WorldWideScience

Sample records for center dot cl

  1. Analysis of Cl center dot center dot center dot Cl and C-H center dot center dot center dot Cl intermolecular interactions involving chlorine in substituted 2-chloroquinoline derivatives

    OpenAIRE

    Hathwar, Venkatesha R.; Roopan, Mohana S; R. Subashini; Khan, Nawaz F; Row, Guru TN

    2010-01-01

    Six crystal structures of substituted 2-chloroquinoline derivatives have been analysed to evaluate the role of Cl atom as a self recognizing unit resulting in the formation of Cl center dot center dot center dot Cl and C-H center dot center dot center dot Cl interactions to generate supramolecular assembly in the solid state. The features of Type I and Type II geometries associated with Cl center dot center dot center dot Cl interactions have been analysed to show directional preferences lead...

  2. Metalated N-heterocyclic reagents prepared by the frustrated Lewis pair TMPMgCl center dot BF3 and their addition to aromatic aldehydes and activated ketones

    OpenAIRE

    Manolikakes, Sophia M.; Jaric, Milica; Karaghiosoff, Konstantin; Knochel, Paul

    2013-01-01

    Treatment of pyridines, quinoline and methylthiopyrazine with the frustrated Lewis pair TMPMgCl center dot BF3 (1) leads to organotrifluoro borates which react readily with a variety of aromatic aldehydes in the absence of a transition metal catalyst.

  3. Critical and superciritcal properties of 0.3 to 3.0 mol{center_dot}kg{sup {minus}1} CaCl{sub 2}(aq)

    Energy Technology Data Exchange (ETDEWEB)

    Oakes, C.S.; Bodnar, R.J.; Pitzer, K.S. [State Univ., Blacksburg, VA (United States)]|[Lawrence Berkeley Lab., CA (United States); Simonson, J.M. [Oak Ridge National Lab., TN (United States)

    1994-06-01

    Critical temperatures (T{sub c}) and densities (p{sub c}) for aqueous CaCl{sub 2} solutions were measured using two different optical techniques. Fluid inclusions with compositions of 0.5 to 4.0 mol{center_dot}ks{sup {minus}1} were synthesized from 600 to 820{degrees}C and at 1500 and 2500 bars in both the single and two-fluid phase fields. Critical temperatures were determined from measured homogenization temperatures and the observed mode of homogenization (i.e., to the liquid or vapor phase or by fading of the meniscus between apparent equal volumes of liquid and vapor). Critical temperatures determined by this method for 0.5, 1.0, 2.0, and 3.0 molal CaCl{sub 2}(aq) solutions are 395, 406, 466, and 565{degrees}C, respectively. T{sub c} for 4.0 molal CaCl{sub 2}(aq) was found to be in excess of 662{degree}C. Critical pressures (P{sub c}) could not be accurately determined from these measurements but were estimated from another source. Measurements of T{sub c} were also made using sealed silica capillaries containing 0.3, 0.5, 1.0, and 2.0 molal Cal{sub 2}(aq) solutions. T{sub c} values from these measurements are 388, 393, 405, and 465{degrees}C, respectively. Our data are in fair agreement with previously published data at and below 1.0 mol{center_dot}kg{sup {minus}1}, data from the two published sources of CaCl{sub 2}(aq) T{sub 2} measurements show substantially different trends, with the data from this study agreeing with the more recent of the two reports. Estimated values of p{sub c} are given for the solutions examined in the capillary tube experiments. Critical isochores are presented with new synthetic fluid inclusion derived isochores for 1.0 and 2.0 mol{center_dot}kg{sup {minus}1} Cal{sub 2}(aq) liquids to form a complete arrays of isochores for temperatures form {approximately} 100{degrees}C to those along the critical isochore and pressures to 5000 bars. 18 refs., 6 figs., 5 tabs.

