WorldWideScience

Sample records for ceratitis capitata anastrepha

  1. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1992-01-01

    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  2. Toxic effect of citrus peel constituents on Anastrepha fraterculus Wiedemann and Ceratitis capitata Wiedemann immature stages.

    Science.gov (United States)

    Ruiz, María J; Juárez, María L; Alzogaray, Raúl A; Arrighi, Federico; Arroyo, Lorena; Gastaminza, Gerardo; Willink, Eduardo; Bardón, Alicia del Valle; Vera, Teresa

    2014-10-15

    The toxicity of essential oils from the citrus peel has been proposed as the major resistance mechanism offered by citrus to fruit fly infestation. We evaluated the insecticidal activity of the ether extracts from the lemon (Citrus limon [L.] Burm.) and grapefruit (C. paradisi Macfadyen) peel as well as from limonene and citral against Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann) immature stages. We also evaluated the toxicity of the extracts at two ripening stages. Extracts proved toxic to A. fraterculus egg and larvae. The lemon and grapefruit extracts showed the same toxicity in both fruit fly species. For A. fraterculus eggs, citral was more toxic than limonene; for larvae, they showed equal toxicity. Anastrepha fraterculus eggs were more sensitive than C. capitata eggs. In conclusion, we provide evidence of chemical resistance mechanisms that could account for the nonhost condition of lemon for A. fraterculus.

  3. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  4. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  5. Update of host plant list of Anastrepha fraterculus and Ceratitis capitata in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Orono, Luis E.; Albornoz-Medina, Patricia; Nunez-Campero, Segundo; Nieuwenhove, Guido A. van; Bezdjian, Laura P.; Martin, Cristina B.; Schliserman, Pablo; Ovruski, Sergio M. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    The study displays a complete picture of the host range of the two economically important fruit fly species in Argentina, the native Anastrepha fraterculus (Wiedemann) (South American Fruit Fly) and the exotic Ceratitis capitata (Wiedemann) (Mediterranean Fruit Fly or Medfly). This work provides information on the fruit type of each plant species, associated tephritid species, habitat where the fruit was collected, geographical location of each fruit collection area (latitude, longitude, and altitude), phyto geographic regions where each area is located, as well as a general description of the landscape characteristics of those habitats where the fruit samples with fly larvae were collected. A complete, detailed bibliographic review was made in order to provide all the relevant information needed for host use in natural setting. (author)

  6. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-01-01

    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  7. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  8. Quarantine cold treatments for Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) for citrus in Argentina: conclusions after 10 years of research

    Energy Technology Data Exchange (ETDEWEB)

    Willink, Eduardo; Gastaminza, Gerardo; Salvatore, Analia; Gramajo, M. Cecilia; Acenolaza, Mariana; Avila, Rosana; Favre, Paola, E-mail: ewillink@eeaoc.org.a [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Argentina has quarantine restrictions in some markets due to the presence of two quarantine fruit fly pests: Ceratitis capitata and Anastrepha fraterculus. One alternative is the use of cold quarantine treatments during transport of the commodities. Since 1996, the Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman, Argentina, has developed different cold quarantine treatments for citrus. In the present work we present all the data the EEAOC generated in the last ten years in order to facilitate the development of such cold treatments. Fruit flies were obtained from the colonies reared at EEAOC. Four citrus species were analyzed: lemon, grapefruit, orange and tangerines. Different varieties were analyzed for each fruit species. Sensitivity trials aiming at determine the most tolerant stage as well as to asses if there is any influence of varieties on cold tolerance were performed. Finally we compared the tolerance to cold between the two species. Sensitivity trials showed that mature larvae (L3) are the most tolerant stage for both fruit fly species. There was no effect of the varieties and the two fruit fly species were equally sensible to cold. Our results provide strong evidence in favor of concluding that any cold treatment developed for C. capitata is effective for A. fraterculus. (author)

  9. Trapping Female Medflies (Ceratitis capitata) by Broadcast of Male Calling Song

    Science.gov (United States)

    2003-07-01

    UNCLASSIFIED Defense Technical Information Center Compilation Part Notice ADP022884 TITLE: Trapping Female Medflies [ Ceratitis capitata ] by Broadcast...component part numbers comprise the compilation report: ADP022883 thru ADP023022 UNCLASSIFIED Trapping Female Medflies ( Ceratitis capitata ) by...systems for Ceratitis capitata (Diptera: Tephritidae) in seven countries," J. Econ. Entomol. 92, 156-164. 2. Hendrichs, J., Franz, G., and Rendon, P

  10. Potential geographical distributions of the fruit flies Ceratitis capitata, Ceratitis cosyra, and Ceratitis rosa in China.

    Science.gov (United States)

    Li, Baini; Ma, Jun; Hu, Xuenan; Liu, Haijun; Zhang, Runjie

    2009-10-01

    There have been relatively few attempts to model the distributions of the fruit flies Ceratitis capitata (Wiedemann), Ceratitis cosyra (Walker), and Ceratitis rosa Karsch in China, but the geographic distributions of these species are of considerable concern in terms of biosecurity. In this study, two different modeling methods (genetic algorithm for rule-set prediction [GARP] and maximum entropy species distribution modeling [Maxent]) were used to predict the potential distributions of these three fly species in China, by using distribution records and a set of environmental predictor variables. The results showed that Maxent performed well, compared with modeling by GARP, at each test threshold. For all three species, the results predicted by Maxent agreed with the observed distributions in Africa and in other parts of the world. In China, C. capitata seems to have the highest number of favorable habitat areas, relative to C. cosyra and C. rosa, i.e., Yunnan, Guizhou, Guangxi, Guangdong, Hainan, Fujian, Sichuan and Chongqing, whereas C. cosyra has the smallest range of suitable areas, i.e., Yunnan, some parts of Hainan and Sichuan. The suitable areas for C. rosa are mainly restricted to Yunnan, Hainan, southern Guangdong, and a few areas of Sichuan. The indications are that on the whole, Southwest and South China are the areas with the highest risk for establishment from these three fly species. Jackknife tests reveal that environmental variables associated with temperature have the strongest influence on the potential distributions of all three species relative to other variables.

  11. The distribution, relative abundance, and seasonal phenology of Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    De Villiers, Marelize; Manrakhan, Aruna; Addison, Pia; Hattingh, Vaughan

    2013-10-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) are fruit fly species (Diptera: Tephritidae) of economic importance in South Africa. These pests cause direct damage to a number of commercially produced fruit and are of phytosanitary concern. A study was conducted to determine the distribution, relative abundance, and seasonal occurrence of the three species in different climatic regions of South Africa. The relative abundance and seasonal phenology of C. capitata and C. rosa were also compared between production areas and home gardens in Stellenbosch, Western Cape. Yellow bucket traps baited with Biolure were used to trap the flies over a 2-yr period in the different sampling areas. Different fruit types were sampled in Stellenbosch to determine fruit fly infestation. C. capitata was found to have a widespread distribution in South Africa, whereas C. rosa were absent from or only present in low numbers in the drier regions. C. cosyra was restricted to the North East and East coast, following a similar pattern to the distribution of marula, Sclerocarrya birrea, an important wild host. Fruit in home gardens provided a breeding ground for C. capitata and C. rosa and a source for infestation of orchards when fruit started to mature, highlighting the need for an area-wide strategy for the control of fruit flies.

  12. Host status of avocado ('Hass') to Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    de Graaf, J

    2009-08-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) (Diptera: Tephritidae) are pests potentially associated with avocado (Persea americana Mill.) in South Africa. The aim of the study was to determine the host status of 'Hass' avocado to these tephritid pests over 4 yr. Unpunctured harvested avocado was exposed to fruit flies in the laboratory under no-choice conditions for 24 h. In field studies, each species was exposed for 48 h under no-choice conditions to avocado attached to the tree. Fruit was harvested immediately, 4, 8 and 18 d after exposure. In all the experiments, the fruit was incubated at 25 degrees C for 49 d after harvest. Hass avocado fruit was sourced from pack-houses throughout the avocado production areas and inspected for any internal pests. Similar inspections were done from 2005 to 2008 at arrival in Europe following standard export procedures. Analysis indicated that Hass avocado is a conditional nonhost for C. capitata and a poor but potential host for C. rosa and C. cosyra. No requirement for a risk mitigation treatment for C. capitata on South African Hass avocado was found. Fruit sampling data did not produce any infested fruit, suggesting that natural conditions and/or existing procedures functioning in a systems approach are likely to mitigate the quarantine risks of C. rosa and C. cosyra on Hass avocado in South Africa.

  13. Susceptibility of the Mediterranean fruit fly (Ceratitis capitata) and the Natal fruit fly (Ceratitis rosa) to entomopathogenic nematodes.

    Science.gov (United States)

    Malan, Antoinette P; Manrakhan, Aruna

    2009-01-01

    The potential of entomopathogenic nematodes, Heterorhabditis bacteriophora, Heterorhabditis zealandica and Steinernema khoisanae, to infect pupariating larvae, pupae and adults of Ceratitis capitata and Ceratitis rosa was investigated in laboratory bioassays. Pupariating larvae and adult flies were susceptible to nematode infection, with no infection recorded for the pupae. Pupariating larvae of C. capitata were generally more susceptible to infection than those of C. rosa. Significantly more larvae of C. capitata were infected by H. bacteriophora. For C. rosa, highest infectivity of larvae was obtained with H. zealandica. In contrast, adults of both species were highly infected by S. khoisanae.

  14. Risk of introducing exotic fruit flies, Ceratitis capitata, Ceratitis cosyra, and Ceratitis rosa (Diptera: Tephritidae), into southern China.

    Science.gov (United States)

    Li, Baini; Ma, Jun; Hu, Xuenan; Liu, Haijun; Wu, Jiajiao; Chen, Hongjun; Zhang, Runjie

    2010-08-01

    Exotic fruit flies (Ceratitis spp.) are often serious agricultural pests. Here, we used, pathway analysis and Monte Carlo simulations to assess the risk of introduction of Ceratitis capitata (Wiedemann), Ceratitis cosyra (Walker), and Ceratitis rosa Karsch, into southern China with fruit consignments and incoming travelers. Historical data, expert opinions, relevant literature, and archives were used to set appropriate parameters in the pathway analysis. Based on the ongoing quarantine/ inspection strategies of China, as well as the interception records, we estimated the annual number of each fruit fly species entering Guangdong province undetected with commercially imported fruit, and the associated risk. We also estimated the gross number of pests arriving at Guangdong ports with incoming travelers and the associated risk. Sensitivity analysis also was performed to test the impact of parameter changes and to assess how the risk could be reduced. Results showed that the risk of introduction of the three fruit fly species into southern China with fruit consignments, which are mostly transported by ship, exists but is relatively low. In contrast, the risk of introduction with incoming travelers is high and hence deserves intensive attention. Sensitivity analysis indicated that either ensuring all shipments meet current phytosanitary requirements or increasing the proportion of fruit imports sampled for inspection could substantially reduce the risk associated with commercial imports. Sensitivity analysis also provided justification for banning importation of fresh fruit by international travelers. Thus, inspection and quarantine in conjunction with intensive detection were important mitigation measures to reduce the risk of Ceratitis spp. introduced into China.

  15. Aphaereta ceratitivora sp. n. (Hymenoptera, Braconidae, a new parasitoid of Ceratitis capitata (Wiedemann (Diptera, Tephritidae from the Azores

    Directory of Open Access Journals (Sweden)

    Kees van Achterberg

    2012-09-01

    Full Text Available A new gregarious larval-pupal endoparasitoid of Ceratitis capitata (Wiedemann (Diptera: Tephritidae is described and illustrated: Aphaereta ceratitivora sp. n. (Braconidae: Alysiinae: Alysiini.

  16. Behavioral effects of plant essential oils on Ceratitis capitata males – risk versus reward

    Science.gov (United States)

    Plant essential oils have a number of roles in insect pest management. For male Ceratitis capitata, these roles include male-targeted attractants for traps and aromatherapy exposure for increased mating success. Essential oils that affect C. capitata behavior may be from either host or non-host pl...

  17. Export of commercial 'Hass' avocados from Argentina poses negligible risk of ceratitis capitata (Diptera: Tephritidae) infestation

    Science.gov (United States)

    Quarantine restrictions due to the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), prevent Argentina from exporting avocados, Persea americana Miller, cv. Hass, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata, which cou...

  18. Glycosidases in the plasma membrane of Ceratitis capitata spermatozoa.

    Science.gov (United States)

    Intra, Jari; De Caro, Daniela; Perotti, Maria-Elisa; Pasini, Maria Enrica

    2011-02-01

    Fruit flies in the family Tephritidae are rated among the world's most destructive agricultural pests. The Mediterranean fruit fly Ceratitis capitata is emerging as a model organism to study the fertilization in Insects. Three integral proteins with glycosidase activity are present in the plasma membrane of spermatozoa. The glycosidases have been purified and characterized. We have demonstrated the presence of three enzymes, a β-N-acetylhexosaminidase, an α-mannosidase and an α-l-fucosidase. The molecular mass of the native enzymes estimated by gel filtration was 160 kDa for β-N-acetylhexosaminidase, 310 kDa for α-mannosidase and 140 kDa for α-l-fucosidase. SDS-PAGE showed that β-N-acetylhexosaminidase is a dimer of a single protein of 73 kDa, α-mannosidase consists of six subunits with different molecular weights and α-l-fucosidase is a dimer made up by two different monomers. Characterization of the purified enzymes included glycosylation pattern, pI, optimal pH, substrate preference, kinetic properties and thermal stability. Soluble forms similar to the sperm associated glycosidases are present. Polyclonal antibodies raised against synthetic peptides designed from the predicted products of the Drosophila melanogaster genes encoding β-N-acetylhexosaminidase and α-l-fucosidase were used. Immunofluorescence labelling of spermatozoa showed that the enzymes are present in the sperm plasma membrane overlying the acrosome and the tail. This work represents the first report on the characterization in C. capitata of sperm proteins that are potentially involved in primary gamete recognition.

  19. Description of third instar larvae of Ceratitis fasciventris, C. anonae, C. rosa (FAR complex) and C. capitata (Diptera, Tephritidae).

    Science.gov (United States)

    Steck, Gary J; Ekesi, Sunday

    2015-01-01

    Third instar larvae of members of the Ceratitis FAR complex, including Ceratitis fasciventris (Bezzi), Ceratitis anonae Graham, and Ceratitis rosa Karsch are described and compared with those of Ceratitis capitata (Wiedemann). Diagnostic characters, such as presence vs. absence of a secondary tooth on the mandibles, previously used to separate Ceratitis capitata from Ceratitis rosa, are shown to vary in each species. Significant variation in diagnostic morphological characters among populations of Ceratitis rosa from east and south Africa is documented; however, the differences are not simply congruent with the R1 and R2 designations based on other studies. Quantitative measures of numerous morphological characters are consistently smaller in the larvae of Ceratitis fasciventris and distinguish them from other species of the FAR complex. Larvae of Ceratitis capitata can be distinguished from those of the FAR complex by characters such as absence of accessory plates of the oral ridges, the shape of the anterior spiracle, and the pattern of dorsal spinules. Previous studies indicated that absence of accessory lobes separate the genus Ceratitis from Bactrocera, but this is shown to be incorrect, as accessory lobes are in fact present in several species of Ceratitis.

  20. Description of third instar larvae of Ceratitis fasciventris, C. anonae, C. rosa (FAR complex) and C. capitata (Diptera, Tephritidae)

    Science.gov (United States)

    Steck, Gary J.; Ekesi, Sunday

    2015-01-01

    Abstract Third instar larvae of members of the Ceratitis FAR complex, including Ceratitis fasciventris (Bezzi), Ceratitis anonae Graham, and Ceratitis rosa Karsch are described and compared with those of Ceratitis capitata (Wiedemann). Diagnostic characters, such as presence vs. absence of a secondary tooth on the mandibles, previously used to separate Ceratitis capitata from Ceratitis rosa, are shown to vary in each species. Significant variation in diagnostic morphological characters among populations of Ceratitis rosa from east and south Africa is documented; however, the differences are not simply congruent with the R1 and R2 designations based on other studies. Quantitative measures of numerous morphological characters are consistently smaller in the larvae of Ceratitis fasciventris and distinguish them from other species of the FAR complex. Larvae of Ceratitis capitata can be distinguished from those of the FAR complex by characters such as absence of accessory plates of the oral ridges, the shape of the anterior spiracle, and the pattern of dorsal spinules. Previous studies indicated that absence of accessory lobes separate the genus Ceratitis from Bactrocera, but this is shown to be incorrect, as accessory lobes are in fact present in several species of Ceratitis. PMID:26798272

  1. Effective sampling range of a synthetic protein-based attractant for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Studies were conducted in Honduras to determine sampling range for female-targeted food-based synthetic attractants for pest tephritid fruit flies. Field studies were conducted in shaded coffee and adults of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), were captured. Traps (38 traps ...

  2. Laboratory evaluation of the chemosterilant lufenuron against Ceratitis capitata, Bactrocera dorsalis, B. cucurbitae, and B. latifrons.

    Science.gov (United States)

    Four species of tephritid fruit flies, Ceratitis capitata, Bactrocera dorsalis, B. cucurbitae, and B. latifrons were evaluated for toxic, developmental, and physiological responses to the chemosterilant lufenuorn incorporated in an agar adult diet and a liquid larval diet. No significant mortality o...

  3. Oviposition preference and larval performance in Ceratitis capitata (Díptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Iara Sordi Joachim-Bravo

    1997-12-01

    Full Text Available Experiments concerning oviposition preference were carried out on Ceratitis capitata to determine whether females are able to preferentially oviposit on natural hosts in which the larvae develop better. The results indicated that the females do not preferentially oviposit on hosts of better nutritive value for the larvae.

  4. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), version 3.0

    Science.gov (United States)

    The Mediterranean fruit fly (Medfly), Ceratitis capitata (Wiedemann), causes direct damage to fruits and vegetables through oviposition and larval feeding. Rigorous quarantine procedures are currently enforced to prevent domestic and transnational spread of Medfly. Accessible and reliable informatio...

  5. Effects of parental age on the fecundity, fertility and longevity of the Mediterranean fruit fly, Ceratitis capitata Wied.

    OpenAIRE

    Muñiz, M.

    1986-01-01

    Investigations with single pair mating have been conducted in order to study the influence of parental age on the adult progeny's longevity and reproductive parameters of t he Mediterranean fruit fly, Ceratitis capitata Wied.

  6. Selection of a Bacillus pumilus strain highly active against Ceratitis capitata (Wiedemann) larvae.

    Science.gov (United States)

    Molina, C Alfonso; Caña-Roca, Juan F; Osuna, Antonio; Vilchez, Susana

    2010-03-01

    Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the Mediterranean fruit fly (medfly), is one of the most important fruit pests worldwide. The medfly is a polyphagous species that causes losses in many crops, which leads to huge economic losses. Entomopathogenic bacteria belonging to the genus Bacillus have been proven to be safe, environmentally friendly, and cost-effective tools to control pest populations. As no control method for C. capitata based on these bacteria has been developed, isolation of novel strains is needed. Here, we report the isolation of 115 bacterial strains and the results of toxicity screening with adults and larvae of C. capitata. As a result of this analysis, we obtained a novel Bacillus pumilus strain, strain 15.1, that is highly toxic to C. capitata larvae. The toxicity of this strain for C. capitata was related to the sporulation process and was observed only when cultures were incubated at low temperatures before they were used in a bioassay. The mortality rate for C. capitata larvae ranged from 68 to 94% depending on the conditions under which the culture was kept before the bioassay. Toxicity was proven to be a special characteristic of the newly isolated strain, since other B. pumilus strains did not have a toxic effect on C. capitata larvae. The results of the present study suggest that B. pumilus 15.1 could be considered a strong candidate for developing strategies for biological control of C. capitata.

  7. De novo assembly and transcriptome analysis of the Mediterranean fruit fly Ceratitis capitata early embryos.

    Directory of Open Access Journals (Sweden)

    Marco Salvemini

    Full Text Available The agricultural pest Ceratitis capitata, also known as the Mediterranean fruit fly or Medfly, belongs to the Tephritidae family, which includes a large number of other damaging pest species. The Medfly has been the first non-drosophilid fly species which has been genetically transformed paving the way for designing genetic-based pest control strategies. Furthermore, it is an experimentally tractable model, in which transient and transgene-mediated RNAi have been successfully used. We applied Illumina sequencing to total RNA preparations of 8-10 hours old embryos of C. capitata, This developmental window corresponds to the blastoderm cellularization stage. In summary, we assembled 42,614 transcripts which cluster in 26,319 unique transcripts of which 11,045 correspond to protein coding genes; we identified several hundreds of long ncRNAs; we found an enrichment of transcripts encoding RNA binding proteins among the highly expressed transcripts, such as CcTRA-2, known to be necessary to establish and, most likely, to maintain female sex of C. capitata. Our study is the first de novo assembly performed for Ceratitis capitata based on Illumina NGS technology during embryogenesis and it adds novel data to the previously published C. capitata EST databases. We expect that it will be useful for a variety of applications such as gene cloning and phylogenetic analyses, as well as to advance genetic research and biotechnological applications in the Medfly and other related Tephritidae.

  8. De novo assembly and transcriptome analysis of the Mediterranean fruit fly Ceratitis capitata early embryos.

    Science.gov (United States)

    Salvemini, Marco; Arunkumar, Kallare P; Nagaraju, Javaregowda; Sanges, Remo; Petrella, Valeria; Tomar, Archana; Zhang, Hongyu; Zheng, Weiwei; Saccone, Giuseppe

    2014-01-01

    The agricultural pest Ceratitis capitata, also known as the Mediterranean fruit fly or Medfly, belongs to the Tephritidae family, which includes a large number of other damaging pest species. The Medfly has been the first non-drosophilid fly species which has been genetically transformed paving the way for designing genetic-based pest control strategies. Furthermore, it is an experimentally tractable model, in which transient and transgene-mediated RNAi have been successfully used. We applied Illumina sequencing to total RNA preparations of 8-10 hours old embryos of C. capitata, This developmental window corresponds to the blastoderm cellularization stage. In summary, we assembled 42,614 transcripts which cluster in 26,319 unique transcripts of which 11,045 correspond to protein coding genes; we identified several hundreds of long ncRNAs; we found an enrichment of transcripts encoding RNA binding proteins among the highly expressed transcripts, such as CcTRA-2, known to be necessary to establish and, most likely, to maintain female sex of C. capitata. Our study is the first de novo assembly performed for Ceratitis capitata based on Illumina NGS technology during embryogenesis and it adds novel data to the previously published C. capitata EST databases. We expect that it will be useful for a variety of applications such as gene cloning and phylogenetic analyses, as well as to advance genetic research and biotechnological applications in the Medfly and other related Tephritidae.

  9. Introducción y producción en laboratorio de Diachasmimorpha tryon i y Diachasmimorpha longicaudata (Hymenoptera: Braconidae para el control biológico de Ceratitis capitata (Diptera: Tephritidae en la Argentina Introduction and laboratory production of Diachasmimorpha tryoni and Diachasmimorpha longicaudata (Hymenoptera: Braconidae for the biological control of Ceratitis capitata (Diptera: Tephritidae in Argentina

    Directory of Open Access Journals (Sweden)

    Sergio M. Ovruski

    2003-12-01

    Full Text Available Con el propósito de reanudar la utilización de enemigos naturales contra la especie exótica Ceratitis capitata (Wiedemann, fueron introducidos a la Argentina en 1999 los agentes de control biológico Diachasmimorpha tryoni (Cameron y Diachasmimorpha longicaudata (Ashmead, dos endoparasitoides de larvas de tefrítidos. Por este motivo, en este trabajo se describen los procedimientos de cría en laboratorio del huésped y de ambas especies de parasitoides y, se presentan y discuten los resultados de un año de producción de D. tryoni y D. longicaudata a mediana escala (enero-diciembre/2000. Se realizó un análisis comparativo de los datos obtenidos sobre la producción de descendientes, proporción sexual, porcentaje de parasitismo y viabilidad de puparios por jaula de cría durante 15 generaciones entre ambas especies de parasitoides exóticos, utilizando como huésped larvas de C. capitata del tercer estadio de siete días de edad. Además, se discuten las posibilidades para implementar el control biológico aumentativo contra C. capitata y Anastrepha fraterculus (Wiedemann en el país.The biocontrol agents Diachasmimorpha tryoni (Cameron and Diachasmimorpha longicaudata (Ashmead, two endoparasitoids of fruit fly larvae, were introduced to Argentina in 1999 with the purpose of renewing the employment of natural enemies against Ceratitis capitata (Wiedemann. For this reason, the general procedure and maintenance of the host and parasitoids rearing in the laboratory are described, and the results of one year insectary production (January-December/2000 of both D. tryoni and D. longicaudata are discussed. Data are presented of the progeny production, offpring sex ratio, host parasitism percentage, and pupal viability per parasitoid rearing cage during 15 generations of D. longicaudata and D. tryoni reared using late third instar larvae of C. capitata. New perspectives are discussed on the establishment of a biological control program for C

  10. [Parasitic effect of Opius concolor (Spzl) (Hymenoptera, Braconidae) on an intermediate host Ceratitis capitata Wied (Diptera, Trypetidae)].

    Science.gov (United States)

    Ben Hamouda, M H; Ben Salah, H

    1984-01-01

    The parasitic incidence of Opius concolor (Hymenoptera, Braconidae) on a replacement host, Ceratitis capitata (Diptera, Trypetidae) was studied using polyacrylamide gel electrophoresis and immunoelectrophoresis methods. A noticeable modification of C. capitata proteins was observed when parasited by O. concolor. But the most important phenomenon is the finding of common antigens between the host and the parasite. These results are discussed with regard to trophic and parasitic behaviour of the parasite.

  11. An Additional Phytosanitary Cold Treatment Against Ceratitis capitata (Diptera: Tephritidae) in 'Oroblanco' Citrus Fruit.

    Science.gov (United States)

    Gazit, Yoav; Kaspi, Roy

    2017-01-12

    For 'Oroblanco' ('Sweetie'), the sweet seedless pummelo-grapefruit hybrid, when exported from Israel to Japan, the standard cold treatment against Ceratitis capitata (Wied.) (Diptera: Tephritidae) is conducted at ≤ 1.5 °C, for 16 d. In recent years, the transportation means of exported citrus was changed from reefer vessels to individual refrigerated containers, where the fruit bulk is relatively small and may be exposed to temperature fluctuations and to the risk of chilling injuries. To reduce this risk, Israel proposed to Japan to increase the treatment temperature and extend its duration to 2.2 °C and 18 d, respectively. This study shows that the proposed treatment effectively kills the third instar larva of C. capitata, in Oroblanco.

  12. Hot-water phytosanitary treatment against Ceratitis capitata (Diptera: Tephritidae) in 'Ataulfo' mangoes.

    Science.gov (United States)

    Hernández, Emilio; Rivera, Pedro; Bravo, Bigail; Toledo, Jorge; Caro-Corrales, José; Montoya, Pablo

    2012-12-01

    We determined the thermal death rate constants and mortality curves for the eggs and different instars of Ceratitis capitata (Mediterranean fruit fly) (Wiedemann) submerged in isolation in water at 44, 46, and 48 degrees C and submerged within fruits of Mangifera indica (mango) (L.) in water at 43.1, 44.1, 45.1, and 46.1 degrees C. The first instar was the most tolerant to this treatment, with estimated times for achieving 99.9968% mortality of 103.28, 92.73, and 92.49 min at temperatures of 43.1, 44.1, and 45.1 degrees C, respectively. The results of the study indicate that 'Ataulfo' mangoes weighing capitata while maintaining market quality at least for 15 d.

  13. Survival of Wild Adults of Ceratitis capitata (Wiedemann under Natural Winter Conditions in North East Spain

    Directory of Open Access Journals (Sweden)

    E. Peñarrubia-María

    2012-01-01

    Full Text Available The overwintering of the Mediterranean fruit fly (medfly, Ceratitis capitata (Wiedemann at the northern limits of its geographic distribution is not yet well known. With the aim of estimating the survival rate of medfly adults in northeast Spain under natural winter conditions, a two-winter-season trial was carried out. A control was carried out in a climatic chamber at 25°C. The results showed that medfly adults were unable to survive the entire winter season in the Girona area. Climatic conditions, including the daily minimum temperature, daily maximum temperature and the high rainfall, appeared to be involved in adult mortality in winter.

  14. The Process of Intromission in the Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidiae

    Directory of Open Access Journals (Sweden)

    William G. Eberhard

    1995-01-01

    Full Text Available The distiphallus of the male of Ceratitis capitata is folded back 180° onto the basiphallus during the early stages of intromission, and is then unfolded within the female. Repeated folding and unfolding may occur within the female. Two membranous sacs on the distiphallus are capable of rhythmic cycles of inflation and deflation. Inflations of the sac near the base of the distiphallus probably help propel the aedeagus deeper into the female, along with periodic stiffening of the basiphallus; inflation of the larger, distal sac may drive the genital rod (which does not transfer sperm into the ventral receptacle.

  15. Pos-harvest control of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in guava fruits (Psidium guajava L.).; Controle pos-colheita de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) em frutos de goiaba (Psidium guajava L.)

    Energy Technology Data Exchange (ETDEWEB)

    Doria, Hayda Oliveira Souza

    2006-07-01

    The objective of this work is to evaluate the effect of the treatment with steam heating, hot water and gamma radiation of Co-60 on eggs and fruit flies larvae (Ceratitis capitata Wiedemann, 1824) (Diptera: Tephritidae), and analyze the effect of these treatments in the fruit quality (chemical composition)

  16. New genetic tools for improving SIT in Ceratitis capitata: embryonic lethality and sperm marking

    Energy Technology Data Exchange (ETDEWEB)

    Schetelig, Marc F.; Wimmer, Ernst A. [Georg-August-University, Gottingen (Germany). Johann-Friedrich Blumenbach Institute of Zoology and Anthropology. Gottingen Center for Molecular Biosciences; Scolari, Francesca; Gasperi, Giuliano [Universita di Pavia (Italy). Dipt. di Biologia Animale; Handler, Ernst A. [U.S. Department of Agriculture (USDA/ARS), Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural and Veterinary Entomology

    2006-07-01

    Environment friendly sterile insect technique (SIT) is being applied effectively as a component of area-wide integrated pest management (AW-IPM) for Ceratitis capitata since 1970s. Nevertheless improved biological strategies are needed to increase the efficacy of AW-IPM. Transgenic approaches should increase and widen the applicability of such programmes to different pest species. In this respect two major strategies are followed: First an approach to cause sterility was designed without interfering with spermatogenesis to maintain males and their sperm as competitive as possible. We followed a strategy, which is based on the expression of a lethal factor under the control of a promoter that is active at early blastoderm stages. The system employs the ectopic expression of a hyperactive pro apoptotic gene that causes embryo-specific lethality when driven by the tetracycline-controlled trans activator tTA under the regulation of a cellularization gene enhancer/promoter. The system has been tested successfully in Drosophila melanogaster (Horn and Wimmer 2003). We tried the direct transfer of the Drosophila system to Ceratitis capitata by injecting the respective constructs that carry Drosophila-derived promoters. Unfortunately, the cellularization specific promoters from Drosophila seem not functional in Ceratitis. Therefore, the corresponding enhancers/promoters from Ceratitis were isolated and subsequently the tTA was brought independently under the control of each enhancer/promoter region. These constructs were injected in Ceratitis for further evaluation. Second, we have engineered a medfly strain carrying a sperm marking system. This strain carries two fluorescent markers. One (turboGFP) marker is under the control of the spermatogenesis specific b2-tubulin promoter from Ceratitis and is therefore sperm specifically expressed. The second (DsRed) is under the control of the poly ubiquitin promoter of Drosophila. Released males from this strain could be

  17. Development of a transgenic sexing system based on female-specific embryonic lethality in Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    The Sterile Insect Technique (SIT) is more efficient and cost-effective when only sterile males are released. A female-specific lethality system based on a female-specifically spliced intron was developed for transgenic sexing in Ceratitis capitata (Fu et al., 2007) possibly to overcome the fitness ...

  18. Attraction and Electroantennography responses of the male Mediterranean Fruit Fly, Ceratitis capitata, to natural essential oils and synthetic blends.

    Science.gov (United States)

    Field experiments and long range bioassays were used to understand the difference in attractiveness among various natural essential oils for the Mediterranean Fruit Fly, Ceratitis capitata. Using electroantennography, we have selected various antennally active chemicals and tested their role in the ...

  19. Field estimates of attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to methyl eugenol in varying environments

    Science.gov (United States)

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation and control of invasive pests. Here we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel)...

  20. Soil application of Beauveria bassiana to control Ceratitis capitata in semi field conditions.

    Science.gov (United States)

    Ali, Ali; Sermann, Helga; Lerche, Sandra; Büttner, Carmen

    2009-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) is a highly polyphagous pest of economic importance cultures in Syria, as in many other parts of the world. The potential of the entomopathogenic fungus Beauveria bassiona BALS (VUIL.) strain 412 against adults of Mediterranean fruit fly C. capitata was evaluated in semi field conditions during the summer. Soil (5-7 cm high) was filled into plastic container (27 cm x 32 cm). In one container 75 pupae, two days before emergency, were spread uniformly on the soil. Then the pupae were covered with soil (4-5 cm layer). After that, 30 ml suspension of fungal spores (4 x 10(8) spores/ml) was applied to the soil surface using a dash bottle. This corresponded to a spore density of 1.3 x 10(7) spores/cm2 on soil. Water and food (1:4 yeast, sucrose) were placed in the cages for the emerged flies. The semi-field evaluation of B. bassiana revealed a fly mortality of about 46% compared to 16% in the control. In addition 72% of dead flies were moulded in the treatment. These results indicated that the entomopathogenic fungus B. bassiana was pathogen against the adults of C. capitata not only in the laboratory condition but also under field condition. That means B. bassiana could decrease the offspring of C. capitata. Therefore B. bassiana could be an effective factor to control C. capitata in combination with other control methods, used in IPM program in the field.

  1. Export of commercial Hass avocados from Argentina poses negligible risk of Ceratitis capitata (Diptera: Tephritidae) infestation.

    Science.gov (United States)

    Villagrán, M Elvira; Willink, Eduardo; Vera, M Teresa; Follett, Peter

    2012-08-01

    Argentina has to meet quarantine restrictions because of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), to export 'Hass' avocados, Persea americana Miller, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata and could open export markets without the need for a quarantine treatment. Trapping data from 1998 to 2006 showed that C. capitata was present in avocado orchards, particularly early in the harvest season. The host status of hard, mature green Hass avocado to C. capitata was evaluated using laboratory and field cage tests under no-choice conditions and by assessing natural levels of infestation in commercially harvested fruit from the main avocado production area. In total, 2,250 hard, mature green avocado fruit were exposed to 11,250 gravid females for 24 or 48 h after harvest in laboratory or field cages, and no infestations were found. During 11 seasons, 5,949 fruit in total were sampled from the trees and 992 fruit were collected from the ground, and in none of them were any live or dead fruit fly larvae found. Inspection of >198,000 commercial fruit at the packinghouse from 1998 to 2011 showed no symptoms of fruit fly infestation. These data exceed the published standards for determination of nonhost status, as well as the Probit 9 standard for development of quarantine treatments. Hass avocado harvested at the hard, mature green stage was not infested by C. capitata and seems to pose a negligible quarantine risk. As a consequence, no postharvest treatment or other quarantine actions should be required by importing countries.

  2. A new mechanised cultural practice to reduce Ceratitis capitata Wied. populations in area-wide IPM

    Directory of Open Access Journals (Sweden)

    P. Chueca

    2013-11-01

    Full Text Available The Mediterranean fruit fly (or medfly, Ceratitis capitata (Wiedemann (Diptera: Tephritidae, affects most of the fruit species grown in temperate and tropical climate regions, causing significant economic damage. One of the classical cultural strategies against this pest is to gather and bury the remaining fruit after harvest, but this is economically unfeasible today. Wood shredders already available in current Spanish groves can be used to grind or crush fruits laying on the soil as an alternative to this practice and to the use of pesticides in area-wide integrated pest management (IPM. With the purpose of evaluating this alternative, the initial step of this study was to perform laboratory tests to assess the efficacy of crushing and grinding as a method for controlling medflies. The results showed that grinding was 78% effective against larval stages, while crushing resulted in a 17% efficacy, leading us to choose the first alternative. As a second step, the operational parameters (type of cutting tool, shaft rotation speed and tractor speed of the wood shredders were adjusted to efficiently carry out this practice under field conditions. Finally, the effect of the mechanised grinding of fallen fruit on C. capitata populations was evaluated for two consecutive years in commercial citrus orchards. The results showed a significant 27-46% reduction in C. capitata populations the following spring, thus demonstrating that the newly proposed mechanised alternative can be included in the current area-wide IPM of the pest in Spain.

  3. Characterisation of novel Bacillus thuringiensis isolates against Aedes aegypti (Diptera: Culicidae) and Ceratitis capitata (Diptera: Tephridae).

    Science.gov (United States)

    Elleuch, Jihen; Tounsi, Slim; Ben Hassen, Najeh Belguith; Lacoix, Marie Noël; Chandre, Fabrice; Jaoua, Samir; Zghal, Raida Zribi

    2015-01-01

    Bacillus thuringiensis is successfully used in pest management strategies as an eco-friendly bioinsecticide. Isolation and identification of new strains with a wide variety of target pests is an ever growing field. In this paper, new B. thuringiensis isolates were investigated to search for original strains active against diptera and able to produce novel toxins that could be used as an alternative for the commercial H14 strain. Biochemical and molecular characterization revealed a remarkable diversity among the studied strains. Using the PCR method, cry4C/Da1, cry30Ea, cry39A, cry40 and cry54 genes were detected in four isolates. Three strains, BLB355, BLB196 and BUPM109, showed feeble activities against Aedes aegypti larvae. Interestingly, spore-crystal mixtures of BLB361, BLB30 and BLB237 were found to be active against Ceratitis capitata with an LC50 value of about 65.375, 51.735 and 42.972 μg cm(-2), respectively. All the studied strains exhibited important mortality levels using culture supernatants against C. capitata larvae. This suggests that these strains produce a wide range of soluble factors active against C. capitata larvae.

  4. Transcriptome analysis in Ceratitis capitata to unveil genes involved in ageing-maturation process

    Directory of Open Access Journals (Sweden)

    V. San Andrés

    2013-07-01

    Full Text Available The sterile insect technique (SIT is widely used in integrated programmes against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann (Diptera: Tephritidae. Information on the age distribution of insects, and more particularly, the knowledge of wild female reproductive status (mature or not at the time of the sterile male release is one of the key factors for the success of the SIT. In recent years, sequencing analysis has become an important tool in molecular biology. In this work we present a genome-wide expression analysis based on SSH (substractive sequence hybridization and EST (expressed sequence tag sequencing and macroarray expression analysis to identify signature genes related to the ageing-maturing process in C. capitata, leading to the successful identification of new putative candidate genes of reproductive status in medfly that would serve as molecular markers for ageing. We have sorted out 94 unigenes from 873 single-pass ESTs, of which 57% have homology with known genes. Ageing-maturing process in C. capitata presents a marked expression pattern accompanied by the increase of transcription level of genes involved in reproduction (vitellogenins, chorion proteins and male-specific serum proteins. Other identified cDNAs (43% with a differential expression pattern would be also candidates but deserve further studies, as they belong to the unknown function class.

  5. Selection of Ceratitis capitata (Diptera: Tephritidae) specific recombinant monoclonal phage display antibodies for prey detection analysis.

    Science.gov (United States)

    Monzó, César; Urbaneja, Alberto; Ximénez-Embún, Miguel; García-Fernández, Julia; García, José Luis; Castañera, Pedro

    2012-01-01

    Several recombinant antibodies against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), one of the most important pests in agriculture worldwide, were selected for the first time from a commercial phage display library of human scFv antibodies. The specificity and sensitivity of the selected recombinant antibodies were compared with that of a rabbit polyclonal serum raised in parallel using a wide range of arthropod species as controls. The selected recombinant monoclonal antibodies had a similar or greater specificity when compared with classical monoclonal antibodies. The selected recombinant antibodies were successfully used to detect the target antigen in the gut of predators and the scFv antibodies were sequenced and compared. These results demonstrate the potential for recombinant scFv antibodies to be used as an alternative to the classical monoclonal antibodies or even molecular probes in the post-mortem analysis studies of generalist predators.

  6. Medfly Ceratitis capitata as Potential Vector for Fire Blight Pathogen Erwinia amylovora: Survival and Transmission.

    Directory of Open Access Journals (Sweden)

    Mónica Ordax

    Full Text Available Monitoring the ability of bacterial plant pathogens to survive in insects is required for elucidating unknown aspects of their epidemiology and for designing appropriate control strategies. Erwinia amylovora is a plant pathogenic bacterium that causes fire blight, a devastating disease in apple and pear commercial orchards. Studies on fire blight spread by insects have mainly focused on pollinating agents, such as honeybees. However, the Mediterranean fruit fly (medfly Ceratitis capitata (Diptera: Tephritidae, one of the most damaging fruit pests worldwide, is also common in pome fruit orchards. The main objective of the study was to investigate whether E. amylovora can survive and be transmitted by the medfly. Our experimental results show: i E. amylovora can survive for at least 8 days inside the digestive tract of the medfly and until 28 days on its external surface, and ii medflies are able to transmit the bacteria from inoculated apples to both detached shoots and pear plants, being the pathogen recovered from lesions in both cases. This is the first report on E. amylovora internalization and survival in/on C. capitata, as well as the experimental transmission of the fire blight pathogen by this insect. Our results suggest that medfly can act as a potential vector for E. amylovora, and expand our knowledge on the possible role of these and other insects in its life cycle.

  7. Pathogenicity of Metarhizium anisopliae for Ceratitis capitata (Wied.) (Diptera: Tephritidae) in soil with different pesticides.

    Science.gov (United States)

    Mochi, Dinalva A; Monteiro, Antonio C; De Bortoli, Sergio A; Dória, Háyda O S; Barbosa, José C

    2006-01-01

    This research intended to investigate if the presence of pesticides in the soil could affect the pathogenicity of Metarhizium anisopliae Metsch. (Sorokin) for Ceratitis capitata (Wied.) and assess the effect of conidia application as suspension or dry conidia. The fungicides chlorothalonyl and tebuconazol, the acaricide abamectin, the insecticide trichlorfon, and the herbicide ametrin were applied at the manufacturer-recommended doses. Soil samples were placed in glass flasks and were given the fungus as conidial suspension or dry. After pesticide application, 20 3rd-instar larvae were placed in the soil. The flasks were sealed with voile fabric and incubated at 27 +/- 0.5 masculineC for nine days, until adult emergence; incubation continued for four more days at room temperature. The total insect survival was significantly affected and pathogenic activity was detected from the pupa stage on. Pupa survival was reduced (Ptebuconazole reduced (86.2% and 82.5%, respectively) the survival period of C. capitata compared to the control (95.0%). The techniques used for conidia application did not influence the total insect survival rate, but conidial suspension applied on soil surface reduced survival during the pupae and adult phases.

  8. Population Fluctuation of Ceratitis capitata (Diptera: Tephritidae) as a Function of Altitude in Eastern Guatemala.

    Science.gov (United States)

    Flores, S; Montoya, P; Ruiz-Montoya, L; Villaseñor, A; Valle, A; Enkerlin, W; Liedo, P

    2016-08-01

    Population fluctuations of Ceratitis capitata (Wiedemann) were evaluated over a period of 12 mo in four altitudinal strata (400-750, 750-1,100, 1,100-1,450, and 1,450-1,800 meters above sea level, masl) in Eastern Guatemala. Within each altitudinal range, sampling plots were established in coffee plantations and adjacent areas, in which Jackson traps were set and baited with Trimedlure. Coffee berries and other host fruits were collected. Population density was lowest at the 400-750 masl stratum and highest at 1,450-1,800 masl. At every altitudinal range, the fluctuations of the pest were associated mainly with the availability of ripe coffee berries as a primary host. From 750-1,450 masl, the pest was also associated with the availability of sweet orange and mandarins in commercial and backyard orchards. The highest densities of the pest were recorded in the dry season. Citrus were the main alternate host where ripe coffee berries were not available. This knowledge on population dynamics of C. capitata will contribute to develop more effective area-wide pest management strategies including the use of sterile insects, natural enemies, and bait sprays.

  9. Male-specific phosphorylated SR proteins in adult flies of the Mediterranean fruitfly Ceratitis capitata.

    Science.gov (United States)

    Saccone, Giuseppe; Louis, Christos; Zhang, Hongyou; Petrella, Valeria; Di Natale, Manuela; Perri, Maria; Salvemini, Marco

    2014-01-01

    Alternative splicing is a widely used mechanism of gene regulation in sex determination pathways of Insects. In species from orders as distant as Diptera, Hymenoptera and Coleoptera, female differentiation relies on the activities of conserved splicing regulators, TRA and TRA-2, promoting female-specific expression of the global effector doublesex (dsx). Less understood is to what extent post-translational modifications of splicing regulators plays a role in this pathway. In Drosophila melanogaster phosphorylation of TRA, TRA-2 and the general RBP1 factor by the LAMMER kinase doa (darkener of apricot) is required for proper female sex determination. To explore whether this is a general feature of the pathway we examined sex-specific differences in phosphorylation levels of SR splicing factors in the dipteran species D. melanogaster, Ceratitis capitata (Medfly) and Musca domestica (Housefly). We found a distinct and reproducible pattern of male-specific phosphorylation on protein extracts enriched for SR proteins in C. capitata suggesting that differential phosphorylation may also contribute to the regulation of sex-specific splicing in the Medfly.

  10. Photosensitizing effect of hematoporphyrin IX on immature stages of Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Massaldi, Ana; Rabossi, Alejandro; Quesada-Allué, Luis Alberto

    2010-01-01

    Immature stages of Ceratitis capitata were tested as a model for hematoporphyrin IX (HP IX) phototoxicity. The lethal concentration 50 (LC(50)) of HP IX in the food was determined during postembryonic development until adult emergence as 0.173 mm (95% CI: 0.138-0.209). The corresponding HP IX LC(50) during the dispersal period alone was 0.536 mm (95% CI: 0.450-0.633). HP IX toxicity was compared against Phloxine B (PhB) (0.5 mm). HP IX elicited a mortality of 90.87%, which was mainly concentrated during prepupal and early pupal stages. PhB mortality was much lower (56.88%) and occurred mainly during the adult pharate stage. A direct correlation between light-dependent HP IX mortality, evidence of reactive oxygen species (ROS) and lipid peroxidation (conjugated dienes and thiobarbituric acid reactive substances) was established in C. capitata larvae. ROS were found to be very significant in both the brain and in the gut.

  11. The Mediterranean fruit fly (Ceratitis capitata in Iran: genetic diversity and comparison with other countries

    Directory of Open Access Journals (Sweden)

    M. Rajabiyan

    2015-04-01

    Full Text Available The Mediterranean fruit fly, Ceratitis capitata (Wiedemann is an economically important pest on fruits all over the world. The origin of this fly is thought to be from Africa, but it has recently expanded its distribution in many geographic regions including Iran. Due to the wide spread of this pest in Iran and its serious damage to fruit on trees, including citrus orchards of northern Iran, the present study was conducted firstly to investigate genetic diversity within populations of C. capitata based on the sequences of three mitochondrial DNA (mtDNA genes including cytochrome C oxidase I (COI, NAHD dehydrogenase subunits 4 and 5 (ND4 and ND5 and secondly to compare the Iranian haplotypes with those found in other countries. Results of this study indicated low levels of genetic diversity (four, four and three haplotypes among different populations of this pest, respectively for the COI, ND4 and ND5 genes in northern Iranian populations. The genetic similarity and very low levels of genetic diversity of northern Iranian populations suggest that the pest colonisation occurred relatively recently. In addition, haplotypes of Mazandaran province are similar to haplotypes of those countries that have recently been infected by this pest.

  12. Population genetics of Ceratitis capitata in South Africa: implications for dispersal and pest management.

    Science.gov (United States)

    Karsten, Minette; van Vuuren, Bettine Jansen; Barnaud, Adeline; Terblanche, John S

    2013-01-01

    The invasive Mediterranean fruit fly (medfly), Ceratitis capitata, is one of the major agricultural and economical pests globally. Understanding invasion risk and mitigation of medfly in agricultural landscapes requires knowledge of its population structure and dispersal patterns. Here, estimates of dispersal ability are provided in medfly from South Africa at three spatial scales using molecular approaches. Individuals were genotyped at 11 polymorphic microsatellite loci and a subset of individuals were also sequenced for the mitochondrial cytochrome oxidase subunit I gene. Our results show that South African medfly populations are generally characterized by high levels of genetic diversity and limited population differentiation at all spatial scales. This suggests high levels of gene flow among sampling locations. However, natural dispersal in C. capitata has been shown to rarely exceed 10 km. Therefore, documented levels of high gene flow in the present study, even between distant populations (>1600 km), are likely the result of human-mediated dispersal or at least some form of long-distance jump dispersal. These findings may have broad applicability to other global fruit production areas and have significant implications for ongoing pest management practices, such as the sterile insect technique.

  13. Medfly Ceratitis capitata as Potential Vector for Fire Blight Pathogen Erwinia amylovora: Survival and Transmission.

    Science.gov (United States)

    Ordax, Mónica; Piquer-Salcedo, Jaime E; Santander, Ricardo D; Sabater-Muñoz, Beatriz; Biosca, Elena G; López, María M; Marco-Noales, Ester

    2015-01-01

    Monitoring the ability of bacterial plant pathogens to survive in insects is required for elucidating unknown aspects of their epidemiology and for designing appropriate control strategies. Erwinia amylovora is a plant pathogenic bacterium that causes fire blight, a devastating disease in apple and pear commercial orchards. Studies on fire blight spread by insects have mainly focused on pollinating agents, such as honeybees. However, the Mediterranean fruit fly (medfly) Ceratitis capitata (Diptera: Tephritidae), one of the most damaging fruit pests worldwide, is also common in pome fruit orchards. The main objective of the study was to investigate whether E. amylovora can survive and be transmitted by the medfly. Our experimental results show: i) E. amylovora can survive for at least 8 days inside the digestive tract of the medfly and until 28 days on its external surface, and ii) medflies are able to transmit the bacteria from inoculated apples to both detached shoots and pear plants, being the pathogen recovered from lesions in both cases. This is the first report on E. amylovora internalization and survival in/on C. capitata, as well as the experimental transmission of the fire blight pathogen by this insect. Our results suggest that medfly can act as a potential vector for E. amylovora, and expand our knowledge on the possible role of these and other insects in its life cycle.

  14. Morphological characterization of the antennal lobes in the Mediterranean fruit fly Ceratitis capitata.

    Science.gov (United States)

    Solari, Paolo; Corda, Valentina; Sollai, Giorgia; Kreissl, Sabine; Galizia, C Giovanni; Crnjar, Roberto

    2016-02-01

    The medfly Ceratitis capitata is one of the most important pests for horticulture worldwide. The knowledge about anatomy and function of the medfly olfactory system is still limited. The first brain structure to process olfactory information in insects is the antennal lobe (AL), which is composed of its functional and morphological units, the olfactory glomeruli. Here, we present a morphological three-dimensional reconstruction of AL glomeruli in adult brains. We used unilateral antennal backfills of olfactory receptor neurons (ORNs) with neural tracers, revealing the AL structure. We recorded confocal stacks acquired from whole-mount specimens, and analyzed them with the software AMIRA. The ALs in C. capitata are organized in glomeruli which are more tightly packed in the anterior part than the posterior one. Axons of ORNs bilaterally connect the ALs through a commissure between the two ALs. This commissure is formed by several distinct fascicles. Contralateral dye transfer suggests the presence of gap junctions connecting ORNs from both antennae. There was no statistical difference between the average volumes of female ALs (204,166 ± 12,554 μm(3)) and of male ALs (190,287 ± 11,823 μm(3)). In most specimens, we counted 53 glomeruli in each AL, seven of which were sexually dimorphic in size.

  15. Infestation of grape Vitis vinifera by Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) in sub-medium Sao Francisco valley, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Habibe, Tuffi C.; Viana, Rodrigo E.; Damasceno, Itala Cruz; Malavasi, Aldo [Biofabrica Moscamed Brasil, Juazeiro, BA (Brazil). Distrito Industrial do Sao Francisco; Nascimento, Antonio S., E-mail: antnasc@cnpmf.embrapa.b [EMBRAPA Mandioca e Fruticultura Tropical, Cruz das Almas, BA (Brazil); Paranhos, Beatriz A.J.; Haji, Francisca Nemaura P., E-mail: bjodao@cpatsa.embrapa.b [EMBRAPA Semi-Arido, Petrolina, PE (Brazil); Carvalho, Raimundo S. [Agencia de Defesa Agropecuaria da Bahia (ADAB), Salvador, BA (Brazil)

    2006-07-01

    The objective of this study was to assess the infestation level in grapes, Vitis vinifera, by the medfly,Ceratitis capitata in the Sao Francisco River Valley. The adult population was monitored with Jackson trap baited with trimedlure. Samples of grapes for larval infestation assessment were taken along three months, with a total of 116 kg. The average FTD (flies/trap/day) for medfly males was 0.26. The number of pupae obtained from the fruit samples was 471; 287 adults emerged (60.4%), all Ceratitis capitata. The infestation level was 4.0 pupa/kg of fresh fruit. We conclude that grape is a medfly host in SFV, occasionally causing high damage to production. (author)

  16. One Metarhizium brunneum Strain, Two Uses to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Yousef, M; Garrido-Jurado, I; Quesada-Moraga, E

    2014-10-01

    We determined the virulence and insecticidal activity of the hypocrealean fungus Metarhizium brunneum (Petch) strain EAMb 09/01-Su and its crude extract against Mediterranean fruit fly Ceratitis capitata Wiedemann (Diptera: Tephritidae) and we evaluated the combined use of the fungus with its crude extract. We also determined the effect of fermentation time, temperature, and initial pH of the M. brunneum culture medium on the insecticidal activity of the crude extract. When C. capitata adults were sprayed with a conidial suspension, the strain EAMb 09/01-Su caused 100% mortality with a mean lethal time (LT50) of 5.6 d and mean lethal concentration (LC50) of 2.84 f#x2013; 10(7) conidia per milliliter. Fermentation time significantly affected the lethality of the crude extract when it was provided to C. capitata per os. The highest level of mortality (73.3%) and the shortest median survival time (25.5 h) was obtained from 15-d-old cultures. The crude extract was demonstrated to be thermostable, given that the mortality was >50% at 48 h when the extract had been heated to 100°C for 3 h. Lastly, the optimum initial pH for maximum crude extract activity in terms of mortality ranged between 7 and 9. Additivity was observed for all M. brunneum EAMb 09/01-Su strain crude extract combinations tested, indicating compatibility between products. We concluded that the M. brunneum EAMb 09/01-Su strain is a promising tool for medfly control alone or in combination with its crude extract.

  17. Estimating SIT-driven population reduction in the Mediterranean fruit fly, Ceratitis capitata, from sterile mating.

    Science.gov (United States)

    Juan-Blasco, M; Sabater-Muñoz, B; Pla, I; Argilés, R; Castañera, P; Jacas, J A; Ibáñez-Gual, M V; Urbaneja, A

    2014-04-01

    Area-wide sterile insect technique (SIT) programs assume that offspring reduction of the target population correlates with the mating success of the sterile males released. However, there is a lack of monitoring tools to prove the success of these programs in real-time. Field-cage tests were conducted under the environmental conditions of the Mediterranean coast of Spain to estimate: (a) the mating success of sterile Vienna-8 (V8) Ceratitis capitata males using molecular markers and (b) their efficacy to reduce C. capitata populations under six release ratios of wild females to wild males to V8 males (1:0:0, 1:1:0, 1:1:1, 1:1:5, 1:1:10, and 1:1:20). Statistical models were developed to predict: (a) the number of females captured in traps, (b) sperm ID (sterile or not) in spermathecae of the trapped females, and (c) the viable offspring produced, using release ratio and temperature as predictors. The number of females captured was affected by relative humidity. However, its influence in the model was low. Female captures were significantly higher in ratios 1:0:0 compared to ratios where V8 males were released. The proportion of V8 sperm in spermathecae increased with temperature and with the number of V8 males released, but leveled off between ratios 1:1:10 and 1:1:20. In all seasons, except winter (no offspring), viable offspring increased with temperature and was lowest for ratio 1:1:20. For the first time, a strong negative relationship between proportion of V8 sperm detected by molecular tools and C. capitata offspring was established. The models obtained should contribute to enhance the efficacy of SIT programs against this pest.

  18. Quarantine treatment against mediterranean fruit fly (Ceratitis capitata Wiedemann) in mangoes haden variety (Mangifera indica) with gamma irradiation (Co 60)

    OpenAIRE

    Peña C., María E.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.; Guillen E., Rafael; Servicio Nacional de Sanidad Agraria - SENASA.; Arias A., Gladys C.; Laboratorio de Bromatología Facultad de Farmacia y Bioquímica de la Universidad Nacional Mayor de San Marcos, Lima, Perú.

    2014-01-01

    Tephritidae fruit flies are among the most damaging pests of fruit crops worldwide Ceratitis capitata Wiedemann, for instance, can infest more than 250 fruit and vegetable crop species, and constitutes the main phytosanitary restrict for export purposes. The investigation was carried out in a SENASA’s Production Center of Sterile Fruit Flies and PIMU’s laboratory; it was supervised by an OIEA’s irradiation expert. This research comprised two stages: 1) Determine the minimum irradiation dose t...

  19. Sensitivity of Ceratitis capitata eggs irradiated in artificial diet and in mango fruits; Sensibilidade de ovos de Ceratitis capitata (WIED.,1824) irradiados em dieta artificial e em frutos de manga (Mangifera indica L.)

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Yasuoka, S.T.; Amorim, E.O.; Sato, M.E.; Suplicy Filho, N. [Instituto Biologico, Campinas, SP (Brazil); Faria, J.T. de [Delegacia Federal de Agricultura, Sao Paulo, SP (Brazil)

    1996-01-01

    The objective of this study was to establish gamma radiation doses required to prevent emergence of Ceratitis capitata adults, from irradiated eggs in artificial diet and mango fruits. Six-, twelve-, twenty-four-, and forty-eight-hour-old eggs were used. Artificial infestation by C. capitata was carried out in mangoes of Haden, Tommy and Keith cultivars. An increase of radiation resistance of C. capitata eggs was observed as a function of the embryonic development and a Probit 9 of 24.67 Gy was estimated for 48-hour-old eggs in artificial diet. No significant influence of mango fruits was found on the efficacy of irradiation. (author). 11 refs., 3 tabs.

  20. Sex and the single embryo: early deveopment in the Mediterranean fruit fly, Ceratitis capitata

    Directory of Open Access Journals (Sweden)

    Zacharopoulou Antigone

    2010-01-01

    Full Text Available Abstract Background In embryos the maternal-to-zygotic transition (MTZ integrates post-transcriptional regulation of maternal transcripts with transcriptional activation of the zygotic genome. Although the molecular mechanisms underlying this event are being clarified in Drosophila melanogaster, little is know about the embryogenic processes in other insect species. The recent publication of expressed sequence tags (ESTs from embryos of the global pest species Ceratitis capitata (medfly has enabled the investigation of embryogenesis in this species and has allowed a comparison of the embryogenic processes in these two related dipteran species, C. capitata and D. melanogaster, that shared a common ancestor 80-100 mya. Results Using a novel PCR-based sexing method, which takes advantage of a putative LTR retrotransposon MITE insertion on the medfly Y chromosome, the transcriptomes of individual early male and female embryos were analysed using RT-PCR. This study is focused on two crucial aspects of the onset of embryonic development: sex determination and cellular blastoderm formation. Together with the three known medfly genes (Cctransformer, Cctransformer2 and Ccdoublesex, the expression patterns of other medfly genes that are similar to the D. melanogaster sex-determination genes (sisterlessA, groucho, deadpan, Sex-lethal, female lethal d, sans fille and intersex and four cellular blastoderm formation genes (Rho1, spaghetti squash, slow-as-molasses and serendipity-α were analyzed, allowing us to sketch a preliminary outline of the embryonic process in the medfly. Furthermore, a putative homologue of the Zelda gene has been considered, which in D. melanogaster encodes a DNA-binding factor responsible for the maternal-to-zygotic transition. Conclusions Our novel sexing method facilitates the study of i when the MTZ transition occurs in males and females of C. capitata, ii when and how the maternal information of "female-development" is

  1. Sniffing out chemosensory genes from the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Siciliano, Paolo; Scolari, Francesca; Gomulski, Ludvik M; Falchetto, Marco; Manni, Mosè; Gabrieli, Paolo; Field, Linda M; Zhou, Jing-Jiang; Gasperi, Giuliano; Malacrida, Anna R

    2014-01-01

    The Mediterranean fruit fly, Ceratitis capitata (medfly), is an extremely invasive agricultural pest due to its extremely wide host range and its ability to adapt to a broad range of climatic conditions and habitats. Chemosensory behaviour plays an important role in many crucial stages in the life of this insect, such as the detection of pheromone cues during mate pursuit and odorants during host plant localisation. Thus, the analysis of the chemosensory gene repertoire is an important step for the interpretation of the biology of this species and consequently its invasive potential. Moreover, these genes may represent ideal targets for the development of novel, effective control methods and pest population monitoring systems. Expressed sequence tag libraries from C. capitata adult heads, embryos, male accessory glands and testes were screened for sequences encoding putative odorant binding proteins (OBPs). A total of seventeen putative OBP transcripts were identified, corresponding to 13 Classic, three Minus-C and one Plus-C subfamily OBPs. The tissue distributions of the OBP transcripts were assessed by RT-PCR and a subset of five genes with predicted proteins sharing high sequence similarities and close phylogenetic affinities to Drosophila melanogaster pheromone binding protein related proteins (PBPRPs) were characterised in greater detail. Real Time quantitative PCR was used to assess the effects of maturation, mating and time of day on the transcript abundances of the putative PBPRP genes in the principal olfactory organs, the antennae, in males and females. The results of the present study have facilitated the annotation of OBP genes in the recently released medfly genome sequence and represent a significant contribution to the characterisation of the medfly chemosensory repertoire. The identification of these medfly OBPs/PBPRPs permitted evolutionary and functional comparisons with homologous sequences from other tephritids of the genera Bactrocera and

  2. Sniffing out chemosensory genes from the Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Paolo Siciliano

    Full Text Available The Mediterranean fruit fly, Ceratitis capitata (medfly, is an extremely invasive agricultural pest due to its extremely wide host range and its ability to adapt to a broad range of climatic conditions and habitats. Chemosensory behaviour plays an important role in many crucial stages in the life of this insect, such as the detection of pheromone cues during mate pursuit and odorants during host plant localisation. Thus, the analysis of the chemosensory gene repertoire is an important step for the interpretation of the biology of this species and consequently its invasive potential. Moreover, these genes may represent ideal targets for the development of novel, effective control methods and pest population monitoring systems. Expressed sequence tag libraries from C. capitata adult heads, embryos, male accessory glands and testes were screened for sequences encoding putative odorant binding proteins (OBPs. A total of seventeen putative OBP transcripts were identified, corresponding to 13 Classic, three Minus-C and one Plus-C subfamily OBPs. The tissue distributions of the OBP transcripts were assessed by RT-PCR and a subset of five genes with predicted proteins sharing high sequence similarities and close phylogenetic affinities to Drosophila melanogaster pheromone binding protein related proteins (PBPRPs were characterised in greater detail. Real Time quantitative PCR was used to assess the effects of maturation, mating and time of day on the transcript abundances of the putative PBPRP genes in the principal olfactory organs, the antennae, in males and females. The results of the present study have facilitated the annotation of OBP genes in the recently released medfly genome sequence and represent a significant contribution to the characterisation of the medfly chemosensory repertoire. The identification of these medfly OBPs/PBPRPs permitted evolutionary and functional comparisons with homologous sequences from other tephritids of the genera

  3. Identification and expression profiling of Ceratitis capitata genes coding for β-hexosaminidases.

    Science.gov (United States)

    Pasini, Maria E; Intra, Jari; Gomulski, Ludvik M; Calvenzani, Valentina; Petroni, Katia; Briani, Federica; Perotti, Maria Elisa

    2011-02-15

    The goal of this study was to identify the genes coding for β-N-acetylhexosaminidases in the Mediterranean fruit fly (medfly) Ceratitis capitata, one of the most destructive agricultural pests, belonging to the Tephritidae family, order Diptera. Two dimeric β-N-acetylhexosaminidases, HEXA and HEXB, have been recently identified on Drosophila sperm. These enzymes are involved in egg binding through interactions with complementary carbohydrates on the surface of the egg shell. Three genes, Hexosaminidase 1 (Hexo1), Hexosaminidase 2 (Hexo2) and fused lobes (fdl), encode for HEXA and HEXB subunits. The availability of C. capitata EST libraries derived from embryos and adult heads allowed us to identify three sequences homologous to the D. melanogaster Hexo1, Hexo2 and fdl genes. Here, we report the expression profile analysis of CcHexo1, CcHexo2 and Ccfdld in several tissues, organs and stages. Ccfdl expression was highest in heads of both sexes and in whole adult females. In the testis and ovary the three genes showed distinct spatial and temporal expression patterns. All the mRNAs were detectable in early stages of spermatogenesis; CcHexo2 and Ccfdl were also expressed in early elongating spermatid cysts. All three genes are expressed in the ovarian nurse cells. CcHexo1 and Ccfdl are stage specific, since they have been observed in stages 12 and 13 during oocyte growth, when programmed cell death occurs in nurse cells. The expression pattern of the three genes in medfly gonads suggests that, as their Drosophila counterparts, they may encode for proteins involved in gametogenesis and fertilization.

  4. An agent-based simulation of extirpation of Ceratitis capitata applied to invasions in California.

    Science.gov (United States)

    Manoukis, Nicholas C; Hoffman, Kevin

    2014-01-01

    We present an agent-based simulation (ABS) of Ceratitis capitata ("Medfly") developed for estimating the time to extirpation of this pest in areas where quarantines and eradication treatments were immediately imposed. We use the ABS, implemented in the program MED-FOES, to study seven different outbreaks that occurred in Southern California from 2008 to 2010. Results are compared with the length of intervention and quarantine imposed by the State, based on a linear developmental model (thermal unit accumulation, or "degree-day"). MED-FOES is a useful tool for invasive species managers as it incorporates more information from the known biology of the Medfly, and includes the important feature of being demographically explicit, providing significant improvements over simple degree-day calculations. While there was general agreement between the length of quarantine by degree-day and the time to extirpation indicated by MED-FOES, the ABS suggests that the margin of safety varies among cases and that in two cases the quarantine may have been excessively long. We also examined changes in the number of individuals over time in MED-FOES and conducted a sensitivity analysis for one of the outbreaks to explore the role of various input parameters on simulation outcomes. While our implementation of the ABS in this work is motivated by C. capitata and takes extirpation as a postulate, the simulation is very flexible and can be used to study a variety of questions on the invasion biology of pest insects and methods proposed to manage or eradicate such species.

  5. Transgenic sexing system for Ceratitis capitata (Diptera: Tephritidae) based on female-specific embryonic lethality.

    Science.gov (United States)

    Ogaugwu, Christian E; Schetelig, Marc F; Wimmer, Ernst A

    2013-01-01

    Fruit fly pest species have been successfully controlled and managed via the Sterile Insect Technique (SIT), a control strategy that uses infertile matings of sterile males to wild females to reduce pest populations. Biological efficiency in the field is higher if only sterile males are released in SIT programs and production costs are also reduced. Sexing strains developed in the Mediterranean fruit fly Ceratitis capitata (medfly) through classical genetics are immensely beneficial to medfly SIT programs but exhibit reduced fertility and fitness. Moreover, transfer of such classical genetic systems to other tephritid species is difficult. Transgenic approaches can overcome this limitation of classical genetic sexing strains (GSSs), but had resulted so far in transgenic sexing strains (TSSs) with dominant lethality at late larval and pupal stages. Here we present a transgene-based female-specific lethality system for early embryonic sexing in medfly. The system utilizes the sex-specifically spliced transformer intron to restrict ectopic mRNA translation of the pro-apoptotic gene hid(Ala5) to females only. The expression of this lethal effector gene is driven by a tetracycline-repressible transactivator gene tTA that is under the control of promoters/enhancers of early-acting cellularization genes. Despite observed position effects on the sex-specific splicing, we could effectively establish this early-acting transgenic sexing system in the medfly C. capitata. After satisfactory performance in large scale tests, TSSs based on this system will offer cost-effective sexing once introduced into SIT programs. Moreover, this approach is straight forward to be developed also for other insect pest and vector species.

  6. Delivery of Nucleic Acids through Embryo Microinjection in the Worldwide Agricultural Pest Insect, Ceratitis capitata.

    Science.gov (United States)

    Gabrieli, Paolo; Scolari, Francesca

    2016-10-01

    The Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is a pest species with extremely high agricultural relevance. This is due to its reproductive behavior: females damage the external surface of fruits and vegetables when they lay eggs and the hatched larvae feed on their pulp. Wild C. capitata populations are traditionally controlled through insecticide spraying and/or eco-friendly approaches, the most successful being the Sterile Insect Technique (SIT). The SIT relies on mass-rearing, radiation-based sterilization and field release of males that retain their capacity to mate but are not able to generate fertile progeny. The advent and the subsequent rapid development of biotechnological tools, together with the availability of the medfly genome sequence, has greatly boosted our understanding of the biology of this species. This favored the proliferation of new strategies for genome manipulation, which can be applied to population control. In this context, embryo microinjection plays a dual role in expanding the toolbox for medfly control. The ability to interfere with the function of genes that regulate key biological processes, indeed, expands our understanding of the molecular machinery underlying medfly invasiveness. Furthermore, the ability to achieve germ-line transformation facilitates the production of multiple transgenic strains that can be tested for future field applications in novel SIT settings. Indeed, genetic manipulation can be used to confer desirable traits that can, for example, be used to monitor sterile male performance in the field, or that can result in early life-stage lethality. Here we describe a method to microinject nucleic acids into medfly embryos to achieve these two main goals.

  7. Insecticidal Activity of a Destruxin-Containing Extract of Metarhizium brunneum Against Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Lozano-Tovar, M D; Garrido-Jurado, I; Lafont, F; Quesada-Moraga, E

    2015-04-01

    Tephritid fruit flies are major pests that limit fruit production around the world; they cause important damages, increasing directly and indirectly annual costs, and their management is predominately based on the use of chemical insecticides. This research investigated the insecticidal activity of the crude extract obtained of Metarhizium brunneum Petch EAMb 09/01-Su strain and its capacity to secrete secondary metabolites including destruxins (dtx). Dtx A and A2 had insecticidal activity against Ceratitis capitata (Wiedemann) when administered per os. The crude extract of seven Metarhizium and one Beauveria isolates were evaluated per os against medfly adults. The crude extracts of the isolate EAMb 09/01-Su resulted in mortality ranging between 95 and 100% at 48 h. The high-pressure liquid chromatography profile showed two active peaks (F5B and F6 subfractions) related with dtx A2 and dtx A, which caused 70 and 100% mortality on C. capitata at 48 h postfeeding, respectively. The LC50 was 104.92 ppm of dtx A, contained in the F6 subfraction, and the LT50 was 4.16 h at a concentration of 400 ppm of dtx A contained in the F6 subfraction. Moreover, the average survival time of adults exposed to this subfraction was 12.6 h with only 1 h of exposure. The insecticide metabolites of the F6 subfraction of the EAMb 09/01-Su isolate retained >90% of its insecticidal activity after exposure to 60°C for 2 h and 120°C for 20 min. These results highlight the potential of this strain as a source of new insecticidal compounds of natural origin for fruit fly control.

