relatively higher in the fed batch compared to batch process, i.e. 2.50 %. ABSTRAK Bacillus cereus IFO 13690 adalah bakteri Gram positif penghasil polihidroksibutirat(PHB yang bersifat amilolitik sehingga dapat dikulturkan dalam substrat pati. Penelitian ini dimaksudkan untuk melaporkan kemampuan B. cereus IFO 13690 dalam mengakumulasi PHB pada proses batch dan pengaruh penambahan pati serta amonium terhadap produktivitas sel dan PHB pada proses fed batch. Percobaan proses batch dilaksanakan pada konsentrasi pati awal 18 g/l, pH medium 5,6 dan suhu medium 30 oC. Percobaan proses fedbatch dilaksanakan seperti pada proses batch opti­ mum kemudian ditambahkan medium umpan pada saat pertumbuhan eksponensial, yaitu 2,1 l/jam pada saat pertum­ buhan

  16. Tetracycline and oxytetracycline resistance determinants detected in Bacillus cereus strains isolated from honey samples Detección de determinantes de resistencia a tetraciclina y oxitetraciclina en cepas de Bacillus cereus aisladas de muestras de miel

    A. C. López

    2008-12-01

    Full Text Available The aim of this study was to investigate the presence of tetracycline and oxytetracycline resistance determinants in Bacillus cereus strains isolated from honey samples. Of a total of 77 isolates analyzed, 30 (39% exhibited resistance to tetracyclines according to the results of a disk diffusion method. Resistant strains (n=30 were screened by PCR for the presence of the resistant determinants tetK, tetL, tetM, tetO, tetW, otrA and otrB and their MIC values for tetracycline, oxytetracycline and minocycline were assessed. According to the PCR results, 23 isolates (77% presented at least one tetracycline or oxytetracycline resistance determinant. The tetK genotype was present in 10 isolates while the tetL, tetM, and otrA genotypes were present in 3, 2, and 5 isolates, respectively. In addition, 2 isolates of the tetK plus tetM genotype, 1 of the tetK plus tetL genotype, and 1 of the tetK plus otrA genotype were found. All isolates were tetW, tetO and otrB negatives. On the other hand, 7 isolates (23% showed a tetracycline-resistant and/or minocyclineresistant phenotype (MIC but did not carry any of the tet or otr determinants investigated in this study. This research has shown that B. cereus isolates from honey samples contain a variety of tetracycline and oxytetracycline resistance genes, including the tetK and tetL determinants which encode for efflux proteins, and tetM and otrA, which encode for ribosomal protection proteins. These findings indicate that strains isolated from honeys could represent a reservoir for tetracycline resistance genes. To our knowledge, this is the first report of tetracycline-resistant and oxytetracyclineresistant B. cereus strains carrying the tetK determinant, and also the first report of oxytetracycline-resistant and tetracycline- resistant Bacillus species carrying the otrA determinant.El objetivo del presente estudio ha sido investigar la presencia de diversos determinantes de resistencia a tetraciclina y

  17. Substrate binding and catalytic mechanism in phospholipase C from Bacillus cereus. a molecular mechanics and molecular dynamics study

    da Graça Thrige, D; Buur, J R; Jørgensen, Flemming Steen

    1997-01-01

    cereus including a docked substrate molecule was subjected to a stepwise molecular mechanics energy minimization. Second, the location of the nucleophilic water molecule in the active site of the fully relaxed enzyme-substrate complex was determined by evaluation of nonbonded interaction energies between...... water molecule was verified during a 100 ps molecular dynamics simulation. During the simulation the substrate undergoes a conformational change, but retains its localization in the active site. The contacts between the enzyme, the substrate, and the nucleophilic water molecule display some fluctuations...... the strong electrostatic interactions in the active site realistically during energy minimization, delocalization of the charges from the three zinc ions was considered. Therefore, quantum mechanics calculations on the zinc ions and the zinc-coordinating residues were carried out prior to the molecular...

  18. A strain-variable bacteriocin in Bacillus anthracis and Bacillus cereus with repeated Cys-Xaa-Xaa motifs

    Haft Daniel H

    2009-04-01

    Full Text Available Abstract Bacteriocins are peptide antibiotics from ribosomally translated precursors, produced by bacteria often through extensive post-translational modification. Minimal sequence conservation, short gene lengths, and low complexity sequence can hinder bacteriocin identification, even during gene calling, so they are often discovered by proximity to accessory genes encoding maturation, immunity, and export functions. This work reports a new subfamily of putative thiazole-containing heterocyclic bacteriocins. It appears universal in all strains of Bacillus anthracis and B. cereus, but has gone unrecognized because it is always encoded far from its maturation protein operon. Patterns of insertions and deletions among twenty-four variants suggest a repeating functional unit of Cys-Xaa-Xaa. Reviewers This article was reviewed by Andrei Osterman and Lakshminarayan Iyer.

  19. Changes in ultraviolet resistance and photoproduct formation as early events in spore germination of Bacillus cereus T

    Irie, R.

    1978-01-01

    In order to determine the timing of the change in the state of DNA in bacterial spores during the course of germination, L-alanine-induced germination of Bacillus cereus spores was interrupted by 0.3M CaCl 2 as an inhibitor, and the resulting semi-refractive spores (spores at the end of the first phase of germination) were examined for UV-resistance and photoproduct formation. Upon UV-irradiation, these spores, still having a semi-refractile core as observed under a phase-contrast microscope, gave rise to mainly the cyclobutane-type thymine dimer. It was concluded that change in the stats of the spore DNA occurs early in the process of germination, i.e. before the refractility of the core is lost. It was also found that CaCl 2 markedly prolonged the duration of the transient UV-resistant stage. (author)

  20. Optimization of fermentation conditions for green pigment production from Bacillus cereus M¹ 16 (MTCC 5521) and its pharmacological application.

    Banerjee, D; Mondal, A; Gupta, M; Guha, A K; Ray, L

    2014-01-01

    Optimal culture conditions for the production of green pigment was investigated. The optimal culture condition for the production of an extracellular green pigment by growing Bacillus cereus M(1) 16 (MTCC 5521) in a complex medium containing (g l(-1) ) Peptone-4.0, Beef Extract-9.0, NaCl-7.0, MgSO4 .7H2 O-1.0 and KH2 PO4 -5.0 was as follows pH-7.0 at 30°C for 72 h in a 5 l fermenter. Aeration rate and agitator speed had no effect on the pigment production. Thin layer chromatogram of the pigment extracted from the fermented broth with chloroform on silica gel GF254 using ethyl acetate and hexane (1 : 1) as solvent showed three fractions. The major fraction (C3 ) was separated out and identified as 9-methyl-1, 4, 5, 8-tetra-azaphenanthrene. Acute toxicity test revealed the nontoxic nature upto a dose of 2000 mg kg(-1) , b.wt., of mice. MTT assay showed the cytotoxic nature in HL60 cells having an IC50 of 2.47 mmol. So, this biopigment may have application in food, textile colorant and pharmaceutical industry. This study demonstrated the optimum production of a biopigment (9-methyl-1, 4, 5, 8-tetra-azaphenanthrene) by fermentation of a complex medium with Bacillus cereus M(1) 16 (MTCC 5521) in submerged fermentation. This is the first investigation of toxicity and cytotoxicity activities of this biopigment. The study showed that the purified pigment had no toxicity to healthy albino mice but a high cytotoxicity activity in HL60 cancer cell line in vitro. The biopigment had further displayed dyeing capability to both solidified agar and cotton cloth. Therefore, it may represent a nontoxic and natural alternative to chemical dyes and pigments. © 2013 The Society for Applied Microbiology.

  1. Cytotoxic Potential of Bacillus cereus Strains ATCC 11778 and 14579 Against Human Lung Epithelial Cells Under Microaerobic Growth Conditions

    Kathleen eKilcullen

    2016-02-01

    Full Text Available Bacillus cereus, a food poisoning bacterium closely related to Bacillus anthracis, secretes a multitude of virulence factors including enterotoxins, hemolysins, and phospholipases. However, the majority of the in vitro experiments evaluating the cytotoxic potential of B. cereus were carried out in the conditions of aeration, and the impact of the oxygen limitation in conditions encountered by the microbe in natural environment such as gastrointestinal tract remains poorly understood. This research reports comparative analysis of ATCC strains 11778 (BC1 and 14579 (BC2 in aerated and microaerobic (static cultures with regard to their toxicity for human lung epithelial cells. We showed that BC1 increased its toxicity upon oxygen limitation while BC2 was highly cytotoxic in both growth conditions. The combined effect of the pore-forming, cholesterol-dependent hemolysin, cereolysin O (CLO, and metabolic product(s such as succinate produced in microaerobic conditions provided substantial contribution to the toxicity of BC1 but not BC2 which relied mainly on other toxins. This mechanism is shared between CB1 and B. anthracis. It involves the permeabilization of the cell membrane which facilitates transport of toxic bacterial metabolites into the cell. The toxicity of BC1was potentiated in the presence of bovine serum albumin which appeared to serve as reservoir for bacteria-derived nitric oxide participating in the downstream production of reactive oxidizing species with the properties of peroxynitrite. In agreement with this the BC1cultures demonstrated the increased oxidation of the indicator dye Amplex Red catalyzed by peroxidase as well as the increased toxicity in the presence of externally added ascorbic acid.

  2. Clusters of orthologous genes for 41 archaeal genomes and implications for evolutionary genomics of archaea

    Wolf Yuri I; Novichkov Pavel S; Sorokin Alexander V; Makarova Kira S; Koonin Eugene V

    2007-01-01

    Abstract Background An evolutionary classification of genes from sequenced genomes that distinguishes between orthologs and paralogs is indispensable for genome annotation and evolutionary reconstruction. Shortly after multiple genome sequences of bacteria, archaea, and unicellular eukaryotes became available, an attempt on such a classification was implemented in Clusters of Orthologous Groups of proteins (COGs). Rapid accumulation of genome sequences creates opportunities for refining COGs ...

  3. Genetic, comparative genomic, and expression analyses of the Mc1r locus in the polychromatic Midas cichlid fish (Teleostei, Cichlidae Amphilophus sp.) species group.

    Henning, Frederico; Renz, Adina Josepha; Fukamachi, Shoji; Meyer, Axel

    2010-05-01

    Natural populations of the Midas cichlid species in several different crater lakes in Nicaragua exhibit a conspicuous color polymorphism. Most individuals are dark and the remaining have a gold coloration. The color morphs mate assortatively and sympatric population differentiation has been shown based on neutral molecular data. We investigated the color polymorphism using segregation analysis and a candidate gene approach. The segregation patterns observed in a mapping cross between a gold and a dark individual were consistent with a single dominant gene as a cause of the gold phenotype. This suggests that a simple genetic architecture underlies some of the speciation events in the Midas cichlids. We compared the expression levels of several candidate color genes Mc1r, Ednrb1, Slc45a2, and Tfap1a between the color morphs. Mc1r was found to be up regulated in the gold morph. Given its widespread association in color evolution and role on melanin synthesis, the Mc1r locus was further investigated using sequences derived from a genomic library. Comparative analysis revealed conserved synteny in relation to the majority of teleosts and highlighted several previously unidentified conserved non-coding elements (CNEs) in the upstream and downstream regions in the vicinity of Mc1r. The identification of the CNEs regions allowed the comparison of sequences from gold and dark specimens of natural populations. No polymorphisms were found between in the population sample and Mc1r showed no linkage to the gold phenotype in the mapping cross, demonstrating that it is not causally related to the color polymorphism in the Midas cichlid.

  4. Genomic amplification of Fanconi anemia complementation group A (FancA) in head and neck squamous cell carcinoma (HNSCC): Cellular mechanisms of radioresistance and clinical relevance.

    Hess, Julia; Unger, Kristian; Orth, Michael; Schötz, Ulrike; Schüttrumpf, Lars; Zangen, Verena; Gimenez-Aznar, Igor; Michna, Agata; Schneider, Ludmila; Stamp, Ramona; Selmansberger, Martin; Braselmann, Herbert; Hieber, Ludwig; Drexler, Guido A; Kuger, Sebastian; Klein, Diana; Jendrossek, Verena; Friedl, Anna A; Belka, Claus; Zitzelsberger, Horst; Lauber, Kirsten

    2017-02-01

    Radio (chemo) therapy is a crucial treatment modality for head and neck squamous cell carcinoma (HNSCC), but relapse is frequent, and the underlying mechanisms remain largely elusive. Therefore, novel biomarkers are urgently needed. Previously, we identified gains on 16q23-24 to be associated with amplification of the Fanconi anemia A (FancA) gene and to correlate with reduced progression-free survival after radiotherapy. Here, we analyzed the effects of FancA on radiation sensitivity in vitro, characterized the underlying mechanisms, and evaluated their clinical relevance. Silencing of FancA expression in HNSCC cell lines with genomic gains on 16q23-24 resulted in significantly impaired clonogenic survival upon irradiation. Conversely, overexpression of FancA in immortalized keratinocytes conferred increased survival accompanied by improved DNA repair, reduced accumulation of chromosomal translocations, but no hyperactivation of the FA/BRCA-pathway. Downregulation of interferon signaling as identified by microarray analyses, enforced irradiation-induced senescence, and elevated production of the senescence-associated secretory phenotype (SASP) appeared to be candidate mechanisms contributing to FancA-mediated radioresistance. Data of the TCGA HNSCC cohort confirmed the association of gains on 16q24.3 with FancA overexpression and impaired overall survival. Importantly, transcriptomic alterations similar to those observed upon FancA overexpression in vitro strengthened the clinical relevance. Overall, FancA amplification and overexpression appear to be crucial for radiotherapeutic failure in HNSCC. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. All about the Human Genome Project (HGP)

    ... Care Genomic Medicine Working Group New Horizons and Research Patient Management Policy and Ethics Issues Quick Links for Patient Care Education All About the Human Genome Project Fact Sheets Genetic Education Resources for ...

  6. Genomics and fish adaptation

    Agostinho Antunes

    2015-12-01

    Full Text Available The completion of the human genome sequencing in 2003 opened a new perspective into the importance of whole genome sequencing projects, and currently multiple species are having their genomes completed sequenced, from simple organisms, such as bacteria, to more complex taxa, such as mammals. This voluminous sequencing data generated across multiple organisms provides also the framework to better understand the genetic makeup of such species and related ones, allowing to explore the genetic changes underlining the evolution of diverse phenotypic traits. Here, recent results from our group retrieved from comparative evolutionary genomic analyses of varied fish species will be considered to exemplify how gene novelty and gene enhancement by positive selection might have been determinant in the success of adaptive radiations into diverse habitats and lifestyles.

  7. Genomic diversity and affinities in population groups of North West India: an analysis of Alu insertion and a single nucleotide polymorphism.