  4. Structure, phase transitions and molecular motions in ferroelastic (C{sub 4}H{sub 8}NH{sub 2})SbCl{sub 6}{center_dot}(C{sub 4}H{sub 8}NH{sub 2})Cl

    Energy Technology Data Exchange (ETDEWEB)

    Bednarska-Bolek, B.; Jakubas, R. [Faculty of Chemistry, University of Wroclaw, Wroclaw (Poland)]. E-mail: rj@wchuwr.chem.uni.wroc.pl; Medycki, W. [Institute of Molecular Physics, PAS, Poznan (Poland); Nowak, D. [Institute of Physics, UAM, Poznan (Poland); Zaleski, J. [Institute of Chemistry, University of Opole, Opole (Poland)

    2002-04-01

    The crystal structure at 293 K of the new pyrrolidinium chloroantimonate (V) analogue, (C{sub 4}H{sub 8}NH{sub 2})SbCl{sub 6}{center_dot}(C{sub 4}H{sub 8}NH{sub 2})Cl, has been determined by x-ray diffraction as monoclinic, space group P2{sub 1}/c, Z=8. The crystal is built up of isolated SbCl{sub 6}{sup -} anions, two types of inequivalent pyrrolidinium cation and isolated Cl- ions. It undergoes five solid-solid phase transitions: at 351/374 K of first-order type (cooling/heating, respectively), at 356 and 152 K second order and at 135/141 and 105/134 K first order, detected by differential scanning calorimetry, dilatometric and dielectric measurements. The ferroelastic domain structure appears between 152 and 135 K. The proton nuclear magnetic resonance second moment and spin-lattice relaxation time of polycrystalline samples were studied over the temperature range 27-410 K. The order-disorder mechanism of the phase transitions at 105 and 374 K connected with the reorientational motion of the pyrrolidinium cations has been confirmed. (author)

  5. Optical lifetime and linewidth studies of the {sup 7}F{sub 0}{yields}{sup 5}D{sub 0} transition in EuCl{sub 3}{center_dot}6H{sub 2}O: A potential material for quantum memory applications

    Energy Technology Data Exchange (ETDEWEB)

    Ahlefeldt, R.L., E-mail: rose.ahlefeldt@anu.edu.au [Centre for Quantum Computation and Communication Technology, Research School of Physics and Engineering, The Australian National University, Canberra, Australian Capital Territory 0200 (Australia); Manson, N.B. [Laser Physics Centre, Research School of Physics and Engineering, The Australian National University, Canberra, Australian Capital Territory 0200 (Australia); Sellars, M.J. [Centre for Quantum Computation and Communication Technology, Research School of Physics and Engineering, The Australian National University, Canberra, Australian Capital Territory 0200 (Australia)

    2013-01-15

    The effect of substituting deuterium for hydrogen in EuCl{sub 3}{center_dot}6H{sub 2}O on the lifetime and homogeneous and inhomogeneous linewidths of the {sup 7}F{sub 0}{yields}{sup 5}D{sub 0} transition at below 4 K are investigated. It is observed that the transition lifetime increases from 116{mu}s to 2.6 ms and the homogeneous linewidth decreases from 4.1 kHz to 430 Hz. The sensitivity of the inhomogeneous broadening to the residual hydrogen concentration is estimated to be 91 MHz/atm%. The potential of utilizing this crystal for quantum memory applications is discussed. - Highlights: Black-Right-Pointing-Pointer The optical lifetime of EuCl{sub 3}{center_dot}6H{sub 2}O increases 20 times with full deuteration. Black-Right-Pointing-Pointer An optical coherence time of 740{mu}s was observed in EuCl{sub 3}{center_dot}6D{sub 2}O. Black-Right-Pointing-Pointer High D purity EuCl{sub 3}{center_dot}6H{sub 2}O is a good candidate material for quantum memories.

  6. Effects of Shannon entropy and electric field on polaron in RbCl triangular quantum dot

    Science.gov (United States)

    M, Tiotsop; A, J. Fotue; S, C. Kenfack; N, Issofa; H, Fotsin; L, C. Fai

    2016-04-01

    In this paper, the time evolution of the quantum mechanical state of a polaron is examined using the Pekar type variational method on the condition of the electric-LO-phonon strong-coupling and polar angle in RbCl triangular quantum dot. We obtain the eigenenergies, and the eigenfunctions of the ground state, and the first excited state respectively. This system in a quantum dot can be treated as a two-level quantum system qubit and the numerical calculations are performed. The effects of Shannon entropy and electric field on the polaron in the RbCl triangular quantum dot are also studied.