  8. Avaliação da qualidade de frutos de café atacados por Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae Evaluation of the quality of coffee fruit attacked by Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    F.J. Cividanes

    1993-09-01

    Full Text Available Foram usadas plantas de Coffea arabica L., variedade Catuaí Vermelho, localizadas no Campus da Escola Superior de Agricultura "Luiz de Queiroz" - USP, Piracicaba,SP, para avaliação dos danos que Ceratitis capitata (Wied., 1824 pode causar aos frutos do cafeeiro. Os resultados mostraram que o ataque de C. capitula não causou queda prematura dos frutos, mas aumentou a queda de cerejas e foram encontradas, fortes evidências, com base na atividade da enzima polifenol oxidase e lixiviação de potássio, que cerejas atacadas podem produzir bebida de café de qualidade inferior.The present work was carried out using trees of Coffea arabica L. variety Red Catuaí grown at Escola Superior de Agricultura "Luiz de Queiroz" - Campus of the University of São Paulo, Piracicaba,SP. The objective was to estimate damages that Ceratitis capitata (Wied., 1824 can cause to coffee fruits. The results showed that C.capitata did not cause premature fruit fall, but it increased berry fall. The activity of the enzyme polyphenol oxidase and potassium lixiviatiou give strong evidences that atacked coffee beans produce coffee beverage of inferior quality.

  9. Pupal development of Ceratitis capitata (Diptera: Tephritidae) and Diachasmimorpha longicaudata (Hymenoptera: Braconidae) at different moisture values in four soil types.

    Science.gov (United States)

    Bento, F de M M; Marques, R N; Costa, M L Z; Walder, J M M; Silva, A P; Parra, J R P

    2010-08-01

    This study aimed to evaluate adult emergence and duration of the pupal stage of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and emergence of the fruit fly parasitoid, Diachasmimorpha longicaudata (Ashmead), under different moisture conditions in four soil types, using soil water matric potential. Pupal stage duration in C. capitata was influenced differently for males and females. In females, only soil type affected pupal stage duration, which was longer in a clay soil. In males, pupal stage duration was individually influenced by moisture and soil type, with a reduction in pupal stage duration in a heavy clay soil and in a sandy clay, with longer duration in the clay soil. As matric potential decreased, duration of the pupal stage of C. capitata males increased, regardless of soil type. C. capitata emergence was affected by moisture, regardless of soil type, and was higher in drier soils. The emergence of D. longicaudata adults was individually influenced by soil type and moisture factors, and the number of emerged D. longicaudata adults was three times higher in sandy loam and lower in a heavy clay soil. Always, the number of emerged adults was higher at higher moisture conditions. C. capitata and D. longicaudata pupal development was affected by moisture and soil type, which may facilitate pest sampling and allow release areas for the parasitoid to be defined under field conditions.

  10. Transcriptome profiling of sexual maturation and mating in the Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Ludvik M Gomulski

    Full Text Available Sexual maturation and mating in insects are generally accompanied by major physiological and behavioural changes. Many of these changes are related to the need to locate a mate and subsequently, in the case of females, to switch from mate searching to oviposition behaviour. The prodigious reproductive capacity of the Mediterranean fruit fly, Ceratitis capitata, is one of the factors that has led to its success as an invasive pest species. To identify the molecular changes related to maturation and mating status in male and female medfly, a microarray-based gene expression approach was used to compare the head transcriptomes of sexually immature, mature virgin, and mated individuals. Attention was focused on the changes in abundance of transcripts related to reproduction, behaviour, sensory perception of chemical stimulus, and immune system processes. Broad transcriptional changes were recorded during female maturation, while post-mating transcriptional changes in females were, by contrast, modest. In male medfly, transcriptional changes were consistent both during maturation and as a consequence of mating. Of particular note was the lack of the mating-induced immune responses that have been recorded for Drosophila melanogaster, that may be due to the different reproductive strategies of these species. This study, in addition to increasing our understanding of the molecular machinery behind maturation and mating in the medfly, has identified important gene targets that might be useful in the future management of this pest.

  11. Oviposition preference hierarchy in Ceratitis capitata (Diptera, Tephritidae: influence of female age and experience

    Directory of Open Access Journals (Sweden)

    Joachim-Bravo Iara S.

    2001-01-01

    Full Text Available The influence of two factors, age and previous experience, on the oviposition hierarchy preference of Ceratitis capitata (Wiedemann, 1824 females was studied. Two populations were analyzed: one reared in laboratory during 17 years and the other captured in nature. In the first experiment the oviposition preference for four fruits, papaya, orange, banana and apple was tested at the beginning of oviposition period and 20 days past. The results showed that the wild females as much the laboratory ones had an oviposition preference hierarchy at the beginning of peak period of oviposition. However this hierarchic preference disappeared in a later phase of life. In the second experiment the females were previously exposed to fruits of different hierarchic positions and afterwards their choice was tested in respect to the oviposition preference for those fruits. The results showed that there was an influence of the previous experience on the posterior choice of fruits to oviposition when the females were exposed to fruits of lower hierarchic position.

  12. Conditional embryonic lethality to improve the sterile insect technique in Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Franz Gerald

    2009-01-01

    Full Text Available Abstract Background The sterile insect technique (SIT is an environment-friendly method used in area-wide pest management of the Mediterranean fruit fly Ceratitis capitata (Wiedemann; Diptera: Tephritidae. Ionizing radiation used to generate reproductive sterility in the mass-reared populations before release leads to reduction of competitiveness. Results Here, we present a first alternative reproductive sterility system for medfly based on transgenic embryonic lethality. This system is dependent on newly isolated medfly promoter/enhancer elements of cellularization-specifically-expressed genes. These elements act differently in expression strength and their ability to drive lethal effector gene activation. Moreover, position effects strongly influence the efficiency of the system. Out of 60 combinations of driver and effector construct integrations, several lines resulted in larval and pupal lethality with one line showing complete embryonic lethality. This line was highly competitive to wildtype medfly in laboratory and field cage tests. Conclusion The high competitiveness of the transgenic lines and the achieved 100% embryonic lethality causing reproductive sterility without the need of irradiation can improve the efficacy of operational medfly SIT programs.

  13. Transcriptome profiling of sexual maturation and mating in the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Gomulski, Ludvik M; Dimopoulos, George; Xi, Zhiyong; Scolari, Francesca; Gabrieli, Paolo; Siciliano, Paolo; Clarke, Anthony R; Malacrida, Anna R; Gasperi, Giuliano

    2012-01-01

    Sexual maturation and mating in insects are generally accompanied by major physiological and behavioural changes. Many of these changes are related to the need to locate a mate and subsequently, in the case of females, to switch from mate searching to oviposition behaviour. The prodigious reproductive capacity of the Mediterranean fruit fly, Ceratitis capitata, is one of the factors that has led to its success as an invasive pest species. To identify the molecular changes related to maturation and mating status in male and female medfly, a microarray-based gene expression approach was used to compare the head transcriptomes of sexually immature, mature virgin, and mated individuals. Attention was focused on the changes in abundance of transcripts related to reproduction, behaviour, sensory perception of chemical stimulus, and immune system processes. Broad transcriptional changes were recorded during female maturation, while post-mating transcriptional changes in females were, by contrast, modest. In male medfly, transcriptional changes were consistent both during maturation and as a consequence of mating. Of particular note was the lack of the mating-induced immune responses that have been recorded for Drosophila melanogaster, that may be due to the different reproductive strategies of these species. This study, in addition to increasing our understanding of the molecular machinery behind maturation and mating in the medfly, has identified important gene targets that might be useful in the future management of this pest.

  14. Molecular cloning and expression of nanos in the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Ogaugwu, Christian E; Wimmer, Ernst A

    2013-01-01

    The gene nanos (nos) is a maternal-effect gene that plays an important role in posterior patterning and germ cell development in early stage embryos. nos is known from several diverse insect species, but has so far not been described for any Tephritid fruit fly. Here, we report the molecular cloning and expression pattern of the nos orthologous gene, Ccnos, in the Mediterranean fruit fly Ceratitis capitata, which is a destructive pest of high agricultural importance. CcNOS contains 398 amino acids and has a C-terminal region with two conserved CCHC zinc-binding motifs known to be essential for NOS function. Transcripts of Ccnos were confirmed by in situ hybridization to be maternally-derived and localized to the posterior pole of early stage embryos. Regulatory regions of nos have been employed in genetic engineering in some dipterans such as Drosophila and mosquitoes. Given the similarity in spatial and temporal expression between Ccnos and nos orthologs from other dipterans, its regulatory regions will be valuable to generate additional genetic tools that can be applied for engineering purposes to improve the fight against this devastating pest.

  15. Sperm storage and use in polyandrous females of the globally invasive fruitfly, Ceratitis capitata.

    Science.gov (United States)

    Bertin, Sabrina; Scolari, Francesca; Guglielmino, Carmela R; Bonizzoni, Mariangela; Bonomi, Angelica; Marchini, Daniela; Gomulski, Ludvik M; Gasperi, Giuliano; Malacrida, Anna R; Matessi, Carlo

    2010-11-01

    The medfly, Ceratitis capitata, is an invasive species in which polyandry, associated with sperm precedence, is a common behaviour in the wild. In this species, characterized by internal fertilization, we disclose how the sperm from two males are stored in the female storage organs and how they are used in terms of paternity outcome. The experiments were designed to furnish comparable and unbiased estimates of sperm numbers and progeny in twice-mated females. Results are incorporated in a model through which it is possible to relate the amount of stored sperm with the progeny of twice-mated females. The results show that polyandrous medfly females conserve equal amounts of sperm from the two males to fertilize their eggs. However, we observed a clear advantage of the second male's sperm in siring progeny, which interestingly decreases in favor of the first male as ovipositions progress. The results enable us to exclude differential sperm mortality and suggest that it is the mechanics governing the storage organs which causes the initial, but decreasing second male sperm precedence during the female reproductive life. These outcomes allow us to correlate sperm use in polyandrous females with the mating strategies and invasiveness of this fly.

  16. Thermotolerance and HSP70 expression in the Mediterranean fruit fly Ceratitis capitata.

    Science.gov (United States)

    Kalosaka, Katerina; Soumaka, Elisavet; Politis, Nikos; Mintzas, Anastassios C

    2009-06-01

    The relationship between Hsp70 expression and thermotolerance has been well documented in Drosophila melanogaster. However, there is limited information on this relationship in other insect species. In this report we describe the Hsp70-thermotolerance relationship in one of the major fruit fly pests, Ceratitis capitata (medfly). Hsp70 expression and thermotolerance were assayed at a range of temperatures in several stages of medfly development. The most thermotolerant stage was found to be the late larval stage (100% survival at 41 degrees C) followed by adult flies and late embryos (100% survival at 39 degrees C). These three stages showed a positive relationship between Hsp70 expression and thermotolerance. Mid-larval and mid-embryonic stages were found less thermotolerant and the Hsp70-thermotolerance relationship was not evident. Early embryos did not express Hsp70 at any temperature and exhibited the lowest thermotolerance. The relationship between Hsp70 and inducible thermotolerance was also studied in late larvae. A pretreatment at 37-39 degrees C increased thermotolerance at higher temperatures by approximately 1 degrees C. In parallel, the pretreatment increased Hsp70 expression suggesting a close link between Hsp70 expression and inducible thermotolerance. The increased Hsp70 levels after pretreatment were found to be due to the increased levels of the hsp70 RNA.

  17. Sperm-less males modulate female behaviour in Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Gabrieli, Paolo; Scolari, Francesca; Di Cosimo, Alessandro; Savini, Grazia; Fumagalli, Marco; Gomulski, Ludvik M; Malacrida, Anna R; Gasperi, Giuliano

    2016-12-01

    In the Mediterranean fruit fly, Ceratitis capitata (Wiedemann)(Diptera: Tephritidae), mating has a strong impact on female biology, leading to a decrease in sexual receptivity and increased oviposition and fecundity. Previous studies suggest that sperm transfer may play a role in inducing these behavioural changes. Here we report the identification of a medfly innexin gene, Cc-inx5, whose expression is limited to the germ-line of both sexes. Through RNA interference of this gene, we generated males without testes and, consequently, sperm, but apparently retaining all the other reproductive organs intact. These sperm-less males were able to mate and, like their wild-type counterparts, to induce in their partners increased oviposition rates and refractoriness to remating. Interestingly, matings to sperm-less males results in oviposition rates higher than those induced by copulation with control males. In addition, the observed female post-mating behavioural changes were congruent with changes in transcript abundance of genes known to be regulated by mating in this species. Our results suggest that sperm transfer is not necessary to reduce female sexual receptivity and to increase oviposition and fecundity. These data pave the way to a better understanding of the role/s of seminal components in modulating female post-mating responses. In the long term, this knowledge will be the basis for the development of novel approaches for the manipulation of female fertility, and, consequently, innovative tools to be applied to medfly control strategies in the field.

  18. Influence of protein on feeding behavior of Ceratitis capitata Wiedemann (Diptera: Tephritidae): comparison between immature males and females

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do C.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Dept. de Biologia

    2005-07-15

    The objective of this work was to compare the influence of dietary protein on performance and feeding behavior of immature males and females of Ceratitis capitata (Wiedemann). The protein source was beer yeast at 6.5 and 1.5 g.100 ml-1. The following parameters were evaluated: percentage of emergence, total life cycle, adult size, diet consumption, feeding preference and discrimination threshold for yeast. Immature adults showed similar protein requirements regardless of sex. Both males and females showed similar feeding behavior, preferring to feed on the diet with higher protein content. The discrimination threshold for levedure in both sexes was 0.4 g.100 ml-1. We concluded that immature males of C. capitata show similar protein requirements as the immature females. (author)

  19. Treatment post harvest of Citrus sinensis infested with Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) using gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno M.M. Soares de; Bortoli, Sergio A. de, E-mail: nmendes@terra.com.b, E-mail: bortoli@fcav.unesp.b [UNESP, Jaboticabal, SP (Brazil). Faculdade de Ciencias Agrarias e Veterinarias. Depto. de Fitossanidade; Doria, Hayda O.S., E-mail: hosd75@terra.com.b [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Medicina. Dept. de Biologia; Arthur, Valter, E-mail: varthur@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). Lab. de Radiobiologia e Ambiente

    2009-07-01

    This work was carried out to evaluate the effect of irradiation on fruit fly (Ceratitis capitata) eggs and larvae (first, second, third instars), in 'Valencia' oranges; and evaluate the effect of the irradiation on the chemical composition of the fruits. Fruits were artificially infested with the immature stages of the fruit fly and treated with 0, 10, 20, 30, 40, 50, 100, 150 and 200 Gy Cobalt-60 doses. By the results obtained it is possible to conclude that: third instar larvae are more tolerant to irradiation treatments; the dose of 50 Gy causes sterility to the adults emerged from all immature stages irradiated. (author)

  20. SENSIBILIDADE DE OVOS DE Ceratitis capitata (WIED., 1824 IRRADIADOS EM DIETA ARTIFICIAL E EM FRUTOS DE MANGA (Mangifera indica L.

    Directory of Open Access Journals (Sweden)

    A RAGA

    1996-01-01

    Full Text Available O objetivo deste trabalho foi determinar as doses de radiação gama que impedissem a emergência de adultos de Ceratitis capitata, a partir de ovos irradiados em dieta artificial e em frutos de manga. Quinhentos ovos de 6, 12, 24 e 48 horas de idade foram irradiados em cada dose. A infestação artificial de ovos ocorreu em mangas das cultivares Haden, Tommy Atkins ou Keitt. Um aumento da radioresistência de ovos foi observado durante o desenvolvimento embrionário, e para ovos de 48 horas em dieta artificial, foi estimado um Probit 9 de 24,67Gy. Não foi observada influência significativa dos frutos de manga na eficiência da irradiação dos ovos, quando comparada com os testes em dieta artificial.The objective of this study was to establish gamma radiation doses required to prevent emergence of Ceratitis capitata (Wied. adults, from irradiated eggs in artificial diet and mango fruits. Six-, twelve-, twenty-four- and fourty-eight-hour-old eggs were used. Artificial infestation by C. capitata was carried out in mangoes of `Haden', `Tommy Atkins' and `Keitt' cultivars. An increase of radiation resistance of C. capitata eggs was observed as a function of the embryonic development and a Probit 9 of 24.67Gy was estimated for 48-hour-old eggs in artificial diet. No significant influence of mango fruits was found on the efficacy of irradiation.

  1. Cryopreservation of Embryos of the Mediterranean Fruit Fly Ceratitis capitata Vienna 8 Genetic Sexing Strain

    Science.gov (United States)

    Augustinos, Antonios A.; Rajamohan, Arun; Kyritsis, Georgios A.; Zacharopoulou, Antigone; Haq, Ihsan ul; Targovska, Asya; Caceres, Carlos; Bourtzis, Kostas; Abd-Alla, Adly M. M.

    2016-01-01

    The Mediterranean fruit fly, Ceratitis capitata, is one of the most serious pests of fruit crops world-wide. During the last decades, area-wide pest management (AW-IPM) approaches with a sterile insect technique (SIT) component have been used to control populations of this pest in an effective and environment-friendly manner. The development of genetic sexing strains (GSS), such as the Vienna 8 strain, has been played a major role in increasing the efficacy and reducing the cost of SIT programs. However, mass rearing, extensive inbreeding, possible bottleneck phenomena and hitch-hiking effects might pose major risks for deterioration and loss of important genetic characteristics of domesticated insect. In the present study, we present a modified procedure to cryopreserve the embryos of the medfly Vienna 8 GSS based on vitrification and used this strain as insect model to assess the impact of the cryopreservation process on the genetic structure of the cryopreserved insects. Forty-eight hours old embryos, incubated at 24°C, were found to be the most suitable developmental stage for cryopreservation treatment for high production of acceptable hatch rate (38%). Our data suggest the absence of any negative impact of the cryopreservation process on egg hatch rate, pupation rates, adult emergence rates and stability of the temperature sensitive lethal (tsl) character on two established cryopreserved lines (flies emerged from cryopreserved embryos), named V8-118 and V8-228. Taken together, our study provides an optimized procedure to cryopreserve the medfly Vienna 8 GSS and documents the absence of any negative impact on the genetic structure and quality of the strain. Benefits and sceneries for utilization of this technology to support operational SIT projects are discussed in this paper. PMID:27537351

  2. Chill-coma recovery time, age and sex determine lipid profiles in Ceratitis capitata tissues.

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Fagali, Natalia Soledad; Rabossi, Alejandro; Catalá, Ángel; Quesada-Allué, Luis Alberto

    2016-04-01

    The remodeling of membrane composition by changes in phospholipid head groups and fatty acids (FA) degree of unsaturation has been associated with the maintenance of membrane homeostasis under stress conditions. Overall lipid levels and the composition of cuticle lipids also influence insect stress resistance and tissue protection. In a previous study, we demonstrated differences in survival, behavior and Cu/Zn superoxide dismutase gene expression between subgroups of Ceratitis capitata flies that had a reversible recovery from chill-coma and those that developed chilling-injury. Here, we analyzed lipid profiles from comparable subgroups of 15 and 30-day-old flies separated according to their recovery time after a chill-coma treatment. Neutral and polar lipid classes of chill-coma subgroups were separated by thin layer chromatography and quantified by densitometry. FA composition of polar lipids of chill-coma subgroups and non-stressed flies was evaluated using gas chromatography coupled to mass spectrometry. Higher amounts of neutral lipids such as triglycerides, diacylglycerol, wax esters, sterol esters and free esters were found in male flies that recovered faster from chill-coma compared to slower flies. A multivariate analysis revealed changes in patterns of storage and cuticle lipids among subgroups both in males and females. FA unsaturation increased after cold exposure, and was higher in thorax of slower subgroups compared to faster subgroups. The changes in neutral lipid patterns and FA composition depended on recovery time, sex, age and body-part, and were not specifically associated with the development of chilling-injury. An analysis of phospholipid classes showed that the phosphatidylcholine to lysophosphatidylcholine ratio (PC/LPC) was significantly higher, or showed a tendency, in subgroups that may have developed chilling-injury compared to those with a reversible recovery from coma.

  3. Cryopreservation of Embryos of the Mediterranean Fruit Fly Ceratitis capitata Vienna 8 Genetic Sexing Strain.

    Science.gov (United States)

    Augustinos, Antonios A; Rajamohan, Arun; Kyritsis, Georgios A; Zacharopoulou, Antigone; Haq, Ihsan Ul; Targovska, Asya; Caceres, Carlos; Bourtzis, Kostas; Abd-Alla, Adly M M

    2016-01-01

    The Mediterranean fruit fly, Ceratitis capitata, is one of the most serious pests of fruit crops world-wide. During the last decades, area-wide pest management (AW-IPM) approaches with a sterile insect technique (SIT) component have been used to control populations of this pest in an effective and environment-friendly manner. The development of genetic sexing strains (GSS), such as the Vienna 8 strain, has been played a major role in increasing the efficacy and reducing the cost of SIT programs. However, mass rearing, extensive inbreeding, possible bottleneck phenomena and hitch-hiking effects might pose major risks for deterioration and loss of important genetic characteristics of domesticated insect. In the present study, we present a modified procedure to cryopreserve the embryos of the medfly Vienna 8 GSS based on vitrification and used this strain as insect model to assess the impact of the cryopreservation process on the genetic structure of the cryopreserved insects. Forty-eight hours old embryos, incubated at 24°C, were found to be the most suitable developmental stage for cryopreservation treatment for high production of acceptable hatch rate (38%). Our data suggest the absence of any negative impact of the cryopreservation process on egg hatch rate, pupation rates, adult emergence rates and stability of the temperature sensitive lethal (tsl) character on two established cryopreserved lines (flies emerged from cryopreserved embryos), named V8-118 and V8-228. Taken together, our study provides an optimized procedure to cryopreserve the medfly Vienna 8 GSS and documents the absence of any negative impact on the genetic structure and quality of the strain. Benefits and sceneries for utilization of this technology to support operational SIT projects are discussed in this paper.

  4. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae in southern Syria

    Directory of Open Access Journals (Sweden)

    Mansour Mohammed

    2016-09-01

    Full Text Available Population fluctuations of the Mediterranean fruit fly (medfly, Ceratitis capitata, were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria (Damascus Ghota, Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab. Medfly adults were monitored weekly all year around using Jackson traps baited with trimedlure dispensers. Larvae were also sampled in Damascus Ghota by collecting fruits from ripe or ripening fruit trees and recording the number of larvae emerged from these fruits. In addition, suspected overwintering refuges were sampled at weekly intervals during the three coldest months of the year (December – February and the number of collected larvae was recorded. The results of trap catches and fruit sampling studies showed a similar pattern of occurrence of medfly populations in the study areas, particularly in Damascus Ghota, during the three years of the study. In Damascus Ghota, flies were caught continuously from early June to late December with some variability between years. Two distinct periods of high fly activity were observed: the first one occurred in August and the second in November with a much higher amplitude. In general, seasonal fluctuations in the pattern of occurrence were influenced by differences in temperature and abundance of preferred host fruits. Traps on fig Ficus carica and oriental persimmon Diospyros kaki trees caught the highest numbers of flies, and fruits collected from these trees showed the highest level of infestation, reaching 100% for fig fruit late in the season. Sampling fruits (in Damascus Ghota from trees during the three coldest months of the year showed that a small population of medfly larvae was able to survive winter conditions in prickly pear Opuntia vulgaris fruit left on the trees. In the other areas of the study (Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab, only a few flies were caught.

  5. The significance of genetic polymorphisms within and between founder populations of Ceratitis capitata (Wied. from Argentina.

    Directory of Open Access Journals (Sweden)

    Alicia Basso

    Full Text Available BACKGROUND: The Mediterranean fruit fly Ceratitis Capitata (DIPTERA: Tephritidae is a major agricultural pest in Argentina. One main cause for the success of non-contaminant control programs based on genetic strategies is compatibility between natural and laboratory germplasms. A comprehensive characterization of the fruit fly based on genetic studies and compatibility analysis was undertaken on two founder populations from the provinces of Buenos Aires and Mendoza, used in pioneering sterile male technique control programmes in our country. The locations are 1,000 km apart from each other. METHODOLOGY/PRINCIPAL FINDINGS: We compared the genetic composition of both populations based on cytological, physiological and morphological characterization. Compatibility studies were performed in order to determine the presence of isolation barriers. Results indicate that the Buenos Aires germplasm described previously is partially different from that of the Mendoza population. Both laboratory colonies are a reservoir of mutational and cytological polymorphisms. Some sexual chromosome variants such as the XL and the YL resulting from attachment of a B-chromosome to the X-chromosome or Y-chromosome behave as a lethal sex-linked factor. Our results also show incompatibility between both germplasms and pre-zygotic isolation barriers between them. Our evidence is consistent with the fact that polymorphisms are responsible for the lack of compatibility. CONCLUSIONS: The genetic control mechanism should be directly produced in the germplasm of the target population in order to favour mating conditions. This is an additional requirement for the biological as well as economic success of control programs based on genetic strategies such as the sterile insect technique. The analysis of representative samples also revealed natural auto-control mechanisms which could be used in modifying pest population dynamics.

  6. Medhost: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann),Version 2.0

    Science.gov (United States)

    MEDHOST,Version 2.0 is the second revision of:"MEDHOST: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly,Ceratitis capitata(Wiedemann),Version 1.0," which was released in 1998 as a Windows-based executable database and listed all plant species reported as hosts of Medit...

  7. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and B. zonata (Diptera: Tephritidae) by comparison...existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Phytosanitary cold treatments are attempted for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) by comparison with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were...

  8. Attraction of Ceratitis capitata (Diptera: Tephritidae) and Nontarget Insects to the Attractant BioLure and its Individual Components in Hawaii.

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  9. Insecticidal Activity of Basil Oil, trans-Anethole, Estragole, and Linalool to Adults of Ceratitis capitata, Bactrocera dorsalis, and B. cucurbitae

    Science.gov (United States)

    Pest tephritid fruit flies, Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel), and B. cucurbitae (Cocquillett) are among the species of economic significance. Their management has primarily relied on the use of food baits, male attractants and their combinations with insecticides. Basil o...

  10. Capacidad dispersiva de Ceratitis capitata (Diptera: Tephritidae entre valles agrícolas en San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Leonardo M. DÍAZ

    2008-01-01

    Full Text Available Ceratitis capitata (Wiedemann, díptero tefrítido cosmopolita originario del norte de África, es la principal plaga de los frutales en muchos países de América. El objetivo de este trabajo fue conocer las características de la capacidad de dispersión de Ceratitis capitata , mediante la liberación de moscas estériles en condiciones de campo, con el propósito de predecir las posibles invasiones de valles agrícolas vecinos. Se liberaron 54.000 moscas estériles marcadas de ambos sexos, en localidades del valle de Tulum, cercanas a los ingresos de los valles de Ullum y Zonda. Para el monitoreo del vuelo dispersivo se instalaron trampas Jackson y Mc Phail. Se capturaron 1.213 adultos durante el periodo de muestreo. No hubo propagación de los adultos liberados desde el valle de Tulum a los valles de Ullum y Zonda. La presencia de hospederos, posición geográfica de cada Quebrada y la orientación respecto al viento predominante, podrían explicar la diferencia de difusión entre ambas Quebradas. La dispersión duró cinco semanas. La distancia media de los adultos liberados fue de 3.764 m (S= 2.897 m sin encontrar diferencias entre ambos sexos.

  11. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.Influência de diferentes frutos tropicais em aspectos biológicos e comportamentais da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Estudos em Ceratitis capitata, uma praga agrícola, pode auxiliar

  12. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.

  13. Genomic structure and expression analysis of the RNase kappa family ortholog gene in the insect Ceratitis capitata.

    Science.gov (United States)

    Rampias, Theodoros N; Fragoulis, Emmanuel G; Sideris, Diamantis C

    2008-12-01

    Cc RNase is the founding member of the recently identified RNase kappa family, which is represented by a single ortholog in a wide range of animal taxonomic groups. Although the precise biological role of this protein is still unknown, it has been shown that the recombinant proteins isolated so far from the insect Ceratitis capitata and from human exhibit ribonucleolytic activity. In this work, we report the genomic organization and molecular evolution of the RNase kappa gene from various animal species, as well as expression analysis of the ortholog gene in C. capitata. The high degree of amino acid sequence similarity, in combination with the fact that exon sizes and intronic positions are extremely conserved among RNase kappa orthologs in 15 diverse genomes from sea anemone to human, imply a very significant biological function for this enzyme. In C. capitata, two forms of RNase kappa mRNA (0.9 and 1.5 kb) with various lengths of 3' UTR were identified as alternative products of a single gene, resulting from the use of different polyadenylation signals. Both transcripts are expressed in all insect tissues and developmental stages. Sequence analysis of the extended region of the longer transcript revealed the existence of three mRNA instability motifs (AUUUA) and five poly(U) tracts, whose functional importance in RNase kappa mRNA decay remains to be explored.

  14. Field Efficacy of a Metarhizium anisopliae-Based Attractant-Contaminant Device to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Ayala, I; Sanchis, J; Primo, J; Moya, P

    2015-08-01

    Biological control of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) using entomopathogenic fungi is being studied as a viable control strategy. The efficacy of a Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae)-based attractant-contaminant device (ACD) to control C. capitata was evaluated in a medium-scale (40 ha) 2-yr field trial using a density of 24 ACD per ha. Results showed that this density was adequate to efficiently reduce fruitfly populations and that the inoculation dishes (IDs) needed replacing mid-season to provide protection for the entire season. In this study, fungal treatment was even more effective than conventional chemical treatment. Population dynamics in fungus-treated fields along with the infectivity study of field-aged IDs in the laboratory found that the ACD remained effective for at least 3 mo. The results suggest M. anisopliae-based ACD can be used to control C. capitata in the field. The implications of its use, especially as a tool in an integrated pest management program, are discussed.

  15. Ammonium Acetate Enhances the Attractiveness of a Variety of Protein-Based Baits to Female Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Smith, Trevor R; Fox, Abbie J; Vargas, Roger I

    2015-04-01

    Ammonia and its derivatives are used by female fruit flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally based control strategies such as food-based lures and insecticidal baits targeting pestiferous fruit fly species. In field cage studies conducted in Hawaii, we examined the behavioral response of laboratory-reared male and female Mediterranean fruit fly, Ceratitis capitata (Wiedemann), to seven commercially available protein baits and to beer waste, a relatively inexpensive and readily available substance. Each material was tested alone or in combination with either ammonium acetate or ammonium carbonate. For the majority of baits evaluated, the presence of ammonium acetate, but not ammonium carbonate, elicited a significantly greater level of response of female C. capitata compared with the protein baits alone. The addition of ammonium acetate to selected baits increased bait attractiveness to a level comparable with that elicited by the most widely used spinosad-based protein bait, GF-120. Our findings indicate that the addition of ammonium acetate to commercially available proteinaceous baits and to beer waste can greatly improve their attractiveness to C. capitata, potentially increasing the bait's effectiveness for fruit fly monitoring and suppression.

  16. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and Bactrocera zonata (Diptera: Tephritidae) by comparison with existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Hallman, Guy J; Myers, Scott W; El-Wakkad, Mokhtar F; Tadrous, Meshil D; Jessup, Andrew J

    2013-08-01

    Phytosanitary cold treatments were tested for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) using comparisons with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were initiated when the larvae reached late third instar because previous research had shown that stage to be the most cold tolerant for all three species. Results show that B. invadens is not more cold tolerant than C. capitata and B. zonata at 1.0 +/- 0.1 degrees C and lend support to the use of C. capitata cold treatment schedules for B. invadens. It cannot be concluded that B. zonata is not more cold tolerant than C. capitata.

  17. Solid phase microextraction of volatile emissions of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of fly sex, age, and mating status.

    Science.gov (United States)

    Alfaro, Cristina; Vacas, Sandra; Zarzo, Manuel; Navarro-Llopis, Vicente; Primo, Jaime

    2011-01-12

    Considerable efforts have been devoted to understanding the courtship behavior and pheromone communication of medflies; however, the sex pheromone composition is still a controversial subject. The discovery of new components affecting medfly behavior would be of interest for medfly control methods based on semiochemicals. This work describes volatile compounds emitted by Ceratitis capitata collected using solid phase microextraction. The volatile study was conducted according to an experimental design with three factors (sex, age, and mating status) assumed to be relevant for better understanding the chemical communication. Emission data were treated by means of principal component analysis, a statistical methodology not previously applied to the study of volatiles emitted by fruit flies. The characterization of emission patterns could be useful for the selection of compounds to be further investigated in biological assays to improve knowledge of the key semiochemicals involved in medfly behavior.

  18. How functional genomics will impact fruit fly pest control: the example of the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Scolari, Francesca; Gomulski, Ludvik M; Gabrieli, Paolo; Manni, Mosè; Savini, Grazia; Gasperi, Giuliano; Malacrida, Anna R

    2014-01-01

    The highly invasive agricultural insect pest Ceratitis capitata (Diptera: Tephritidae) is the most thoroughly studied tephritid fruit fly at the genetic and molecular levels. It has become a model for the analysis of fruit fly invasions and for the development of area-wide integrated pest management (AW-IPM) programmes based on the environmentally-friendly Sterile Insect Technique (SIT). Extensive transcriptome resources and the recently released genome sequence are making it possible to unravel several aspects of the medfly reproductive biology and behaviour, opening new opportunities for comparative genomics and barcoding for species identification. New genes, promotors and regulatory sequences are becoming available for the development/improvement of highly competitive sexing strains, for the monitoring of sterile males released in the field and for determining the mating status of wild females. The tools developed in this species have been transferred to other tephritids that are also the subject of SIT programmes.

  19. Mating choice of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of male ageing on mating success; Escolha de parceiro para acasalamento em Ceratitis capitata (Wiedemann)(Diptera: Tephritidae): influencia do envelhecimento dos machos no sucesso de copula

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral], e-mail: bio.alberto@gmail.com, e-mail: vanessasidias@hotmail.com, e-mail: ibravo@ufba.br

    2009-09-15

    The objective of this study was to evaluate the effect of male ageing on male pheromone release and mating success of Ceratitis capitata (Wiedemann). The effects of male ageing on mating were evaluated on fi ve and 21 d-old males by assessing their mating success (males chosen by a female for copulation) and the amount of males releasing the sex pheromone. The mating success was evaluated by using several ratios of young to older males by increasing the number of older males:young males from 1:1 to 5:1. The mating success of the 1:1 ratio was also evaluated in fi eld cages. The evaluation of the mating success (in the 1:1 ratio) showed a clear preference of the females for young males. Sex pheromone emission was much more common on young than older males. Even in cases were older males were more abundant (ratios 2:1 and 3:1), females still chose the young males. However, females could not distinguish young from older males in ratios of 4:1 or 5:1. Our data indicate that the ageing of C. capitata males has a considerable negative effect on their reproductive success, especially if they are found in a proportion any lower than 3:1. (author)

  20. Transcriptional profiles of mating-responsive genes from testes and male accessory glands of the Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Francesca Scolari

    Full Text Available BACKGROUND: Insect seminal fluid is a complex mixture of proteins, carbohydrates and lipids, produced in the male reproductive tract. This seminal fluid is transferred together with the spermatozoa during mating and induces post-mating changes in the female. Molecular characterization of seminal fluid proteins in the Mediterranean fruit fly, Ceratitis capitata, is limited, although studies suggest that some of these proteins are biologically active. METHODOLOGY/PRINCIPAL FINDINGS: We report on the functional annotation of 5914 high quality expressed sequence tags (ESTs from the testes and male accessory glands, to identify transcripts encoding putative secreted peptides that might elicit post-mating responses in females. The ESTs were assembled into 3344 contigs, of which over 33% produced no hits against the nr database, and thus may represent novel or rapidly evolving sequences. Extraction of the coding sequences resulted in a total of 3371 putative peptides. The annotated dataset is available as a hyperlinked spreadsheet. Four hundred peptides were identified with putative secretory activity, including odorant binding proteins, protease inhibitor domain-containing peptides, antigen 5 proteins, mucins, and immunity-related sequences. Quantitative RT-PCR-based analyses of a subset of putative secretory protein-encoding transcripts from accessory glands indicated changes in their abundance after one or more copulations when compared to virgin males of the same age. These changes in abundance, particularly evident after the third mating, may be related to the requirement to replenish proteins to be transferred to the female. CONCLUSIONS/SIGNIFICANCE: We have developed the first large-scale dataset for novel studies on functions and processes associated with the reproductive biology of Ceratitis capitata. The identified genes may help study genome evolution, in light of the high adaptive potential of the medfly. In addition, studies of male

  1. Size relationships of different body parts in the three dipteran species Drosophila melanogaster, Ceratitis capitata and Musca domestica.

    Science.gov (United States)

    Siomava, Natalia; Wimmer, Ernst A; Posnien, Nico

    2016-06-01

    Body size is an integral feature of an organism that influences many aspects of life such as fecundity, life span and mating success. Size of individual organs and the entire body size represent quantitative traits with a large reaction norm, which are influenced by various environmental factors. In the model system Drosophila melanogaster, pupal size and adult traits, such as tibia and thorax length or wing size, accurately estimate the overall body size. However, it is unclear whether these traits can be used in other flies. Therefore, we studied changes in size of pupae and adult organs in response to different rearing temperatures and densities for D. melanogaster, Ceratitis capitata and Musca domestica. We confirm a clear sexual size dimorphism (SSD) for Drosophila and show that the SSD is less uniform in the other species. Moreover, the size response to changing growth conditions is sex dependent. Comparison of static and evolutionary allometries of the studied traits revealed that response to the same environmental variable is genotype specific but has similarities between species of the same order. We conclude that the value of adult traits as estimators of the absolute body size may differ among species and the use of a single trait may result in wrong assumptions. Therefore, we suggest using a body size coefficient computed from several individual measurements. Our data is of special importance for monitoring activities of natural populations of the three dipteran flies, since they are harmful species causing economical damage (Drosophila, Ceratitis) or transferring diseases (Musca).

  2. Insecticidal effects of various concentrations of selected extractions of Cestrum parqui on adult and immature Ceratitis capitata.

    Science.gov (United States)

    Zapata, Nelson; Budia, Flor; Viñuela, Elisa; Medina, Pilar

    2006-04-01

    Aqueous extracts of Cestrum parqui L'Héritier (Solanaceae) were evaluated at different concentrations in several stages of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). For adults, the study was extended to extracts obtained with several solvents of an increasing degree of polarity. Aqueous extracts from C. parqui showed a high toxicity to neonate larvae when ingested through diet, inhibiting pupation at a concentration above 0.6%. Lower concentrations delayed the larval development and reduced the percentages of pupae formed and adult emergence. An LC50 = 0.9% after 3 d of continuous ingestion of C. parqui aqueous extracts could be calculated, whereas extracts obtained with organic compounds were nearly innocuous except with the use of the solvent methanol/water (80:20), the more polar of those tested, that killed 12.5% of adults. Aqueous extracts were also harmful to adults by diminishing the reproductive potential, which implies a significant effect on the offspring. Egg contact with insecticide or dipping third instars did not cause any adverse effect, supporting the hypothesis that only by means of ingestion can the toxic compounds of C. parqui reach the target. Our results showed that C. parqui components causing C. capitata mortality are mostly dissolved in water and not in organic solvents, which point out their polar character.

  3. Intensity of Attack Caused by Mediterranean Fruit Fly Ceratitis capitata Wiedem. (Diptera, Tephritidae on Mandarin along the Montenegrin Seacoast

    Directory of Open Access Journals (Sweden)

    Sanja Radonjić

    2011-01-01

    Full Text Available Along the Montenegrin seacoast, all cultivated citrus species (mandarin, orange, lemon,grapefruit, fig, loquat and ziziphus were detected as host plants of the Ceratitis capitata Wiedem.Among those found, in economic sense, the most important host plant is mandarinUnšiu.Intensity of the attack were monitored on mandarin in 2003 and 2004 in localities Baošići,Lastva Grbaljska and Bar, and was determined as higher in 2003. The first symptoms ofattack were detected, depending on locality, from middle of September until beginning ofOctober, one to two months earlier then in 2004. The maximum number of larvae per fruitwere detected in October and November (average from 13.44±0.16 to 22.82±0.13. Timeof the first symptoms appearence on mandarin in September and October 2003 and in November2004, indicate on crucial importance of alternative host plants (figs and loquat forreproduction and increasing of C. capitata population, because later during a season its intensityof attack on mandarin, depend largely on their presence.

  4. Field Estimates of Attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to Methyl Eugenol in Varying Environments.

    Science.gov (United States)

    Manoukis, Nicholas C; Siderhurst, Matthew; Jang, Eric B

    2015-06-01

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation, and control of invasive pests. Here, we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel) to estimate the relationship between distance from a trap baited with trimedlure and methyl eugenol, respectively, and probability of capture for a receptive male insect. Experiments were conducted using a grid of traps with a central release point at two sites on Hawaii Island, a Macadamia orchard on the East side of the island and a lava field on the West side. We found that for B. dorsalis and methyl eugenol there is a 65% probability of capture at ∼36 m from a single trap, regardless of habitat. For C. capitata, we found a 65% probability of capture at a distance of ∼14 m from a single trap in the orchard and 7 m in the lava field. We also present results on the spatial and temporal pattern of recaptures. The attraction data are analyzed via a hyperbolic secant-based capture probability model.

  5. Wing Morphometry and Acoustic Signals in Sterile and Wild Males: Implications for Mating Success in Ceratitis capitata.

    Science.gov (United States)

    de Souza, João Maria Gomes Alencar; de Lima-Filho, Paulo Augusto; Molina, Wagner Franco; de Almeida, Lúcia Maria; de Gouveia, Milson Bezerra; de Macêdo, Francisco Pepino; Laumann, Raul Alberto; Paranhos, Beatriz Aguiar Jordão

    2015-01-01

    The sterile insect technique (SIT) is widely utilized in the biological control of fruit flies of the family Tephritidae, particularly against the Mediterranean fruit fly. This study investigated the interaction between mating success and morphometric variation in the wings and the production of acoustic signals among three male groups of Ceratitis capitata (Wiedemann): (1) wild males, (2) irradiated with Co-60 (steriles), and (3) irradiated (steriles) and treated with ginger oil. The canonical variate analysis discriminated two groups (males irradiated and males wild), based on the morphological shape of the wings. Among males that emit buzz signals, wild males obtained copulation more frequently than males in Groups 2 and 3. The individuals of Group 3 achieved more matings than those in Group 2. Wild males displayed lower pulse duration, higher intervals between pulses, and higher dominant frequency. Regarding the reproductive success, the morphological differences in the wings' shape between accepted and nonaccepted males are higher in wild males than in the irradiated ones. The present results can be useful in programs using the sterile insect technique for biological control of C. capitata.

  6. Cloning and purification of protein kinase CK2 recombinant alpha and beta subunits from the Mediterranean fly Ceratitis capitata.

    Science.gov (United States)

    Kouyanou-Koutsoukou, Sophia; Baier, Andrea; Kolaitis, Regina-Maria; Maniatopoulou, Evanthia; Thanopoulou, Konstantina; Szyszka, Ryszard

    2011-10-01

    The Mediterranean fruit fly Ceratitis capitata is an insect capable of wreaking extensive damage to a wide range of fruit crops. Protein kinase CK2 is a ubiquitous Ser/Thr kinase that is highly conserved among eukaryotes; it is a heterotetramer composed of two catalytic (α) and a dimer of regulatory (β) subunits. We present here the construction of the cDNA molecules of the CK2α and CK2β subunits from the medfly C. capitata by the 5'/3' RACE and RT-PCR methods, respectively. CcCK2α catalytic subunit presents the characteristic and conserved features of a typical protein kinase, similar to the regulatory CcCK2β subunit, that also possess the conserved features of regulatory CK2β subunits, as revealed by comparison of their predicted amino acid sequences with other eukaryotic species. The recombinant CcCK2α and CcCK2β proteins were purified by affinity chromatography to homogeneity, after overexpression in Escherichia coli. CcCK2α is capable to utilize GTP and its activity and is inhibited by polyanions and stimulated by polycations in phosphorylation assays, using purified acidic ribosomal protein P1 as a substrate.

  7. 地中海实蝇幼虫分子鉴定%Molecular identification for larvae of Ceratitis capitata

    Institute of Scientific and Technical Information of China (English)

    叶军; 周国梁; 易建平; 吴家教; 阮长浩; 梁帆; 郑建中; 王文兵

    2007-01-01

    通过对从秘鲁进口的葡萄中截获实蝇类幼虫进行ITS区和线粒体CO Ⅰ,COⅡ,COⅢ、ND5基因序列的扩增和测序,并与GenBank中对应的序列进行比对,结果表明,截获样品ITS区序列和地中海实蝇Ceratitis capitata(Wiedemann)同源性为95.16%(其中ITS1为99.52%,ITS2为86.2%),线粒体COⅠ,COⅡ,COⅢ,ND5基因序列和地中海实蝇C.capitata同源性为100%,99.9%,99.5%,99.8%;基于CO Ⅰ序列构建的系统发育树中,幼虫样品和地中海实蝇最为接近.根据序列分析和系统发育关系分析的结果,将截获的实蝇类幼虫鉴定为地中海实蝇C.capitata.

  8. Cloning, sequence identification and expression profile analysis of α-L-fucosidase gene from the Mediterranean fruit fly Ceratitis capitata.

    Science.gov (United States)

    Intra, Jari; Perotti, Maria-Elisa; Pasini, Maria Enrica

    2011-04-01

    The Mediterranean fruit fly Ceratitis capitata (Diptera: Tephritidae) is one of the most destructive agricultural pests, a polyphagus insect of relevant economic importance and is widespread in many regions around the world. It is the best-studied fruit fly pest at genetic and molecular level and much has been learned on its ecology and behaviour. An α-L-fucosidase has been recently hypothesized to be involved in sperm-egg interactions in Drosophila melanogaster and in other Drosophila species. Here, a complete cDNA encoding a putative α-L-fucosidase of the medfly was amplified using the reverse polymerase chain reaction (RT-PCR) with degenerate based on the conserved coding sequence information of several insect α-L-fucosidases, cloned and sequenced (GenBank accession no. FJ177429). The coding region consisted of 1482 bp which encoded a 485-residues protein (named CcFUCA) with a predicted molecular mass of 56.1 kDa. The deduced protein sequence showed 75% amino acid identity to D. melanogaster α-L-fucosidase, and in fact the phylogenetic tree analysis revealed that CcFUCA had closer relationships with the α-L-fucosidases of drosophilid species. The tissue expression analysis indicated that CcFuca was expressed in a single transcript in all tissues, suggesting a ubiquitous localization pattern of the encoded protein. Our findings provide novel insights on a gene encoding a protein potentially involved in primary gamete interactions in C. capitata.

  9. Wing Morphometry and Acoustic Signals in Sterile and Wild Males: Implications for Mating Success in Ceratitis capitata

    Directory of Open Access Journals (Sweden)

    João Maria Gomes Alencar de Souza

    2015-01-01

    Full Text Available The sterile insect technique (SIT is widely utilized in the biological control of fruit flies of the family Tephritidae, particularly against the Mediterranean fruit fly. This study investigated the interaction between mating success and morphometric variation in the wings and the production of acoustic signals among three male groups of Ceratitis capitata (Wiedemann: (1 wild males, (2 irradiated with Co-60 (steriles, and (3 irradiated (steriles and treated with ginger oil. The canonical variate analysis discriminated two groups (males irradiated and males wild, based on the morphological shape of the wings. Among males that emit buzz signals, wild males obtained copulation more frequently than males in Groups 2 and 3. The individuals of Group 3 achieved more matings than those in Group 2. Wild males displayed lower pulse duration, higher intervals between pulses, and higher dominant frequency. Regarding the reproductive success, the morphological differences in the wings’ shape between accepted and nonaccepted males are higher in wild males than in the irradiated ones. The present results can be useful in programs using the sterile insect technique for biological control of C. capitata.

  10. Toxicity of naturally occurring Bio-fly and chitosan compounds to control the Mediterranean fruit fly Ceratitis capitata (Wiedemann).

    Science.gov (United States)

    Rabea, E I; Nasr, H M; Badawy, M E I; El-Gendy, I R

    2015-01-01

    The efficacy of five compounds of a biopolymer chitosan and Bio-fly (Beauveria bassiana fungus) as biopesticide was evaluated on Ceratitis capitata under laboratory conditions. The inhibitory effects on acetylcholinesterase (AChE) and adenosinetriphosphatase (ATPase) as biochemical indicators were also determined in vivo. The results indicated that B. bassiana based Bio-fly exhibited significant toxicity against C. capitata (LC50 = 3008 and 3126 mg/L after 48 h in females and males, respectively) followed by the derivatives of chitosan, N-(4-propylbenzyl)chitosan and N-(2-nitrobenzyl)chitosan. Bio-fly displayed remarkable inhibition of AChE activity (IC50 = 2220 mg/L) while N-(2-chloro,6-flourobenzyl)chitosan, N-(4-propylbenzyl)chitosan and N-(3,4-methylenedioxybenzyl) chitosan had no significant difference in inhibitory action. In adult males, N-(2-nitrobenzyl)chitosan exhibited the highest inhibitory action (IC50 = 6569 mg/L). In addition, the toxic effects of the tested compounds on the activity of ATPase indicated that highly significant inhibition was found with N-(4-propylbenzyl)chitosan with an IC50 of 8194 and 8035 mg/L, in females and males, respectively.

  11. Evaluación de colores para la oviposición de Ceratitis capitata (Diptera, Tephritidae en Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Suárez

    2013-04-01

    Full Text Available Ceratitis capitata es una de las principales plagas de la fruticultura mundial y en Argentina es la Mosca de los Frutos de mayor abundancia y distribución. El desarrollo de una trampa artificial de oviposición, puede ser una herramienta útil de monitoreo para hembras grávidas. El objetivo de este trabajo fue evaluar la capacidad atrayente para la oviposición de C. capitata sobre esferas de agar de color amarillo, rojo, verde, negro y sin color; en condiciones de laboratorio. Se observaron diferencias estadísticamente significativas, siendo las esferas rojas y negras las más atractivas sobre las verdes, amarillas y sin color. En laboratorio, la mayor atracción alcanzada por el rojo y negro sustentaría la hipótesis de que el fuerte contraste respecto al fondo incrementaría la atracción de los colores más oscuros.

  12. Nitric oxide synthase-dependent NADPH-diaphorase activity in the optic lobes of male and female Ceratitis capitata mutants

    Directory of Open Access Journals (Sweden)

    E Roda

    2009-06-01

    Full Text Available Nitric oxide (NO is acknowledged as a messenger molecule in the nervous system with a pivotal role in the modulation of the chemosensory information. It has been shown to be present in the optic lobes of several insect species. In the present study, we used males and females from four different strains of the medfly Ceratitis capitata (Diptera, Tephritidae: or; or,wp (both orange eyed; w,M360 and w,Heraklion (both white eyed, as models to further clarify the involvement of NO in the mutants’ visual system and differences in its activity and localization in the sexes. Comparison of the localization pattern of NO synthase (NOS, through NADPH-diaphorase (NADPHd staining, in the optic lobes of the four strains, revealed a stronger reaction intensity in the retina and in the neuropile region lamina than in medulla and lobula. Interestingly, the intensity of NADPHd staining differs, at least in some strains, in the optic lobes of the two sexes; all the areas are generally strongly labelled in the males of the or and w,M360 strains, whereas the w,Heraklion and or,wp mutants do not show evident sexdependent NADPHd staining. Taken as a whole, our data point to NO as a likely transmitter candidate in the visual information processes in insects, with a possible correlation among NOS distribution, eye pigmentation and visual function in C. capitata males. Moreover, NO could influence behavioural differences linked to vision in the two sexes.

  13. Pathogenicity of Beauveria bassiana isolated from Moroccan Argan forests soil against larvae of Ceratitis capitata (Diptera: Tephritidae) in laboratory conditions.

    Science.gov (United States)

    Imoulan, Abdessamad; Elmeziane, Abdellatif

    2014-03-01

    The Mediterranean fruit fly, Ceratitis capitata Wiedemann (Diptera: Tephritidae), is the major tephritid pest in Morocco. This pest survives in Moroccan forests Argania spinosa and continually invades the nearest agricultural areas. Entomopathogenic fungi are an interesting tool for fruit fly control and hold a useful alternative to conventional insecticides. However, primary selection of effective pathogens should be taken in laboratory condition prior to applying them in the field. Here, we used third late instar larvae of C. capitata to investigate the effectiveness of 15 local Beauveria bassiana isolates. Results showed that all isolates were able to infect the larval stage, producing a large mortality rate in puparia ranging from 65 to 95 % and caused significant reduction in adult emergence. The fungal treatments revealed that the mycosis occurred also in adults escaping infection as pupariating larvae. The percentage of mycosed puparia was highest in strain TAM6.2 (95 %) followed by ERS4.16 (90 %), therefore they were the most virulent. Median lethal concentration (LC₅₀) was studied for five isolates at four concentrations ranging from 10⁵ to 10⁸ conidia ml⁻¹. The results showed that the slopes of regression lines for B. bassiana ERS4.16 (slope = 0.386) and TAM6.2 (slope = 0.41) were the most important and had the lowest LC₅₀ values (2.85 × 10³ and 3.16 × 10³ conidia ml⁻¹ respectively). This investigation suggests that the soil of Argan forests contains pathogenic B. bassiana isolates and highlights for the first time their potential as biological control toward C. capitata larval stage in Morocco.

  14. Efectos de la edad de la generación parental en la biología reproductiva de Ceratitis capitata Wied. (Diptera: Trypetidae)

    OpenAIRE

    Andrés, Mª.P.; Muñiz, Mariano

    1993-01-01

    Se ha realizado un estudio con parejas aisladas de Ceratitis capitata Wied. para determinar la influencia de la edad de los padres, tanto en la calidad de las pupas, fecundidad, fertilidad y longevidad de los adultos de la primera generación filial, como en el desarrollo larvario, actividad reproductora y eficacia biológica de los descendientes originados por adultos de edad avanzada en cuatro generaciones sucesivas. De los resultados obtenidos se deduce que la edad de los prog...

  15. Sublethal effect of neem extract on mediterranean fruit fly adults Efeito subletal de extratos de Azadirachta indica Sobre adultos de Ceratitis capitata

    Directory of Open Access Journals (Sweden)

    Márcio Alves Silva

    2013-03-01

    Full Text Available The sublethal effect of extracts of Azadirachta indica on Ceratitis capitata was evaluated. Two pairs of flies were treated in plastic tubes with cotton placed in plastic cages. An artificial diet (hydrolyzed protein + sugar was provided ad libitum. The extracts affected significantly the longevity of C. capitata. The pre-oviposition period were not significantly affected by the extracts. The A. indica branches extracted with dichloromethane (888 ppm affected significantly the fecundity and fertility, reducing the number of eggs laid to approximately 80 % and the egg hatching by 30 % at the 8th day. Therefore, the neem branches extracted with dichloromethane affected the reproduction of C. capitata.Neste estudo, avaliou-se o efeito subletal de extratos de Azadirachta indica sobre Ceratitis capitata. Os tratamentos em um tubo plástico com algodão foram expostos para dois casais numa gaiola plástica. Nessa gaiola, também foi fornecida dieta artificial (proteína hidrolisada + açúcar ad libitum. Os extratos afetaram significativamente a longevidade de C. capitata. O período de pré-oviposição não foi significativamente afetado pelos extratos. Em contrapartida, o extrato de ramos em diclorometano (888 ppm afetou a fecundidade e a fertilidade, reduzindo em 80% o número de ovos colocados e a viabilidade dos ovos em 30%, no 8º dia. Portanto, o extrato de ramos em diclorometano afeta a reprodução de C. capitata.

  16. Producción masiva y simultánea de machos de Ceratitis capitata (Diptera: Tephritidae y parasitoides Dichasmimorpha longicaudata (Hymenoptera: Braconidae Massive and simultaneous production of Ceratitis capitata (Diptera: Tephritidae males and Diachasmimorpha longicaudata (Hymenoptera: Braconidae parasitoids

    Directory of Open Access Journals (Sweden)

    Silvia N. López

    2006-12-01

    Full Text Available En la línea de sexado genético «Cast191» las hembras de Ceratitis capitata son homocigotas para el gen slow , lo que reduce su velocidad de desarrollo; los machos son heterocigotas y muestran una velocidad de desarrollo normal. Esta característica permitió producir, con Cast191, machos estériles por un lado, y parasitoides criados sobre las larvas remanentes por el otro. Nuestro objetivo con este trabajo fue producir ambos insumos simultáneamente y a una escala mayor que hasta ahora. Además, bajo estas condiciones, y en un intento por aumentar la separación entre sexos, se aplicó a las larvas del primer estadío un pulso de 15º C, durante 1 ó 2 días, luego del cual se las mantuvo a 20º C ó 25º C, hasta que entraron al estado de pupa, luego se mantuvo todo el material a 25º C. La mejor separación de sexos, lograda con el tratamiento a 20º C sin pulso de frío, se usó para comparar la calidad del parasitoide Diachasmimorpha longicaudata, criado sobre las larvas obtenidas tras la separación de los machos, con aquellos criados sobre la línea salvaje. Para ello, este tratamiento de separación fue aplicado en la cría de la mosca, y el material remanente de dieta con larvas fue expuesto al parasitoide. La tasa de parasitismo obtenida fue semejante a la hallada sobre la línea salvaje, y la tasa sexual de la F 1 del parasitoide presentó un sesgo hacia las hembras aún mayor. Se discute la factibilidad de utilizar la línea Cast191 de C. Capitata, para la producción a mayor escala de machos de mosca y para la cría masiva del parasitoide D. longicaudata.In the genetic sexing strain «Cast191», the females of Ceratitis capitata are homozygous for the mutation slow , slowing down their rate of development, and the males are heterozygous, having a normal rate of development. This feature made Cast191 capable of producing sterile males, on one hand, and parasitoids that are reared on the remaining larvae, on the other. The

  17. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae Relationship between time of larval development and fecundity in the female of Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. Manso

    2006-07-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw , la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw (- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw (- como en las sw(+ , los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.We studied the relationship between the development time in the larva stage and the resulting female fecundity, in Ceratitis capitata Wiedemann wild-type individuals compared to mutant individuals showing slow development (sw. We observed the morphology of the ovaries in the progenies of the crossing between mutant and wild-type strains, comparing females segregating by «development time». This study showed that sw(- females developing later have got less ovarioles, and a more heterogeneous distribution of ovules, than females developing earlier. It was also found that the wild type females developing late also produce lower numbers both of ovarioles and fully developed ova, than those developing

  18. Quarantine treatment to Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) in orange fruits (Citrus sinensis).; Tratamento quarentenario para Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) em frutos de laranja (Citrus sinensis)

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno Miguel Mendes Soares de

    2005-07-01

    This work was carried out to evaluate the effect of thermal treatments (vapour heat and hot water) and irradiation on Ceratitis capitata eggs and larvae (first, second and third instars), in 'Valencia' oranges; the relation between temperature and exposition time to vapour heat and hot water on fruit fly immature; the relation among the different doses of radiation on fruit fly immature and evaluate the effect of the treatments (thermal treatments and irradiation) on the chemical composition of the fruits. It was evaluated the heat absorption and loose of heat by the fruit. For thermal treatments it was used temperatures of 44 and 46 deg C for 15,30,60, 90 and 120 minutes and a control. For irradiation were used the doses: 10,20, 30, 40, 50, 100, 150 and 200 Gy. By the results obtained it is possible to conclude that: to the control of eggs and larvae (first, second and third instars) the treatment with vapour heat was less efficient than the hot water treatment; the thermal treatments of C. capitata eggs and larvae (first and second and third instars) can be recommended with vapor heat at 46 deg C at 152.2 minutes or with hot water at 46 deg C at 84.8 minutes, achieving the quarantine request; third instar larvae are more tolerant to the thermal and irradiation treatments; the treatment with irradiation can be recommended for quarantine treatment of ali immature stages evaluated with the dose of 72.88 Gy; the dose of 50 Gy causes sterility to the adults emerged from ali immature stages irradiated; treatments do not cause any change in the chemical proprieties in the orange fruits var. 'Valencia'. (author)

  19. Some aspects of the behavior at different ages of Ceratitis capitata (Wiedemann, 1824) (Diptera-Tephritidae) irradiated with gamma rays; Alguns aspectos do comportamento em diferentes idades de Ceratitis capitata (Wiedemann, 1824) (Diptera-tephritidae) irradiadas com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Ivone Midori

    1988-08-01

    The present work was carried out in the laboratory of the Entomology Section of the Nuclear Energy for Agriculture Center (CENA) in Piracicaba, Sao Paulo state, Brazil, to determine the effects different gamma radiation doses on the reproductive potential of males and the flight behavior of Ceratitis capitata (Wied.). For all the treatments with gamma radiation a Cobalt-60 source type Gamma beam-650 was used, with activity of approximately 13,410 x 10{sup B} Bq. (4,967 Ci.), and the dose rate of 2.000 Gy per hour. The doses used were 80 Gy, 100 Gy and 120 Gy. The three doses employed affected more the longevity of males than the females and the number of spermatozoid found lower in the irradiated insects compared with the control, with no significant differences between doses. The insects irradiated with 80 Gy showed activity similar to the control population until four days after emergence: afterwards they were more active than the unirradiated. The gamma irradiation diminished the take-off ability of the insects. (author). 59 refs., 9 figs., 9 tabs.

  20. Importance of adult protein ingestion on the mating success of Ceratitis capitata Wiedemann males (Diptera: Tephritidae); Importancia da ingestao de proteina na fase adulta para o sucesso de acasalamento dos machos de Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S., E-mail: bio.alberto@gmail.co, E-mail: vanessasidias@hotmail.co, E-mail: ibravo@ufba.b [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral

    2010-04-15

    The importance of the protein ingestion during the adult stage on the mating success of males of Ceratitis capitata Wiedemann was evaluated in experiments of laboratory and fi eld cage. In laboratory, the effects of protein ingestion during the fi rst four or 12 days of the male adult life was assessed by the following parameters: mating success (capacity of being chosen by the female) and the number of males that give out pheromonal signals. Some experiments of mating success had been carried through with males in different ratios. In these tests, the number of males which had ingested protein (an unique male) was remained constant and the number of males fed without protein was gradually increased from 1:1 to 1:5. In the fi eld cages, the mating success experiments were done using a 1:1 ratio. The results showed that the protein ingestion in the fi rst four days of life did not influence any of the analyzed parameters. When the period of ingestion of protein was extended to 12 days, protein-fed males fed produced more pheromonal signals and had a higher mating success when at a 1:1 ratio in laboratory and fi eld cage assays. In laboratory, females randomly chose males in any other tested ratio (1:2, 1:3, 1:4 and 1:5), indicating that the female may lose the perception to identify the male who ingested protein in the fi rst 12 days. (author)

  1. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. MANSO

    2006-01-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw, la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw(- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw(- como en las sw(+, los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.

  2. PRESENCE OF THE MEDITERRANEAN FRUIT FLY(Ceratitis capitata Wied. IN SELECTED OLIVE ORCHARDS OF CENTRAL DALMATIA

    Directory of Open Access Journals (Sweden)

    M. Bjeliš

    2007-12-01

    Full Text Available Mediterranean fruit fly (Ceratitis capitata Wiedemann is a regular pest of large number of cultivated and wild host plants in Dalmatia. However, this pest does not develop either inside fruits of cultivated olive - Olea europaea sativa or wild olive „ mastrinka“ - Olea europaea oleaster. The main objective of this research was to prove regular presence, time of appearance and flight duration of the Mediterranean fruit fly inside selected orchards of central Dalmatia. During the four years of research, from 2001 to 2004 by using of traps and parapheromone trimedlure, the regular presence of the Mediterranean fruit fly was proved inside four selected orchards on the area of cities of Split and Kaštela, with differences in adult caught between localities and years. During the 2001 year, on the three locations in the area of city of Kaštela, the highest capture during the total research period was recorded, while on the locations in Split, the highest capture was recorded during 2003 year, but also significant during 2001 year. The lowest number of adult, less than 5 flies/trap was captured on all four locations during 2002 year.

  3. Manipulation of the microbiota of mass-reared Mediterranean fruit flies Ceratitis capitata (Diptera: Tephritidae) improves sterile male sexual performance.

    Science.gov (United States)

    Ben Ami, Eyal; Yuval, Boaz; Jurkevitch, Edouard

    2010-01-01

    The sterile insect technique (SIT) is a method of biological control whereby millions of factory reared sterile male insects are released into the field. This technique is commonly used to combat the Mediterranean fruit fly (Ceratitis capitata, Diptera: Tephritidae). Sterile medfly males are less competent in attracting and mating with wild females, a property commonly linked to the irradiation process responsible for the sterilization. As bacteria are important partners in the fly's life cycle, we used molecular analytical methods to study the community structure of the gut microbiota in irradiated male medflies. We find that the sterilizing irradiation procedure affects the gut bacterial community structure of the Mediterranean fruit fly. Although the Enterobacteriaceae family remains the dominant bacterial group present in the gut, the levels of Klebsiella species decreases significantly in the days after sterilization. In addition, we detected substantial differences in some bacterial species between the mass rearing strain Vienna 8 and the wild strain. Most notable among these are the increased levels of the potentially pathogenic species Pseudomonas in the industrial strain. Testing the hypothesis that regenerating the original microbiota community could result in enhanced competitiveness of the sterile flies, we found that the addition of the bacterial species Klebsiella oxytoca to the postirradiation diet enables colonization of these bacteria in the gut while resulting in decreased levels of the Pseudomonas sp. Feeding on diets containing bacteria significantly improved sterile male performance in copulatory tests. Further studies will determine the feasibility of bacterial amelioration in SIT operations.

  4. Impact of the Mediterranean fruit fly (medfly) Ceratitis capitata on different peach cultivars: the possible role of peach volatile compounds.

    Science.gov (United States)

    Tabilio, Maria Rosaria; Fiorini, Dennis; Marcantoni, Enrico; Materazzi, Stefano; Delfini, Maurizio; De Salvador, Flavio Roberto; Musmeci, Sergio

    2013-09-01

    The relationship between susceptibility of different peach cultivars (cvs) to the Mediterranean fruit fly (medfly), Ceratitis capitata, and the volatile composition of ripe fruit of each cv has been investigated, since understanding the fruit-insect interaction mechanism is crucial for developing control strategies for such a pest. Volatile compounds were analyzed by SPME-GC-MS in three cvs highly susceptible to medfly attack (Fair Time, Flaminia, Sicilia Piatta), and in two less susceptible cvs (Percoca Romagnola 7 and Doctor Davis). Among the volatile compounds detected, 88 could be identified. The main differences found in the volatile composition of the cvs, concerned the relative abundance of esters. The least susceptible cvs, above all Percoca Romagnola 7, contained the higher amounts of hexenyl, hexyl, 3-methylbutyl, butyl and 2-methylpropyl esters; among these, some C6 derivatives detected, such as (Z)-3-hexenyl acetate, are known to act as priming agents, enhancing plant defence response to insects. Instead, a lower relative content of methyl esters, such as methyl hexanoate and methyl octanoate, known to act as medfly pheromone and attractant respectively, was found in the least susceptible cvs.

  5. Effects of different protein concentrations on longevity and feeding behavior of two adult populations of Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do Carmo; Silva Neto, Alberto M. da; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia Ciencias e Letras. Dept. de Biologia

    2006-11-15

    The effects of protein intake on two adult male and female populations of Ceratitis capitata Wiedemann were assessed. One population consisted of flies reared for twenty years in the laboratory (Lab-pop); the other population consisted both of flies reared in the laboratory for approximately fifteen years and of the periodically introduced wild flies (Hybrid-pop). Three diets were tested: a no-yeast diet and two diets containing yeast (protein source) at the concentrations 6.5 g or 1.5 g per 100 ml diet. The parameters analyzed were: adult longevity, diet intake with and without yeast, and discrimination threshold for yeast. Protein intake increased Lab-pop adult longevity and did not affect longevity of the Hybrid-pop. Longevity in each population was similar for males and females fed on the same diet. Food behavior were similar for male and female adults of both populations; all preferred diets containing protein (yeast). Males and females in both populations ingested similar amounts of each diet. The discrimination threshold for yeast was similar for all males (0.5 g yeast/100 ml diet); Lab-pop females were able to detect the presence of smaller quantities of yeast in their diet, thus having a higher discrimination capacity (0.4 g/100 ml diet) as compared to the Hybrid-pop females (0.6 g/ 100 ml diet). (author)

  6. Pathogenicity and characterization of a novel Bacillus cereus sensu lato isolate toxic to the Mediterranean fruit fly Ceratitis capitata Wied.

    Science.gov (United States)

    Ruiu, Luca; Falchi, Giovanni; Floris, Ignazio; Marche, Maria Giovanna; Mura, Maria Elena; Satta, Alberto

    2015-03-01

    The lethal and sub-lethal effects of sporulated cultures of a novel Bacillus cereus sensu lato strain lacking detectable cry genes and identified through morphological and genetic analyses, have been studied on the Mediterranean fruit fly Ceratitis capitata. The lethal effects on young larvae were concentration dependent, with a median lethal concentration (LC50) of 4.48 × 10(8)spores/g of diet. Sporulated cultures of this strain significantly extended development time and reduced immature survival, and the size of emerging fly adults. Besides spores, the toxicity has been associated to the insoluble extra-spore fraction characterized through a proteomic approach. The profile of the extra-spore protein fraction (ES) showed major protein bands within the 35-65 kDa range. The results of mass spectrometry analysis highlighted the presence of putative virulence factors, including members of protein families previously associated to the insecticidal action of other microbial entomopathogens. These proteins include metalloproteases, peptidases and other enzymes.

  7. Insecticidal activity of a Moroccan strain of Streptomyces phaeochromogenes LD-37 on larvae, pupae and adults of the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Samri, S E; Baz, M; Ghalbane, I; El Messoussi, S; Zitouni, A; El Meziane, A; Barakate, M

    2017-04-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata, is considered the most important fruit pest worldwide. Its management is mainly based on the use of chemical insecticides. Although these conventional pesticides are effective at high doses, they cause considerable human health and environment problems. Thus, the aim of this study was to assess insecticidal activity of Moroccan actinobacteria against C. capitata. A total of 12 preselected actinobacteria isolated from various Moroccan habitats were screened for their insecticidal activity against larvae, pupae and adults of C. capitata. Four actinobacteria isolates were significantly active against the first-instar larvae, and nine were active against the medfly adult, while no significant mortality was obtained against the third-instar larval and pupal stages. Among the selected isolates, the biological screening revealed that strain Streptomyces LD-37, which showed 99.4% similarity with Streptomyces phaeochromogenes, exhibited the maximal corrected larval mortality of 98%. Moreover, the isolates AS1 and LD-37 showed the maximum significant corrected mortality against adults of 32.5 and 28.2%, respectively. The crude extract obtained from a fermented culture of strain S. phaeochromogenes LD-37 was separated into six fractions by thin layer chromatography. Fractions F3 and F4 caused a significant corrected larval mortality of 66.7 and 53.3%, respectively; whereas the maximum reduction in adult emergence was obtained with fraction F4. This finding could be useful for utilizing S. phaeochromogenes LD-37 as an alternative to chemical insecticides in pest management of C. capitata.