    Saini, J S; Kumar, A; Matharoo, K; Sokhi, J; Badaruddoza; Bhanwer, A J S

    2012-12-15

    The North West region of India is extremely important to understand the peopling of India, as it acted as a corridor to the foreign invaders from Eurasia and Central Asia. A series of these invasions along with multiple migrations led to intermixture of variable populations, strongly contributing to genetic variations. The present investigation was designed to explore the genetic diversities and affinities among the five major ethnic groups from North West India; Brahmin, Jat Sikh, Bania, Rajput and Gujjar. A total of 327 individuals of the abovementioned ethnic groups were analyzed for 4 Alu insertion marker loci (ACE, PV92, APO and D1) and a Single Nucleotide Polymorphism (SNP) rs2234693 in the intronic region of the ESR1 gene. Statistical analysis was performed to interpret the genetic structure and diversity of the population groups. Genotypes for ACE, APO, ESR1 and PV92 loci were found to be in Hardy-Weinberg equilibrium in all the ethnic groups, while significant departures were observed at the D1 locus in every investigated population after Bonferroni's correction. The average heterozygosity for all the loci in these ethnic groups was fairly substantial ranging from 0.3927 ± 0.1877 to 0.4333 ± 0.1416. Inbreeding coefficient indicated an overall 10% decrease in heterozygosity in these North West Indian populations. The gene differentiation among the populations was observed to be of the order of 0.013. Genetic distance estimates revealed that Gujjars were close to Banias and Jat Sikhs were close to Rajputs. Overall the study favored the recent division of the populations of North West India into largely endogamous groups. It was observed that the populations of North West India represent a more or less homogenous genetic entity, owing to their common ancestral history as well as geographical proximity. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Advances in editing microalgae genomes

    Daboussi, Fayza

    2017-01-01

    There have been significant advances in microalgal genomics over the last decade. Nevertheless, there are still insufficient tools for the manipulation of microalgae genomes and the development of microalgae as industrial biofactories. Several research groups have recently contributed to progress by demonstrating that particular nucleases can be used for targeted and stable modifications of the genomes of some microalgae species. The nucleases include Meganucleases, Zinc Finger nucleases, TAL...

  9. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  10. Genome Imprinting

    the cell nucleus (mitochondrial and chloroplast genomes), and. (3) traits governed ... tively good embryonic development but very poor development of membranes and ... Human homologies for the type of situation described above are naturally ..... imprint; (b) New modifications of the paternal genome in germ cells of each ...

  11. Baculovirus Genomics

    Oers, van M.M.; Vlak, J.M.

    2007-01-01

    Baculovirus genomes are covalently closed circles of double stranded-DNA varying in size between 80 and 180 kilobase-pair. The genomes of more than fourty-one baculoviruses have been sequenced to date. The majority of these (37) are pathogenic to lepidopteran hosts; three infect sawflies

  12. Genomic Testing

    ... this database. Top of Page Evaluation of Genomic Applications in Practice and Prevention (EGAPP™) In 2004, the Centers for Disease Control and Prevention launched the EGAPP initiative to establish and test a ... and other applications of genomic technology that are in transition from ...

  13. Ancient genomes

    Hoelzel, A Rus

    2005-01-01

    Ever since its invention, the polymerase chain reaction has been the method of choice for work with ancient DNA. In an application of modern genomic methods to material from the Pleistocene, a recent study has instead undertaken to clone and sequence a portion of the ancient genome of the cave bear.

  14. The promise of insect genomics

    Grimmelikhuijzen, Cornelis J P; Cazzamali, Giuseppe; Williamson, Michael

    2007-01-01

    Insects are the largest animal group in the world and are ecologically and economically extremely important. This importance of insects is reflected by the existence of currently 24 insect genome projects. Our perspective discusses the state-of-the-art of these genome projects and the impacts...

  15. Genomics of Volvocine Algae

    Umen, James G.; Olson, Bradley J.S.C.

    2015-01-01

    Volvocine algae are a group of chlorophytes that together comprise a unique model for evolutionary and developmental biology. The species Chlamydomonas reinhardtii and Volvox carteri represent extremes in morphological diversity within the Volvocine clade. Chlamydomonas is unicellular and reflects the ancestral state of the group, while Volvox is multicellular and has evolved numerous innovations including germ-soma differentiation, sexual dimorphism, and complex morphogenetic patterning. The Chlamydomonas genome sequence has shed light on several areas of eukaryotic cell biology, metabolism and evolution, while the Volvox genome sequence has enabled a comparison with Chlamydomonas that reveals some of the underlying changes that enabled its transition to multicellularity, but also underscores the subtlety of this transition. Many of the tools and resources are in place to further develop Volvocine algae as a model for evolutionary genomics. PMID:25883411

  16. Human social genomics.

    Steven W Cole

    2014-08-01

    Full Text Available A growing literature in human social genomics has begun to analyze how everyday life circumstances influence human gene expression. Social-environmental conditions such as urbanity, low socioeconomic status, social isolation, social threat, and low or unstable social status have been found to associate with differential expression of hundreds of gene transcripts in leukocytes and diseased tissues such as metastatic cancers. In leukocytes, diverse types of social adversity evoke a common conserved transcriptional response to adversity (CTRA characterized by increased expression of proinflammatory genes and decreased expression of genes involved in innate antiviral responses and antibody synthesis. Mechanistic analyses have mapped the neural "social signal transduction" pathways that stimulate CTRA gene expression in response to social threat and may contribute to social gradients in health. Research has also begun to analyze the functional genomics of optimal health and thriving. Two emerging opportunities now stand to revolutionize our understanding of the everyday life of the human genome: network genomics analyses examining how systems-level capabilities emerge from groups of individual socially sensitive genomes and near-real-time transcriptional biofeedback to empirically optimize individual well-being in the context of the unique genetic, geographic, historical, developmental, and social contexts that jointly shape the transcriptional realization of our innate human genomic potential for thriving.

  17. The genomes and comparative genomics of Lactobacillus delbrueckii phages.

    Riipinen, Katja-Anneli; Forsman, Päivi; Alatossava, Tapani

    2011-07-01

    Lactobacillus delbrueckii phages are a great source of genetic diversity. Here, the genome sequences of Lb. delbrueckii phages LL-Ku, c5 and JCL1032 were analyzed in detail, and the genetic diversity of Lb. delbrueckii phages belonging to different taxonomic groups was explored. The lytic isometric group b phages LL-Ku (31,080 bp) and c5 (31,841 bp) showed a minimum nucleotide sequence identity of 90% over about three-fourths of their genomes. The genomic locations of their lysis modules were unique, and the genomes featured several putative overlapping transcription units of genes. LL-Ku and c5 virions displayed peptidoglycan hydrolytic activity associated with a ~36-kDa protein similar in size to the endolysin. Unexpectedly, the 49,433-bp genome of the prolate phage JCL1032 (temperate, group c) revealed a conserved gene order within its structural genes. Lb. delbrueckii phages representing groups a (a phage LL-H), b and c possessed only limited protein sequence homology. Genomic comparison of LL-Ku and c5 suggested that diversification of Lb. delbrueckii phages is mainly due to insertions, deletions and recombination. For the first time, the complete genome sequences of group b and c Lb. delbrueckii phages are reported.

  18. Optimization of the production conditions of the lipase produced by Bacillus cereus from rice flour through Plackett-Burman Design (PBD) and response surface methodology (RSM).

    Vasiee, Alireza; Behbahani, Behrooz Alizadeh; Yazdi, Farideh Tabatabaei; Moradi, Samira

    2016-12-01

    In this study, the screening of lipase positive bacteria from rice flour was carried out by Rhodamin B agar plate method. Bacillus cereus was identified by 16S rDNA method. Screening of the appropriate variables and optimization of the lipase production was performed using Plackett-Burman design (PBD) and response surface methodology (RSM). Among the isolated bacteria, an aerobic Bacillus cereus strain was recognized as the best lipase-producing bacteria (177.3 ± 20 U/ml). Given the results, the optimal enzyme production conditions were achieved with coriander seed extract (CSE)/yeast extract ratio of 16.9 w/w, olive oil (OO) and MgCl 2 concentration of 2.37 g/L and 24.23 mM, respectively. In these conditions, the lipase activity (LA) was predicted 343 U/mL that was approximately close to the predicted value (324 U/mL), which was increased 1.83 fold LA compared with the non-optimized lipase. The kinetic parameters of V max and K m for the lipase were measured 0.367 μM/min.mL and 5.3 mM, respectively. The lipase producing Bacillus cereus was isolated and RSM was used for the optimization of enzyme production. The CSE/yeast extract ratio of 16.9 w/w, OO concentration of 2.37 g/L and MgCl 2 concentration of 24.23 mM, were found to be the optimal conditions of the enzyme production process. LA at optimal enzyme production conditions was observed 1.83 times more than the non-optimal conditions. Ultimately, it can be concluded that the isolated B. cereus from rice flour is a proper source of lipase. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Synergistic effect of high hydrostatic pressure and natural antimicrobials on inactivation kinetics of Bacillus cereus in a liquid whole egg and skim milk mixed beverage.

    Pina-Pérez, Maria Consuelo; Silva-Angulo, Angela B; Muguerza-Marquínez, Begoña; Aliaga, D Rodrigo; López, Antonio Martínez

    2009-01-01

    An in-depth study was conducted in order to extend the storage life of a liquid whole egg-skim milk (LWE-SM) mixed beverage to enhance its safety and the safety of related beverages. Bacillus cereus vegetative cells (1 x 10(8) colony-forming units [CFU]/mL) were inoculated in LWE-SM beverages with or without natural antimicrobial supplements: flavonol rich-cocoa powder (cocoanOX 12%, CCX) (700 ppm), vanillin (700 ppm), anise (700 ppm), and cinnamon (700 ppm). B. cereus cells were maintained at 10 degrees C for 10 days in the different beverages to test the bacteriostatic or inhibitory effect of the aforementioned ingredients. Beverages were treated with high hydrostatic pressure (HHP) technology and stored at 10 degrees C for 15 days after treatment. All natural antimicrobials reduced the micro(max) values and increased the lag phase time of B. cereus, and Gompertz growth curves showed different inhibitory effects depending on the substance. The maximum inhibitory effect (1.330 log cycle reduction) was achieved in LWE-SM-cinnamon-supplemented beverage. The maximum inactivation achieved by HHP in LWE-SM beverage was a reduction of around 3.89 +/- 0.25 log cycles at 300 MPa for 12 minutes. When supplemented beverages were treated under the same conditions, enhanced inactivation levels were achieved. This increased inactivation can be attributed to a synergistic effect when the LWE-SM was supplemented with flavonol-rich cocoa powder, cinnamon, and vanillin. The maximum synergistic effect was observed in LWE-SM-CCX-supplemented beverage. During the refrigerated storage of B. cereus HHP-treated cells in beverages to which antimicrobials had been added, the inhibitory effect was dependent on the previously applied pressure level.

  20. Biorremediation of soil polluted by 75000 ppm of waste motor oil applying biostimulation and phytoremediation with Sorghum vulgare and Bacillus cereus or Burkholderia cepacia

    Balderas-León Iván; Sánchez-Yáñez Juan Manuel

    2015-01-01

    Waste motor oil (WMO) pollutes soil and causing lost soil fertility. An alternative to solve this problem its bioremediation (BR) by double and following biostimulation (BS) with mineral solution (MS) and a legume as green manure (GM) then using phytoremediation (PR) with growth promoting vegetal bacteria (GPVB) like Bacillus cereus and Burkholderia cepacia to minimize remaining WMO. The aims of this research were: a) bioremediation of polluted soil by 75000 ppm of WMO by biostimulation and t...

  1. Bioaccumulation of copper, zinc, cadmium and lead by Bacillus sp., Bacillus cereus, Bacillus sphaericus and Bacillus subtilis Bioacumulação de cobre, zinco, cádmio e chumbo por Bacillus sp., Bacillus cereus, Bacillus sphaericus e Bacillus subtilis

    Antonio Carlos Augusto da Costa

    2001-03-01

    Full Text Available This work presents some results on the use of microbes from the genus Bacillus for uptake of cadmium, zinc, copper and lead ions. Maximum copper bioaccumulations were 5.6 mol/g biomass for B. sphaericus, 5.9 mol/g biomass for B. cereus and B. subtilis, and 6.4 mol/g biomass for Bacillus sp. Maximum zinc bioaccumulations were 4.3 mol/g biomass for B. sphaericus, 4.6 mol/g biomass for B. cereus, 4.8 mol/g biomass for Bacillus sp. and 5.0 mol/g biomass for B. subtilis. Maximum cadmium bioaccumulations were 8.0 mol/g biomass for B. cereus, 9.5 mol/g biomass for B. subtilis, 10.8 mol/g biomass for Bacillus sp. and 11.8 mol/g biomass for B. sphaericus. Maximum lead biomaccumulations were 0.7 mol/g biomass for B. sphaericus, 1.1 mol/g biomass for B. cereus, 1.4 mol/g biomass for Bacillus sp. and 1.8 mol/g biomass for B. subtilis. The different Bacillus strains tested presented distinct uptake capacities, and the best results were obtained for B. subtilis and B. cereus.Este trabalho apresenta resultados de acumulação dos íons metálicos cádmio, zinco, cobre e chumbo por bactérias do gênero Bacillus. A bioacumulação máxima de cobre foi 5,6 mol/g biomassa para B. sphaericus, 5,9 mol/g biomassa para B. cereus e B. subtilis, e 6,4 mol/g biomassa para Bacillus sp.. A bioacumulação máxima de zinco foi 4,3 mol/g biomassa para B. sphaericus, 4,6 mol/g biomassa para B. cereus, 4,8 mol/g biomassa para Bacillus sp. e 5,0 mol/g biomassa para B. subtilis. A bioacumulação máxima de cádmio foi 8,0 mol/g biomassa para B. cereus, 9,5 mol/g biomassa para B. subtilis, 10,8 mol/g biomassa para Bacillus sp. e 11,8 mol/g biomassa para B. sphaericus. A bioacumulação máxima de chumbo foi 0,7 mol/g biomassa para B. sphaericus, 1,1 mol/g biomassa para B. cereus, 1,4 mol/g biomassa para Bacillus sp. e 1,8 mol/g biomassa para B. subtilis. As distintas linhagens de Bacillus testadas apresentaram variáveis capacidades de carregamento de íons metálicos, sendo os

  2. Feasible Management of Southern Corn Leaf Blight via Induction of Systemic Resistance by Bacillus cereus C1L in Combination with Reduced Use of Dithiocarbamate Fungicides

    Yi-Ru Lai

    2016-10-01

    Full Text Available Dithiocarbamate fungicides such as maneb and mancozeb are widely used nonsystemic protectant fungicides to control various plant fungal diseases. Dithiocarbamate fungicides should be frequently applied to achieve optimal efficacy of disease control and avoid either decline in effectiveness or wash-off from leaf surface. Dithiocarbamates are of low resistance risk but have the potential to cause human neurological diseases. The objective of this study was to develop a strategy to effectively control plant disease with reduced use of dithiocarbamtes. Southern corn leaf blight was the model pathosystem for the investigation. When corn plants were drench-treated with Bacillus cereus C1L, a rhizobacterium able to induce systemic resistance in corn plants against southern leaf blight, frequency of spraying dithiocarbamate fungicides could be decreased. The treatment of B. cereus C1L was able to protect maize from southern leaf blight while residues of dithiocarbamates on leaf surface were too low to provide sufficient protection. On the other hand, frequent sprays of mancozeb slightly but significantly reduced growth of corn plants under natural conditions. In contrast, application of B. cereus C1L can significantly promote growth of corn plants whether sprayed with mancozeb or not. Our results provide the information that plant disease can be well controlled by rhizobacteria-mediated induced systemic resistance in combination with reduced but appropriate application of dithiocarbamate fungicides just before a heavy infection period. An appropriate use of rhizobacteria can enhance plant growth and help plants overcome negative effects caused by dithiocarbamates.