  7. Dynamic [Cl{sup -}]{sub i} measurement with chloride sensing quantum dots nanosensor in epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang Yuchi; Mao Hua; Wong, Lid B, E-mail: ywang@biotechplex.com [BioTechPlex Corporation, 1205 Linda Vista Drive Suite A, San Marcos, CA 92078 (United States); Cytoptics Corporation, 1205 Linda Vista Drive Suite B, San Marcos, CA 92078 (United States)

    2010-02-05

    We have synthesized a chloride sensing quantum dots (QD) nanosensor, Cl-QD, for the dynamic measurements of chloride ion concentration in the millimolar range, a sensitivity that is applicable to most physiological intracellular chloride ion concentration ([Cl{sup -}]{sub i}) measurements in epithelial cells. The Cl-QD is synthesized by conjugating an anion receptor, 1-(2-mercapto-ethyl)-3-phenyl-thiourea (MEPTU) to a water soluble CdSe/ZnS QD at an emission wavelength of 620 nm. Upon binding of chloride ions to the Cl-QD, a photo-induced electron transfer mechanism caused the fluorescence of the QD to quench. This resulted in an inversely proportional relationship between the chloride ion concentration and the fluorescence intensity of the Cl-QD. We have utilized this Cl-QD to measure [Cl{sup -}]{sub i} in T84 and CF-PAC cultured cells, with either the C1C-2 or CFTR chloride channels being manipulated by pharmacological chloride channel activators and inhibitors. Activations of C1C-2 and CFTR chloride channels in T84 by the respective lubiprostone and genistein caused predictive increases in the fluorescence of the Cl-QD, i.e., a decrease of [Cl{sup -}]{sub i}. Conversely, glibenclamide, a chloride channel inhibitor, applied to the CF-PAC cells caused a predictable decrease in the fluorescence of Cl-QD due to the increase of [Cl{sup -}]{sub i}. These are the first data in using QD-based chloride ion sensors for dynamic measurements of intracellular chloride ion concentrations in epithelial cells.

  8. Combined MTX{center_dot}5-FU{center_dot}CDGP for the treatment of head and neck cancer

    Energy Technology Data Exchange (ETDEWEB)

    Sakoda, Takema; Kitano, Hiroya [Tottori Univ., Yonago (Japan). Faculty of Medicine; Saitoh, Yuko; Ikeda, Hiroki; Dake, Yoshihiro; Enomoto, Tadao [Japanese Red Cross Society Wakayama Medical Center (Japan); Seno, Satoshi [Shiga Univ. of Medical Science, Otsu (Japan); Kawano, Atsushi [Tokyo Medical Coll. (Japan)

    2003-05-01

    Combination chemotherapy including 5-fluorouracil (5-FU) and nedaplatin (CDGP) with methotrexate (MTX) and leucovorin (LV) was administered for modulation in patients with head and neck cancer. We treated 19 patients with MTX{center_dot}5-FU{center_dot}CDGP consisting of 150 mg/body of MTX on day 1 followed by a 3-day continuous infusion of 5-FU at 3,500 mg/m{sup 2} and 17 injections of LV at 15 mg and infusion of CDGP at 100 mg/m{sup 2}. Six patients had recurrent head and neck cancer, and 13 had newly diagnosed disease. Eleven of the new patients were concurrently treated with radiation therapy. Treatment-associated toxicity was significant, including mucositis and myelosuppression, but acceptable. Sixteen patients were eligible for evaluation of response. The overall complete response rate was 75.0% (12/16). Patients treated with radiotherapy had a 90.0% (9/10) overall complete response rate. (author)

  9. On the nature of the stabilisation of the E center dot center dot center dot pi pnicogen bond in the SbCl3 center dot center dot center dot toluene complex

    Czech Academy of Sciences Publication Activity Database

    Lo, Rabindranath; Švec, P.; Růžičková, Z.; Růžička, A.; Hobza, Pavel

    2016-01-01

    Roč. 52, č. 17 (2016), s. 3500-3503. ISSN 1359-7345 R&D Projects: GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : adapted perturbation theory * density functional theory * Kohn-Sham orbitals Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.834, year: 2014 http://pubs.rsc.org/en/content/articlepdf/2016/cc/c5cc10363k