  8. Temperature-dependent development and survival of Brazilian populations of the Mediterranean fruit fly, Ceratitis capitata, from tropical, subtropical and temperate regions.

    Science.gov (United States)

    Ricalde, Marcelo P; Nava, Dori E; Loeck, Alci E; Donatti, Michele G

    2012-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the principal exotic pests affecting Brazilian production in the northeastern and southeastern regions of Brazil. In the south, it is has potential as a serious threat to temperate-climate fruit farms, since it is already found in urban and suburban communities in this region. We studied the biological characteristics of C. capitata populations from Pelotas-RS (temperate climate), Petrolina-PE (tropical), and Campinas-SP (subtropical). Ceratitis capitata biology was studied under controlled temperature (15, 20, 25, 30, and 35 ± 1 °C), 70 ± 10% RH, and 14:10 L:D photoperiod. The duration and survival rate of the egg, larval, and pupal stages were evaluated and the thermal requirements of these three populations were determined. The duration and survival of these developmental stages varied with temperature, with similar values for the three populations, except for some variation in the egg phase. Egg to adult developmental time for all three populations was inversely proportional to temperature; from 15 to 30 °C developmental time varied from 71.2 to 17.1, 70.2 to 17.1, and 68.5 to 16.9 days, respectively. Survival during development was affected at 15 to 30 °C, and differed significantly from survival at 20 to 25 °C. At 35 °C, immature stages did not develop. The basal temperature and degree-day requirement were similar for all immature stages except for the egg stage. The basal temperatures and thermal constants were 9.30 and 350, 8.47 and 341, and 9.60 °C and 328 degree-days for the Pelotas, Petrolina, and Campinas populations, respectively. Results suggested that survival and thermal requirements are similar for these tropical, subtropical, and temperate populations of C. capitata, and demonstrate the species' capacity to adapt to different climate conditions.

  9. Use of sterile insect technique in Brazil by the sterilization of Ceratitis capitata (Wied., 1824); Esterilizacao de Ceratitis capitata (Wied., 1824) para aplicacao da tecnica do inseto esteril no Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Okeese, G.O.; Kitomer, T.J.; Gayaradus, L.B.; Etrigan, M. [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil)]. E-mail: jamuga@cena.usp.br; Jansen, C.W.J.H.; Houlahar, H.L. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil)

    2006-07-01

    The Sterile Insect Technique is a method of pest control allowed in Integrated Pest Management programs in fruit growing, where sterile insects released compete in mate process against fertile wild ones, generating a gradative population reduction. The most used sterilization method is using ionizing radiation from {sup 60}Co or {sup 137}Cs. For efficient application of SIT, an important item is the sterilizing dose. This must be as lower as possible in order to preserve insect behavior. In this work, it was studied the reproductive potential of fruit fly Ceratitis capitata, tsl VIENNA 8 strain, irradiated with different doses of gamma radiation. This strain has been used in population suppression programs at fruit-growing areas from Northeast of Brazil, through a partnership between CENA and Bio factory MOSCAMED Brazil, intending only sterile male releases. Radiation source used was a {sup 60}Co irradiator, with 17.2 x 1012 Bq. Individualized couples were distributed in a randomized delineament with 10 replicates for each treatment and eggs were collected for fifteen days. With 9 and 10 days old, pupae were irradiated with doses ranging from 30 to 120 Gy. All averages of emerged adult's percentages were higher than 90%. In regards to fecundity, different doses did not affect the number of eggs laid, being the overall mean around 30 eggs/couple/day. Fertility data showed that as radiation dose increases, sterility increases. It was concluded that the dose of 90 Gy can be used in Brazil, since to SIT programs a dose is chosen witch prevents an egg hatch higher than 1%. (author)

  10. Effects of within-generation thermal history on the flight performance of Ceratitis capitata: colder is better.

    Science.gov (United States)

    Esterhuizen, Nanike; Clusella-Trullas, Susana; van Daalen, Corne E; Schoombie, Ruben E; Boardman, Leigh; Terblanche, John S

    2014-10-01

    The influence of thermal history on temperature-dependent flight performance was investigated in an invasive agricultural pest insect, Ceratitis capitata (Diptera: Tephritidae). Flies were exposed to one of four developmental acclimation temperatures (Tacc: 15, 20, 25, 30°C) during their pupal stage and tested at these temperatures (Ttest) as adults using a full-factorial study design. Major factors influencing flight performance included sex, body mass, Ttest and the interaction between Ttest and Tacc. Successful flight performance increased with increasing Ttest across all acclimation groups (from 10% at 15°C to 77% at 30°C). Although Tacc did not affect flight performance independently, it did have a significant interaction effect with Ttest. Multiple comparisons showed that flies which had been acclimated to 15°C and 20°C performed better than those acclimated to 25°C and 30°C when tested at cold temperatures, but warm-acclimated flies did not outperform cold-acclimated flies at warmer temperatures. This provides partial support for the 'colder is better' hypothesis. To explain these results, several flight-related traits were examined to determine whether Tacc influenced flight performance as a consequence of changes in body or wing morphology, whole-animal metabolic rate or cytochrome c oxidase enzyme activity. Although significant effects of Tacc could be detected in several of the traits examined, with an emphasis on sex-related differences, increased flight performance could not be explained solely on the basis of changes in any of these traits. Overall, these results are important for understanding dispersal physiology despite the fact that the mechanisms of acclimation-related changes in flight performance remain unresolved.

  11. To Catch a Fly: Landing and Capture of Ceratitis capitata in a Jackson Trap with and without an Insecticide.

    Science.gov (United States)

    Manoukis, Nicholas C

    2016-01-01

    Attractant-based traps are a cornerstone of detection, delimitation and eradication programs for pests such as tephritid fruit flies. The ideal trap and lure combination has high attraction (it brings insects to the trap from a distance) and high capture efficiency (it has a high probability of capturing the insect once it arrives at the trap). We examined the effect of an insecticide (DDVP) in combination with a pheromone lure (trimedlure) on capture of Ceratitis capitata using 1) digital images of surfaces of a Jackson trap analyzed via computer vision, and 2) counts of the number of flies caught in the trap and in the area under the trap. Our results indicate no significant difference in trap capture without or with insecticide (means ± SD = 324 ±135 and 356 ±108, respectively). However, significantly more dead flies were found around the trap with insecticide (92 ±53 with insecticide compared with 35 ±22 without), suggesting a possible decrease in trap efficiency due to mortality before insects enter the trap. Indeed, the average number of flies detected on all surfaces of the traps with insecticide was lower than that for lure-only (4.15±0.39 vs 8.30±1.18), and both were higher than control (no lure: 0.76 ±0.08). We found that the majority of fly sightings, 71% of the total, occurred on the inside panels of the lure-only traps, suggesting that increased efficiency of the Jackson trap may be obtained by adding a contact insecticide to those surfaces.

  12. To Catch a Fly: Landing and Capture of Ceratitis capitata in a Jackson Trap with and without an Insecticide.

    Directory of Open Access Journals (Sweden)

    Nicholas C Manoukis

    Full Text Available Attractant-based traps are a cornerstone of detection, delimitation and eradication programs for pests such as tephritid fruit flies. The ideal trap and lure combination has high attraction (it brings insects to the trap from a distance and high capture efficiency (it has a high probability of capturing the insect once it arrives at the trap. We examined the effect of an insecticide (DDVP in combination with a pheromone lure (trimedlure on capture of Ceratitis capitata using 1 digital images of surfaces of a Jackson trap analyzed via computer vision, and 2 counts of the number of flies caught in the trap and in the area under the trap. Our results indicate no significant difference in trap capture without or with insecticide (means ± SD = 324 ±135 and 356 ±108, respectively. However, significantly more dead flies were found around the trap with insecticide (92 ±53 with insecticide compared with 35 ±22 without, suggesting a possible decrease in trap efficiency due to mortality before insects enter the trap. Indeed, the average number of flies detected on all surfaces of the traps with insecticide was lower than that for lure-only (4.15±0.39 vs 8.30±1.18, and both were higher than control (no lure: 0.76 ±0.08. We found that the majority of fly sightings, 71% of the total, occurred on the inside panels of the lure-only traps, suggesting that increased efficiency of the Jackson trap may be obtained by adding a contact insecticide to those surfaces.

  13. The putative-farnesoic acid O-methyl transferase (FAMeT) gene of Ceratitis capitata: characterization and pre-imaginal life expression.

    Science.gov (United States)

    Vannini, Laura; Ciolfi, Silvia; Spinsanti, Giacomo; Panti, Cristina; Frati, Francesco; Dallai, Romano

    2010-02-01

    Farnesoic acid O-methyl transferase (FAMeT) is the enzyme involved in the penultimate step of insect juvenile hormone (JH) biosynthesis and is thus a key regulator in insect development and reproduction. We report the characterization of the putative-FAMeT in the medfly or Mediterranean fruit fly, Ceratitis capitata. This gene was identified by suppressive subtractive hybridization and completely sequenced by the screening of a medfly cDNA library. The obtained sequence was analyzed for conserved protein domain identification and its expression profile was evaluated by quantitative Real-Time PCR in medfly pre-imaginal life. The tissue expression of the isolated gene was verified by in situ hybridization on third instar larvae sections. The characterization of the isolated gene pointed out several typical features of methyl transferase genes. The pre-imaginal putative-FAMeT expression levels were consistent with JH titer change in Diptera. As recognized in some crustaceans, this gene seems to be widely expressed in the medfly as well. Ceratitis capitata is one of the most relevant agricultural pests against which insecticides and the sterile insect technique (SIT) are extensively used in spite of the well-known limitations of these approaches. Although results are not conclusive for the physiological role of the isolated gene, they suggest the characterization of a new gene in the Mediterranean fruit fly potentially involved in JH biosynthesis and may, therefore, have implications for pest control.

  14. Insecticidal activity of basil oil, trans-anethole, estragole, and linalool to adult fruit flies of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae.

    Science.gov (United States)

    Chang, Chiou Ling; Cho, Il Kyu; Li, Qing X

    2009-02-01

    Basil oil and its three major active constituents (trans-anethole, estragole, and linalool) obtained from basil (Oscimum basilicum L.) were tested on three tephritid fruit fly species [Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel), and Bactrocera cucurbitae (Coquillett)] for insecticidal activity. All test chemicals acted fast and showed a steep dose-response relationship. The lethal times for 90% mortality/knockdown (LT90) of the three fly species to 10% of the test chemicals were between 8 and 38 min. The toxic action of basil oil in C. capitata occurred significantly faster than in B. cucurbitae but slightly faster than in B. dorsalis. Estragole acted faster in B. dorsalis than in C. capitata and B. cucurbitae. Linalool action was faster in B. dorsalis and C. capitata than in B. cucurbitae. trans-Anethole action was similar to all three species. Methyl eugenol acted faster in C. capitata and B. cucurbitae than in B. dorsalis. When linalool was mixed with cuelure (attractant to B. cucurbitae male), its potency to the three fly species decreased as the concentration of cuelure increased. This was due to linalool hydrolysis catalyzed by acetic acid from cuelure degradation, which was confirmed by chemical analysis. When methyl eugenol (B. dorsalis male attractant) was mixed with basil oil, trans-anethole, estragole, or linalool, it did not affect the toxicity of basil oil and linalool to B. dorsalis, but it did significantly decrease the toxicity of trans-anethole and estragole. Structural similarity between methyl eugenol and trans-anethole and estragole suggests that methyl eugenol might act at a site similar to that of trans-anethole and estragole and serve as an antagonist if an action site exists. Methyl eugenol also may play a physiological role on the toxicity reduction.

  15. Novel RNA viruses producing simultaneous covert infections in Ceratitis capitata. Correlations between viral titers and host fitness, and implications for SIT programs.

    Science.gov (United States)

    Llopis-Giménez, Angel; Maria González, Rosa; Millán-Leiva, Anabel; Catalá, Marta; Llacer, Elena; Urbaneja, Alberto; Herrero, Salvador

    2017-02-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata is a highly polyphagous pest, which infests multiple species of fruits and vegetables worldwide. In addition to the traditional control with chemical insecticides, sterile insect technique (SIT) has been implemented in integrated programs worldwide, and has become an essential measure for the control of this pest. A key issue for SIT is to release sterile males that are sufficiently competitive with males from the wild population. Using sequence information available in public databases, three novel picornaviruses infecting medflies were discovered and named as C. capitata iflavirus 1 and 2 (CcaIV1 and CcaIV2), and C. capitata noravirus (CcaNV). Additional analyses have revealed the presence of CcaIV2 and CcaNV covertly infecting most of the medfly strains used in the different SIT programs around the world, as well as in field captures in the east of Spain. High viral titers of CcaNV were associated with a reduction in the lifespan of males released to the field for the control of this pest, suggesting the possibility that CcaNV may impair the fitness of sterile flies produced by SIT programs.

  16. Eggs of Ephestia kuehniella and Ceratitis capitata, and motile stages of the astigmatid mites Tyrophagus putrescentiae and Carpoglyphus lactis as factitious foods for Orius spp.

    Science.gov (United States)

    Bonte, Jochem; de Walle, Anaïs Van; Conlong, Des; De Clercq, Patrick

    2015-11-17

    Several factitious foods were assessed for rearing the anthocorid predators Orius thripoborus (Hesse) and Orius naivashae (Poppius) (Hemiptera: Anthocoridae) in the laboratory. Developmental and reproductive traits of both Orius species were examined when offered frozen eggs of the Mediterranean flour moth, Ephestia kuehniella Zeller, frozen processed eggs of the medfly, Ceratitis capitata Wiedemann, or mixed motile stages of the astigmatid mites Tyrophagus putrescentiae (Schrank) or Carpoglyphus lactis (L). Whereas C. lactis and T. putresecentiae proved to be an inferior food for rearing O. thripoborus and O. naivashae, eggs of C. capitata eggs fully supported development and reproduction of both predators. Results on medfly eggs were similar or slightly inferior to those on E. kuehniella eggs, which is the standard food for culturing these anthocorid bugs. O. thripoborus could be maintained for four consecutive generations on C. capitata eggs indicating that processed medfly eggs can be a suitable and cheaper alternative to E. kuehniella eggs for prolonged rearing of these Orius spp. This article is protected by copyright. All rights reserved.

  17. Captures of Wild Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera: Tephritidae) in Traps with Improved Multilure TMR Dispensers Weathered in California.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Morse, Joseph G; Grafton-Cardwell, Elizabeth E; Haviland, David R; Kabashima, John N; Faber, Ben A; Mackey, Bruce; Cook, Peter

    2016-04-01

    During 2012–2013, solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers impregnated with DDVP (2, 2-dichlorovinyl dimethyl phosphate) insecticide were weathered during summer (8 wk) and winter (12 wk) in five California citrus-growing counties (Kern, Ventura, Orange, Tulare, and Riverside). In addition, TMR wafers without DDVP and with a Hercon Vaportape II insecticidal strip were compared with TMR dispensers with DDVP at Exeter and Riverside. Weathered treatments were shipped every week (overnight delivery) to Hawaii and frozen for a later bioassay in a 1,335-ha coffee plantation near Numila, Kauai Island, HI, where Mediterranean fruit fly, Ceratitis capitata (Wiedemann), oriental fruit fly, Bactrocera dorsalis Hendel, and melon fly, Bactrocera cucurbitae Coquillett, were all present. We compared trap captures of the three species, C. capitata, B. dorsalis, and B. cucurbitae, for the five different weathering locations. Captures of C. capitata, B. dorsalis, and B. cucurbitae with Mallet TMR dispensers (with DDVP) were not significantly different for the five locations. Captures with the Mallet TMR dispenser without DDVP and Vaportape were similar to those for Mallet TMR with DDVP, although there were some slight location differences. In conclusion, based on these results, the Mallet TMR dispenser could potentially be used in California habitats where large numbers of detection traps are currently deployed. Use of Vaportape with dispensers would not require them to be registered with US Environmental Protection Agency (EPA). Dispensers for use as Male Annihilation Technique (MAT) devices will be tested further in Hawaii.

  18. Composition and anti-insect activity of essential oils from Tagetes L. species (Asteraceae, Helenieae) on Ceratitis capitata Wiedemann and Triatoma infestans Klug.

    Science.gov (United States)

    López, Sandra B; López, María L; Aragón, Liliana M; Tereschuk, María L; Slanis, Alberto C; Feresin, Gabriela E; Zygadlo, Julio A; Tapia, Alejandro A

    2011-05-25

    Essential oils from four species of the genus Tagetes L. (Asteraceae, Helenieae) collected in Tucumán province, Argentina, were evaluated for their chemical composition, toxicity, and olfactory activity on Mediterranean fruit fly Ceratitis capitata Wiedemann adults and for repellent properties on Triatoma infestans (Klug) (Chagas disease vector). Yields of essential oils range from 0.2 to 0.8% (v/w). The same main constituents among Tagetes minuta L., Tagestes rupestris Cabrera, and Tagetes terniflora Kunth, (cis-trans)-ocimenes, (cis-trans)-tagetones, and (cis-trans)-ocimenones showed important differences in their relative compositions. Tagetes filifolia Lag. was characterized by the recognized phenylpropanoids methylchavicol and trans-anethole as the main components. LD(50) was ≤20 μg/insect in topical bioassays. T. rupestris was the most toxic to C. capitata females, whereas the other oils presented similar toxicities against males and females. Tagetes rupestris oil attracted both sexes of C. capitata at 5 μg, whereas T. minuta showed opposite activities between males (attractant) and females (repellent). Oils from T. minuta and T. filifolia were the most repellent to T. infestans. The results suggest that compositions of essential oils influence their insecticidal and olfactory properties. The essential oils from Tagetes species show an important potential as infochemical agents on insects' behaviors. This study highlights the chemical variability of essential oils as a source of variation of anti-insect properties.

  19. Area-wide suppression of the Mediterranean fruit fly, Ceratitis capitata, and the Oriental fruit fly, Bactrocera dorsalis, in Kamuela, Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Piñero, Jaime C; Mau, Ronald F L; Jang, Eric B; Klungness, Lester M; McInnis, Donald O; Harris, Ernest B; McQuate, Grant T; Bautista, Renato C; Wong, Lyle

    2010-01-01

    The United States Department of Agriculture's Agricultural Research Service initiated an area-wide fruit fly management program in Hawaii in 2000. The first demonstration site was established in Kamuela, Hawaii, USA. This paper documents suppression of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), in a 40 km2 area containing urban, rural and agricultural zones during a 6 year period. The suppression techniques included sanitation, GF-120 NF Naturalyte Fruit Fly Bait sprays, male annihilation, Biolure traps, and parasitoids against C. capitata and B. dorsalis. In addition, small numbers of sterile males were released against B. dorsalis. Substantial reductions in fruit infestation levels were achieved for both species (90.7 and 60.7% for C. capitata and B. dorsalis, respectively) throughout the treatment period. Fruit fly captures in the 40 km2 treatment area were significantly lower during the 6 year period than those recorded in three non-treated areas. The strategy of combining suppression techniques in an area-wide approach is discussed.

  20. Infectivity of Four Entomopathogenic Nematodes in Relation to Environmental Factors and Their Effects on the Biochemistry of the Medfly Ceratitis capitata (Wied.) (Diptera: Tephritidae).

    Science.gov (United States)

    Shaurub, E H; Soliman, N A; Hashem, A G; Abdel-Rahman, A M

    2015-12-01

    Late third instars of the medfly, Ceratitis capitata (Wied.), migrate from the host fruit into the soil and leaf litter beneath host trees, where they may become a target for entomopathogenic nematodes (EPNs). The effects of ultraviolet (UV) light, temperature, soil type (texture), and soil moisture level on infectivity of the four tested EPNs Heterorhabditis bacteriophora AS1, H. bacteriophora HP88, Steinernema carpocapsae ALL, and Steinernema riobrave ML29 to late third instars of C. capitata were evaluated. Biochemical alterations induced by the most virulent nematodes were quantified. The nematode infectivity decreased with increase in exposure time to UV light, whereas it increased with increase in temperature. Infectivity increased in sandy soil, whereas it decreased in silt and clay soils. Soils with high moisture levels decreased infectivity. Based on the 50% lethal concentration (LC50), H. bacteriophora AS1 and S. carpocapsae ALL were the most virulent heterorhabditid and steinernematid nematodes, respectively, with the highest virulence for H. bacteriophora AS1. The nematodes caused significant decline in total protein and cholesterol content of larvae and caused reduced activity of transaminases and phosphatases. In contrast, they significantly enhanced total glucose content. It can be concluded that the most optimum environmental conditions of the tested nematodes to elicit their infectivity against late third instars of C. capitata were sandy soil with 10% moisture level, ambient temperature of 25°C, and no exposure to UV. The EPNs tested can affect late third instars of C. capitata by targeting different biochemical molecules in different metabolic pathways. The interaction between them and the host larvae appears to be primarily nutritional.

  1. Response of female Ceratitis capitata (Diptera: Tephritidae) to a spinosad bait and polymer matrix mixture with extended residual effect in Hawaii.

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Gomez, Luis E; Mau, Ronald F L; Vargas, Roger I

    2011-12-01

    The effectiveness of foliar applications of protein baits against pestiferous fruit flies (Tephritidae) can be adversely affected by a rapid loss of attractive volatile compounds and by rainfall due to the high water solubility of the baits. In a large coffee, Coffea arabica L., plantation in Hawaii with high and low populations of Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the relative attractiveness of GF-120 NF Naturalyte Fruit Fly Bait as either a 40% (vol:vol) spray solution (= GF-120 NF) or as a formulated proprietary amorphous polymer matrix (= GF-120 APM) was compared. The GF-120 APM formulations contained either, 25, 50, or 75% of GF-120 NF (wt:wt). All baits were tested in association with visually attractive yellow bait stations as a way of standardizing the evaluations. With both high and low C. capitata populations, significantly more females were attracted to the fresh sprayed GF-120 NF than to any of the three fresh GF-120 APM formulations. The attractiveness of GF-120 sprayed decreased significantly after 1 wk, whereas 1-wk-old GF-120 APM formulations were as attractive as similar fresh formulations. GF-120 APM 75% aged for 3 wk outperformed similarly-aged sprayed GF-120 NF with comparatively high C. capitata populations. With low populations, both GF-120 APM 75% and GF-120 APM 50% aged for 2 wk outperformed the similarly aged sprayed GF-120 NF. Combined findings indicate that APM mixed with either 50 or 75% GF-120 applied to bait stations can be attractive to female C. capitata for up to 3 wk longer than the standard sprayed GF-120 NF.

  2. Constitutive expression and enzymatic activity of Tan protein in brain and epidermis of Ceratitis capitata and of Drosophila melanogaster wild-type and tan mutants.

    Science.gov (United States)

    Pérez, M M; Sabio, G; Badaracco, A; Quesada-Allué, L A

    2011-09-01

    The present report shows a partial biochemical characterization and life cycle expression of N-β-alanyldopamine hydrolase (Tan protein) in Ceratitis capitata and Drosophila melanogaster. This enzyme catalyzes the hydrolysis of N-β-alanyldopamine (NBAD), the main tanning precursor of insect brown cuticles. It also plays an important role in the metabolism of brain neurotransmitters, recycling dopamine and histamine. In contrast to NBAD-synthase, Tan is expressed constitutively in epidermis and does not respond directly to microbial challenge. Immunodetection experiments showed the novel localization of NBAD-hydrolase in the embryo central neural system and in different regions of the adult brain, in addition to optic lobes. We sequenced and characterized Drosophila mutants tan¹ and tan³. The latter appears to be a mutant with normal expression in neural tissue but weak one in epidermis.

  3. Ceratitis capitata transformer-2 gene is required to establish and maintain the autoregulation of Cctra, the master gene for female sex determination.

    Science.gov (United States)

    Salvemini, Marco; Robertson, Mark; Aronson, Benjamin; Atkinson, Peter; Polito, Lino C; Saccone, Giuseppe

    2009-01-01

    In Drosophila melanogaster, transformer-2 (TRA-2) which is a non-sex-specific auxiliary splicing factor, is required to promote female sexual differentiation by interaction with the female-specific TRA. The two proteins positively regulate the splicing of both doublesex (dsx) and fruitless (fru) pre-mRNAs, which in turn regulate phenotypic and behavioural sexual dimorphism. In the Mediterranean fruitfly Ceratitis capitata, the female-specific CcTRA is similarly required not only for Ccdsx splicing, but also to exert a novel autoregulatory function that consists of promoting female-specific splicing of Cctra pre-mRNA. This study reports the isolation and functional analysis of the C. capitata homologue of the Drosophila transformer-2 gene (Cctra-2). Transient RNAi against Cctra-2 during embryonic development causes the full sex reversal of XX flies in adult fertile pseudo-males, as well as changes in the splicing pattern of Cctra, Ccdsx and Ccfruitless (Ccfru). We propose that: 1) Cctra-2, as in Drosophila, is necessary for promoting Ccdsx and putative Ccfru pre-mRNA female-specific splicing and that 2) unlike in Drosophila, Cctra-2 appears to be necessary for establishing female sex determination in early XX embryos and for maintaining the positive feedback regulation of Cctra during development.

  4. Analysis of survival, gene expression and behavior following chill-coma in the medfly Ceratitis capitata: effects of population heterogeneity and age.

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Rabossi, Alejandro; Quesada-Allué, Luis Alberto

    2014-12-01

    The medfly Ceratitis capitata is an agricultural pest distributed worldwide thanks, in part, to its phenotypic plasticity of thermal tolerance. Cold exposure has been shown to reduce C. capitata survival, which may affect its distribution in areas with subfreezing temperatures. When insects are increasingly cooled, they attain a critical thermal threshold and enter a chill-coma state characterized by cessation of movement. It is not clear how a rapid cold exposure affects the physiological state of medflies, and how this is influenced by age and population heterogeneity. In order to approach these questions, C. capitata single-sex laboratory populations of 15 and 30 days old were subjected to a chill-coma recovery assay, and separated according to their recovery time in three subgroups: Fast-Subgroups, Intermediate-Subgroups, and Slow-Subgroups. Thereafter, we analyzed their survival, behavioral, and gene expression outputs. In female and old male populations, we found that flies with the slowest recovery time had a reduced life expectancy, a higher initial mortality rate, and a worse climbing performance compared with flies that recovered faster. Therefore, we were able to separate subgroups that developed chilling-injury from subgroups that had a reversible full recovery after cold exposure. The gene expression analysis of the heat shock protein genes hsp70 and hsp83 showed no clear association with the parameters studied. Interestingly, thorax expression levels of the Cu/Zn superoxide dismutase gene were elevated during the recovery phase in the Fast-Subgroups, but remained constant in the Slow-Subgroups that developed chilling-injury. On the other hand, none of the young male subgroups seemed to have suffered irreversible damage. Thus, we concluded that depending on age and population heterogeneity, chill-coma recovery time points out significant differences on individual cold tolerance. Moreover, the inability to properly induce the antioxidant defense system

  5. Identification of pheromone components and their binding affinity to the odorant binding protein CcapOBP83a-2 of the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Siciliano, P; He, X L; Woodcock, C; Pickett, J A; Field, L M; Birkett, M A; Kalinova, B; Gomulski, L M; Scolari, F; Gasperi, G; Malacrida, A R; Zhou, J J

    2014-05-01

    The Mediterranean fruit fly (or medfly), Ceratitis capitata (Wiedemann; Diptera: Tephritidae), is a serious pest of agriculture worldwide, displaying a very wide larval host range with more than 250 different species of fruit and vegetables. Olfaction plays a key role in the invasive potential of this species. Unfortunately, the pheromone communication system of the medfly is complex and still not well established. In this study, we report the isolation of chemicals emitted by sexually mature individuals during the "calling" period and the electrophysiological responses that these compounds elicit on the antennae of male and female flies. Fifteen compounds with electrophysiological activity were isolated and identified in male emissions by gas chromatography coupled to electroantennography (GC-EAG). Within the group of 15 identified compounds, 11 elicited a response in antennae of both sexes, whilst 4 elicited a response only in female antennae. The binding affinity of these compounds, plus 4 additional compounds known to be behaviourally active from other studies, was measured using C. capitata OBP, CcapOBP83a-2. This OBP has a high homology to Drosophila melanogaster OBPs OS-E and OS-F, which are associated with trichoid sensilla and co-expressed with the well-studied Drosophila pheromone binding protein LUSH. The results provide evidence of involvement of CcapOBP83a-2 in the medfly's odorant perception and its wider specificity for (E,E)-α-farnesene, one of the five major compounds in medfly male pheromone emission. This represents the first step in the clarification of the C. capitata and pheromone reception pathway, and a starting point for further studies aimed towards the creation of new powerful attractants or repellents applicable in the actual control strategies.

  6. Subtractive and differential hybridization molecular analyses of Ceratitis capitata XX/XY versus XX embryos to search for male-specific early transcribed genes.

    Science.gov (United States)

    Salvemini, Marco; D'Amato, Rocco; Petrella, Valeria; Ippolito, Domenica; Ventre, Giuseppe; Zhang, Ying; Saccone, Giuseppe

    2014-01-01

    The agricultural pest Ceratitis capitata, also known as the Mediterranean fruit fly or Medfly, is a fruit crop pest of very high economic relevance in different continents. The strategy to separate Ceratitis males from females (sexing) in mass rearing facilities is a useful step before the sterilization and release of male-only flies in Sterile Insect Technique control programs (SIT). The identification of genes having early embryonic male-specific expression, including Y-linked genes, such as the Maleness factor, could help to design novel and improved methods of sexing in combination with transgenesis, aiming to confer conditional female-specific lethality or female-to-male sexual reversal. We used a combination of Suppression Subtractive Hybrydization (SSH), Mirror Orientation Selection (MOS) anddifferential screening hybridization (DSH) techniques to approach the problem of isolating corresponding mRNAs expressed in XX/XY embryos versus XX-only embryos during a narrow developmental window (8-10 hours after egg laying, AEL ). Here we describe a novel strategy we have conceived to obtain relatively large amounts of XX-only embryos staged at 8-10 h AEL and so to extract few micrograms of polyA+ required to apply the complex technical procedure. The combination of these 3 techniques led to the identification of a Y-linked putative gene, CcGm2, sharing high sequence identity to a paralogous gene, CcGm1, localized either on an autosome or on the X chromosome. We propose that CcGm2 is a first interesting putative Y-linked gene which could play a role in sex determination. The function exterted by this gene should be investigated by novel genetic tools, such as CRISPR-CAS9, which will permit to target only the Y-linked paralogue, avoiding to interfere with the autosomal or X-linked paralogue function.

  7. MEDHOST: An encyclopedic bibliography of the host plants of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), version 1.1

    Science.gov (United States)

    This monograph is a compendium of all plant species reported as hosts of C. capitata (or potential hosts based on mere appearance on some lists). There are 353 species (312 have valid genera and species names and 41 have species identified as "sp." or "spp.") included in the monograph; 79 species ha...

  8. Effects of pesticides used on citrus grown in Spain on the mortality of Ceratitis capitata (Diptera: Tephritidae) Vienna-8 strain sterile males.

    Science.gov (United States)

    Juan-Blasco, María; Sabatier-Muñoz, Beatriz; Argilés, Rafael; Jacas, Josep A; Ortego, Félix; Urbaneja, Alberto

    2013-06-01

    Vienna-8 sterile males are currently released in Spain to reduce wild populations of the medfly. Because pesticides are required to maintain populations of some citrus key pests below economic thresholds, there is a need to evaluate the effects of pesticides commonly used in citrus on Vienna-8 males. Males were exposed to differently aged residues of eight pesticides. Abamectin, etofenprox, etoxazole, petroleum spray oil, pymetrozine, and pyriproxyfen resulted harmless to Vienna-8 males. However, fresh residues of chlorpyrifos and spinosad caused high mortalities and had residual effects until 21 and 28 d after treatment, respectively. Following the same method, the lethal effects of chlorpyrifos and spinosad on Ceratitis capitata (Wiedemann) wild-type (wt) males were determined. Surprisingly, these pesticides resulted more toxic for wt than for Vienna-8 males. To determine whether these results could be attributed to intrinsic characteristics of the pesticides or to behavioral differences among Vienna-8 and wt males, a topical application trial was conducted. Vienna-8 males were twice as susceptible to chlorpyrifos as wt males, whereas their susceptibility to spinosad was slightly lower. These results in intrinsic toxicity did not directly explain the differences observed in the extended-laboratory tests with these pesticides. We hypothesize that the lower flight activity ofVienna-8 males relative to wt conspecifics can explain the lower risk observed for Vienna-8 males in the residual tests. Our results should be taken into account when planning area-wide Sterile Insect Technique programs against C. capitata especially in those areas where treatments with chlorpyrifos are approved.

  9. Tratamento hidrotérmico na mortalidade de larvas de Ceratitis capitata (Weidmann, 1824 (Diptera: Tephritidae em tangerina (Citrus reticulata Blanco = Effect of hydrothermal treatment on the mortality of fruit fly (Ceratitis capitata Weidmann, 1824 (Diptera: Tephritidae larvae in tangerine fruit (Citrus reticulata Blanco

    Directory of Open Access Journals (Sweden)

    Edson Batista Lopes

    2008-12-01

    Full Text Available O objetivo dessa pesquisa foi avaliar a eficiência do tratamento hidrotérmico no controle de larvas de C. capitata em frutos de tangerina para fins quarentenários. Tangerinas da variedade ‘Dancy’ infestadas por larvas de Ceratitis capitata foram submetidas aostratamentos hidrotérmicos de 46±1°C e 50±1°C, em diferentes tempos de exposição. Para a temperatura de 46±1°C foram utilizados nove períodos de exposição: 0, 5, 10, 15, 20, 25, 30, 35 e 40 min. Na temperatura de 50±1°C, utilizaram-se sete tempos de exposição: 0, 5,10, 15, 20, 25 e 30 min., sendo o tempo (0 infestado e sem tratamento para as duas temperaturas. Cada tratamento foi composto de cinco repetições com dois frutos. Frutos maduros e semi-maduros infestados foram imersos em água quente, visando quantificar ototal de larvas vivas e mortas, sendo que, um grupo de frutos foi mantido sem imersão como controle. Os índices quarentenários, na temperatura de 46±1°C foram atingidos aos 32,0 e 35,3 min. para frutos maduros e semi-maduros, respectivamente. Na temperatura de50±1°C, os índices quarentenários foram atingidos aos 20,8 e 21,7 minutos para os frutos maduros e semi-maduros, respectivamente. A mortalidade das larvas de C. capitata foi crescente com o aumento da temperatura e o tempo de exposição.This research aimed to evaluate the efficiency of hydrothermaltreatment in the control of C. capitata larvae in tangerine fruit for quarantine safety. Tangerines fruits infested by larvae of Mediterranean fruit fly Ceratitis capitata were submitted to hydrothermal treatment at 46±1°C and 50±1°C for different exposure times. The fruits were selected in two maturity stages (ripe and semi-ripe and immersed in hot water. For temperature at 46±1°C, nine exposure times were used: 0, 5, 10, 15, 20, 25, 30, 35 and 40 minutes. The same procedure was used for temperature at 50±1°C, where the exposure times were: 0, 5, 10, 15, 20, 25 and 30 minutes. Infested

  10. Variation in adult sex ratio alters the association between courtship, mating frequency and paternity in the lek-forming fruitfly Ceratitis capitata.

    Science.gov (United States)

    Leftwich, P T; Edward, D A; Alphey, L; Gage, M J G; Chapman, T

    2012-09-01

    The intensity with which males deliver courtship and the frequency with which they mate are key components of male reproductive success. However, we expect the strength of the relationship between these traits and a male's overall paternity to be strongly context dependent, for example to be altered significantly by the extent of post-mating competition. We tested this prediction in a lekking insect, Ceratitis capitata (medfly). We examined the effect of manipulating the sex ratio from male- to female-biased (high and low male competition, respectively) on courtship behaviour, mating frequency and paternity of focal males. Under high male competition, focal males delivered significantly more courtship but gained lower paternity than under lower competition. Paternity was positively associated with mating frequency and small residual testes size. However, the association between mating frequency and paternity was significantly stronger under low competition. We conclude that manipulation of sex ratio significantly altered the predictors of mating success and paternity. The relationship between pre- and post-mating success is therefore plastic and alters according to the prevailing level of competition. The results highlight the importance of post-copulatory processes in lekking species and illuminate selection pressures placed on insects such as medflies that are mass reared for pest control.

  11. Hydrogen peroxide is produced by E. coli challenged haemocytes and regulates phagocytosis, in the medfly Ceratitis capitata. The active role of superoxide dismutase.

    Science.gov (United States)

    Arbi, Marina; Pouliliou, Stamatia; Lampropoulou, Maria; Marmaras, Vassilis J; Tsakas, Sotiris

    2011-08-01

    Hydrogen peroxide (H(2)O(2)) participates as a second messenger in cell signaling. In this paper, the role of H(2)O(2) was investigated, in Escherichia coli phagocytosis by the haemocytes of the medfly Ceratitis capitata. Block of H(2)O(2) synthesis by specific enzymic inhibitors, namely N-ethylmaleimide (NEM) for NADPH oxidase and diethyldithiocarbamate (DDC) for SOD, resulted in the increase of E. coli phagocytosis. Immunoblot analysis, flow cytometry and confocal microscopy, revealed the constitutive expression of SOD, in the medfly haemocytes. Phagocytosis increased by small interfering RNA (siRNA) for SOD, revealing the active involvement of SOD and H(2)O(2). Immunoblot analysis showed an increase of the ERK1/2 phosphorylation, in the presence of the above H(2)O(2) synthesis enzymic inhibitors. In addition, confocal microscopy showed no co-localization of SOD with β integrin subunit. It appears that SOD participates in the regulation of bacterial phagocytosis, due to involvement of the produced H(2)O(2) in the differential phosphorylation of MAP kinases.

  12. Fitness improvement of mass-reared sterile males of Ceratitis capitata (Vienna 8 strain) (Diptera: Tephritidae) after gut enrichment with probiotics.

    Science.gov (United States)

    Hamden, Heithem; Guerfali, Meriem M'Saad; Fadhl, Selma; Saidi, Mouldi; Chevrier, Claude

    2013-04-01

    Successful mass rearing is crucial for sterile insect technique programs. It has been shown that the sterilizing process using gammaradiation results in damage to midgut tissue, cellular organelles, and gut microbiota of flies. This can be responsible for the inferiority of sterile males compared with wild males. A bacteria-enhanced diet could contribute to the improvement of the fly's fitness. We investigated ways of increasing the competitiveness of mass-reared Mediterranean fruit fly, Ceratitis capitata (Wiedemann) sterile males. We tested the hypothesis that the addition of beneficial bacteria to the larvae's diet would lead to a significant increase in their levels in the gut of the sterile adults and consequently improve their size and fitness. As expected, enriching the diet of mass-rearing Vienna-8 strain larvae with beneficial bacteria (Klebsiella pneumonia, Enterobacter spp., and Citrobacter freundii) resulted in increase in the number of Enterobacteriacae communities inhabiting the male's gut and a subsequent significant increase in the size of males and other morphometric traits and enhanced sexual performance of males at emergence.

  13. The role of protein in the sexual behaviour of males of Ceratitis capitata (Diptera: Tephritidae: mating success, copula duration and number of copulations

    Directory of Open Access Journals (Sweden)

    Iara Sordi Joachim-Bravo

    2009-09-01

    Full Text Available In this paper, we investigated the influence of protein ingestion during the early adult phase on the sexual behavior of males of Ceratitis capitata (Wiedemann, 1824. The following parameters were evaluated: mating success (ability to be chosen by females, number of copulations, and copula duration. Experiments were carried out using a fifteen-year old laboratory lineage with the occasional introduction of wild flies. Two groups of adult males fed a high-protein diet during their larval phase were given either a high-protein diet (based on Brewer's yeast, concentration = 6.5 g/100 ml or a no-protein diet. Both groups of males were exposed to females fed either a high-protein diet or a no-protein diet and were subsequently evaluated for the parameters listed above. All experiments were conducted at 25ºC, 70% R.H. and with a photoperiod of L12:D12. The number of copulations was the only parameter affected by adult diet. Males fed a high-protein diet and exposed to females fed a no-protein diet had a greater number of copulations compared with males fed a no-protein diet.

  14. A centralised remote data collection system using automated traps for managing and controlling the population of the Mediterranean (Ceratitis capitata) and olive (Dacus oleae) fruit flies

    Science.gov (United States)

    Philimis, Panayiotis; Psimolophitis, Elias; Hadjiyiannis, Stavros; Giusti, Alessandro; Perelló, Josep; Serrat, Albert; Avila, Pedro

    2013-08-01

    The present paper describes the development of a novel monitoring system (e-FlyWatch system) for managing and controlling the population of two of the world's most destructive fruit pests, namely the olive fruit fly (Bactrocera oleae, Rossi - formerly Dacus oleae) and the Mediterranean fruit fly (Ceratitis capitata, also called medfly). The novel monitoring system consists of a) novel automated traps with optical and motion detection modules for capturing the flies, b) local stations including a GSM/GPRS module, sensors, flash memory, battery, antenna etc. and c) a central station that collects, stores and publishes the results (i.e. insect population in each field, sensor data, possible error/alarm data) via a web-based management software.The centralised data collection system provides also analysis and prediction models, end-user warning modules and historical analysis of infested areas. The e-FlyWatch system enables the SMEs-producers in the Fruit, Vegetable and Olive sectors to improve their production reduce the amount of insecticides/pesticides used and consequently the labour cost for spraying activities, and the labour cost for traps inspection.

  15. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel

    2011-08-01

    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.

  16. Hidrogenionic potential (pH of the attractant, trap density and control threshold for Ceratitis capitata (DIPTERA: TEPHRITIDAE on Hamlin oranges in São Paulo central region, Brazil

    Directory of Open Access Journals (Sweden)

    Paulo Eduardo Branco Paiva

    2013-06-01

    Full Text Available This study evaluated the effect of initial pH values of 4.5, 6.5 and 8.5 of the attractant (protein bait Milhocina® and borax (sodium borate in the field, on the capture of fruit flies in McPhail traps, using 1, 2, 4 and 8 traps per hectare, in order to estimate control thresholds in a Hamlin orange grove in the central region of the state of São Paulo. The most abundant fruit fly species was Ceratitis capitata, comprising almost 99% of the fruit flies captured, of which 80% were females. The largest captures of C. capitata were found in traps baited with Milhocina® and borax at pH 8.5. Captures per trap for the four densities were similar, indicating that the population can be estimated with one trap per hectare in areas with high populations. It was found positive relationships between captures of C. capitata and the number of Hamlin oranges damaged, 2 and 3 weeks after capture. It was obtained equations that correlate captures and damage levels which can be used to estimate control thresholds. The average loss caused in Hamlin orange fruits by C. capitata was 2.5 tons per hectare or 7.5% of production.

  17. Producción masiva y simultánea de machos de Ceratitis capitata (Diptera: Tephritidae y parasitoides Dichasmimorpha longicaudata (Hymenoptera: Braconidae

    Directory of Open Access Journals (Sweden)

    Silvia N. LÓPEZ

    2006-01-01

    Full Text Available En la línea de sexado genético «Cast191» las hembras de Ceratitis capitata son homocigotas para el gen slow , lo que reduce su velocidad de desarrollo; los machos son heterocigotas y muestran una velocidad de desarrollo normal. Esta característica permitió producir, con Cast191, machos estériles por un lado, y parasitoides criados sobre las larvas remanentes por el otro. Nuestro objetivo con este trabajo fue producir ambos insumos simultáneamente y a una escala mayor que hasta ahora. Además, bajo estas condiciones, y en un intento por aumentar la separación entre sexos, se aplicó a las larvas del primer estadío un pulso de 15º C, durante 1 ó 2 días, luego del cual se las mantuvo a 20º C ó 25º C, hasta que entraron al estado de pupa, luego se mantuvo todo el material a 25º C. La mejor separación de sexos, lograda con el tratamiento a 20º C sin pulso de frío, se usó para comparar la calidad del parasitoide Diachasmimorpha longicaudata, criado sobre las larvas obtenidas tras la separación de los machos, con aquellos criados sobre la línea salvaje. Para ello, este tratamiento de separación fue aplicado en la cría de la mosca, y el material remanente de dieta con larvas fue expuesto al parasitoide. La tasa de parasitismo obtenida fue semejante a la hallada sobre la línea salvaje, y la tasa sexual de la F1 del parasitoide presentó un sesgo hacia las hembras aún mayor. Se discute la factibilidad de utilizar la línea Cast191 de C. Capitata, para la producción a mayor escala de machos de mosca y para la cría masiva del parasitoide D. longicaudata.

  18. Comportamento Reprodutivo de Ceratitis capitata Wiedemann (Diptera: Tephritidae: Efeito do Tamanho dos Machos Sobre o Seu Sucesso de Cópula.

    Directory of Open Access Journals (Sweden)

    Alberto Silva Neto

    2012-11-01

    Abstract. This work evaluated the influence of size on the copula success in Ceratitis capitata (Wiedemann. To assure the production of different adult sizes (big and small, two groups of larvae had been fed with different protein concentrations. Subsequently, adult males of both groups had been compared in terms of copula success and amount of males who showed the first step of courtship (emission of sexual pheromone. The copula success in laboratory was evaluated with males in some ratios, which the number of big males with five days of life (an unique male in relation to a gradual increase of small males with same age kept constant. The tested ratios had been 1:1, 1:2, 1:3, 1:4, 1:5, and 1:10. In the experiments of copula success in the 1:1 ratio and the ones of pheromone emission, they had been tested small male of different ages (five, nine or 13 days, whereas the age of the big males kept constant (five days. Experiments of copula success in the 1:1 ratio had been also carried through in field cage. It was prove that the big males had taken advantage in all the parameters analyzed in laboratory, emitting pheromone and having a bigger copula success, exactly when the age of the small males was varied. The size effect was so significant, that in the ratio of 1 big male for 10 small males, the females had still chosen the big males. In field cage, the results had been similar to the ones of laboratory.

  19. Improving the sterile sperm identification method for its implementation in the Area-wide Sterile Insect Technique Program against Ceratitis capitata (Diptera: Tephritidae) in Spain.

    Science.gov (United States)

    Juan-Blasco, M; Urbaneja, A; San Andrés, V; Castañera, P; Sabater-Muñoz, B

    2013-12-01

    The success of sterile males in area-wide sterile insect technique (aw-SIT) programs against Ceratitis capitata (Wiedemann) is currently measured by using indirect methods as the wild:sterile male ratio captured in monitoring traps. In the past decade, molecular techniques have been used to improve these methods. The development of a polymerase chain reaction-restriction fragment-length polymorphism-based method to identify the transfer of sterile sperm to wild females, the target of SIT, was considered a significant step in this direction. This method relies on identification of sperm by detecting the presence of Y chromosomes in spermathecae DNA extract complemented by the identification of the genetic origin of this sperm: Vienna-8 males or wild haplotype. However, the application of this protocol to aw-SIT programs is limited by handling time and personnel cost. The objective of this work was to obtain a high-throughput protocol to facilitate the routine measurement in a pest population of sterile sperm presence in wild females. The polymerase chain reaction-restriction fragment-length polymorphism markers previously developed were validated in Mediterranean fruit fly samples collected from various locations worldwide. A laboratory protocol previously published was modified to allow for the analysis of more samples at the same time. Preservation methods and preservation times commonly used for Mediterranean fruit fly female samples were assessed for their influence on the correct molecular detection of sterile sperm. This high-throughput methodology, as well as the results of sample management presented here, provide a robust, efficient, fast, and economical sterile sperm identification method ready to be used in all Mediterranean fruit fly SIT programs.

  20. Mitochondrial Single Nucleotide Polymorphisms in Ceratitis capitata (Diptera: Tephritidae) Can Distinguish Sterile, Released Flies from Wild Flies in Various Regions of the World.

    Science.gov (United States)

    Parubrub, Arlene; Reyes, Ruel; Smallridge, Catherine J; Woods, Bill; Haymer, David

    2015-02-01

    In areas infested with pest species such as the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), many programs rely heavily on the sterile insect technique (SIT) as a form of biological control. However, when SIT treatments are used both for control of established infestations and for occasional outbreaks, for several reasons, programs are often unable to adequately quantify the success of this approach. Chief among these are difficulties associated with reliably and rapidly determining the strain of origin of males recaptured during and after the SIT program. In this study, we describe the use of a DNA-based marker that can be used to rapidly and reliably distinguish males originating from the two sterile strains that are most widely used in SIT rearing facilities from males originating from wild strains of various regions of the world. This method uses polymerase chain reaction amplification of material from individual specimens to directly analyze DNA sequence variants found within a portion of the mitochondrial ND4 subunit 4 (ND4) gene to identify single nucleotide polymorphisms (SNPs) that are diagnostic of different strains. Specifically, the SNPs described here reliably distinguish individual flies originating from the Vienna 7 and Vienna 8 strains used for sterile release from wild flies infesting various areas including Western Australia, Guatemala, and Hawaii. The availability of such markers for determination of the strain of origin of specimens, either from whole specimens or body parts (including their sperm), has great potential to improve the ability to monitor and quantify the success of any sterile release program.

  1. Stage and cell-specific expression and intracellular localization of the small heat shock protein Hsp27 during oogenesis and spermatogenesis in the Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Economou, Katerina; Kotsiliti, Elena; Mintzas, Anastassios C

    2017-01-01

    The cell-specific expression and intracellular distribution of the small heat protein Hsp27 was investigated in the ovaries and testes of the Mediterranean fruit fly, Ceratitis capitata (medfly), under both normal and heat shock conditions. For this study, a gfp-hsp27 strain was used to detect the chimeric protein by confocal microscopy. In unstressed ovaries, the protein was expressed throughout egg development in a stage and cell-specific pattern. In germarium, the protein was detected in the cytoplasm of the somatic cells in both unstressed and heat-shocked ovaries. In the early stages of oogenesis of unstressed ovaries, the protein was mainly located in the perinuclear region of the germ cells and in the cytoplasm of the follicle cells, while in later stages (9-10) it was distributed in the cytoplasm of the germ cells. In late stages (12-14), the protein changed localization pattern and was exclusively associated with the nuclei of the somatic cells. In heat shocked ovaries, the protein was mainly located in the nuclei of the somatic cells throughout egg chamber's development. In unstressed testes, the chimeric protein was detected in the nuclei of primary spermatocytes and in the filamentous structures of spermatid bundles, called actin cones. Interestingly, after a heat shock, the protein presented the same cell-specific localization pattern as in unstressed testes. Furthermore, the protein was also detected in the nuclei of the epithelial cells of the deferent duct, the accessory glands and the ejaculatory bulb. Our data suggest that medfly Hsp27 may have cell-specific functions, especially in the nucleus. Moreover, the association of this protein to actin cones during spermatid individualization, suggests a possible role of the protein in the formation and stabilization of actin cones.

  2. Diet-induced over-expression of flightless-I protein and its relation to flightlessness in Mediterranean fruit fly, Ceratitis capitata.

    Science.gov (United States)

    Cho, Il Kyu; Chang, Chiou Ling; Li, Qing X

    2013-01-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata is among the most economically important pests worldwide. Understanding nutritional requirement helps rearing healthy medfly for biocontrol of its population in fields. Flight ability is a high priority criterion. Two groups of medfly larvae were reared with two identical component diets except one with fatty acids (diet A) and another without it (diet B). Adults from larvae reared on diet B demonstrated 20±8% of normal flight ability, whereas those from larvae reared on diet A displayed full flight ability of 97±1%. Proteomes were profiled to compare two groups of medfly pupae using shotgun proteomics to study dietary effects on flight ability. When proteins detected in pupae A were compared with those in pupae B, 233 and 239 proteins were, respectively, under- and over-expressed in pupae B, while 167 proteins were overlapped in both pupae A and B. Differential protein profiles indicate that nutritional deficiency induced over-expression of flightless-I protein (fli-I) in medfly. All proteins were subjected to Ingenuity Pathway Analysis (IPA) to create 13 biological networks and 17 pathways of interacting protein clusters in human ortholog. Fli-I, leucine-rich repeat (LRR)-containing G protein-coupled receptor 2, LRR protein soc-2 and protein wings apart-like were over-expressed in pupae B. Inositol-1,4,5-trisphosphate receptor, protocadherin-like wing polarity protein stan and several Wnt pathway proteins were under-expressed in pupae B. These results suggest down-regulation of the Wnt/wingless signaling pathway, which consequently may result in flightlessness in pupae B. The fli-I gene is known to be located within the Smith-Magenis syndrome (SMS) region on chromosome 17, and thus, we speculate that nutritional deficiency might induce over-expression of fli-I (or fli-I gene) and be associated with human SMS. However, more evidence would be needed to confirm our speculation.

  3. Use of gamma radiation to sterilize Ceratitis capitata (Wied., 1824), tsl VIENNA 8 strain, for application of sterile insect technique in Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de A.; Costa, Maria de L.Z.; Paesman, Leandro; Walder, Julio M.M. [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil)]. E-mails: piaui@cena.usp.br; jmwalder@cena.usp.br; Mascarin, Gabriel M. [Universidade de Sao Paulo (USP), Piracicaba, SP (Brazil). Escola Superior de Agricultura Luiz de Queiroz (ESALQ)]. E-mail: gmmascar@esalq.usp.br

    2007-07-01

    The Sterile insect technique is a method of pest control allowed in integrated pest management programs in fruit growing, where sterile insects released compete in mate process against fertile wild ones, generating a gradual population reduction. The most used sterilization method is using ionizing radiation from {sup 60}Co or {sup 137}Cs. For efficient application of SIT, an important item is the sterilizing dose. This must be as lower as possible in order to preserve insect behavior. In this work, it was studied the reproductive potential of fruit fly Ceratitis capitata, tsl VIENNA 8 strain, irradiated with different doses of gamma radiation. This strain shall be used in population suppression programs at fruit-growing areas from Northeast of Brazil, through a partnership between CENA and Biofactory MOSCAMED Brazil, intending only sterile male releases. Radiation source used was a {sup 60}Co irradiator, with 17.2 .1012 Bq. Individualized couples were distributed in a randomized delineament with 10 replicates for each treatment and eggs were collected for fifteen days. With 9 and 10 days old, pupae were irradiated with doses ranging from 30 to 120 Gy. All means of emerged adult's percentages were higher than 90%. In regards to fecundity, different doses didn't affect the number of eggs laid, being the overall mean around 30 eggs/couple/day. Fertility data showed that as radiation dose increases, sterility increases. It was concluded that the dose of 90 Gy could be used in Brazil, since to SIT programs a dose is chosen witch prevents an egg hatch higher than 1%. (author)

  4. Analysis of Seasonal Risk for Importation of the Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidae), via Air Passenger Traffic Arriving in Florida and California.

    Science.gov (United States)

    Szyniszewska, A M; Leppla, N C; Huang, Z; Tatem, A J

    2016-09-04

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is one of the most economically damaging pests in the world and has repeatedly invaded two major agricultural states in the United States, Florida and California, each time requiring costly eradication. The Mediterranean fruit fly gains entry primarily in infested fruit carried by airline passengers and, since Florida and California each receive about 13 million international passengers annually, the risk of Mediterranean fruit fly entering the United States is potentially very high. The risk of passengers bringing the pest into Florida or California from Mediterranean fruit fly-infested countries was determined with two novel models, one estimated seasonal variation in airline passenger number and the other defined the seasonal and spatial variability in Mediterranean fruit fly abundance. These models elucidated relationships among the risk factors for Mediterranean fruit fly introduction, such as amount of passenger traffic, routes traveled, season of travel, abundance of Mediterranean fruit fly in countries where flights departed, and risk of the pest arriving at destination airports. The risk of Mediterranean fruit fly being introduced into Florida was greatest from Colombia, Brazil, Panama, Venezuela, Argentina, and Ecuador during January-August, whereas primarily the risk to California was from Brazil, Panama, Colombia, and Italy in May-August. About three times more Mediterranean fruit flies were intercepted in passenger baggage at airports in Florida than California, although the data were compromised by a lack of systematic sampling and other limitations. Nevertheless, this study achieved the goal of analyzing available data on seasonal passenger flow and Mediterranean fruit fly population levels to determine when surveillance should be intensified at key airports in Florida and California.

  5. Controle da infestação natural de ceratitis capitata (Wied., 1824 (Diptera, Tephritidae em pêssegos(Prunus persica através das radiações gama Control of naturally infested peaches (Prunus persica by mediterranean fruit fly (Ceratitis capitata through the use of gamma radiation

    Directory of Open Access Journals (Sweden)

    V. Arthur

    1993-12-01

    Full Text Available Determinou-se a dose desinfestante de radiações gama para pêssegos, Prunus persica, infestados com larvas da mosca do Mediterrâneo, Ceratitis capitata. Utilizaram-se frutas de procedência conhecida no campo fazendo-se uma amostragem prévia, constatando-se que cada fruta continha em média nove larvas do último ínstar da mosca praga. As frutas foram irradiadas em uma fonte de Cobalto-60 com as seguintes doses de radiação gama: 0 (test., 25, 50, 100, 200, 400, 600, 800, 1000 e 1200 Gy, sob uma taxa de 58 Gy por minuto. Após a irradiação as frutas foram colocadas em câmaras climatizadas com a temperatura variando entre 23 e 27°C e a umidade relativa variando entre 65 e 75%. Aguardou-se que as larvas deixassem as frutas e se transformassem em pupas e adultos. A dose letal para larvas, pelos resultados obtidos no experimento, concluiu-se ser de 600 Gy. A dose letal para pupas provenientes de larvas irradiadas dentro das frutas foi de 50 Gy, impedindo totalmente a emergência de adultos.Determination of the dose of gamma radiation to disinfest peaches, Prunus pérsica infested with larvae of Ceratitis capitata (Wied., 1824 was made. Fruits were collected in the field, each one holding about nine larvae of the last instar of the fruit-fly. The fruits were irradiated with Cobalt-60 gamma radiation source at the following doses: 0 (control, 25, 50, 100, 200, 400, 600, 800, 1000 and 1200 Gy; at a dose rate of 58 Gy per minute. After irradiation the fruits were kept in a climatic chamber with the temperature adjusted between 23 and 27°C, and relative humidity between 65 and 75 percent, until the larvae left the fruits and were transformed into pupae and adults. It was concluded that the lethal dose of gamma radiation for larvae at the last instar, in naturally infested peaches, was 600 Gy and the dose of 50 Gy inhibited completely the emergency of adults.

  6. Machos Virgens e Acasalados de Ceratitis capitata Wiedemann (Diptera: Tephritidae Apresentam o mesmo Sucesso de Cópula e a mesma Capacidade de Inibição de Recópula das Fêmeas?

    Directory of Open Access Journals (Sweden)

    Luiza Santana

    2014-08-01

    Virgin and Mated Males of Ceratitis capitata Wiedemann (Diptera: Tephritidae Have the Same Mating Success and the Same Ability to Inhibit Female Remating? Abstract. Ceratitis capitata Wiedemann is a polyphagous species that damages fruits and affects their production and consumption. One of the techniques to manage this pest is the Sterile Insect Technique, which consists in releasing sterile males in nature to compete with wild males for mating. The success of this technique is associated with the ability of sterile male in being selected by the female and in preventing female remating with other males. This paper aims to evaluate the influence of male reproductive status in mating success and in female remating inhibition. Tests for evaluating the latency to mate and copula duration were performed to evaluate latency to mate and copula duration based on different male status. In remating inhibition tests, females mated with virgin and mated males, were exposed to other males one day after the first mating so the rate of remating could be evaluated. The results showed that males of different reproductive status had no differences in mating success and in female remating inhibition. The latency to mate and copula duration were similar for both male status as well. Our results suggest that, assuming that the sterile males have the same basic biology of no sterile males, in SIT, after released in nature, mated males can have the same success in mating and female remating inhibition as virgin males.

  7. In vivo bioinsecticidal activity toward Ceratitis capitata (fruit fly) and Callosobruchus maculatus (cowpea weevil) and in vitro bioinsecticidal activity toward different orders of insect pests of a trypsin inhibitor purified from tamarind tree (Tamarindus indica) seeds.

    Science.gov (United States)

    Araújo, Carina L; Bezerra, Ingrid W L; Oliveira, Adeliana S; Moura, Fabiano T; Macedo, Leonardo L P; Gomes, Carlos E M; Barbosa, Aulus E A D; Macedo, Francisco P; Souza, Tánia M S; Franco, Octavio L; Bloch-J, Carlos; Sales, Mauricio P

    2005-06-01

    A proteinaceous inhibitor with high activity against trypsin-like serine proteinases was purified from seeds of the tamarind tree (Tamarindus indica) by gel filtration on Shephacryl S-200 followed by a reverse-phase HPLC Vidac C18 TP. The inhibitor, called the tamarind trypsin inhibitor (TTI), showed a Mr of 21.42 kDa by mass spectrometry analysis. TTI was a noncompetitive inhibitor with a Ki value of 1.7 x 10(-9) M. In vitro bioinsecticidal activity against insect digestive enzymes from different orders showed that TTI had remarkable activity against enzymes from coleopteran, Anthonomus grandis (29.6%), Zabrotes subfasciatus (51.6%), Callosobruchus maculatus (86.7%), Rhyzopertha dominica(88.2%), and lepidopteron, Plodia interpuncptella (26.7%), Alabama argillacea (53.8%), and Spodoptera frugiperda (75.5%). Also, digestive enzymes from Diptera, Ceratitis capitata (fruit fly), were inhibited (52.9%). In vivo bioinsecticidal assays toward C. capitata and C. maculatus larvae were developed. The concentration of TTI (w/w) in the artificial seed necessary to cause 50% mortality (LD50) of larvae was 3.6%, and that to reduce mass larvae by 50.0% (ED50) was 3.2%. Furthermore, the mass C. capitata larvae were affected at 53.2% and produced approximately 34% mortality at a level of 4.0% (w/w) of TTI incorporated in artificial diets.

  8. Compatibility of entomopathogenic nematodes and aqueous plant extracts aiming at the control of fruit fly Ceratitis capitata (Wiedemann (Diptera: TephritidaeCompatibilidade de nematóides entomopatogênicos e extratos vegetais aquosos visando o controle da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristhiane Rohde

    2013-06-01

    Full Text Available Currently, the fruit fly Ceratitis capitata (Diptera: Tephritidae has been controlled mainly by the chemical method, which is responsible for environmental and public health impacts. It has often been ineffective due to development of resistant insect populations. Thus, it has necessary to research new effective and less impacting control forms. In this sense, the use of entomopathogenic nematodes and plant extracts has been effective for controlling this pest. However, studies are needed to assess the compatibility between these methods, aiming at their use in integrated management programs for this pest. The aim of this study was to evaluate the compatibility of the nematodes Steinernema carpocapsae ALL and Heterorhabditis sp. JPM4 with aqueous extracts prepared from dried plant of cinnamon leaf, twig and fruit (Melia azedarach, rue leaf (Ruta graveolens, ginger (Zingiber officinale and garlic (Allium sativum for the control of C. capitata. The bioassay was carried out in completely randomized design with four replicates per treatment. Each replication consisted of a glass tube containing 1 mL of plant extract 40% w/v and 1 mL suspension of entomopathogenic nematodes with 1800 JI/mL for S. carpocapsae ALL and 600 JI/mL for Heterorhabditis sp. JPM4. The viability and infectivity of this nematode were evaluated on C. capitata larvae after 48 and 120 hours. It was found that all extracts reduced the viability and infectivity of both nematodes and they were incompatible after 120 hours of exposure. The nematode Heterorhabditis sp. JPM4 was more sensitive than the S. carpocapsae ALL as it showed, in the first 48 hours, a reduction in the viability and infectivity of more than 80 and 75%, respectively, when exposed to all the extracts except the ginger.A mosca-das-frutas Ceratitis capitata (Diptera: Tephritidae tem sido controlada, principalmente, pelo método químico, que é o responsável por impactos ambientais e na saúde pública e, muitas

  9. Diet-induced over-expression of flightless-I protein and its relation to flightlessness in Mediterranean fruit fly, Ceratitis capitata.

    Directory of Open Access Journals (Sweden)

    Il Kyu Cho

    Full Text Available The Mediterranean fruit fly (medfly, Ceratitis capitata is among the most economically important pests worldwide. Understanding nutritional requirement helps rearing healthy medfly for biocontrol of its population in fields. Flight ability is a high priority criterion. Two groups of medfly larvae were reared with two identical component diets except one with fatty acids (diet A and another without it (diet B. Adults from larvae reared on diet B demonstrated 20±8% of normal flight ability, whereas those from larvae reared on diet A displayed full flight ability of 97±1%. Proteomes were profiled to compare two groups of medfly pupae using shotgun proteomics to study dietary effects on flight ability. When proteins detected in pupae A were compared with those in pupae B, 233 and 239 proteins were, respectively, under- and over-expressed in pupae B, while 167 proteins were overlapped in both pupae A and B. Differential protein profiles indicate that nutritional deficiency induced over-expression of flightless-I protein (fli-I in medfly. All proteins were subjected to Ingenuity Pathway Analysis (IPA to create 13 biological networks and 17 pathways of interacting protein clusters in human ortholog. Fli-I, leucine-rich repeat (LRR-containing G protein-coupled receptor 2, LRR protein soc-2 and protein wings apart-like were over-expressed in pupae B. Inositol-1,4,5-trisphosphate receptor, protocadherin-like wing polarity protein stan and several Wnt pathway proteins were under-expressed in pupae B. These results suggest down-regulation of the Wnt/wingless signaling pathway, which consequently may result in flightlessness in pupae B. The fli-I gene is known to be located within the Smith-Magenis syndrome (SMS region on chromosome 17, and thus, we speculate that nutritional deficiency might induce over-expression of fli-I (or fli-I gene and be associated with human SMS. However, more evidence would be needed to confirm our speculation.

  10. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Polychronis Rempoulakis

    Full Text Available The Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT as a component of area-wide integrated pest management (AW-IPM approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS that has a white pupae (wp and temperature sensitive lethal (tsl mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C. The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2 strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were

  11. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Rempoulakis, Polychronis; Taret, Gustavo; Haq, Ihsan Ul; Wornayporn, Viwat; Ahmad, Sohel; Sto Tomas, Ulysses; Dammalage, Thilakasiri; Gembinsky, Keke; Franz, Gerald; Cáceres, Carlos; Vreysen, Marc J B

    2016-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT) as a component of area-wide integrated pest management (AW-IPM) approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS) that has a white pupae (wp) and temperature sensitive lethal (tsl) mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C). The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2) strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were equally

  12. Biological and morphological aspects of Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) on irradiated larva of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae);Aspectos biologicos e morfologicos de Diachasmimorpha longicaudata (Ashmead, 1905) (Hymenoptera: Braconidae) criado em larvas irradiadas de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Valle, Giuliana Etore do

    2006-07-01

    The objective of this work was evaluate some biological and morphological aspects of Diachasmimorpha longicaudata on irradiated and not irradiated larva of bisexual and tsl strains of Ceratitis capitata. The experiments were developed at the Laboratorio de Irradiacao de Alimentos e Radioentomologia (LIARE) of CENA/USP. For gamma radiation treatment it was used a Cobalt-60 source, model Gamma beam-650. Larva of bisexual strain were irradiated with 65 Gy and the tsl strain with 45 Gy. Experiments were carried out at room temperature of 25 +- 2 deg C, 75 +- 5 % RH and 14 hours of photo phase. After irradiation, the bisexual strain larva were exposed to adults of D. longicaudata for parasitization and parameters of percentage adult emergency and rate of male and female of D. longicaudata were observed. For tsl strain, were used larva from the first and the fourth collection only, and the following parameters were observed: percentage of adult emergency, rate of male and female, and the average unitary volume and weight of pupae at the 8{sup th} and 16 days after the parasitism date. Other parameters evaluated for tsl strain related to the parasitoid morphology such as, the length of the body, antenna, tibia and ovipositor. As result, both of the first and second experiments, the rate of parasitism was satisfactory, as well as showed larger incidence of females than males in parasitized larva, discarding the possibility that gamma radiation interfere in the sexual rate. No significant differences were observed on pupae volume. Some differences on pupae weight were observed at 8th and 16th day after the parasitism date, which should be associated to pre-emerging flies (8th day) and empty pupa (16th day). None significant difference was observed on morphological parameters, so one can conclude that gamma radiation treatment did not interfere in these quality parameters of the parasitoid. (author)

  13. Field trials of solid triple lure (trimedlure, methyl eugenol, raspberry ketone, and DDVP) dispensers for detection and male annihilation of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera: Tephritidae) in Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Mackey, Bruce; Cook, Peter; Morse, Joseph G; Stark, John D

    2012-10-01

    Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers and Mallet CMR (ceralure, ME, RK, benzyl acetate) wafers impregnated with DDVP (2,2-dichlorovinyl dimethyl phosphate) insecticide were measured in traps as potential detection and male annihilation technique (MAT) devices. Comparisons were made with 1) liquid lure and insecticide formulations, 2) solid cones and plugs with an insecticidal strip, and 3) solid single and double lure wafers with DDVP for captures of Mediterranean fruit fly, Ceratitis capitata (Wiedemann); oriental fruit fly, Bactrocera dorsalis Hendel; and melon fly, B. cucurbitae Coquillett. Bucket and Jackson traps were tested in a coffee plantation near Eleele, Kauai Island, HI (trials at high populations) and avocado orchards near Kona, HI Island, HI (trials at low populations). Captures of all three species with Mallet TMR were not different from Mallet CMR; therefore, subsequent experiments did not include Mallet CMR because of higher production costs. In MAT trials near Eleele, HI captures in AWPM traps with Mallet TMR wafers were equal to any other solid lure (single or double) except the Mallet ME wafer. In survey trials near Kona, captures of C. capitata, B. cucurbitae, and B. dorsalis with Mallet TMR wafers were equal to those for the standard TML, ME, and C-L traps used in FL and CA. A solid Mallet TMR wafer is safer, more convenient to handle, and may be used in place of several individual lure and trap systems, potentially reducing costs of large survey and detection programs in Florida and California, and MAT programs in Hawaii.

  14. Genetics and biology of Anastrepha fraterculus: research supporting the use of the sterile insect technique (SIT) to control this pest in Argentina.