  3. Beneficial effects of bio-controlling agent Bacillus cereus IB311 on the agricultural crop production and its biomass optimization through response surface methodology

    GOUTAM BANERJEE

    2017-10-01

    Full Text Available ABSTRACT Disease in agricultural field is a big problem that causes a massive loss in production. In this present investigation, we have reported a soil-borne bacterium Bacillus cereus IB311 which is antagonistic to plant pathogens (Pseudomonas syringae and Agrobacterium tumefaciens, and could make a substantial contribution to the prevention of plant diseases. To prove the practical application, the strain was directly applied in agricultural field. The results demonstrated that B. cereus IB311 has increased the production (20% and 26% in term of average pod number per plant, average seed number per pod, and seed yield per experimental plot in ground nut (Arachis hypogaea var. Koushal, G201 and sesame (Sesamum indicum var. Kanak, respectively. To reduce the production cost, the biomass production was optimized through response surface methodology (RSM. Interactions of three variables (glucose, beef extract and inoculum were studied using Central Composite Design. According to our analysis, optimum production of Bacillus cereus IB311 (5.383 µg/ mL may be obtained at glucose 1.985%, beef extract 1.615% and inoculums size 0.757%. Therefore, we strongly believe that the application of this strain in agricultural field as bio-controlling agent will definitely enhance the production yield and will reduce the disease risk.

  4. Blooming rhythms of cactus Cereus peruvianus with nocturnal peak at full moon during seasons of prolonged daytime photoperiod.

    Ben-Attia, Mossadok; Reinberg, Alain; Smolensky, Michael H; Gadacha, Wafa; Khedaier, Achraf; Sani, Mamane; Touitou, Yvan; Boughamni, Néziha Ghanem

    2016-01-01

    Cereus peruvianus (Peruvian apple cactus) is a large erect and thorny succulent cactus characterized by column-like (cereus [L]: column), that is, candle-shaped, appendages. For three successive years (1100 days), between early April and late November, we studied the flowering patterns of eight cacti growing in public gardens and rural areas of north and central Tunisia, far from nighttime artificial illumination, in relation to natural environmental light, temperature, relative humidity and precipitation parameters. Flower blooming was assessed nightly between 23:00 h and until at least 02:00 h, and additionally around-the-clock at ~1 h intervals for 30 consecutive days during the late summer of each year of study to quantify both nyctohemeral (day-night) and lunar patterns. During the summer months of prolonged daytime photoperiod, flower blooming of C. peruvianus exhibited predictable-in-time variation as "waves" with average period of 29.5 days synchronized by the light of the full moon. The large-sized flower (~16 cm diameter) opens almost exclusively at night, between sunset and sunrise, as a 24 h rhythm during a specific 3-4-day span of the lunar cycle (full moon), with a strong correlation between moon phase and number and proportion of flowers in bloom (ranging from r = +0.59 to +0.91). Black, blue and red cotton sheets were used to filter specific spectral bands of nighttime moonlight from illuminating randomly selected plant appendages as a means to test the hypothesis of a "gating" 24 h rhythm phenomenon of photoreceptors at the bud level. Relative to control conditions (no light filtering), black sheet covering inhibited flower bud induction by 87.5%, red sheet covering by 46.6% and blue sheet covering by 34%, and the respective inhibiting effects on number of flowers in bloom were essentially 100%, ~81% and ~44%. C. peruvianus is a unique example of a terrestrial plant that exhibits a circadian flowering rhythm (peak ~00:00 h) "gated" by 24 h, lunar

  5. Herbarium genomics

    Bakker, Freek T.; Lei, Di; Yu, Jiaying

    2016-01-01

    Herbarium genomics is proving promising as next-generation sequencing approaches are well suited to deal with the usually fragmented nature of archival DNA. We show that routine assembly of partial plastome sequences from herbarium specimens is feasible, from total DNA extracts and with specimens...... up to 146 years old. We use genome skimming and an automated assembly pipeline, Iterative Organelle Genome Assembly, that assembles paired-end reads into a series of candidate assemblies, the best one of which is selected based on likelihood estimation. We used 93 specimens from 12 different...... correlation between plastome coverage and nuclear genome size (C value) in our samples, but the range of C values included is limited. Finally, we conclude that routine plastome sequencing from herbarium specimens is feasible and cost-effective (compared with Sanger sequencing or plastome...

  6. Genome-wide discovery of novel M1T1 group A streptococcal determinants important for fitness and virulence during soft-tissue infection.

    Yoann Le Breton

    2017-08-01

    Full Text Available The Group A Streptococcus remains a significant human pathogen causing a wide array of disease ranging from self-limiting to life-threatening invasive infections. Epithelium (skin or throat colonization with progression to the subepithelial tissues is the common step in all GAS infections. Here, we used transposon-sequencing (Tn-seq to define the GAS 5448 genetic requirements for in vivo fitness in subepithelial tissue. A near-saturation transposon library of the M1T1 GAS 5448 strain was injected subcutaneously into mice, producing suppurative inflammation at 24 h that progressed to prominent abscesses with tissue necrosis at 48 h. The library composition was monitored en masse by Tn-seq and ratios of mutant abundance comparing the output (12, 24 and 48 h versus input (T0 mutant pools were calculated for each gene. We identified a total of 273 subcutaneous fitness (scf genes with 147 genes (55 of unknown function critical for the M1T1 GAS 5448 fitness in vivo; and 126 genes (53 of unknown function potentially linked to in vivo fitness advantage. Selected scf genes were validated in competitive subcutaneous infection with parental 5448. Two uncharacterized genes, scfA and scfB, encoding putative membrane-associated proteins and conserved among Gram-positive pathogens, were further characterized. Defined scfAB mutants in GAS were outcompeted by wild type 5448 in vivo, attenuated for lesion formation in the soft tissue infection model and dissemination to the bloodstream. We hypothesize that scfAB play an integral role in enhancing adaptation and fitness of GAS during localized skin infection, and potentially in propagation to other deeper host environments.

  7. Genome-wide discovery of novel M1T1 group A streptococcal determinants important for fitness and virulence during soft-tissue infection.

    Le Breton, Yoann; Belew, Ashton T; Freiberg, Jeffrey A; Sundar, Ganesh S; Islam, Emrul; Lieberman, Joshua; Shirtliff, Mark E; Tettelin, Hervé; El-Sayed, Najib M; McIver, Kevin S

    2017-08-01

    The Group A Streptococcus remains a significant human pathogen causing a wide array of disease ranging from self-limiting to life-threatening invasive infections. Epithelium (skin or throat) colonization with progression to the subepithelial tissues is the common step in all GAS infections. Here, we used transposon-sequencing (Tn-seq) to define the GAS 5448 genetic requirements for in vivo fitness in subepithelial tissue. A near-saturation transposon library of the M1T1 GAS 5448 strain was injected subcutaneously into mice, producing suppurative inflammation at 24 h that progressed to prominent abscesses with tissue necrosis at 48 h. The library composition was monitored en masse by Tn-seq and ratios of mutant abundance comparing the output (12, 24 and 48 h) versus input (T0) mutant pools were calculated for each gene. We identified a total of 273 subcutaneous fitness (scf) genes with 147 genes (55 of unknown function) critical for the M1T1 GAS 5448 fitness in vivo; and 126 genes (53 of unknown function) potentially linked to in vivo fitness advantage. Selected scf genes were validated in competitive subcutaneous infection with parental 5448. Two uncharacterized genes, scfA and scfB, encoding putative membrane-associated proteins and conserved among Gram-positive pathogens, were further characterized. Defined scfAB mutants in GAS were outcompeted by wild type 5448 in vivo, attenuated for lesion formation in the soft tissue infection model and dissemination to the bloodstream. We hypothesize that scfAB play an integral role in enhancing adaptation and fitness of GAS during localized skin infection, and potentially in propagation to other deeper host environments.

  8. PSP: rapid identification of orthologous coding genes under positive selection across multiple closely related prokaryotic genomes.

    Su, Fei; Ou, Hong-Yu; Tao, Fei; Tang, Hongzhi; Xu, Ping

    2013-12-27

    With genomic sequences of many closely related bacterial strains made available by deep sequencing, it is now possible to investigate trends in prokaryotic microevolution. Positive selection is a sub-process of microevolution, in which a particular mutation is favored, causing the allele frequency to continuously shift in one direction. Wide scanning of prokaryotic genomes has shown that positive selection at the molecular level is much more frequent than expected. Genes with significant positive selection may play key roles in bacterial adaption to different environmental pressures. However, selection pressure analyses are computationally intensive and awkward to configure. Here we describe an open access web server, which is designated as PSP (Positive Selection analysis for Prokaryotic genomes) for performing evolutionary analysis on orthologous coding genes, specially designed for rapid comparison of dozens of closely related prokaryotic genomes. Remarkably, PSP facilitates functional exploration at the multiple levels by assignments and enrichments of KO, GO or COG terms. To illustrate this user-friendly tool, we analyzed Escherichia coli and Bacillus cereus genomes and found that several genes, which play key roles in human infection and antibiotic resistance, show significant evidence of positive selection. PSP is freely available to all users without any login requirement at: http://db-mml.sjtu.edu.cn/PSP/. PSP ultimately allows researchers to do genome-scale analysis for evolutionary selection across multiple prokaryotic genomes rapidly and easily, and identify the genes undergoing positive selection, which may play key roles in the interactions of host-pathogen and/or environmental adaptation.

  9. The Endospore-Forming Pathogen Bacillus cereus Exploits a Small Colony Variant-Based Diversification Strategy in Response to Aminoglycoside Exposure.

    Frenzel, Elrike; Kranzler, Markus; Stark, Timo D; Hofmann, Thomas; Ehling-Schulz, Monika

    2015-12-08

    Bacillus cereus is among the microorganisms most often isolated from cases of food spoilage and causes gastrointestinal diseases as well as nongastrointestinal infections elicited by the emetic toxin cereulide, enterotoxins, and a panel of tissue-destructive virulence factors. This opportunistic pathogen is increasingly associated with rapidly fatal clinical infections especially linked to neonates and immunocompromised individuals. Fatality results from either the misdiagnosis of B. cereus as a contaminant of the clinical specimen or from failure of antibiotic therapy. Here we report for the first time that exposure to aminoglycoside antibiotics induces a phenotype switching of emetic B. cereus subpopulations to a slow-growing small colony variant (SCV) state. Along with altered antibiotic resistance, SCVs showed distinct phenotypic and metabolic properties, bearing the risk of antibiotic treatment failure and of clinical misdiagnosis by standard identification tests used in routine diagnostic. The SCV subpopulation is characterized by enhanced production of the toxin cereulide, but it does not secrete tissue-destructive and immune system-affecting enzymes such as sphingomyelinase and phospholipase. SCVs showed significantly prolonged persistence and decreased virulence in the Galleria mellonella model for bacterial infections, indicating diversification concerning their ecological lifestyle. Importantly, diversification into coexisting wild-type and SCV subpopulations also emerged during amikacin pressure during in vivo infection experiments. This study shows for the first time that pathogenic spore-forming B. cereus strains are able to switch to a so far unreported slow-growing lifestyle, which differs substantially in terms of developmental, phenotypic, metabolic, and virulence traits from the wild-type populations. This underpins the necessity of molecular-based differential diagnostics and a well-chosen therapeutic treatment strategy in clinical

  10. Characteristics of enterotoxin distribution, hemolysis, lecithinase, and starch hydrolysis of Bacillus cereus isolated from infant formulas and ready-to-eat foods.

    Hwang, Ji-Yeon; Park, Jong-Hyun

    2015-03-01

    Bacillus cereus is a ubiquitous environmental microbe implicated as a main cause of food poisoning with various symptoms, depending on the strain type and the isolation source. In this study, the potential virulence factors and biochemical properties of B. cereus isolated from infant formulas and ready-to-eat (RTE) foods were analyzed and compared. A total of 347 B. cereus strains were isolated and identified from 687 infant food formulas and RTE food samples. All the isolates had one or more enterotoxin genes, and one-half of the strains had all 3 enterotoxin genes (hbl, nhe, and cytK) that are involved in food poisoning in humans. Here, all the 3 genes were detected in 50% of the B. cereus isolates from RTE foods and only 14% of the isolates were identified from infant formulas. The latter harbored low cytK and bceT, and very low hbl genes. Most B. cereus isolates possessed the hemolysis gene, but not the ces gene. The infant formula isolates showed stronger hemolysis activity than the other isolates. In addition, 26% of the total isolates showed low lecithinase activities and 10% showed high lecithinase activities. A greater number of isolates from the infant formula showed high lecithinase activity than those from the RTE foods. Approximately 83% of the isolates were positive and 17% were negative for starch hydrolysis. Over 90% of the RTE food isolates and only 35% of the infant formula isolates were positive for starch hydrolysis. However, all the strains possessed nhe, but their harboring patterns of hbl and cytK were significantly different. Most starch-hydrolyzing strains possessed hbl, but only 23% nonstarch-hydrolyzing isolates possessed this gene. Moreover, very low nonstarch hydrolyzing strains harbored cytK. Most nonstarch-hydrolyzing isolates showed high lecithinase and strong hemolysis activities, and very low hbl and cytK harboring. In summary, most infant formula isolates showed stronger hemolysis and higher lecithinase activities with lower

  11. Genomes in turmoil: quantification of genome dynamics in prokaryote supergenomes.

    Puigbò, Pere; Lobkovsky, Alexander E; Kristensen, David M; Wolf, Yuri I; Koonin, Eugene V

    2014-08-21

    Genomes of bacteria and archaea (collectively, prokaryotes) appear to exist in incessant flux, expanding via horizontal gene transfer and gene duplication, and contracting via gene loss. However, the actual rates of genome dynamics and relative contributions of different types of event across the diversity of prokaryotes are largely unknown, as are the sizes of microbial supergenomes, i.e. pools of genes that are accessible to the given microbial species. We performed a comprehensive analysis of the genome dynamics in 35 groups (34 bacterial and one archaeal) of closely related microbial genomes using a phylogenetic birth-and-death maximum likelihood model to quantify the rates of gene family gain and loss, as well as expansion and reduction. The results show that loss of gene families dominates the evolution of prokaryotes, occurring at approximately three times the rate of gain. The rates of gene family expansion and reduction are typically seven and twenty times less than the gain and loss rates, respectively. Thus, the prevailing mode of evolution in bacteria and archaea is genome contraction, which is partially compensated by the gain of new gene families via horizontal gene transfer. However, the rates of gene family gain, loss, expansion and reduction vary within wide ranges, with the most stable genomes showing rates about 25 times lower than the most dynamic genomes. For many groups, the supergenome estimated from the fraction of repetitive gene family gains includes about tenfold more gene families than the typical genome in the group although some groups appear to have vast, 'open' supergenomes. Reconstruction of evolution for groups of closely related bacteria and archaea reveals an extremely rapid and highly variable flux of genes in evolving microbial genomes, demonstrates that extensive gene loss and horizontal gene transfer leading to innovation are the two dominant evolutionary processes, and yields robust estimates of the supergenome size.