  10. Structure of Na{sub 2}O{center_dot}MO{center_dot}SiO{sub 2}{center_dot}CaF{sub 2} (M=Mg, Ca) oxyfluoride glasses

    Energy Technology Data Exchange (ETDEWEB)

    Cheng Jinshu [State Key Laboratory of Silicate Materials for Architectures, Wuhan University of Technology, Wuhan 430070 (China); Deng Wei, E-mail: dengwei@whut.edu.cn [State Key Laboratory of Silicate Materials for Architectures, Wuhan University of Technology, Wuhan 430070 (China); Wang Mitang [School of Materials and Metallurgy, Inner Mongolia University of Science and Technology, Baotou 014010 (China)

    2012-07-15

    (9-x)CaO{center_dot}xMgO{center_dot}15Na{sub 2}O{center_dot}60SiO{sub 2}{center_dot}16CaF{sub 2}(x=0, 2, 4, 6, and 9) oxyfluoride glasses were prepared. Utilizing the Raman scattering technique together with {sup 29}Si and {sup 19}F MAS NMR, the effect of alkaline metal oxides on the Q species of glass was characterized. Raman results show that as magnesia is added at the expense of calcium oxide, the disproportional reaction Q{sup 3}{yields}Q{sup 4}+Q{sup 2} (Q{sup n} is a SiO{sub 4} tetrahedron with n bridging oxygens) prompted due to the high ionic field strength of magnesia, magnesium oxide entered into the silicate network as tetrahedral MgO{sub 4}, and removed other modifying ions for charge compensation. This reaction was confirmed by {sup 29}Si MAS NMR. {sup 19}F MAS NMR results show that fluorine exists in the form of mixed calcium sodium fluoride species in all glasses and no Si-F bonds were formed. As CaO is gradually replaced by MgO (x=6, 9), a proportion of the magnesium ions combines with fluorine to form the MgF{sup +} species. Meanwhile, some part of Na{sup +} ions complex F{sup -} in the form of F-Na(6).

  11. Off-Center D- Centers in a Quantum Dot in the Presence of a Perpendicular Magnetic Fields

    Institute of Scientific and Technical Information of China (English)

    XIE Wen-Fang

    2001-01-01

    We investigate the effect of the position of the donor in quantum dots on the energy spectrum in the presence ofa perpendicular magnetic field by using the method of few-body physics. As a function of the magnetic field, we find, when D- centers are placed sufficiently off-center, discontinuous ground-state transitions which are similar to those found in many-electron parabolic quantum dots. Series of magic numbers of angular momentum which minimize the ground-state electron-electron interaction energy have been discovered. The dependence of the binding energy of the ground-state of the 1D- center on the dot radius for a few values of the magnetic field strength is obtained and compared with other results.

  12. Color centers in NaCl by hybrid functionals

    OpenAIRE

    Chen, Wei; Tegenkamp, Christoph; Pfnür, Herbert; Bredow, Thomas

    2010-01-01

    We present in this work the electronic structure and transition energies (both thermodynamic and optical) of Cl vacancies in NaCl by hybrid density functionals. The underestimated transition energies by the semi-local functional inherited from the band gap problem are recovered by the PBE0 hybrid functional through the non-local exact exchange, whose amount is adjusted to reproduce the experimental band gap. The hybrid functional also gives a better account of the lattice relaxation for the d...