    Science.gov (United States)

    Cladera, Jorge L; Vilardi, Juan C; Juri, Marianela; Paulin, Laura E; Giardini, M Cecilia; Gómez Cendra, Paula V; Segura, Diego F; Lanzavecchia, Silvia B

    2014-01-01

    Two species of true fruit flies (taxonomic family Tephritidae) are considered pests of fruit and vegetable production in Argentina: the cosmopolitan Mediterranean fruit fly (Ceratitis capitata Wiedemann) and the new world South American fruit fly (Anastrepha fraterculus Wiedemann). The distribution of these two species in Argentina overlaps north of the capital, Buenos Aires. Regarding the control of these two pests, the varied geographical fruit producing regions in Argentina are in different fly control situations. One part is under a programme using the sterile insect technique (SIT) for the eradication of C. capitata, because A. fraterculus is not present in this area. The application of the SIT to control C. capitata north of the present line with the possibility of A. fraterculus occupying the niche left vacant by C. capitata becomes a cause of much concern. Only initial steps have been taken to investigate the genetics and biology of A. fraterculus. Consequently, only fragmentary information has been recorded in the literature regarding the use of SIT to control this species. For these reasons, the research to develop a SIT protocol to control A. fraterculus is greatly needed. In recent years, research groups have been building a network in Argentina in order to address particular aspects of the development of the SIT for Anastrepha fraterculus. The problems being addressed by these groups include improvement of artificial diets, facilitation of insect mass rearing, radiation doses and conditions for insect sterilisation, basic knowledge supporting the development of males-only strains, reduction of male maturation time to facilitate releases, identification and isolation of chemical communication signals, and a good deal of population genetic studies. This paper is the product of a concerted effort to gather all this knowledge scattered in numerous and often hard-to-access reports and papers and summarize their basic conclusions in a single publication.

  15. The gene transformer of anastrepha fruit flies (Diptera, tephritidae and its evolution in insects.

    Directory of Open Access Journals (Sweden)

    María Fernanda Ruiz

    Full Text Available In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA, and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA. Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality.

  16. Etude de l’activité antiparasitaire et antimicrobienne des extraits de zests d’oranges Citrus sinensis var.Washington navel sur le ravageur Ceratitis capitata et la mycoflore qui lui est associée.

    OpenAIRE

    Benazzouz, Fatima zohra

    2015-01-01

    Ceratitis capitata سمحت لنا الدراسة البیوایكولوجیة لذبالة الفواكھ Penicillium sp. Aspergillus sp et Monilia أربع أنواع (Alternaria sp.,. الفطریات الضارة المتعلقة بھا، سمحت بتعریف ثمانیة أنواع فطریة sp). ثم تلیھا مكونات فینولیة أخرى (Tanins ) بالمقابل دراسة قدرة البرتقال على مقاومة ھذه القطریات بینت أن المكافحة تبدأ بإفراز مركبات فینولیة تركیبیة Ceratitis ) دراسة خلاصة قشرة البرتقال و الزیوت الطیارة الخاصة بھا على العزلات الفطریة و یرقات الذبابة و الذبابة نفسھا .(Flavonoides) حاثة ...

  17. Long aculeus and behavior of Anastrepha ludens render gibberellic acid ineffective as an agent to reduce 'ruby red' grapefruit susceptibility to the attack of this pestiferous fruit fly in commercial groves.

    Science.gov (United States)

    Birke, Andrea; Aluja, Martín; Greany, Patrick; Bigurra, Everardo; Pérez-Staples, Diana; McDonald, Roy

    2006-08-01

    Treating Mexican grapefruit with gibberellic acid (GA3) before color break, significantly delayed peel color change and increased peel puncture resistance, but it did not reduce grapefruit susceptibility to Mexican fruit fly, Anastrepha ludens (Loew) attack under natural conditions. Despite GA3 treatments, larval infestation levels increased with higher fruit fly populations, which also increased as the season progressed. Late in the season, infestation levels were even higher in GA3-treated fruit compared with untreated fruit, possibly because treated fruit were in better condition at that stage. Egg clutch size was significantly greater in very unripe, hard, GA3-treated fruit at the beginning of the harvest season and in December, compared with control fruit. Under laboratory conditions, egg injection into different regions of the fruit suggested that A. ludens eggs are intoxicated by peel oil content in the flavedo region. However, A. ludens' long aculeus allows females to oviposit eggs deeper into the peel (i.e., albedo), avoiding toxic essential oils in the flavedo. This makes A. ludens a particularly difficult species to control compared with other citrus-infesting species such as Anastrepha suspensa (Loew), Anastrepha fraterculus (Wiedemann), and Ceratitis capitata (Wiedemann) (fly species with significantly shorter aculei), which can be effectively managed with GA3 sprays. We discuss our findings in light of their practical implications and with respect to the oviposition behavior of various fruit flies attacking citrus.

  18. Determination of the dose of gamma radiation sterilization for assessment of biological parameters of male Ceratitis capitada (Diptera: Tephritidae), tsl - Vienna 8 strain; Determinacao da dose de radiacao gama esterilizante pela avaliacao dos parametros biologicos de machos de Ceratitis capitata (Diptera: Tephritidae), linhagem tsl - Vienna 8

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, Aline Cristina Pereira da

    2011-07-01

    The Vienna-8, tsl (temperature sensitive lethal) strain of Ceratitis capitata, by presenting mutations that facilitate the mass rearing and release only of sterile males in the field, has been used in (Sterile Insect Technique) programmes. The objective of this study was to determine the radiation dose that provides the highest level of sterility for Vienna-8, tsl males assessing their biological parameters that indicate the quality of sterile males to be released. Brown pupae (males) of the tsl strain were obtained from the mass rearing of the Food Irradiation and Radio entomology laboratory of CENA/USP, and they were irradiated (with gamma radiation - {sup 60}Co) 24 hours before the emergence at rates of 0, 30, 60, 90 and 120 Gy. The determination of the sterilizing dose was based on fertility of sexually mature females of the bisexual strain and not irradiated, mated with males of different treatments. Eggs were collected daily during 6 days, were counted and it was possible to estimate fecundity, and assess the hatching rate. The emergence and flight ability were determined by following the protocol of quality control manual for FAO/IAEA/USDA (2003). To assess the longevity under nutritional stress, the insects were kept a period of 48 h after emergence in the absence of water and food, and after this period, mortality was recorded. The size of the testes (left and right) was obtained by dissecting irradiated and non-irradiated males at the eighth day of life, and measure the testes in an ocular micrometer, considering the maximum length and width of each sample. To determine the sperm number was necessary to dissect the males and break their testicles. No difference was observed in emergence rate, flight ability and longevity of irradiated and non-irradiated males, nor in the fecundity of females mated with males of different treatments. The sterilizing dose that resulted in lower fertility of females was 120 Gy, with 1.5% hatching. Considering the parameters

  19. Genetics differentiation in the Mediterranean fruit fly, Ceratitis capitata (Wiedemann)%地中海实蝇地理种群遗传分化研究

    Institute of Scientific and Technical Information of China (English)

    林丽莉; 曾玲; 梁广文; 吴佳教; 顾渝娟; 刘海军; 胡学难

    2010-01-01

    以mtDNA的CO Ⅰ基因的部分序列作为分子标记,研究了来自安哥拉、黎巴嫩、刚果共和国、尼日利亚、贝宁、多哥、加纳、科特迪瓦、南非、埃及、法国、约旦、秘鲁、智利、美国佛罗里达和美国夏威夷等16个国家和地区共75个个体的地中海实蝇Ceratitis capitaza地理种群序列特征和单倍型特征,并分析了各种群间的遗传分化水平和进化关系,结果表明,在供试的样品中发现单倍型的数目是29,其中有5种为共享倍型.地中海实蝇各地理种群的遗传多态性水平差异较大,总体遗传距离D等于0.007.非洲南撒哈拉区(安哥拉、刚果、尼日利亚、贝宁、多哥、加纳、科特迪瓦)的种群的单倍型数、单倍型百分比和群内遗传距离等遗传多态性参数值都高于其它供试地区,多样性明显较其他地区丰富.

  20. Conditional lethality strains for the biological control of Anastrepha species

    Science.gov (United States)

    Pro-apoptotic cell death genes are promising candidates for biologically-based autocidal control of pest insects as demonstrated by tetracycline (tet)-suppressible systems for conditional embryonic lethality in Drosophila melanogaster (Dm) and the medfly, Ceratitis capitata (Cc). However, for medfly...

  1. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils.

    Science.gov (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin

    2015-04-01

    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host.

  2. 78 FR 68021 - Notice of Affirmation of Addition of a Treatment Schedule for Methyl Bromide Fumigation of...

    Science.gov (United States)

    2013-11-13

    ... species, Ceratitis capitata (Mediterranean fruit fly) and Anastrepha fraterculus (South American fruit fly... bromide treatment schedule to mitigate risk from C. capitata and A. fraterculus, as described in the...

  3. The gene chip detection technique for the Mediterranean fly, Ceratitis capitata, and its related species (Diptera: Tephritidae)%地中海实蝇及其近缘种基因芯片检测研究

    Institute of Scientific and Technical Information of China (English)

    李文芬; 余道坚; 颜亨梅; 李建光; 徐浪; 任鲁风

    2008-01-01

    本研究选择线粒体DNA(mtDNA)细胞色素氧化酶Ⅰ基因(COⅠ)为分子标记基因,以双翅目实蝇科昆虫DNA序列为目标,建立了我国进境植物检疫害虫地中海实蝇Ceratitis capitata、芒果小条实蝇C.cosyra和纳塔尔小条实蝇C.rosa等生物芯片检测方法.地中海实蝇及其近缘种检测芯片由检测探针(实蝇科通用探针1条.小条实蝇属通用探针1条,地中海实蝇、芒果小条实蝇和纳塔尔小条实蝇近缘种探针2条和种特异探针4条)、质控探针(定位点探针、阳性质控、阴性质控和空白对照探针各1条)组成.芯片检测结果表明,检测探针特异性强,能实现上述3种实蝇的种类快速区分和准确鉴定;检测方法稳定性好,地中海实蝇不同虫态(卵、幼虫、蛹和成虫)和不同地理种群检测结果完全一致.地中海实蝇生物芯片检测技术将为我国进口果蔬中检疫性实蝇快速筛查和种类鉴定提供检测方法,同时,还可应用到其他属的实蝇以及相关害虫的检疫中,为有害生物的快速鉴定提供了新方法.

  4. Adaptation to divergent larval diets in the medfly, Ceratitis capitata.

    Science.gov (United States)

    Leftwich, Philip T; Nash, William J; Friend, Lucy A; Chapman, Tracey

    2017-02-01

    Variation in diet can influence the timing of major life-history events and can drive population diversification and ultimately speciation. Proximate responses of life histories to diet have been well studied. However, there are scant experimental data on how organisms adapt to divergent diets over the longer term. We focused on this omission by testing the responses of a global pest, the Mediterranean fruitfly, to divergent selection on larval diets of different nutritional profiles. Tests conducted before and after 30 generations of nutritional selection revealed a complex interplay between the effects of novel larval dietary conditions on both plastic and evolved responses. There were proximate-only responses to the larval diet in adult male courtship and the frequency of copulation. Males on higher calorie larval diets consistently engaged in more bouts of energetic courtship. In contrast, following selection, larval development time, and egg to adult survival showed evidence of evolved divergence between diet regimes. Adult body size showed evidence for adaptation, with flies being significantly heavier when reared on their "own" diet. The results show the multifaceted responses of individuals to dietary selection and are important in understanding the extreme generalism exhibited by the medfly.

  5. OCORRÊNCIA E ÍNDICE DE INFESTAÇÃO DE Anastrepha spp. (DIP., TEPHRITIADE EM Pouteria gardneriana Radlk. E Pouteria ramiflora (Mart. Radlk. (SAPOTACEAE, NOS CERRADOS DE GOIÁS OCCURENCE AND INFESTATION INDEXES OF Anastrepha spp. (DIP., TEPHIRITIDAE IN Pouteria gardneriana RADLK AND Pouteria ramjflora (MART. RADLK. (SAPOTACEAE IN “CERRADOS” OF THE STATE OF GOIÁS, BRAZIL

    Directory of Open Access Journals (Sweden)

    Nelson Augusto Canal Daza

    2007-09-01

    Full Text Available

    Dentre as frutíferas nativas dos cerrados goianos destacam-se as do gênero Pouteria, com ampla distribuição nas regiões tropicais e subtropicais de todo o mundo, sendo a P. ramiflora (curriola a mais comum. Pouteria gardneriana (guapeva ocorre geralmente nos solos mais úmidos, sempre agrupada na faixa de separação cerrados-veredas. Dos 25 municípios do Estado de Goiás amostrados, em nove foi registrada a ocorrência dessas duas espécies de Pouteria, cujos frutos são bastante suscetíveis ao ataque de moscas-das-frutas. Dos frutos de guapeva e curriola, emergiram adultos de Anastrepha (99,82% e apenas alguns exemplares de Ceratitis capitata (0,18%. As espécies coletadas em P. gardneriana foram: Anastrepha bistrigata, A. fraterculus, A. leptozona, A. serpentina, A. zenildae, A. zernyi e C. capitata. De P. ramiflora foram obtidas: A. fraterculus, A. leptozona, A. serpentina e A. zernyi. Dos pupários de Anastrepha

  6. Proton conducting cerate ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Coffey, G.W.; Pederson, L.R.; Armstrong, T.R.; Bates, J.L.; Weber, W.J. [Pacific Northwest Lab., Richland, WA (United States)

    1995-08-01

    Cerate perovskites of the general formula AM{sub x}Ce{sub 1-x}O{sub 3-{delta}}, where A = Sr or Ba and where M = Gd, Nd, Y, Yb or other rare earth dopant, are known to conduct a protonic current. Such materials may be useful as the electrolyte in a solid oxide fuel cell operating at intermediate temperatures, as an electrochemical hydrogen separation membrane, or as a hydrogen sensor. Conduction mechanisms in these materials were evaluated using dc cyclic voltammetry and mass spectrometry, allowing currents and activation energies for proton, electron, and oxygen ion contributions to the total current to be determined. For SrYb{sub 0.05}Ce{sub 0.95}O{sub 3-{delta}}, one of the best and most environmentally stable compositions, proton conduction followed two different mechanisms: a low temperature process, characterized by an activation energy of 0.42{+-}0.04 eV, and a high temperature process, characterized by an activation energy of 1.38{+-}0.13 eV. It is believed that the low temperature process is dominated by grain boundary conduction while bulk conduction is responsible for the high temperature process. The activation energy for oxygen ion conduction (0.97{+-}0.10 eV) agrees well with other oxygen conductors, while that for electronic conduction, 0.90{+-}0.09 eV, is affected by a temperature-dependent electron carrier concentration. Evaluated by direct measurement of mass flux through a dense ceramic with an applied dc field, oxygen ions were determined to be the majority charge carrier except at the lowest temperatures, followed by electrons and then protons.

  7. Effects of acoustic waves on pupas of Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae); Efeitos das ondas acusticas em pupas de Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Barros, Adilson Camilo de

    2007-07-01

    The aim of this research has been to investigate the hypothesis that acoustic waves would provoke a measurable effect on a population of fruit flies, a treatment denominated sonication. Ionizing radiation, the causative agent for the treatment designated by irradiation has been used as a reference, as long as its effects on living beings and particularly on insects are widely known. This research also enquiries into the possible effects of acoustic waves and gamma rays. The experiments of sonication were carried out in the Laboratory of Entomology of the Instituto Biologico de Sao Paulo. The experiments of radiation were carried out in the Centro de Tecnologia das Radiacoes - IPEN, located within the campus of the University of Sao Paulo. It has been employed a Gamma cell source model 220 with average activity of 757.069 {+-} 293.484 curies (Ci) and an average doses rate of 3.106 {+-} 0.245 kilo grays per hour (kGy/h). Levels applied to the sonication treatment, in hertz and kilo Hertz were: 0 Hz (control) ; 5.0 Hz; 10.0 Hz; 20.0 Hz; 40.0 Hz; 60.0 Hz; 80.0 Hz; 1.0 k Hz; 2.0 k Hz; 10.0 k Hz; 15.0 k Hz e 20.0 k Hz. Irradiation doses applied in Grays were: 5.0 Gy; 7.5 Gy; 10.0 Gy; 12.5 Gy; 15 Gy; 50 Gy; 100 Gy; 150 Gy and 200 Gy. It has been used an acoustic tube made of glass - 40.6 cm in length and 9.1 cm in diameter - and sinusoidal waves originated from three acoustic sources, with response in decibels, which sound intensity varied from 93.60 {+-} 1.51 dB to 123.96 {+-} 0.23 dB. Final results have pointed to evidences that would justify the rejection of null hypothesis H{sub 0}, to which the average of the treatments due to acoustic waves do not differ significantly from each other.(author)

  8. Proton-conducting cerate ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Pederson, L.R.; Coffey, G.W.; Bates, J.L.; Weber, W.J. [Pacific Northwest National Lab., Richland, WA (United States)

    1996-08-01

    Single-cell solid oxide fuel cells were constructed using strontium cerate as the electrolyte and their performance tested. Like certain zirconates, hafnates, and tantalates, the cerate perovskites are among a class of solid electrolytes that conduct protons at elevated temperatures. Depending on the temperature and chemical environment, these ceramics also support electronic and oxygen ion currents. A maximum power output of {approx}100 mW per cm{sup 2} electrolyte surface area was obtained at 900{degrees}C using 4% hydrogen as the fuel and air as the oxidant. A series of rare earth/ceria/zirconia were prepared and their electrical properties characterized. Rare earth dopants included ytterbia, yttria, terbia, and europia. Ionic conductivities were highest for rare earth/ceria and rare earth zirconia compositions; a minimum in ionic conductivity for all series were found for equimolar mixtures of ceria and zirconia. Cerium oxysulfide is of interest in fossil energy applications because of its high chemical stability and refractory nature. An alternative synthesis route to preparing cerium oxysulfide powders has been developed using combustion techniques.

  9. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  10. Global assessment of seasonal potential distribution of Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Anna M Szyniszewska

    Full Text Available The Mediterranean fruit fly (Medfly is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species.

  11. Leg impairement magnifies reproductive costs in male Mediterranean fruit flies, Ceratitis capitata

    Science.gov (United States)

    Injuries frequently accumulate with age in nature. Despite the commonality of injury and the resulting impairment, there are limited experimental data for the effects of impairment on life history trade-offs between reproduction and survival in insects. We tested the effects of artificial injury and...

  12. Global assessment of seasonal potential distribution of Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Szyniszewska, Anna M; Tatem, Andrew J

    2014-01-01

    The Mediterranean fruit fly (Medfly) is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt) and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species.

  13. Effect of dietary components on larval life history characteristics in the medfly (Ceratitis capitata: Diptera, Tephritidae.

    Directory of Open Access Journals (Sweden)

    William J Nash

    Full Text Available BACKGROUND: The ability to respond to heterogenous nutritional resources is an important factor in the adaptive radiation of insects such as the highly polyphagous Medfly. Here we examined the breadth of the Medfly's capacity to respond to different developmental conditions, by experimentally altering diet components as a proxy for host quality and novelty. METHODOLOGY/PRINCIPAL FINDINGS: We tested responses of larval life history to diets containing protein and carbohydrate components found in and outside the natural host range of this species. A 40% reduction in the quantity of protein caused a significant increase in egg to adult mortality by 26.5%±6% in comparison to the standard baseline diet. Proteins and carbohydrates had differential effects on larval versus pupal development and survival. Addition of a novel protein source, casein (i.e. milk protein, to the diet increased larval mortality by 19.4%±3% and also lengthened the duration of larval development by 1.93±0.5 days in comparison to the standard diet. Alteration of dietary carbohydrate, by replacing the baseline starch with simple sugars, increased mortality specifically within the pupal stage (by 28.2%±8% and 26.2%±9% for glucose and maltose diets, respectively. Development in the presence of the novel carbohydrate lactose (milk sugar was successful, though on this diet there was a decrease of 29.8±1.6 µg in mean pupal weight in comparison to pupae reared on the baseline diet. CONCLUSIONS: The results confirm that laboratory reared Medfly retain the ability to survive development through a wide range of fluctuations in the nutritional environment. We highlight new facets of the responses of different stages of holometabolous life histories to key dietary components. The results are relevant to colonisation scenarios and key to the biology of this highly invasive species.

  14. Mass Rearing of Temperature Sensitive Genetic Sexing Strains in the Mediterranean Fruit Fly (Ceratitis Capitata)

    Energy Technology Data Exchange (ETDEWEB)

    Caceres, C. [FAO/IAEA Agriculture and Biotechnology Laboratory, Entomology Unit, A-2444 Seibersdorf (Austria)]. E-mail: c.caceres@iaea.org

    2002-09-15

    Genetic sexing strains (GSS) based on the temperature sensitive lethal(tsl) mutation are being used to produce sterile male medflies for large scale sterile insect technique (SIT) programmes for this pest. The use of male-only strains increases the overall efficiency of the technique. Currently more than 1.4 billion sterile male-only pupae are produced per week in different facilities around the world. Due to the mutations used to construct these strains, that is, translocations and selectable markers, they require different and more careful mass rearing procedures than do bisexual strains (BSS). The basic rearing technology has been developed and can be used to produce only males on a predictable basis to a level of 99.9% accuracy. If specific rearing procedures are followed, then tsl-based GSS has a rearing efficiency that is equal to that of a BSS and it is already know that males produced by the tsl-based GSS are of equal quality to males produced by BSS. Based on current rearing technology the cost of production of male pupae is about the same for both types of strain. This is due to the large colony that is required for the tsl-based GSS. This paper discusses the considerations that need to be taken into account during mass rearing of GSS and identifies the most efficient production processes that are currently available. (author)

  15. ANÁLISE FAUNÍSTICA DE ESPÉCIES DE MOSCA-DAS-FRUTAS (DIP., TEPHRITIDAE EM MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    N.A. CANAL

    1998-01-01

    Full Text Available Em seis locais de quatro municípios (Janaúba, Jaíba, Nova Porteirinha e Itacarambí do norte do Estado de Minas Gerais, foram coletados 29.454 espécimes de mosca-das-frutas, pertencentes a Ceratitis capitata e a 20 espécies de Anastrepha. O levantamento foi feito entre janeiro de 94 e dezembro de 96, utilizando armadilhas plásticas tipo McPhail. Ceratitis capitata foi a espécie predominante em áreas urbanas. As espécies de Anastrepha predominaram em áreas rurais. A. obliqua, A. zenildae e Anastrepha n. sp.3 foram as espécies predominantes do gênero, entretanto, essa predominância variou de local para local em função da disponibilidade de hospedeiros. As comunidades apresentaram índices de diversidade baixos e quocientes de similaridade entre 73 e 100%.A total of 29,454 specimens of fruit fly were trapped in six sites of four counties (Janaúba, Jaíba, Nova Porteirinha and Itacarambí of the north of the State of Minas Gerais, Brazil. The specimens were collected using McPhail plastic traps from January 1994 to December 1996. The trapped fruit flies belonged to Ceratitis capitata and to 20 species of Anastrepha. Ceratitis capitata was the predominant species in the urban areas and Anastrepha species were predominant in the field areas. A. obliqua, A. zenildae and Anastrepha n. sp.3 were the predominant species of the genera, whereas the predominant species differed among localities, according to host availability. The diversity indexes were low and the coefficient of similarity varied from 73 to 100%.

  16. Tetrastichus giffardianus on pupae of Anastrepha in Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2016-07-01

    Full Text Available ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae is recorded for the first time parasitizing Anastrepha obliqua (Macquart (Diptera: Tephritidae in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae in Brazil.

  17. Tetrastichus giffardianus on pupae of Anastrepha in Brazil

    OpenAIRE

    Almerinda Amélia Rodrigues Araújo; Paulo Roberto Ramalho Silva; Ranyse Barbosa Querino Silva; Elizangela Pereira da Silva Sousa

    2016-01-01

    ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae) is recorded for the first time parasitizing Anastrepha obliqua (Macquart) (Diptera: Tephritidae ) in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae) in Brazil.

  18. Ceratitis cosyra, een Afrikaanse boorvlieg gevonden in Drenthe (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.; Aartsen, van B.

    2002-01-01

    Ceratitis cosyra, an African fruitfly found in the Dutch province of Drenthe (Diptera: Tephritidae) A single specimen of Ceratitis (Ceratalaspis) cosyra (Walker, 1849) was collected near Papenvoort (utm ld4768) with a malaisetrap in the period 4-6 september 1993 (leg. L. Witmond). Up till now it was

  19. 7 CFR 319.56-49 - Eggplant from Israel.

    Science.gov (United States)

    2010-01-01

    ... introduction of the following quarantine pests: Ceratitis capitata, Eutetranychus orientalis, Helicoverpa..., Ceratitis capitata) is required both inside and outside the pest-exclusionary structures. Trapping...

  20. 77 FR 34781 - Importation of Tomatoes From the Economic Community of West African States Into the Continental...

    Science.gov (United States)

    2012-06-12

    ... importation of tomatoes from various countries where the Mediterranean fruit fly (Medfly, Ceratitis capitata... quarantine pests: Bactrocera cucurbitae, B. invadens, Ceratitis capitata, C. rosa, Chrysodeixis...

  1. 75 FR 36347 - Determination of Pest-Free Areas in Mendoza Province, Argentina; Request for Comments

    Science.gov (United States)

    2010-06-25

    ... recognize additional areas as pest- free areas for Mediterranean fruit fly (Ceratitis capitata) in Argentina... being free of Ceratitis capitata, Mediterranean fruit fly (Medfly).\\1\\ Specifically, the Government...

  2. MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM POMARES DA ÁREA URBANA NO NORTE DE MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    CLARICE DINIZ ALVARENGA

    2010-01-01

    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  3. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  4. Distribution of Anastrepha spp. in carambola orchards: Evidence for migration

    Science.gov (United States)

    Carambola orchards in Juana Diaz, Corozal, and Isabela, PR, were monitored for Anastrepha spp. fruit flies using Multi-lure traps baited with putrescine and ammonium acetate. The number of flies at various locations within the orchards were statistically compared with the expected distribution if fl...

  5. Ammonia Formulations and Capture of Anastrepha Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted in numbers to protein baits. Synthetic lures based on the principle components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important ...

  6. Particularities of Radiation Defect Formation in Ceramic Barium Cerate

    Science.gov (United States)

    Khromushin, I. V.; Aksenova, T. I.; Tuseev, T.; Munasbaeva, K. K.; Ermolaev, Yu V.; Ermolaev, V. N.; Seitov, A. S.

    2015-04-01

    The effects of irradiation with electrons, ions of noble gases (Ne, Ar, Kr) and oxygen on the structure and properties of neodymium-doped barium cerate have been studied using the methods of X-ray diffraction analysis, scanning electron and atomic force microscopy, thermal desorption spectroscopy. It was shown that irradiation by low-energy ions of noble gases stimulates the blistering processes on the sample surface, while the high-energy ions contribute to formation of the structures on the irradiated surface that resemble the various stages of spherulitegrowth. The similar structures were not observed in the case of irradiation with high-energy oxygen ions. According to the data on thermal desorption of water and oxygen molecules from the irradiated barium cerate it was supposed that irradiation by the noble gas ions promotes neodymium oxidation state change. It was noticed that the electron irradiation leads to the formation of the nano-sized acicular structures on the cerate surface.

  7. Análise faunêstica de moscas-das-frutas (diptera, tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Faunal study of fruit flies (Diptera, Tephritidae in peach or-chards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-12-01

    Full Text Available In order to characterizc the peach trees ecosystem in Porto Alegre related to tephrilidea species, a faunal study was developed over the data of the collects of these insects with traps in tvvelve months. For the characterization of the communities, constancy, abundance and frequency index were determined. Relation between sex were obtained by correlation matrix, sexual proportion and sexual rates. Anastrepha fratercalus (Wiedemann, 1830 was abundant, constant and frequent, Ceratitis capitata (Wiedemann, 1824 was accessory and Anastrepha grandis (Macquart, 1845 accidental. A greatcr number of females than males was observed.

  8. New mariner elements in Anastrepha species (Diptera: Tephritidae).

    Science.gov (United States)

    Marcon, Helena S; Domingues, D S; Coscrato, V E; Selivon, D; Perondini, A L P; Marion, C L

    2011-10-01

    Mariner-like elements (MLE) are members from class II of transposable elements also known as DNA transposons. These elements have a wide distribution among different groups of organisms, including insects, which can be explained by horizontal and vertical gene-transfer. MLE families have been described in tephritid flies and other genera. During screening for Wolbachia bacteria in fruit flies of the genus Anastrepha, we discovered two sequences related to mariner-like elements. Based on these sequences, we designed primers that allowed us to isolate and characterize two new mariner-like elements (Anmar1 and Anmar2) in Anastrepha flies. These elements, which belong to the mellifera and rosa subfamilies have a low nucleotide diversity, and are probably inactive and acquired by vertical transfer. This is the first report of mariner-like transposons in flies found in South America.

  9. Response of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera:Tephritidae) to metabolic stress disinfection and disinfestation treatment

    Science.gov (United States)

    Metabolic stress disinfection and disinfestation (MSDD) is a postharvest treatment designed to control pathogens and arthropod pests on commodities that combines short cycles of low pressure/vacuum and high CO2 with ethanol vapor. Experiments were conducted to evaluate the effect of MSDD treatment o...

  10. Ammonium Acetate and Ammonium Bicarbonate in Traps for Anastrepha Fruit Flies

    Science.gov (United States)

    Fruit flies in the genus Anastrepha, especially the reproductive age females, are attracted to protein baits. Synthetic lures based on the principal components of protein degradation, especially ammonia along with acetic acid, were tested against three of the most economically important Anastrepha s...

  11. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O.T. TÜZÜN, E. GÜRKAN, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  12. 78 FR 8435 - Importation of Fresh Citrus Fruit From Uruguay, Including Citrus Hybrids and Fortunella

    Science.gov (United States)

    2013-02-06

    ... (South American fruit fly) and Ceratitis capitata (Mediterranean fruit fly); two moths, Cryptoblabes..., Ceratitis capitata, Cryptoblabes gnidiella, Elsino australis, Gymnandrosoma aurantianum, and Xanthomonas.... capitata. If the prevalence rises above levels specified in the bilateral workplan, remedial measures...

  13. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael

    1952-11-01

    Full Text Available 1. Colombia tiene amplias posibilidades de desarrollar una industria frutícola floreciente dadas las excepcionales condiciones de ubicación geográfica, diversidad de climas y de suelos. 2. La deficiente producción frutera actual es el resultado de una reunión de factores adversos, entre los que resalta el desconocimiento de los problemas científicos que afectan a dicha industria. En este aspecto, los problemas fitosanitarios, abandonados y faltos de investigación, ocupan lugar preponderante. 3. Las moscas Anastrephas constituyen la plaga más importante de la fruticultura nacional, y por esta razón, un estudio sobre estos insectos es un tema de importancia. 4. Las principales "moscas de las frutas" pertenecen dentro de la familia Trypetidae, a los géneros: Dacus, Rhaglethis, Ceratitis, Dactrocera y Anastrepha. 5. Los nombres comunes con que se conocen las moscas Anastrephas varían de un país a otro y se relacionan particularmente con el lugar de origen de las distintas especies o la fruta determinada como preterida por la mosca en una localidad. En Colombia la denominación vernácula más difundida es la de "gusano de las frutas". También se nombra el insecto como "mosca o gusano del mango" o "gusano de la guayaba". 6. Los nombres científicos de las moscas distinguen a una, gran cantidad de especies. En Colombia, varios autores han reportado la existencia de las especies A.fraterculus, A. ludens, A. mombinpracoptans, A. pikeli y A. serpentina. Todas estas especies inciden en las regiones colombianas comprendidas entre 0 y 2000 metros de altura, es decir, en casi todas las regiones agrícolas importantes (frutales, café, cacao de temperaturas entre 14° y 30° C. 7. Las moscas Anastrephas están confinadas casi exclusivamente al continente americano entre las latitudes 27° N. y 35° S. Particularmente, la especie A. fraterculus, una de las más difundidas en Colombia, fué determinada por Wiedemann (1830

  14. Lifespan of a Ceratitis fruit fly increases with higher altitude

    OpenAIRE

    2010-01-01

    Variation in lifespan may be linked to geographic factors. While latitudinal variation in lifespan has been studied for a number of species, altitude variation has received much less attention, particularly in insects. We measured the lifespan of different populations of the Natal fruit fly Ceratitis rosa along an altitudinal cline. For the different populations we first measured the residual longevity of wild flies by captive cohort approach and compared F1 generation from the same populatio...

  15. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae).

    Science.gov (United States)

    Uramoto, Keiko; Norrbom, Allen L; Zucchi, Roberto A

    2016-09-15

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated.

  16. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae)

    Science.gov (United States)

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated....

  17. Species of fruit flies (Tephritidae obtained of McPhail trap in the Bahia State, Brazil/ Espécies de moscas-das-frutas (Tephritidae obtidas em armadilhas McPhail no Estado da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Miguel Francisco de Souza Filho

    2006-07-01

    Full Text Available The objective of this study was to provide knowledge on the species of fruit flies in commercial orchards in counties of the southern and extreme southern regions of the State of Bahia, Brazil. Flies were captured weekly by McPhail traps, using a hydrolyzed corn protein at 5%, as attractant. A total of 257 female was collected, and the species were identified as: Anastrepha fraterculus (77.4%, A. sororcula (4.7%, A. obliqua (2.7%, A. zenildae (0.8%, A. distincta (0.4%, A. consobrina (0.4%, Anastrepha sp.1 (5.1% and Ceratitis capitata (8.5%.O objetivo deste trabalho foi conhecer as espécies de moscas-das-frutas que ocorrem em pomares comerciais em alguns municípios da região sul e extremo-sul do estado da Bahia, Brasil. As moscas-dasfrutas foram capturadas, semanalmente, utilizando-se armadilhas McPhail, tendo como atrativo proteína hidrolisada de milho a 5%. Foi obtido um total de 257 espécimes fêmeas, pertencentes às espécies: Anastrepha fraterculus (77,4%, A. sororcula (4,7%, A. obliqua (2,7%, A. zenildae (0,8%, A. distincta (0,4%, A. consobrina (0,4%, Anastrepha sp.1 (5,1% e Ceratitis capitata (8,5%.

  18. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  19. ESPÉCIES E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS EM UM POMAR COMERCIAL DE MANGUEIRA, NO LITORAL DO ESTADO DO CEARÁ

    Directory of Open Access Journals (Sweden)

    Joseph Jonathan Dantas de Oliveira

    2009-01-01

    Full Text Available The objective of this research was to know the species and the population fluctuation of fruit flies (Diptera: Tephritidae in a commercial mango (Mangifera indica L. orchard in the coast of Ceará State. The study was developed from July of 2005 to July of 2007, in the municipality of Beberibe (CE. The capture of the fruit flies was performed using McPhail traps with 5% corn protein hydrolyzed solution as attractant. Weekly, the captured insects were sorted, the fruit flies were maintained in 70% alcohol solution and subsequently identified. The population fluctuation was estimated using the FTD (Fly/Trap/Day index. During the research, six fruit flies species were captured: Anastrepha obliqua (Macquart (63%, A. zenildae Zucchi (7%, A. sororcula Zucchi (5%, A. fraterculus (Wied. (2%, A. distincta Greene (2% and Ceratitis capitata (Wied. (21%. The Anastrepha spp. and C. capitata population peaked was between April and July, in both years of study.

  20. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  1. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail: miguelf@biologico.sp.gov.br; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2009-02-15

    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  2. Moscas frugívoras (Diptera, Tephritoidea coletadas em Aquidauana, MS Frugivorous flies (Diptera, Tephritoidea collected in Aquidauana, MS

    Directory of Open Access Journals (Sweden)

    Sérgio Roberto Rodrigues

    2006-03-01

    Full Text Available No Brasil as moscas frugívoras são pragas importantes de frutas e hortaliças. O conhecimento da flutuação populacional dessas espécies em cada bioma é um importante requisito para a adoção de estratégia de controle de pragas nos agroecossistemas. O objetivo desse trabalho foi avaliar a diversidade de espécies de moscas-das-frutas infestantes de frutas silvestres e cultivadas em Aquidauana, MS. Vinte e uma espécies de frutas foram amostradas de fevereiro de 2003 a janeiro de 2004. As espécies de Tephritidae encontradas foram: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 e Ceratitis capitata (Wiedemann, 1824. Os frugívoros Lonchaeidae e Muscidae encontrados foram: Neosilba sp. e Atherigona orientalis (Schiner, 1868, respectivamente. Um total de 2.568 moscas foram coletadas, das quais 2.394 representadas pela mosca-do-Mediterrâneo C. capitata. A associação entre moscas frugívoras e espécies de frutas é discutida.In Brazil, frugivorous flies represent important pests of fruits and vegetables. Information on populational fluctuation of these species in each biome is an important requirement for the adoption of a strategy of pest control in the agroecosystems. The objective of this paper is to assess the diversity of fruit fly species occurring in wild and cultived fruits in Aquidauana, MS. Twenty-nine fruit species were sampled from February 2003 to January 2004. The Tephritidae species recovered were: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 and Ceratitis capitata (Wiedemann, 1824. The frugivorous Lonchaeidae and Muscidae recovered were: Neosilba sp. and Atherigona orientalis (Schiner, 1868, respectively. A total of 2.568 flies were obtained, from which 2.394 flies were the Mediterranean fruit fly, C. capitata. The association between frugivorous flies and the fruit species is discussed.

  3. Anticancer properties of Thymbra capitata and Helichrysum italicum essential oils

    Directory of Open Access Journals (Sweden)

    Juliana Poças

    2014-06-01

    It has long been recognised that some EOs have antimicrobial, antibacterial, antioxidant, antiviral, antimycotic, antiparasitic, insecticidal activities. However, studies into their anti-tumoral activities are scarce. This study, indicates that Thymbra capitata and Helichrysum italicum EOs exhibited antitumor activity against RKO and MCF7 cells, deserving further research into both the mechanism of the observed anti-tumour activity and potential cancer therapeutic applications.

  4. Morphological characterization of the reproductive system of irradiated Anastrepha fraterculus

    Energy Technology Data Exchange (ETDEWEB)

    Bartolucci, Andrea, E-mail: andreabartolucci@iscamen.com.a [Instituto de Sanidad y Calidad Agropecuaria de Mendoza (ISCAMEN), Mendoza (Argentina); Vera, M. Teresa [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), (Argentina); Yusef, Veronica [Comision Nacional de Energia Atomica (Argentina). Centro Atomico Ezeiza; Oviedo, Andrea [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Field identification of released sterile insects is a major issue for eradication and suppression programs. Irradiated flies are normally identified by the presence of a fluorescent dye. When a fly lacks fluorescent dye, determination of gonadal state is necessary to identified between sterile or fertile flies. This is particularly relevant when population levels have decreased. Animal and identification is required to be as unequivocal as possible. Here we describe the reproductive system of irradiated Anastrepha fraterculus of different ages and we compare it with that of fertile flies in order to provide a diagnosis tool. Fertile and irradiated A. fraterculus were dissected from the day of emergence and until 15 days of age. Gross morphology was described and the gonads were measured. Germ cells were visualized in the testis. The reproductive systems of both males and females contained the same structures as other Anastrepha species. From day 1 to day 3, there were no detectable differences between irradiated and fertile males. The growing region encompassed half the testis total length and there was no free sperm in the seminal vesicle. On day 4 the presence of free sperm was seen in the seminal vesicle. At this stage irradiated males started differentiating from fertile ones: the growing region reduced in size and totally disappeared by day 11; sperm bundle zones occupied most of the testis; spermatids lost their triangular shape and sperm remained in the seminal vesicle without moving into the apical region. Testis length and width of irradiated males did not differ from fertile males. In females, the maturation of the ovaries involved a change in size that was more pronounced in the length of the ovary. This became noticeable at day 3. At this stage, the formation of yolk and the basal follicle began in fertile females and the oocyte had the same size as the trophocytes. From this point, the oocyte started growing. After day 8, the maturing oocyte reached

  5. Hypolipidemic effects of aqueous extract of Acalypha capitata leaves in rats fed on high cholesterol diet

    Institute of Scientific and Technical Information of China (English)

    Nnodim Johnkennedy; Emejulu Adamma; Nwadike Constance Nnedimma

    2011-01-01

    Objective:To evaluate the hypolipidemic effects of aqueous extract of Acalypha capitata (A. capitata) leaves in rats fed on high cholesterol diet. Methods:Cholesterol diet was administered to Wistar rats at a dose of 40 mg per 0.2 mL 3 times daily for 14 days while the control received distilled water. These animals were treated with extract of A. capitata at doses of 100 and 200 mg/kg. Lipid profiles were observed and compared. Results:Administration of A. capitata caused significant decrease in cholesterol, triglyceride and low density lipoprotein-cholesterol when compared with the control (P<0.05) which was dose dependent. Also, it was observed that high density lipoprotein-cholesterol was significantly increased when compared with the control. Conclusions:This observation suggests that the leaf extract of A. capitata could probably serve as a potential natural product for treatment of hyperlipidaemia.

  6. Biology of Anastrepha grandis (Diptera: Tephritidae) in Different Cucurbits.

    Science.gov (United States)

    Bolzan, Anderson; Nava, Dori E; Garcia, Flávio R M; Valgas, Ricardo A; Smaniotto, Giovani

    2015-06-01

    Anastrepha grandis (Macquart) (Diptera: Tephritidae) is one of the main pests of cucurbits in Brazil. Losses occur due to the damage caused to the fruits and the embargo on exports, as A. grandis is considered a quarantine pest in countries that import Brazilian cucurbits. This study aimed to evaluate the development of A. grandis in hosts of the Cucurbitaceae family. The hosts used were stem squash (Cucurbita pepo L.), squash (Cucurbita moschata Duchesne), chayote [Sechium edule (Jacq.) Swartz], mini watermelon [Citrullus lanatus (Thunb.) Matsum & Nakai], Spanish melon (Cucumis melo L.), hybrid squash "Tetsukabuto" (C. moschata×Cucurbita maxima Duchesne), and salad cucumber (Cucumis sativus L.). We evaluated the viability and duration of egg-to-pupa period, pupal weight, sex ratio, and average number of pupae per fruit under controlled conditions of temperature, relative humidity, and photophase. The preoviposition and oviposition periods, fecundity, fertility, and longevity of females were determined for adults. Hosts of the genus Cucurbita provided a better development of A. grandis in comparison with other hosts, and presented a greater number of insects on fruit as well as higher infestation rate. Fecundity and longevity were also higher for females that developed in hosts of the genus Cucurbita, although values of these biological parameters varied between stem squash, squash, hybrid squash "Tetsukabuto."

  7. Larval endoparasitoids (Hymenoptera of frugivorous flies (Diptera, Tephritoidea reared from fruits of the cerrado of the State of Mato Grosso do Sul , Brazil

    Directory of Open Access Journals (Sweden)

    Manoel A. Uchôa-Fernandes

    2003-01-01

    Full Text Available This paper presents a five years survey of endoparasitoids obtained from the larvae of frugivorous Tephritidae and Lonchaeidae flies. The insects were reared from cultivated and wild fruits collected in areas of the cerrado in the State of Mato Grosso do Sul, Brazil. The flies obtained from 14 host fruit species were eight Anastrepha species, Ceratitis capitata (Wiedemann, 1824 (Tephritidae; Dasiops sp. and Neosilba spp. (Lonchaeidae. Eleven parasitoid species were collected: Braconidae - Asobara anastrephae (Muesebek, 1958, Doryctobracon areolatus (Szépligeti, 1911, D. fluminensis (Costa Lima, 1938, Opius bellus Gahan, 1930 and Utetes anastrephae (Viereck, 1913; Figitidae - Aganaspis nordlanderi Wharton, 1998, Lopheucoila anastrephae (Rhower, 1919, Odontosema anastrephae (Borgmeier, 1935 and Trybliographa infuscata Gallardo, Díaz & Uchôa-Fernandes, 2000 and, Pteromalidae - Spalangia gemina Boucek, 1963 and S. endius Walker, 1839. In all cases only one parasitoid emerged per puparium. D. areolatus was the most abundant and frequent parasitoid of fruit fly species, as was L. anastrephae in Neosilba spp. larvae. This is the first record of A. nordlanderi in the midwestern Brazilian region.

  8. 7 CFR 318.13-22 - Bananas from Hawaii.

    Science.gov (United States)

    2010-01-01

    ... chapter for the Mediterranean fruit fly (Ceratitis capitata), the melon fruit fly (Bactrocera curcurbitae... requirements in § 305.34 of this chapter for the Mediterranean fruit fly (Ceratitis capitata), the melon...

  9. 7 CFR 319.56-20 - Apples and pears from Australia (including Tasmania) and New Zealand.

    Science.gov (United States)

    2010-01-01

    ... requirements of § 319.56-5 for pest freedom: Mediterranean fruit fly (Ceratitis capitata), the Queensland fruit... fruit fly (Ceratitis capitata), the Queensland fruit fly (Dacus tryoni), Bactrocera jarvisi, and...

  10. 75 FR 5034 - Determination of Pest-Free Areas in the Republic of Chile; Request for Comments

    Science.gov (United States)

    2010-02-01

    ... to recognize additional areas as pest-free areas for Mediterranean fruit fly (Ceratitis capitata) in... country as being free of Ceratitis capitata, Mediterranean fruit fly (Medfly).\\1\\ Specifically,...

  11. 76 FR 56730 - Determination of Pest-Free Areas in Australia; Request for Comments

    Science.gov (United States)

    2011-09-14

    ... recognize additional areas as pest- free areas for Mediterranean fruit fly (Ceratitis capitata) or... being free of Ceratitis capitata, the Mediterranean fruit fly (Medfly), and to recognize other areas...

  12. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae)

    Science.gov (United States)

    Release/recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew), to determine sampling range for a liquid protein bait (hydrolyzed torula yeast) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were d...

  13. Antennal and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to a series of homologous terminal diamines

    Science.gov (United States)

    Current monitoring programs for Anastrepha fruit flies use a two-component synthetic attractant consisting of ammonium acetate (AA) and putrescine (1,4-diaminobutane). Identification of additional attractant chemicals may improve trapping efficacy. We examined response of the Caribbean fruit fly, ...

  14. Response of Anastrepha suspensa (Diptera: Tephritidae) to terminal diamines in a food-based synthetic attractant.

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies utilizes a two-component food-based synthetic attractant consisting of ammonium acetate and putrescine (1,4-diaminobutane) lures. Development of more effective monitoring programs may be realized through identification of additional attractant ch...

  15. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae) and parasitoid wasps (Braconidae)

    Science.gov (United States)

    Mascarenhas, Rodrigo O; Prezotto, Leandro F; Perondini, André Luiz P; Marino, Celso Luiz; Selivon, Denise

    2016-01-01

    Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids. PMID:27648768

  16. Aqueous Grape Juice Bait for Anastrepha suspensa (Loew), (Diptera: Tephritidae) and Zaprionus indianus Gupta (Diptera: Drosophilidae)

    Science.gov (United States)

    Field tests were conducted in Miami, Florida to evaluate attraction of Anastrepha suspensa (Loew), and Zaprionus indianus Gupta, to traps baited with aqueous grape juice solution (10%) with and without preservative. Microbial activity, which occurred in baits without preservative that were aged in t...

  17. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae and parasitoid wasps (Braconidae

    Directory of Open Access Journals (Sweden)

    Rodrigo O Mascarenhas

    Full Text Available Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids.

  18. Eficácia de atrativos alimentares na captura de moscas-das-frutas em pomar de citros

    OpenAIRE

    Raga, Adalton; Machado,Rogério Amaro; Dinardo,Welci; Strikis,Pedro Carlos

    2006-01-01

    As moscas-das-frutas (Diptera: Tephritoidea) são importantes pragas de frutas cítricas no Estado de São Paulo, principalmente Anastrepha fraterculus (Wied.) e Ceratitis capitata (Wied.). O objetivo deste estudo foi medir a eficiência dos atrativos alimentares para monitoramento de moscas-das-frutas, em pomar de citros. O delineamento experimental adotado foi de blocos ao acaso com cinco tratamentos e cinco repetições. O ensaio foi instalado em 30/9/2003 e desenvolvidopor nove semanas. Os atra...

  19. Isolation, identification and determination of the biological activity of candidate fruit volatile components from Argania spinosa L. (Sapotacea)

    Energy Technology Data Exchange (ETDEWEB)

    Bakri, A., E-mail: bakri@ucam.ac.m [University Cadi Ayyad, Marrakech (Morocco). Fac. of Science Semlalia. Insect Biological Control Unit; Dueben, B.D.; Proveaux, A.T.; Heath, R.R., E-mail: rheath@saa.ars.usda.go [U.S. Department of Agriculture (USDA/REE-ARS), Miami, FL (United States). Agricultural Research Service

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  20. Comparative analysis of development and survival of two Natal fruit fly Ceratitis rosa Karsch (Diptera, Tephritidae) populations from Kenya and South Africa.

    Science.gov (United States)

    Tanga, Chrysantus M; Manrakhan, Aruna; Daneel, John-Henry; Mohamed, Samira A; Fathiya, Khamis; Ekesi, Sunday

    2015-01-01

    Comparative analysis of development and survivorship of two geographically divergent populations of the Natal fruit fly Ceratitis rosa Karsch designated as Ceratitis rosa R1 and Ceratitis rosa R2 from Kenya and South Africa were studied at seven constant temperatures (10, 15, 20, 25, 30, 33, 35 °C). Temperature range for development and survival of both populations was 15-35 °C. The developmental duration was found to significantly decrease with increasing temperature for Ceratitis rosa R1 and Ceratitis rosa R2 from both countries. Survivorship of all the immature stages of Ceratitis rosa R1 and Ceratitis rosa R2 from Kenya was highest over the range of 20-30 °C (87-95%) and lowest at 15 and 35 °C (61-76%). Survivorship of larvae of Ceratitis rosa R1 and Ceratitis rosa R2 from South Africa was lowest at 35 °C (22%) and 33 °C (0.33%), respectively. Results from temperature summation models showed that Ceratitis rosa R2 (egg, larva and pupa) from both countries were better adapted to low temperatures than R1, based on lower developmental threshold. Minimum larval temperature threshold for Kenyan populations were 11.27 °C and 6.34 °C (R1 and R2, respectively) compared to 8.99 °C and 7.74 °C (R1 and R2, respectively) for the South African populations. Total degree-day (DD) accumulation for the Kenyan populations were estimated at 302.75 (Ceratitis rosa R1) and 413.53 (Ceratitis rosa R2) compared to 287.35 (Ceratitis rosa R1) and 344.3 (Ceratitis rosa R2) for the South African populations. These results demonstrate that Ceratitis rosa R1 and Ceratitis rosa R2 from both countries were physiologically distinct in their response to different temperature regimes and support the existence of two genetically distinct populations of Ceratitis rosa. It also suggests the need for taxonomic revision of Ceratitis rosa, however, additional information on morphological characterization of Ceratitis rosa R1 and Ceratitis rosa R2 is needed.

  1. 76 FR 51934 - Determination of Pest-Free Areas in Mendoza Province, Argentina; Request for Comments

    Science.gov (United States)

    2011-08-19

    ... of that country as being free of Ceratitis capitata, Mediterranean fruit fly (Medfly). Specifically... recognize additional areas as pest-free areas for Mediterranean fruit fly (Ceratitis capitata) in Argentina... Ceratitis capitata, the Mendoza province of Argentina also be recognized as free of A. fraterculus. \\2\\...

  2. 78 FR 25620 - Importation of Female Squash Flowers From Israel Into the Continental United States

    Science.gov (United States)

    2013-05-02

    ... through the importation of immature fruit attached to female squash flowers. These are Ceratitis capitata... are designed to prevent the introduction of the following quarantine pests: Ceratitis capitata, Dacus... inspected and found free of Ceratitis capitata, Dacus ciliatus, Helicoverpa armigera, and...

  3. Enthalpy of formation of (In, Gd)-doped barium cerate

    Energy Technology Data Exchange (ETDEWEB)

    Matskevich, N.I., E-mail: nata.matskevich@yandex.ru [Nikolaev Institute of Inorganic Chemistry, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk (Russian Federation); Karlsruhe Institute of Technology, Institute of Solid State Physics, D-76334 Karlsruhe (Germany); Wolf, Th. [Karlsruhe Institute of Technology, Institute of Solid State Physics, D-76334 Karlsruhe (Germany); Adelmann, P.; Semerikova, A.N.; Anyfrieva, O.I. [Nikolaev Institute of Inorganic Chemistry, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk (Russian Federation)

    2015-09-10

    Highlights: • BaCe{sub 0.7}Gd{sub 0.2}In{sub 0.1}O{sub 2.85} was prepared by solid-state reaction. • The standard formation enthalpy was determined. • The stabilization energy (Δ{sub st}H°) was calculated. • Δ{sub st}H° of BaCe{sub 0.7}Gd{sub 0.2}In{sub 0.1}O{sub 2.85} is higher than BaCe{sub 0.7}Nd{sub 0.2}In{sub 0.1}O{sub 2.85} and BaCeO{sub 3}. - Abstract: Solution enthalpies of barium cerate doped by gadolinium and indium and a mixture of BaCl{sub 2} + 0.7CeCl{sub 3} + 2GdCl{sub 3} + 0.1InCl{sub 3} have been measured in 1 mol dm{sup −3} HCl with 0.1 mol dm{sup −3} KI. For the first time the standard molar formation enthalpy of BaCe{sub 0.7}Gd{sub 0.2}In{sub 0.1}O{sub 2.85} has been determined by solution calorimetry as follows: Δ{sub f}H° (298.15 K) = −1615.84 ± 9.01 kJ mol{sup −1}. The stabilization energy for above-mentioned compound has been calculated as well. It has been shown that barium cerate doped gadolinium and indium has higher stabilization energy than BaCe{sub 0.7}Nd{sub 0.2}In{sub 0.1}O{sub 2.85} and BaCeO{sub 3}. The reaction enthalpy with CO{sub 2} interaction has been calculated for BaCe{sub 0.7}Gd{sub 0.2}In{sub 0.1}O{sub 2.85}.

  4. The preparation of the rice coral Montipora capitata nubbins for application in coral-reef ecotoxicology.

    Science.gov (United States)

    Vijayavel, K; Richmond, R H

    2012-04-01

    Securing adequate and appropriate source material for coral-reef ecotoxicology studies is a significant impediment to conducting various experiments supporting the goal of conserving coral-reef ecosystems. Collecting colonies from wild stocks may be counter to protecting coral reef populations. To address this issue the rice coral Montipora capitata was used to generate sufficient genetically identical nubbins for research purposes. Growth and survival rates of these laboratory-prepared M. capitata nubbins were studied over a period of 90 days. The resulting data support the conclusion that the laboratory-prepared M. capitata nubbins showed successful growth and survival rates and are the best solution to solve the source material issue for lab experimentation. This paper describes the laboratory method used for the preparation and maintenance of these M. capitata nubbins and discusses the benefits and difficulties of using these nubbins in ecotoxicity studies.

  5. Isolation and characterization of microsatellite loci in tropical forage Stylosanthes capitata Vogel.

    Science.gov (United States)

    Santos, M O; Sassaki, R P; Chiari, L; Resende, R M S; DE Souza, A P

    2009-01-01

    Stylosanthes capitata is an important tropical pasture legume. Knowledge of genetic diversity and structure of S. capitata populations is of great importance for the conservation and germplasm management of this species. Thus, eight microsatellite markers were developed from an S. capitata-enriched library. They were characterized in 20 accessions from the germplasm collection of the Empresa Brasileira de Pesquisa Agropecuária (Embrapa). The observed and expected heterozygosities ranged from 0.16 to 0.85 and from 0.40 to 0.85, respectively. These microsatellites are the first set of molecular markers from this species and will contribute towards studies of genetic diversity, conservation and breeding of S. capitata.

  6. Captures of wild Ceratitis capitata Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae) in traps with improved multi-lure TMR-Dispensers weathered in California

    Science.gov (United States)

    During 2012-2013 two “attract and kill” systems were weathered in California as potential detection and male annihilation treatments (MAT). Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers impregnated with DDVP (2, 2-dichlorovinyl dimethyl phosphate) insecticide...

  7. Ammonium acetate enhances the attractiveness of a variety of protein-based baits to female Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Ammonia and its derivatives are used largely by female fruit 32 flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally-based control strategies such a food-based lures a...

  8. The whole genome sequence of the Mediterranean fruit fly, Ceratitis capitata (Weidmann): a highly invasive and destructive pest of fruits and vegetables throughout the world

    Science.gov (United States)

    The Mediterranean fruit fly is one of the most destructive agricultural pests throughout the world due to its broad host plant range that includes more than 260 different fruits, flowers, vegetables, and nuts. Host preferences vary in different regions of the world, which can be associated with its ...

  9. 78 FR 25692 - Notice of Decision To Authorize the Importation of Fresh Barhi Dates From Israel

    Science.gov (United States)

    2013-05-02

    ... advising the public of our decision to add a treatment schedule for Ceratitis capitata in Barhi dates to... from Israel was treating the dates with cold treatment for Ceratitis capitata. Because no such cold... mitigation for C. capitata, and described a cold treatment schedule for C. capitata in Barhi dates that...

  10. Biology of Fopius arisanus (Hymenoptera: Braconidae) in Two Species of Fruit Flies

    Science.gov (United States)

    Groth, M. Z.; Loeck, A. E.; Nörnberg, S. D.; Bernardi, D.; Nava, D. E.

    2016-01-01

    Fopius arisanus (Sonan, 1932) (Hymenoptera: Braconidae) is an egg–larval parasitoid used in control programs of Bactrocera dorsalis (Hendel) and Ceratitis capitata (Wiedemann). In Brazil, C. capitata and Anastrepha fraterculus (Wiedemann) are considered the main tephritid pests of exotic and indigenous fruits. The objective of this study was to study the biology of F. arisanus in C. capitata and A. fraterculus. Eggs of the two fruit fly species were used to determine the parasitism rate, number of offspring, emergence rate, sex ratio, adult weight and longevity of male and female F. arisanus. These biological parameters were used to develop a fertility life table. We observed higher parasitism and emergence rates of adults, a shorter duration of the egg–adult period and a sex ratio biased to females when F. arisanus was reared in eggs of C. capitata than in those of A. fraterculus. However, adults of F. arisanus from eggs of A. fraterculus were heavier and had greater longevity than those obtained from C. capitata eggs. The fertility life table showed better biological and reproductive performance for F. arisanus reared in eggs of C. capitata, although eggs of A. fraterculus also provided positive values for population increase. PMID:27638954

  11. Cuticular hydrocarbons corroborate the distinction between lowland and highland Natal fruit fly (Tephritidae, Ceratitis rosa) populations

    Science.gov (United States)

    Vaníčková, Lucie; Břízová, Radka; Pompeiano, Antonio; Ekesi, Sunday; Meyer, Marc De

    2015-01-01

    Abstract The cuticular hydrocarbons (CHs) and morphology of two Ceratitis rosa Karsch (Diptera: Tephritidae) populations, putatively belonging to two cryptic taxa, were analysed. The chemical profiles were characterised by two-dimensional gas chromatography with mass spectrometric detection. CHs of Ceratitis rosa that originated from the lowlands and highlands of Kenya comprised of n-alkanes, monomethylalkanes, dimethylalkanes and unsaturated hydrocarbons in the range of the carbon backbone from C14 to C37. Hydrocarbons containing C29, C31, C33 and C35 carbon atoms predominated in these two populations. 2-Methyltriacontane was the predominant compound in both populations. Quantitative differences in the distribution of hydrocarbons of different chain lengths, mainly the C22, C32, C33 and C34 compounds of these two populations, were observed despite indistinct qualitative differences in these hydrocarbons. Morphological analyses of male legs confirmed that the flies belong to different morphotypes of Ceratitis rosa previously labelled as R1 and R2 for lowland and highland populations, respectively. A statistical analysis of the CH compositions of the putative R1 and R2 species showed distinct interspecific identities, with several CHs specific for each of the lowland and highland populations. This study supports a hypothesis that the taxon Ceratitis rosa consists of at least two biological species. PMID:26798275

  12. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars.

    Science.gov (United States)

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín

    2017-01-10

    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack.

  13. Moscas-das-frutas em pomares de pessegueiro e maracujazeiro, no Município de Iraceminha, Santa Catarina, Brasil Fruit flies in peach and passion fruit orchards in Iraceminha, Santa Catarina, Brazil

    Directory of Open Access Journals (Sweden)

    Sheila Alberti

    2009-08-01

    Full Text Available Este estudo teve o objetivo de caracterizar a comunidade de moscas-das-frutas de ocorrência em pomares de pessegueiro e maracujazeiro, no Município de Iraceminha, Santa Catarina (SC, por meio da análise faunística. Os adultos de moscas-das-frutas foram capturados semanalmente, em armadilhas McPhail, contendo glicose invertida a 10%, no período de abril de 2006 a março de 2007. Na caracterização, foram calculados os índices de abundância, constância, dominância, frequência e diversidade. Foram coletados 697 adultos de moscas-das-frutas. Anastrepha grandis e Anastrepha fraterculus foram as espécies mais abundantes, frequentes, constantes e dominantes nos pomares estudados, predominando sobre as outras espécies de moscas-das-frutas. Ceratitis capitata foi caracterizada como dispersa e pouco frequente. O maior índice de diversidade encontrado foi de 1,99 no pomar de maracujazeiro.This research had the objective to characterize the community of fruit flies in peach and passion fruit orchards in Iraceminha, Santa Catarina, Brazil, through faunistic analyses. The adults fruit flies were weekly captured in McPhail traps with 10% inverted glucose, from April 2006 to March 2007. In the characterization, the indices for abundance, constancy, dominance, frequency and diversity were calculated. A total of 697 adults fruit flies were collected. Anastrepha grandis and Anastrepha fraterculus species were the most abundant, frequent, constant and dominant in orchards studied, predominating upon other fruit flies species. Ceratitis capitata was dispersed and not very frequent. The biggest index of diversity of 1.99 was in passion fruit orchard.

  14. Caracterização química da amêndoa de coquinho-azedo (Butia capitata var capitata Chemical characterization of nut of Butia capitata var capitata

    Directory of Open Access Journals (Sweden)

    Juliana Pereira Faria

    2008-06-01

    Full Text Available A palmeira Butia capitata var capitata produz o coquinho-azedo, fruto de odor agradável e penetrante, cuja polpa é aproveitada para a produção de um suco saboroso na região norte de Minas Gerais. As sementes apresentam uma amêndoa cuja exploração ainda é bastante limitada. O objetivo deste trabalho foi determinar a composição da amêndoa do coquinho-azedo, visando a avaliar suas possibilidades de uso. Na amêndoa, a composição química (umidade, proteínas, lipídios, cinzas e fibras foi determinada por métodos gravimétricos. Os teores dos principais minerais foram avaliados por espectrofotometria de emissão atômica com fonte de plasma indutivo, e a composição dos ácidos graxos presentes na gordura da semente foi determinada por cromatografia a gás. A amêndoa do coquinho-azedo apresentou 9,9 % de umidade e 57,8 % de lipídios totais, 25,8 % de fibra detergente neutro, 17,6 % de fibra detergente ácido e 1,6 % de cinzas em base seca. A gordura extraída da amêndoa de coquinho-azedo apresentou elevados teores de ácido láurico (42,1 %, que foi seguido pelo ácido oléico (16,9 %. Predominaram os ácidos graxos saturados (78,9 %, principalmente os de cadeia média (C6-C12.The Butia capitata palm tree produce a very aromatic fruit named "coquinho-azedo", which freeze pulp is frequently used to produce agreeable juice in north of Minas Gerais, Brazil. "Coquinho-azedo" kernel contains a nut that is not frequently explored. The purpose of the present study was the chemical characterization of "coquinho-azedo" nut to evaluate the possibilities of its use. The moisture, lipids, ash and fiber contents were determined by gravimetric methods. The mineral profile was characterized by inductively coupled plasma spectrophotometer and the fatty acids profile was characterized by gas chromatography. The coquinho-azedo nut presented 9,9 % of moisture, 57,8 % of total lipid, 25,8 % of neutral detergent fiber, 17,6 % of acid detergent fiber

  15. Methods to Break Seed Dormancy of Rhynchosia capitata, a Summer Annual Weed Métodos para Romper la Dormancia de Rhynchosia capitata, una Maleza Anual de Verano

    Directory of Open Access Journals (Sweden)

    Hafiz Haider Ali

    2011-09-01

    Full Text Available Dormancy of weed seeds is a significant feature contributing to their survival rate since it helps the weeds to avoid herbicides and other weeding practices along with unfavorable environmental conditions. We investigated the effects of different dormancy breaking treatments on the germination of Rhynchosia capitata, a common summer annual weed, which is emerging as a weed threat in Pakistan. Seeds were soaked in thiourea, KNO3, HCl, HNO3, and H2SO4, and they were also mechanically scarified (sandpaper. Results indicated that R. capitata seeds show signs of physical dormancy that is mainly due to the impermeability of their coat. Mechanical scarification and acid scarification (soaking of seeds in H2SO4 for 60 and 80 min and in HCl for 12 and 15 h were very efficient in breaking dormancy and promoting germination. Seed soaking in HNO3 for 1 to 5 d showed little effect whereas various concentrations of thiourea and KNO3 were ineffective in breaking R. capitata seed dormancy.La dormancia seminal de las malezas es un rasgo significativo contribuyente a su tasa de supervivencia, puesto que ayuda a las malezas a evitar herbicidas y otras prácticas de desmalezado junto con condiciones ambientales desfavorables. Investigamos los efectos de diferentes tratamientos para romper dormancia sobre la germinación de Rhynchosia capitata, una maleza anual estival común en Paquistán. Las semillas se sumergieron en tiourea, KNO3, HCl, HNO3 y H2SO4 y además fueron escarificadas mecánicamente (papel lija. Los resultados indicaron que las semillas de R. capitata muestran signos de dormancia física principalmente debido a impermeabilidad de su cubierta. Escarificación mecánica y ácida (inmersión de semillas en H2SO4 por 60 y 80 min y en HCl por 12 y 15 h fueron muy eficientes para romper dormancia y promover germinación. Las semillas sumergidas en HNO3 por 1 a 5 días mostraron poco efecto, mientras diversas concentraciones de tiourea y KNO3 fueron

  16. Performance of Anastrepha obliqua (Diptera, Tephritidae larvae fed on artificial diets Desempenho das larvas de Anastrepha obliqua (Diptera, Tephritidae alimentadas com dietas artificiais

    Directory of Open Access Journals (Sweden)

    Tânia M. L. Fontellas-Brandalha

    2010-06-01

    Full Text Available Moscas das frutas do gênero Anastrepha Schiner, 1868 são conhecidas por sua importância econômica devido aos danos que elas causam nos frutos comerciais. As exigências nutricionais dos estágios imaturo e adulto são diferentes e as larvas não se desenvolvem bem utilizando a mesma dieta do adulto. Embora as necessidades nutricionais básicas dos insetos sejam bem conhecidas, existe ainda o problema de elaborar dietas de criação adequadas para espécies com necessidades específicas. O objetivo deste trabalho foi verificar o efeito de diferentes tipos e quantidades de carboidratos na dieta sobre a performance larval de Anastrepha obliqua (Macquart, 1835. Larvas foram criadas individualmente em tubos de ensaio contendo uma das dietas artificiais a serem testadas onde elas foram mantidas até a pupação. A composição básica das dietas testadas incluia 2,5 g de agar, 3,25 g de levedo de cerveja e quantidades variadas de sacarose e farinha de trigo. A adequação do meio artificial para A. obliqua foi testada pela avaliação da sobrevivência larval e pupal (% e o tempo de desenvolvimento larval, pupal e de larva-adulto. A dieta contendo farinha de trigo (2 g e sacarose (2 g e a dieta somente com sacarose (5,5 g foram as que apresentaram melhor performance larval. Todas as dietas testadas apresentaram resultados similares ou superiores às dietas utilizadas em outros trabalhos. A importância da presença da farinha de trigo e seu valor nutricional para as larvas são discutidos.Fruit flies of the genus Anastrepha Schiner, 1868 are well-known for having economical importance since they damage commercially cultivated fruits. Nutritional demands during the immature and adult stages are different, so the larvae do not develop well using the same diet as the adults. Although the insect basic nutritional needs are well-known, there is also the challenge to elaborate rearing diets adequate to species with specific needs. The aim of this study

  17. Eficácia de atrativos alimentares na captura de moscas-das-frutas em pomar de citros Attractiveness of food baits to the fruit flies in citrus orchard

    Directory of Open Access Journals (Sweden)

    Adalton Raga

    2006-01-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritoidea são importantes pragas de frutas cítricas no Estado de São Paulo, principalmente Anastrepha fraterculus (Wied. e Ceratitis capitata (Wied.. O objetivo deste estudo foi medir a eficiência dos atrativos alimentares para monitoramento de moscas-das-frutas, em pomar de citros. O delineamento experimental adotado foi de blocos ao acaso com cinco tratamentos e cinco repetições. O ensaio foi instalado em 30/9/2003 e desenvolvidopor nove semanas. Os atrativos testados foram: proteínas hidrolisadas comerciais Bio Anastrepha, Isca Mosca e Aumax®, todas diluídas em água a 5%; melaço a 7% isoladamente e melaço a 7% em mistura com suco de laranja a 10%. Foram utilizados semanalmente, 400mL da solução atrativa por frasco plástico McPhail instalado na copa de laranjeiras da variedade 'Pêra Rio'. As soluções eram renovadas semanalmente, ocasião em que os adultos eram coletados e çevados ao laboratório para contagem, sexagem e identificação. Foram capturados 1.821 adultos de Tephritoidea, sendo 892 de Anastrepha spp., 731 de C. capitata e 198 de Neosilba spp. Para essas espécies, as proteínas Bio Anastrepha e Isca Mosca foram altamente eficientes e semelhantes entre si, capturando 44,5% e 41,3% dos adultos de Tephritidae respectivamente. Não houve diferença entre as espécies de Tephritidae analisadas por sexo capturadas em Bio Anastrepha, Aumax® e melaço. Aumax®, melaço isoladamente e melaço + suco de laranja atraíram apenas 4,6%, 1,3% e 1,2% do total de adultos de Tephritidae, respectivamente. Melaço isoladamente e melaço com suco de laranja foram mais eficazes na atratividade de Zaprionus indianus (Gupta (Diptera: Drosophilidae.Fruit flies (Diptera: Tephritoidea are key pests in citrus production in the State of São Paulo, Brazil, mainly Anastrepha fraterculus (Wied. and Ceratitis capitata (Wied.. The objective of this study was to evaluate food baits to monitor fruit fly

  18. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  19. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini

    2009-03-01

    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  20. Sterile insect technique: new technology to control fruit flies, Ceratitis capitata, in the Lower Basin of the Sao Francisco Valley; Tecnica do inseto esteril: nova tecnologia para combater a mosca-das-frutas, Ceratitis capitata, no Submedio do Vale do Sao Francisco

    Energy Technology Data Exchange (ETDEWEB)

    Paranhos, Beatriz Aguiar Jordao; Barbosa, Flavia Rabelo [Embrapa Semi-Arido, Petrolina, PE (Brazil); Nascimento, Antonio Souza do [Embrapa Mandioca e Fruticultura, Cruz das Almas, BA (Brazil); Viana, Rodrigo; Malavasi, Aldo [Moscamed Brasil, Juazeiro, BA (Brazil); Sampaio, Raimundo [Agencia Estadual de Defesa Agropecuaria da Bahia (ADAB-BA), Salvador, BA (Brazil); Walder, Julio Marcos Melges [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil)

    2008-12-15

    The SIT is the creation, on a large scale, the insect-pest to be controlled and weekly release of these insects sterilized in the field.The sterile insects copulate with the wild, but do not generate descendants. The basic premises for the use of SIT in insect control are: the reproduction is through sexual intercourse, the female copulate preferably only once there is ease of creation of the plague in industrial scale in artificial diet. The efficiency of the SIT may be greater when only the males are released in the field because they increase the probability of copulating with wild females only, with reductions in the cost of production and release. In the case of fruit-flies, sterile females continue doing puncture in the fruits, which decreases the quality for export. To be able to release only males in the field, in 1980s, was developed a mutant strain, whose females emerge from pupae white, thus being able to discard the white ones, keeping the pupae Brown for the release of sterile males. Ten years after, to save on the industrial scale production system, was obtained a mutant whose females possess lethal temperature sensitivity of 34 deg C, still in the embryo stage. Then the eggs are placed on artificial diet, and when they arrive at the pupa stage, they are all brown and males. Forty-eight to 24 hours before the emergence of adults, the pupae are painted with fluorescent powder paint, bagged and irradiated with gamma radiation of 95Gy of Co-60 or X-ray. As soon as the males emerge, are marked with fluorescent ink and when they reach 3 to 5 days old, are released into the field. Thus, when monitoring is done in Jackson traps in the field, it is possible to distinguish wild male sterile under black light or epifluorescence microscope with males, because the sterile are fluorescent. On application of the SIT to Moscamed, sterile males are released in the field must display good dispersibility, good survival and good sexual performance. The efficiency and effectiveness of the use of the SIT depend on the success of the sterile males in competition with wild males for copulating of females. According to FAO / IAEA / USDA (2003 ), so that the SIT is technically feasible in controlling Moscamed, it must occur in field conditions, at least 20 % of matings between sterile males and wild females tsl. One of the ways to increase the efficiency of SIT is releasing a nine to one hundred times the population of sterile males compared to the wild population in this field, it increases the likelihood of wild females are copulated by sterile males. Understanding the behaviors and strategies used by the wild and sterile males approach the females for copulating has great relevance to the SIT programs, since determining the acceptance and response of wild females. The strategy in copulating fruit-flies consists of: a) clustering of males at the bottom of foliage of host or non-host plants; b) issuance of the sex pheromone; c) call through the beating of the wings; d) arrival of the female, which is the male face to face; e) both touch with antennas; f) males jump about the females and initiate copulating, and the female may or may not accept the male g) end copulation.