  12. Growth stimulation of Bacillus cereus and Pseudomonas putida using nanostructured ZnO thin film as transducer element

    Loukanov, Alexandre, E-mail: loukanov@mail.saitama-u.ac.jp [Saitama University, Department of Chemistry, Faculty of Science (Japan); Filipov, Chavdar [University of Forestry, Department of Infectious pathology, hygiene, technology and control of food stuffs of animal origin, Faculty of Veterinary Medicine (Bulgaria); Valcheva, Violeta [Bulgarian Academy of Science, Department of Infectious Diseases, Institute of microbiology (Bulgaria); Lecheva, Marta [University of Mining and Geology “St. Ivan Rilski”, Laboratory of Engineering NanoBiotechnology, Department of Engineering Geoecology (Bulgaria); Emin, Saim [University of Nova Gorica, Materials Research Laboratory (Slovenia)

    2015-04-15

    The semiconductor zinc oxide nanomaterial (ZnO or ZnO:H) is widely used in advanced biosensor technology for the design of highly-sensitive detector elements for various applications. In the attempt to evaluate its effect on common microorganisms, two types of nanostructured transducer films have been used (average diameter 600–1000 nm). They have been prepared by using both wet sol–gel method and magnetron sputtering. Their polycrystalline structure and specific surface features have been analyzed by X-ray diffraction (XRD), scanning electron microscope, and atomic force microscope. The assessment of growth stimulation of bacteria was determined using epifluorescent microscope by cell staining with Live/Dead BacLight kit. In our experiments, the growth stimulation of Gram-positive and Gram-negative bacteria on nanostructured ZnO film is demonstrated by Bacillus cereus and Pseudomonas putida. These two bacterial species have been selected, because they are well known and studied in biosensor technologies, with structural difference of their cell walls. These pathogens are easy for with common source in the liquid food or some commercial products. Our data has revealed that the method of transducer film preparation influences strongly bacterial inhibition and division. These results present the transforming signal precisely, when ZnO is used in biosensor applications.

  13. Resolution of enantiopure (S)-1-(1-napthyl) ethanol from racemic mixture by a novel Bacillus cereus isolate.

    Ranjan, Preeti; Pandey, Ashok; Binod, Parameswaran

    2017-09-01

    Chiral intermediates have wide application and high demand in pharmaceutical, agricultural, and other biotechnological industries for the preparation of bulk drug substances or fine chemicals. (S)-1-(1-napthyl) ethanol is an important synthetic intermediate of mevinic acid analog and a potential inhibitor of 3-hydroxy methyl glutaryl coenzyme A reductase enzymes which is rate limiting for cholesterol synthesis. The present study focuses on the resolution of (RS)-1-(1-napthyl) ethanol using whole cell biotransformation approach. The screening of microbial strains for the specific conversion were performed by the enrichment techniques using (RS)-1-(1-napthyl) ethanol. Evaluation of resolution, i.e., the enantioselective conversion of (R)-1-(1-napthyl) ethanol into 1-acetonapthone and production of (S)-1-(1-napthyl) ethanol with high purity were carried out. Among the isolates, a novel strain Bacillus cereus WG3 was found to be potent for the resolution and conversion of (S)-1-(1-napthyl) ethanol. This strain showed 86% conversion of (R)-1-(1-napthyl) ethanol and 95% yield of S-1-(1-napthyl) ethanol with 80% ee after 24 h. Further, the optimization of biotransformation reactions was carried out and the optimal parameters were found to be pH 7.0 and temperature 30 °C. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Clarificação do extrato aquoso de Stevia rebaudiana (Bert. Bertoni utilizando o cacto, Cereus peruvianus

    Larissa Maria Fernandes

    2001-05-01

    Full Text Available A tendência das indústrias que se preocupam em promover a saúde e prevenir doenças está em investir no desenvolvimento de tecnologias para produção de alimentos com baixas calorias e reduzido teor de gordura, mantendo suas qualidades nutricionais. Um dos estudos mais freqüentes é a substituição do açúcar por edulcorantes não calóricos, com a preocupação que estes substitutos sejam semelhantes em função organoléptica. Nas folhas da planta conhecida como Stevia rebaudiana (Bert. Bertoni (Asteraceae, ou simplesmente estévia, se encontram glicosídeos adoçantes (edulcorantes, como o esteviosídeo, rebaudiosídeos A, B, C, D, E e dulcosídeos A e B. Seu extrato aquoso apresenta-se em estado natural na cor marrom, o que o torna inconveniente para o consumidor usual. Neste trabalho, utilizou-se o cacto Cereus peruvianus como alternativa natural para a clarificação deste extrato. O cacto comportou-se como uma resina fortemente ácida e eliminou cerca de 95%, em média, a cor e turbidez do extrato de estévia

  15. Growth stimulation of Bacillus cereus and Pseudomonas putida using nanostructured ZnO thin film as transducer element

    Loukanov, Alexandre; Filipov, Chavdar; Valcheva, Violeta; Lecheva, Marta; Emin, Saim

    2015-01-01

    The semiconductor zinc oxide nanomaterial (ZnO or ZnO:H) is widely used in advanced biosensor technology for the design of highly-sensitive detector elements for various applications. In the attempt to evaluate its effect on common microorganisms, two types of nanostructured transducer films have been used (average diameter 600–1000 nm). They have been prepared by using both wet sol–gel method and magnetron sputtering. Their polycrystalline structure and specific surface features have been analyzed by X-ray diffraction (XRD), scanning electron microscope, and atomic force microscope. The assessment of growth stimulation of bacteria was determined using epifluorescent microscope by cell staining with Live/Dead BacLight kit. In our experiments, the growth stimulation of Gram-positive and Gram-negative bacteria on nanostructured ZnO film is demonstrated by Bacillus cereus and Pseudomonas putida. These two bacterial species have been selected, because they are well known and studied in biosensor technologies, with structural difference of their cell walls. These pathogens are easy for with common source in the liquid food or some commercial products. Our data has revealed that the method of transducer film preparation influences strongly bacterial inhibition and division. These results present the transforming signal precisely, when ZnO is used in biosensor applications

  16. Growth stimulation of Bacillus cereus and Pseudomonas putida using nanostructured ZnO thin film as transducer element

    Loukanov, Alexandre; Filipov, Chavdar; Valcheva, Violeta; Lecheva, Marta; Emin, Saim

    2015-04-01

    The semiconductor zinc oxide nanomaterial (ZnO or ZnO:H) is widely used in advanced biosensor technology for the design of highly-sensitive detector elements for various applications. In the attempt to evaluate its effect on common microorganisms, two types of nanostructured transducer films have been used (average diameter 600-1000 nm). They have been prepared by using both wet sol-gel method and magnetron sputtering. Their polycrystalline structure and specific surface features have been analyzed by X-ray diffraction (XRD), scanning electron microscope, and atomic force microscope. The assessment of growth stimulation of bacteria was determined using epifluorescent microscope by cell staining with Live/Dead BacLight kit. In our experiments, the growth stimulation of Gram-positive and Gram-negative bacteria on nanostructured ZnO film is demonstrated by Bacillus cereus and Pseudomonas putida. These two bacterial species have been selected, because they are well known and studied in biosensor technologies, with structural difference of their cell walls. These pathogens are easy for with common source in the liquid food or some commercial products. Our data has revealed that the method of transducer film preparation influences strongly bacterial inhibition and division. These results present the transforming signal precisely, when ZnO is used in biosensor applications.

  17. Cow dung is an ideal fermentation medium for amylase production in solid-state fermentation by Bacillus cereus

    Ponnuswamy Vijayaraghavan

    2015-12-01

    Full Text Available Amylase production by Bacillus cereus IND4 was investigated by solid state fermentation (SSF using cow dung substrate. The SSF conditions were optimized by using one-variable-at-a-time approach and two level full factorial design. Two level full factorial design demonstrated that moisture, pH, fructose, yeast extract and ammonium sulphate have significantly influenced enzyme production (p < 0.05. A central composite design was employed to investigate the optimum concentration of these variables affecting amylase production. Maximal amylase production of 464 units/ml of enzyme was observed in the presence of 100% moisture, 0.1% fructose and 0.01% ammonium sulphate. The enzyme production increased three fold compared to the original medium. The optimum pH and temperature for the activity of amylase were found to be 8.0 and 50 °C, respectively. This enzyme was highly stable at wide pH range (7.0–9.0 and showed 32% enzyme activity after initial denaturation at 50 °C for 1 h. This is the first detailed report on the production of amylase by microorganisms using cow dung as the low cost medium.

  18. Seed reserve composition and mobilization during germination and early seedling establishment of Cereus jamacaru D.C. ssp. jamacaru (Cactaceae).

    Alencar, Nara L M; Innecco, Renato; Gomes-Filho, Enéas; Gallão, Maria Izabel; Alvarez-Pizarro, Juan C; Prisco, José T; Oliveira, Alexandre B De

    2012-09-01

    Cereus jamacaru, a Cactaceae found throughout northeast Brazil, is widely used as cattle food and as an ornamental and medicinal plant. However, there has been little information about the physiological and biochemical aspects involved in its germination. The aim of this study was to investigate its reserve mobilization during germination and early seedling growth. For this, C. jamacaru seeds were germinated in a growth chamber and collected at 0, 2, 4, 5, 6, 8 and 12 days after imbibition for morphological and biochemical analyses. Dry seeds had wrinkled seed coats and large, curved embryos. Lipids were the most abundant reserve, comprising approximately 55% and 65% of the dry mass for cotyledons and the hypocotylradicle axis, respectively. Soluble sugars and starch were the minor reserves, corresponding to approximately 2.2% of the cotyledons' dry mass, although their levels showed significant changes during germination. Soluble proteins corresponded to 40% of the cotyledons' dry mass, which was reduced by 81% at the final period of germination compared to dry seeds. C. jamacaru seed can be classified as an oil seed due to its high lipid content. Moreover, lipids were the main reserve mobilized during germination because their levels were strongly reduced after seed germination, while proteins were the second most utilized reserve in this process.

  19. Primary characterization and evaluation of anti ulcerogenic activity of an aqueous extract from callus culture of Cereus peruvianus Mill. (Cactaceae).

    Jayme, Milena O; Ames, Franciele Q; Bersani-Amado, Ciomar A; Machado, Maria de Fatima P S; Mangolin, Claudete A; Goncalves, Regina A C; de Oliveira, Arildo J B

    2015-01-01

    In the current study we reported cultivation, extraction procedure, analysis and preliminary characterization of the aqueous extract from Cereus peruvianus callus culture and evaluated its anti ulcerogenic activity in vivo models of experimental ulcers in Wistar rats. The obtained aqueous extract from callus (AC) was dialyzed and subjected to freeze-thaw process, providing a possible polysaccharide. The carbohydrate and protein contents of the aqueous extract were estimated at 53.4% and 0.66%, respectively, composed primarily of galactose, arabinose and galacturonic acid, with minor amounts of glucose. This appeared heterogeneous when analyzed by high-performance size-exclusion chromatography and a multiangle laser light scattering detector (HPSEC-MALLS). The AC was found to be significantly effective against ethanol-induced lesions but was ineffective against indomethacin-induced lesions. The callus culture of C. peruvianus is an alternative source for the synthesis of substances originally produced by plants. The calluses grown indefinitely in vitro under controlled conditions are stable tissues, and the aqueous extract from calluses may be used instead of fully developed plants using the protocols described in this study.

  20. Comparing the mannitol-egg yolk-polymyxin agar plating method with the three-tube most-probable-number method for enumeration of Bacillus cereus spores in raw and high-temperature, short-time pasteurized milk.

    Harper, Nigel M; Getty, Kelly J K; Schmidt, Karen A; Nutsch, Abbey L; Linton, Richard H

    2011-03-01

    The U.S. Food and Drug Administration's Bacteriological Analytical Manual recommends two enumeration methods for Bacillus cereus: (i) standard plate count method with mannitol-egg yolk-polymyxin (MYP) agar and (ii) a most-probable-number (MPN) method with tryptic soy broth (TSB) supplemented with 0.1% polymyxin sulfate. This study compared the effectiveness of MYP and MPN methods for detecting and enumerating B. cereus in raw and high-temperature, short-time pasteurized skim (0.5%), 2%, and whole (3.5%) bovine milk stored at 4°C for 96 h. Each milk sample was inoculated with B. cereus EZ-Spores and sampled at 0, 48, and 96 h after inoculation. There were no differences (P > 0.05) in B. cereus populations among sampling times for all milk types, so data were pooled to obtain overall mean values for each treatment. The overall B. cereus population mean of pooled sampling times for the MPN method (2.59 log CFU/ml) was greater (P milk samples ranged from 2.36 to 3.46 and 2.66 to 3.58 log CFU/ml for inoculated milk treatments for the MYP plate count and MPN methods, respectively, which is below the level necessary for toxin production. The MPN method recovered more B. cereus, which makes it useful for validation research. However, the MYP plate count method for enumeration of B. cereus also had advantages, including its ease of use and faster time to results (2 versus 5 days for MPN).

  1. Organizational heterogeneity of vertebrate genomes.

    Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham

    2012-01-01

    Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

  2. Organizational heterogeneity of vertebrate genomes.

    Svetlana Frenkel

    Full Text Available Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

  3. Genome Sequencing

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  4. Using a genomic assay for the detection of SNPs of Knops blood group antigens leads to the identification of two caucasians homozygous for the SNP associated with the knops SL3 antigen

    Jakobsen, M. A.; Sprogoe, U.

    2015-01-01

    designed a genomic assay based on sequencing targeting the SNPs underlying the antigens of the Knops system. Study Design/Methods: Samples from a total of 105 blood donors and 2 patients were examined for polymorphisms in CR1 exon 29 by using PCR and subsequent Sanger sequencing. Results......Background/Case Studies: The antigens of the Knops (Kn) blood group system are associated with SNPs located on exon 29 and (to lesser extent) on exon 26 of the complement receptor 1 (CR1) gene. Because of a lack of proper typing antibodies, serologic detection of Kn antigens is not feasible. We....../Findings: With regard to Kn a and b antigens, we found SNP frequencies to be 90.5% for G/G (4681)* associated with Kn(a+b-) and 9.5% for G/A associated with Kn(a+b+). None of the 107 patients/donors were found to be homozygous for A/A associated with Kn(ab+). The frequencies of SNPs associated with the KCAM antigen...

  5. Comparative Genomics

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 8. Comparative Genomics - A Powerful New Tool in Biology. Anand K Bachhawat. General Article Volume 11 Issue 8 August 2006 pp 22-40. Fulltext. Click here to view fulltext PDF. Permanent link:

  6. Theory of microbial genome evolution

    Koonin, Eugene

    Bacteria and archaea have small genomes tightly packed with protein-coding genes. This compactness is commonly perceived as evidence of adaptive genome streamlining caused by strong purifying selection in large microbial populations. In such populations, even the small cost incurred by nonfunctional DNA because of extra energy and time expenditure is thought to be sufficient for this extra genetic material to be eliminated by selection. However, contrary to the predictions of this model, there exists a consistent, positive correlation between the strength of selection at the protein sequence level, measured as the ratio of nonsynonymous to synonymous substitution rates, and microbial genome size. By fitting the genome size distributions in multiple groups of prokaryotes to predictions of mathematical models of population evolution, we show that only models in which acquisition of additional genes is, on average, slightly beneficial yield a good fit to genomic data. Thus, the number of genes in prokaryotic genomes seems to reflect the equilibrium between the benefit of additional genes that diminishes as the genome grows and deletion bias. New genes acquired by microbial genomes, on average, appear to be adaptive. Evolution of bacterial and archaeal genomes involves extensive horizontal gene transfer and gene loss. Many microbes have open pangenomes, where each newly sequenced genome contains more than 10% `ORFans', genes without detectable homologues in other species. A simple, steady-state evolutionary model reveals two sharply distinct classes of microbial genes, one of which (ORFans) is characterized by effectively instantaneous gene replacement, whereas the other consists of genes with finite, distributed replacement rates. These findings imply a conservative estimate of at least a billion distinct genes in the prokaryotic genomic universe.