  13. Measurement of HO{sub x}{center_dot} production rate due to radon decay in air

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Huiling

    1993-08-01

    Radon in indoor air may cause the exposure of the public to excessive radioactivity. Radiolysis of water vapor in indoor air due to radon decay could produce ({center_dot}OH and HO{sub 2} {center_dot}) that may convert atmospheric constituents to compounds of lower vapor pressure. These lower vapor pressure compounds might then nucleate to form new particles in the indoor atmosphere. Chemical amplification was used to determine HO{sub x}{center_dot} production rate in indoor air caused by radon decay. Average HO{sub x}{center_dot} production rate was found to be (4.31{plus_minus}0.07) {times} 10{sup 5} HO{sub x}{center_dot} per Rn decay per second (Bq) 3.4 to 55.0% at 22C. This work provided G{sub (HO{sub x}{center_dot})}-value, 7.86{plus_minus}0.13 No./100 eV in air by directly measuring [HO{sub x}{center_dot}] formed from the radiolysis procedure. This G value implies that HO{sub x}{center_dot} produced by radon decay in air might be formed by multiple processes and may be result of positive ion-molecule reactions, primary radiolysis, and radical reactions. There is no obvious relation between HO{sub x}{center_dot} production rate and relative humidity. A laser-induced fluorescence (LIF) system has been used for {center_dot}OH production rate measurement; it consists of an excimer laser, a dye laser, a frequency doubler, a gaseous fluorescence chamber, and other optical and electronic parts. This system needs to be improved to eliminate the interferences of light scattering and artificial {center_dot}OH produced from the photolysis of O{sub 3}/H{sub 2}O.

  14. Thermoluminescence and F centers of manganese doped NaCl and NaCl-CKl crystals exposed to gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Somera, L.; Cruz Z, E.; Roman L, J. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Hernandez A, J. M.; Murrieta S, H., E-mail: ecruz@nucleares.unam.mx [UNAM, Instituto de Fisica, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico)

    2015-10-15

    Alkali halides crystals doped with rare earths or transition metals have been widely studied due to the luminescence properties. In particular, NaCl and KCl single crystals present thermally stimulated luminescence (Tl) after gamma irradiation. The NaCl and the NaCl KCl mixed crystal doped with manganese (MnCl{sub 2}) impurity were grown by using the Czochralski method. The emission characteristic of Mn{sup 2+} was observed at 543 nm. The crystals were exposed between 0.02 and 10 kGy gamma dose from {sup 60}Co irradiator. Optical absorption at room temperature shows the peaked band at 452 nm corresponding to the manganese impurity. The F bands, was ascribed to the electron trapped in the anion vacancy in the lattice, were obtained at 452 nm and 455 nm belonging to NaCl:Mn and NaCl KCl:Mn, respectively. The F band increases as the doses increase and it was bleaching by the UV light at 470 nm. The glow curves of the samples show the first glow peak between 92-103 degrees C, while the second main peak was observed at 183 degrees C for the undoped NaCl and at 148 and 165 degrees C for the NaCl:Mn and NaCl-KCl:Mn, respectively. The main peak was slowly bleaching when the irradiated sample was illuminated with F (470 nm) light. Optical bleaching confirms that the F center has an important participation in the thermoluminescent response. The glow curves structure from the thermal bleaching suggests the participation of different kind of traps. Also, the kinetics parameters such as activation energy (E), frequency factor (s) and the kinetic order (b) were investigated. (Author)

  15. Thermoluminescence and F centers of manganese doped NaCl and NaCl-CKl crystals exposed to gamma radiation

    International Nuclear Information System (INIS)

    Alkali halides crystals doped with rare earths or transition metals have been widely studied due to the luminescence properties. In particular, NaCl and KCl single crystals present thermally stimulated luminescence (Tl) after gamma irradiation. The NaCl and the NaCl KCl mixed crystal doped with manganese (MnCl2) impurity were grown by using the Czochralski method. The emission characteristic of Mn2+ was observed at 543 nm. The crystals were exposed between 0.02 and 10 kGy gamma dose from 60Co irradiator. Optical absorption at room temperature shows the peaked band at 452 nm corresponding to the manganese impurity. The F bands, was ascribed to the electron trapped in the anion vacancy in the lattice, were obtained at 452 nm and 455 nm belonging to NaCl:Mn and NaCl KCl:Mn, respectively. The F band increases as the doses increase and it was bleaching by the UV light at 470 nm. The glow curves of the samples show the first glow peak between 92-103 degrees C, while the second main peak was observed at 183 degrees C for the undoped NaCl and at 148 and 165 degrees C for the NaCl:Mn and NaCl-KCl:Mn, respectively. The main peak was slowly bleaching when the irradiated sample was illuminated with F (470 nm) light. Optical bleaching confirms that the F center has an important participation in the thermoluminescent response. The glow curves structure from the thermal bleaching suggests the participation of different kind of traps. Also, the kinetics parameters such as activation energy (E), frequency factor (s) and the kinetic order (b) were investigated. (Author)