  1. Comparison of synthetic food-based lures and liquid protein baits for capture of Anastrepha suspensa (Diptera: Tephritidae) adults

    Science.gov (United States)

    Field tests that were conducted in south Florida to compare capture of the Caribbean fruit fly, Anastrepha suspensa (Loew), in Multilure traps baited with liquid protein baits torula yeast/borax or NuLure/borax, or with food-based synthetic lures including two component (ammonium acetate, putrescine...

  2. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua

    Science.gov (United States)

    Different lures based on hydrolyzed protein products were assayed in the field for their ability to attract Anastrepha suspensa and A. obliqua (Diptera: Tephritidae). Typically, ammonium acetate with putrescine and freeze-dried NuLure with ammonium acetate and putrescine attracted more flies than ot...

  3. Electroantennogram response and attraction of Anastrepha suspensa to volatiles of various sugar sources and aged sugar sollutions

    Science.gov (United States)

    With the aim of finding new, sugar-based volatile attractants for economically important tephritid fruit fly species, we used electroantennography (EAG) to quantify olfactory responses of female Caribbean fruit fly, Anastrepha suspensa (Loew), to volatiles of six different sugars (refined white and ...

  4. Male sexual behavior and pheromone emission is enhanced by exposure to guava fruit volatiles in Anastrepha fraterculus

    Science.gov (United States)

    Host plant chemicals can influence sex pheromone communication of tephritid fruit flies, and affect strategies optimizing mating and reproduction. Previous studies suggest that females of the South American fruit fly, Anastrepha fraterculus, prefer to mate with laboratory males previously exposed to...

  5. Phytochemical and biological studies of Butia capitata Becc. leaves cultivated in Egypt

    Directory of Open Access Journals (Sweden)

    Nagwa Mohamed Ammar

    2014-06-01

    Conclusions: B. capitata leaf extracts were shown to possess variable antioxidant effect, the most promising was methanol extract. Both polar and non polar extracts were proved to have anti-inflammatory activity, the non polar extract was superior in this respect. The bioactivity of the extracts was ascribed to the presence of flavonoids, sterols and α-tocopherol.

  6. Phytochemical and biological studies of Butia capitata Becc. leaves cultivated in Egypt

    Institute of Scientific and Technical Information of China (English)

    Nagwa Mohamed Ammar; Mohammed Said Hefnawy; Sahar Youssef Al-Okbi; Doha Abdou Mohamed; Nabil Khamis El-Sayed; Amira Ahmed El-Anssary; Tom Mabry

    2014-01-01

    Objective: To study the antioxidant and anti-inflammatory activity of Butia capitata (B. capitata) leaf extracts along with phytochemical analysis of the proposed bioactive constituents.Methods:organic solvents and screened for their anti-inflammatory activities in tested animals and in-vitro antioxidant effect. An extensive phytochemical investigation of the bioactive extracts through paper chromatography, thin layer chromatography, column chromatography, gas-liquid chromatography (GLC), high pressure liquid chromatography and spectral analysis. GC-Mass, ultraviolet, hydrogen and carbon nuclear magnetic resonance, electron ionization-mass spectrometry, heteronuclear multiple bond correlation and heteronuclear multiple quantum correlation were carried out.Results:Results showed that different extracts possess promising antioxidant effect and Different successive extracts of B. capitata Becc. leaves were prepared with selective significant anti-inflammatory activity with variable degrees. The results of the phytochemical investigation of the bioactive extracts revealed the presence of volatile substances, lipoidal matter, α-tocopherol, free sugars, polysaccharides and flavonoidal compounds.Conclusions: B. capitata leaf extracts were shown to possess variable antioxidant effect, the most promising was methanol extract. Both polar and non polar extracts were proved to have anti-inflammatory activity, the non polar extract was superior in this respect. The bioactivity of the extracts was ascribed to the presence of flavonoids, sterols and α-tocopherol.

  7. Invasive infection due to Saprochaete capitata in a young patient with hematological malignancies

    Science.gov (United States)

    Parahym, Ana Maria Rabelo de Carvalho; Rolim, Pedro José; da Silva, Carolina Maria; Domingos, Igor de Farias; Gonçalves, Sarah Santos; Leite, Edinalva Pereira; de Morais, Vera Lúcia Lins; Macêdo, Danielle Patrícia Cerqueira; de Lima, Reginaldo Gonçalves; Neves, Rejane Pereira

    2015-01-01

    We report a case of invasive infection due to Saprochaete capitata in a patient with hematological malignancies after chemotherapy treatment and empiric antifungal therapy with caspofungin. Although severely immunocompromised the patient survived been treated with amphotericin B lipid complex associated with voriconazole. PMID:26273269

  8. Electroantennogram and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to putrescine and ammonium bicarbonate lures.

    Science.gov (United States)

    Kendra, Paul E; Montgomery, Wayne S; Epsky, Nancy D; Heath, Robert R

    2009-08-01

    At present, the most effective synthetic lures for pest Anastrepha fruit flies are multicomponent blends that include ammonia and the diamine synergist putrescine (1,4-diaminobutane). Both chemicals generally have been regarded as protein cues that result in female-biased attraction. Using electroantennography (EAG) and flight tunnel bioassays, this study evaluated response of the Caribbean fruit fly, Anastrepha suspensa (Loew) to vapors released from commercial lure formulations of ammonium bicarbonate and putrescine. Over a range of doses tested, EAG response to ammonium bicarbonate was equivalent for both sexes, but female response was significantly greater than male response to putrescine and to a 1:1 mixture of ammonium bicarbonate and putrescine. Amplitude of EAG response to the mixture was approximately equal to the summation of responses to the individual substrates. Using a fixed dose of substrate, EAG measurements from females 1-14 d old indicated that antennal sensitivity to both lures varied according to physiological state of the fly. Peak response to ammonium bicarbonate was recorded from immature females, peak response to putrescine from sexually mature females. In bioassays, more females were captured with ammonium bicarbonate plus putrescine than with ammonium bicarbonate alone. This difference was not observed in males, resulting in a higher female to male ratio in captures with ammonium bicarbonate plus putreseine (3:1) versus ammonium bicarbonate alone (1:1). Results suggest that separate olfactory receptors are involved in detection of the two semiochemicals, and that the putrescine component is primarily responsible for the female-biased attraction.

  9. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  10. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea in native forests and orchards in two counties of the State of Tocantins, Brazil

    Directory of Open Access Journals (Sweden)

    Darcy A. do Bomfim

    2007-01-01

    Full Text Available Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002 com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De Lonchaeidae foram capturadas espécies de três gêneros: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 e Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824. Dezenove espécies de Anastrepha foram coletadas, sendo a maioria dos indivíduos (69,1% de A. obliqua (Macquart, 1835. Não houve diferença significativa (P This paper presents comparative and faunistic analysis of the species of fruit flies captured in McPhail traps (from June to December 2002 baited with 5% corn protein hydrolyzed. Species richness and the patterns of population are compared between forest and orchard environments and between the counties of Palmas and Porto Nacional. A total of 1,748 individuals of Tephritidae belonging to species of three genera were collected: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 and Ceratitis MacLeay, 1829. Species of three genera of Lonchaeidae were also captured: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 and Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824 and nineteen species of the genus Anastrepha were collected. Most of the collected individuals (69.1% belonged to A. obliqua (Macquart, 1935. The average numbers of tephritid individuals in Palmas and native forests were significantly lower than Porto Nacional and orchards, respectively. According to the Shannon diversity index (H' and test t used for comparing the fruit flies fauna among the environments, it was verified that only one comparison showed

  11. Generation and characterization of Brassica rapa ssp. pekinensis – B. oleracea var. capitata monosomic and disomic alien addition lines

    Indian Academy of Sciences (India)

    Ai xia Gu; Shu Xing Shen; Yan Hua Wang; Jian Jun Zhao; Shu Xin Xuan; Xue Ping Chen; Xiao Feng Li; Shuang Xia Luo; Yu Jing Zhao

    2015-09-01

    Five monosomic alien addition lines (MAALs) of Brassica rapa ssp. pekinensis – B. oleracea var. capitata were obtained by hybridization and backcrossing between B. rapa ssp. pekinensis (female parent) and B. oleracea var. capitata. The alien linkage groups were identified using 42 B. oleracea var. capitata linkage group-specific markers as B. oleracea linkage groups C2, C3, C6, C7 and C8. Based on the chromosomal karyotype of root tip cells, these five MAALs added individual chromosomes from B. oleracea var. capitata: chr 1 (the longest), chr 2 or 3, chr 5 (small locus of 25S rDNA), chr 7 (satellite-carrying) and chr 9 (the shortest). Five disomic alien addition lines were then generated by selfing their corresponding MAALs.

  12. Controle químico de Anastrepha fraterculus (Wied. (Diptera: Tephritidae em laboratório Chemical control of Anastrepha fraterculus (Wied. (Diptera: Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Priscila Lang Scoz

    2004-12-01

    Full Text Available O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina, éter piretróide (etofemprox, neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan e naturalyte (spinosad foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas, visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.The South American Fruit Fly, Anastrepha fraterculus is one of the most important pest of temperate fruit crops. The effect of four new inseticide groups to replace organophosphate compounds for A. fraterculus control was evaluated under laboratory conditions (25 ± 3ºC, relative humity of 70 ± 10% and 12:12 L:D. Emamectin benzoate, etofenprox, imidacloprid, spinosad, thiacloprid and thiamethoxan were evaluated to control adults by contact and ingestion and against eggs/larvae inside apple fruits compared with fenthion and thrichlorphon. Emamectin benzoate was not efficient to control adults of A. fraterculus by contact and ingestion. Etofenprox, imidacloprid, spinosad and thiamethoxan were efficient to control adults by contact and ingestion being more toxic by ingestion. No new insecticide controlled eggs/larvae inside apple fruit while organophosphate

  13. 78 FR 6227 - Importation of Fresh Apricots From Continental Spain

    Science.gov (United States)

    2013-01-30

    ... fly (Medfly), Ceratitis capitata Wiedemann, The plum fruit moth, Cydia funebrana (Treitschke), Leaf...: Apiognomonia erythrostoma (Pers.), a brown rot fungus; Ceratitis capitata Wiedemann, the Mediterranean fruit... fruit would be cut open to inspect for the internal pest C. capitata. If any of these quarantine...

  14. 78 FR 50023 - Importation of Fresh Oranges and Tangerines From Egypt Into the United States

    Science.gov (United States)

    2013-08-16

    ... fly (Bactrocera zonata) and Mediterranean fruit fly (Ceratitis capitata) in oranges and tangerines... effective against B. zonata in oranges and tangerines. In addition to B. zonata, Ceratitis capitata (Medfly... for C. capitata and B. zonata; and The oranges and tangerines must be accompanied by a...

  15. 78 FR 1825 - Importation of Fresh Barhi Dates From Israel Into the United States

    Science.gov (United States)

    2013-01-09

    ... treatment evaluation document that describes a new treatment schedule for Ceratitis capitata in Barhi dates... Ceratitis capitata; and The dates must be accompanied by a phytosanitary certificate issued by the national... schedule for C. capitata in Barhi variety dates. In accordance with Sec. 305.3(a)(1), we are...

  16. SYSTEMATIC STUDIES IN TURNERA (TURNERACEAE II. SERIES ANNULARES, CAPITATAE, PAPILLIFERAE AND MICROPHYLLAE ESTUDIOS SISTEMÁTICOS EN TURNERA (TURNERACEAE II. SERIES ANNULARES, CAPITATAE, MICROPHYLEAE Y PAPILLIFERAE

    Directory of Open Access Journals (Sweden)

    María Mercedes Arbo

    2010-11-01

    Full Text Available

    Turnera L. includes around 100 American species and two African ones, arranged in nine series. In this paper, the following four series embracing 21 species are revised: Annulares, Capitatae, Microphyllae and Papilliferae. Six new taxa are described: Thatschbachii, Thatschbachii var. miniata, Tmaracasana,and T.princeps of the seriesCapitatae, Tasymmetrica of the series Microphyllae, and Tcaatingana of the series Papilliferae. The species of these four series share the common features of simple and glandular hairs, generally well-developed floral peduncle, absent pedicel, linear or elliptic prophylls, generally warty or granulate fruit, and a floral tube, appendicular in nature, in that it is the product of the fusion of the lower part of the calyx and corolla, with the staminal filaments adnate only at the base. In the series Annulares,
    Microphyllae and Papilliferae the leaves and young stems are fragrant, the scent being produced by the glandular hairs, and the floral peduncle is shortly adnate to the petiole. Three
    series, Annulares, Capitatae and Microphyllae, have leaves with generally well developed stipules and a disjunct geographical distribution. The series Annulares and Capitatae have nectaries and villous or hirsute styles, while Microphyllae and Papilliferae lack nectaries and their styles are glabrous or somewhat pilose. In some species of Microphyllae the staminal filaments are joined at the base, forming an annular structure 0,05-0,50 mm high. The seeds are peculiar in Annulares, being very short, with a central, prominent and slightly concave chalaza. In the series Capitatae, the flowers are gathered in short, capitate inflorescences, the length of the peduncles being variable or sometimes wanting, and the seeds are obovoid, reticulate or striate. The leaves of Microphyllae are small, with the stipules adnate to the foliar
    base; setiform glandular hairs, similar to those of

  17. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2001-11-15

    Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed. (author)

  18. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Cresoni-Pereira Carla

    2001-01-01

    Full Text Available Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835 wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

  19. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia.

    Science.gov (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma

    2015-11-16

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  20. Fruit flies of the genus Anastrepha (Diptera: Tephritidae) from some localities of Paraguay: new records, checklist, and illustrated key.

    Science.gov (United States)

    Arias, Osmar René; Fariña, Nelson Librado; Lopes, Gleidyane Novaes; Uramoto, Keiko; Zucchi, Roberto Antonio

    2014-01-01

    This study deals with fruit flies of the genus Anastrepha Schiner (Diptera: Tephritidae) collected in McPhail traps in the municipalities of Concepción, Belén, Horqueta, Loreto (state of Concepción) and Santa Rosa (state of Misiones), Paraguay. In total, 17 species were captured, 9 of which are new records for Paraguay. All morphological characters used for species identification are illustrated.

  1. Inter-specific coral chimerism: Genetically distinct multicellular structures associated with tissue loss in Montipora capitata

    Science.gov (United States)

    Work, Thierry M.; Forsman, Zac H.; Szabo, Zoltan; Lewis, Teresa D.; Aeby, Greta S.; Toonen, Robert J.

    2011-01-01

    Montipora white syndrome (MWS) results in tissue-loss that is often lethal to Montipora capitata, a major reef building coral that is abundant and dominant in the Hawai'ian Archipelago. Within some MWS-affected colonies in Kane'ohe Bay, Oahu, Hawai'i, we saw unusual motile multicellular structures within gastrovascular canals (hereafter referred to as invasive gastrovascular multicellular structure-IGMS) that were associated with thinning and fragmentation of the basal body wall. IGMS were in significantly greater densities in coral fragments manifesting tissue-loss compared to paired normal fragments. Mesenterial filaments from these colonies yielded typical M. capitata mitochondrial haplotypes (CO1, CR), while IGMS from the same colony consistently yielded distinct haplotypes previously only found in a different Montipora species (Montipora flabellata). Protein profiles showed consistent differences between paired mesenterial filaments and IGMS from the same colonies as did seven microsatellite loci that also exhibited an excess of alleles per locus inconsistent with a single diploid organism. We hypothesize that IGMS are a parasitic cellular lineage resulting from the chimeric fusion between M. capitata and M. flabellata larvae followed by morphological reabsorption of M. flabellata and subsequent formation of cell-lineage parasites. We term this disease Montiporaiasis. Although intra-specific chimerism is common in colonial animals, this is the first suspected inter-specific example and the first associated with tissue loss.

  2. Inter-specific coral chimerism: genetically distinct multicellular structures associated with tissue loss in Montipora capitata.

    Directory of Open Access Journals (Sweden)

    Thierry M Work

    Full Text Available Montipora white syndrome (MWS results in tissue-loss that is often lethal to Montipora capitata, a major reef building coral that is abundant and dominant in the Hawai'ian Archipelago. Within some MWS-affected colonies in Kane'ohe Bay, Oahu, Hawai'i, we saw unusual motile multicellular structures within gastrovascular canals (hereafter referred to as invasive gastrovascular multicellular structure-IGMS that were associated with thinning and fragmentation of the basal body wall. IGMS were in significantly greater densities in coral fragments manifesting tissue-loss compared to paired normal fragments. Mesenterial filaments from these colonies yielded typical M. capitata mitochondrial haplotypes (CO1, CR, while IGMS from the same colony consistently yielded distinct haplotypes previously only found in a different Montipora species (Montipora flabellata. Protein profiles showed consistent differences between paired mesenterial filaments and IGMS from the same colonies as did seven microsatellite loci that also exhibited an excess of alleles per locus inconsistent with a single diploid organism. We hypothesize that IGMS are a parasitic cellular lineage resulting from the chimeric fusion between M. capitata and M. flabellata larvae followed by morphological reabsorption of M. flabellata and subsequent formation of cell-lineage parasites. We term this disease Montiporaiasis. Although intra-specific chimerism is common in colonial animals, this is the first suspected inter-specific example and the first associated with tissue loss.

  3. Caracterização da fauna de moscas-das-frutas (Diptera: Tephritidae na região de Ponta Grossa, Paraná, Brasil Characterization of the fauna of fruit flies (Diptera: Tephritidae in the region of Ponta Grossa, Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Patricia Elizabeth Husch

    2012-10-01

    Full Text Available Apesar do incentivo e do investimento na produção de frutas no estado do Paraná, pouca informação está disponível sobre as moscas-das-frutas, uma das principais pragas da fruticultura. O presente trabalho teve os objetivos de registrar pela primeira vez a fauna de tefritídeos, na região de Ponta Grossa, e caracterizar a sua comunidade por meio de diferentes índices faunísticos. Adultos de tefritídeos foram coletados por meio de frascos caça-moscas com atrativos alimentares em quatro pomares de agosto a dezembro de 2009. Foi coletado um total de 2.428 tefritídeos distribuídos em sete espécies: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann, Rhagoletis sp. Loew e Hexachaeta sp. Loew. A. fraterculus foi a única espécie comum aos quatro pomares, ocorrendo com frequência acima de 80%. Este é o primeiro registro de A. montei no Paraná. A. fraterculus, A. sororcula e C. capitata apresentaram os maiores índices de frequência, abundância, dominância e constância, sendo, portanto, consideradas espécies predominantes. O maior índice de diversidade (H'=0,4360 ocorreu no pomar 2, diferindo significativamente dos demais pomares (teste t, PIn spite of encouragement and investment in fruit production in the state of Paraná, little information is available on the fruit flies, a major pest in fruit growing. The present study had the objective of recording for the first time the tephritid fauna in the region of Ponta Grossa, and characterize the insect community through different faunal indices. Adult tephritids were collected by means of flapper bottles with food baits in four orchards from August to December 2009. A total of 2,428 tephritids distributed in seven species were collected: Anastrepha fraterculus Wiedemann, Anastrepha montei Lima, Anastrepha pseudoparallela Loew, Anastrepha sororcula Zucchi, Ceratitis capitata Wiedemann

  4. Neem derivatives are not effective as toxic bait for tephritid fruit flies.

    Science.gov (United States)

    Silva, M A; Bezerra-Silva, G C D; Vendramim, J D; Mastrangelo, T; Forim, M R

    2013-08-01

    Neem derivatives have been widely touted as replacements for pesticides. A feasible replacement of synthetic insecticides in the management of fruit flies could be to use neem products in baits. This study evaluated the bioactivity of neem (Azadirachta indica A. Juss) derivatives in bait for adults of Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann). The estimated LCs50 values for A. fraterculus and C. capitata were 7,522 ppm (18.40 ppm of azadirachtin) and 1,368 ppm (3.35 ppm of azadirachtin), respectively, using an aqueous extract of neem seeds in bait after 10 d of experimentation. No significant differences in the mortality of A. fraterculus and C. capitata adults exposed to baits made from different extracts and neem oil were observed after 3 h or 2 or 6 d; differences among the treatments were observed only on the 10th day of the evaluation. We conclude that neem derivatives applied as a bait spray over citrus plants did not demonstrate a toxic effect on A. fraterculus and C. capitata. The reasons for the low efficacy of the neem bait on Tephritid fruit flies are discussed.

  5. Comportamento sexual de Anastrepha sororcula Zucchi (Diptera, Tephritidae em laboratório Sexual behavior of Anastrepha sororcula Zucchi (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Michelli C. N. Facholi-Bendassolli

    2006-09-01

    Full Text Available Anastrepha sororcula Zucchi, 1979, é uma das espécies de mosca-das-frutas mais disseminadas no País, sendo considerada a praga-chave que causa os maiores danos à produção de goiaba (Psidium guajava L., 1758 no Brasil. Em vista da importância desta espécie no complexo de pragas naturais da fruticultura brasileira e, em face à escassez de dados sobre sua biologia e comportamento, este trabalho teve por objetivo obter informações sobre a idade de maturação sexual de A. sororcula em laboratório e descrever seu comportamento reprodutivo. Os machos atingiram a maturidade sexual entre 7 e 18 dias após a emergência, com a maioria dos indivíduos tornando-se sexualmente maduros entre 10 e 13 dias de idade. Exibiram comportamento de sinalização às fêmeas, caracterizado pela distensão da região pleural do abdome, formando uma pequena bolsa de cada lado e, eversão de uma diminuta bolsa membranosa de cutícula retal que circunda a área anal. Durante este processo, os machos realizaram rápidos movimentos de vibração das asas, produzindo sinais audíveis. Uma gotícula foi liberada da região anal durante os movimentos de vibração alar. Após a atração das fêmeas, os machos realizaram uma série de movimentos elaborados de cortejo. As fêmeas alcançaram a maturação sexual entre 14 e 24 dias da emergência, com a maioria tornando-se sexualmente madura aos 19 dias de idade. A exibição diária das atividades sexuais foi confinada quase que exclusivamente ao período das 16:00-17:30h. A. sororcula apresentou um acentuado padrão de protandria.Anastrepha sororcula Zucchi, 1979, is a fruit fly species that can be considered a key pest to the production of guava (Psidium guajava L., 1758, fruit tree which has a wide distribution in Brazil. In view of the importance of this species as a natural pest of Brazilian horticulture and, considering the lack of data about its biology and behavior, the aim of this paper is to obtain

  6. Population fluctuations of Anastrepha striata (Diptera: Tephritidae in commercial guava orchards = Flutuação populacional de Anastrepha striata (Diptera: Tephritidae em pomares comerciais de goiabeira

    Directory of Open Access Journals (Sweden)

    Luciana Baú Trassato

    2015-10-01

    Full Text Available The aim of this research was to evaluate population fluctuations in Anastrepha striata (Diptera: Tephritidae for two commercial guava orchards, cultivars Paluma and Japanesa, in an area of savanna, in Boa Vista, in the State of Roraima, Brazil, and relate these to plant phenology, relative humidity (%, temperature (°C and rainfall in the region, from December 2011 to November 2012. The fruit flies were captured using McPhail traps, with 300 ml of 30% passion fruit juice as food bait, which was renewed every week at the time the flies were collected and taken to the Entomology Laboratory of the Federal University of Roraima to be sorted, counted, separated by sex and placed into a 70% alcohol solution for later identification of the species A. striata. The population fluctuations of the pest were calculated using the MAD index (Fly / Trap / Day and the values for temperature (°C, relative humidity (% and cumulative rainfall (mm. The correlation between the number of females and the climatic variables was calculated by the Pearson correlation coefficient. Using the Student t-test, the contribution of climatic factors to the population of A. striata was verified by multiple regression analysis. The greatest MAD indices for the Paluma cultivar are in April, August and September, and for the Japonesa cultivator, in April, May and July, coinciding with the fruiting period of the guava. Relative humidity has a positive influence on population fluctuations in A. striata. = Objetivou-se com esta pesquisa avaliar a flutuação populacional de Anastrepha striata (Diptera: Tephritidae em dois pomares comerciais de goiabeira das cultivares Paluma e Japonesa, em área de savana, em Boa Vista, Roraima, além de relacioná-la com a fenologia das plantas, umidade relativa do ar (%, temperatura (°C e pluviosidade da região, no período de dezembro de 2011 a novembro de 2012. A captura das moscas-das-frutas foi realizada por meio de armadilhas McPhail, cujo

  7. OHOLO Conference (36th): Multidisciplinary Approaches to Cholinesterase Functions Held in Eilat, Israel on April 6 - 10, 1992.

    Science.gov (United States)

    1992-04-10

    Caenorhabditis elegans. A4. - Bank, Gina - Cloning and Analysis of the Acetylcholinesterase Gene of Ceratitis capitata (medfly) A5.- Bartels, C., T...FOR THE 36th OHOLO CONFERENCE CLONING AND ANALYSIS OF THE ACETYLCHOLINESTERASE GENE OF Ceratitis capitata (inedfly) Gina Banks, I.M.B.B., P.O. B. 1527...Heraklion 711 10, Crete, Greece Sequence data has been determined for the acetylcholinesterase (AChE) gene from Ceratitis capitata (medfly), the

  8. 76 FR 80870 - Notice of Determination of Pest-Free Areas in Mendoza Province, Argentina

    Science.gov (United States)

    2011-12-27

    ... additional areas as pest-free areas for Mediterranean fruit fly (Ceratitis capitata) in Argentina. We... that, in addition to the pest-free status for C. capitata, the Mendoza province of Argentina also...

  9. Irradiation of mangoes as a quarantine treatment

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E.; Enkerlin H, W.; Toledo A, J.; Reyes F, J.; Casimiro G, A

    1991-06-15

    This research project was conducted following guidelines of research protocols for post-harvest treatments developed by the United States Department of Agriculture CUSA. Laboratory bioassays included the irradiation of mangoes infested with third instar larvae of Anastrepha serpentina (Wied), A. ludens (Loew), A. obliqua (Macquart) and Ceratitis capitata (Wied) , at doses from 10 to 250 Gy. Irradiation doses were applied using a Co-60 AECL Model JS-7400 irradiator. The design was chosen to obtain a maximum to minimum ratio equal to, or less than, 1.025. C. capitata was the species most tolerant to irradiation. A dose of 60 Gy applied to third instar fruit fly larvae sterilized this species and prevented emergence of adults of the other three species. A dose of 250 Gy was required to prevent emergence of C. capitata. In fertility tests using emerged adults of A . Iudens, and A. obliqua a dose of 30 Gy gave 45 % and 27 % fertility, respectively. Adults of A. serpentina that emerged, died before reaching sexual maturity. The confirmatory tests, at probit-9 security level, were done at 100 Gy for the three species of Anastrepha and at 150 Gy for C. capitata. The quality of mangoes irradiated up to 1000 Gy was evaluated by chemical, physiological, and sensorial tests. The determination of vitamin C indicated that there was no loss of the nutritive value of the fruit. It also was observed that fruit metabolism was not accelerated since no significant increase in respiration or transpiration was registered and consumers accepted both treated and untreated fruit in the same way. (Author)

  10. Effect of the essential volatile oils isolated from Thymbra capitata (L. Cav. on olive and sunflower oils

    Directory of Open Access Journals (Sweden)

    Pedro, L.

    2003-09-01

    Full Text Available The chemical composition of the volatile constituents of the oils isolated from different parts of Thymbra capitata collected at different developmental stages were analysed by GC and GC/MS. The antioxidant ability of the oils isolated from T. capitata was evaluated determining the peroxide values, on olive and sunflower oils, stored at 60 ºC. These peroxide values were compared with those obtained when BHT, carvacrol and control (without adding antioxidants were used and subjected to the same conditions. The best yield oil was obtained from the whole aerial part of T. capitata collected during the flowering phase. The major component of the oils was carvacrol. Relative high amounts of p-cymene, γ-terpinene and β-caryophyllene were also found. BHT revealed to be the best antioxidant when the olive oil was used. On sunflower oil, the antioxidant ability of BHT was not so evident, being the carvacrol-rich essential oils of T. capitata or carvacrol more important antioxidants.Se analizaron, mediante GC y GC/MS, los componentes volátiles de aceites aislados de las distintas partes de la Thymbra capitata, recogida en diferentes etapas de desarrollo. Se evaluó la actividad antioxidante de estos aceites de la T. capitata, midiendo el índice de peróxidos, en aceites de oliva y girasol, almacenados a 60 ºC. Estos índices de peróxidos se compararon con los obtenidos cuando no se agregó ningún antioxidante (control y cuando se utilizó BHT o carvacrol, en las mismas condiciones de almacenamiento. El mayor rendimiento en aceite se obtuvo de la parte aérea de T. capitata recogida durante la etapa de floración. El componente mayoritario de los aceites fue el carvacrol. También se encontraron, cantidades relativamente elevadas, de p-cimeno, γ-terpineno y β-cariofileno. El mejor antioxidante para el aceite de oliva resultó ser el BHT. En el aceite del girasol, la actividad antioxidante del BHT no fue tan evidente, mientras que el

  11. Grape Juice as a Bait for Anastrepha suspensa (Diptera: Tephritidae) and Zaprionus indianus (Diptera: Drosophilidae).

    Science.gov (United States)

    Epsky, Nancy D; Gill, Micah A; Mangan, Robert L

    2015-08-01

    In field tests conducted in south Florida to test grape juice as a bait for the Caribbean fruit fly, Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps with aqueous grape juice. These experiments included comparisons of grape juice bait with established A. suspensa protein-based baits (ammonium acetate + putrescine lures, or torula yeast) or wine, a bait found previously to be attractive to Z. indianus. Effects of different preservatives (polypropylene glycol, polyethylene glycol, proxel, or sodium tetraborate) and bait age were also tested. Traps with grape juice baits captured more A. suspensa than unbaited traps, but more were captured in traps with grape juice plus preservative baits and the highest numbers were captured in traps containing the established protein-based baits. In contrast, grape juice baits without preservative that were prepared on the day of deployment (0 d) or that were aged for 3-4 d in the laboratory captured the highest numbers of Z. indianus, while solutions that were aged in the laboratory for 6 or 9 d captured fewer. Although these studies found that aqueous grape juice is a poor bait for A. suspensa, we found that actively fermenting aqueous grape juice may be an effective bait for Z. indianus.

  12. Viability of Cabralea canjerana extracts to control the South American fruit fly, Anastrepha fraterculus.

    Science.gov (United States)

    Magrini, Flaviane Eva; Specht, Alexandre; Gaio, Juliano; Girelli, Cristiane Priscila; Migues, Ignacio; Heinzen, Horacio; Sartori, Valdirene Camatti; Cesio, Veronica

    2014-04-10

    Several representatives of Meliaceae contain biologically active compounds that are toxic to insects with few negative effects on the environment and humans. Our study evaluated the activity of ethyl acetate and ethanol extracts from the fruit and seeds of Cabralea canjerana (Vellozo) Mart (Sapindales: Meliaceae) on Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae). Limonoids and triterpenes were detected in fruit and seed extracts. Each extract was added to an artificial diet at three concentrations and tested after 24, 48, and 72 hr of extract application. Ethyl acetate extracts were the most active ones and showed the effect of both dose and time elapses after application on the insects. The highest toxic effect on A. fraterculus adults was from ethyl acetate extracts from fruit, followed by extracts from seeds. These extracts showed antifeedant activities. Extract solutions sprinkled on fruits of Carica papaya (L.) (Brassicales: Caricaceae) caused oviposition repellency and negatively affected the biological development of A. fraterculus. Ethyl acetate extracts highly hampered oviposition, but seed extracts showed lesser oviposition deterrence. The fruit and seed extracts diminished pupal viability. Particularly, the ethyl acetate fruit extract caused malformed adults. The sex ratio was also affected, resulting in female predominance for the fruit extract, while the seed extract showed a dose-dependent effect. Low doses caused male abundance, but at higher concentrations the effect was reversed. These encouraging results showed that the C. canjerana extracts have great potential as new tools to be used in integrated pest management programs to protect fruits against A. fraterculus.

  13. Population Dynamics of Anastrepha ludens (Loew) (Diptera: Tephritidae) on Citrus Areas in Southern Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, V; Barrientos-Lozano, L; Pérez-Castañeda, R; Gaona-García, G; Lara-Villalon, M

    2015-12-01

    An analysis of adult population fluctuation of Anastrepha ludens (Loew) was performed in southern Tamaulipas, Mexico from 2008 to 2011. The aim was to analyze population dynamics of A. ludens and its relationships with climatic factors in the citrus region of Llera, Tamaulipas, Mexico. Population densities were weekly examined to identify variation through the year and study period. Four periods were identified according to population size, amplitude, host availability and season of the year. The correlation between population density vs. rainfall and temperature (average, minimum and maximum) was determined by linear and multiple regression analyses. Simple linear regression analysis showed that population density with minimum temperature and rainfall was the most consistent correlation, whereas in multiple regression analysis, rainfall and maximum temperature showed more consistency. A seasonal association between the availability of commercial host, climatic variation, and population peaks of A. ludens was determined. This study may have practical implications for the design of specific control strategies, monitoring, and infestation prevention based on different phases of the pest through the year. This strategy, along with the area-wide approach implemented by the Plant Protection Service may lead to an optimization of material, financial and human resources.

  14. Sterility and Sexual Competitiveness of Tapachula-7 Anastrepha ludens Males Irradiated at Different Doses.

    Science.gov (United States)

    Orozco-Dávila, Dina; Adriano-Anaya, Maria de Lourdes; Quintero-Fong, Luis; Salvador-Figueroa, Miguel

    2015-01-01

    A genetic sexing strain of Anastrepha ludens (Loew), Tapachula-7, was developed by the Mexican Program Against Fruit Flies to produce and release only males in programs where the sterile insect technique (SIT) is applied. Currently, breeding are found at a massive scale, and it is necessary to determine the optimum irradiation dose that releases sterile males with minimum damage to their sexual competitiveness. Under laboratory and field conditions, we evaluated the effects of gamma irradiation at doses of 0, 20, 40, 60 and 80 Gy on the sexual competitiveness of males, the induction of sterility in wild females and offspring survivorship. The results of the study indicate that irradiation doses have a significant effect on the sexual behavior of males. A reduction of mating capacity was inversely proportional to the irradiation dose of males. It is estimated that a dose of 60 Gy can induce more than 99% sterility in wild females. In all treatments, the degree of offspring fertility was correlated with the irradiation dose of the parents. In conclusion, the results of the study indicate that a dose of 60 Gy can be applied in sterile insect technique release programs. The application of this dose in the new genetic sexing strain of A. ludens is discussed.

  15. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae) em relação a uma fonte protéica

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  16. Augmentative Biological Control Using Parasitoids for Fruit Fly Management in Brazil

    Directory of Open Access Journals (Sweden)

    Flávio R. M. Garcia

    2012-12-01

    Full Text Available The history of classical biological control of fruit flies in Brazil includes two reported attempts in the past 70 years. The first occurred in 1937 when an African species of parasitoid larvae (Tetrastichus giffardianus was introduced to control the Mediterranean fruit fly, Ceratitis capitata and other tephritids. The second occurred in September 1994 when the exotic parasitoid Diachasmimorpha longicaudata, originally from Gainesville, Florida, was introduced by a Brazilian agricultural corporation (EMBRAPA to evaluate the parasitoid’s potential for the biological control of Anastrepha spp. and Ceratitis capitata. Although there are numerous native Brazilian fruit fly parasitoids, mass rearing of these native species is difficult. Thus, D. longicaudata was chosen due to its specificity for the family Tephritidae and its ease of laboratory rearing. In this paper we review the literature on Brazilian fruit fly biological control and suggest that those tactics can be used on a large scale, together creating a biological barrier to the introduction of new fruit fly populations, reducing the source of outbreaks and the risk of species spread, while decreasing the use of insecticides on fruit destined for domestic and foreign markets.

  17. Augmentative Biological Control Using Parasitoids for Fruit Fly Management in Brazil.

    Science.gov (United States)

    Garcia, Flávio R M; Ricalde, Marcelo P

    2012-12-21

    The history of classical biological control of fruit flies in Brazil includes two reported attempts in the past 70 years. The first occurred in 1937 when an African species of parasitoid larvae (Tetrastichus giffardianus) was introduced to control the Mediterranean fruit fly, Ceratitis capitata and other tephritids. The second occurred in September 1994 when the exotic parasitoid Diachasmimorpha longicaudata, originally from Gainesville, Florida, was introduced by a Brazilian agricultural corporation (EMBRAPA) to evaluate the parasitoid's potential for the biological control of Anastrepha spp. and Ceratitis capitata. Although there are numerous native Brazilian fruit fly parasitoids, mass rearing of these native species is difficult. Thus, D. longicaudata was chosen due to its specificity for the family Tephritidae and its ease of laboratory rearing. In this paper we review the literature on Brazilian fruit fly biological control and suggest that those tactics can be used on a large scale, together creating a biological barrier to the introduction of new fruit fly populations, reducing the source of outbreaks and the risk of species spread, while decreasing the use of insecticides on fruit destined for domestic and foreign markets.

  18. Phytotoxic Effects of Cinnamic Acid on Cabbage (Brassica oleracea var. capitata

    Directory of Open Access Journals (Sweden)

    Singh, N. B.

    2013-04-01

    Full Text Available The present study deals with the effects of exogenous application of cinnamic acid (CA on growth and metabolism in growing seedlings of Brassica oleracea var. capitata (cabbage in hydroponic culture. CA was added at 0.5, 1.0 and 1.5 mM concentrations. CA has shown inhibitory effects on shoot and root length, fresh and dry weight of seedlings. CA significantly decreased the photosynthetic pigments, nitrate reductase activity and protein content. Graded concentrations of CA increased lipid peroxidation and sugar content. The increasing concentrations of CA significantly increased the antioxidative enzyme activities viz. superoxide dismutase, catalase, peroxidase against the oxidative stress caused by CA.

  19. Disinfestation of mangoes by irradiation; Desinfestacion de mango por irradiacion

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E

    1992-05-15

    The mango is a fruit-bearing very important in the mexican economy. Mexico is between the first positions of the world like country producing with an average export volume of 40,000 annual tons in the last years. For this reason it was decided to make this investigation, which was developed according to the investigation protocols proposed by the Agricultural Research Service of the USA (ARS - US DOA). The objective is to account with the technical and scientific necessary bases to propose to the US DOA the regulation of the irradiation process like quarantine treatment for Mexican export mango. The goals are: to determine in the laboratory the minimum dose (Dmin.) to inhibit the emergency of adults of the species of the fruit flies of more importance for Mexico. To confirm the least radiation dose Dmin. for quarantine treatment based on the safety value Probit-9. To evaluate the mango quality irradiated to 2 and 2.5 times the Dmin. proposal for quarantine treatment. According to information provided by the General Direction of Vegetable Sanity, it was determined that the fly species of the fruit of more economic importance for Mexico are of the genus Anastrepha ludens, Anastrepha serpentina, Anastrepha obliqua and Ceratitis capitata. (Author)

  20. 柳州市2000~2008年检疫性实蝇监测调查报告

    Institute of Scientific and Technical Information of China (English)

    谢晓雁; 贝荣良; 殷积奎

    2010-01-01

    2000~2008 年在柳州市以及各县区范围内建立检疫性实蝇监测体系,对柳州市及周边县区实蝇的发生进行监测调查,通过对调查结果的统计分析,确定柳州市检疫性实蝇发生的优势种和高发期,监测调查结果表明:柳州市未发现地中海实蝇Ceratitis capitata(Widedmann)、墨西哥实蝇Anastrepha ludens、加勒比实蝇A.suspensa 等我国过去没有报道的实蝇种类.

  1. Temporal Diversity and Abundance Patterns of Parasitoids of Fruit-Infesting Tephritidae (Diptera) in the Argentinean Yungas: Implications for Biological Control.

    Science.gov (United States)

    Schliserman, Pablo; Aluja, Martin; Rull, Juan; Ovruski, Sergio M

    2016-10-01

    A 4-yr study was done to analyze seasonal patterns underlying host plant-fruit fly-parasitoid interactions in a secondary forest in the Argentinean Yunga and its importance for the implementation of conservation and augmentative biological control. Larval-pupal hymenopteran parasitoids associated with all host plants and fruit fly species were identified and the seasonal occurrence of fruit, infestation levels, parasitism percentage, and relative parasitoid abundance were determined. Three fruit fly species in two genera were found in association with surveyed plants, two of which (Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann)) are of major economic importance. Infestation levels were strongly influenced by environmental factors and peak fruit availability. Five fruit fly parasitoid species were recovered from fly pupae, four braconid species, and one figitid. Time windows for fruit fly population growth were pinpointed. Based on results, the present analysis proposes an effective fruit fly biological control strategy tailored for the northwestern Argentinean citrus-producing area.

  2. Fruit flies (Diptera, Tephritidae) and their associations with native host plants in a remnant area of the highly endangered Atlantic Rain Forest in the State of Espírito Santo, Brazil.

    Science.gov (United States)

    Uramoto, K; Martins, D S; Zucchi, R A

    2008-10-01

    The results presented in this paper refer to a host survey, lasting approximately three and a half years (February 2003-July 2006), undertaken in the Vale do Rio Doce Natural Reserve, a remnant area of the highly endangered Atlantic Rain Forest located in Linhares County, State of Espírito Santo, Brazil. A total of 330 fruit samples were collected from native plants, representing 248 species and 51 plant families. Myrtaceae was the most diverse family with 54 sampled species. Twenty-eight plant species, from ten families, are hosts of ten Anastrepha species and of Ceratitis capitata (Wiedemann). Among 33 associations between host plants and fruit flies, 20 constitute new records, including the records of host plants for A. fumipennis Lima and A. nascimentoi Zucchi. The findings were discussed in the light of their implications for rain forest conservation efforts and the study of evolutionary relationships between fruit flies and their hosts.

  3. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua (Diptera;Tephritidae)

    Science.gov (United States)

    Lures based on odors released by hydrolyzed protein were assessed for their attractiveness to Anastrepha obliqua and A. suspensa at three locations in Puerto Rico in August through October 2009. Lures compared included ammonium acetate combined with putrescine, hydrolyzed corn protein (Nulure) with ...

  4. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico

    Science.gov (United States)

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua and A. suspensa at four sites in Guánica, Puerto Rico; one forest fragment in Ponce, Puerto Rico; in a commercial mango orchard in Guayanilla, PR; and an experimental carambola orcha...

  5. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico.

    Science.gov (United States)

    Jenkins, David A; Kendra, Paul E; Van Bloem, Skip; Whitmire, Stefanie; Mizell, Russ; Goenaga, Ricardo

    2013-04-01

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua (Macquart) and Anastrepha suspensa (Loew) in two orchards with hosts of these flies (mango, Mangifera indica L., and carambola, Averrhoa carambola L.), as well as in forest fragments bordering these orchards. Contour maps were constructed to measure population distributions in and around orchards. Our results indicate that Anastrepha populations are focused around host fruit in both space and time, that traps do not draw fruit flies away from hosts, even when placed within 15 m of the host, and that lures continue to function for 6 mo in the field. The contour mapping analyses reveal that populations of fruit flies are focused around ovipositional hosts. Although the trapping system does not have a very long effective sampling range, it is ideal, when used in combination with contour analyses, for assessing fine-scale (on the order of meters) population distributions, including identifying resources around which fly populations are focused or, conversely, assessing the effectiveness of management tools. The results are discussed as they pertain to monitoring and detecting Anastrepha spp. with the McPhail-type trap and ammonium acetate and putrescine baiting system and the dispersal of these flies within Puerto Rico.

  6. Response of Anastrepha suspensa (Diptera: Tepritidae) to white and brown cane, coconut, date, date jaggery and panela sugar solutions with varying degrees of fermentation

    Science.gov (United States)

    We measured the EAG response of Anastrepha suspensa (Loew), the Caribbean fruit fly to six different sugars (white and brown cane, coconut, date, date jaggery and panela sugars). Wild and lab female flies of different physiological states (immature and mature) were tested in dry crystals and 10% su...

  7. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The IT...

  8. Metallothionein induction and antioxidative responses in the estuarine polychaeta Capitella capitata (Capitellidae)

    Institute of Scientific and Technical Information of China (English)

    Suriya J; S Bharathiraja; V Sekar; R Rajasekaran

    2012-01-01

    Objective: To evaluate the antioxidant response induced by copper (Cu) exposure inCapitella capitata. The capacity of Cu bioaccumulation was also evaluated through the metal quantification. Methods: Worms were exposed to different concentrations of Cu 50, 100, and 200 μg/L for 7, 14 and 21 days respectively. In all the assays, control groups were run in parallel, employing only saline water (10%). The concentrations of Cu in the digested acidic solutions of worms were determined by using the inductively coupled plasma-Optical emission spectrophotometry. The total protein content and other anti oxidant enzyme activities such as superoxide dismutase (SOD), catalase (CAT) and glutathione S-transferase (GST) were recorded for the experiment period. Results: Bioaccumulation of Cu metals in polychaetes was increased parallel to exposure time. A peak concentration (197.30±12.32 μg/g) of metallothioneins (MTs) was registered at 14th day of 100 μg/L group compared to control group (37.29 μg/g). Catalase activities (CAT) in Cu treated-worms were increased significantly (P<0.05) after 7 and 14 days of exposure. The concentration of Cu had significant (P<0.05) influences on the activity of SOD. The same physiological activity was recorded in GST evaluation. Conclusions: These results of biochemical variables in C. capitata suggest us a useful model species for monitoring of environmental disturbance by heavy metal pollution. Antioxidant defenses were confirmed as sensitive biomarkers for metal stress in polychaete worms.

  9. Bleached Porites compressa and Montipora capitata corals catabolize δ13C-enriched lipids

    Science.gov (United States)

    Grottoli, Andréa G.; Rodrigues, Lisa J.

    2011-09-01

    Corals rely on stored energy reserves (i.e., lipids, carbohydrates, and protein) to survive bleaching events. To better understand the physiological implications of coral bleaching on lipid catabolism and/or synthesis, we measured the δ13C of coral total lipids (δ13CTL) in experimentally bleached (treatment) and non-bleached (control) Porites compressa and Montipora capitata corals immediately after bleaching and after 1.5 and 4 months of recovery on the reef. Overall δ13CTL values in treatment corals were significantly lower than in control corals because of a 1.9 and 3.4‰ decrease in δ13CTL immediately after bleaching in P. compressa and M. capitata, respectively. The decrease in δ13CTL coincided with decreases in total lipid concentration, indicating that corals catabolized δ13C-enriched lipids. Since storage lipids are primarily depleted during bleaching, we hypothesize that they are isotopically enriched relative to other lipid classes. This work further helps clarify our understanding of changes to coral metabolism and biogeochemistry when bleached and helps elucidate how lipid classes may influence recovery from bleaching and ultimately coral survival.

  10. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications.

    Science.gov (United States)

    Aluja, M; Arredondo, J; Díaz-Fleischer, F; Birke, A; Rull, J; Niogret, J; Epsky, N

    2014-02-01

    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the main tephritid pests of this crop in Mexico. In a field experiment, bagged fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time, adult eclosion, and F1 adult longevity, fecundity, and fertility were recorded, ranking cultivars in terms of susceptibility to fly attack and development. We also compared the volatile profile in selected resistant and susceptible cultivars in search of possible correlations. In a second experiment, clutch size for A. ludens was determined in each cultivar. Infestation rates, developmental time, and F1 demographic parameters varied sharply among cultivars and between fly species for bagged fruit. Cultivars 'Vishi,' '74-82,' and 'Brooks' were most susceptible to A. ludens infestation while "Tommy,' 'Sensation,' and 'Ataulfo "niño"' (parthenocarpic fruit) were most susceptible to A. obliqua infestation. 'Edward,' 'Kent,' 'Brooks late,' 'Palmer, and 'Ataulfo' exhibited tolerance to attack of both fly species. Fruit of susceptible and resistant cultivars exhibited unique volatile profiles. Fly development and F1 adult demographic parameters varied significantly among cultivars. A. ludens females laid larger clutches in larger and harder fruit. We highlight the important role of Ataulfo "niño" as pest reservoir if fruit is left unharvested on trees. We discuss the possible use of highly resistant cultivars as trap crops or egg sinks.

  11. The temporal pattern of mating behavior of the fruit fly, Anastrepha zenildae in the laboratory.

    Science.gov (United States)

    Almeida, Lucia M de; Araújo, Arrilton; Mendes, Norma H D; Souza, João M G A de; Menezes, Alexandre A L

    2011-01-01

    The state of Rio Grande do Norte is an important fruit-producing and exporting area in northeastern Brazil. The success of this industry depends on fruit fly population control, especially in fly-free exporting zones. However, many fruits are not exported because of quarantine restrictions imposed by importing countries. A survey in the state has detected a considerable increase of the fruit fly, Anastrepha zenildae Zucchi (Diptera: Tephritidae), probably a result of the introduction of irrigated guava orchards that make fruit available all year. Knowledge of the sexual behavior of Tephritidae has great importance to pest control programs, particularly those that employ the Sterile Insect Technique. In order to characterize the reproductive behavior of A. zenildae, 32 individuals (16 males; 16 females) in each of six generations were submitted to an artificial 12:12 L:D cycle (750: < 1 lux, lights on 07:00-19:00) and observed over their lifetimes. The courtship and copulation occurred in leks and the episodes varied with the time of day, courtship being most frequent between Zeitgeber time (ZT) 3 and ZT 7, peaking at ZT 5-6. Copulations occurred between ZT 2 and ZT 8, with a higher frequency between ZT 5-7 and a peak at ZT 6. Mean duration was 0.28 ± 0.03 min/male (range: 5-163 min). Males in the leks attempted to copulate mainly between ZT 3 and ZT 7 with a peak at ZT 6, and males outside leks peaked at ZT 7. The different timing of sexual behaviors among related sympatric species, including A. zenildae, may contribute to species isolation.

  12. Assessment of differences between X and gamma rays in order to validate a new generation of irradiators for insect sterilization

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago; Walder, Julio M.M., E-mail: piaui@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil); Parker, Andrew G.; Jessup, Andrew; Orozco-Davila, Dina; Islam, Amirul; Dammalage, Thilakasiri, E-mail: A.Jessup@iaea.or [Joint FAO/IAEA-UN A-2444, Seibersdorf (Austria). Insect Pest Control Subprogramme; Pereira, Rui, E-mail: R.Cardoso-Pereira@iaea.or [Joint FAO/IAEA-UN, Vienna (Austria). Insect Pest Control Subprogramme

    2009-07-01

    Recent fears of terrorism provoked an increase in delays and denials of transboundary shipments of radioisotopes. This represents a serious constraint to sterile insect technique (SIT) programs around the world as they rely on the use of ionizing energy from radioisotopes for insect sterilization. In order to validate a novel Xray irradiator, a series of studies on Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) were carried out, comparing the relative biological effectiveness (RBE) between X-rays and traditional gamma radiation from {sup 60}Co. Male C. capitata pupae and pupae of both sexes of A. fraterculus, both 24 to 48 h before adult emergence, were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Estimated mean doses of 91.2 Gy of X and 124.9 Gy of gamma radiation induced 99% sterility in C. capitata males. Irradiated A. fraterculus were 99% sterile at about 40-60 Gy for both radiation treatments. Standard quality control parameters were not significantly affected by the two types of radiation. There were no significant differences between X and gamma radiation regarding mating indices. The RBE did not differ significantly between the tested X and gamma radiation, and X-rays are as biologically effective for SIT purposes as gamma rays are. This work confirms the suitability of this new generation of X-ray irradiators for pest control programs in UN Member States. (author)

  13. Field trials of solid triple lure (trimedlure, methyl eugenol, raspberry ketone, and DDVP) dispensers for detection and male annihilation of Ceratitis capitata (Wiedemann), Bactrocera dorsalis (Hendel) and Bactrocera cucurbit

    Science.gov (United States)

    Solid Mallet TMR (trimedlure [TML], methyl eugenol [ME], raspberry ketone [RK]) wafers and Mallet CMR (ceralure, ME, RK, benzyl acetate) wafers impregnated with DDVP insecticide were evaluated in traps as potential detection and male annihilation devices. Comparisons were made with 1) liquid lure a...

  14. Plastid transformation in cabbage (Brassica oleracea L. var. capitata L.) by the biolistic process.

    Science.gov (United States)

    Tseng, Menq-Jiau; Yang, Ming-Te; Chu, Wan-Ru; Liu, Cheng-Wei

    2014-01-01

    Cabbage (Brassica oleracea L. var. capitata L.) is one of the most important vegetable crops grown worldwide. Scientists are using biotechnology in addition to traditional breeding methods to develop new cabbage varieties with desirable traits. Recent biotechnological advances in chloroplast transformation technology have opened new avenues for crop improvement. In 2007, we developed a stable plastid transformation system for cabbage and reported the successful transformation of the cry1Ab gene into the cabbage chloroplast genome. This chapter describes the methods for cabbage transformation using biolistic procedures. The following sections are included in this protocol: preparation of donor materials, coating gold particles with DNA, biolistic bombardment, as well as the regeneration and selection of transplastomic cabbage plants. The establishment of a plastid transformation system for cabbage offers new possibilities for introducing new agronomic and horticultural traits into Brassica crops.

  15. Origanum vulgare and Thymbra capitata Essential Oils from Spain: Determination of Aromatic Profile and Bioactivities.

    Science.gov (United States)

    Carrasco, Alejandro; Perez, Enrique; Cutillas, Ana-Belen; Martinez-Gutierrez, Ramiro; Tomas, Virginia; Tudela, Jose

    2016-01-01

    Oregano (Thymbra capitata and Origanum vulgare) essential oils (EOs), cultivated and extracted in the South-East of Spain, were analysed by GC/MS to determine their composition. (E)-β-Caryophyllene (0.5-4.9%), thymol (0.2-5.8%), p-cymene (3.8-8.2%), γ-terpinene (2.1-10.7%) and carvacrol (58.7-77.4%) were determined as the main molecules. This characterisation was completed with enantioselective gas chromatography, where (-)-(E)-β-caryophyllene, (+)-a- pinene and (+)-β-pinene were determined as the main enantiomers. Antioxidant activity was evaluated positively by several methods, accounting for activity against free radicals and reducing power. Important inhibitory activity on lipoxygenase (LOX) and acetylcholinesterase (AChE) was observed supporting potential anti-inflammatory, anti-Alzheimer and insecticidal activities, mainly due to carvacrol. These properties support the potential use of oregano EOs as natural cosmetic and natural pharmaceutical ingredients.

  16. Experimental and DFT studies on the antioxidant activity of a C-glycoside from Rhynchosia capitata

    Science.gov (United States)

    Praveena, R.; Sadasivam, K.; Kumaresan, R.; Deepha, V.; Sivakumar, Raman

    2013-02-01

    Rhynchosia capitata (=Glycine capitata) Heyne ex roth, was found to possess polyphenolics including flavonoids, which acts as potential antioxidant. The study of ethanolic extract of roots and leaves reveals that the leaves possess high polyphenolics including flavonoids than roots. This was also confirmed by DPPH radical scavenging activity. Leaf powder of the plant was extracted with different solvents by soxhlet apparatus in the order of increasing polarity. The DPPH scavenging activity of methanol fraction was found to be high compared to the crude extract and other fractions. Nitric oxide scavenging activity was dominant in chloroform fraction compared to methanol fraction. Presence of flavonoids especially vitexin, a C-glycoside in methanol and chloroform fractions were confirmed by high pressure thin layer chromatography (HPTLC) analysis. The structural and molecular characteristics of naturally occurring flavonoid, vitexin was investigated in gas phase using density functional theory (DFT) approach with B3LYP/6-311G(d,p) level of theory. Analysis of bond dissociation enthalpy (BDE) reveals that the OH site that requires minimum energy for dissociation is 4'-OH from B-ring. To explore the radical scavenging activity of vitexin, the adiabatic ionization potential, electron affinity, hardness, softness, electronegativity and electrophilic index properties were computed and interpreted. The nonvalidity of Koopman's theorem has been verified by the computation of Eo and Ev energy magnitudes. Interestingly, from BDE calculations it was observed that BDE for 4'-OH, 5-OH and 7-OH are comparatively low for vitexin than its aglycone apigenin and this may be due to the presence of C-8 glucoside in vitexin. To substantiate this, plot of frontier molecular orbital and spin density distribution analysis for neutral and the corresponding radical species for the compound vitexin have been presented.

  17. Effect of multiple endogenous biological factors on the response of the tephritids Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) to multilure traps baited with BioLure or NuLure in mango orchards.

    Science.gov (United States)

    Arredondo, José; Flores, Salvador; Montoya, Pablo; Díaz-Fleischer, Francisco

    2014-06-01

    The physiological state of an insect is likely the most important endogenous factor influencing resource-oriented behavior, and it varies considerably among individuals. Trials were conducted in mango orchards to study the effect of multiple endogenous biological factors on the response of two fly species, Anastrepha ludens (Loew) and Anastrepha obliqua Maquart (Diptera: Tephritidae), to BioLure and NuLure baits. The biological factors of the two fly species that were tested were the following: 1) fertility status-sterile (irradiated) and fertile flies; 2) two types of diets (only sugar and a 3:1 mixture of sugar and hydrolyzed yeast protein; 3) sex, and 4) two sexual maturity conditions (2-4- and 15-18-d-old flies, representing immature and sexually mature flies, respectively, and 2-4-d-old flies treated with methoprene as an artificially induced sexually state male condition). The laboratory-treated flies were released into three different mango orchards. The trials were conducted in four blocks per orchard using eight traps in each block (50:50 BioLure: NuLure). The traps were replaced every 2 d during the 12-d period and the flies per trap per day values were calculated. More protein-fed, fertile, female, immature, and A. obliqua flies were caught compared with the other flies tested. In addition, the traps baited with NuLure attracted more flies than those baited with BioLure. Interaction analyses indicated that the type of bait and the sexual maturity status were the most important factors affecting the responses of the flies. Our study demonstrated that lures attract only a small segment of the fly population, those that have a specific hunger for amino acids-immature flies-and those that were protein-starved. The implications for improved trapping system designs are discussed.

  18. Germination ecology of Rhynchosia capitata: an emerging summer weed in Asia Ecologia da germinação de Rhynchosia capitata: planta daninha emergente durante o verão na Ásia

    Directory of Open Access Journals (Sweden)

    H.H. Ali

    2013-06-01

    Full Text Available Rhynchosia capitata is becoming an increasing problem in summer crops, such as cotton, soybean, pearl millet and mungbean in many Asian countries. Laboratory and greenhouse studies have been conducted to determine the effects of several environmental factors on seed germination patterns and seedling emergence of R. capitata. We investigated whether the diverse ecological factors such as temperature, light, salinity, moisture stress, pH, and soil depth affected germination and seedling emergence of R. capitata. Germination increased as temperature increased from 25ºC and significantly reduced at 45ºC. Presence or absence of light did not influence germination. Germination of R. capitata was sensitive to increased salt and moisture stress, as well as to seed burial depth. Only 48% of seeds germinated at 150 mM salt concentration compared to 100% in control (distilled water. Similarly, 15% of seeds germinated at an osmotic potential of ‑0.8 MPa compared to 88% at ‑0.2 MPa. The optimum pH for seed germination of R. capitata was 7 (98% germination, but the seeds also germinated at lower level of pH 5 (85% and at higher level of pH 10 (75%. In seed burial trial, maximum seedling emergence of 93% occurred at 2 cm depth, and seedling did not emerge from a depth of 12 cm. The high germination ability of R. capitata under a wide range of ecological factors suggests that this species is likely to be the one to cause more problems in a near future, if not managed appropriately.A Rhynchosia capitata vem se tornando um problema crescente para culturas de verão como algodão, soja, milheto e feijão-mungo em muitos países asiáticos. Foram feitos estudos de laboratório e estufa para determinar os efeitos de vários fatores ambientais sobre os padrões de germinação das sementes e emergência das plântulas de R. capitata. Diversos fatores ecológicos, tais como, temperatura, luz, salinidade, estresse hídrico, pH e profundidade do solo foram

  19. Evaluating the quality of the Mexican fruit-fly, Anastrepha ludens, as host for the parasitoid Melittobia digitata

    Directory of Open Access Journals (Sweden)

    J.M. González

    2013-08-01

    Full Text Available We investigated the presence of Melittobia digitata (Hymenoptera: Eulophidae and its associations with its natural hosts in Veracruz, Mexico. The parasitoid was confirmed to be present and found to attack prepupae of Trypoxylon and Sceliphron (Hymenoptera: Crabronidae and Sphecidae, respectively mud daubers as well as pupae of the Mexican fruit fly Anastrepha ludens (Diptera: Tephritidae. Since A. ludens is a very important pest of citrus and mango in Mexico and Central America, we evaluated, in laboratory experiments, the quality of A. ludens as host of M. digitata comparing the development of the parasitoid in another unrelated fly species (Sarcophaga [Neobellieria] bullata (Diptera: Sarcophagidae and in mud dauber wasps (Trypoxylon sp. and Sceliphron sp.. The Mexican fruit fly appears to be a good-quality host for M. digitata, and the results are discussed in the context of their possible interest as a natural enemy of A. ludens.

  20. Establishment of a colony of Anastrepha ludens (Diptera: Tephritidae) under relaxed mass-rearing conditions in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Orozco-Davila, Dina; Hernandez, Refugio; Solis, Eduardo; Quintero, J. Luis; Dominguez, Julio, E-mail: dorozco1@prodigy.net.m [United States Department of Agriculture, Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural, and Veterinary Entomology; Sigma Space Corporation, MD(United States); Programa Moscamed Moscafrut-Desarrollo de Metodos, Chiapas (Mexico)

    2006-07-01

    Several studies have suggested that maintaining a line of insects under laboratory conditions reduces their biological attributes. With this principle in mind, the mass production of Anastrepha ludens originating from a colony raised under relaxed rearing conditions was evaluated over a period of three years. The results of the evaluation indicated that insects kept under these conditions reached their larval maturity in 10 days, and attained a greater weight, which has a direct influence on pupal quality. In adult cages having a fly density of 70,000 individuals, there was a lower level of stress which favored fecundity. Fertility was apparently not affected by the cage density. These results suggest that keeping a production line under relaxed conditions optimizes insect production and promotes higher quality. (author)

  1. Selection by mating competitiveness improves the performance of Anastrepha ludens males of the genetic sexing strain Tapachula-7.

    Science.gov (United States)

    Quintero-Fong, L; Toledo, J; Ruiz, L; Rendón, P; Orozco-Dávila, D; Cruz, L; Liedo, P

    2016-10-01

    The sexual performance of Anastrepha ludens males of the Tapachula-7 genetic sexing strain, produced via selection based on mating success, was compared with that of males produced without selection in competition with wild males. Mating competition, development time, survival, mass-rearing quality parameters and pheromone production were compared. The results showed that selection based on mating competitiveness significantly improved the sexual performance of offspring. Development time, survival of larvae, pupae and adults, and weights of larvae and pupae increased with each selection cycle. Differences in the relative quantity of the pheromone compounds (Z)-3-nonenol and anastrephin were observed when comparing the parental males with the F4 and wild males. The implications of this colony management method on the sterile insect technique are discussed.

  2. Evaluation of Food Lures for Capture and Monitoring of Anastrepha fraterculus (Diptera: Tephritidae) on Temperate Fruit Trees.

    Science.gov (United States)

    Rosa, J M da; Arioli, C J; Santos, J P Dos; Menezes-Netto, A C; Botton, M

    2017-03-16

    The Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is the main pest of fruit trees grown in temperate climates in the southern region of Brazil. The objective of this work was to evaluate the efficiency of the major commercial food lures used in Brazil for trapping and monitoring of A. fraterculus in plum, pear, and feijoa orchards. The assessed lures were hydrolyzed proteins of animal origin (CeraTrap) and plant origin (BioAnastrepha), torula yeast + borax (Torula), and grape juice. Response variables included the rate of adult capture (flies per trap per day, FTD) and the percentage of females captured. We also evaluated the number of times the weekly capture rate exceeded the traditional threshold of 0.5 FTD for each lure. Traps baited with grape juice, currently used for monitoring A. fraterculus in Southern Brazil, captured fewer adults and a lower percentage of females compared with the other lures. CeraTrap trapped a greater number of A. fraterculus adults and, in some cases, a lower percentage of females compared with the other lures in pears. Traps baited with CeraTrap had greater capture rates (FTD), particularly during the stages of fruit maturation and harvest, and even in years with low population density of A. fraterculus, thus demonstrating greater sensitivity in the detection of this pest. These results show that, in order to detect and monitor the presence of A. fraterculus in plum, feijoa, and pear crops, protein-based lures are superior to grape juice, especially the animal protein CeraTrap.

  3. MONITORAMENTO POPULACIONAL DE Anastrepha spp. (DIPTERA: TEPHRITIDAE EM POMAR DE MANGA (Mangifera indica L. NO MUNICÍPIO DE JABOTICABAL – SP

    Directory of Open Access Journals (Sweden)

    Wilson Carlos Pazini

    2013-05-01

    Full Text Available The population monitoring of agricultural pests is an important tool to select the best control methodto be employed in a determined culture. Thus, the objective of this research was analyze the population fluctuation of Anastrepha spp. correlated with the mango tree phenology and the meteorological elements, temperature, relative humidity and pluviometric precipitation. The study was conducted between Mach 2009 to August 2010 in Jaboticabal, SP. For Anastrepha spp. monitoring, we randomly installed five yellow stick traps in an experimental orchard composed by a collection of mango varieties. These traps were replaced every fifteen days and carried to the Laboratory of Ecological Selectivity of the Department of Plant Protection (FCAV/UNESP to evaluate the sampled specimens. The meteorological data were recorded at the FCAV/UNESP Meteorological Station, located approximately 200 m from the study area. The results showed that the greater and more consistent Anastrepha spp. population density is between the spring and summer seasons, particularly related to the mature fruits. A weak positive correlation is observed between maximum temperature (°C and relative humitidy (% when compared with the Anastrepha spp. population density. There is moderate positive correlation between minimum and medium temperatures (°C and accumuluted pluviometric precipitation (mm when compared with the said agricultural pest.O monitoramento populacional de insetos considerados pragas agrícolas constitui uma importante ferramenta para a escolha do melhor método de controle a ser empregado em determinada cultura. Desta forma, o objetivo desta pesquisa foi analisar a flutuação populacional de Anastrepha spp. correlacionada com a fenologia da mangueira e com os elementos meteorológicos, temperatura, umidade relativa e precipitação pluviométrica. O estudo foi desenvolvido no período entre março de 2009 a agosto de 2010 no município de Jaboticabal, SP. Para o

  4. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  5. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    OpenAIRE

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava,Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez,Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca,Jeniffer K.; Zapata,Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and t...

  6. Discovery and Understanding of the Ambient-Condition Degradation of Doped Barium Cerate Proton-Conducting Perovskite Oxide in Solid Oxide Fuel Cells

    NARCIS (Netherlands)

    Yan, N.; Zeng, Y.; Shalchi, B; Wang, W.; Gao, T; Rothenberg, G.; Luo, J.L.

    2015-01-01

    Proton-conducting perovskite oxides such as doped barium cerate and barium zirconate are promising electrolytes for solid oxide fuel cells (SOFCs). Here we report that the typical high performance proton conductor, BaZr0.1Ce0.7Y0.2O3±δ (BZCY), is prone to physical, chemical and thereby electrochemic

  7. Respuesta de ecotipos de Stylosanthes capitata a dosis de cobre en solución nutritiva

    Directory of Open Access Journals (Sweden)

    Pizarro Esteban A.