  7. Ebolavirus comparative genomics

    Jun, Se-Ran; Leuze, Michael R.; Nookaew, Intawat; Uberbacher, Edward C.; Land, Miriam; Zhang, Qian; Wanchai, Visanu; Chai, Juanjuan; Nielsen, Morten; Trolle, Thomas; Lund, Ole; Buzard, Gregory S.; Pedersen, Thomas D.; Wassenaar, Trudy M.; Ussery, David W.

    2015-01-01

    The 2014 Ebola outbreak in West Africa is the largest documented for this virus. To examine the dynamics of this genome, we compare more than 100 currently available ebolavirus genomes to each other and to other viral genomes. Based on oligomer frequency analysis, the family Filoviridae forms a distinct group from all other sequenced viral genomes. All filovirus genomes sequenced to date encode proteins with similar functions and gene order, although there is considerable divergence in sequences between the three genera Ebolavirus, Cuevavirus and Marburgvirus within the family Filoviridae. Whereas all ebolavirus genomes are quite similar (multiple sequences of the same strain are often identical), variation is most common in the intergenic regions and within specific areas of the genes encoding the glycoprotein (GP), nucleoprotein (NP) and polymerase (L). We predict regions that could contain epitope-binding sites, which might be good vaccine targets. This information, combined with glycosylation sites and experimentally determined epitopes, can identify the most promising regions for the development of therapeutic strategies. This manuscript has been authored by UT-Battelle, LLC under Contract No. DE-AC05-00OR22725 with the U.S. Department of Energy. The United States Government retains and the publisher, by accepting the article for publication, acknowledges that the United States Government retains a non-exclusive, paid-up, irrevocable, world-wide license to publish or reproduce the published form of this manuscript, or allow others to do so, for United States Government purposes. The Department of Energy will provide public access to these results of federally sponsored research in accordance with the DOE Public Access Plan (http://energy.gov/downloads/doe-public-access-plan). PMID:26175035

  8. Immunomodulatory effect of non-viable components of probiotic culture stimulated with heat-inactivated Escherichia coli and Bacillus cereus on holoxenic mice.

    Ditu, L M; Chifiriuc, M C; Bezirtzoglou, E; Marutescu, L; Bleotu, C; Pelinescu, D; Mihaescu, G; Lazar, V

    2014-01-01

    Competition of probiotic bacteria with other species from the intestinal microbiota involves different mechanisms that occur regardless of probiotics' viability. The objective of this paper was to assess the cytokine serum levels in holoxenic mice after oral administration of non-viable components (NVC) of Enterococcus faecium probiotic culture stimulated with heat-inactivated Escherichia coli and Bacillus cereus in comparison to NVC of unstimulated E. faecium probiotic culture. Probiotic E. faecium CMGb 16 culture, grown in the presence of heat-inactivated cultures of E. coli and B. cereus CMGB 102, was subsequently separated into supernatant (SN) and heat-inactivated cellular sediment (CS) fractions by centrifugation. Each NVC was orally administered to holoxenic mice (balb C mouse strain), in three doses, given at 24 hours. Blood samples were collected from the retinal artery, at 7, 14, and 21 days after the first administration of the NVC. The serum concentrations of IL-12 and tumor necrosis factor-alpha (TNF-α) interleukins were assessed by ELISA method. After the oral administration of SN component obtained from the probiotic culture stimulated with heat-inactivated cultures of B. cereus CMGB 102 and E. coli O28, the serum concentrations of IL-12 were maintained higher in the samples collected at 7 and 14 days post-administration. No specific TNF-α profile could be established, depending on stimulated or non-stimulated probiotic culture, NVC fraction, or harvesting time. The obtained results demonstrate that non-viable fractions of probiotic bacteria, stimulated by other bacterial species, could induce immunostimulatory effects mediated by cytokines and act, therefore, as immunological adjuvants.

  9. Implementation of the Bacillus cereus microbiological plate used for the screening of tetracyclines in raw milk samples with STAR protocol - the problem with false-negative results solved.

    Raspor Lainšček, P; Biasizzo, M; Henigman, U; Dolenc, J; Kirbiš, A

    2014-01-01

    In antibiotic residue analyses the first step of screening is just as important as the following steps. Screening methods need to be quick and inexpensive, but above all sensitive enough to detect the antibiotic residue at or below the maximum residue limit (MRL). In the case of a positive result, the next step is conducted and further methods are used for confirmation. MRLs stated in European Union Regulation 37/2010 for tetracyclines in raw milk are: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 100 µg kg(-1) for chlortetracycline and no limit for doxycycline because it is prohibited for use in animals from which milk is produced for human consumption. The current five-plate microbiological screening method for the detection of antibiotic residues in raw milk was found to be simple and inexpensive, but not specific, sensitive and reliable enough to detect tetracycline at MRL in routine raw milk screening procedures. Spiking samples with tetracycline at the MRL level and applying them on Bacillus cereus ATCC 11778 microbiological plates often gave false-negative results, indicating that tetracyclines may have to be inactivated or masked. Tetracyclines seem to bind to a certain component in milk. Consequently, when applying samples to the B. cereus microbiological plate the antibiotic cannot inhibit the growth of B. cereus which disables the formation of inhibition zones on the test plate. After adding the appropriate amount of citric acid into the milk samples, we solved the problem of false-negative results. During the validation 79 samples of milk were spiked with tetracyclines at different concentrations: 100 µg kg(-1) for tetracycline, 100 µg kg(-1) for oxytetracycline, 80 µg kg(-1) for chlortetracycline and 30 µg kg(-1) for doxycycline. Concentrations used in the validation matched the requirements for MRLs (they were either at or below the MRLs) stated in European Union Regulation 37/2010. The sensitivity of the validation was 100%.

  10. Structural and computational analysis of peptide recognition mechanism of class-C type penicillin binding protein, alkaline D-peptidase from Bacillus cereus DF4-B

    Nakano, Shogo; Okazaki, Seiji; Ishitsubo, Erika; Kawahara, Nobuhiro; Komeda, Hidenobu; Tokiwa, Hiroaki; Asano, Yasuhisa

    2015-01-01

    Alkaline D-peptidase from Bacillus cereus DF4-B, called ADP, is a D-stereospecific endopeptidase reacting with oligopeptides containing D-phenylalanine (D-Phe) at N-terminal penultimate residue. ADP has attracted increasing attention because it is useful as a catalyst for synthesis of D-Phe oligopeptides or, with the help of substrate mimetics, L-amino acid peptides and proteins. Structure and functional analysis of ADP is expected to elucidate molecular mechanism of ADP. In this study, the c...

  11. Inhibition of Bacillus cereus and Bacillus weihenstephanensis in raw vegetables by application of washing solutions containing enterocin AS-48 alone and in combination with other antimicrobials.

    Cobo Molinos, Antonio; Abriouel, Hikmate; Lucas López, Rosario; Ben Omar, Nabil; Valdivia, Eva; Gálvez, Antonio

    2008-09-01

    Enterocin AS-48 is a broad-spectrum cyclic antimicrobial peptide produced by Enterococcus faecalis. In the present study, the bacteriocin was tested alone and in combination with other antimicrobials for decontamination of Bacillus inoculated on alfalfa, soybean sprouts and green asparagus. Washing with enterocin AS-48 solutions reduced viable cell counts of Bacillus cereus and Bacillus weihenstephanensis by 1.0-1.5 and by 1.5-2.38 log units right after application of treatment, respectively. In both cases, the bacteriocin was effective in reducing the remaining viable population below detection levels during further storage of the samples at 6 degrees C, but failed to prevent regrowth in samples stored at 15 or 22 degrees C. Application of washing treatments containing enterocin AS-48 in combination with several other antimicrobials and sanitizers (cinnamic and hydrocinnamic acids, carvacrol, polyphosphoric acid, peracetic acid, hexadecylpyridinium chloride and sodium hypochlorite) greatly enhanced the bactericidal effects. The combinations of AS-48 and sodium hypochlorite, peracetic acid or hexadecylpyridinium chloride provided the best results. After application of the combined treatments on alfalfa sprouts contaminated with B. cereus or with B. weihenstephanensis, viable bacilli were not detected or remained at very low concentrations in the treated samples during a 1-week storage period at 15 degrees C. Inhibition of B. cereus by in situ produced bacteriocin was tested by cocultivation with the AS-48 producer strain E. faecalis A-48-32 inoculated on soybean sprouts. Strain A-48-32 was able to grow and produce bacteriocin on sprouts both at 15 and 22 degrees C. At 15 degrees C, growth of B. cereus was completely inhibited in the cocultures, while a much more limited effect was observed at 22 degrees C. The results obtained for washing treatments are very encouraging for the application of enterocin AS-48 in the decontamination of sprouts. Application of washing

  12. Lethality of chlorine, chlorine dioxide, and a commercial fruit and vegetable sanitizer to vegetative cells and spores of Bacillus cereus and spores of Bacillus thuringiensis.

    Beuchat, Larry R; Pettigrew, Charles A; Tremblay, Mario E; Roselle, Brian J; Scouten, Alan J

    2004-08-01

    Chlorine, ClO2, and a commercial raw fruit and vegetable sanitizer were evaluated for their effectiveness in killing vegetative cells and spores of Bacillus cereus and spores of Bacillus thuringiensis. The ultimate goal was to use one or both species as a potential surrogate(s) for Bacillus anthracis in studies that focus on determining the efficacy of sanitizers in killing the pathogen on food contact surfaces and foods. Treatment with alkaline (pH 10.5 to 11.0) ClO2 (200 microg/ml) produced by electrochemical technologies reduced populations of a five-strain mixture of vegetative cells and a five-strain mixture of spores of B. cereus by more than 5.4 and more than 6.4 log CFU/ml respectively, within 5 min. This finding compares with respective reductions of 4.5 and 1.8 log CFU/ml resulting from treatment with 200 microg/ml of chlorine. Treatment with a 1.5% acidified (pH 3.0) solution of Fit powder product was less effective, causing 2.5- and 0.4-log CFU/ml reductions in the number of B. cereus cells and spores, respectively. Treatment with alkaline ClO2 (85 microg/ml), acidified (pH 3.4) ClO2 (85 microg/ml), and a mixture of ClO2 (85 microg/ml) and Fit powder product (0.5%) (pH 3.5) caused reductions in vegetative cell/spore populations of more than 5.3/5.6, 5.3/5.7, and 5.3/6.0 log CFU/ml, respectively. Treatment of B. cereus and B. thuringiensis spores in a medium (3.4 mg/ml of organic and inorganic solids) in which cells had grown and produced spores with an equal volume of alkaline (pH 12.1) ClO2 (400 microg/ml) for 30 min reduced populations by 4.6 and 5.2 log CFU/ml, respectively, indicating high lethality in the presence of materials other than spores that would potentially react with and neutralize the sporicidal activity of ClO2.

  13. Personal genomics services: whose genomes?

    Gurwitz, David; Bregman-Eschet, Yael

    2009-07-01

    New companies offering personal whole-genome information services over the internet are dynamic and highly visible players in the personal genomics field. For fees currently ranging from US$399 to US$2500 and a vial of saliva, individuals can now purchase online access to their individual genetic information regarding susceptibility to a range of chronic diseases and phenotypic traits based on a genome-wide SNP scan. Most of the companies offering such services are based in the United States, but their clients may come from nearly anywhere in the world. Although the scientific validity, clinical utility and potential future implications of such services are being hotly debated, several ethical and regulatory questions related to direct-to-consumer (DTC) marketing strategies of genetic tests have not yet received sufficient attention. For example, how can we minimize the risk of unauthorized third parties from submitting other people's DNA for testing? Another pressing question concerns the ownership of (genotypic and phenotypic) information, as well as the unclear legal status of customers regarding their own personal information. Current legislation in the US and Europe falls short of providing clear answers to these questions. Until the regulation of personal genomics services catches up with the technology, we call upon commercial providers to self-regulate and coordinate their activities to minimize potential risks to individual privacy. We also point out some specific steps, along the trustee model, that providers of DTC personal genomics services as well as regulators and policy makers could consider for addressing some of the concerns raised below.

  14. The Nostoc punctiforme Genome

    John C. Meeks

    2001-12-31

    Nostoc punctiforme is a filamentous cyanobacterium with extensive phenotypic characteristics and a relatively large genome, approaching 10 Mb. The phenotypic characteristics include a photoautotrophic, diazotrophic mode of growth, but N. punctiforme is also facultatively heterotrophic; its vegetative cells have multiple development alternatives, including terminal differentiation into nitrogen-fixing heterocysts and transient differentiation into spore-like akinetes or motile filaments called hormogonia; and N. punctiforme has broad symbiotic competence with fungi and terrestrial plants, including bryophytes, gymnosperms and an angiosperm. The shotgun-sequencing phase of the N. punctiforme strain ATCC 29133 genome has been completed by the Joint Genome Institute. Annotation of an 8.9 Mb database yielded 7432 open reading frames, 45% of which encode proteins with known or probable known function and 29% of which are unique to N. punctiforme. Comparative analysis of the sequence indicates a genome that is highly plastic and in a state of flux, with numerous insertion sequences and multilocus repeats, as well as genes encoding transposases and DNA modification enzymes. The sequence also reveals the presence of genes encoding putative proteins that collectively define almost all characteristics of cyanobacteria as a group. N. punctiforme has an extensive potential to sense and respond to environmental signals as reflected by the presence of more than 400 genes encoding sensor protein kinases, response regulators and other transcriptional factors. The signal transduction systems and any of the large number of unique genes may play essential roles in the cell differentiation and symbiotic interaction properties of N. punctiforme.

  15. Visualization for genomics: the Microbial Genome Viewer.

    Kerkhoven, R.; Enckevort, F.H.J. van; Boekhorst, J.; Molenaar, D; Siezen, R.J.