  16. Effects of Temperature and Electric Field on the Coherence Time of a RbCl Parabolic Quantum Dot Qubit

    Science.gov (United States)

    Xiao, Wei; Xiao, Jing-Lin

    2016-06-01

    We study the effects of the temperature and electric field on the coherence time of a RbCl parabolic quantum dot (PQD) qubit by using the variational method of Pekar type, the Fermi Golden Rule and the quantum statistics theory (VMPTFGRQST). The ground and the first excited states' (GFES) eigenenergies and the eigenfunctions of an electron in the RbCl PQD with an applied electric field are derived. A single qubit can be realized in this two-level quantum system. It turns out that the coherence time is a decreasing function of the temperature and the electric field, whereas it is an increasing one of the effective confinement length (ECL). By changing the electric field, the temperature and the ECL one can adjust the coherence time. Our research results may be useful for the design and implementation of solid-state quantum computation.

  17. Quasiclassical trajectory study of the four-center reactions: HBr+Cl2 and HBr+BrCl

    International Nuclear Information System (INIS)

    A quasiclassical trajectory study has been made of the dynamics of two four-center reactions: HBr+Cl2→HCl+BrCl, HBr+BrCl→HCl+Br2. Semiempirical, valence-bond potential-energy surfaces were employed, with potential parameters obtained from related atom--diatomic molecule systems. Reaction probabilities and cross sections were computed as functions of reactant vibration, rotation, and translation. Extrapolated cross section curves were used to make estimates of thermal rate coefficients. The dependence of the reaction probability on other dynamics variables such as impact parameter and orientation angles was also investigated. These results indicate that under attainable laboratory conditions (including IR excitation) the reaction proceeds at a rate too slow to be observed by usual methods

  18. Optical properties of the Bi+ center in KAlCl4

    International Nuclear Information System (INIS)

    Temperature behavior of the Bi+ center emission, excitation bands and luminescence decay law in KAlCl4 crystal are investigated. Abrupt changes of the monocation optical properties are observed at phase transitions of the host. The observed optical transitions are assigned to the specific energy states of Bi+ ion. It is shown that two thermalized levels are responsible for the luminescence. The experimental temperature behavior of the emission and excitation bands are in agreement with theory of electron–phonon interaction of impurity centers in solids; the effective-phonon frequencies and Huang–Rhys parameters are estimated. The configuration coordinate diagram is determined for the Bi+ center in KAlCl4 crystal. - Highlights: • Optical properties of the Bi+ center in KAlCl4 are investigated in details. • The optical transitions are assigned to the specific energy states of Bi+ ion. • The parameters of electron–phonon interaction of the Bi+ center in KAlCl4 are estimated. • The configuration coordinate diagram of the Bi+ in KAlCl4 is determined

  19. Synthesis and properties of BaO{center_dot}AL{sub 2}O{sub 3}{center_dot}2SiO{sub 2}-SrO{center_dot}Al{sub 2}O{sub 3}{center_dot}2SiO{sub 2}(BAS-SAS) ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Talmy, I.G.; Haught, D.A.; Zaykoski, J.A. [Naval Surface Warfare Center, Silver Spring, MD (United States)] [and others