    1986-09-01

    Full Text Available La solución nutritiva de Arnon y Hoagland se modificó a 1/10 para simular las condiciones de acidez y fertilidad del suelo de las sabanas bien drenadas isohipertérmicas de los Llanos Orientales de Colombia. Se usaron seis concentraciones de cobre (0,0.05, 0.1, 0.2, 0.4 Y 0.8 ppm. la solución nutritiva se renovó cada 15 días y se aplicaron nitrógeno (14 ppm/semana e hierro (1 ppm, 3/semana. La cantidad de materia seca producida por los ecotipos y el cultivar Capica en los tratamientos de 0.2, 0.4 Y0.8 ppm Cu, fue relativamente te nula. La producción de materia seca de la parte aérea, raíz y total de la planta fue diferente en los ecotipos de S capitata. Así mismo hubo diferencias significativas en la concentración, absorción y translocación del cobre por lo ecotipos y el cultivar Capica. El requerimiento diferencial de cobre, manifestado en la producción de materia seca en la parte aérea en el nivel 0.05 ppr por los ecotipos CIAT 1693 y 1728 por el cultivar Capica (CIAT 102801, se define como el resultado de las relaciones evolutivas de cada ecotipo con el nivel de cobre disponible en la solución del suelo.In the greenhouse ecotypes of Stylosanthes capitata were cultivated to observe their behavior under different copper concentrations. A nutrient solution based on Arnon and Hoagland's (1/10 was used to simulate the acidity and the fertility of well drained savannas of the Eastern Planes of Colombia. Six concentrations of copper were used (O, 0.05, 0.1, 0.2, 0.4 and 0.8 ppm with rewal of the nutrient solution every 15 days, and applications of nitrogen (14 ppm/week and iron (1 ppm, three times/week. The dry matter quantity produced by the ecotypes and the Capica cultivar under treatments of 0.2, 0.4 and 0.8 ppm Cu, relatively nill. A differential behavior of Stylosanthes capitata ecotypes responses to applied copper was observed in relation to dry matter production in aerial, part, root and total plant. So, there were significant

  8. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae em relação a uma fonte protéica

    Directory of Open Access Journals (Sweden)

    Carla Cresoni-Pereira

    2006-03-01

    Full Text Available The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835 females are able to associate a compound (quinine sulphate - QS not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a diet containing agar and QS. When the nutritional value of the diets was adequate, the females did not show any preference for the diet with or without QS. With respect to the agar diet and the agar + QS diet, females previously fed on a nutritive diet containing QS preferred the diet containing QS, indicating an association between the compound and the nutritional value of the diet. The importance of this behavioral strategy is discussed.O objetivo do presente estudo foi determinar se fêmeas adultas selvagens de Anastrepha obliqua (Macquart, 1835 são capazes de associar um composto (sulfato de quinino-SQ não-relacionado à sua dieta habitual com um alimento rico em proteínas. Primeiro, as fêmeas foram alimentadas com dietas à base de lêvedo de cerveja e sacarose contendo ou não SQ. Os grupos foram então colocados para escolher entre sua dieta original e dietas com ou sem SQ, dependendo do tratamento prévio, e entre uma dieta à base de agar somente e outra à base de agar e SQ. Quando o valor nutricional das dietas era adequado, as fêmeas não mostraram nenhuma preferência para a dieta com ou sem SQ. Em relação às dietas de agar e agar+SQ, fêmeas previamente alimentadas com uma dieta nutritiva contendo SQ preferiram a dieta contendo SQ, indicando uma associação entre o composto e o valor nutricional da dieta. A importância desta estratégia comportamental é discutida.

  9. 78 FR 23208 - Importation of Fresh Oranges and Tangerines From Egypt Into the United States

    Science.gov (United States)

    2013-04-18

    ... fly (Ceratitis capitata); however, imports of oranges from Egypt were suspended in July 2002 due to... with 7 CFR part 305 for C. capitata and B. zonata; and The oranges and tangerines must be accompanied... has undergone treatment for C. capitata and B. zonata in accordance with 7 CFR part 305, with...

  10. 77 FR 22465 - Importation of Fresh Pitaya Fruit From Central America Into the Continental United States

    Science.gov (United States)

    2012-04-16

    ..., Ceratitis capitata, Dysmicoccus neobrevipes, and Planococcus minor. (a) Monitoring and oversight. (1) The... crop itself, must not shade the crop during the day. No C. capitata or A. ludens host plants may be.... capitata and A. ludens--(1) Pest- free places of production. (i) Beginning at least 1 year before...

  11. Impact of copper toxicity on stone-head cabbage (Brassica oleracea var. capitata) in hydroponics.

    Science.gov (United States)

    Ali, Sajid; Shahbaz, Muhammad; Shahzad, Ahmad Naeem; Khan, Hafiz Azhar Ali; Anees, Moazzam; Haider, Muhammad Saleem; Fatima, Ammara

    2015-01-01

    Arable soils are frequently subjected to contamination with copper as the consequence of imbalanced fertilization with manure and organic fertilizers and/or extensive use of copper-containing fungicides. In the present study, the exposure of stone-head cabbage (Brassica oleracea var. capitata) to elevated Cu(2+) levels resulted in leaf chlorosis and lesser biomass yield at ≥2 µ M. Root nitrate content was not statistically affected by Cu(2+) levels, although it was substantially decreased at ≥5 µ M Cu(2+) in the shoot. The decrease in nitrate contents can be related to lower nitrate uptake rates because of growth inhibition by Cu-toxicity. Shoot sulfate content increased strongly at ≥2 µ M Cu(2+) indicating an increase in demand for sulfur under Cu stress. Furthermore, at ≥2 µM concentration, concentration of water-soluble non-protein thiol increased markedly in the roots and to a smaller level in the shoot. When exposed to elevated concentrations of Cu(2+) the improved sulfate and water-soluble non-protein thiols need further studies for the evaluation of their direct relation with the synthesis of metal-chelating compounds (i.e., phytochelatins).

  12. Impact of copper toxicity on stone-head cabbage (Brassica oleracea var. capitata in hydroponics

    Directory of Open Access Journals (Sweden)

    Sajid Ali

    2015-08-01

    Full Text Available Arable soils are frequently subjected to contamination with copper as the consequence of imbalanced fertilization with manure and organic fertilizers and/or extensive use of copper-containing fungicides. In the present study, the exposure of stone-head cabbage (Brassica oleracea var. capitata to elevated Cu2+ levels resulted in leaf chlorosis and lesser biomass yield at ≥2 µ M. Root nitrate content was not statistically affected by Cu2+ levels, although it was substantially decreased at ≥5 µ M Cu2+ in the shoot. The decrease in nitrate contents can be related to lower nitrate uptake rates because of growth inhibition by Cu-toxicity. Shoot sulfate content increased strongly at ≥2 µ M Cu2+ indicating an increase in demand for sulfur under Cu stress. Furthermore, at ≥2 µM concentration, concentration of water-soluble non-protein thiol increased markedly in the roots and to a smaller level in the shoot. When exposed to elevated concentrations of Cu2+ the improved sulfate and water-soluble non-protein thiols need further studies for the evaluation of their direct relation with the synthesis of metal-chelating compounds (i.e., phytochelatins.

  13. The nitrogen and nitrate economy of butterhead lettuce (Lactuca sativa var capitata L).

    Science.gov (United States)

    Broadley, Martin R; Seginer, Ido; Burns, Amanda; Escobar-Gutiérrez, Abraham J; Burns, Ian G; White, Philip J

    2003-09-01

    Quantifying and simulating the relationships between crop growth, total-nitrogen (total-N) and nitrate-N (NO3--N) concentration can improve crop nutritional husbandry. In this study, the relationship between shoot relative growth rate (RGR) and shoot total-N, organic-N and NO3--N concentration of hydroponically-grown lettuce (Lactuca sativa var. capitata L. cv. Kennedy) was described and simulated. Plants were grown hydroponically for up to 74 d. Nitrogen was supplied throughout (control; T1), or removed at 35 d (T2) and 54 d (T3), respectively, after sowing. The organic-N and NO3--N concentration declined in the shoots of control plants with growth, until commercial maturity approached when organic-N and NO3--N concentration increased. There were sub-linear relationships between both total-N and organic-N concentration, and shoot RGR, in the N-limited treatments, i.e. shoot RGR approached an asymptote at high shoot N concentration. The proportional effects of total-N and organic-N concentration on shoot RGR were independent of plant age. A dynamic simulation model ('Nicolet'), derived previously under different conditions, was used to simulate the growth, dry matter content, organic-N, and NO3--N concentration of lettuce grown under the extreme N-stress conditions experienced by the plants. In view of the largely successful fitting of the model to experimental data, the model was used to interpret the results. Suggestions for model improvement are made.

  14. Formation and structural organization of the egg-sperm bundle of the scleractinian coral Montipora capitata

    Science.gov (United States)

    Padilla-Gamiño, J. L.; Weatherby, T. M.; Waller, R. G.; Gates, R. D.

    2011-06-01

    The majority of scleractinian corals are hermaphrodites that broadcast spawn their gametes separately or packaged as egg-sperm bundles during spawning events that are timed to the lunar cycle. The egg-sperm bundle is an efficient way of transporting gametes to the ocean surface where fertilization takes place, while minimizing sperm dilution and maximizing the opportunity for gamete encounters during a spawning event. To date, there are few studies that focus on the formation and structure of egg-sperm bundle. This study explores formation, ultrastructure, and longevity of the egg-sperm bundle in Montipora capitata, a major reef building coral in Hawai`i. Our results show that the egg-sperm bundle is formed by a mucus layer secreted by the oocytes. The sperm package is located at the center of each bundle, possibly reflecting the development of male and female gametes in different mesenteries. Once the egg-sperm bundle has reached the ocean surface, it breaks open within 10-35 min, depending on the environmental conditions (i.e., wind, water turbulence). Although the bundle has an ephemeral life span, the formation of an egg-sperm bundle is a fundamental part of the reproductive process that could be strongly influenced by climate change and deterioration of water quality (due to anthropogenic effects) and thus requires further investigation.

  15. First register of fruit flies (Diptera: Tephritidae in star fruit in Teresina, Altos and Parnaiba, state of Piaui, Brazil/ Primeiro registro de moscas-das-frutas (Diptera: Tephritidae em carambola nos municípios de Teresina, Altos e Parnaíba no estado do Piauí

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo Soares

    2007-08-01

    Full Text Available The present work aims to register the occurrence of the fruit flies associated to star fruit (Averrhoa carambola L. in three counties of the state of Piaui, as well as to determine the frequency and the index of infestation of these insects. The fruits had been collected during the months of August and September 2005, and had been placed in plastic trays with sterilized soil, stored in metal cages, and left in environmental temperature at the laboratory. Until emergency, the adults had been kept in bottles with alcohol 70% and later identified in the species level. The biggest index of infestation (flies/fruit of C. capitata has occurred in the county of Altos (3.66, followed by Teresina and Parnaiba that had presented index of infestation of 2.18 and 0.016, respectively. C. capitata was the most frequent species in all the counties, presenting frequencies of 100%, 96.5%, and 100% in Teresina, Altos and Parnaiba, respectively. Ceratitis capitata is registered for the first time in star fruit in Teresina, Altos and Parnaiba, state of the Piaui. Anastrepha fraterculus is registered for the first time in the county of Altos. A. fraterculus and C. capitata occur simultaneously in star fruits.O presente trabalho visou conhecer as espécies de moscas-das-frutas associadas à carambola (Averrhoa carambola L. em três municípios do Estado do Piauí, bem como determinar a freqüência e o índice de infestação desses insetos. Os frutos foram coletados durante os meses de agosto e setembro de 2005, colocados em bandejas plásticas com solo esterilizado, armazenados em gaiolas metálicas e deixados em temperatura ambiente no laboratório. Até a emergência dos adultos, estes foram acondicionados em frascos contendo álcool 70% e posteriormente identificados em nível de espécie. O maior índice de infestação (moscas/fruto de C. capitata ocorreu no município de Altos (3,66, seguido pelos municípios de Teresina e Parnaíba que apresentaram

  16. Incidence of fruit flies on coffee and citrus and quarantine treatment of citrus fruits by gamma radiation; Incidencia de moscas-das-frutas em cafe e citros e tratamento quarentenario de frutos citricos com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Raga, Adalton

    1996-12-31

    The objective of this study was to evaluate the fruit fly infestation on coffee and citrus, and also to determine gamma radiation doses for immature stages of Ceratitis capitata and Anastrepha fraterculus, in order to satisfy quarantine regulations. Coffee arabica varieties Icatu Vermelho, Catuai Amarelo, Mundo Novo and Sarchimor showed the highest infestation indices (pupa/berry): 0.53; 0,41; 0.33 and 0.36. respectively Icatu Vermelho and Catuai Vermelho showed the highest values of pupa/berry weight (0.49 and 0.39, respectively), and Robusta (Coffea canephora) presented the lowest index (0.01). The following fruit flies were found in coffee berries: C. capitata (76.6%) Anastrepha spp. (7.4%) and Lonchaeidae (17.0%). In area near coffee plantation, fruit fly infestation indices in sweet oranges were of 4.77 larvae/kg and 0.55 larva/fruit. The infestation indices for sweet orange, collected from five regions of the State of Sao Paulo ranged from 0.73 to 7.60 pupa/kg and 0.12 to 1.27 pupa/fruit. The same species of fruit flies were found in oranges. In the case of C. capitata eggs with 24-48 hours old, 20 Gy prevented completely adult emergence (artificial diet and orange). No emergence of adult occurred when C. capitata larvae of third instar were irradiated at 20 Gy in their rearing medium. But at 25 Gy, the number of adults was reduced by 54% and 97% from larval infestation in oranges and grapefruit, respectively. A dose of 30 Gy was required to prevent medfly emergence from third instar larvae in grapefruit. A dose of 15 Gy was required for third instar, to prevent adult emergence of A. fraterculus. No adult emerged from C third instar, to prevent adult emergence of A. fraterculus. No adult emerged from C capitata pre-pupa irradiated at 30 Gy. One medfly adult emerged from pupa (3-4 days after pupating) irradiated at 120 Gy. At the same dose, sixteen A. fraterculus adults emergency from irradiated pupa with 5-6 days old. (author) 85 refs., 2 figs., 13 tabs.

  17. Nitrate reductase activity in cabbage (Brassica oleracae var. capitata seedlings affected by the different nitrogen fertilizer forms

    Directory of Open Access Journals (Sweden)

    Metin Turan

    2013-12-01

    Full Text Available The effect of different nitrogen fertilizer (potassium nitrate, ammonium nitrate, ammonium sulphate, urea and farmyard manure on nitrate reductase activity in cabbage (Brassica oleracea var. capitata seedlings were studied. pH of the plant growth niedia was higher in the nitrate fertilizer treatment than the ammonium and other fertilizer forms. NO3--N application increased NRA in plant, but NH4+-N decreased NRA in plant. Harvesting date and different fertilizer doses increased NRA while NH4+-N decreased plant nitrate uptake. There was a significant relationship between NRA and fertilizer types.

  18. Fungi that cause rot in bunches of grape identified in adult fruit flies (Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ruben Machota Jr

    2013-06-01

    Full Text Available Anastrepha fraterculus (Wiedemann is the main species of frugivorous insect that damages berries of table grape (Vitis vinifera L. in Southern Brazil. This study was conducted to isolate and identify the fungi associated with bunch rot present in the body of adults of A. fraterculus collected in a commercial vineyard. From January to February 2011, adults of A. fraterculus were collected from a commercial vineyard of green grapes using adapted McPhail traps. In laboratory, flies bodies were divided into four parts (head, legs, wings, and ovipositor in Petri dishes with PDA medium to evaluate microorganisms associated. Six adult females of A. fraterculus collected in the field were also analyzed in a scanning electron microscope (SEM to identify spores of fungi. Phytopathogenic microorganisms were found in all sectioned parts. Fungal spores were recorded adhered to the body of adult females of A. fraterculus. The main species of fungi found in the body parts of A. fraterculus were Cladosporium spp. (20.2% of the obtained colonies, Botrytis cinerea Pers. (12.9%, Colletotrichum spp. (10.1%, Penicillium spp. (10.1%, Fusarium spp. (7.7%, followed by Rhizopus spp., Trichoderma spp. and Aspergillus spp., suggesting that the insect can serve as a mechanical vector of spores increasing damage in the vineyards.

  19. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  20. Hole diameters in pet bottles used for fruit fly capture

    Directory of Open Access Journals (Sweden)

    Maurico Paulo Batistella Pasini

    2015-05-01

    Full Text Available Two experiments were conducted during the period from 31 January to 6 March 2012 in Santa Maria, Rio Grande do Sul State, Brazil to determine the efficiency of different hole diameters in PET trap bottles on pests in guava and persimmon orchards. In a randomised block design in a factorial scheme, we assessed the average number adults of Anastrepha fraterculus, Ceratitis capitata (Diptera: Tephitidae and Zaprionus indianus (Diptera: Drosophilidae infruits thatemerged in two situations (in the plant and on the soil; we also assessed the number of captured adults in trap bottlesunder two conditions, different hole diameters and different days after placement of the attractive solution. Smaller diameter sizescaptured more A. fraterculus, C. capitata and Z. indianusadults. The 1.0 cm diameter was the most efficient hole size in reducing the adult emergence of Tephritidae to Z. indianus, whereas the smallest diameter hole sizes, 0.6 and 0.8 cm, showed the highest efficiencies in controlling adult emergence in persimmon fruit and guava fruit.

  1. Biological Control of Tephritid Fruit Flies in Argentina: Historical Review, Current Status, and Future Trends for Developing a Parasitoid Mass-Release Program

    Directory of Open Access Journals (Sweden)

    Sergio M. Ovruski

    2012-09-01

    Full Text Available In Argentina there are two tephritid fruit fly species of major economic and quarantine importance: the exotic Ceratitis capitata that originated from Southeast Africa and the native Anastrepha fraterculus. In recent years, the use of fruit fly parasitoids as biocontrol agents has received renewed attention. This increasing interest has recently led to the establishment of a program for the mass rearing of five million Diachasmimorpha longicaudata parasitoids per week in the BioPlanta San Juan facility, San Juan, Argentina. The first augmentative releases of D. longicaudata in Argentina are currently occurring on commercial fig crops in rural areas of San Juan as part of an integrated fruit fly management program on an area-wide basis. In this context, research is ongoing to assess the suitability of indigenous parasitoid species for successful mass rearing on larvae of either C. capitata or A. fraterculus. The purpose of this article is to provide a historical overview of the biological control of the fruit fly in Argentina, report on the strategies currently used in Argentina, present information on native parasitoids as potential biocontrol agents, and discuss the establishment of a long-term fruit fly biological control program, including augmentative and conservation modalities, in Argentina’s various fruit growing regions.

  2. Tissue loss (white syndrome) in the coral Montipora capitata is a dynamic disease with multiple host responses and potential causes

    Science.gov (United States)

    Work, Thierry M.; Russell, Robin; Aeby, Greta S.

    2012-01-01

    Tissue loss diseases or white syndromes (WS) are some of the most important coral diseases because they result in significant colony mortality and morbidity, threatening dominant Acroporidae in the Caribbean and Pacific. The causes of WS remain elusive in part because few have examined affected corals at the cellular level. We studied the cellular changes associated with WS over time in a dominant Hawaiian coral, Montipora capitata, and showed that: (i) WS has rapidly progressing (acute) phases mainly associated with ciliates or slowly progressing (chronic) phases mainly associated with helminths or chimeric parasites; (ii) these phases interchanged and waxed and waned; (iii) WS could be a systemic disease associated with chimeric parasitism or a localized disease associated with helminths or ciliates; (iv) corals responded to ciliates mainly with necrosis and to helminths or chimeric parasites with wound repair; (v) mixed infections were uncommon; and (vi) other than cyanobacteria, prokaryotes associated with cell death were not seen. Recognizing potential agents associated with disease at the cellular level and the host response to those agents offers a logical deductive rationale to further explore the role of such agents in the pathogenesis of WS in M. capitata and helps explain manifestation of gross lesions. This approach has broad applicability to the study of the pathogenesis of coral diseases in the field and under experimental settings.

  3. Highly differentiated populations of the freshwater diatom Sellaphora capitata suggest limited dispersal and opportunities for allopatric speciation.

    Science.gov (United States)

    Evans, Katharine M; Chepurnov, Victor A; Sluiman, Hans J; Thomas, Sindu J; Spears, Bryan M; Mann, David G

    2009-08-01

    The diversities and distributions of diatoms are much more complex than was ever imagined. To understand the underlying mechanisms, research must focus on evolutionary processes occurring at a population level and employ sufficiently informative molecular markers. Using ten microsatellites and ITS rDNA sequence data, we investigated the genetic structure of populations of the benthic freshwater diatom Sellaphora capitata (until 2004 a cryptic entity within the S. pupula agg. species complex). This is the first time that microsatellites have been used to investigate the genetic structure of any freshwater or benthic microalga. Using an integrated approach (morphology, DNA barcoding and specificity of the microsatellite primers), we verified the identity of 70 S. capitata isolates obtained from lakes in the UK, Belgium and Australia. Standardized F'(ST) values were very high (>0.4) and in Bayesian analyses, isolates clustered according to their country of origin, with limited evidence of admixture. However, selected isolates from all countries were sexually compatible, a result consistent with limited ITS divergence. Considering the apparent absence of desiccation-resistant resting stages in most diatoms, we conclude that such levels of differentiation are likely to be a consequence of limited dispersal. With restricted dispersal, previously unacknowledged opportunities for allopatric speciation exist, which may help to explain the huge extant diversity of diatoms.

  4. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  5. PARASITOIDES (HYMENOPTERA DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO SEMIÁRIDO DO ESTADO DO CEARÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    ELTON LUCIO ARAUJO

    2015-09-01

    Full Text Available RESUMO As moscas-das-frutas (Diptera: Tephritidae, Anastrepha spp. e Ceratitis capitata(Wiedemann, são importantes pragas da fruticultura no Brasil. Para desenvolver um sistema sustentável de manejo integrado para este grupo de pragas, é fundamental conhecer os parasitoides (Hymenoptera que podem regular as populações destes tefritídeos. Portanto, o objetivo deste estudo foi relatar a diversidade, a distribuição geográfica e as relações tritróficas dos himenópteros parasitoides de moscas-das-frutas, na região do Baixo Jaguaribe, no semiárido do Estado do Ceará, Brasil. Foram realizadas coletas de frutos em sete municípios da região, no período de maio de 2010 amaio de 2013. Os frutos foram levados para o laboratório, onde foram contados, pesados, colocados em bandejas plásticas com vermiculita e fechadas com tecido voile. Após sete dias, a vermiculita foi peneirada para a obtenção dos pupários das moscas-das-frutas que, em seguida, foram contados e acondicionados em placas de Petri, onde permaneceram até a emergência dos adultos (moscas e/ou parasitoides. Quatro espécies de parasitoides foram encontradas: Doryctobracon areolatus(Szépligeti, Opius bellus Gahan, Utetes anastrephae(Viereck (Braconidae e Tetrastichus giffardianusSilvestri (Eulophidae,sendo o mais frequente e com maior distribuição geográfica na região, D. areolatus. Doryctobracon areolatusfoi mais comum em associação com espécies de Anastrepha - A. sororcula Zucchi, A. obliqua (Mcquart e A. zenildae Zucchi, em frutos nativos e com C. capitata em frutos exóticos. Tetrastichus giffardianus foi obtido apenas em associação com C. capitata, em frutos nativos e exóticos. Estas informações podem servir de base para inserção de parasitoides em futuros programas de manejo integrado de moscas-das-frutas, nas condições do Semiárido brasileiro.

  6. Assessment of Injuries Caused by Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) on the Incidence of Bunch Rot Diseases in Table Grape.

    Science.gov (United States)

    Machota, R; Bortoli, L C; Cavalcanti, F R; Botton, M; Grützmacher, A D

    2016-08-01

    Anastrepha fraterculus (Wied.) is the main insect pest of table grapes (Vitis vinifera) in the Southern Region of Brazil. In this study, we aimed to investigate the effect of fruit puncturing by adult females and larval infestation by A. fraterculus on the occurrence of bunch rot disease in the grape (cultivar "Itália") by evaluating grapes (a) punctured for oviposition by females of A. fraterculus, sterilized in laboratory with novaluron (40 mg L(-1)) and further spray-inoculated separately with Botrytis cinerea (1 × 10(6) conidia mL(-1)), Glomerella cingulata (1 × 10(6) conidia mL(-1)), and bacteria and yeast that cause sour rot (1 × 10(5) cells mL(-1)), (b) grapes punctured for oviposition by non-sterilized females with pathogen spraying, (c) grapes with mechanical wounds and pathogen spraying, (d) grapes with no wounds and with pathogen spraying, (e) grapes punctured for oviposition by A. fraterculus chemically sterilized in laboratory with novaluron, (f) grapes punctured for oviposition by A. fraterculus non-sterilized in laboratory with novaluron, (g) grapes with mechanical wounds, and (h) grapes with no sterilization or pathogen spraying. Our data indicated that the mechanical and oviposition wounds caused by A. fraterculus increased the percentage of grapes infected by B. cinerea, G. cingulata, and microorganisms of acid rot. The grape puncturing by A. fraterculus and the mechanical wound allows the penetration of B. cinerea and microorganisms leading to acid rot. We conclude that the fruit fly A. fraterculus may facilitate phytopathogens penetration leading to bunch rots in the table grape Itália.

  7. Limits to the host range of the highly polyphagous tephritid fruit fly Anastrepha ludens in its natural habitat.

    Science.gov (United States)

    Birke, A; Acosta, E; Aluja, M

    2015-12-01

    Anastepha ludens (Diptera: Tephritidae) is a highly polyphagous fruit fly that is able to develop in a wide range of hosts. Understanding the limits of this pest's host range could provide valuable information for pest management and plant breeding for pest resistance. Previous studies have shown that guavas (Psidium guajava (Myrtaceae) L.), are not attacked under natural conditions by A. ludens. To understand this phenomenon, guavas were exposed to natural infestation by A. ludens and to other fruit fly species that infest guavas in nature (Anastrepha striata Schiner, Anastepha fraterculus (Wiedemann), Anastepha obliqua (Macquart)). Once the susceptible phenological stage of guavas was determined, fruit infestation levels were compared between A. ludens and A. striata. Choice and non-choice tests were performed under field-cage conditions. Under field conditions, guavas were susceptible to A. striata and A. fraterculus attack all the way from when fruit was undeveloped to when fruit began to ripen. No infestation by A. ludens was recorded under natural conditions. Similar results were obtained when forced exposures were performed, indicating that unripe guavas were preferred by A. striata over ripe fruit, and that infestation rates were higher at early fruit maturity stages. Under forced oviposition conditions, A. ludens larvae were unable to develop in unripe guavas but did so in fully ripe fruit. However, A. ludens fitness parameters were dramatically affected, exhibiting reduced survival and reduced pupal weight compared to conspecifics that developed in a natural host, grapefruit. We confirm that P. guajava should not be treated as a natural host of this pestiferous species, and suggest that both behavioral aspects and the fact that larvae are unable to adequately develop in this fruit, indeed represent clear limits to A. ludens's broad host range.

  8. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  9. Fatores climáticos na dinâmica populacional de Anastrepha spp. (diptera: tephritidae e de Scymnus spp. (coleoptera: coccinellidae em um pomar experimental de goiaba (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Ricardo Aparecido Calore

    2013-03-01

    Full Text Available Este trabalho objetivou caracterizar a dinâmica populacional de Anastrepha spp. e de Scymnus spp. em pomar experimental semiorgânico de goiaba (Psidium guajava L., em Pindorama-SP, na Agência Paulista de Tecnologia dos Agronegócios (APTA e correlacioná-la com fatores meteorológicos. Para o levantamento da dinâmica populacional, os espécimes foram monitorados com armadilhas adesivas amarelas (25 cm x 9,5 cm, trocadas a cada 15 dias, no período de um ano (entre junho de 2009 e junho de 2010. Os insetos foram avaliados e quantificados no Laboratório de Seletividade Ecológica da UNESP-FCAV em Jaboticabal-SP. Observou-se a ocorrência de Anastrepha spp. e Scymnus spp. durante todo o período de amostragem. Com base nos resultados obtidos e nas condições de desenvolvimento do presente trabalho, foram possíveis as seguintes conclusões: a Ocorre aumento na densidade populacional de Anastrepha spp. com o aumento das temperaturas mínima, média e máxima; b Os picos populacionais de Anastrepha spp. ocorrem de janeiro a março e coincidem com o período de disponibilidade de frutos maduros no pomar de goiaba; c Constatam-se as maiores ocorrências do predador Scymnus spp. no período de setembro a dezembro, e as menores ocorrências, em fevereiro e março; d As precipitações não interferem na dinâmica populacional de Anastrepha spp. e de Scymnus spp..

  10. Faunistic analysis of Anastrepha spp. (Diptera: Tephritidae) on a guava orchard under organic management in the municipality of Una, Bahia, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Vivian S.; Santos, Mirian S; Souza Filho, Zilton A.; Silva, Janisete G. [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Araujo, Elton L. [Universidade Federal Rural do Semi-Arido, Mossoro, RN (Brazil). Dept. de Ciencias Vegetais

    2009-01-15

    We carried out a study to characterize fruit fly populations on an organic guava orchard (Psidium guajava cv. Paluma) in the municipality of Una, southern region of the state of Bahia, Brazil, using faunistic analysis of the adult fruit f y specimens captured in McPhail traps from January 2004 through March 2007. A total of 22,673 specimens of Anastrepha (15,306 females and 7,367 males) were captured. Thirteen species of Anastrepha were recorded. A. fraterculus and A. obliqua were the more frequent and dominant species, accounting for 90.1% of all females captured in the traps. A. fraterculus was the predominant species (more frequent, constant and dominant). The high value of the Simpson index (0.62) and the low values of Shannon-Wiener (0.83) and equitability (0.49) indices indicated the dominance and high frequency of A. fraterculus and A. obliqua on the guava orchard despite the presence of other fruit species as potential hosts of fruit flies. (author)

  11. Antioxidant and Antiproliferative Activities of the Essential Oils from Thymbra capitata and Thymus Species Grown in Portugal

    Directory of Open Access Journals (Sweden)

    Maria Graça Miguel

    2015-01-01

    Full Text Available The antioxidant and antiproliferative activities of the essential oils from Thymbra capitata and Thymus species grown in Portugal were evaluated. Thymbra and Thymus essential oils were grouped into two clusters: Cluster I in which carvacrol, thymol, p-cymene, α-terpineol, and γ-terpinene dominated and Cluster II in which thymol and carvacrol were absent and the main constituent was linalool. The ability for scavenging ABTS•+ and peroxyl free radicals as well as for preventing the growth of THP-1 leukemia cells was better in essential oils with the highest contents of thymol and carvacrol. These results show the importance of these two terpene-phenolic compounds as antioxidants and cytotoxic agents against THP-1 cells.

  12. Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae Eficácia de Metarhizium anisopliae a estágios imaturos de Anastrepha fraterculus a mosca das frutas (Diptera : Tephritidae

    Directory of Open Access Journals (Sweden)

    Ricardo Henry Rodrigues Destéfano

    2005-03-01

    Full Text Available The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae, against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS and non-autoclaved (NAS soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10 for AS and 2.52 x 10(10 for NAS. The lethal concentration (LC50, expressed as conidia concentration, was 8.44 x 10(9 conidia/g of soil (S for AS and 12.23 x 10(9 conidia/g of soil for NAS.O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae, contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS e não autoclavado (NAS de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10 para AS e 2,52 x 10(10 para NAS. A concentração letal (LC50 expressa pela concentração de conídios, foi 8,44 x 10(9 conídios/g de solo para AS e 12,2 x 10(9 conídios/g/S para NAS.

  13. Capture of Anastrepha sororcula (Diptera: Tephritidae in McPhail and Jackson traps with food attractant and virgin adults

    Directory of Open Access Journals (Sweden)

    Christiane dos Santos Felix

    2009-02-01

    Full Text Available This stady evaluated the capture of A. sororcula in the traps baited with the conspecific virgin adults and food attractant in two orchards. The first was the orchard of the Universidade Federal da Grande Dourados (OUFGD and the second, the orchard of the Sindicato Rural de Dourados (OSRD. The capture of A. sororcula in McPhail and Jackson traps was carried out using the corn hydrolysed protein (CHP, control (no flies, virgin males (5, 10 and 15, five virgin females and five virgin couples. The average number of the flies caught in the traps with the corn hydrolysed protein was signifícantly higher than all the other treatments. There was no significant capture of A. sororcula females in the traps baited with the conspecific virgin males, females or the couples.As moscas-das-frutas constituem um grupo de pragas responsáveis por grandes prejuízos econômicos à fruticultura mundial. Anastrepha sororcula Zucchi, é a principal espécie de tefritídeo que ataca a goiaba em Mato Grosso do Sul. O objetivo desta pesquisa foi avaliar a captura de adultos de A. sororcula em armadilhas com atrativo alimentar e adultos virgens, em dois ambientes. Os bioensaios iniciaram-se com a criação de A. sororcula no Laboratório de Insetos Frugívoros da Universidade Federal da Grande Dourados (UFGD. As pesquisas de campo foram desenvolvidas nos pomares da UFGD e do Sindicato Rural de Dourados (SRD-MS. A captura de adultos de A. sororcula em armadilhas McPhail e Jackson foi avaliada para os tratamentos: proteína hidrolisada de milho, testemunha (sem moscas, machos virgens (5, 10 e 15, 5 fêmeas virgens e 5 casais. O número médio de indivíduos capturados nas armadilhas com proteína foi significativamente maior que nos demais tratamentos. O número médio de adultos de A. sororcula, capturado com o tratamento proteína no SRD foi significativamente superior ao do pomar da UFGD. Não ocorreu captura significativa de fêmeas de A. sororcula nas armadilhas com

  14. Butia capitata (Mart. Becc. lamina anatomy as a tool for taxonomic distinction from B. odorata (Barb. Rodr. Noblick comb. nov (Arecaceae

    Directory of Open Access Journals (Sweden)

    BRUNO F. SANT'ANNA-SANTOS

    2015-03-01

    Full Text Available The distinction between Butia capitata and B. odorata is based only on a few morphological characteristics, therefore there is a need for additional studies for supporting the separation of the species. As lamina anatomy characteristics are relevant in circumscribing Arecaceae taxa, this work aimed to describe B. capitata lamina anatomy and compare it with B. odorata. Samples from the middle portion of the pinnae were collected and processed in accordance with standard plant anatomy techniques. The epidermis is uniseriate and composed of a thick cuticle and epicuticular waxes into like hooked filaments. The subsidiary cells that arch over the guard cells are located at the hypodermis. The mesophyll is isobilateral and compact. The vascular bundles are collateral with a sclerenchymatic sheath extension that reaches the hypodermis. The stegmata cells have spherical and druse-like silica bodies. The midrib faces the adaxial surface with a thick fibrous layer surrounding the vascular bundles adjacent to the chlorenchyma. The stratified expansion tissue is on the abaxial surface, within the boundary between the mesophyll and midrib. Raphides are only found in B. capitata. Small bundles of the midrib fully surround the fibrous cylinder only in B. odorata. These characteristics are diagnostic and useful for supporting the proposed separation.

  15. Butia capitata (Mart.) Becc. lamina anatomy as a tool for taxonomic distinction from B. odorata (Barb. Rodr.) Noblick comb. nov (Arecaceae).

    Science.gov (United States)

    Sant'anna-Santos, Bruno F; Carvalho Júnior, Wellington G O; Amaral, Vanessa B

    2015-03-01

    The distinction between Butia capitata and B. odorata is based only on a few morphological characteristics, therefore there is a need for additional studies for supporting the separation of the species. As lamina anatomy characteristics are relevant in circumscribing Arecaceae taxa, this work aimed to describe B. capitata lamina anatomy and compare it with B. odorata. Samples from the middle portion of the pinnae were collected and processed in accordance with standard plant anatomy techniques. The epidermis is uniseriate and composed of a thick cuticle and epicuticular waxes into like hooked filaments. The subsidiary cells that arch over the guard cells are located at the hypodermis. The mesophyll is isobilateral and compact. The vascular bundles are collateral with a sclerenchymatic sheath extension that reaches the hypodermis. The stegmata cells have spherical and druse-like silica bodies. The midrib faces the adaxial surface with a thick fibrous layer surrounding the vascular bundles adjacent to the chlorenchyma. The stratified expansion tissue is on the abaxial surface, within the boundary between the mesophyll and midrib. Raphides are only found in B. capitata. Small bundles of the midrib fully surround the fibrous cylinder only in B. odorata. These characteristics are diagnostic and useful for supporting the proposed separation.

  16. 7 CFR 319.56-31 - Peppers from Spain.

    Science.gov (United States)

    2010-01-01

    ... October 1, and continuing through April 30, MAFF must set and maintain Mediterranean fruit fly (Ceratitis capitata) (Medfly) traps baited with trimedlure inside the greenhouses at a rate of four traps per...

  17. Dicty_cDB: Contig-U11429-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 1 Ceratitis capitata... 40 2e-04 4 ( DJ001102 ) Prediction method of carcinogenicity of chemicals. 46 0.001 ...2 ( DD492826 ) Prediction method of carcinogenicity of chemicals. 46 0.001 2 ( AA

  18. Himenópteros parasitóides de larvas de Anastrepha spp. em frutos de carambola (Averrhoa carambola L. na região de Divinópolis, Minas Gerais, Brasil Himenopterous parasitoids of Anastrepha spp. larvae, in star fruit (Averrhoa carambola L. In divinópolis region, Minas Gerais, Brasil

    Directory of Open Access Journals (Sweden)

    Cláudio Gonçalves Silva

    2003-12-01

    Full Text Available Este trabalho foi conduzido com o objetivo de conhecer os parasitóides de moscas-da-fruta na região de Divinópolis-MG. As pupas foram obtidas pelo método de flutuação, sendo individualizadas em cápsulas de gelatina até a emergência das moscas adultas ou de seus parasitóides. A prevalência total de parasitismo foi de 14,8%. Trichopria anastrepha foi a espécie mais comum, com 44,5%.The objective of this work was to identify the parasitoids of fruit flies in Divinópolis-MG region. The pupae were obtained by the flotation method. They were individually placed in gelatin capsules until the emergency of the adult flies or their parasitoids. The overall prevalence of parasitism was 14,8%. Trichopria anastrepha was the most common specie with a frequency of 44,5%.

  19. Caracterização molecular de populações de Butia capitata (Arecaceae do Sul do Brasil através de marcadores AFLP Molecular characterization of Butia capitata populations (Arecaceae in Southern Brazil estimated by AFLP analysis

    Directory of Open Access Journals (Sweden)

    Miriam Valli Buttow

    2010-03-01

    Full Text Available O gênero Butia (Arecaceae é um pequeno gênero subtropical com espécies no sul da América do Sul, considerado ornamental. Além disso, seus frutos são apreciados pelo sabor e aroma peculiares. Porém, no Rio Grande do Sul, as populações naturais sofrem com o avanço das atividades rurais e da construção imobiliária. O objetivo deste trabalho foi caracterizar oito populações de Butia capitata ocorrentes no Rio Grande do Sul através de marcadores moleculares do tipo AFLP. Pela análise molecular da variância, foi possível verificar que 83,68% da variabilidade genética são atribuídos à variação entre populações e 13,67% são atribuídos a diferenças entre populações dentro de regiões. A análise comparativa entre as oito populações feita de duas a duas demonstrou que são significativas as diferenças entre 15 populações, com média de 14,72% da variação molecular atribuída às diferenças entre populações. Este resultado indica a presença de variabilidade genética distribuída entre todas as populações, sem subdivisão decorrente de isolamento geográfico.The Butia genus (Arecaceae is a small genus with subtropical species distributed in South America widely used as an ornamental plant. Besides, its fruits are appreciated for its unique flavor and aroma. But in some regions in Rio Grande do Sul State natural populations suffer with progress of building and rural activities. The aim of this study, therefore, was characterizing eight populations of Butia capitata through AFLP markers. By analysis of molecular variance was possible to verify that 83.68% of genetic variability is attributed to variation among populations and 13.67% is attributed to differences among populations within regions. In the pair-wise analysis, differences between 15 populations were significant, with an average of 14.72% of molecular variation attributed to differences between populations. This result indicates the presence of genetic

  20. Diversidade de moscas-das-frutas em pomares de citros no município de Araruama, RJ Diversity of fruit flies in citrus groves in the municipality of Araruama, RJ

    Directory of Open Access Journals (Sweden)

    Jorge Ferreira de Souza

    2008-04-01

    Full Text Available O objetivo deste estudo foi determinar as espécies de Tephritidae e Lonchaeidae (Diptera: Tephritoidea de ocorrência em pomares de laranja doce (Citrus sinensis Osbeck e tangerina (Citrus reticulata Blanco, no município de Araruama, RJ, durante o período de dezembro de 2002 a novembro de 2003. Os espécimes foram coletados em armadilhas McPhail contendo solução aquosa de proteína hidrolisada a 5% e em amostras de frutos de seis variedades de citros. Nas armadilhas, o total de 2.543 adultos de Tephritoidea (1.430 fêmeas e 1.023 machos foi capturado, sendo dez espécies de Tephritidae, quatro espécies e dois morfotipos de Lonchaeidae. Dos Tephritidae e capturados nas McPhail, quatro espécies (Anastrepha fraterculus, A. obliqua, A. sororcula e Ceratitis capitata infestaram frutos cítricos, enquanto que, dos Lonchaeidae, somente os morfotipos não infestaram as amostras de citros. Os resultados demonstram que a densidade populacional das moscas-das-frutas pode ser superestimada, quando baseada no número de moscas por armadilha, devido à captura de espécies que não infestam os frutos de interesse comercial.This study was aimed at determining the species of Tephritidae and Lonchaeidae (Diptera: Tephritoidea that occur on groves of sweet orange (Citrus sinensis Osbeck and tangerine (Citrus reticulata Blanco in the municipality of Araruama, state of Rio de Janeiro, Brazil, from December, 2002 to November, 2003. The specimens were collected by McPhail traps with aqueous solution of hydrolyzed protein to 5% and in fruits samples of six varieties of citrus. In the traps the total of 2,543 adults of Tephritoidea (1,430 females and 1,023 males was captured, being ten species of Tephritidae, four species and two morphotypes of Lonchaeidae. From the Tephritidae caught by the McPhail, four species (Anastrepha fraterculus, A. obliqua, A. sororcula and Ceratitis capitata infested citric fruits while the Lonchaeidae, the morphotypes did not infest

  1. Avaliação de populações de Butia capitata de Santa Vitória do Palmar Performance of populations of Butia capitata of Santa Vitória do Palmar

    Directory of Open Access Journals (Sweden)

    Elisane Schwartz

    2010-09-01

    Full Text Available O gênero Butia pertence à família Arecaceae e possui cinco espécies com ocorrência no Rio Grande do Sul. A espécie Butia capitata está recebendo atenção especial, não só pelo seu uso no consumo in natura como também em formas processadas. No entanto, mesmo sendo uma espécie que tem sua utilização registrada desde os tempos pré-históricos, vem sendo explorada apenas de modo extrativista, como a maioria das espécies de frutíferas nativas. Além disso, a espécie está seriamente comprometida em médio prazo pela ausência de regeneração natural e com risco muito alto de extinção num futuro próximo. Nesse sentido, o objetivo deste trabalho foi comparar os frutos, a partir de parâmetros químicos e físicos, e também observar os dados produtivos das plantas de três populações de butiazeiros do município de Santa Vitória do Palmar-RS. Os dados foram obtidos em experimentos conduzidos na safra de 2005/2006 e na safra de 2006/2007, em três propriedades localizadas em Santa Vitória do Palmar. Os resultados permitiram verificar que as propriedades e ou variações genéticas entre as populações de Butia capitata avaliadas propiciaram variabilidade para duração do ciclo, coloração da epiderme dos frutos, volume de suco produzido, relação entre sólidos solúveis totais e acidez titulável, características biométricas de fruto e produtividade anual. Uma das populações, denominada Celina, apresentou maior produtividade e rendimento industrial. As populações Celina e São José apresentaram as melhores características biométricas de fruto. A população Aguiar apresentou a melhor relação entre sólidos solúveis totais e acidez titulável.The genus Butia belongs to the Arecaceae family and shows five species occurring in Rio Grande de Sul. The specie Butia capitata requires special attention, not just for its use as fresh consumption but also as processed product. However, even having its use recorded since

  2. Are all eggs created equal? A case study from the Hawaiian reef-building coral Montipora capitata

    Science.gov (United States)

    Padilla-Gamiño, Jacqueline L.; Bidigare, Robert R.; Barshis, Daniel J.; Alamaru, Ada; Hédouin, Laetitia; Hernández-Pech, Xavier; Kandel, Frederique; Leon Soon, Sherril; Roth, Melissa S.; Rodrigues, Lisa J.; Grottoli, Andrea G.; Portocarrero, Claudia; Wagenhauser, Stephanie A.; Buttler, Fenina; Gates, Ruth D.

    2013-03-01

    Parental effects have been largely unexplored in marine organisms and may play a significant role in dictating the phenotypic range of traits in coral offspring, influencing their ability to survive environmental challenges. This study explored parental effects and life-stage differences in the Hawaiian reef-building coral Montipora capitata from different environments by examining the biochemical composition of mature coral colonies and their eggs. Our results indicate that there are large biochemical differences between adults and eggs, with the latter containing higher concentration of lipids (mostly wax esters), ubiquitinated proteins (which may indicate high turnover rate of proteins) and antioxidants (e.g., manganese superoxide dismutase). Adults displayed high phenotypic plasticity, with corals from a high-light environment having more wax esters, lighter tissue δ13C signatures and higher Symbiodinium densities than adults from the low-light environment who had higher content of accessory pigments. A green-algal pigment (α-carotene) and powerful antioxidant was present in eggs; it is unclear whether this pigment is acquired from heterotrophic food sources or from endolithic green algae living in the adult coral skeletons. Despite the broad phenotypic plasticity displayed by adults, parental investment in the context of provisioning of energy reserves and antioxidant defense was the same in eggs from the different sites. Such equality in investment maximizes the capacity of all embryos and larvae to cope with challenging conditions associated with floating at the surface and to disperse successfully until an appropriate habitat for settlement is found.

  3. Molecular cloning and primary sequence analysis of a gene encoding a putative shitinase gene in Brassica oleracea var.capitata

    Institute of Scientific and Technical Information of China (English)

    TANGGUOQING; YONGYANBAI; 等

    1996-01-01

    Chitinase,which catalyzes the hydrolysis of the β-1,4-acetyl-D-glucosamine linkages of the fungal cell wall polymer chitin,is involved in inducible plants defense system.By construction of cabbage(Brassica oleracea var. capitata) genomic library and screening the library with pRCH8,a probe of rice chitinase gene fragment,a chitinase genomic sequence was isolated.The complete uncleotide sequence of the putative cabbage chitinase gene (cabch29) was determined,with its longest open reading frame (ORF) encoding a polypeptide of 413 aa.This polypeptide consists of a 21 aa N-terminal signal peptide,two chitin-binding domains different from those of other classes of plant chitinases,and a catalytic domain.Homology analysis illustrated that this cabch29 gene has 58.8% identity at the nucleotide level with the pRCH8 ORF probe and has 50% identity at the amino acid level tiwh the catalytic domains of chitinase from bean,maize and sugar beet.Meanwhile,several kinds of cis-elements,such as TATA box,CAAT box,GATA motif,ASF-1 binding site,wound-response elements and AATAAA,have also been discovered in the flanking region of cabch29 gene.

  4. Discovery of the chitinozoans Belonechitina capitata from the Shiala Formation of northeastern Garhwal-Kumaon Tethys Himalaya, Pithoragarh District, Uttrakhand, India

    Institute of Scientific and Technical Information of China (English)

    H.N. Sinha; Jacques Verniers

    2016-01-01

    Belonechitina capitata, a typically middle to late Ordovician chitinozoan index taxon was for the first time recovered from the northeastern Kumaon region, a part of Garhwal-Kumaon Tethys basin of the Himalaya, India. This species is of great biostratigraphic importance and has already been reported from Avalonia, Baltica and northern Gondwana. The study area was during Ordovician, part of a low-palaeolatitudinal Gondwana region. The vesicles of recovered forms are black and fragmentary. This is principally attributed to intense tectonic activity during the Himalayan orogenic movement which resulted into high thermal alteration. The chitinozoans are found along with melanosclerites.

  5. Effects of gamma radiation on the sterility and behavioral quality of the caribbean fruit fly, Anastrepha suspensa (Loew (Diptera:Tephritidae Efeitos da radiação gama na esterilização e comportamento da mosca-do-caribe, Anastrepha suspensa (Low (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    J.M.M. Walder

    1993-09-01

    Full Text Available Pupae of Anastrepha suspensa (Loew were irradiated 2 days before adult eclosión in an air atmosphere with 15, 20, 25, 30, 50 and 70 Gy of gamma radiation (Co-60. The radiation effects on sterility and other parameters of quality and behavior of males and females of caribfly were established. Males became fully sterile with a dose of 50 Gy and females laid no eggs when exposed to 25 Gy. Radiation had no significant effect on adult eclosion, sex ratio, flight ability and irritability, but female mortality was affected significantly by radiation, showing higher survival rates in low dosage treatments. The mating behavior of the males was reduced significantly by increasing the radiation doses.Pupas de Anastrepha suspensa (Loew foram irradiadas dois dias antes da emergência dos adultos em atmosfera de ar com as doses de 15, 20, 25, 30, 50 e 70 Gy de radiação gama (Co-60. Foram avaliados os efeitos da radiação sobre a esterilidade e outros parâmetros de qualidade e comportamento de machos e fêmeas de mosca-do-caribe. Machos tornaram-se totalmente estéreis com uma dose de 50 Gy e as fêmeas não ovipositaram quando expostas a 25 Gy. A radiação não teve efeito significativo sobre a taxa de emergência de adultos, na razão sexual, na habilidade de vôo e na irritabilidade desses insetos. Somente a mortalidade das fêmeas foi afetada significativamente pela radiação, causando unia maior sobrevivência nas dosagens mais baixas. A atividade de acasalamento dos machos foi reduzida significativamente com o incremento da dosagem de radiação.

  6. Vibrio owensii induces the tissue loss disease Montipora white syndrome in the Hawaiian reef coral Montipora capitata.

    Directory of Open Access Journals (Sweden)

    Blake Ushijima

    Full Text Available Incidences of coral disease in the Indo-Pacific are increasing at an alarming rate. In particular, Montipora white syndrome, a tissue-loss disease found on corals throughout the Hawaiian archipelago, has the potential to degrade Hawaii's reefs. To identify the etiologic agent of Montipora white syndrome, bacteria were isolated from a diseased fragment of Montipora capitata and used in a screen for virulent strains. A single isolate, designated strain OCN002, recreated disease signs in 53% of coral fragments in laboratory infection trials when added to a final concentration of 10(7 cells/ml of seawater. In addition to displaying similar signs of disease, diseased coral fragments from the field and those from infection trials both had a dramatic increase in the abundance of associated culturable bacteria, with those of the genus Vibiro well represented. Bacteria isolated from diseased fragments used in infection trails were shown to be descendants of the original OCN002 inocula based on both the presence of a plasmid introduced to genetically tag the strain and the sequence of a region of the OCN002 genome. In contrast, OCN002 was not re-isolated from fragments that were exposed to the strain but did not develop tissue loss. Sequencing of the rrsH gene, metabolic characterization, as well as multilocus sequence analysis indicated that OCN002 is a strain of the recently described species Vibrio owensii. This investigation of Montipora white syndrome recognizes V. owensii OCN002 as the first bacterial coral pathogen identified from Hawaii's reefs and expands the range of bacteria known to cause disease in corals.

  7. An apparent "vital effect" of calcification rate on the Sr/Ca temperature proxy in the reef coral Montipora capitata

    Science.gov (United States)

    Kuffner, Ilsa; Jokiel, Paul L.; Rodgers, Kuulei; Andersson, Andreas; Mackenzie, Fred T.

    2012-01-01

    Measuring the strontium to calcium ratio in coral skeletons reveals information on seawater temperatures during skeletal deposition, but studies have shown additional variables may affect the ratio. Here we measured Sr/Ca in the reef coral, Montipora capitata, grown in six mesocosms continuously supplied with seawater from the adjacent reef flat. Three mesocosms were ambient controls, and three had seawater chemistry simulating "ocean acidification" (OA). We found that Sr/Ca was not affected by the OA treatment, and neither was coral calcification for these small colonies (larger colonies did show an OA effect). The lack of OA effects allowed us to test the hypothesis that coral growth rate can affect Sr/Ca using the natural range in calcification rates of the corals grown at the same temperature. We found that Sr/Ca was inversely related to calcification rate (Sr/Ca = 9.39 - 0.00404 mmol/mol * mg day-1 cm-2, R2 = 0.32). Using a previously published calibration curve for this species, a 22 mg day-1 colony-1 increase in calcification rate introduced a 1°C warmer temperature estimate, with the 27 corals reporting "temperatures" ranging from 24.9 to 28.9, with mean 26.6 ± 0.9°C SD. Our results lend support to hypotheses invoking kinetic processes and growth rate to explain vital effects on Sr/Ca. However, uncertainty in the slope of the regression of Sr/Ca on calcification and a low R-squared value lead us to conclude that Sr/Ca could still be a useful proxy in this species given sufficient replication or by including growth rate in the calibration.

  8. Índice de infestação e diversidade de moscas-das-frutas em hospedeiros exóticos e nativos no pólo de fruticultura de Anagé, BA Index of infestation and diversity of fruit-flies in exotic hosts native to the fruitculture area in Anagé, Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2008-01-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são os principais entraves às exportações de manga nos pólos de fruticultura da Região Sudoeste da Bahia. O presente trabalho teve como objetivo estudar índices de infestação e a diversidade de moscas-das-frutas no pólo de fruticultura de Anagé, BA, visando obter subsídios para o manejo integrado dessas pragas na mangueira, na região. Os estudos foram realizados em 2004 e 2005, nos municípios de Anagé, Belo Campo e Caraíbas, BA, procedendo-se à coleta de frutos de 21 espécies vegetais, nativas e exóticas, e identificação das espécies de moscas associadas. Estimaram-se os índices de infestação em pupários/kg de fruto e pupários/fruto. Os maiores índices de infestação, em pupários/kg de fruto, ocorreram em serigüela (Spondias purpurea L. com 61,3, juá (Ziziphus joazeiro L., 38,3 e umbu (Spondias tuberosa L., 33,1, considerados hospedeiros primários de Anastrepha fraterculus (Wiedemann e A. obliqua (Macquart. As maiores infestações em pupários/fruto ocorreram em serigüela (0,9; umbu (0,7 e cajarana (Spondias sp. (0,2. Com base no monitoramento larval, registra-se, para as condições do pólo de fruticultura de Anagé, a ocorrência das espécies Anastrepha fraterculus, A. obliqua, A. dissimilis, A. amita, A. distincta, A. sororcula, A. zenildae e Ceratitis capitata. Registram-se, pela primeira vez, as seguintes associações bitróficas: juá com A. fraterculus, A. obliqua, A. dissimilis e A. distincta; e umbu com A. amita e A. sororcula.Fruit-flies (Diptera: Tephritidae are the main hindrance for mango exportation in the fruitculture areas of the Southwestern Region of Bahia. The purpose of the present work was to study the indexes of infestation and diversity of fruit-flies in the fruitculture area of Anagé, BA, in order to obtain subsidies to the integrated management of these pests in mango, in this region. Studies were carried out in 2004 and 2005 in the

  9. Diversidade de moscas frugívoras (Diptera, Tephritoidea em áreas de matas decídua e ciliar no Pantanal sul-mato-grossense, Brasil Diversity of frugivorous flies (Diptera, Tephritoidea in areas of decidual and riparian forests in South Pantanal, Brazil

    Directory of Open Access Journals (Sweden)

    Edima Ramos Minzão

    2008-09-01

    Full Text Available O conhecimento da diversidade de espécies de moscas nos ecossistemas é importante para subsidiar na escolha de métodos ecologicamente corretos para o controle de tefritóideos (Tephritidae e Lonchaeidae pragas. O objetivo deste trabalho foi avaliar a diversidade de tefritóideos e seus padrões populacionais em áreas de matas decídua e ciliar. As moscas foram capturadas em armadilhas McPhail com atrativo alimentar em duas reservas florestais do município de Corumbá-MS, de agosto de 2003 a agosto de 2004. Treze espécies pertencentes a cinco gêneros e duas famílias foram registradas. No Sítio Pingo de Amor (mata decídua [MD], foram coletadas: Anastrepha dissimilis, A. fraterculus, A. obliqua, A. rheediae, A. sororcula, A. undosa e Ceratitis capitata (Tephritidae e de Lonchaeidae foram capturadas: Dasiops sp.1, Dasiops sp.2, Lonchaea sp.1, Lonchaea sp.2, Neosilba sp.1 e Neosilba sp.2. No Canal do Tamengo (mata ciliar [MC], foram obtidas todas as espécies mencionadas acima, exceto: A. dissimilis, A. rheediae, A. undosa, Dasiops sp.2 and Neosilba sp.2. O índice de diversidade de Shannon-Weaver (H', foi: 2,01 na MD e 1,51 na MC. Anastrepha obliqua foi caracterizada como muito abundante em ambas as reservas florestais. Na mata decídua A. sororcula foi constante e predominante e, Neosilba sp.1, muito abundante. Em ambos os ambientes A. obliqua, Lonchaea sp.2 e Neosilba sp.1 foram muito freqüentes e, A. obliqua e Neosilba sp.1 foram dominantes.The knowledge of fly species diversity and population patterns in the ecosystems is important to subsidy the choice of ecologically correct methods for control of tephritoid pests. The aim of this paper is to evaluate the diversity of tephritoids and their population patterns in a decidual and a riparian forest. Flies were caught in McPhail traps with food bait in two natural forest reserves at the Municipality of Corumbá-MS, from August 2003 to August 2004. Thirteen species belonging to five

  10. Diversidade de moscas-das-frutas, suas plantas hospedeiras e seus parasitóides nas regiões Norte e Noroeste do Estado do Rio de Janeiro, Brasil Fruit fly diversity, their host plants and their parasitoids in the northern and northwestern regions of Rio de Janeiro State, Brazil

    Directory of Open Access Journals (Sweden)

    Michela Rocha Leal

    2009-06-01

    Full Text Available Em razão da exploração crescente da fruticultura nas regiões Norte e Noroeste do Estado do Rio de Janeiro e da importância econômica e quarentenária das moscas-das-frutas para essa atividade agrícola no mundo, este estudo foi conduzido em cinco municípios dessas regiões: Cambuci, Campos dos Goytacazes, Itaocara, São Francisco do Itabapoana e São João da Barra, com objetivo de registrar as espécies de moscas-das-frutas, suas plantas hospedeiras e seus parasitóides. Os espécimes foram coletados por meio de armadilhas McPhail com solução aquosa de proteína hidrolisada a 5% e em amostras de frutos. Nas armadilhas, 4% do total de moscas-das-frutas capturadas foram Ceratitis capitata e 96% eram do gênero Anastrepha, num total de 15 espécies. Das moscas capturadas nas armadilhas, apenas seis espécies infestaram frutos entre as 12 espécies de fruteiras amostradas. Fruteiras das famílias Anacardiaceae, Malpighiaceae, Myrtaceae, Oxalidaceae, Passifloraceae e Sapotaceae foram plantas hospedeiras de moscas-das-frutas. Apenas três espécies de Anastrepha (A. fraterculus, A. sororcula e A. zenildae infestaram goiabas da variedade comercial Paluma. Os parasitóides de larvas de moscas-das-frutas encontrados foram Doryctobracon areolatus e Aganaspis pelleranoi, parasitando-as em frutos de goiabeira e de outras fruteiras nessas regiões.Due to the increase in fruit crops acreage in the northern and northwestern regions of Rio de Janeiro State and to the economic and quarantine importance of the fruit flies to this agricultural activity in the world, this study was carried out in five municipalities of these regions: Cambuci, Campos dos Goytacazes, Itaocara, São Francisco do Itabapoana, and São João da Barra, aiming to study the fruit fly species, their host plants and their parasitoids. The specimens were collected using McPhail traps with aqueous solution of hydrolyzed protein to 5% and in fruit samples. In the traps, 4% of the total

  11. Regional-Scale Spatio-Temporal Analysis of Anastrepha ludens (Diptera: Tephritidae) Populations in the Citrus Region of Santa Engracia, Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, Venancio; Barrientos-Lozano, Ludivina; Pérez-Castañeda, Roberto; Gaona-García, Griselda; Lara-Villalon, Manuel

    2015-08-01

    Large citrus areas in Tamaulipas are affected by Anastrepha ludens (Loew) populations. Here we report the findings of a spatio-temporal analysis of A. ludens on an extended citrus area from 2008-2011 aimed at analyzing the probabilities of A. ludens infestation and developing an infestation risk classification for citrus production. A Geographic Information System combined with the indicator kriging geostatistics technique was used to assess A. ludens adult densities in the spring and fall. During the spring, our models predicted higher probabilities of infestation in the western region, close to the Sierra Madre Oriental, than in the east. Although a patchy distribution of probabilities was observed in the fall, there was a trend toward higher probabilities of infestation in the west than east. The final raster models summarized the probability maps using a three-tiered infestation risk classification (low-, medium-, and high risk). These models confirmed the greater infestation risk in the west in both seasons. These risk classification data support arguments for the use of the sterile insect technique and biological control in this extended citrus area and will have practical implications for the area-wide integrated pest management carried out by the National Program Against Fruit Flies in Tamaulipas, Mexico.

  12. Morphometric analysis of Mexican and South American populations of the Anastrepha fraterculus complex (Diptera: Tephritidae) and recognition of a distinct Mexican morphotype.

    Science.gov (United States)

    Hernández-Ortiz, V; Gómez-Anaya, J A; Sánchez, A; McPheron, B A; Aluja, M

    2004-12-01

    Discriminant function and cluster analyses were performed on 19 morphometric variables of the aculeus, wing and mesonotum to determine whether populations of Anastrepha fraterculus (Wiedemann) from different parts of Mexico could be distinguished from populations from South America. Samples were collected from seven localities across Mexico, two from Brazil, and one each from Colombia and Argentina. Results showed there were statistically significant differences between Mexican and South American populations with respect to the aculeus (tip length, length of serrated section, mean number of teeth) and wing (width of S-band and connection between S- and V-bands). The degree of morphological variation observed among Mexican populations was extremely low, and as a consequence, the Mexican populations were identified as a single morphotype by discriminant analysis. The 'Andean morphotype'consisting of the Colombian population, and the 'Brazilian morphotype'consisting of the two Brazilian populations plus the single Argentinian population were also distinguished. It was concluded that the macro-geographical morphotypes from Mexico, Colombia, and Brazil plus Argentina correspond to three distinct taxonomic entities. Comparisons of results with those obtained from behavioural, karyotypic, isozyme and DNA studies suggest that sufficient evidence now exists to name a new Mexican species from within the A. fraterculus complex. This will be done in a separate publication. A provisional key to the morphotypes of A. fraterculus studied is provided.

  13. Can consumption of antioxidant rich mushrooms extend longevity?: antioxidant activity of Pleurotus spp. and its effects on Mexican fruit flies' (Anastrepha ludens) longevity.

    Science.gov (United States)

    Sánchez, José E; Jiménez-Pérez, Gabriela; Liedo, Pablo

    2015-12-01

    The variability of antioxidant capacity of 14 strains of the edible oyster mushroom Pleurotus spp. was determined, and the effect of selected mushroom supplements on the longevity of the Mexican fruit fly, Anastrepha ludens, was evaluated. The antioxidant capacity of the fruiting bodies was determined by three different methods, measuring the free radical scavenging activity of methanolic extracts, the OH radical scavenging capacity, and the total phenol content. The inhibition percentage of the DPPH radical varied between 32.6 and 85.7% and total phenols varied between 30.6 and 143.3 mg/g. The strains with the highest (Pleurotus djamor ECS-0142) and lowest (Pleurotus ostreatus ECS-1123) antioxidant capacity were selected to study their effect on the survival, life expectancy, and mortality of the Mexican fruit fly A. ludens. The results demonstrated differing responses between male and female flies. High concentrations of mushrooms (5 and 20%) in the diet resulted in a decrease in life expectancy. However, flies on the diet with 1% P. djamor ECS-0142 showed slightly but significantly greater survival than those on the control diet. The possible adverse effect of protein content in mushroom extracts is discussed.

  14. Isolation of entomopathogenic nematodes in an apple orchard in Southern Brazil and its virulence to Anastrepha fraterculus (Diptera: Tephritidae larvae, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    E. Foelkel

    Full Text Available Abstract Entomopathogenic nematodes (EPNs are a promising alternative to integrated control in many fruit pests. Few studies were made on the relationship of Anastrepha fraterculus natural population with native EPNs population and other biotic and abiotic factors. The aim of this work was to verify the occurrence of endemic nematodes in an apple orchard, concerning environmental conditions and technical procedure, and access isolates virulence to A. fraterculus larvae. The experiment was conducted during a year taking monthly soil samples from an apple orchard, with and without fallen fruits just above the soil. Samples were baited with Tenebrium molitor and A. fraterculus larvae in laboratory. Canopy and fallen fruits were sampled to access the pest infestation. Seventy three EPN isolates were captured, in 23.2% soil samples, more with T. molitor than with A. fraterculus baits. From the 20 isolates tested against A. fraterculus, only five were pathogenic, and they were identified as Oscheius sp. The nematodes were captured during all seasons in a similar frequency. Soil and weather conditions, presence of fruit over the orchard soil, and A. fraterculus pupae in the fruits had no significant influence on the capture. As a conclusion, nematodes of the genera Oscheius are found in an apple orchard of Porto Amazonas constantly along the year, independently of fluctuations in A. fraterculus population, climate conditions and presence of fruit over the soil. Some of the isolates are pathogenic to A. fraterculus.

  15. Chemical Composition, Antioxidant and Antimicrobial Activities of Thymus capitata Essential Oil with Its Preservative Effect against Listeria monocytogenes Inoculated in Minced Beef Meat

    Directory of Open Access Journals (Sweden)

    Nariman El Abed

    2014-01-01

    Full Text Available The chemical composition, antioxidant and antimicrobial activities, and the preservative effect of Thymus capitata essential oil against Listeria monocytogenes inoculated in minced beef meat were evaluated. The essential oil extracted was chemically analyzed by gas chromatography-mass spectrometry. Nineteen components were identified, of which carvacrol represented (88.89% of the oil. The antioxidant activity was assessed in vitro by using both the DPPH and the ABTS assays. The findings showed that the essential oil exhibited high antioxidant activity, which was comparable to the reference standards (BHT and ascorbic acid with IC50 values of 44.16 and 0.463 μg/mL determined by the free-radical scavenging DPPH and ABTS assays, respectively. Furthermore, the essential oil was evaluated for its antimicrobial activity using disc agar diffusion and microdilution methods. The results demonstrated that the zone of inhibition varied from moderate to strong (15–80 mm and the minimum inhibition concentration values ranged from 0.32 to 20 mg/mL. In addition, essential oil evaluated in vivo against Listeria monocytogenes showed clear and strong inhibitory effect. The application of 0.25 or 1% (v/w essential oil of T. capitata to minced beef significantly reduced the L. monocytogenes population when compared to those of control samples (P-value  <0.01.

  16. Chemical Composition, Antioxidant and Antimicrobial Activities of Thymus capitata Essential Oil with Its Preservative Effect against Listeria monocytogenes Inoculated in Minced Beef Meat.

    Science.gov (United States)

    El Abed, Nariman; Kaabi, Belhassen; Smaali, Mohamed Issam; Chabbouh, Meriem; Habibi, Kamel; Mejri, Mondher; Marzouki, Mohamed Nejib; Ben Hadj Ahmed, Sami

    2014-01-01

    The chemical composition, antioxidant and antimicrobial activities, and the preservative effect of Thymus capitata essential oil against Listeria monocytogenes inoculated in minced beef meat were evaluated. The essential oil extracted was chemically analyzed by gas chromatography-mass spectrometry. Nineteen components were identified, of which carvacrol represented (88.89%) of the oil. The antioxidant activity was assessed in vitro by using both the DPPH and the ABTS assays. The findings showed that the essential oil exhibited high antioxidant activity, which was comparable to the reference standards (BHT and ascorbic acid) with IC50 values of 44.16 and 0.463 μ g/mL determined by the free-radical scavenging DPPH and ABTS assays, respectively. Furthermore, the essential oil was evaluated for its antimicrobial activity using disc agar diffusion and microdilution methods. The results demonstrated that the zone of inhibition varied from moderate to strong (15-80 mm) and the minimum inhibition concentration values ranged from 0.32 to 20 mg/mL. In addition, essential oil evaluated in vivo against Listeria monocytogenes showed clear and strong inhibitory effect. The application of 0.25 or 1% (v/w) essential oil of T. capitata to minced beef significantly reduced the L. monocytogenes population when compared to those of control samples (P-value  <0.01).

  17. Fruit flies (Diptera: Tephritidae associated to native fruit of Spondias spp. (Anacardiaceae and Ximenia americana L. (Olacaceae and their parasitoids in the State of Piaui, Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2014-09-01

    Full Text Available This work aims to identify the species of fruit flies and their parasitoids associated to native fruit of Spondias spp. (caja S. mombin L., umbu-caja Spondias sp., umbu S. tuberosa Arr. Câm. and wild plum Ximenia americana L., in the State of Piaui, Brazil. Samples (63 of fruits were collected from November 2009 to July 2010, totalizing 4,495 fruits and 46,906 kg. It was possible to obtain 10,617 puparia, from which 4,497 tephritids and 1,118 braconid parasitoids emerged. Regarding Spondias spp., the highest occurrence was Anastrepha obliqua (Macquart, with 100% for umbu and umbu-caja. Caja presented an average of 99.52% of A. obliqua, 0.46% of Anastrepha fraterculus (Wied. and 0.97% of Ceratitis capitata (Wied.. Wild plum percentages were 97.83% for A. alveata Stone and 2.17% for A. fraterculus. Infestation rates were 429.2, 178.4, 158.9 and 43.3 puparia/kg in umbu-caja, caja, wild plum and umbu, respectively. Pupal viability was 77.8%, 69.3%, 52.5% and 41.1% to umbu, wild plum, umbu-caja and caja, respectively. By analyzing the sample parasitoids, the percentage was 21.39% for the Doryctobracon areolatus (Szépligeti species and 78.61% for Opius bellus Gahan. For the first time, it was recorded in Brazil X. americana as a host to A. alveata, as well as D. aleolatus and O. bellus as parasitoids of A. obliqua and A. alveata in Piaui.

  18. The smart aerial release machine, a universal system for applying the sterile insect technique.

    Directory of Open Access Journals (Sweden)

    Ruben Leal Mubarqui

    Full Text Available Beyond insecticides, alternative methods to control insect pests for agriculture and vectors of diseases are needed. Management strategies involving the mass-release of living control agents have been developed, including genetic control with sterile insects and biological control with parasitoids, for which aerial release of insects is often required. Aerial release in genetic control programmes often involves the use of chilled sterile insects, which can improve dispersal, survival and competitiveness of sterile males. Currently available means of aerially releasing chilled fruit flies are however insufficiently precise to ensure homogeneous distribution at low release rates and no device is available for tsetse.Here we present the smart aerial release machine, a new design by the Mubarqui Company, based on the use of vibrating conveyors. The machine is controlled through Bluetooth by a tablet with Android Operating System including a completely automatic guidance and navigation system (MaxNav software. The tablet is also connected to an online relational database facilitating the preparation of flight schedules and automatic storage of flight reports. The new machine was compared with a conveyor release machine in Mexico using two fruit flies species (Anastrepha ludens and Ceratitis capitata and we obtained better dispersal homogeneity (% of positive traps, p<0.001 for both species and better recapture rates for Anastrepha ludens (p<0.001, especially at low release densities (<1500 per ha. We also demonstrated that the machine can replace paper boxes for aerial release of tsetse in Senegal.This technology limits damages to insects and allows a large range of release rates from 10 flies/km2 for tsetse flies up to 600,000 flies/km2 for fruit flies. The potential of this machine to release other species like mosquitoes is discussed. Plans and operating of the machine are provided to allow its use worldwide.