    2004-01-01

    SUMMARY: A Web-based visualization tool, the Microbial Genome Viewer, is presented that allows the user to combine complex genomic data in a highly interactive way. This Web tool enables the interactive generation of chromosome wheels and linear genome maps from genome annotation data stored in a

  16. Comparing Mycobacterium tuberculosis genomes using genome topology networks.

    Jiang, Jianping; Gu, Jianlei; Zhang, Liang; Zhang, Chenyi; Deng, Xiao; Dou, Tonghai; Zhao, Guoping; Zhou, Yan

    2015-02-14

    Over the last decade, emerging research methods, such as comparative genomic analysis and phylogenetic study, have yielded new insights into genotypes and phenotypes of closely related bacterial strains. Several findings have revealed that genomic structural variations (SVs), including gene gain/loss, gene duplication and genome rearrangement, can lead to different phenotypes among strains, and an investigation of genes affected by SVs may extend our knowledge of the relationships between SVs and phenotypes in microbes, especially in pathogenic bacteria. In this work, we introduce a 'Genome Topology Network' (GTN) method based on gene homology and gene locations to analyze genomic SVs and perform phylogenetic analysis. Furthermore, the concept of 'unfixed ortholog' has been proposed, whose members are affected by SVs in genome topology among close species. To improve the precision of 'unfixed ortholog' recognition, a strategy to detect annotation differences and complete gene annotation was applied. To assess the GTN method, a set of thirteen complete M. tuberculosis genomes was analyzed as a case study. GTNs with two different gene homology-assigning methods were built, the Clusters of Orthologous Groups (COG) method and the orthoMCL clustering method, and two phylogenetic trees were constructed accordingly, which may provide additional insights into whole genome-based phylogenetic analysis. We obtained 24 unfixable COG groups, of which most members were related to immunogenicity and drug resistance, such as PPE-repeat proteins (COG5651) and transcriptional regulator TetR gene family members (COG1309). The GTN method has been implemented in PERL and released on our website. The tool can be downloaded from http://homepage.fudan.edu.cn/zhouyan/gtn/ , and allows re-annotating the 'lost' genes among closely related genomes, analyzing genes affected by SVs, and performing phylogenetic analysis. With this tool, many immunogenic-related and drug resistance-related genes

  17. The comER Gene Plays an Important Role in Biofilm Formation and Sporulation in both Bacillus subtilis and Bacillus cereus.

    Yan, Fang; Yu, Yiyang; Wang, Luyao; Luo, Yuming; Guo, Jian-Hua; Chai, Yunrong

    2016-01-01

    Bacteria adopt alternative cell fates during development. In Bacillus subtilis, the transition from planktonic growth to biofilm formation and sporulation is controlled by a complex regulatory circuit, in which the most important event is activation of Spo0A, a transcription factor and a master regulator for genes involved in both biofilm formation and sporulation. In B. cereus, the regulatory pathway controlling biofilm formation and cell differentiation is much less clear. In this study, we show that a novel gene, comER, plays a significant role in biofilm formation as well as sporulation in both B. subtilis and B. cereus. Mutations in the comER gene result in defects in biofilm formation and a delay in spore formation in the two Bacillus species. Our evidence supports the idea that comER may be part of the regulatory circuit that controls Spo0A activation. comER likely acts upstream of sda, a gene encoding a small checkpoint protein for both sporulation and biofilm formation, by blocking the phosphor-relay and thereby Spo0A activation. In summary, our studies outlined a conserved, positive role for comER, a gene whose function was previously uncharacterized, in the regulation of biofilm formation and sporulation in the two Bacillus species.

  18. Biorremediation of soil polluted by 75000 ppm of waste motor oil applying biostimulation and phytoremediation with Sorghum vulgare and Bacillus cereus or Burkholderia cepacia

    Balderas-León Iván

    2015-02-01

    Full Text Available Waste motor oil (WMO pollutes soil and causing lost soil fertility. An alternative to solve this problem its bioremediation (BR by double and following biostimulation (BS with mineral solution (MS and a legume as green manure (GM then using phytoremediation (PR with growth promoting vegetal bacteria (GPVB like Bacillus cereus and Burkholderia cepacia to minimize remaining WMO. The aims of this research were: a bioremediation of polluted soil by 75000 ppm of WMO by biostimulation and then b Its phytoremediation for remaining WMO by Sorghum vulgare inoculated with B. cereus and B. cepacia. Soil polluted by high concentration WMO was biostimulated with MS, and then Phaseolus vulgaris treated by GPVB was incorporated as GM, finally to apply PR to eliminate WMO with S. vulgare with GPVB. Results indicate that soil bioremediated by biostimulation with MS, WMO decreased at 32500 ppm/30 days, and then with GM, WMO was reduced at 10100 ppm after/90 days. Finally, to apply phytoremediation using S. vulgare and GPVB at flowering, WMO was reduced from 2500 ppm to 800 ppm. For recovering soil impacted by high concentration WMO to apply both techniques double and following BS and PR are the best option than each technique separately.

  19. The comER Gene Plays an Important Role in Biofilm Formation and Sporulation in both Bacillus subtilis and Bacillus cereus

    Yan, Fang; Yu, Yiyang; Wang, Luyao; Luo, Yuming; Guo, Jian-hua; Chai, Yunrong

    2016-01-01

    Bacteria adopt alternative cell fates during development. In Bacillus subtilis, the transition from planktonic growth to biofilm formation and sporulation is controlled by a complex regulatory circuit, in which the most important event is activation of Spo0A, a transcription factor and a master regulator for genes involved in both biofilm formation and sporulation. In B. cereus, the regulatory pathway controlling biofilm formation and cell differentiation is much less clear. In this study, we show that a novel gene, comER, plays a significant role in biofilm formation as well as sporulation in both B. subtilis and B. cereus. Mutations in the comER gene result in defects in biofilm formation and a delay in spore formation in the two Bacillus species. Our evidence supports the idea that comER may be part of the regulatory circuit that controls Spo0A activation. comER likely acts upstream of sda, a gene encoding a small checkpoint protein for both sporulation and biofilm formation, by blocking the phosphor-relay and thereby Spo0A activation. In summary, our studies outlined a conserved, positive role for comER, a gene whose function was previously uncharacterized, in the regulation of biofilm formation and sporulation in the two Bacillus species. PMID:27446060

  20. Effects of Mentha longifolia L. essential oil and nisin alone and in combination on Bacillus cereus and Bacillus subtilis in a food model and bacterial ultrastructural changes.

    Pajohi, Mohamad Reza; Tajik, Hossein; Farshid, Amir Abbas; Basti, Afshin Akhondzadeh; Hadian, Mojtaba

    2011-02-01

    In the face of emerging new pathogens and ever-growing health-conscious customers, food preservation technology remains on the top agenda of food industry. This study was aimed at determining the effects of the essential oil of Mentha longifolia L., alone and in combination with nisin, on Bacillus cereus and Bacillus subtilis at 8°C and 25°C in a food model (commercial barley soup) during 15 days. The essential oil alone at 8°C inhibited bacterial growth significantly compared with the control (p < 0.05). However, at 25°C, none of the concentrations of the essential oil alone showed inhibitory effect on bacterial growth. At 8°C, the combination effect of the essential oil and nisin on bacteria was noted at 0.25 μg mL(-1) for nisin and 0.05 μL mL(-1) for the essential oil (p < 0.05). The combination of nisin and the essential oil demonstrated significant inhibitory effects on the vegetative forms of bacteria at 25°C, although it was comparable to that of nisin alone at the same concentrations. Electron microscopy studies revealed a great deal of damage to B. cereus treated with a combination of nisin and the essential oil. However, the combination of nisin with the essential oil led to a complete destruction of cell wall and cytoplasm of vegetative cells of B. subtilis.

  1. Crystal structures of two transcriptional regulators from Bacillus cereus define the conserved structural features of a PadR subfamily.

    Guntur Fibriansah

    Full Text Available PadR-like transcriptional regulators form a structurally-related family of proteins that control the expression of genes associated with detoxification, virulence and multi-drug resistance in bacteria. Only a few members of this family have been studied by genetic, biochemical and biophysical methods, and their structure/function relationships are still largely undefined. Here, we report the crystal structures of two PadR-like proteins from Bacillus cereus, which we named bcPadR1 and bcPadR2 (products of gene loci BC4206 and BCE3449 in strains ATCC 14579 and ATCC 10987, respectively. BC4206, together with its neighboring gene BC4207, was previously shown to become significantly upregulated in presence of the bacteriocin AS-48. DNA mobility shift assays reveal that bcPadR1 binds to a 250 bp intergenic region containing the putative BC4206-BC4207 promoter sequence, while in-situ expression of bcPadR1 decreases bacteriocin tolerance, together suggesting a role for bcPadR1 as repressor of BC4206-BC4207 transcription. The function of bcPadR2 (48% identical in sequence to bcPadR1 is unknown, but the location of its gene just upstream from genes encoding a putative antibiotic ABC efflux pump, suggests a role in regulating antibiotic resistance. The bcPadR proteins are structurally similar to LmrR, a PadR-like transcription regulator in Lactococcus lactis that controls expression of a multidrug ABC transporter via a mechanism of multidrug binding and induction. Together these proteins define a subfamily of conserved, relatively small PadR proteins characterized by a single C-terminal helix for dimerization. Unlike LmrR, bcPadR1 and bcPadR2 lack a central pore for ligand binding, making it unclear whether the transcriptional regulatory roles of bcPadR1 and bcPadR2 involve direct ligand recognition and induction.

  2. Ancient genomics

    Der Sarkissian, Clio; Allentoft, Morten Erik; Avila Arcos, Maria del Carmen

    2015-01-01

    throughput of next generation sequencing platforms and the ability to target short and degraded DNA molecules. Many ancient specimens previously unsuitable for DNA analyses because of extensive degradation can now successfully be used as source materials. Additionally, the analytical power obtained...... by increasing the number of sequence reads to billions effectively means that contamination issues that have haunted aDNA research for decades, particularly in human studies, can now be efficiently and confidently quantified. At present, whole genomes have been sequenced from ancient anatomically modern humans...

  3. Marine genomics

    Oliveira Ribeiro, Ângela Maria; Foote, Andrew David; Kupczok, Anne

    2017-01-01

    Marine ecosystems occupy 71% of the surface of our planet, yet we know little about their diversity. Although the inventory of species is continually increasing, as registered by the Census of Marine Life program, only about 10% of the estimated two million marine species are known. This lag......-throughput sequencing approaches have been helping to improve our knowledge of marine biodiversity, from the rich microbial biota that forms the base of the tree of life to a wealth of plant and animal species. In this review, we present an overview of the applications of genomics to the study of marine life, from...

  4. Re-evaluation of the taxonomy of the Mitis group of the genus Streptococcus based on whole genome phylogenetic analyses, and proposed reclassification of Streptococcus dentisani as Streptococcus oralis subsp. dentisani comb. nov., Streptococcus tigurinus as Streptococcus oralis subsp. tigurinus comb. nov., and Streptococcus oligofermentans as a later synonym of Streptococcus cristatus.

    Jensen, Anders; Scholz, Christian F P; Kilian, Mogens

    2016-11-01

    The Mitis group of the genus Streptococcus currently comprises 20 species with validly published names, including the pathogen S. pneumoniae. They have been the subject of much taxonomic confusion, due to phenotypic overlap and genetic heterogeneity, which has hampered a full appreciation of their clinical significance. The purpose of this study was to critically re-examine the taxonomy of the Mitis group using 195 publicly available genomes, including designated type strains for phylogenetic analyses based on core genomes, multilocus sequences and 16S rRNA gene sequences, combined with estimates of average nucleotide identity (ANI) and in silico and in vitro analyses of specific phenotypic characteristics. Our core genomic phylogenetic analyses revealed distinct clades that, to some extent, and from the clustering of type strains represent known species. However, many of the genomes have been incorrectly identified adding to the current confusion. Furthermore, our data show that 16S rRNA gene sequences and ANI are unsuitable for identifying and circumscribing new species of the Mitis group of the genus Streptococci. Based on the clustering patterns resulting from core genome phylogenetic analysis, we conclude that S. oligofermentans is a later synonym of S. cristatus. The recently described strains of the species Streptococcus dentisani includes one previously referred to as 'S. mitis biovar 2'. Together with S. oralis, S. dentisani and S. tigurinus form subclusters within a coherent phylogenetic clade. We propose that the species S. oralis consists of three subspecies: S. oralis subsp. oralis subsp. nov., S. oralis subsp. tigurinus comb. nov., and S. oralis subsp. dentisani comb. nov.

  5. Insights into Conifer Giga-Genomes1

    De La Torre, Amanda R.; Birol, Inanc; Bousquet, Jean; Ingvarsson, Pär K.; Jansson, Stefan; Jones, Steven J.M.; Keeling, Christopher I.; MacKay, John; Nilsson, Ove; Ritland, Kermit; Street, Nathaniel; Yanchuk, Alvin; Zerbe, Philipp; Bohlmann, Jörg

    2014-01-01

    Insights from sequenced genomes of major land plant lineages have advanced research in almost every aspect of plant biology. Until recently, however, assembled genome sequences of gymnosperms have been missing from this picture. Conifers of the pine family (Pinaceae) are a group of gymnosperms that dominate large parts of the world’s forests. Despite their ecological and economic importance, conifers seemed long out of reach for complete genome sequencing, due in part to their enormous genome size (20–30 Gb) and the highly repetitive nature of their genomes. Technological advances in genome sequencing and assembly enabled the recent publication of three conifer genomes: white spruce (Picea glauca), Norway spruce (Picea abies), and loblolly pine (Pinus taeda). These genome sequences revealed distinctive features compared with other plant genomes and may represent a window into the past of seed plant genomes. This Update highlights recent advances, remaining challenges, and opportunities in light of the publication of the first conifer and gymnosperm genomes. PMID:25349325

  6. glucanase from Bacillus cereus

    DR. NJ TONUKARI

    2011-11-16

    Nov 16, 2011 ... showed that secondary structure of the CMCase mainly consists of α-helix structures in solid phase. ... Cellulose, an abundant and renewable energy resource, .... reciprocal plot of the initial reaction rates at different substrate ...

  7. Influence of temperature shifts on survival, growth, and toxin production by psychrotrophic and mesophilic strains of Bacillus cereus in potatoes and chicken gravy.