  19. Development of Myrmeleon brasiliensis (Navas) (Neuroptera, Myrmeleontidae), in laboratory, with different natural diets

    Energy Technology Data Exchange (ETDEWEB)

    Missirian, Giani L.B. [Centro Universitario da Grande Dourados, MS (Brazil). Curso de Ciencias Biologicas; Uchoa-Fernandes, Manoel A. [Universidade Federal da Grande Dourados, MS (Brazil). Faculdade de Ciencias Biologicas e Ambientais]. E-mail: uchoa.fernandes@ufgd.edu.br; Fischer, Erich [Universidade Federal de Mato Grosso do Sul, Campo Grande, MS (Brazil). Dept. de Biologia

    2006-07-01

    Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp.), fruit fly larvae (Anastrepha spp. and Ceratitis capitata) and mixed diet (Atta spp. plus fruit fly larvae)] on the development of larvae and pupae of M. brasiliensis (Navas, 1914) and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days) of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm), the mean weight (mg) or the mean body size (mm) in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments. (author)

  20. [Susceptibility of six Arabic coffee cultivars to fruit flies (Diptera: Tephritoidea) under shaded and unshaded organic management in Valença, State of Rio de Janeiro, Brazil].

    Science.gov (United States)

    Aguiar-Menezes, Elen L; Souza, Silvana A S; Santos, Carlos M A; Resende, André L S; Strikis, Pedro C; Costa, Janaína R; Ricci, Marta S F

    2007-01-01

    The infestation indices by fruit flies were determined for six cultivars of Coffea arabica L. in shaded and unshaded systems under organic management. The experiment was set in a completely randomized design with a split-split-plot arrangement and four replicates. A 250g-sample of maturing fruits per plot was harvested in May 2005. The cultivars Icatu Amarelo and Catucaí Amarelo were the least susceptible to attack by tephritids in both systems. As for lonchaeids, Oeiras, Catucaí Amarelo and Catuaí Vermelho were the least susceptible cultivars in the shaded system, and there was no difference among the cultivars in the unshaded system. The following tephritid species were obtained: Ceratitis capitata (Wiedemann), Anastrepha fraterculus (Wiedemann) and A. sororcula Zucchi (Tephritidae). Lonchaeids were represented by Neosilba bifida Strikis & Prado, N. certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. pseudopendula (Korytkowski and Ojeda), Dasiops rugifrons Hennig, Neosilba n.sp.10 and Neosilba n.sp.14.

  1. PHYSICAL AND CHEMICAL TREATMENTS FOR OVERCOMING DORMANCY IN Butia capitata (MARTIUS BECCARI SEEDS TRATAMENTOS FÍSICOS E QUÍMICOS PARA SUPERAÇÃO DE DORMÊNCIA EM SEMENTES DE Butia capitata (MARTIUS BECCARI

    Directory of Open Access Journals (Sweden)

    Delacyr da Silva Brandão Júnior

    2011-01-01

    Full Text Available The aim of this study was to assess the effect of pre-germination treatments for overcoming dormancy in Butia capitata seeds. The experiment was conducted in a randomized blocks design, in a 3x3 factorial scheme (mechanical treatments x immersion substances, with 20 seeds per plot and four replications. For mechanical treatments, seeds with endocarp (pyrene, seeds without endocarp, and scarified pyrenes were used, whereas, for the immersion substances, gibberellic acid, water, and the control (without immersion were used. The emergence of seedlings began within 51 days, in pyrenes scarified and treated with gibberellic acid. The difference between the first and last count was 190 days. There was no interaction effect for the characteristics assessed, except for the mechanical treatments. It was possible to conclude that the scarified pyrenes showed a higher performance for most  characteristics assessed: emergence percentage, emergence speed index, length, and root fresh and dry mass.

    KEY-WORDS: Arecaceae; pyrene; scarification; gibberellins.Objetivou-se avaliar o efeito de tratamentos pré-germinativos, na superação de dormência em sementes de coquinho-azedo. O experimento foi montado em delineamento de blocos ao acaso, em esquema fatorial 3x3 (tratamentos mecânicos x substâncias de imersão, com 20 sementes por parcela e quatro repetições. Nos tratamentos mecânicos, utilizaram-se sementes com endocarpo (pirênio, sementes sem endocarpo e pirênios escarificados, enquanto, nos tratamentos de substância de imersão, foram utilizados ácido giberélico, água e a testemunha (sem imersão. A emergência das plântulas iniciou-se aos 51 dias, em pirênios escarificados e tratados com ácido giberélico. A diferença entre a primeira e a última contagem foi de 190 dias. Para as características avaliadas, não houve efeito da interação, somente dos tratamentos mecânicos. Concluiu-se que os pirênios escarificados

  2. Experimental Air Warming of a Stylosanthes capitata, Vogel Dominated Tropical Pasture Affects Soil Respiration and Nitrogen Dynamics

    Science.gov (United States)

    Gonzalez-Meler, Miquel A.; Silva, Lais B. C.; Dias-De-Oliveira, Eduardo; Flower, Charles E.; Martinez, Carlos A.

    2017-01-01

    Warming due to global climate change is predicted to reach 2°C in tropical latitudes. There is an alarming paucity of information regarding the effects of air temperature on tropical agroecosystems, including foraging pastures. Here, we investigated the effects of a 2°C increase in air temperature over ambient for 30 days on an established tropical pasture (Ribeirão Preto, São Paulo, Brazil) dominated by the legume Stylosanthes capitata Vogel, using a T-FACE (temperature free-air controlled enhancement) system. We tested the effects of air warming on soil properties [carbon (C), nitrogen (N), and their stable isotopic levels (δ13C and δ15N), as well as soil respiration and soil enzymatic activity] and aboveground characteristics (foliar C, N, δ13C, δ15N, leaf area index, and aboveground biomass) under field conditions. Results show that experimental air warming moderately increased soil respiration rates compared to ambient temperature. Soil respiration was positively correlated with soil temperature and moisture during mid-day (when soil respiration was at its highest) but not at dusk. Foliar δ13C were not different between control and elevated temperature treatments, indicating that plants grown in warmed plots did not show the obvious signs of water stress often seen in warming experiments. The 15N isotopic composition of leaves from plants grown at elevated temperature was lower than in ambient plants, suggesting perhaps a higher proportion of N-fixation contributing to tissue N in warmed plants when compared to ambient ones. Soil microbial enzymatic activity decreased in response to the air warming treatment, suggesting a slower decomposition of organic matter under elevated air temperature conditions. Decreased soil enzyme capacity and increases in soil respiration and plant biomass in plots exposed to high temperature suggest that increased root activity may have caused the increase seen in soil respiration in this tropical pasture. This response

  3. Temporal Overlap and Co-Occurrence in a Guild of Sub-Tropical Tephritid Fruit Flies.

    Directory of Open Access Journals (Sweden)

    Gleidyane N Lopes

    Full Text Available Studies of community assembly have emphasized snapshot comparisons of spatially replicated samples from "natural" assemblages. Agro-ecosystems are characterized by relatively little habitat heterogeneity and no dispersal barriers for actively flying insects. Therefore, dynamic patterns of species segregation and aggregation are more likely to reflect the direct or indirect effects of species interactions. We studied the temporal organization of a guild of 21 congeneric species of Anastrepha that colonized fruit orchards in Monte Alegre do Sul, São Paulo, Brazil. This assemblage also included the introduced Mediterranean fruit fly Ceratitis capitata. One hundred six consecutive weekly censuses (11 Jan 2002-16 Jan 2004 of flies in guava, loquat, and peach orchards revealed a pattern of minimum abundance during the coldest months of each year (June and July and a maximum abundance during periods of flowering and fruit ripening. Overall, phenological overlap was greater than expected by chance. However, conditioned on the pattern of seasonal abundances, temporal occurrence and abundance matrices exhibited patterns of significant species segregation and anti-nestedness. In each year, the 3 orchards contained a small number of species pairs that exhibited statistically significant temporal segregation or aggregation. Most aggregated and segregated pairs reflected seasonal shifts in species presences that were not related to variation in air temperature. Most of the significant pairwise associations involved C. capitata: 8 of the 11 segregated pairs and 2 of the 7 aggregated pairs. These results suggest that species interactions between introduced and native species can be an important determinant of species associations in agro-ecosystems.

  4. Nível de infestação de moscas-das-frutas em faixa de fronteira, no Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Naymã Pinto Dias

    2013-08-01

    Full Text Available As moscas-das-frutas são as principais pragas da fruticultura mundial, destacando-se os tefritídeos e os lonqueídeos, sendo que, sobre este último grupo de insetos, existem poucas informações a respeito do seu potencial de danos. O objetivo deste trabalho foi identificar os níveis de infestação de moscas-das-frutas, em municípios da faixa de fronteira do Rio Grande do Sul com a Argentina e o Uruguai. O estudo foi realizado em 2011 e 2012, nos municípios de Itaqui, Quaraí, Santana do Livramento e Uruguaiana, RS. Foram realizadas coletas de frutos de 19 espécies vegetais exóticas e nativas, calculando-se os índices de infestação em pupários/kg de fruto e pupários/fruto. O maior índice de infestação de Ceratitis capitata ocorreu em nectarineira, com 72,01 pupários/kg e 2,51 pupários/fruto. Anastrepha fraterculus apresentou índices elevados em cerejeira, correspondendo a 57,57 pupários/kg e 0,23 pupários/fruto. Os lonqueídeos foram representados pelos gêneros Neosilba e Lonchaea, infestando frutos de mamoeiro e caramboleira, respectivamente. Registra-se para os municípios estudados do Rio Grande do Sul a ocorrência das seguintes espécies de moscas-das-frutas: C. capitata, A. fraterculus, Neosilba zadolicha e Lonchaea sp.

  5. Conserved metallomics in two insect families evolving separately for a hundred million years.

    Science.gov (United States)

    Rempoulakis, Polychronis; Afshar, Negar; Osorio, Beatriz; Barajas-Aceves, Martha; Szular, Joanna; Ahmad, Sohel; Dammalage, Thilakasiri; Tomas, Ulysses Sto; Nemny-Lavy, Esther; Salomon, Mor; Vreysen, Marc J B; Nestel, David; Missirlis, Fanis

    2014-12-01

    Μetal cofactors are required for enzymatic catalysis and structural stability of many proteins. Physiological metal requirements underpin the evolution of cellular and systemic regulatory mechanisms for metal uptake, storage and excretion. Considering the role of metal biology in animal evolution, this paper asks whether metal content is conserved between different fruit flies. A similar metal homeostasis was previously observed in Drosophilidae flies cultivated on the same larval medium. Each species accumulated in the order of 200 µg iron and zinc and approximately ten-fold less manganese and copper per gram dry weight of the adult insect. In this paper, data on the metal content in fourteen species of Tephritidae, which are major agricultural pests worldwide, are presented. These fruit flies can be polyphagous (e.g., Ceratitis capitata) or strictly monophagous (e.g., Bactrocera oleae) or oligophagous (e.g., Anastrepha grandis) and were maintained in the laboratory on five distinct diets based on olive oil, carrot, wheat bran, zucchini and molasses, respectively. The data indicate that overall metal content and distribution between the Tephritidae and Drosophilidae species was similar. Reduced metal concentration was observed in B. oleae. Feeding the polyphagous C. capitata with the diet of B. oleae resulted in a significant quantitative reduction of all metals. Thus, dietary components affect metal content in some Tephritidae. Nevertheless, although the evidence suggests some fruit fly species evolved preferences in the use or storage of particular metals, no metal concentration varied in order of magnitude between these two families of Diptera that evolved independently for over 100 million years.

  6. Irradiation of Anastrepha fraterculus (Diptera: Tephritidae) Eggs to Inhibit Fly Emergence in the Mass-Rearing of Diachasmimorpha longicaudata (Hymenoptera: Braconidae)

    Science.gov (United States)

    Costa, M. L. Z.; Pacheco, M. G.; Lopes, L. A.; Botteon, V. W.; Mastrangelo, T.

    2016-01-01

    As the incidence of Anastrepha fraterculus (Wiedemann) has increased in Southern Brazil in the past 3 yr, an initiative to release sterile flies and parasitoids has started. In order to make feasible the mass-rearing of the parasitoid Diachasmimorpha longicaudata (Ashmed), this study investigated the suitability of A. fraterculus larvae derived from irradiated eggs as host for D. longicaudata. Two different ages of A. fraterculus eggs (24 and 48 h old) were analyzed for hatchability after the exposure to a range of radiation doses. The hatchability of 48-h-old eggs was not affected by radiation, and no fly emerged at doses higher than 27.5 Gy. The larvae derived from irradiated eggs proved to be suitable hosts for the parasitoid development, with observed parasitism rates higher than 70% and sex ratio values above 0.6. The parasitism capability and longevity of D. longicaudata reared on larvae derived from irradiated eggs were also assessed. During the 10 d of parasitism evaluated, D. longicaudata from the treatments were able to parasitize nonirradiated larvae similarly as the parasitoids from controls and the laboratory colony. The longevity of D. longicaudata from the treatments was not affected either, with survival rates higher than 80% after 20 d of evaluation. The age of 48 h and a dose of 30 Gy could be considered the best age and dose for A. fraterculus eggs to be used in the mass-rearing of D. longicaudata. The results of this study will decrease the costs of mass-rearing D. longicaudata on A. fraterculus. PMID:27638956

  7. Effect of cold storage on larval and adult Anastrepha ludens (Diptera: Tephritidae) viability in commercially ripe, artificially infested Persea americana 'Hass'.

    Science.gov (United States)

    Aluja, M; Díaz-Fleischer, F; Arredondo, J; Valle-Mora, J; Rull, J

    2010-12-01

    Commercially ripe 'Hass' avocados, Persea americana Mill, artificially exposed to wild Anastrepha ludens (Loew) (Diptera: Tephritidae) females 24 h after harvest were placed in a cold storage facility to determine the effect of low temperature on larval survival and adult viability. Fruit were left for 3, 6, 9, and 12 d in a cold room at 5 degrees C followed by a 20-25-d period at ambient temperature to allow for larval development and pupation. Hass avocados and grapefruit, Citrus paradisi Macfadyen, maintained at ambient temperature served as controls. Overall, only 0.23% of the Hass avocados and 19.30% of the grapefruit were infested. The number of infested fruit increased with decreasing exposure time to cold. Puparia from cold-treated Hass avocados were significantly smaller than those stemming from cold-treated grapefruit. Hass avocados exposed for 12 d to 5 degrees C yielded no puparia, and those exposed for 6 and 9 d yielded 22 and two puparia, respectively, but no adults. Although Hass avocados exposed to cold temperature for 3 d yielded adults that reached sexual maturity (N = 16), females laid inviable eggs. Grapefruit exposed to cold for 12 d yielded normal-sized puparia (but no adults), whereas those exposed over 9 d yielded females able to lay viable eggs. We conclude that exposing fruit to cold storage after packing and during transport represents an effective risk-mitigating procedure in the highly improbable event that a gravid A. ludens female might lay eggs in a commercially ripe Hass avocado that had been left unprotected in a packinghouse.

  8. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    Science.gov (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  9. Selection of artificial hosts for oviposition by wild Anastrepha obliqua (Macquart (Diptera, Tephritidae: influence of adult food and effect of experience Seleção de hospedeiros artificiais para oviposição por Anastrepha obliqua (Macquart (Diptera, Tephritidae selvagem: influência do alimento do adulto e efeito da experiência

    Directory of Open Access Journals (Sweden)

    Thamara A. B. S. Leal

    2008-09-01

    Full Text Available Several factors influence the selection of oviposition substrates by insects. The aim of the present work was to find answers to the following questions related to the oviposition behavior of Anastrepha obliqua. Can carbohydrates (glucose or sucrose present in the adult diet have influence on the female preference for an oviposition substrate with similar composition? Can the previous experience with a host containing one of mentioned carbohydrates interfere in further selection of oviposition substrates? The results showed that the kind of carbohydrate present in the adult diet did not affect the female preference for an artificial oviposition substrate, neither when it was presented by itself nor in combination with brewer's yeast. The effect of experience in the oviposition behavior was observed when there was a previous contact with artificial oviposition substrates containing yeast and sucrose. The data are discussed in terms of the behavioral plasticity presented by this species in relation to feeding and oviposition behaviors.Vários fatores podem atuar durante a seleção de substratos para oviposição por insetos. O presente estudo teve por objetivo responder às seguintes questões relacionadas ao comportamento de oviposição de Anastrepha obliqua. O carboidrato presente na dieta do adulto (glicose ou sacarose pode influenciar a preferência da fêmea por um substrato para oviposição com composição semelhante? A experiência prévia com um hospedeiro que possui um dos dois carboidratos citados pode interferir em escolhas futuras entre substratos para oviposição? Os resultados indicaram que o tipo de carboidrato presente na dieta do adulto não exerceu influência sobre a preferência das fêmeas por um substrato artificial para oviposição, tanto quando em combinação com lêvedo de cerveja ou quando sozinho. O efeito da experiência no comportamento de oviposição foi notado quando o contato prévio foi com substratos

  10. Moscas frugívoras e seus parasitoides nos municípios de Pelotas e Capão do Leão, Rio Grande do Sul, Brasil Frugivorous flies and their parasitoids in the cities of Pelotas and Capão do Leão, Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Adrise Medeiros Nunes

    2012-01-01

    Full Text Available As moscas frugívoras (Tephritoidea são as principais pragas da fruticultura de clima temperado no Brasil. O objetivo do presente trabalho foi avaliar a infestação desses dípteros e a ocorrência de seus parasitoides em frutíferas nos municípios de Pelotas e Capão do Leão, localizados na região Sul, nas safras agrícolas de 2007/08 e 2008/09. Foram coletados frutos de araçazeiro-amarelo e vermelho (Psidium cattleianum Sabine, 1821, butiazeiro [Butia capitata (Mart. Becc., 1916], caquizeiro (Diospyros kaki Linnaeus, 1753, cerejeira-do-mato (Eugenia involucrata DC., 1828, goiabeira [Psidium guajava (Linnaeus, 1753], goiabeira-serrana [Acca sellowiana (Berg. Burret, 1941], nespereira [Eriobotrya japonica (Thunb. Lindley, 1822], pessegueiro [Prunus persicae (L. Batsch, 1801], pitangueira (Eugenia uniflora Linnaeus,1753 e uvalheira (Eugenia pyriformis Cambessèdes, 1832. Os frutos foram coletados e transportados para o laboratório, onde foram individualizados e determinados os seguintes parâmetros: índice de infestação das moscas, índice de parasitismo e frequência de indivíduos por espécie de parasitoide. Foram constatadas duas espécies de Tephritidae, Anastrepha fraterculus (Wiedemann, 1830 (90,5% e Ceratitis capitata (Wiedemann, 1824 (9,5% e duas de Lonchaeidae, Neosilba zadolicha McAlpine & Steyskal, 1982 (87,8% e uma espécie ainda não descrita, referida como Neosilba n. sp. 3 (12,2%. Anastrepha fraterculus é a espécie mais abundante nos dois municípios, sendo constatada na maioria das frutíferas coletadas. Caquizeiro e goiabeira foram os hospedeiros que apresentaram o maior índice de infestação por C. capitata. Quanto às espécies de Neosilba, a maior infestação ocorreu em frutos de goiabeira-serrana. Dos parasitoides emergidos, foram identificadas três espécies, sendo duas de Braconidae, Doryctobracon areolatus (Szépligeti, 1911 (52,6% e Opius bellus (Gahan, 1930 (27,5% e uma espécie de Figitidae, Aganaspis

  11. Combining field phenological observations with distribution data to model the potential distribution of the fruit fly Ceratitis rosa Karsch (Diptera: Tephritidae).

    Science.gov (United States)

    de Villiers, M; Hattingh, V; Kriticos, D J

    2013-02-01

    Despite the potential for phenological and abundance data to improve the reliability of species niche models, they are seldom used. The aim of this study was to combine information on the distribution, relative abundance and seasonal phenology of Natal fruit fly, Ceratitis rosa Karsch (Diptera: Tephritidae), in South Africa to model its potential global distribution. Bucket traps, baited with Biolure, were used to trap C. rosa in different climatic regions of South Africa over a two-year period. A CLIMEX niche model of the potential global distribution of C. rosa was fitted using the collected trapping data and other distribution records from South Africa. Independent distribution records for elsewhere in Africa were reserved for model validation. The CLIMEX model results conformed well to the South African trapping data, including information on relative abundance and seasonal phenology, as well as to the pattern of presence records of the species elsewhere in Africa. The model suggests that under recent historical conditions a large part of South America, Central America, Mexico and southern USA may be climatically suitable for establishment of C. rosa. In Europe, climatically suitable habitat is restricted to coastal regions of the Mediterranean, in Asia, mostly to the southern and south eastern countries, and in Australia mostly to the wetter south and east. The independent cross-validation provided by South African relative abundance and seasonal phenology data, central African distribution data and relevant species specific biological information provides greater confidence in the modelled potential distribution of C. rosa.

  12. Significant performance enhancement of yttrium-doped barium cerate proton conductor as electrolyte for solid oxide fuel cells through a Pd ingress-egress approach

    Science.gov (United States)

    Liu, Yu; Ran, Ran; Li, Sidian; Jiao, Yong; Tade, Moses O.; Shao, Zongping

    2014-07-01

    Proton-conducting perovskite oxides are excellent electrolyte materials for SOFCs that may improve power density at reduced temperatures and increase fuel efficiency, thus encouraging the widespread implementation of this attractive technology. The main challenges in the application of these oxides in SOFCs are difficult sintering and insufficient conductivity in real cells. In this study, we propose a novel method to significantly enhance the performance of a yttrium-doped barium cerate proton conductor as an electrolyte for SOFCs through a Pd ingress-egress approach to the development of BaCe0.8Y0.1Pd0.1O3-δ (BCYP10). The capability of the Pd egress from the BCYP10 perovskite lattice is demonstrated by H2-TPR, XRD, EDX mapping of STEM and XPS. Significant improvement in the sinterability is observed after the introduction of Pd due to the increased ionic conductivity and the sintering aid effect of egressed Pd. The formation of a B-site cation defect structure after Pd egress and the consequent modification of perovskite grain boundaries with Pd nanoparticles leads to a proton conductivity of BCYP10 that is approximately 3 times higher than that of BCY under a reducing atmosphere. A single cell with a thin film BCYP10 electrolyte reaches a peak power density as high as 645 mA cm-2 at 700 °C.

  13. Flutuação populacional de Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae na Região Oeste de Santa Catarina, Brasil Population fluctuation of Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae in the Western Region of Santa Catarina State, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2003-01-01

    Full Text Available Fruit flies are the major pests in fruit orchards and require a frequent insecticide aplication control, which increases production cost and chemical residues in fruits. Adults of Anastrepha fraterculus were sampled from twelve peach, plum, orange, tangerine and acid lime orchards in four counties in the Western Region of Santa Catarina. Modified McPhail plastic traps, baited with glucose 10%, were used to collect the flies from October 1998 to September 2000. Trap monitoring, bait replacement and fruit flies sorting by species and sex were done weekly. A total of 4,164 specimens of A. fraterculus was collected and highest population was registered in the county of Chapecó (64,8% of all sampled flies. Adults were collected all year long, with the highest population peaks occurring from December and January, although the fluctuation was different for each fruit species due to their particular phenology and in different years. Positive correlation among temperature, atmospheric humidity and population levels of adults of A. fraterculus was observed. According to the degree days obtained for each year, 4851.9, 4632.9 and 4983.7, respectively in 1998, 1999 and 2000, it was established that A. fraterculus could present an average of 11.2 generations a year.

  14. 结球甘蓝减数分裂中染色体异常行为分析%Analysis on Chromosome Abnormal Behavior in Meiosis of Brassica oleraces var. Capitata L.

    Institute of Scientific and Technical Information of China (English)

    邵治亮

    2009-01-01

    对300多个纯合二倍体结球甘蓝花粉母细胞减数分裂各时期的染色体进行观察,发现自然条件下纯合二倍体甘蓝花粉母细胞在减数分裂的双线期、终变期以及中期Ⅰ出现了高频率的1~3个四价体和中期Ⅰ有高频率的1~3对染色体提早分离和滞后分离2种异常现象,探讨了甘蓝结实率不高与染色体异常行为之间的关系.%The chromosomes from more than 300 pollen mother cells of homozygous diploid of Brassica oleraces var. Capitata L were observed in every period of meiosis. It was found that altofrequent 1-3 quadrivalent appeared in diplotene, diakinesis and metaphase I of meiosis of pollen mother cells of B. oleraces var. Capitata under natural conditions, and 2 kinds of abnormal phenomenas such as altofrequent 1-3 pairs of chromosomes separated early or late in metaphase I of meiosis. The relationship between low seed setting rate of B. oleraces var. Capitata and chromosome abnormal behavior was explored.

  15. SISTEMA DE CROMOSSOMOS SEXUAIS MÚLTIPLOS X1X1X2X2/X1X2Y NA MOSCA-DAS-FRUTAS Anastrepha sororcula (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Inês Regina de Araújo Moura Cunha

    2014-08-01

    Full Text Available Sistemas de cromossomos sexuais simples estão difundidos entre os Tephritidae do gênero Anastrepha. Espécies deste gênero apresentam enorme importância pelo impacto que causam em frutíferas cultivadas, sobretudo no nordeste do Brasil. Análises citogenéticas desenvolvidas em Anastrepha sororcula, através da análise da estrutura cariotípica e bandamento C revelaram a presença de um sistema de cromossomos sexuais múltiplos do tipo X1X1X2X2/X1X2Y nesta espécie. Enquanto as fêmeas apresentam um cariótipo homomórfico com 2n=12, os machos possuem 2n=11, onde se destaca um grande cromossomo Y despareado. O nível de divergência cariotípica da espécie A. sororcula do nordeste, com a presença de um sistema de cromossomos sexuais múltiplos, em relação às regiões central e sudeste do Brasil, podem indicar a ocorrência de impedimentos reprodutivos entre os exemplares das duas áreas e que possivelmente, como outros exemplos que existem neste gênero, A. sororcula constitua um complexo de espécies ainda não inteiramente definido. Palavras-chave: Alossomos, peste agrícola, citogenética de insetos, heterocromatina. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v4n2p1-4

  16. Cold Tolerance of the Mediterranean Fruit Fly in Date and Mandarin.

    Science.gov (United States)

    Gazit, Yoav; Akiva, Ruti; Gavriel, Sagi

    2014-10-01

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is an endemic pest in Israel and there can be low levels of infestation of dates (Phoenix dactylifera L.). Because C. capitata is considered a quarantine pest by several major importing countries, the export of fresh dates requires the elimination of this pest. For mandarin, cold storage at 1.11°C for 15 d is considered to be an effective treatment for the elimination of C. capitata. In this study, we compared the cold tolerance of C. capitata in "Barhi" dates to that of C. capitata in mandarins (Citrus unshiu Marcovitch, "Satsuma"). In Barhi dates, we found the third instars to be the most cold-tolerant as compared with other life stages. Ceratitis capitata in date fruits were significantly less cold-tolerant than C. capitata in Satsuma mandarins. The last viable larvae in dates and mandarins were found after 8 and 13 d of treatment, respectively, and the calculated mortality curves in the two crops were significantly different. These results demonstrate that C. capitata is more sensitive to cold treatment when in date fruits than in mandarins. Therefore, the quarantine cold treatments used to eliminate C. capitata from mandarins should be sufficiently effective if applied to fresh date fruits.

  17. Production of dry matter of Stylosanthes capitata submitted to phosphorus in soil with different textures Produção de matéria seca de Stylosanthes capitata submetido à adubação fosfatada em solos com diferentes texturas

    Directory of Open Access Journals (Sweden)

    Victor Hugo Nakase Otsubo

    2011-12-01

    Full Text Available The low availability of phosphorus is among the factors that limit the development of the Stylosanthes. Only with the appropriate management aiming to increase the phosphorus liberation in the soil we can provide the increase in yield of this leguminous plant. The study was conducted in a greenhouse at the University of Londrina (UEL, the objective was to evaluate the effect of P shoots of Stylosanthes capitata in soil with sandy texture (Typical Yellow Dystropic – LVAd and clay (Typical Eutrophic – Lvef. The experimental design used was completely randomized with four replications in a 2x5x2 factorial design, in which the factors were two soil types, five shots of phosphorus (0, 40, 80, 120 and 160 kg ha-1 of P2O5 and two cuts. For the sowing, seeds of Stylosanthes capitata were used. The aerial part’s cuts were made at 60 and 105 days after sowing. Regardless of the texture and cut, the phosphated fertilization increased the dry matter production of Stylosanthes’ aerial part, and the maximum yield was obtained with a shot of 105 kg ha-1 P2O5. Among the soils the biggest production was obtained in the second cut and soil of sandy texture. With the increase of the doses, the phosphorus content increases in dry matter yield, improving their nutritional quality for animal feed. The maximum dry matter production (2.39 g / plant in sandy soil and 1.36 g / plant in clay soil were obtained with doses of 102.69 and 113.25 kg ha-1 P2O5, respectively.A baixa disponibilidade de fósforo (P está entre os fatores que limitam o desenvolvimento do estilosante. Somente com manejo adequado que vise aumentar a liberação do fósforo no solo se consegue altos rendimentos desta leguminosa. O trabalho foi desenvolvido em casa de vegetação na Universidade Estadual de Londrina (UEL, com o objetivo de avaliar o efeito de doses de P na produção de matéria seca de Stylosanthes capitata em solos com texturas arenosa (Latossolo Vermelho-Amarelo Distr

  18. A Co-Dominant Marker BoE332 Applied to Marker-Assisted Selection of Homozygous Male-Sterile Plants in Cabbage (Brassica oleracea var. capitata L.)

    Institute of Scientific and Technical Information of China (English)

    CHEN Chen; ZHUANG Mu; FANG Zhi-yuan; WANG Qing-biao; ZHANG Yang-yong; LIU Yu-mei; YANG Li-mei; CHENG Fei

    2013-01-01

    The dominant genic male sterility (DGMS) gene CDMs399-3 derived from a spontaneous mutation in the line 79-399-3 of spring cabbage (Brassica oleracea var. capitata L.), has been successfully applied in hybrid seed production of several cabbage cultivars in China. During the development of dominant male sterility lines in cabbage, the conventional identification of homozygous male-sterile plants (CDMs399-3/CDMs399-3) is a laborious and time-consuming process. For marker-assisted selection (MAS) of the gene CDMs399-3 transferred into key spring cabbage line 397, expressed sequence tag-simple sequence repeats (EST-SSR) and SSR technology were used to identify markers that were linked to CDMs399-3 based on method of bulked segregant analysis (BSA). By screening a set of 978 EST-SSRs and 395 SSRs, a marker BoE332 linked to the CDMs399-3 at a distance of 3.6 cM in the genetic background of cabbage line 397 were identified. 7 homozygous male-sterile plants in population P1170 with 20 plants were obtained finally via MAS of BoE332. Thus, BoE332 will greatly facilitate the transferring of the gene CDMs399-3 into the key spring cabbage line 397 and improve the application of DGMS in cabbage hybrid breeding.

  19. Nondestructive Optical Sensing of Flavonols and Chlorophyll in White Head Cabbage (Brassica oleracea L. var. capitata subvar. alba) Grown under Different Nitrogen Regimens.

    Science.gov (United States)

    Agati, Giovanni; Tuccio, Lorenza; Kusznierewicz, Barbara; Chmiel, Tomasz; Bartoszek, Agnieszka; Kowalski, Artur; Grzegorzewska, Maria; Kosson, Ryszard; Kaniszewski, Stanislaw

    2016-01-13

    A multiparametric optical sensor was used to nondestructively estimate phytochemical compounds in white cabbage leaves directly in the field. An experimental site of 1980 white cabbages (Brassica oleracea L. var. capitata subvar. alba), under different nitrogen (N) treatments, was mapped by measuring leaf transmittance and chlorophyll fluorescence screening in one leaf/cabbage head. The provided indices of flavonols (FLAV) and chlorophyll (CHL) displayed the opposite response to applied N rates, decreasing and increasing, respectively. The combined nitrogen balance index (NBI = CHL/FLAV) calculated was able to discriminate all of the plots under four N regimens (0, 100, 200, and 400 kg/ha) and was correlated with the leaf N content determined destructively. CHL and FLAV were properly calibrated against chlorophyll (R(2) = 0.945) and flavonol (R(2) = 0.932) leaf contents, respectively, by using a homographic fit function. The proposed optical sensing of cabbage crops can be used to estimate the N status of plants and perform precision fertilization to maintain acceptable crop yield levels and, additionally, to rapidly detect health-promoting flavonol antioxidants in Brassica plants.

  20. Pheromones, male lures and trapping of tephritid fruit flies

    Science.gov (United States)

    The dipteran family of Tephritidae consists of many genera, of which several namely, Anastrepha, Bactrocera, Ceratitis, Dacus, Rhagoletis and Toxotrypana possess species of high economic importance as major pests of fruits and vegetables. Hitherto, pheromones isolated and identified for possible use...

  1. El modelo V.S.P. en lechuga Batavia Lactuca sativa var. Capitata L. y respuesta de dos variedades a las aplicaciones de compuestos orgánicos

    Directory of Open Access Journals (Sweden)

    Bruzón C. Serapio F.

    1996-12-01

    Full Text Available

    An investigation was realized in the region of Pavitas, municipality of La Cumbre, Santa Fe farm, 1480 meters above sea level in a soil of Pavas Association (Aeric Tropaquept to prove the plastic cup-sustrate-plant model in the production of Batavia lecttuce Lactuca sativa var. capitata, and the effects of the organic matter filter cake press, cattle manure, poultry manure and earthworm soil, incorporated in the soil. Twenty two (22 treatments and fours repetitions were applied with each of the two varieties (Great lakes 118 and Pacific, the treatments corresponded to 5, 10, 15 t/ha of the organic matter which were applied to the soil fifteen days before transplantations occured. The results showed an excellent plant vigour and quality after the transplantation. It was also observed a good plant poblation and uniformity. The sustrate filter cake press mixed with botton fly ash presented better results in the field than the other treatments, having the highest crop yield and the best quality. The Great Lakes 118 with this treatment doubled the production of the treatment with soil. With the organic sustrates, the poultry manure 5 t/ha projected better results. The work showed the good behavior of the varity Great Lakes 118 compared to the Pacific. This treatments also improved the chemical caracteristics of the soil, especially increased the organic matter, potassium, phosporus, manganesum and zinc.

    En el Corregimiento Pavitas, municipio de La Cumbre, en la Finca Santafé, a 1.480 msnm en un suelo de la Asociación Pavas (Aeric Tropaquept se probó el modelo vaso-sustrato-planta (VSP, en la producción de plántulas de lechuga Batavia L. sativa var. capitata y el efecto en la producción de los compuestos orgánicos, cachaza, lombricompuesto, gallinaza y bovinaza, incorporados al suelo. Los 22 tratamientos con cuatro repeticiones, repartidos en dos variedades (Great Lake 118 y Pacific correspondieron a dosis (5, 10, 15 t/ha de las

  2. Chromosome Doubling of Microspore-Derived Plants from Cabbage (Brassica oleracea var. capitata L.) and Broccoli (Brassica oleracea var. italica L.).

    Science.gov (United States)

    Yuan, Suxia; Su, Yanbin; Liu, Yumei; Li, Zhansheng; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Sun, Peitian

    2015-01-01

    Chromosome doubling of microspore-derived plants is an important factor in the practical application of microspore culture technology because breeding programs require a large number of genetically stable, homozygous doubled haploid plants with a high level of fertility. In the present paper, 29 populations of microspore-derived plantlets from cabbage (Brassica oleracea var. capitata) and broccoli (Brassica oleracea var. italica) were used to study the ploidy level and spontaneous chromosome doubling of these populations, the artificial chromosome doubling induced by colchicine, and the influence of tissue culture duration on the chromosomal ploidy of the microspore-derived regenerants. Spontaneous chromosome doubling occurred randomly and was genotype dependent. In the plant populations derived from microspores, there were haploids, diploids, and even a low frequency of polyploids and mixed-ploidy plantlets. The total spontaneous doubling in the 14 cabbage populations ranged from 0 to 76.9%, compared with 52.2 to 100% in the 15 broccoli populations. To improve the rate of chromosome doubling, an efficient and reliable artificial chromosome doubling protocol (i.e., the immersion of haploid plantlet roots in a colchicine solution) was developed for cabbage and broccoli microspore-derived haploids. The optimal chromosome doubling of the haploids was obtained with a solution of 0.2% colchicine for 9-12 h or 0.4% colchicine for 3-9 h for cabbage and 0.05% colchicine for 6-12 h for broccoli. This protocol produced chromosome doubling in over 50% of the haploid genotypes for most of the populations derived from cabbage and broccoli. Notably, after 1 or more years in tissue culture, the chromosomes of the haploids were doubled, and most of the haploids turned into doubled haploid or mixed-ploidy plants. This is the first report indicating that tissue culture duration can change the chromosomal ploidy of microspore-derived regenerants.

  3. Influence of fermentation conditions on glucosinolates, ascorbigen, and ascorbic acid content in white cabbage (Brassica oleracea var. capitata cv. Taler) cultivated in different seasons.

    Science.gov (United States)

    Martinez-Villaluenga, C; Peñas, E; Frias, J; Ciska, E; Honke, J; Piskula, M K; Kozlowska, H; Vidal-Valverde, C

    2009-01-01

    The content of glucosinolates (GLS), ascorbigen, and ascorbic acid in white cabbage (Brassica oleracea var. capitata cv. Taler) cultivated in different seasons (summer and winter) was determined, before and after spontaneous and starter-induced fermentation. Different salt concentrations (0.5% NaCl or 1.5% NaCl) were used for sauerkraut production. Glucoiberin, sinigrin, and glucobrassicin were dominating in raw white cabbage cultivated either in winter or summer seasons. Ascorbigen precursor, glucobrassicin, was found higher in cabbage cultivated in winter (2.54 micromol/g dw) than those grown in summer (1.83 micromol/g dw). Cabbage fermented for 7 d was found to contain only traces of some GLS irrespective of the fermentation conditions used. Ascorbigen synthesis occurred during white cabbage fermentation. Brining cabbage at low salt concentration (0.5% NaCl) improved ascorbigen content in sauerkraut after 7 d of fermentation at 25 degrees C. The highest ascorbigen concentration was observed in low-sodium (0.5% NaCl) sauerkraut produced from cabbage cultivated in winter submitted to either natural (109.0 micromol/100 g dw) or starter-induced fermentation (108.3 and 104.6 micromol/100 g dw in cabbages fermented by L. plantarum and L. mesenteroides, respectively). Ascorbic acid content was found higher in cabbage cultivated in summer and fermentation process led to significant reductions. Therefore, the selection of cabbages with high glucobrassicin content and the production of low-sodium sauerkrauts may provide enhanced health benefits towards prevention of chronic diseases.

  4. Development of Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, in laboratory, with different natural diets Desenvolvimento de Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, em laboratório, com diferentes dietas naturais

    Directory of Open Access Journals (Sweden)

    Giani L. B. Missirian

    2006-12-01

    Full Text Available Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp., fruit fly larvae (Anastrepha spp. and Ceratitis capitata and mixed diet (Atta spp. plus fruit fly larvae] on the development of larvae and pupae of M. brasiliensis (Navás, 1914 and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm, the mean weight (mg or the mean body size (mm in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments.Larvas de formiga-leão são conhecidas por suas armadilhas ("funis" que constroem em solo arenoso, sob as quais esperam por suas presas. Este trabalho teve como objetivos verificar o efeito de diferentes dietas naturais [formigas-cortadeiras (Atta spp., larvas de moscas-das-frutas (Anastrepha spp. e Ceratitis capitata e dieta mista (Atta spp. e larvas de moscas-das-frutas] sobre o desenvolvimento larval e pupal de M. brasiliensis (Navás, 1914 e estimar o número e tamanho de presas capturadas, por instar larval, em cada dieta. No segundo e terceiro instares, as larvas de M. brasiliensis alimentadas com formigas-cortadeiras consumiram um número maior de presas e a

  5. Sublethal effect of neem extract on mediterranean fruit fly adults

    Directory of Open Access Journals (Sweden)

    Márcio Alves Silva

    2013-03-01

    Full Text Available The sublethal effect of extracts of Azadirachta indica on Ceratitis capitata was evaluated. Two pairs of flies were treated in plastic tubes with cotton placed in plastic cages. An artificial diet (hydrolyzed protein + sugar was provided ad libitum. The extracts affected significantly the longevity of C. capitata. The pre-oviposition period were not significantly affected by the extracts. The A. indica branches extracted with dichloromethane (888 ppm affected significantly the fecundity and fertility, reducing the number of eggs laid to approximately 80 % and the egg hatching by 30 % at the 8th day. Therefore, the neem branches extracted with dichloromethane affected the reproduction of C. capitata.

  6. Captures of bactrocera fruit flies (Diptera: Tephritidae) and nontarget insects in biolure and torula yeast traps in Hawaii

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  7. Subtropical Fruit Fly Invasions into Temperate Fruit Fly Territory in California's San Joaquin Valley

    Science.gov (United States)

    Subtropical fruit fly species including peach fruit fly, Bactrocera zonata (Saunders); melon fly, B. cucurbitae (Coquillett); oriental fruit fly, B. dorsalis (Hendel); and Mediterranean fruit fly, Ceratitis capitata Weidemann, have been detected in the past decade in the San Joaquin Valley of Califo...

  8. A qPCR-based method for detecting parasitism of Fopius arisanus (Sonan) in oriental fruit flies, Bactrocera dorsalis (Hendel)

    Science.gov (United States)

    BACKGROUND: Parasitism rate detection and parasitoid species identification are necessary in fruit fly biological control. Currently release of mass-reared Fopius arisanus is occurring world-wide, as this species is effective in controlling Bactrocera dorsalis and Ceratitis capitata. While release i...

  9. Rhythmicity of Bactrocera cucurbitae (Diptera:Tephritidae) attraction to cuelure: Insights from an interruptable lure and computer vision

    Science.gov (United States)

    We describe and validate an Agent-Based Simulation (ABS) of invasive insects and use it to investigate the time to extirpation of Ceratitis capitata using data from seven outbreaks that occurred in California from 2008-2010. Results are compared with the length of intervention and quarantine imposed...

  10. Transcriptome of the egg parasitoid Fopius arisanus, an important biocontrol tool for Tephritid fruit fly suppression

    Science.gov (United States)

    Background The Braconoid wasp Fopius arisanus (Sonan) has been utilized for biological control of the Mediterranean fruit fly (Ceratitis capitata), and the oriental fruit fly (Bactrocera dorsalis), both phytophagous fruit flies pest of economic importance in Hawaii. We have sequenced and assembled t...

  11. Efficacy of wax matrix bait stations for Mediterranean Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Tests were conducted that evaluated efficacy of wax matrix bait stations for Ceratitis capitata (Wiedemann) adults in Guatemala. Bait stations were exposed to outdoor conditions to determine effect of weathering on longevity as indicated by bait station age. Results of laboratory tests found that ba...

  12. Exposure to tea tree oil enhances the mating success of male Mediterranean fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    The aroma of various plant essential oils has been shown to enhance the mating competitiveness of males of the Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann). Laboratory observations revealed that male medflies show strong short-range attraction to tea tree oil (TTO hereafter) deri...

  13. Evidence for the evolutionary nascence of a novel sex determination pathway in honeybees

    DEFF Research Database (Denmark)

    Hasselmann, Martin; Gempe, Tanja; Schiøtt, Morten

    2008-01-01

    -determining gene transformer (tra), but lacks conserved motifs except for a 30-amino-acid motif that Fem shares only with Tra of another fly, Ceratitis capitata. Like tra, the fem transcript is alternatively spliced. The male-specific splice variant contains a premature stop codon and yields no functional product...

  14. Biological and Cultural Control of Olive Fruit Fly in California---Utilization of Parasitoids from USDA-APHIS-PPQ, Guatemala and Cultural Control Methods

    Science.gov (United States)

    The parasitoid Psytallia humilis = P. cf. concolor (Szépligeti) was reared on sterile Mediterranean fruit fly, Ceratitis capitata (Wiedemann), larvae at the USDA, APHIS, PPQ, Moscamed biological control laboratory in San Miguel Petapa, Guatemala and shipped to the USDA, ARS, Parlier, for biological ...

  15. Evidence for potential of managing some african fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone

    Science.gov (United States)

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aq...

  16. Embryogenesis in Culture of Isolated Microspores of Brassica juncea var.capitata%结球芥菜游离小孢子培养的胚状体发生

    Institute of Scientific and Technical Information of China (English)

    王长龙; 杨培新; 郑奕雄

    2011-01-01

    2009~2011年对6种不同结球芥菜品种进行了小孢子培养试验,结果表明:在相同的培养条件下,各品种胚状体的发育是不同步的,胚状体的平均产量也存在极显著的差异,以大平铺的平均产胚量最高,为3.52个/蕾,其次为哥历蕾.%The isolated microspores of 6 Brassica juncea var. Capitata varieties were cultured from 2009 to 2011. The results showed that: under the same culture conditions, the embryogenesis of different varieties was of asynchrony, the average embryoid yield had extremely significant difference among different varieties, and the variety Dapingpu had the highest average embryoid yield (3.52 embryoids per bud) , followed by Gelilei.

  17. Sterilization of fruit flies (Diptera: Tephritidae) with X-rays for sterile insect technique programs; Esterilizacao de moscas-das-frutas (Diptera: Tephritidae) com raios-X para programas de tecnica do inseto esteril

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de Araujo

    2009-07-01

    Recent fear of acts of terrorism provoked an increase of delays and denials in the shipment of radioisotopes. This truly represented a menace to sterile insect production projects around the world. In order to validate the use of a new kind of low-energy Xray irradiator, a series of radiobiological studies on Ceratitis capitata (tsl-VIENNA 8 strain) (Wied., 1824) (Diptera: Tephritidae) and an Argentinean strain of Anastrepha fraterculus (Wied., 1830) (Diptera: Tephritidae) were carried out, also comparing biological effectiveness between X-rays and traditional {gamma} radiation from {sup 60}Co. Pupae 48- 24 h before adult emergence of C. capitata males and both sexes of A. fraterculus were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Doses that induce 50, 90 and 99% of sterility were estimated and the hypothesis of Parallelism for the Probit equations was tested. Doses of 82.7 Gy of X-rays and 128.2 Gy of {gamma} rays (thus, a RBE{approx}1.5) induced 99% sterility on medfly males. The fertility of A. fraterculus fertile females crossed with 41 Gy of X-rays and 62.7 Gy of {gamma} rays decreased in 99% comparing with the control group (RBE{approx}1.5). 99% sterility of A. fraterculus irradiated females was achieved with 60-80 Gy (RBE{approx}0.7). The standard quality control parameters of fecundity, adult emergence, fliers and survival were not significantly affected by the two types of radiation (RBE{approx}1) either for medfly or A. fraterculus (p>0.01), being averages in conformity with the values required by FAO/IAEA/USDA. Only fecundity of irradiated A. fraterculus females was severely reduced with increasing doses and no egg was laid at 70 Gy of both radiations. There were no significant differences between X-rays and {gamma} rays regarding mating indices (RSI for medfly, RII, ISI, MRPI and FRPI for A. fraterculus) (p>0.05), what indicated more random matings for fertile and sterile insects. The results demonstrated that no

  18. Desarrollo de herramientas moleculares para la evaluación de la calidad genética y productividad en la cría artificial de Diachasmimorpha longicaudata, agente de control biológico de moscas plaga de los frutos

    OpenAIRE

    2016-01-01

    Diachasmimorpha longicaudata Ashmead (Hymenoptera: Braconidae) es un endoparasitoide solitario de estadios larvales de moscas de la fruta perteneciente a la familia Tephritidae. Es criado a nivel masivo en bioplantas y utilizado en diversas partes del mundo para las estrategias de control biológico (CB) principalmente de dípteros de importancia económica de los géneros Ceratitis, Anastrepha y Bactrocera. Actualmente, se estudia su implementación en nuestro país para el control de Ceratitis ca...

  19. Hongos de importancia agrícola presentes en moscas de la fruta del valle de Ica, Perú

    OpenAIRE

    Carlos E. Tipismana; Lilian R. Astudillo; Juan J. Guillermo

    2013-01-01

    El objetivo del presente trabajo fue aislar e identificar hongos de especímenes de moscas de la fruta de los géneros Ceratitis (Macleay) y Anastrepha (Schiner), del valle de Ica, Perú. Se aislaron hongos pertenecientes a los géneros Alternaria, Aspergillus, Cladosporium, Mucor, Penicillium, Rhizoctonia, Rhizopus y Trichoderma;así como levaduras y micelios estériles. Los recuentos de hongos presentaron rangos entre 8x103 a 8x104 UFC/g para el género Ceratitis; y 7x103 a 7x104 UFC/g para el g...

  20. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes.

  1. THERMAL TREATMENT WITH HOT AIR IN THE CONTROL OF FRUIT FLY IN SAPOTA

    Directory of Open Access Journals (Sweden)

    João Vilian de Moraes Lima Marinus

    2008-08-01

    Full Text Available One of the main postharvest problems of the sapota (Achras sapota L. is caused by the fruit fly (Ceratitis capitata, affecting its quality and commercialization. With this experiment, the objective was to evaluate the effect of hot air as thermal treatment in the control of immature phases of Ceratitis capitata and the fruit quality. The research was carried out at Entomology Laboratory – Centro de Ciências Agrárias, UFPB, Areia-PB. It was made the damaging of fruits with eggs inoculation of Ceratitis capitata and after three days the fruits were treated in hot air at temperatures of 46±1°C and 50±1°C, during 30, 45, 60, 75 and 90 minutes. Hot air was injected in the chamber using an equipment of the Skill mark. It was used a randomized design, in factorial scheme of 2x5+1 (two temperatures, five times of exhibition and one control, with four replications. The treatment with hot air was efficient to control the immature phases of C. capitata during 75 and 90 minutes of exposure and didn't affect the physical and chemical qualities of the sapota fruits.

  2. 基于生态位模型的番荔枝实蝇潜在适生性分布预测%Prediction of the potential distribution of Ceratitis anonae in China based on ecological niche modeling

    Institute of Scientific and Technical Information of China (English)

    李白尼; 马骏; 侯柏华; 张润杰

    2009-01-01

    番荔枝实蝇Ceratitis artortoe(Graham)是一种重要的外来人侵性检疫害虫.在广东口岸,其幼虫连续从入境旅客所携带的水果中被榆出.目前关于番荔枝实蝇潜在适生性分布的研究进行得很少,但对于我国的生物生态安全却有重要意义.本研究中,我们使用3种牛态位模型(ENFA模型,马氏典型性模型和Maxent模型)对番荔枝实蝇在中斟以及全球范尉内的潜在适生性分布区域进行了预测分析.结果显示:Maxent模型拥有最好的预测精确度,马氏典型件模型次之,而ENFA模型的预测精确度最差;Maxent模型和马氏典型性模型的预测精确度无显著性差异;根据Maxent模型的预测结果,番荔枝实蝇在中国的潜在适生区主要是广西、广东、海南以及云南的少部分地区.分析结果显示,番荔枝实蝇从境外传人中国南部地区并最终在上述地区定殖的风险可能性存在,但风险较小.另外,折刀法(Jackknife)分析显示,6种环境因子,例如地面霜冻频率、年平均降雨量、十月降雨量、四月降雨量、年最低温度以及蒸气压,对于番荔枝实蝇在全球和局部地区的分布模式有显著的影响.

  3. Prediction of the potential geographic distribution of Ceratitis rosa Karsch in China%利用CLIMEX预测纳塔尔实蝇在中国的潜在地理分布

    Institute of Scientific and Technical Information of China (English)

    张哲; 李志红; 万方浩; 倪文龙; 曲伟伟

    2011-01-01

    纳塔尔实蝇Ceratitis rosa Karsch属双翅目实蝇科腊实蝇属,为害30余种经济植物,被我国列为进境植物检疫性有害生物.本研究运用CLIMEX 3.0及ArcGIS 9.3对纳塔尔实蝇在我国目前及未来的潜在地理分布进行了预测.结果显示:在目前的气候条件下,纳塔尔实蝇在我国的潜在地理分布区为18.250°N~30.250°N,其中,华南和东南地区为高度潜在地理分布区,包括四川、重庆、云南、福建、广东、广西、海南以及台湾等地.在未来的气候条件下,2020和2050年潜在地理分布区的北界分别移至31.250°N和32.250°N,且中度潜在地理分布区北移明显;2100年潜在地理分布区的北界移至33.750°N,且高度适生区北移明显.因此建议目前应加强纳塔尔实蝇检疫措施,完善监测体系,监测网点主要设在我国的南方地区,尤其应对云南、广西、广东、福建和海南等地进行长期监测;同时,应对湖南、贵州、江西、湖北、江苏、安徽等省进行定期监测,严防该虫入侵.

  4. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 December 2009-31 January 2010.

    Science.gov (United States)

    Anderson, Cynthia M; Aparicio, Gallego J; Atangana, Alain R; Beaulieu, Jean; Bruford, M W; Cain, Forrest; Campos, T; Cariani, A; Carvalho, M A; Chen, Nan; Chen, P P; Clamens, A-L; Clark, Ann M; Coeur D'Acier, A; Connolly, Paul; Cordero-Rivera, Adolfo; Coughlan, James P; Cross, Thomas S; David, Bruno; DE Bruyn, Colin; DE Meyer, M; DE Ridder, Chantal; Delatte, H; Dettori, M T; Downer, S J; Dubreuil, Christine; Evans, K J; Fan, Bin; Ferrara, G; Gagné, André; Gaillard, Maria; Gigliarelli, L; Giovinazzi, J; Gomez, D R; Grünwald, N J; Hansson, Bengt; Huotari, T; Jank, L; Jousselin, E; Jungmann, L; Kaczmarek, M E; Khasa, Damase P; Kneebone, Jeff; Korpelainen, H; Kostamo, K; Lanfaloni, L; Lin, Haoran; Liu, Xiaochun; Lucentini, L; Maes, G E; Mahaffee, W F; Meng, Zining; Micali, S; Milano, I; Mok, H F; Morin, L; Neill, T M; Newton, Craig H; Gigi Ostrow, D; Palomba, A; Panara, F; Puletti, M E; Quarta, R; Quilici, S; Ramos, A K B; Rigaud, Thierry; Risterucci, A M; Salomon, Matthew P; Sánchez-Guillén, Rosa A; Sarver, Shane K; Sequeira, A S; Sforça, D A; Simiand, C; Smith, Brian; Sousa, A C B; Souza, A P; Stepien, C C; Stuckert, A J; Sulikowski, James; Tayeh, A; Tinti, F; Tsang, Paul C W; VAN Houdt, J K J; Vendramin, E; Verde, I; Virgilio, M; Wang, Huan L; Wang, L E; Wattier, Rémi A; Wellenreuther, Maren; Xie, Cong X; Zane, L; Zhang, Xiu J; Zhang, Yong; Zhuang, Zhimeng; Zucchi, M I

    2010-05-01

    This article documents the addition of 220 microsatellite marker loci to the Molecular Ecology Resources Database. Loci were developed for the following species: Allanblackia floribunda, Amblyraja radiata, Bactrocera cucurbitae, Brachycaudus helichrysi, Calopogonium mucunoides, Dissodactylus primitivus, Elodea canadensis, Ephydatia fluviatilis, Galapaganus howdenae howdenae, Hoplostethus atlanticus, Ischnura elegans, Larimichthys polyactis, Opheodrys vernalis, Pelteobagrus fulvidraco, Phragmidium violaceum, Pistacia vera, and Thunnus thynnus. These loci were cross-tested on the following species: Allanblackia gabonensis, Allanblackia stanerana, Neoceratitis cyanescens, Dacus ciliatus, Dacus demmerezi, Bactrocera zonata, Ceratitis capitata, Ceratitis rosa, Ceratits catoirii, Dacus punctatifrons, Ephydatia mülleri, Spongilla lacustris, Geodia cydonium, Axinella sp., Ischnura graellsii, Ischnura ramburii, Ischnura pumilio, Pistacia integerrima and Pistacia terebinthus.

  5. 两类甘蓝雄性不育系种子产量构成因素分析%Analysis of Seed Yield Components between Two Cabbage ( Brassica oleracea var.capitata L.) Male Sterile Lines

    Institute of Scientific and Technical Information of China (English)

    王庆彪; 方智远; 张扬勇; 刘玉梅; 杨丽梅; 庄木; 陈琛

    2011-01-01

    The differences of seed yield and component factors among dominant genie male sterile line DGMS02-12, cytoplasmic male sterile line CMSR302-12 and inbred line of cabbage ( Brassica oleracea var. Capitata L. ) 02-12 were studied. The results showed that the differences of seed yield per plant and plot yield between DGMS02-12 and CMSR302-12 were significant. The whole plant valid siliqua and seeds per siliqua were the main factors for the differences of seed yield between these two male sterile lines of cabbage. The seed yield at the 1st branch account for more than 80% of per plant seed yield, and there were significantly positive correlations and high path coefficient between seed yield and seeds per siliqua and the valid siliqua at the 1st branch.%以结球甘蓝自交系02-12及其回交转育多代育成的显性核基因雄性不育系(DGMS)和细胞质雄性不育系(CMS)为试材,对其制种产量及种子产量构成因素进行分析.结果表明:显性核基因雄性不育系材料DGMS02-12与细胞质雄性不育系材料CMSR302-12在单株产量和小区产量方面存在显著差异,并且全株有效荚数和每荚种子粒数是两种类型甘蓝雄性不育系间制种产量存在差异的主要构成因素.其中,一级分枝种子产量占单株产量的80%以上,一级分枝有效荚数、每荚种子粒数与制种产量有显著的相关性和较高的通径系数.

  6. Dicty_cDB: Contig-U16208-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 67428 ) FLD1_68_H08.g1_A029 Root flooded Pinus taeda cDNA... 38 0.76 2 ( CN753675 ) ID0AAA10DD04RM1 ApMS Acy...2 ( FG075806 ) UI-FF-IF0-abm-h-15-0-UI.r1 Ceratitis capitata emb... 34 0.77 2 ( CO159864 ) FLD1_16_B09.g1_A029 Root flood

  7. Effect of Magnetic Field on Brassica oleracea L. var. capitata L. Seed Germination and Studies on Its Mechanism%磁场对结球甘蓝种子萌发的影响及机理研究

    Institute of Scientific and Technical Information of China (English)

    崔路路; 于海霞; 李景富; 姜景彬; 许向阳

    2014-01-01

    以结球甘蓝种子为试材,采用正交试验和均匀试验方法,研究了磁场强度、作用时间及处理前种子浸泡时间对各发芽指标的影响以及各影响因素的主次顺序,并对磁场参数中磁场强度和作用时间进行大范围筛选,更进一步从可溶性蛋白含量、丙二醛含量、抗氧化酶活性等方面探讨磁场处理提高种子活力的作用机理。结果表明:适宜的磁场处理可以促进种子萌发,提高种子活力,以20℃蒸馏水浸泡8 h 后1000~3500 GS 磁场处理1~6 min 为宜,但长时间、大强度磁场处理反而抑制种子萌发;磁场强度为种子萌发的主要影响因子,作用时间和浸泡时间的主次顺序因发芽指标的不同而不同;与对照相比,磁场处理的种子萌发期间可溶性蛋白含量降低或升高的速率、MDA 含量下降的幅度和速率、3种抗氧化酶活性上升的速率均加快,从而提高种子活力。%Taking Brassica oleracea L. var. capitata L. seed as experimental material,the effect of magnetic field intensity,and magnetic acting time and seed soaking time before treatment on seed germination index and primary and secondary relations between all factors were studied by orthogonal test and uniform test method.Then the large scale screening of magnetic field intensity and magnetic acting time were carried out to further investigate the mechanism of using magnetic field treatment to improve seed vigor from the view points of soluble protein content,malondialdehyde content,and antioxidant enzyme activity.The results indicated that suitable magnetic field treatment could promote seed germination and improve seed vigor.Magnetic field intensity was the main factor affecting seed germination.The primary and secondary order of action time and soaking time were varied with different germination indexes. Seed germination was inhibited by too high magnetic field intensity for a long time. Soaking seed in 20

  8. Evaluating mating compatibility within fruit fly cryptic species complexes and the potential role of sex pheromones in pre-mating isolation

    Science.gov (United States)

    Juárez, M. Laura; Devescovi, Francisco; Břízová, Radka; Bachmann, Guillermo; Segura, Diego F.; Kalinová, Blanka; Fernández, Patricia; Ruiz, M. Josefina; Yang, Jianquan; Teal, Peter E.A.; Cáceres, Carlos; Vreysen, Marc J.B.; Hendrichs, Jorge; Vera, M. Teresa

    2015-01-01

    Abstract The study of sexual behavior and the identification of the signals involved in mate recognition between con-specifics are key components that can shed some light, as part of an integrative taxonomic approach, in delimitating species within species complexes. In the Tephritidae family several species complexes have received particular attention as they include important agricultural pests such as the Ceratitis fasciventris (Bezzi), Ceratitis anonae (Graham) and Ceratitis rosa Karsch (FAR) complex, the Bactrocera dorsalis (Hendel) complex and the Anastrepha fraterculus (Wiedemann) complex. Here the value and usefulness of a methodology that uses walk-in field cages with host trees to assess, under semi-natural conditions, mating compatibility within these complexes is reviewed, and the same methodology to study the role of chemical communication in pre-mating isolation among Anastrepha fraterculus populations is used. Results showed that under the same experimental conditions it was possible to distinguish an entire range of different outcomes: from full mating compatibility among some populations to complete assortative mating among others. The effectiveness of the methodology in contributing to defining species limits was shown in two species complexes: Anastrepha fraterculus and Bactrocera dorsalis, and in the case of the latter the synonymization of several established species was published. We conclude that walk-in field cages constitute a powerful tool to measure mating compatibility, which is also useful to determine the role of chemical signals in species recognition. Overall, this experimental approach provides a good source of information about reproductive boundaries to delimit species. However, it needs to be applied as part of an integrative taxonomic approach that simultaneously assesses cytogenetic, molecular, physiological and morphological traits in order to reach more robust species delimitations. PMID:26798257

  9. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea) em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea) in native forests and orchards in two counties of the State of Tocantins, Brazil

    OpenAIRE

    Darcy A. do Bomfim; Manoel A. Uchôa-Fernandes; Marcos A. L. Bragança

    2007-01-01

    Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002) com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De L...

  10. Ceratólise auto-imune em paciente com vasculite leucocitoclástica: apresentação atípica de erythema elevatum diutinum com padrão granulomatoso Autoimmune keratolysis in a patient with leucocytoclastic vasculitis: unusual erythema elevatum diutinum with granulomatous pattern

    Directory of Open Access Journals (Sweden)

    Fábio Henrique Cacho Casanova

    2000-06-01

    Full Text Available Contexto: A vasculite leucocitoclástica é uma doença que acomete pequenos vasos mais comumente associada a distúrbios do tecido conectivo, caracterizada clinicamente pela presença de lesões purpúricas palpáveis. Manifestações oftalmológicas são raras. Objetivo: Descrever quadro clínico de paciente portador de vasculite leucocitoclástica como manifestação incomum de padrão granulomatoso do erythema elevatum diutinum (EED. Relato de Caso: Paciente de 64 anos, masculino, apresentando baixa de acuidade visual e aparecimento de lesões nodulares em mãos. Ao exame oftalmológico, evidenciou-se afinamento corneano superior bilateral com perfuração corneana do olho esquerdo e espessamento da conjuntiva limbar em ambos os olhos, associada a intensa atividade inflamatória. Exame anatomopatológico da conjuntiva revelou vasculite granulomatosa com intenso exsudato neutrofílico, células gigantes multinucleadas, além de proliferação fibroblástica. Exame anatomopatológico de biopsia da pele evidenciou alterações semelhantes compatíveis com EED, porém não foi visto célula gigante sugerindo lesão granulomatosa. Conclusão: Ceratólise auto-imune secundária a vasculite leucocitoclástica cutânea (EED não havia sido descrito na literatura, tampouco encontramos referências sobre a reação granulomatosa (encontrada na conjuntiva em EED.Purpose: Leucocytoclastic vasculitis is an immune complex-mediated, small vessel disease, that is characterized clinically by the presence of palpable purpuric lesions, most often in association with rheumatic diseases. Ocular manifestations are rare. We describe a patient with an unusual granulomatous pattern of EED associated with autoimmune keratolysis. Case Report: A 64-year-old man with decreased visual acuity and nodular lesions in both hands. Ocular exami-nation presented bilateral superior corneal melting with perfuration in left eye and conjunctival thickness in both eyes, in

  11. 构建结球甘蓝K IN基因在叶绿体基因组定点表达的载体%Construction of Chloroplast Site-specific Integration Expression Vector Harboring KIN Gene of Cabbage (Brassica oleracea L. var. capitata L.)

    Institute of Scientific and Technical Information of China (English)

    陶鹏; 黄小云; 李必元; 王五宏; 岳智臣; 雷娟利; 钟新民

    2015-01-01

    获得叶绿体基因组定点整合表达载体是开展结球甘蓝叶绿体基因组的遗传转化研究的第一步。本研究克隆了CMS结球甘蓝的抗冻蛋白K IN基因,发现该基因定位于结球甘蓝的2号染色体上。通过构建中间载体pKA和pAI,将K IN基因的编码区构建到了CMS结球甘蓝叶绿体基因组定点整合表达载体pIKAA中。该载体以TrnA 和TrnI基因片段作为同源整合片段,能整合到CMS结球甘蓝叶绿体基因组中。此外,该载体是双顺反子形式的,即在转录的单条mRNA上,同时包含了K IN和aadA 基因编码区。将pIKAA转化到大肠杆菌中,结果显示转化有该载体的大肠杆菌能够在含有氨苄青霉素(AMP)和壮观霉素(SPEC)的固体LB平板中生长。研究结果可为后期CMS结球甘蓝叶绿体基因组的遗传转化体系的建立奠定基础。%To construct chloroplast site-specific integration expression vector is the first step for carrying on genetic transformation of cabbage chloroplast genome (Brassica oleracea L. var. capitata L.). In this study, antifree-ze protein KIN gene was cloned from cytoplasmic male sterility (CMS) cabbage (Brassica oleracea L. var. capitata L.), and was located in 2 chromosome in B. oleracea genome. By constructing the intermediate vector pKA and pAI, coding region of KIN gene was inserted into the site-specific integration expression vector (pIKAA) of CMS cabbage chloroplast. Due to the fragments of TrnA and TrnI used as homologous integration fragments, the pIKAA could target to chloroplast genomes of CMS cabbage. In addition, the pIKAA vector was bicistronic. The single transcribed mRNA from the pIKAA vector contained simultaneously coding regions of KIN and aadA gene. The vector was transformed into E. coli that can grow in LB containing ampicillin and spectinomycin. The study might lay essential basis in establishment of genetic transformation system of chloroplast genome of CMS cabbage.

  12. Cloning and Expression of an Ogura Cytoplasmic Male Sterile (OguCMS)-related MYB Transcription Factor in Brassica oleracea var.capitata%甘蓝胞质雄性不育(OguCMS)相关的MYB转录因子BoMYB1的克隆与表达分析

    Institute of Scientific and Technical Information of China (English)

    张磊; 康宗利; 刘海霞; 康俊根

    2012-01-01

    Ogura cytoplasmic male sterile (OguCMS) is the most widely used male sterile type in cabbage breeding. MYB transcription factors play a key role in regulation of plant defense response and multiple development processes. In present experiment, a R2R3-MYB transcription factor which down regulated 10.3 times in cabbage (Brasska okracea var. capitata) OguCMS lines was cloned by SMART RACE strategy.The full-length cDNA of B0MYB1 was 1 141 bp, which contained a 196 bp long 5' untranslated region, a 246 bp long 3' untranslated region and a 699 bp long open reading frame (GenBank accession number: JN703995). It was localized in the nucleus by subcellular localization prediction. It was an anther preferentially expressed gene in cabbage, which reached its expression peak in the late development. It was induced by the regulation of plant hormones salicylic acid(SA) and jasmonate methyl (JA-ME), and consequently regulated the expression of anther development genes. The experimental results suggests that B0MYB1 may be one of the important genes which involved in OguCMS anther development.%萝卜胞质雄性不育(OguCMS)是目前甘蓝中应用较广的雄性不育类型,MYB转录因子具有调控植物防御应答反应和多个发育过程的作用.本实验以在甘蓝(Brassica oleracea var.capitata)OguCMS花药中下调10.3倍的EST序列为信息探针,结合电子克隆及RACE技术,得到一个与甘蓝OguCMS雄性不育相关的MYB转录因子全长cDNA,命名为BoMYB1(GenBank登录号:JN703995).经亚细胞定位预测,该基因定位于细胞核,全长1 141 bp,包含一个长度为196 bp的5’非翻译区、246 bp的3’非翻译区和一个699 bp的开放阅读框.该基因在花药中具表达优势,并在花药发育晚期出现表达高峰,受植物激素水杨酸(SA)和茉莉酸甲酯(JA-ME)的调控,诱导花药发育基因的表达.实验结果提示,BoMY B1可能是参与OguCMS花药发育的重要基因之一.

  13. Contribución al Conocimiento de las Moscas de las Frutas (Tephritidae y sus Parasitoides en el Departamento de Antioquia

    Directory of Open Access Journals (Sweden)

    Yepes R. Francisco

    1989-12-01

    Full Text Available Las moscas de las frutas constituyen, como grupo, la plaga insectil mas importante de estos cultivos en Colombia y en el mundo. Además de Anastrepha spp., la especie más dañina dentro de las verdaderas moscas de las frutas (Tephritidae, la mosca del Mediterráneo, fue detectada por primera vez en Colombia en 1986 y confirmada su presencia en Antioquia en abril de 1987. El trabajo se realizó en tres fases simultáneamente; una de campo (11 regiones, otra de laboratorio (procesamiento de muestras y la tercera consistió en la obtención de la identificación de las especies (moscas y parasitoides Los resultados fueron: 1.la especie más distribuida y frecuentemente registrada en mayor número de hospedantes fue Anastrepha striata; fue reportada por primera vez en guayabo anselmo (Campomanesia cornifolia y guayabo de mono (Bellucia axinanthera, 2.la especie que ataca a B. axinanthera en el nordeste y oriente antioqueños es A sp. "F-]", aparentemente no descrita y considerada dentro de un grupo actualmente bajo revisión, 3.en total se encontraron 13 especies diferentes de Tephritidae (incluyendo los géneros de Anastrepha, Ceratitis y Toxotrypana y siete especies de Lonchaeidae (Neosilba spp. y Dasiops spp., 4.dentro de los parasitoides de larva-pupa de Anastrepha spp. se destacan: Doryctobracon areolatus y D. crawfordi¡ Opius anastrephae, Asobara anastrephaey Microcrasis sp. pertenecientes a la familia Braconidae y Aganaspis pelleranoi (Eucoilidae y Aceratoneuromyia indicum (Eulophidae.