    Mahakarnchanakul, W; Beuchat, L R

    1999-03-15

    A study was done to determine the influence of temperature on growth and toxin production characteristics of psychrotrophic and mesophilic strains of Bacillus cereus when inoculated into mashed potatoes and chicken gravy containing various concentrations of sodium chloride and held at temperatures different from those at which cells had been cultured. Logarithmic growth phase cells (10 h, 30 degrees C) of psychrotrophic (F3802A/84) and mesophilic (B4ac-1) strains of Bacillus cereus were inoculated into rehydrated commercially processed instant mashed potatoes and chicken gravy supplemented with 0, 2, or 4% sodium chloride. Growth, survival, and diarrheal toxin production in potatoes and gravy held at 30, 37, and 10 degrees C (strain F3802A/84) or 30, 40, and 10 degrees C (strain B4ac-1) were monitored. Both strains grew in both foods containing no added sodium chloride or 2% sodium chloride when held at 30, 37, or 40 degrees C for 2 days. Strain B4ac-1 grew better than strain F3802A/84 in foods containing 4% sodium chloride. Maximum amounts of enterotoxin (1024 ng/g) were produced by strain B4ac-1 in chicken gravy held at 30 and 40 degrees C. Strain F3802A/84 grew to populations of 7 log10 CFU/g in foods containing no added sodium chloride or 2% sodium chloride at 10 degrees C. Strain F3802A/84 produced the highest amount of enterotoxin (1024 ng/g) at 30 degrees C in chicken gravy containing 0.7 or 2% sodium chloride; however, little or low amounts of toxin (4-16 ng/g) were produced in chicken gravy at 10 degrees C. Compared to strain B4ac-1, cells of strain F3802A/84 subjected to a downward shift in incubation temperature (10 degrees C) grew more rapidly in chicken gravy. Strain B4ac-1 produced the highest amount of toxin (1024 ng/g) at 30 degrees C in gravy containing 4% sodium chloride and at 40 degrees C in gravy containing 0.7% sodium chloride. Toxin was not detected in inoculated mashed potatoes. Results of this study indicate that shifts in incubation

  8. Detection of enterotoxins produced by B. cereus through PCR analysis of ground and roasted coffee samples in Rio de Janeiro, Brazil

    Cyllene de Matos Ornelas da Cunha Corrêa de Souza

    2011-06-01

    Full Text Available Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984 was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid, according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR methods for hblA, hblD and hblC genes (encoding hemolysin HBL and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE. Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17 were positive for the 3 genes encoding the HBL complex; 35.3% (6/17 were positive for the three NHE encoding genes; and 29.4% (5/17 were positive for

  9. Ensembl Genomes 2016: more genomes, more complexity.

    Kersey, Paul Julian; Allen, James E; Armean, Irina; Boddu, Sanjay; Bolt, Bruce J; Carvalho-Silva, Denise; Christensen, Mikkel; Davis, Paul; Falin, Lee J; Grabmueller, Christoph; Humphrey, Jay; Kerhornou, Arnaud; Khobova, Julia; Aranganathan, Naveen K; Langridge, Nicholas; Lowy, Ernesto; McDowall, Mark D; Maheswari, Uma; Nuhn, Michael; Ong, Chuang Kee; Overduin, Bert; Paulini, Michael; Pedro, Helder; Perry, Emily; Spudich, Giulietta; Tapanari, Electra; Walts, Brandon; Williams, Gareth; Tello-Ruiz, Marcela; Stein, Joshua; Wei, Sharon; Ware, Doreen; Bolser, Daniel M; Howe, Kevin L; Kulesha, Eugene; Lawson, Daniel; Maslen, Gareth; Staines, Daniel M

    2016-01-04

    Ensembl Genomes (http://www.ensemblgenomes.org) is an integrating resource for genome-scale data from non-vertebrate species, complementing the resources for vertebrate genomics developed in the context of the Ensembl project (http://www.ensembl.org). Together, the two resources provide a consistent set of programmatic and interactive interfaces to a rich range of data including reference sequence, gene models, transcriptional data, genetic variation and comparative analysis. This paper provides an update to the previous publications about the resource, with a focus on recent developments. These include the development of new analyses and views to represent polyploid genomes (of which bread wheat is the primary exemplar); and the continued up-scaling of the resource, which now includes over 23 000 bacterial genomes, 400 fungal genomes and 100 protist genomes, in addition to 55 genomes from invertebrate metazoa and 39 genomes from plants. This dramatic increase in the number of included genomes is one part of a broader effort to automate the integration of archival data (genome sequence, but also associated RNA sequence data and variant calls) within the context of reference genomes and make it available through the Ensembl user interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Rodent malaria parasites : genome organization & comparative genomics

    Kooij, Taco W.A.

    2006-01-01

    The aim of the studies described in this thesis was to investigate the genome organization of rodent malaria parasites (RMPs) and compare the organization and gene content of the genomes of RMPs and the human malaria parasite P. falciparum. The release of the complete genome sequence of P.

  11. Feast and famine in plant genomes.

    Jonathan F. Wendel; Richard C. Cronn; J. Spencer Jonhston; H. James. Price

    2002-01-01

    Plant genomes vary over several orders of magnitude in size, even among closely related species, yet the origin, genesis and significance of this variation are not clear. Because DNA content varies over a sevenfold range among diploid species in the cotton genus (Gossypium) and its allies, this group offers opportunities for exploring patterns and mechanisms of genome...

  12. Genome bioinformatics of tomato and potato

    Datema, E.

    2011-01-01

    In the past two decades genome sequencing has developed from a laborious and costly technology employed by large international consortia to a widely used, automated and affordable tool used worldwide by many individual research groups. Genome sequences of many food animals and crop plants have

  13. Human Germline Genome Editing.

    Ormond, Kelly E; Mortlock, Douglas P; Scholes, Derek T; Bombard, Yvonne; Brody, Lawrence C; Faucett, W Andrew; Garrison, Nanibaa' A; Hercher, Laura; Isasi, Rosario; Middleton, Anna; Musunuru, Kiran; Shriner, Daniel; Virani, Alice; Young, Caroline E

    2017-08-03

    With CRISPR/Cas9 and other genome-editing technologies, successful somatic and germline genome editing are becoming feasible. To respond, an American Society of Human Genetics (ASHG) workgroup developed this position statement, which was approved by the ASHG Board in March 2017. The workgroup included representatives from the UK Association of Genetic Nurses and Counsellors, Canadian Association of Genetic Counsellors, International Genetic Epidemiology Society, and US National Society of Genetic Counselors. These groups, as well as the American Society for Reproductive Medicine, Asia Pacific Society of Human Genetics, British Society for Genetic Medicine, Human Genetics Society of Australasia, Professional Society of Genetic Counselors in Asia, and Southern African Society for Human Genetics, endorsed the final statement. The statement includes the following positions. (1) At this time, given the nature and number of unanswered scientific, ethical, and policy questions, it is inappropriate to perform germline gene editing that culminates in human pregnancy. (2) Currently, there is no reason to prohibit in vitro germline genome editing on human embryos and gametes, with appropriate oversight and consent from donors, to facilitate research on the possible future clinical applications of gene editing. There should be no prohibition on making public funds available to support this research. (3) Future clinical application of human germline genome editing should not proceed unless, at a minimum, there is (a) a compelling medical rationale, (b) an evidence base that supports its clinical use, (c) an ethical justification, and (d) a transparent public process to solicit and incorporate stakeholder input. Copyright © 2017 American Society of Human Genetics. All rights reserved.

  14. Produção de material de referência para ensaio de proficiência de enumeração de Bacillus cereus em leite / Preparation of reference material for proficiency test for enumeration of Bacillus cereus in milk

    Marcelo Luiz Lima Brandão

    2014-02-01

    Full Text Available A participação em ensaios de proficiência é essencial para que um laboratório de ensaio possa ter seu desempenho avaliado por meio de uma comparação interlaboratorial. O objetivo deste trabalho foi produzir um material de referência (MR quantitativo para EP contendo Bacillus cereus em leite em pó. Uma solução estéril de leite desnatado a 10% contendo 100 mM de sacarose foi contaminada com uma cepa de B. cereus em uma concentração previamente determinada. A matriz foi homogeneizada, distribuída em frascos e liofilizada. O lote produzido foi considerado suficientemente homogêneo atribuindo-se um desvio-padrão alvo de 0,25 log10 UFC/mL. O MR apresentou-se estável a ≤ -70 ºC e (-20 ± 4 ºC durante 1.058 e 60 dias, respectivamente. Na avaliação da influência de diferentes temperaturas para o transporte deste material, o MR se apresentou estável a 4 ºC, 25 ºC e 35 ºC durante o período de quatro dias de estudo. Conclui-se que o lote produzido apresentou todos os requisitos necessários para ser utilizado como itens de EP. ---------------------------------------------------------------------- The participation in proficiency testing (PT is essential for testing laboratories to prove their technical competence. The aim of this study was to produce a quantitative reference material (RM for PT containing Bacillus cereus in milk powder. A sterile solution of 10% skim milk containing 100 mM sucrose was contaminated with a B. cereus strain in a specific concentration. The homogenized matrix was distributed into vials and freeze- -drying. The batch produced was considered sufficiently homogeneous assigning a target standard deviation of 0.25. The RM was stable at ≤ -70 ºC and (-20 ± 4 ºC for 1,058 and 60 days, respectively. In the evaluation of temperatures for the transport of material, the RM was stable at 4, 25 and 35 ºC during four days. It is concluded that the batch produced had all the necessary requirements to be

  15. Funding Opportunity: Genomic Data Centers

    Funding Opportunity CCG, Funding Opportunity Center for Cancer Genomics, CCG, Center for Cancer Genomics, CCG RFA, Center for cancer genomics rfa, genomic data analysis network, genomic data analysis network centers,

  16. Application of a molecular beacon based real-time isothermal amplification (MBRTIA) technology for simultaneous detection of Bacillus cereus and Staphylococcus aureus.

    Mandappa, I M; Joglekar, Prasanna; Manonmani, H K

    2015-07-01

    A multiplex real-time isothermal amplification assay was developed using molecular beacons for the detection of Bacillus cereus and Staphylococcus aureus by targeting four important virulence genes. A correlation between targeting highly accessible DNA sequences and isothermal amplification based molecular beacon efficiency and sensitivity was demonstrated using phi(Φ)29 DNA polymerase at a constant isothermal temperature of 30 °C. It was very selective and consistently detected down to 10(1) copies of DNA. The specificity and sensitivity of this assay, when tested with pure culture were high, surpassing those of currently used PCR assays for the detection of these organisms. The molecular beacon based real-time isothermal amplification (MBRTIA) assay could be carried out entirely in 96 well plates or well strips, enabling a rapid and high-throughput detection of food borne pathogens.

  17. Characterization of cell-free extracts from fenpropathrin-degrading strain Bacillus cereus ZH-3 and its potential for bioremediation of pyrethroid-contaminated soils.

    Liu, Jie; Huang, Wenwen; Han, Haitao; She, Changchun; Zhong, Guohua

    2015-08-01

    Synthetic pyrethroid fenpropathrin has received increasing attention because of its environmental contamination and toxic effects on non-target organisms including human beings. Here we report the degradation characteristics of cell-free extracts from fenpropathrin-degrading strain Bacillus cereus ZH-3 and its potential for pyrethroid bioremediation in soils. 50mg·L(-1) of fenpropathrin was decreased to 20.6mg·L(-1) by the enzymatic extracts (869.4mg·L(-1)) within 30min. Kinetic constants Km and Vm were determined to be 1006.7nmol·L(-1) and 56.8nmol·min(-1), respectively. Degradation products were identified as 3-phenoxybenzaldehyde, α-hydroxy-3-phenoxy-benzeneacetonitrile and phenol by gas chromatography-mass spectrometry (GC-MS). In addition to degradation of fenpropathrin, the cell-free extracts could degrade other pyrethroids including beta-cypermethrin, cyfluthrin, deltamethrin and cypermethrin. Additionally, the reaction conditions were optimized. In the sterile and non-sterile soils, 50mg·kg(-1) of fenpropathrin was reduced to 15.3 and 13.9mg·L(-1) in 1d, respectively. Sprayed 100 and 300mg·kg(-1) of fenpropathrin emulsifiable concentrate (EC), up to 84.6% and 92.1% of soil fenpropathrin were removed from soils within 7d, respectively. Taken together, our results depict the biodegradation characteristics of cell-free extracts from B. cereus ZH-3, highlight its promising potential in bioremediation of pyrethroid-contaminated soils and also provide new insights into the utilization of degrading microbes. Copyright © 2015. Published by Elsevier B.V.

  18. Bacillus cereus Fnr binds a [4Fe-4S] cluster and forms a ternary complex with ResD and PlcR

    Esbelin Julia

    2012-06-01

    Full Text Available Abstract Background Bacillus cereus is a facultative anaerobe that causes diarrheal disease in humans. Diarrheal syndrome may result from the secretion of various virulence factors including hemolysin BL and nonhemolytic enterotoxin Nhe. Expression of genes encoding Hbl and Nhe is regulated by the two redox systems, ResDE and Fnr, and the virulence regulator PlcR. B. cereus Fnr is a member of the Crp/Fnr family of iron-sulfur (Fe-S proteins. Only its apo-form has so far been studied. A major goal in deciphering the Fnr-dependent regulation of enterotoxin genes is thus to obtain and characterize holoFnr. Results Fnr has been subjected to in vitro Fe-S cluster reconstitution under anoxic conditions. UV-visible and EPR spectroscopic analyses together with the chemical estimation of the iron content indicated that Fnr binds one [4Fe-4S]2+ cluster per monomer. Atmospheric O2 causes disassembly of the Fe-S cluster, which exhibited a half-life of 15 min in air. Holo- and apoFnr have similar affinities for the nhe and hbl promoter regions, while holoFnr has a higher affinity for fnr promoter region than apoFnr. Both the apo- and holo-form of Fnr interact with ResD and PlcR to form a ternary complex. Conclusions Overall, this work shows that incorporation of the [4Fe-4S]2+ cluster is not required for DNA binding of Fnr to promoter regions of hbl and nhe enterotoxin genes or for the formation of a ternary complex with ResD and PlcR. This points to some new unusual properties of Fnr that may have physiological relevance in the redox regulation of enterotoxin gene regulation.

  19. Exploring Other Genomes: Bacteria.

    Flannery, Maura C.

    2001-01-01

    Points out the importance of genomes other than the human genome project and provides information on the identified bacterial genomes Pseudomonas aeuroginosa, Leprosy, Cholera, Meningitis, Tuberculosis, Bubonic Plague, and plant pathogens. Considers the computer's use in genome studies. (Contains 14 references.) (YDS)

  20. Whole-genome sequence of the Tibetan frog Nanorana parkeri and the comparative evolution of tetrapod genomes.

    Sun, Yan-Bo; Xiong, Zi-Jun; Xiang, Xue-Yan; Liu, Shi-Ping; Zhou, Wei-Wei; Tu, Xiao-Long; Zhong, Li; Wang, Lu; Wu, Dong-Dong; Zhang, Bao-Lin; Zhu, Chun-Ling; Yang, Min-Min; Chen, Hong-Man; Li, Fang; Zhou, Long; Feng, Shao-Hong; Huang, Chao; Zhang, Guo-Jie; Irwin, David; Hillis, David M; Murphy, Robert W; Yang, Huan-Ming; Che, Jing; Wang, Jun; Zhang, Ya-Ping

    2015-03-17

    The development of efficient sequencing techniques has resulted in large numbers of genomes being available for evolutionary studies. However, only one genome is available for all amphibians, that of Xenopus tropicalis, which is distantly related from the majority of frogs. More than 96% of frogs belong to the Neobatrachia, and no genome exists for this group. This dearth of amphibian genomes greatly restricts genomic studies of amphibians and, more generally, our understanding of tetrapod genome evolution. To fill this gap, we provide the de novo genome of a Tibetan Plateau frog, Nanorana parkeri, and compare it to that of X. tropicalis and other vertebrates. This genome encodes more than 20,000 protein-coding genes, a number similar to that of Xenopus. Although the genome size of Nanorana is considerably larger than that of Xenopus (2.3 vs. 1.5 Gb), most of the difference is due to the respective number of transposable elements in the two genomes. The two frogs exhibit considerable conserved whole-genome synteny despite having diverged approximately 266 Ma, indicating a slow rate of DNA structural evolution in anurans. Multigenome synteny blocks further show that amphibians have fewer interchromosomal rearrangements than mammals but have a comparable rate of intrachromosomal rearrangements. Our analysis also identifies 11 Mb of anuran-specific highly conserved elements that will be useful for comparative genomic analyses of frogs. The Nanorana genome offers an improved understanding of evolution of tetrapod genomes and also provides a genomic reference for other evolutionary studies.

  1. Genomics With Cloud Computing

    Sukhamrit Kaur; Sandeep Kaur

    2015-01-01

    Abstract Genomics is study of genome which provides large amount of data for which large storage and computation power is needed. These issues are solved by cloud computing that provides various cloud platforms for genomics. These platforms provides many services to user like easy access to data easy sharing and transfer providing storage in hundreds of terabytes more computational power. Some cloud platforms are Google genomics DNAnexus and Globus genomics. Various features of cloud computin...