  14. Hongos de importancia agrícola presentes en moscas de la fruta del valle de Ica, Perú

    Directory of Open Access Journals (Sweden)

    Carlos E. Tipismana

    2013-05-01

    Full Text Available El objetivo del presente trabajo fue aislar e identificar hongos de especímenes de moscas de la fruta de los géneros Ceratitis (Macleay y Anastrepha (Schiner, del valle de Ica, Perú. Se aislaron hongos pertenecientes a los géneros Alternaria, Aspergillus, Cladosporium, Mucor, Penicillium, Rhizoctonia, Rhizopus y Trichoderma;así como levaduras y micelios estériles. Los recuentos de hongos presentaron rangos entre 8x103 a 8x104 UFC/g para el género Ceratitis; y 7x103 a 7x104 UFC/g para el género Anastrepha. El IVI% (Índice de Valor de Importancia demostró que Cladosporium es el género con mayor valor ecológico con un 78,05%. El Índice de Similitud de especies de hongos entre ambos géneros de mosca de la fruta analizados fue 0,5. Los resultados obtenidos confirman la presencia de hongos en moscas de la fruta; y se deduce el posible impacto de estos dípteros en el área agrícola como potenciales agentes vectores de enfermedades fúngicas para los cultivos locales de importancia económica.

  15. Control of medfly by SIT in the Nereva river valley

    Energy Technology Data Exchange (ETDEWEB)

    Bjelis, Mario, E-mail: mario.bjelis@zzb.h [Institut for Plant Protection in Agriculture and Foresty of Republic of Croatia, Zagreb, Zvonimirova (Croatia); Ljubetic, Visnja [Ministry of Agriculture, Forestry and Watter Managment of Republic of Croatia, Zagreb (Croatia); Novosel, Nevenka [State Office for Nuclear Safety, Zagreb (Croatia)

    2006-07-01

    A feasibility study of medfly suppression by means of sterile males released program in the Neretva Vallley, Croatia, is presented. The increase of medfly infestation is considered, as almost all cultures of the region represent host plants for the insect. Environmental friendly methods such well developed SIT technique associated with other organic methods are mentioned as an option of no disruption of the present natural balance. Area study and strategy planning is briefly presented. Population dynamics of Ceratitis capitata in the different parts of the delta Neretva valley, during period 2002 - 2004 Year is reported. Medfly capture on selected locations with different host availability in Neretva river is studied. (MAC)

  16. 夏威夷岛果蝇的综合防治

    Institute of Scientific and Technical Information of China (English)

    夏禹

    2003-01-01

    @@ 夏威夷地区受温暖潮湿气候的影响,外来引进的水果和蔬菜几乎全年都处在生长茂盛期.然而,一部分亚热带果蝇害虫也同样始终处于繁育旺期,其中包括桔小实蝇(Chaetodacus dorsalis)、甜瓜实蝇(Bactroceral latifrons)、地中海实蝇(Ceratitis capitata)和茄科(马来西亚)果蝇(Bactocerala tifrons).

  17. The importance of recognizing and reporting sequence database contamination for proteomics

    Directory of Open Access Journals (Sweden)

    Olivier Pible

    2014-06-01

    Full Text Available Advances in genome sequencing have made proteomic experiments more successful than ever. However, not all entries in a sequence database are of equal quality. Genome sequences are contaminated more frequently than is admitted. Contamination impacts homology-based proteomic, proteogenomic, and metaproteomic results. We highlight two examples in the National Center for Biotechnology Information non-redundant database (NCBInr that are likely contaminated: the bacterium Enterococcus gallinarum EGD-AAK12 and the insect Ceratitis capitata. We hope to incite users of this and other databases to critically evaluate submitted sequences and to contribute to the overall quality of the database by signaling potential errors when possible.

  18. A Sterile Insect Technique (S.I.T.) Study Project to control Medfly in a Southern region of Italy

    Energy Technology Data Exchange (ETDEWEB)

    Tata, A.; Cirio, U.; Balducci, R. [ENEA, Centro Ricerche Casaccia, Rome (Italy). Dipt. Innovazione

    1997-12-01

    Since 1967 the National Agency for New Technology, Energy and the Environment (ENEA) namely the main Italian governmental technological research organization, is carrying out R and D programmes and demonstrative projects aimed to set up S.I.T. (Sterile Insect Technique) processes. In the framework of a world-wide growing interest concerning pest control technology, the National Agency for New Technology, Energy and the Environment (ENEA) developed a very large industrial project aimed to control Medfly (Ceratitis capitata Wied.) with reference to fruit crops situation in Sicily region (Southern of Italy) through the production and spreading of over 250 million sterile flies per week.

  19. Diets based on soybean protein for Mediterranean fruit fly

    Energy Technology Data Exchange (ETDEWEB)

    Sobrinho, Raimundo Braga [Embrapa Agroindustria Tropical, Rua Dra. Sara Mesquita, 2270, CEP 60511-110 Fortaleza, CE (Brazil)]. E-mail: braga@cnpat.embrapa.br; Caceres, Carlos; Islam, Amirul; Wornoayporn, Vivat [Food and Agriculture Organization (FAO), International Atomic Energy Agency (IAEA), Agriculture and Biotechnology Laboratory, A-2444 Seibersdorf (Austria)]. E-mail: C.Caceres@iaea.org; Enkerlin, Walter [Insect Pest Control Section, Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, Vienna (Austria)]. E-mail: W.Enkerlin@iaea.org

    2006-04-15

    The objective of this work was to develop suitable and economic diets for mass rearing Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae). Diets containing sugar beet bagasse, wheat bran, brewer yeast, and others with wheat bran and palletized soybean protein from Brazil were tested. Diets based on soybean protein have shown promising results regarding pupal recovery, pupal weight and adult emergence. Soybean bagasse in the form of pellets with 60% of protein can be a very important substitute for other expensive sources of protein. (author)

  20. Seasonality of the Mediterranean Fruit Fly (Diptera: Tephritidae) on Terceira and Sao Jorge Islands, Azores, Portugal

    Science.gov (United States)

    Pimentel, R.; Lopes, D.J.H.; Mexia, A.M.M.; Mumford, J.D.

    2017-01-01

    Population dynamics studies are very important for any area-wide control program as they provide detailed knowledge about the relationship of Medfly [Ceratitis capitata (Wiedemann)] life cycle with host availability and abundance. The main goal of this study is to analyse seasonality of C. capitata in Terceira and Sao Jorge Islands (Azores archipelago) using field and laboratory data collected during (2010–2014) CABMEDMAC (MAC/3/A163) project. The results from Sao Jorge Island indicate significantly lower male/female ratio than on Terceira Island. This is an important finding specially regarding when stablishing the scenario parameters for a sterile insect technique application in each island. The population dynamics of C. capitata are generally linked with host fruit availability and abundance. However, on Terceira Island fruit infestation levels are not synchronized with the trap counts. For example, there was Medfly infestations in some fruits [e.g., Solanum mauritianum (Scop.)] while in the nearby traps there were no captures at the same time. From this perspective, it is important to denote the importance of wild invasive plants, on the population dynamics of C. capitata, as well important to consider the possibility of having different densities of traps according to the characteristics of each area in order to improve the network of traps surveillance’s sensitivity on Terceira Island. PMID:28082349

  1. Population fluctuation of fruit flies (Diptera, Tephritidae in peach and passion fruit orchards in Iraceminha, Santa Catarina

    Directory of Open Access Journals (Sweden)

    Sheila Alberti

    2012-06-01

    Full Text Available The objective of this study was learn more about the population fluctuation of fruit flies in peach and passion fruit orchards in the municipality of Iraceminha, Santa Catarina. In order to carry out the survey, McPhail traps were set up with 10% inverted glucose from April 2006 to March 2007. Captured flies were identified at the Laboratório de Entomologia at UNOCHAPECÓ. The collected females belonged to twelve species and four genera. The adults of Anastrepha fraterculus were trapped during all seasons, with a population peak in October 2006 in the peach orchards. The population levels of Anastrepha grandis remained higher during the first five months in the passion fruit orchard. There were low infestation rates by flies of the genera Ceratitis, Blepharoneura and Tomoplagia when compared to flies of the genus Anastrepha. The results showed that the presence of flies in the orchards was associated with the availability of host fruit and not with climatic conditions.

  2. Nanostructured composite materials of cerium oxide and barium cerate

    Science.gov (United States)

    Medvedev, D. A.; Pikalova, E. Yu.; Demin, A. K.; Khrustov, V. R.; Nikolaenko, I. V.; Nikonov, A. V.; Malkov, V. B.; Antonov, B. D.

    2013-02-01

    Nanosized powders with a composition of (1- x)Ce0.8Sm0.2O2-δ- xBace0.8Sm0.2O3-δ ( x = 0, 0.3, and 1) were obtained by self-ignition combustion synthesis (SICS) from the appropriate nitrates and various organic fuels (glycine, glycerol, citric acid, and a mixture of citric acid and ethylene glycol). The most finely dispersed powders formed when the concentration of the perovskite phase in the system decreased or when glycerol or citric acid-enthyleneglycol mixture was used as a fuel during SICS. A procedure for the preparation of powders and nanostructured ceramics was developed and their electric properties were studied.

  3. Preparation of Nd-doped barium cerate through different routes

    DEFF Research Database (Denmark)

    Chen, F.L.; Toft Sørensen, O.; Meng, G.Y.;

    1997-01-01

    BaCe0.9Nd0.1O3-delta was prepared through different routes: oxalate coprecipitation (OF), carbonate-oxide mixed by ball-milling (COB) and carbonate-oxide mixed by mortar/pestle (COM). The reaction process studied by DTA-TG and XRD showed that calcination of the precursor powders at T greater than...... density and open porosity indicated that the calcination temperature had a major influence on the sintering process for all the three routes. The calcined powders from OP and COB had small particle size, large surface area and good sinterability, while those from COM had large particle size, small surface...

  4. Diets based on soybean protein for Mediterranean fruit fly Dietas baseadas em proteína de soja para moscas do Mediterrâneo

    Directory of Open Access Journals (Sweden)

    Raimundo Braga Sobrinho

    2006-04-01

    Full Text Available The objective of this work was to develop suitable and economic diets for mass rearing Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae. Diets containing sugar beet bagase, wheat bran, brewer yeast, and others with wheat bran and palletized soybean protein from Brazil were tested. Diets based on soybean protein have shown promising results regarding pupal recovery, pupal weight and adult emergence. Soybean bagase in the form of pellets with 60% of protein can be a very important substitute for other expensive sources of protein.O objetivo deste trabalho foi desenvolver dietas adequadas e econômicas para a criação massal de moscas de frutas do Mediterrâneo, Ceratitis capitata (Diptera: Tephritidae. Foram testados dietas com bagaço de beterraba açucareira, farelo de trigo, levedura de cerveja e outras dietas de farelo de trigo e proteína de soja prensada brasileira. Dietas compostas por proteína de soja apresentaram resultados positivos de recuperação de pupas, pesos de pupa e emergência de adultos. O bagaço de soja, na forma de pellet com 60% de proteína, pode ser um importante substituto de outras fontes de proteína.

  5. The hydrocoral genus Millepora (Hydrozoa: Capitata: Milleporidae) in Indonesia

    NARCIS (Netherlands)

    Razak, T.B.; Hoeksema, B.W.

    2003-01-01

    This revision of Indonesian Millepora species is based on the morphology of museum specimens and photographed specimens in the field. Based on the use of pore characters and overall skeleton growth forms, which are normally used for the classification of Millepora, the present study concludes that s

  6. Dispersal capacity of fruit fly parasitoid Diachasmimorpha longicaudata (Hymenoptera: Braconidae in irrigated coffee plantations

    Directory of Open Access Journals (Sweden)

    Maria Gisely Camargos

    2016-06-01

    Full Text Available ABSTRACT Diachasmimorpha longicaudata is an Old World parasitoid of tephritid fruit flies that was widely introduced in the Americas to control pest species such as the Mediterranean fruit fly Ceratitis capitata. Augmentative releases in irrigated coffee plantations in semiarid regions of Brazil are under consideration and dispersal capacity of D. longicaudata in this habitat are important to develop release strategies. Approximately 2,000 individuals of D. longicaudata (5 to 7 days old were released in the center of a fruiting coffee plantation every two weeks from Dec. 2009 to Apr. 2010. Dispersal from the central release point was monitored to the north, south, east, west, northeast, northwest, southeast and southwest at 11 distances, beginning at 4.6 m and ending at 90 m from the release point. At each point, a parasitism unit (approximately 120 larvae of C. capitata in the 3rd instar wrapped in voile fabric and 10 coffee beans were collected. The average dispersion distance and dispersion area were estimated by the model proposed by Dobzhansky and Wright (1943. The average dispersion distances were 27.06 m (as estimated by fruit collection and 33.11 m (as estimated by oviposition traps. The average dispersion areas were 1,315.25 m2 and 1,752.45 m2 originating from the collection of beans and parasitism units, respectively. Cohorts of 2,000 adult D. longicaudata released at six points ha−1 are estimated to result in sufficient colonization to exert significant control of Ceratitis capitata.

  7. Vertically transmitted rhabdoviruses are found across three insect families and have dynamic interactions with their hosts

    Science.gov (United States)

    Day, Jonathan P.; Schulz, Nora; Leftwich, Philip T.; de Jong, Maaike A.; Wilfert, Lena; Smith, Sophia C. L.; McGonigle, John E.; Houslay, Thomas M.; Livraghi, Luca; Evans, Luke C.; Friend, Lucy A.; Vontas, John; Kambouraki, Natasa

    2017-01-01

    A small number of free-living viruses have been found to be obligately vertically transmitted, but it remains uncertain how widespread vertically transmitted viruses are and how quickly they can spread through host populations. Recent metagenomic studies have found several insects to be infected with sigma viruses (Rhabdoviridae). Here, we report that sigma viruses that infect Mediterranean fruit flies (Ceratitis capitata), Drosophila immigrans, and speckled wood butterflies (Pararge aegeria) are all vertically transmitted. We find patterns of vertical transmission that are consistent with those seen in Drosophila sigma viruses, with high rates of maternal transmission, and lower rates of paternal transmission. This mode of transmission allows them to spread rapidly in populations, and using viral sequence data we found the viruses in D. immigrans and C. capitata had both recently swept through host populations. The viruses were common in nature, with mean prevalences of 12% in C. capitata, 38% in D. immigrans and 74% in P. aegeria. We conclude that vertically transmitted rhabdoviruses may be widespread in a broad range of insect taxa, and that these viruses can have dynamic interactions with their hosts. PMID:28100819

  8. Chemosterilant bait stations coupled with sterile insect technique: an integrated strategy to control the Mediterranean fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Vacas, S; Sanchis, J; Primo, J; Alfaro, C

    2011-10-01

    During 2008 and 2009, the efficacy of the combination of two Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), control techniques, sterile insect technique (SIT) and a chemosterilant bait station system (Adress), was tested in three crops: citrus (Citrus spp.), stone fruit (Prunus spp.), and persimmon (Diospyros spp.). Two thousand sterile males were released per ha each week in the whole trial area (50,000 ha, SIT area). For 3,600 ha, within the whole trial area, 24 Adress traps per ha were hung (SIT + Adress area). Ten SIT + Adress plots and 10 SIT plots in each of three different fruit crops were arranged to assess Mediterranean fruit fly population densities and fruit damage throughout the trial period. To evaluate the efficacy of each treatment, the male and female populations were each monitored from August 2008 to November 2009, and injured fruit was assessed before harvest. Results showed a significant reduction in the C. capitata population in plots treated with both techniques versus plots treated only with the SIT. Likewise, a corresponding reduction in the percentage of injured fruit was observed. These data indicate the compatibility of these techniques and suggest the possibility of using Adress coupled with SIT to reduce C. capitata populations in locations with high population densities, where SIT alone is not sufficiently effective to suppress fruit fly populations to below damaging levels.

  9. Tephritid Integrative Taxonomy: Where We Are Now, with a Focus on the Resolution of Three Tropical Fruit Fly Species Complexes.

    Science.gov (United States)

    Schutze, Mark K; Virgilio, Massimiliano; Norrbom, Allen; Clarke, Anthony R

    2017-01-31

    Accurate species delimitation underpins good taxonomy. Formalization of integrative taxonomy in the past decade has provided a framework for using multidisciplinary data to make species delimitation hypotheses more rigorous. We address the current state of integrative taxonomy by using as a case study an international project targeted at resolving three important tephritid species complexes: Bactrocera dorsalis complex, Anastrepha fraterculus complex, and Ceratitis FAR (C. fasciventris, C. anonae, C. rosa) complex. The integrative taxonomic approach has helped deliver significant advances in resolving these complexes: It has been used to identify some taxa as belonging to the same biological species as well as to confirm hidden cryptic diversity under a single taxonomic name. Nevertheless, the general application of integrative taxonomy has not been without issue, revealing challenges that must be considered when undertaking an integrative taxonomy project. Scrutiny of this international case study provides a unique opportunity to document lessons learned for the benefit of not only tephritid taxonomists, but also the wider taxonomic community.

  10. Dicty_cDB: Contig-U03803-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH260-90L04_SP6 CHORI-260 Meleagris gallopavo gen... 46 2.5 1 ( ES222208 ) MpGVN_ag3_A19 Myzus persicae, li...ne G006, PLRV fre... 46 2.5 1 ( DW013102 ) w18o20_M13F Myzus persicae, tobacco lineage, whol... 46 2.5 1 ( C...( ES219391 ) MpGnorm_ag3_H23 Myzus persicae, tobacco lineage, ... 40 4.5 2 ( AM48...4.9 2 ( ES220416 ) MpGnorm_ag6_I23 Myzus persicae, tobacco lineage, ... 40 5.1 2 ( ES222123 ) MpGVN_ag2_M12 Myzus persicae...-UI.r1 Ceratitis capitata emb... 42 5.9 2 ( ES451001 ) 25971 Myzus persicae 2001-12 (red), Fenton Myzus ...

  11. Dicty_cDB: Contig-U15493-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 41 7 ( FG076080 ) UI-FF-IF0-abn-h-19-0-UI.r1 Ceratitis capitata emb... 68 7e-41 7 ( EE009975 ) ROE00005661 Rhizopus oryzae Company...es ratti PA female naive SL... 88 4e-38 3 ( EE008512 ) ROE00004371 Rhizopus oryzae Company Rhizopus oryz... ..... 76 6e-36 5 ( EE007004 ) ROE00004237 Rhizopus oryzae Company Rhizopus oryz... 52 1e-35 6 ( DY886601 ) Cele...1525 ) Lysiphlebus testaceipes ribosomal protein L8 (RpL... 88 2e-34 5 ( EE008341 ) ROE00002957 Rhizopus oryzae Company... 4 ( EE004477 ) ROE00008423 Rhizopus oryzae Company Rhizopus oryz... 52 2e-32 6 ( EE004269 ) ROE00008327 Rhizopus oryzae Company

  12. Masters change, slaves remain.

    Science.gov (United States)

    Graham, Patricia; Penn, Jill K M; Schedl, Paul

    2003-01-01

    Sex determination offers an opportunity to address many classic questions of developmental biology. In addition, because sex determination evolves rapidly, it offers an opportunity to investigate the evolution of genetic hierarchies. Sex determination in Drosophila melanogaster is controlled by the master regulatory gene, Sex lethal (Sxl). DmSxl controls the alternative splicing of a downstream gene, transformer (tra), which acts with tra2 to control alternative splicing of doublesex (dsx). DmSxl also controls its own splicing, creating an autoregulatory feedback loop that ensures expression of Sxl in females, but not males. A recent paper has shown that in the dipteran Ceratitis capitata later (downstream) steps in the regulatory hierarchy are conserved, while earlier (upstream) steps are not. Cctra is regulated by alternative splicing and apparently controls the alternative splicing of Ccdsx. However, Cctra is not regulated by CcSxl. Instead it appears to autoregulate in a manner similar to the autoregulation seen with DmSxl.

  13. Effect of X-ray irradiation on fruit quality of clementine mandarin cv. 'Clemenules'

    Energy Technology Data Exchange (ETDEWEB)

    Alonso, Miquel [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain); Palou, Lluis [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain)]. E-mail: lluis.palou@ivia.es; Angel del Rio, Miguel [Centre de Technologia Postcollita, Institut Valencia d' Investigacions Agraries (IVIA), Ctra. de Montcada a Naquera, km. 4.5, E-46113 Montcada, Valencia (Spain); Jacas, Josep-Anton [Departament de Ciencies Experimentals, Universitat Jaume I (UJI), Campus del Riu Sec, E-12071 Castello de la Plana (Spain)

    2007-10-15

    The effects of a potential quarantine treatment consisting of exposure to X-ray irradiation against the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) on 'Clemenules' mandarin quality are presented and compared with those from the standard cold temperature quarantine treatment. X-ray irradiation doses of 0.195 and 0.395 kGy had no detrimental effects on fruit quality (rind color, firmness, juice yield, maturity index, internal volatiles, deterioration index and sensory evaluation). These results therefore indicate that X-ray irradiation is a harmless and highly effective quarantine technique for clementine mandarin and this technique could be as useful as the current cold treatment for 'Clemenules' mandarins.

  14. Essential oils composition of two Sicilian cultivars of Opuntia ficus-indica (L.) Mill. (Cactaceae) fruits (prickly pear).

    Science.gov (United States)

    Zito, Pietro; Sajeva, Maurizio; Bruno, Maurizio; Rosselli, Sergio; Maggio, Antonella; Senatore, Felice

    2013-01-01

    The essential oils composition of the skin, pulp and seeds from fruits of two Sicilian cultivars of Opuntia ficus-indica (cv. Sanguigna and cv. Surfarina) has been obtained by hydrodistillation and the possible antioxidant, antimicrobial and semiochemical roles have been investigated comparing the data with those reported in the literature. The presence of antioxidants and antimicrobials found in this study increases the spectrum of compounds that have beneficial properties in O. ficus-indica. In addition, several compounds identified in this study have been reported to influence the behaviour of Ceratitis capitata, a phytophagous pest which causes severe damages to several crops including O. ficus-indica and the kairomonal activity of the odour of the fruits seems provided by a blend of compounds found in the various matrices analysed.

  15. Effect of X-ray irradiation on fruit quality of clementine mandarin cv. ‘Clemenules’

    Science.gov (United States)

    Alonso, Miquel; Palou, Lluís; Ángel del Río, Miguel; Jacas, Josep-Anton

    2007-10-01

    The effects of a potential quarantine treatment consisting of exposure to X-ray irradiation against the Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) on 'Clemenules' mandarin quality are presented and compared with those from the standard cold temperature quarantine treatment. X-ray irradiation doses of 0.195 and 0.395 kGy had no detrimental effects on fruit quality (rind color, firmness, juice yield, maturity index, internal volatiles, deterioration index and sensory evaluation). These results therefore indicate that X-ray irradiation is a harmless and highly effective quarantine technique for clementine mandarin and this technique could be as useful as the current cold treatment for 'Clemenules' mandarins.

  16. Overview of prohibited and permitted plant regulatory listing systems

    Science.gov (United States)

    Westbrooks, Randy G.; Tasker, Alan V.

    2011-01-01

    Pest risk analysis is a process that evaluates the risks involved with a proposed species to help determine whether it should be permitted or denied entry into a country, and how the risks could be managed if it is imported. The prohibited listing approach was developed in the late 1800s and early 1900s in response to outbreaks of plant and animals pests such as foot and mouth disease of livestock, Mediterranean fruitfly (Ceratitis capitata Wiedemann), and Gypsy moth (Lymantria dispar L.). Under this approach, selected species of concern are evaluated to determine if they should be regulated for entry. Under the permitted listing approach that was first used on a national level in Australia in the 1990s, all species that are proposed for introduction are assessed to determine if they should be regulated.

  17. 福州实蝇监测初报%A preliminary report on the monitoring of Bactrocera in Fuzhou

    Institute of Scientific and Technical Information of China (English)

    林惠敏; 陈艳; 范青海

    2006-01-01

    自2005年5月29日至2006年5月28日在福州金山福建农林大学校园内进行了实蝇监测.采用甲基丁香酚(Me)、诱蝇酮(Cue)和地中海实蝇诱芯(T),诱集到橘小实蝇[Bactrocera(Bactrocera)dorsalis]、瓜实蝇[B.(Zeugodacus)cucurbitae]、南瓜实蝇[B.(Zeugodacus)tau]和具条实蝇(B.scutellata)4种实蝇,但未诱到地中海实蝇(Ceratitis capitata).其中,橘小实蝇诱集量最大,8月中下旬达到高峰.本研究为掌握福州地区实蝇发生动态提供了基础资料.

  18. A Computer Model of Insect Traps in a Landscape

    Science.gov (United States)

    Manoukis, Nicholas C.; Hall, Brian; Geib, Scott M.

    2014-11-01

    Attractant-based trap networks are important elements of invasive insect detection, pest control, and basic research programs. We present a landscape-level, spatially explicit model of trap networks, focused on detection, that incorporates variable attractiveness of traps and a movement model for insect dispersion. We describe the model and validate its behavior using field trap data on networks targeting two species, Ceratitis capitata and Anoplophora glabripennis. Our model will assist efforts to optimize trap networks by 1) introducing an accessible and realistic mathematical characterization of the operation of a single trap that lends itself easily to parametrization via field experiments and 2) allowing direct quantification and comparison of sensitivity between trap networks. Results from the two case studies indicate that the relationship between number of traps and their spatial distribution and capture probability under the model is qualitatively dependent on the attractiveness of the traps, a result with important practical consequences.

  19. Identification of Fruit Fly Low Instar Larvae in Imported Red Pepper%进境辣椒中低龄辣椒实蝇幼虫的鉴定

    Institute of Scientific and Technical Information of China (English)

    孙涛; 陆丽华; 滕少娜; 邓朝晖; 赵野; 刘宏; 孔德英

    2013-01-01

    自菲律宾进境旅客携带的小红辣椒中截获1头低龄实蝇幼虫.分别用辣椒实蝇(Bactrocera latifrons)、橘小实蝇(B.dorsalis)和地中海实蝇(Ceratitis capitata)的特异性引物lati1/lati2、PF-1/PF-2和CCCA-COL-L/CCCA-COL-R对样品总DNA进行PCR扩增和测序后,与Genbank中已知序列比对,结果表明该实蝇与Genbank中辣椒实蝇(FJ903498.1)的同源性达99%.结合形态学特征,确认截获的样本为辣椒实蝇(Bactrocera latifrons).

  20. Environ: E00691 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00691 Cyathula capitata root Crude drug Cyathula capitata, Cyathula [TAX:221765] Amaranthaceae (amaranth... family) Cyathula capitata root (dried) Crude drugs [BR:br08305] Dicot plants: others Amaranthaceae (amaranth family) E00691 Cyathula capitata root ...

  1. Solar sterilization of abscised fruit: a cultural practice to reduce infestations of Anastrepha obliqua around orchards

    Science.gov (United States)

    Abscised mangoes, Mangifera indica L., of several varieties were stored under varying conditions of insolation, including no sun (stored in a laboratory), shade (stored under the shade of a mango tree), full sun (stored in direct view of the sun), and covered in a black plastic bag and stored in dir...

  2. Contribución al estudio de las moscas anastrephas en colombia.

    OpenAIRE

    González Mendoza, Rafael

    2012-01-01

    1. Colombia tiene amplias posibilidades de desarrollar una industria frutícola floreciente dadas las excepcionales condiciones de ubicación geográfica, diversidad de climas y de suelos. 2. La deficiente producción frutera actual es el resultado de una reunión de factores adversos, entre los que resalta el desconocimiento de los problemas científicos que afectan a dicha industria. En este aspecto, los problemas fitosanitarios, abandonados y faltos de investigación, ocupan lugar preponder...

  3. Response of Anastrepha suspensa to liquid protein baits and synthetic lure formulations

    Energy Technology Data Exchange (ETDEWEB)

    Epsky, Nancy D.; Kendra, Paul E.; Heath, Robert R., E-mail: Nancy.Epsky@ars.usda.go, E-mail: Paul.Kendra@ars.usda.go, E-mail: Bob.Heath@ars.usda.go [U.S. Department of Agriculture (USDA/ARS/SHRS), Miami, FL (United States). Agricultural Research Service. Subtropical Horticulture Research Station

    2006-07-01

    Traps baited with AAPt captured more A. suspensa than traps baited with ABPt even when the ammonia release rates were similar. Reducing dosage of ammonia by 50% of the commercially available AA lure slightly increased female capture, but reducing dosage to 25% tended to decrease female capture. The 5% CPH/3% borax bait captured the same number of flies as TYB, and was more effective than 10% CPH/3% borax. Further decreasing the amount of borax added to CPH may improve its effectiveness. As has been observed in field tests, fresh TYB captures more A. suspensa than fresh Nulure/borax but this difference decreases as the bait solutions age. EAG analysis indicates that volatiles from fresh Nulure/ borax elicit a higher antennal response than TYB, but this difference decreases as the TYB solution ages. Chemical analysis will be needed to determine the nature of reduced capture by fresh Nulure/borax and to identify additional attractive chemicals emitted by these protein baits. (author)

  4. Pro-apoptotic gene regulation in the Caribbean fruit fly, Anastrepha suspensa

    Science.gov (United States)

    Transcriptional activation of pro-apoptotic genes in response to cytotoxic stimuli is a conserved feature of the cell death pathway proposed for metazoans. However, understanding the extent of this conservation in insects, as well as other organisms, has been limited by the lack of known pro-apoptot...

  5. Mass-rearing of Mediterranean fruit fly using low-cost yeast products produced in Brazil

    Directory of Open Access Journals (Sweden)

    Alberto Moreira da Silva Neto

    2012-12-01

    Full Text Available Ceratitis capitata is one of the most important pests of fruits for exportation, and Sterile Insect Technique (SIT has been the most efficient and environmental friendly technique used to control fruit fly populations around the world. A key goal in achieving a successful SIT program is a mass rearing system producing high quality insects at low cost. Providing adults with an artificial diet containing hydrolysed protein has been the major obstacle for bio-production facilities in Brazil, because it is expensive and has to be imported. Two other commercial products, autolysed yeast (AY and yeast extract (YE, of domestic origin and low cost, were tested as substitutes of the imported hydrolyzed protein. To compare their efficiency we observed the female fecundity, adult survival and egg viability of flies raised on diets containing one of each of the different protein products. Flies reared on the domestic yeast products had equivalent or superior performance to the flies reared on imported protein. Both AY and YE can be a possible substitute for imported hydrolyzed protein for C. capitata mass-rearing, as they are cheaper and are readily available in the national market.

  6. Evidence for potential of managing some African fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone.

    Science.gov (United States)

    Kachigamba, Donald L; Ekesi, Sunday; Ndungu, Mary W; Gitonga, Linus M; Teal, Peter E A; Torto, Baldwyn

    2012-12-01

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aqueous solutions. The objective of the study was to get insight into the potential of managing these pests using the host-marking technique. Observations were done on mango slices marked by the flies and treated with aqueous solutions of fecal matter of the flies, respectively. In both host-marking and fecal matter experiments, C. cosyra, which is the most destructive species of the four on mango, was exceptional. It only discriminated against hosts treated with its fecal matter but with lower sensitivity while C. capitata and C.fasciventris discriminated against hosts marked by it or treated with its fecal matter and with higher sensitivity. Our results provide evidence for potential of managing some of the major fruit fly species infesting mango in Africa using the host-marking pheromone of the mango fruit fly, C. cosyra.

  7. Moscas frugívoras (Tephritidae e Lonchaeidae: ocorrência em pomares comerciais de tangerina (Citrus reticulata Blanco do município de Matinhas, Estado da Paraíba = Frugivorous flies (Tephritidae and Lonchaeidae: occurrence in commercials tangerine orchards (Citrus reticulata Blanco in Matinhas, state of Paraíba, Brazil

    Directory of Open Access Journals (Sweden)

    Edson Batista Lopes

    2008-12-01

    Full Text Available O município de Matinhas, Estado da Paraíba com aproximadamente 1,3 milhões de plantas de tangerina, é responsável por 90% da produção do Estado. A pesquisa foi conduzida em cinco regiões geográficas do município de Matinhas, onde foram coletados 20 frutos na copa e 20 sob a copa da planta, objetivando pesquisar a ocorrência de moscasfrugívoras e seus níveis de infestação em tangerina. Os resultados obtidos evidenciaram que a tangerina é infestada por Ceratitis capitata (Wiedmann,1824, Neosilba zadolicha (McAlpine e Steyskal e Neosilba glaberrima (Wiedmann,1830. O índice médio de infestação de C. capitata nas cinco regiões não ultrapassou 0,5 pupa fruto-1. A percentagem de emergência (P.E. de C. capitata em frutos coletados na planta e solo variou entre 14,0 a 54,0% de adultos fruto-1. Osíndices de infestação de N. zadolicha, em frutos coletados na planta e solo, variaram entre 0,4 a 4,3 pupários fruto-1. Os dados da percentagem de emergência (P.E. de N. zadolicha variaram entre 49,9 a 65,9% de adultos fruto-1, sendo considerada a espécie mais abundante, dominante e com uma alta taxa de sobrevivência. N. zadolicha foi considerada praga primária da tangerina nas condições de Matinhas. Este é, também, o primeiro relato das espécies N. zadolicha e N. glaberrima infestando tangerina na Paraíba.The municipality of Matinhas, with approximately 1.3 million tangerinetrees, is responsible for 90% of the tangerine production in the state of Paraíba. This research was carried out in five geographic regions of Matinhas, where 20 fruits on plant and 20 fruits in soil were collected, with the aim of searching for the frugivorous flies and their levels of infestation in tangerine. The results showed that tangerine is infested by frugivorous flies Ceratitis capitata (Wiedmann, 1824, Neosilba zadolicha (McAlpine e Steyskal and Neosilba glaberrima (Wiedmann, 1830. The mean infestation index of C. capitata in five regions did

  8. Horizontal Transmission of Metarhizium anisopliae in Fruit Flies and Effect of Fungal Infection on Egg Laying and Fertility

    Directory of Open Access Journals (Sweden)

    Nguya K. Maniania

    2013-05-01

    Full Text Available Fly-to-fly transmission of conidia of the entomopathogenic fungus Metarhizium anisopliae and the effect of fungal infection on the reproductive potential of females surviving infection were investigated in three fruit fly species, Ceratitis cosyra, C. fasciventris, and C. capitata. The number of conidia picked up by a single fruit fly was determined in C. cosyra. The initial uptake (Day 0 of conidia by a single fly was approx. 1.1 × 106 conidia after exposure to the treated substrate. However, the number of conidia dropped from 7.2 × 105 to 4.1 × 105 conidia after 2 and 8 h post-exposure, respectively. The number of conidia picked up by a single fungus-treated fly (“donor” varied between 3.8 × 105 and 1.0 × 106 in the three fruit fly species, resulting in 100% mortality 5–6 days post-exposure. When fungus-free flies of both sexes (“recipient” flies were allowed to mate with “donor” flies, the number of conidia picked up by a single fly varied between 1.0 × 105 and 2.5 × 105, resulting in a mortality of 83–100% in C. capitata, 72–85% in C. cosyra and 71–93% in C. fasciventris 10–15 days post-inoculation. There was an effect of fungal infection on female egg laying in the three species of fruit flies as control flies laid more eggs than fungus-treated females. The percentage reduction in fecundity in flies infected with M. anisopliae was 82, 73 and 37% in C. capitata, C. fasciventris and C. cosyra, respectively. The results are discussed with regard to application in autodissemination techniques.

  9. A comparative assessment of the response of three fruit fly species (Diptera: Tephritidae) to a spinosad-based bait: effect of ammonium acetate, female age, and protein hunger.

    Science.gov (United States)

    Piñero, J C; Mau, R F L; Vargas, R I

    2011-08-01

    Ammonia-releasing substances are known to play an important role in fruit fly (Diptera: Tephritidae) attraction to food sources, and this information has been exploited for the development of effective synthetic food-based lures and insecticidal baits. In field studies conducted in Hawaii, we examined the behavioural response of wild female oriental fruit fly (Bactrocera dorsalis (Hendel)), melon fly (B. cucurbitae (Coquillett)), and Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) to spinosad-based GF-120 NF Naturalyte Fruit Fly Bait(©) formulated to contain either 0, 1 or 2% ammonium acetate. Use of visually-attractive yellow bait stations for bait application in the field allowed for proper comparisons among bait formulations. Field cage tests were also conducted to investigate, using a comparative behavioural approach, the effects of female age and protein starvation on the subsequent response of F1 generation B. cucurbitae and B. dorsalis to the same three bait formulations that were evaluated in the field. Our field results indicate a significant positive effect of the presence, regardless of amount, of AA in GF-120 for B. dorsalis and B. cucurbitae. For C. capitata, there was a significant positive linear relationship between the relative amounts of AA in bait and female response. GF-120 with no AA was significantly more attractive to female C. capitata, but not to female B. dorsalis or B. cucurbitae, than the control treatment. Our field cage results indicate that the effects of varying amounts of AA present in GF-120 can be modulated by the physiological stage of the female flies and that the response of female B. cucurbitae to GF-120 was consistently greater than that of B. dorsalis over the various ages and levels of protein starvation regimes evaluated. Results are discussed in light of their applications for effective fruit fly suppression.

  10. The thermodynamic stability and hydration enthalpy of strontium cerate doped by yttrium

    OpenAIRE

    Matskevich, N. I.; Wolf, Th.; Matskevich, M. Yu.

    2005-01-01

    The standard molar enthalpy of formation of SrY0.05Ce0.95O2.975 has been derived by combining the enthalpy of solution of this compound in 1 M HCl + 0.1 KI obtained by us and auxiliary literature data. The following value has been derived: DfH (SrY0.05Ce0.95O2.975, s, 298.15 K) = -1720.4 (3.4) kJ/mol. The obtained value has been used to obtain the formation enthalpy of SrY0.05Ce0.95O2.975 from the mixture of binary oxides (DoxH (298.15 K) = -45.9 (3.4) kJ/mol) and formation enthalpy of reacti...

  11. Role of CA-EDTA on the Synthesizing Process of Cerate-Zirconate Ceramics Electrolyte

    Directory of Open Access Journals (Sweden)

    Nur Athirah Abdullah

    2013-01-01

    Full Text Available The role of a combination between citric acid (CA and ethylenediaminetetra acetic acid (EDTA as chelating agents in preparation of BaCe0.54Zr0.36Y0.1O2.95 powder by a modified sol-gel method is reported. The precursor solutions were prepared from metal nitrate salts (M+, chelating agents (C, and ethylene glycol (EG at molar ratio of M+ : C : EG = 3 : 2 : 3. Chemical and phase transformation of samples during thermal decomposition were analyzed by thermogravimetric analysis (TGA and Fourier transform infrared (FTIR spectroscopy. TGA results show that the sample prepared by a combination of CA-EDTA exhibited the lowest thermal decomposition temperature, Ttd since there was no significant weight loss after 750°C. After calcined at 1100°C, the carbonates residue remained in the samples as proven by FTIR results. It was found that the used combination of CA-EDTA acts as a better combustion reagent to increase the reaction rate and influence the thermal decomposition behaviour compared to a single citric acid and EDTA, respectively. Apparently, calcination temperatures above 1100°C are needed to produce a pure perovskitic BaCe0.54Zr0.36Y0.1O2.95.

  12. A high-resolution neutron powder diffraction study of neodymium doping in barium cerate

    DEFF Research Database (Denmark)

    Knight, K.S.; Bonanos, N.

    1995-01-01

    in the thermal expansion properties are small in BaCe1-xNdxO3-x/2. The spontaneous strain decreases with increasing neodymium doping showing the deviation from an ideal cubic aristotype reduces with doping level. There is some evidence for saturation in the spontaneous strain at x>0.2.......High-resolution neutron powder diffraction data have been collected on 6 perovskites of composition BaCe1-xNdxO3-x/(2), with 0 less than or equal to x less than or equal to 0.2, in which structural phase transitions Pmcn-->P4/mbm at x=0.05, and P4/mbm-->Pm3m at x=0.1, were inferred from a recent...... Raman spectroscopy study. Our results contradict these conclusions; for 0 less than or equal to x less than or equal to 0.16, BaCe1-xNdxO3-x/2 is orthorhombic, space group Pmcn. At x=0.2, the powder data are consistent with either space group Pmcn or Cmcm, and could not be distinguished using structural...

  13. Low temperature preparation and fuel cell properties of rare earth doped barium cerate solid electrolytes

    Institute of Scientific and Technical Information of China (English)

    蒋凯; 何志奇; 孟建; 任玉芳; 苏锵

    1999-01-01

    The solid electrolytes, BaCe0.8 Ln0.2O2.9 (Ln: Gd, Sm, Eu), were prepared by the sol-gel method. XRD indicated that a pure orthorhombic phase was formed at 900℃. The synthesis temperature by the sol-gel method was about 600℃ lower than the high temperature solid phase reaction method, The electrical conductivity and impedance spectra were measured and the conduction mechanism was studied. The grain-boundary resistance of the solid electrolyte could be reduced or eliminated by the sol-gel method. The conductivity of BaCe0.8Gd0.2O2.9 is 7.87×10-2 S·cm-1 at 800℃. The open-circuit voltage of hydrogen-oxygen fuel cell using BaCe0.8 Gd0.2O2.9 as electrolyte was near to 1 V and its maximum power density was 30 mW·cm-2.

  14. Assessing the Risk of Invasion by Tephritid Fruit Flies: Intraspecific Divergence Matters.

    Science.gov (United States)

    Godefroid, Martin; Cruaud, Astrid; Rossi, Jean-Pierre; Rasplus, Jean-Yves

    2015-01-01

    Widely distributed species often show strong phylogeographic structure, with lineages potentially adapted to different biotic and abiotic conditions. The success of an invasion process may thus depend on the intraspecific identity of the introduced propagules. However, pest risk analyses are usually performed without accounting for intraspecific diversity. In this study, we developed bioclimatic models using MaxEnt and boosted regression trees approaches, to predict the potential distribution in Europe of six economically important Tephritid pests (Ceratitis fasciventris (Bezzi), Bactrocera oleae (Rossi), Anastrepha obliqua (Macquart), Anastrepha fraterculus (Wiedemann), Rhagoletis pomonella (Walsh) and Bactrocera cucurbitae (Coquillet)). We considered intraspecific diversity in our risk analyses by independently modeling the distributions of conspecific lineages. The six species displayed different potential distributions in Europe. A strong signal of intraspecific climate envelope divergence was observed in most species. In some cases, conspecific lineages differed strongly in potential distributions suggesting that taxonomic resolution should be accounted for in pest risk analyses. No models (lineage- and species-based approaches) predicted high climatic suitability in the entire invaded range of B. oleae-the only species whose intraspecific identity of invading populations has been elucidated-in California. Host availability appears to play the most important role in shaping the geographic range of this specialist pest. However, climatic suitability values predicted by species-based models are correlated with population densities of B. oleae globally reported in California. Our study highlights how classical taxonomic boundaries may lead to under- or overestimation of the potential pest distributions and encourages accounting for intraspecific diversity when assessing the risk of biological invasion.

  15. Assessing the Risk of Invasion by Tephritid Fruit Flies: Intraspecific Divergence Matters.

    Directory of Open Access Journals (Sweden)

    Martin Godefroid

    Full Text Available Widely distributed species often show strong phylogeographic structure, with lineages potentially adapted to different biotic and abiotic conditions. The success of an invasion process may thus depend on the intraspecific identity of the introduced propagules. However, pest risk analyses are usually performed without accounting for intraspecific diversity. In this study, we developed bioclimatic models using MaxEnt and boosted regression trees approaches, to predict the potential distribution in Europe of six economically important Tephritid pests (Ceratitis fasciventris (Bezzi, Bactrocera oleae (Rossi, Anastrepha obliqua (Macquart, Anastrepha fraterculus (Wiedemann, Rhagoletis pomonella (Walsh and Bactrocera cucurbitae (Coquillet. We considered intraspecific diversity in our risk analyses by independently modeling the distributions of conspecific lineages. The six species displayed different potential distributions in Europe. A strong signal of intraspecific climate envelope divergence was observed in most species. In some cases, conspecific lineages differed strongly in potential distributions suggesting that taxonomic resolution should be accounted for in pest risk analyses. No models (lineage- and species-based approaches predicted high climatic suitability in the entire invaded range of B. oleae-the only species whose intraspecific identity of invading populations has been elucidated-in California. Host availability appears to play the most important role in shaping the geographic range of this specialist pest. However, climatic suitability values predicted by species-based models are correlated with population densities of B. oleae globally reported in California. Our study highlights how classical taxonomic boundaries may lead to under- or overestimation of the potential pest distributions and encourages accounting for intraspecific diversity when assessing the risk of biological invasion.

  16. Extraction, partial purification and characterization of acidic peroxidase from cabbage leaves (Brasicca olearacea var. capitata

    Directory of Open Access Journals (Sweden)

    Aniruddha Bhalchandra Pandit

    2012-08-01

    Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 The present work deals with extraction of cabbage peroxidase (CP from fresh cabbage leaves and subsequent purification using ammonium sulphate (80% w/v precipitation. The peroxidase extraction has been carried out by screening two different cabbage and then different parameters like different buffer systems, strength of buffers, buffer volumes, grinding time and cabbage leaves weight ratio to buffer volumes were optimized. The purified peroxidase showed maximum activity at pH 5.5 and at temperature 55 °C. The enzyme action followed the Michelis–Menton kinetics and gave a Km of 0.7018 mg/ml for Guaiacol oxidation over different concentrations (0 – 10 mg/ml at pH 5.0 and Vmax was obtained as 0.6498 mg/min.ml. The molecular weight of the partially purified enzyme was found to be about 67,000 Daltons using SDS-PAGE and zymogram method. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

  17. Histopathology of Brassica oleracea var. capitata subvar. alba infected with Heterodera cruciferae Franklin, 1945 (Tylenchida: Heteroderidae)

    Science.gov (United States)

    Because anatomical changes induced by the cabbage cyst nematode (Heterodera cruciferae) have been insufficiently characterized, here we describe these changes in the root tissues of white head cabbage varieties commonly grown in the Black Sea Region of Turkey, where cabbage-growing areas are heavily...

  18. Effects of intraspecific variation in white cabbage (Brassica oleracea var. capitata) on soil organisms

    NARCIS (Netherlands)

    Kabouw, P.; Van der Putten, W.H.; Van Dam, N.M.; Biere, A.

    2010-01-01

    Intraspecific variation in plants can affect soil organisms. However, little is known about whether the magnitude of the effect depends on the degree of interaction with the roots. We analyzed effects of plant intraspecific variation on root herbivores and other soil organisms that interact directly

  19. Effects of intraspecific variation in white cabbage (Brassica oleracea var. Capitata) on soil ogranisms

    NARCIS (Netherlands)

    Kabouw, P.; Putten, van der W.H.; Dam, van N.M.; Biere, A.

    2010-01-01

    Intraspecific variation in plants can affect soil organisms. However, little is known about whether the magnitude of the effect depends on the degree of interaction with the roots. We analyzed effects of plant intraspecific variation on root herbivores and other soil organisms that interact directly

  20. Plant traits associated with resistance to Thrips tabaci in cabbage (Brassica oleracea var capitata)

    NARCIS (Netherlands)

    Voorrips, R.E.; Steenhuis, M.M.; Tiemens-Hulscher, M.; Lammerts Van Bueren, E.

    2008-01-01

    Thrips tabaci is a major problem in the cultivation of cabbage for storage, as this pest causes symptoms that necessitate the removal of affected leaves from the product. Between cabbage varieties large differences in susceptibility occur. This study aimed to identify plant traits associated with th

  1. Dinâmica populacional e incidência de moscas-das-frutas e parasitoides em cultivares de pessegueiros (Prunus Persica L. Batsch no município de presidente prudente-sp Population dynamic and occurrence of fruit flies and their parasitoids in peach cultivars (Prunus persica L. Batsch in presidente prudente municipality, sp

    Directory of Open Access Journals (Sweden)

    Sônia Maria Nalesso Marangoni Montes

    2011-06-01

    Full Text Available Esta pesquisa teve como objetivos avaliar a dinâmica populacional e registrar a diversidade de moscas-das-frutas (Diptera: Tephritoidea em cultivares de pessegueiro Tropical, Talismã, Aurora 2, Aurora 1, Dourado 2 e Doçura 2, enxertadas sobre os porta-enxertos 'Okinawa' e Umê, em Presidente Prudente-SP. Foram realizadas as correlações da dinâmica populacional com a temperatura e a precipitação, e também a infestação com as características químicas dos frutos, Sólidos Solúveis e Acidez Titulável. No período de julho de 2004 a dezembro de 2006, a dinâmica populacional de moscas-das-frutas foi obtida através de coletas semanais de moscas-das-frutas em armadilhas McPhail, e a incidência foi determinada através da coleta de 30 frutos/planta/cultivar. O delineamento estatístico adotado foi o inteiramente casualizado, com cinco repetições. Ceratitis capitata foi predominante nas cultivares de pessegueiros estudadas. Não foi observada correlação significativa entre população de moscas-das-frutas e as variáveis de temperatura e precipitação, e sólidos solúveis e ácidez titulável. Entre as cultivares de pêssego, Aurora 2 apresentou maior infestação por C. capitata, da ordem de 22 e 23% nos anos 2004 e 2006, respectivamente. Também foi registrada a incidência de Neosilba spp. em frutos de pêssego. Doryctobracon areolatus (Braconidae, Tetrastichus giffardianus (Eulophidae e Pachycrepoideus vindemmiae (Pteromalidae foram recuperados de pupários de Tephritidae.The objectives of this research were evaluate the population dynamic and diversity of fruit flies (Diptera: Tephritoidea on peach cultivars Tropical, Talisma, Aurora 2, Aurora 1, Dourado 2 and Doçura 2, under the rootstocks 'Okinawa' and Umê, in Presidente Prudente, São Paulo, Brazil. The dynamic population of fruit flies was correlated with temperature and precipitation. The fruit fly infestation was correlated with chemical characteristics of fruits

  2. Desenvolvimento e reprodução da mosca-do-mediterrâneo em caquizeiro, macieira, pessegueiro e videira

    Directory of Open Access Journals (Sweden)

    Odimar Zanuzo Zanardi

    2011-07-01

    Full Text Available O objetivo deste trabalho foi descrever o desenvolvimento e reprodução de Ceratitis capitata (Diptera: Tephritidae em frutos de caqui 'Fuyu', maçã 'Gala', pêssego 'Maciel' e uva 'Itália'. Foram feitas avaliações quanto a: duração e viabilidade do ovo, duração do estágio larval, peso de pupa, duração e viabilidade da pupa, duração do período ovo-adulto, razão sexual, período de pré-oviposição e oviposição, fecundidade diária e total e longevidade de machos e fêmeas. A maior duração do período ovo-adulto ocorreu em maçã, em consequência do aumento do estágio larval, seguido por uva, caqui e pêssego. Larvas que se alimentaram de pêssego apresentaram maior peso médio de pupa. A maior viabilidade pupal foi registrada em pêssego, equivalente à de uva e caqui. O período de pré-oviposição foi maior para fêmeas provenientes de maçã e uva. Fêmeas provenientes de pêssego apresentaram período de oviposição mais longo, além de maior fecundidade média diária e fecundidade total. A longevidade de adultos foi superior em insetos criados em pêssego. Frutos de pessegueiro são mais adequados para o desenvolvimento de C. capitata, em comparação aos de caqui, maçã e uva.

  3. Dinâmica populacional e incidência de moscas-das-frutas e parasitoides em cultivares de pessegueiros (Prunus Persica L. Batsch no município de presidente prudente-sp

    Directory of Open Access Journals (Sweden)

    Sônia Maria Nalesso Marangoni Montes

    2011-06-01

    Full Text Available Esta pesquisa teve como objetivos avaliar a dinâmica populacional e registrar a diversidade de moscas-das-frutas (Diptera: Tephritoidea em cultivares de pessegueiro Tropical, Talismã, Aurora 2, Aurora 1, Dourado 2 e Doçura 2, enxertadas sobre os porta-enxertos 'Okinawa' e Umê, em Presidente Prudente-SP. Foram realizadas as correlações da dinâmica populacional com a temperatura e a precipitação, e também a infestação com as características químicas dos frutos, Sólidos Solúveis e Acidez Titulável. No período de julho de 2004 a dezembro de 2006, a dinâmica populacional de moscas-das-frutas foi obtida através de coletas semanais de moscas-das-frutas em armadilhas McPhail, e a incidência foi determinada através da coleta de 30 frutos/planta/cultivar. O delineamento estatístico adotado foi o inteiramente casualizado, com cinco repetições. Ceratitis capitata foi predominante nas cultivares de pessegueiros estudadas. Não foi observada correlação significativa entre população de moscas-das-frutas e as variáveis de temperatura e precipitação, e sólidos solúveis e ácidez titulável. Entre as cultivares de pêssego, Aurora 2 apresentou maior infestação por C. capitata, da ordem de 22 e 23% nos anos 2004 e 2006, respectivamente. Também foi registrada a incidência de Neosilba spp. em frutos de pêssego. Doryctobracon areolatus (Braconidae, Tetrastichus giffardianus (Eulophidae e Pachycrepoideus vindemmiae (Pteromalidae foram recuperados de pupários de Tephritidae.

  4. Development of improved attractants and their integration into fruit fly management programmes

    Energy Technology Data Exchange (ETDEWEB)

    Sookar, P.; Permalloo, S.; Alleck, M.; Seewooruthun, S.I., E-mail: ento@intnet.m, E-mail: moa-entomology@mail.gov.m [Ministry of Agro Industry and Fisheries, Reduit (Mauritius)

    2006-07-01

    Fruit flies are major constraint to fruit production in Mauritius. The peach fruit fly, Bactrocera zonata (Saunders), the natal fly, Ceratitis rosa (Karsch), the medfly, C. capitata (Wiedmann) are the main pests of fleshy fruits. Fruit fly trapping trials were conducted in backyards to find the most effective combination of attractant and lures for females. There were two separate trapping trials, carried out in two different localities during the period November 2004 to March 2005. In the first trial, the attractants in different combinations were tested in International Pheromone McPhail Trap (IPMT). The attractants were as follows: three patches containing Ammonium Acetate (AA) + Trimethylamine (TMA) + Putrescine (PT); Two patches of AA ; two patches of AA + one patch of PT ; two patches of AA + one patch of TMA; one patch of solbait; torula tablets; protein hydrolysate and GF120. Water and Triton B were used as retention device in traps baited with the patches. In the first trial, all treatments were equally effective in the capture of either female B. zonata or female C. capitata with the exception of protein hydrolysate and GF120 which trapped fewer numbers of flies. In the second trapping trial, additional trap types and lure combinations were assessed. The three component lure (AA + PT + TMA with water/Triton as retention device in IPMT) and the trap baited with Waste Brewer's Yeast captured significantly more female flies followed by IPMT with AA + PT + TMA / Sticky insert and the Easy trap. In all trials, females accounted for more than 75% of the catches. (author)

  5. Trap capture of three economically important fruit fly species (Diptera: Tephritidae): evaluation of a solid formulation containing multiple male lures in a Hawaiian coffee field.

    Science.gov (United States)

    Shelly, Todd; Nishimoto, Jon; Kurashima, Rick

    2012-08-01

    Invasive fruit flies (Diptera: Tephritidae) pose a global threat to agriculture through direct damage to food crops and the accompanying trade restrictions that often result. Early detection is vital to controlling fruit flies, because it increases the probability of limiting the growth and spread of the invasive population and thus may greatly reduce the monetary costs required for eradication or suppression. Male-specific lures are an important component of fruit fly detection, and three such lures are used widely: trimedlure (TML), cue lure (CL), and methyl eugenol (ME), attractive to Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, Bactrocera cucurbitae (Coquillett); and oriental fruit fly, Bactrocera dorsalis (Hendel), respectively. In California, Florida, and Texas, the two Bactrocera lures are applied to separate species-specific traps as liquids (with a small amount of the insecticide naled added), whereas TML is delivered as a solid plug in another set of traps. Thus, the detection protocol involves considerable handling time as well as potential contact with a pesticide. The purpose of this study was to compare trap capture between liquid male lures and "trilure" wafers that contain TML, ME, raspberry ketone (RK, the hydroxy equivalent of CL), and the toxicant DDVP embedded within a solid matrix. Field studies were conducted in a Hawaiian coffee (Coffea arabica L.) field where the three aforementioned species co-occur, showed that the wafer captured at least as many flies as the liquid baits for all three species. This same result was obtained in comparisons using both fresh and aged (6-wk) baits. Moreover, the wafers performed as well as the single-lure traps in an ancillary experiment in which TML plugs were substituted for liquid TML. Additional experiments demonstrated explicitly that the presence of ME and RK had no effect on captures of C. capitata males and similarly that the presence of TML had no effect on the capture of B

  6. Threshold Concentration of Limonoids (Azamax) for Preventing Infestation by Mediterranean Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Silva, M A; Bezerra-Silva, G C D; Vendramim, J D; Forim, M R; Sá, I C G

    2015-04-01

    This study identified the threshold concentration of limonoids for the complete inhibition of oviposition of Ceratitis capitata (Wiedemann) in grapes 'Itália.' Choice and no-choice experiments with the insect were performed. The three no-choice bioassays were conducted following a completely randomized design with 18 treatments (three densities of insects [one, two, or three females]×five concentrations of limonoids and control) and 20 replicates. In a free choice bioassay, two fruits per cage (a treatment grape and a control) were provided for ovipositing. Three densities of insects (one, two, or three females) were used, with 15 replicates. Bioassays were conducted at 25±2°C, 60±10% relative humidity, and a photoperiod of 14:10 (L:D) h. The inhibition of oviposition of C. capitata was concentration dependent, with infestation occurring at lower concentrations of azadirachtin (+3-tigloylazadirachtol) and complete inhibition occurring at concentrations at or exceeding 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol), maintaining protective effects even at the most densely populated treatment (three females per fruit). When the pest had a free choice of host grapes (treatment vs. control), severe inhibition was observed at concentrations≥50 ppm azadirachtin (+14.3 ppm of 3-tigloylazadirachtol). We conclude that a threshold concentration of 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol) is capable of preventing grape infestation. This concentration is likely to provide a reliable level of protection, as the experimental population density of three females per fruit usually does not occur in the field and wild flies usually have more host options.

  7. Electrical Properties Of Indium And Yttrium-Doped Barium Cerate-Based Compounds For Use As Ceramic Fuel Cell Electrolytes

    Directory of Open Access Journals (Sweden)

    Gawel R.

    2015-06-01

    Full Text Available The aim of this work is to compare the electrical properties of BaCe0.85Y0.15O3−δ (BCY15, BaCe0.70In0.30O3−δ (BCI30 and a composite material consisting of 30%vol. BCY15 and 70%vol. Ce0.85Y0.15O2−δ (YDC15. BCY15 and YDC15 were synthesized by co-precipitation, whereas BCI30 was obtained using the solid-state reaction method. Pellets were initially formed from powders at 5 MPa, after which they were isostatically pressed at 250 MPa and sintered at 1500°C. Electrochemical impedance spectroscopy (EIS was used to determine the electrical properties of the samples in both air (pO2 = 0.021 MPa and Ar-5%H2 atmospheres. In the temperature range 200-400°C in air atmosphere the highest conductivity values were determined for BCY15 (5,22·10−5 − 2.74·10−3 S/cm. On the other hand, the electrical conductivity values obtained for Y70B30 in both atmospheres between 200 and 550°C are in the order of magnitude of 10−7 − 10−3 S/cm. Consequently, it can be concluded that the compounds exhibit significant H+ and O2− electrical conductivity at temperatures above 500°C, which indicates the possibility for their potential use as ceramic fuel cell electrolytes.

  8. Enhanced sintering and conductivity study of cobalt or nickel doped solid solution of barium cerate and zirconate

    DEFF Research Database (Denmark)

    Ricote, Sandrine; Bonanos, Nikolaos

    2010-01-01

    BaZr(0.9 − x)CexY(0.1 − y)CoyO(3 − δ) (with x = 0 and 0.2; y = 0.01; 0.02; 0.05) and BaZr(0.9 − x)CexY(0.1 − y)NiyO(3 − δ) (with x = 0 and 0.2; y = 0.01; 0.02) compounds have been synthesized by solid state reaction at 1400 °C and obtained as dense pellets after sintering at 1450 °C. Cobalt...... or nickel doping reduces the sintering temperature by about 250 °C. The samples are stable in a CO2 rich atmosphere at 600 °C but the 5% B site Co doped samples are aging in wet atmosphere. The conductivity has been measured for the 1 and 2% doped samples (both cobalt and nickel), in different wet...... atmospheres and compared to the undoped compounds. The ionic and p-type conductivities have been determined, as well as the activation energy in wet reducing atmospheres, in which protonic conduction is dominant. A decrease of the ionic conductivity is noticeable for the cobalt or nickel doped barium...

  9. Solid State Structure-Reactivity Studies on Bixbyites, Fluorites and Perovskites Belonging to the Vanadate, Titanate and Cerate Families

    Science.gov (United States)

    Shafi, Shahid P.

    This thesis primarily focuses on the systematic understanding of structure-reactivity relationships in two representative systems: bixbyite and related structures as well as indium doped CeO2. Topotactic reaction routes have gained significant attention over the past two decades due to their potential to access kinetically controlled metastable materials. This has contributed substantially to the understanding of solid state reaction pathways and provided first insights into mechanisms. Contrary to the widely used ex-situ methods, in-situ techniques including powder x-ray diffraction and thermogravimetric-differential thermal analysis have been employed extensively throughout this work in order to follow the reaction pathways in real time. Detailed analysis of the AVO3 (A = In, Sc) bixbyite reactivity under oxidative conditions has been carried out and a variety of novel metastable oxygen defect phases have been identified and characterized. The novel metastable materials have oxygen deficient fluorite structures and consequently are potential ion conductors. Structural aspects of the topotactic vs. reconstructive transformations are illustrated with this model system. The structure-reactivity study of AVO3 phases was extended to AVO3 perovskite family. Based on the research methodologies and results from AVO3 bixbyite reactivity studies a generalized mechanistic oxidation pathway has been established with a non-vanadium phase, ScTiO3 bixbyite. However, there is stark contrast in terms of structural stability and features beyond this stability limit during AVO3 and ScTiO3 bixbyite reaction pathways. A series of complex reaction sequences including phase separation and phase transitions were identified during the investigation of ScTiO3 reactivity. The two-step formation pathway for the fluorite-type oxide ion conductor Ce1-xInxO2-delta (0 ≤ x ≤ 0.3) is being reported. The formation of the BaCe1-xInxO 3-delta perovskites and the subsequent CO2-capture reaction with the formation of Ce1-xInxO2-delta (0 ≤ x ≤ 0.3) has been investigated in detail. The two-step formation pathway is contrasted with the unsuccessful direct method. The stability and the extent of In-doping for the CeO2 fluorite phases that can be achieved through this CO2-capture method are reported. The necessity and strategies for the selection of appropriate intermediate precursors for the preparation of doped CeO2 are also reported.

  10. Sterile medfly males of the tsl Vienna 8 genetic sexing strain display improved mating performance with ginger root oil

    Energy Technology Data Exchange (ETDEWEB)

    Paranhos, Beatriz Jordao; Alves, Renata Morelli, E-mail: bjordao@cpatsa.embrapa.b [EMBRAPA Semi-Arido, Petrolina, PE (Brazil); McInnis, Donald [U.S. Department of Agriculture (USDA/ARS/PBARC), Honolulu, HI (United States). Agricultural Research Service. Pacific Basin Agricultural Research Center; Uramoto, Keiko [Universidade de Sao Paulo (USP), SP (Brazil); Damasceno, Itala; Malavasi, Aldo [Biofabrica Moscamed Brasil, Juazeiro, BA (Brazil); Goncalves, Nilmara [Valexport, Petrolina, PE (Brazil); Costa, Maria de Lourdes; Walder, Julio [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil); Nascimento, Antonio [EMBRAPA Mandioca e Fruticultura, Cruz das Almas, BA (Brazil)

    2006-07-01

    A key point of the sterile insect technique applied to the medfly, Ceratitis capitata, is that the sterile males produced in the laboratory should have at least a minimal sexual compatibility with wild females. Among several genetic sexing tsl (Temperature Sensitive Lethal) strains of C. capitata mass-reared around the world, the Biofabrica Moscamed Brasil has chosen the most recent mass produced tsl strain, Vienna 8 (V8), which has been evaluated in the San Francisco River Valley, Brazil, since April, 2005. The tests were accomplished in field cages, with different treatments for V8 males, sterile or fertile, exposed to the aroma of ginger root oil (GRO) or not, versus wild males and females. Males of one strain (V8 or wild) were painted white on the thorax the day before the mating tests. All the insects were virgin, and early in the morning (7-8 A.M.) males were released inside the field cages, 10 min. before females. Mating pairs were collected in glass vials, until early afternoon. From this raw data, both the type of male mating and the time in copula were recorded for each pair. Then, the total percentage of mated females, the RSI (Relative Sterility Index), and Fried's competitiveness values (C), were calculated for each field cage. The percentage of females mated was statistically higher to sterile males exposed to GRO than to non exposed to GRO. Time in copula was significantly higher for wild flies than for laboratory flies, except for the case of fertile V8 males exposed to GRO x wild females. The RSI and C values were significantly higher for V8 males (irradiated and fertile) treated with GRO than for V8 males not treated with GRO. The results indicate that there is adequate sexual compatibility between sterile males of the tsl Vienna 8 strain and wild C. capitata females from the San Francisco River Valley, Brazil. Also, the radiation dose of 95 Gy, used to sterilize the males, did not affect their sexual activity. Ginger root oil acted as a

  11. The FAO/IAEA interactive spreadsheet for design and operation of insect mass rearing facilities

    Energy Technology Data Exchange (ETDEWEB)

    Caceres, Carlos, E-mail: carlos.e.caceres@aphis.usda.co [International Atomic Energy Agency (IAEA), Seibersdorf (Austria). Agency' s Labs. Programme of Nuclear Techniques in Food and Agriculture; Rendon, Pedro [U.S. Department of Agriculture (USDA/APHIS/CPHST), Guatemala City (Guatemala). Animal and Plant Health Inspection. Center for Plant Health Science and Technology

    2006-07-01

    An electronic spreadsheet is described which helps users to design, equip and operate facilities for the mass rearing of insects for use in insect pest control programmes integrating the sterile insect technique. The spreadsheet was designed based on experience accumulated in the mass rearing of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), using genetic sexing strains based on a temperature sensitive lethal (tsl) mutation. The spreadsheet takes into account the biological, production, and quality control parameters of the species to be mass reared, as well as the diets and equipment required. All this information is incorporated into the spreadsheet for user-friendly calculation of the main components involved in facility design and operation. Outputs of the spreadsheet include size of the different rearing areas, rearing equipment, volumes of diet ingredients, other consumables, as well as personnel requirements. By adding cost factors to these components, the spreadsheet can estimate the costs of facility construction, equipment, and operation. All the output parameters can be easily generated by simply entering the target number of sterile insects required per week. For other insect species, the biological and production characteristics need to be defined and inputted accordingly to obtain outputs relevant to these species. This spreadsheet, available under http://www-naweb.iaea.org/nafa/ipc/index.html, is a powerful tool for project and facility managers as it can be used to estimate facility cost, production cost, and production projections under different rearing efficiency scenarios. (author)

  12. Field evaluation of Mediterranean fruit fly mass trapping with Tripack as alternative to malathion bait-spraying in citrus orchards

    Energy Technology Data Exchange (ETDEWEB)

    Mediouni Ben Jemaa, J.; Bachrouch, O.; Allimi, E.; Dhouibi, M. H.

    2010-07-01

    The mass trapping technique based on the use of the female-targeted attractant lure Tri-pack as an alternative to malathion bait-spraying (control treatment) was tested in two citrus orchards in the North of Tunisia against the Mediterranean fruit fly Ceratitis capitata during 2006 and 2007. Results of mass trapping trials in 2006 and 2007 indicated that adult males Medfly captures showed reductions respect to control of 37.62% and 40.2% respectively in mandarin orange variety (Citrus reticulata) orchard compared to 36.48% and 47.29% in Washington navel orange variety (Citrus sinensis) field. Fruit damage assessment showed significant differences between the mass trapping with Tripack and malathion bait-spraying techniques in the reduction of the percentage of fruit punctures. The percentage of punctured fruit at harvest was significantly different between the treated and the control field in 2006 and in 2007 in the mandarin orange orchard. Nevertheless, in the Washington navel orange orchard, the percentage of punctured fruit at harvest was significantly different between the treated and the control field only in 2006. Thus, results obtained from this study showed that the mass trapping technique based on the use of the female-targeted lure Tri-pack could be involved as an appropriate strategy for the control of the Medfly and is as effective as malathion bait spraying treatment without leaving pesticide residues on fruit. (Author) 40 refs.

  13. Dispersal propensity, but not flight performance, explains variation in dispersal ability.

    Science.gov (United States)

    Steyn, Vernon M; Mitchell, Katherine A; Terblanche, John S

    2016-08-17

    Enhanced dispersal ability may lead to accelerated range expansion and increased rates of population establishment, thereby affecting population genetic structure and evolutionary potential. Morphological, behavioural and physiological traits that characterize dispersive individuals from residents are poorly understood for many invertebrate systems, especially in non-polymorphic pterygote species. Here we examined phenotypic differences between dispersal-prone and philopatric individuals from repeated mark-release-recapture (MRR) experiments using an invasive agricultural pest, Ceratitis capitata Comprehensive morphometric assessment and subsequent minimal adequate modelling using an information theoretic approach identified thorax mass : body mass ratio as a key predictor of disperser flies under semi-natural conditions. Performance differences in flight ability were then examined under controlled laboratory conditions to assess whether greater thorax mass : body mass ratio was associated with enhanced flight ability. The larger thorax : body mass ratio was associated with measurable differences in mean flight duration, most predominantly in males, and also by their willingness to disperse, scored as the number and duration of voluntary flights. No other measures of whole-animal flight performance (e.g. mean and peak vertical force, total or maximum flight duration) differed. Variation in voluntary behaviour may result in significant alterations of movement behaviour and realized dispersal in nature. This phenomenon may help explain intraspecific variation in the dispersal ability of insects.

  14. Exploitation of the Medfly Gut Microbiota for the Enhancement of Sterile Insect Technique: Use of Enterobacter sp. in Larval Diet-Based Probiotic Applications.

    Science.gov (United States)

    Augustinos, Antonios A; Kyritsis, Georgios A; Papadopoulos, Nikos T; Abd-Alla, Adly M M; Cáceres, Carlos; Bourtzis, Kostas

    2015-01-01

    The Mediterranean fruit fly (medfly), Ceratitis capitata, is a pest of worldwide substantial economic importance, as well as a Tephritidae model for sterile insect technique (SIT) applications. The latter is partially due to the development and utilization of genetic sexing strains (GSS) for this species, such as the Vienna 8 strain, which is currently used in mass rearing facilities worldwide. Improving the performance of such a strain both in mass rearing facilities and in the field could significantly enhance the efficacy of SIT and reduce operational costs. Recent studies have suggested that the manipulation of gut symbionts can have a significant positive effect on the overall fitness of insect strains. We used culture-based approaches to isolate and characterize gut-associated bacterial species of the Vienna 8 strain under mass rea