  2. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun

    2014-01-01

    Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738

  3. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Zheng Ping

    2014-01-01

    Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.

  4. Genome Maps, a new generation genome browser.

    Medina, Ignacio; Salavert, Francisco; Sanchez, Rubén; de Maria, Alejandro; Alonso, Roberto; Escobar, Pablo; Bleda, Marta; Dopazo, Joaquín

    2013-07-01

    Genome browsers have gained importance as more genomes and related genomic information become available. However, the increase of information brought about by new generation sequencing technologies is, at the same time, causing a subtle but continuous decrease in the efficiency of conventional genome browsers. Here, we present Genome Maps, a genome browser that implements an innovative model of data transfer and management. The program uses highly efficient technologies from the new HTML5 standard, such as scalable vector graphics, that optimize workloads at both server and client sides and ensure future scalability. Thus, data management and representation are entirely carried out by the browser, without the need of any Java Applet, Flash or other plug-in technology installation. Relevant biological data on genes, transcripts, exons, regulatory features, single-nucleotide polymorphisms, karyotype and so forth, are imported from web services and are available as tracks. In addition, several DAS servers are already included in Genome Maps. As a novelty, this web-based genome browser allows the local upload of huge genomic data files (e.g. VCF or BAM) that can be dynamically visualized in real time at the client side, thus facilitating the management of medical data affected by privacy restrictions. Finally, Genome Maps can easily be integrated in any web application by including only a few lines of code. Genome Maps is an open source collaborative initiative available in the GitHub repository (https://github.com/compbio-bigdata-viz/genome-maps). Genome Maps is available at: http://www.genomemaps.org.

  5. Whole genome shotgun sequencing of Indian strains of Streptococcus agalactiae

    Balaji Veeraraghavan

    2017-12-01

    Full Text Available Group B streptococcus is known as a leading cause of neonatal infections in developing countries. The present study describes the whole genome shotgun sequences of four Group B Streptococcus (GBS isolates. Molecular data on clonality is lacking for GBS in India. The present genome report will add important information on the scarce genome data of GBS and will help in deriving comparative genome studies of GBS isolates at global level. This Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession numbers NHPL00000000 – NHPO00000000.

  6. Modification of membrane sulfhydryl groups in bacteriostatic action of nitrite

    Buchman, G.W. III; Hansen, J.N.

    1987-01-01

    The mechanism by which nitrite inhibits outgrowing spores of bacillus cereus T was examined by using techniques developed earlier for nitrite analogs. The morphological stage of inhibition, cooperativity effects, effect of pH on inhibition, kinetics of protection against tritiated iodoacetate incorporation into membrane sulfhydryl groups, and protection against the bacteriocidal effect of carboxymethylation of iodoacetate indicate that nitrite acts as a membrane-directed sulfhydryl agent. The mechanism by which nitrite modifies the chemical reactivity of the sulfhyrdyl group could be either direct covalent modification or inactivation through communication with another modified membrane component. Profiles of pH effects suggest that the active agent is the protonated form of nitrite. The nitrite concentrations which modify membrane sulfhydryl activity coincide with those which have a bacteriostatic effect. These results are consistent with membrane sulfhydryl modification as a component of the mechanism of nitrite-induced bacteriostasis in this aerobic sporeformer

  7. JGI Fungal Genomics Program

    Grigoriev, Igor V.

    2011-03-14

    Genomes of energy and environment fungi are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 50 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such 'parts' suggested by comparative genomics and functional analysis in these areas are presented here

  8. Genomic Encyclopedia of Fungi

    Grigoriev, Igor

    2012-08-10

    Genomes of fungi relevant to energy and environment are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 150 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such parts suggested by comparative genomics and functional analysis in these areas are presented here.

  9. Identification and assembly of genomes and genetic elements in complex metagenomic samples without using reference genomes

    Nielsen, Henrik Bjørn; Almeida, Mathieu; Juncker, Agnieszka

    2014-01-01

    of microbial genomes without the need for reference sequences. We demonstrate the method on data from 396 human gut microbiome samples and identify 7,381 co-abundance gene groups (CAGs), including 741 metagenomic species (MGS). We use these to assemble 238 high-quality microbial genomes and identify...

  10. Genomics With Cloud Computing

    Sukhamrit Kaur

    2015-04-01

    Full Text Available Abstract Genomics is study of genome which provides large amount of data for which large storage and computation power is needed. These issues are solved by cloud computing that provides various cloud platforms for genomics. These platforms provides many services to user like easy access to data easy sharing and transfer providing storage in hundreds of terabytes more computational power. Some cloud platforms are Google genomics DNAnexus and Globus genomics. Various features of cloud computing to genomics are like easy access and sharing of data security of data less cost to pay for resources but still there are some demerits like large time needed to transfer data less network bandwidth.

  11. The effect of monolaurin in combination with Mentha pulegium L. and Mentha spicata L. essential oils on Bacillus cereus and E. coli O157:H7: in vitro study

    M Neyriz Nagadehi

    2010-02-01

    Full Text Available Monolaurin, pennyroyal (Mentha pulegium L., Labiatae and spearmint (Mentha spicata L. essential oils have various antibacterial activities on microorganisms. Enhancement of antibacterial activity and detection of their combined effects on B.cereus ATCC 11778 and E. coli O157:H7 were the purpose of this investigation. Monolaurin preparation, spearmint and pennyroyal essential oils preparation and analysis of their chemical composition with GC-MS method, bacterial inoculums preparation, antimicrobial susceptibility testing using broth micro dilution MIC testing and finally statistic analysis of results with SPSS software package were the material and methods used in this research. MIC (minimum inhibitory concentration of pennyroyal oil, spearmint oil, monolaurin, monolaurin-pennyroyal oil combination and monolaurin-spearmint oil combination on B.cereus and E. coli O157:H7 were significant (p

  12. Two New Loci for Body-Weight Regulation Identified in a Joint Analysis of Genome-Wide Association Studies for Early-Onset Extreme Obesity in French and German Study Groups

    Scherag, André; Dina, Christian; Hinney, Anke; Vatin, Vincent; Scherag, Susann; Vogel, Carla I. G.; Müller, Timo D.; Grallert, Harald; Wichmann, H.-Erich; Balkau, Beverley; Heude, Barbara; Jarvelin, Marjo-Riitta; Hartikainen, Anna-Liisa; Levy-Marchal, Claire; Weill, Jacques; Delplanque, Jérôme; Körner, Antje; Kiess, Wieland; Kovacs, Peter; Rayner, Nigel W.; Prokopenko, Inga; McCarthy, Mark I.; Schäfer, Helmut; Jarick, Ivonne; Boeing, Heiner; Fisher, Eva; Reinehr, Thomas; Heinrich, Joachim; Rzehak, Peter; Berdel, Dietrich; Borte, Michael; Biebermann, Heike; Krude, Heiko; Rosskopf, Dieter; Rimmbach, Christian; Rief, Winfried; Fromme, Tobias; Klingenspor, Martin; Schürmann, Annette; Schulz, Nadja; Nöthen, Markus M.; Mühleisen, Thomas W.; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne; Boes, Tanja; Illig, Thomas; Froguel, Philippe; Hebebrand, Johannes; Meyre, David

    2010-01-01

    Meta-analyses of population-based genome-wide association studies (GWAS) in adults have recently led to the detection of new genetic loci for obesity. Here we aimed to discover additional obesity loci in extremely obese children and adolescents. We also investigated if these results generalize by estimating the effects of these obesity loci in adults and in population-based samples including both children and adults. We jointly analysed two GWAS of 2,258 individuals and followed-up the best, according to lowest p-values, 44 single nucleotide polymorphisms (SNP) from 21 genomic regions in 3,141 individuals. After this DISCOVERY step, we explored if the findings derived from the extremely obese children and adolescents (10 SNPs from 5 genomic regions) generalized to (i) the population level and (ii) to adults by genotyping another 31,182 individuals (GENERALIZATION step). Apart from previously identified FTO, MC4R, and TMEM18, we detected two new loci for obesity: one in SDCCAG8 (serologically defined colon cancer antigen 8 gene; p = 1.85×10−8 in the DISCOVERY step) and one between TNKS (tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase gene) and MSRA (methionine sulfoxide reductase A gene; p = 4.84×10−7), the latter finding being limited to children and adolescents as demonstrated in the GENERALIZATION step. The odds ratios for early-onset obesity were estimated at ∼1.10 per risk allele for both loci. Interestingly, the TNKS/MSRA locus has recently been found to be associated with adult waist circumference. In summary, we have completed a meta-analysis of two GWAS which both focus on extremely obese children and adolescents and replicated our findings in a large followed-up data set. We observed that genetic variants in or near FTO, MC4R, TMEM18, SDCCAG8, and TNKS/MSRA were robustly associated with early-onset obesity. We conclude that the currently known major common variants related to obesity overlap to a substantial degree between

  13. Two new Loci for body-weight regulation identified in a joint analysis of genome-wide association studies for early-onset extreme obesity in French and german study groups.

    André Scherag

    2010-04-01

    Full Text Available Meta-analyses of population-based genome-wide association studies (GWAS in adults have recently led to the detection of new genetic loci for obesity. Here we aimed to discover additional obesity loci in extremely obese children and adolescents. We also investigated if these results generalize by estimating the effects of these obesity loci in adults and in population-based samples including both children and adults. We jointly analysed two GWAS of 2,258 individuals and followed-up the best, according to lowest p-values, 44 single nucleotide polymorphisms (SNP from 21 genomic regions in 3,141 individuals. After this DISCOVERY step, we explored if the findings derived from the extremely obese children and adolescents (10 SNPs from 5 genomic regions generalized to (i the population level and (ii to adults by genotyping another 31,182 individuals (GENERALIZATION step. Apart from previously identified FTO, MC4R, and TMEM18, we detected two new loci for obesity: one in SDCCAG8 (serologically defined colon cancer antigen 8 gene; p = 1.85x10(-8 in the DISCOVERY step and one between TNKS (tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase gene and MSRA (methionine sulfoxide reductase A gene; p = 4.84x10(-7, the latter finding being limited to children and adolescents as demonstrated in the GENERALIZATION step. The odds ratios for early-onset obesity were estimated at approximately 1.10 per risk allele for both loci. Interestingly, the TNKS/MSRA locus has recently been found to be associated with adult waist circumference. In summary, we have completed a meta-analysis of two GWAS which both focus on extremely obese children and adolescents and replicated our findings in a large followed-up data set. We observed that genetic variants in or near FTO, MC4R, TMEM18, SDCCAG8, and TNKS/MSRA were robustly associated with early-onset obesity. We conclude that the currently known major common variants related to obesity overlap to a substantial

  14. Evaluation of nutrients removal (NO3-N, NH3-N and PO4-P) with Chlorella vulgaris, Pseudomonas putida, Bacillus cereus and a consortium of these microorganisms in the treatment of wastewater effluents.

    Gómez-Guzmán, Abril; Jiménez-Magaña, Sergio; Guerra-Rentería, A Suggey; Gómez-Hermosillo, César; Parra-Rodríguez, F Javier; Velázquez, Sergio; Aguilar-Uscanga, Blanca Rosa; Solis-Pacheco, Josue; González-Reynoso, Orfil

    2017-07-01

    In this research removal of NH 3 -N, NO 3 -N and PO 4 -P nutrients from municipal wastewater was studied, using Chlorella vulgaris, Pseudomonas putida, Bacillus cereus and an artificial consortium of them. The objective is to analyze the performance of these microorganisms and their consortium, which has not been previously studied for nutrient removal in municipal wastewater. A model wastewater was prepared simulating the physicochemical characteristics found at the wastewater plant in Chapala, Mexico. Experiments were carried out without adding an external carbon source. Results indicate that nutrient removal with Chlorella vulgaris was the most efficient with a removal of 24.03% of NO 3 -N, 80.62% of NH 3 -N and 4.30% of PO 4 -P. With Bacillus cereus the results were 8.40% of NO 3 -N, 28.80% of NH 3 -N and 3.80% of PO 4 -P. The removals with Pseudomonas putida were 2.50% of NO 3 -N, 41.80 of NH 3 -N and 4.30% of PO 4 -P. The consortium of Chlorella vulgaris-Bacillus cereus-Pseudomonas putida removed 29.40% of NO 3 -N, 4.2% of NH 3 -N and 8.4% of PO 4 -P. The highest biomass production was with Bacillus cereus (450 mg/l) followed by Pseudomonas putida (444 mg/l), the consortium (205 mg/l) and Chlorella vulgaris (88.9 mg/l). This study highlights the utility of these microorganisms for nutrient removal in wastewater treatments.

  15. Comparative Genome Analysis and Genome Evolution

    Snel, Berend

    2002-01-01

    This thesis described a collection of bioinformatic analyses on complete genome sequence data. We have studied the evolution of gene content and find that vertical inheritance dominates over horizontal gene trasnfer, even to the extent that we can use the gene content to make genome phylogenies.

  16. Genomic definition of species. Revision 2

    Crkvenjakov, R.; Drmanac, R.

    1993-03-01

    A genome is the sum total of the DNA sequences in the cells of an individual organism. The common usage that species possess genomes comes naturally to biochemists, who have shown that all protein and nucleic acid molecules are at the same time species- and individual-specific, with minor individual variations being superimposed on a consensus sequence that is constant for a species. By extension, this property is attributed to the common features of DNA in the chromosomes of members of a given species and is called species genome. Our proposal for the definition of a biological species is as follows: A species comprises a group of actual and potential biological organisms built according to a unique genome program that is recorded, and at least in part expressed, in the structures of their genomic nucleic acid molecule(s), having intragroup sequence differences which can be fully interconverted in the process of organismal reproduction.

  17. Genomic Data Commons launches

    The Genomic Data Commons (GDC), a unified data system that promotes sharing of genomic and clinical data between researchers, launched today with a visit from Vice President Joe Biden to the operations center at the University of Chicago.

  18. Rat Genome Database (RGD)

    U.S. Department of Health & Human Services — The Rat Genome Database (RGD) is a collaborative effort between leading research institutions involved in rat genetic and genomic research to collect, consolidate,...

  19. Visualization for genomics: the Microbial Genome Viewer.

    Kerkhoven, Robert; van Enckevort, Frank H J; Boekhorst, Jos; Molenaar, Douwe; Siezen, Roland J

    2004-07-22

    A Web-based visualization tool, the Microbial Genome Viewer, is presented that allows the user to combine complex genomic data in a highly interactive way. This Web tool enables the interactive generation of chromosome wheels and linear genome maps from genome annotation data stored in a MySQL database. The generated images are in scalable vector graphics (SVG) format, which is suitable for creating high-quality scalable images and dynamic Web representations. Gene-related data such as transcriptome and time-course microarray experiments can be superimposed on the maps for visual inspection. The Microbial Genome Viewer 1.0 is freely available at http://www.cmbi.kun.nl/MGV

  20. Genomic prediction using subsampling

    Xavier, Alencar; Xu, Shizhong; Muir, William; Rainey, Katy Martin

    2017-01-01

    Background Genome-wide assisted selection is a critical tool for the?genetic improvement of plants and animals. Whole-genome regression models in Bayesian framework represent the main family of prediction methods. Fitting such models with a large number of observations involves a prohibitive computational burden. We propose the use of subsampling bootstrap Markov chain in genomic prediction. Such method consists of fitting whole-genome regression models by subsampling observations in each rou...