    1995-08-01

    Ceramics based on BaO{center_dot}AL{sub 2}O{sub 3}{center_dot}2SiO{sub 2} (celsian, BAS) and SrO{center_dot}Al{sub 2}O{sub 3}{center_dot}2SiO{sub 2} (SAS) are attracting considerable interest for a variety of applications due to their unique combination of high refractoriness, low thermal expansion, low dielectric constant and loss tangent both stable over a broad range of temperatures and frequencies. Dielectric ceramics, electronic packaging, and structural ceramics are all possible applications for BAS and SAS. Celsian is the only ternary compound in the BaO-AL{sub 2}O{sub 3}{center_dot}SiO{sub 2} system. It exists in two main crystalline modifications: monoclinic, stable up to 1590{degrees}C and hexagonal, stable from 1590{degrees}C to the melting temperature (1760{degrees}C). Even though the hexagonal modification (hexacelsian) is the high temperature modification, it tends to be the first product of synthesis (solid- and gaseous state reactions, melt crystallization, sol-gel process, and oxidation of metals) and persists metastably throughout the whole temperature range. Hexacelsian reversibly transforms at 300{degrees}C into the low temperature orthorhombic modification. Transformation of hexagonal celsian into the desirable monoclinic form is promoted by prolonged high-temperature heating, hydrothermal treatment, and by the presence of impurities or the addition of certain additives (such as B{sub 2}O{sub 3}LiF, Cr{sub 2}O{sub 3}, ZrSiO{sub 3}). The additives or impurities can adversely affect all properties of the ceramics, particularly their dielectric behavior and high-temperature mechanical properties. Strontium aluminosilicate (SAS) with a melting point of 1710{degrees}C exhibits similar polymorphism. This article summarizes the results of research conducted at the Naval Surface Warfare Center (Dahlgren Division) on synthesis, processing and characterization of ceramics based on the BAS-SAS system.

  20. "Dot COM", a nuclear transit center for the primary piRNA pathway in Drosophila.

    Science.gov (United States)

    Dennis, Cynthia; Zanni, Vanessa; Brasset, Emilie; Eymery, Angeline; Zhang, Liang; Mteirek, Rana; Jensen, Silke; Rong, Yikang S; Vaury, Chantal

    2013-01-01

    The piRNA pathway protects genomes by silencing mobile elements. Despite advances in understanding the processing events that generate piRNAs for silencing, little is known about how primary transcripts are transported from their genomic clusters to their processing centers. Using a model of the Drosophila COM/flamenco locus in ovarian somatic cells, we identified a prominent nuclear structure called Dot COM, which is enriched in long transcripts from piRNA clusters but located far from their transcription sites. Remarkably, transcripts from multiple clusters accumulate at Dot COM, which is often juxtaposed with Yb-bodies, the cytoplasmic processing centers for cluster transcripts. Genetic evidence suggests that the accumulation of precursor transcripts at Dot COM represents one of the most upstream events in the piRNA pathway. Our results provide new insights into the initial steps of the piRNA pathway, and open up a new research area important for a complete understanding of this conserved pathway. PMID:24039799

  1. Excitons and biexcitons in InGaN quantum dot like localization centers

    International Nuclear Information System (INIS)

    Indium segregation in a narrow InGaN single quantum well creates quantum dot (QD) like exciton localization centers. Cross-section transmission electron microscopy reveals varying shapes and lateral sizes in the range ∼1–5 nm of the QD-like features, while scanning near field optical microscopy demonstrates a highly inhomogeneous spatial distribution of optically active individual localization centers. Microphotoluminescence spectroscopy confirms the spectrally inhomogeneous distribution of localization centers, in which the exciton and the biexciton related emissions from single centers of varying geometry could be identified by means of excitation power dependencies. Interestingly, the biexciton binding energy (Ebxx) was found to vary from center to center, between 3 to −22 meV, in correlation with the exciton emission energy. Negative binding energies are only justified by a three-dimensional quantum confinement, which confirms QD-like properties of the localization centers. The observed energy correlation is proposed to be understood as variations of the lateral extension of the confinement potential, which would yield smaller values of Ebxx for reduced lateral extension and higher exciton emission energy. The proposed relation between lateral extension and Ebxx is further supported by the exciton and the biexciton recombination lifetimes of a single QD, which suggest a lateral extension of merely ∼3 nm for a QD with strongly negative Ebxx = −15.5 meV. (paper)

  2. Binding energy and optical properties of an off-center hydrogenic donor impurity in a spherical quantum dot placed at the center of a cylindrical nano-wire

    Energy Technology Data Exchange (ETDEWEB)

    Safarpour, Gh., E-mail: safarpour.ghasem@gmail.com [Young Researchers and Elite Club, Shiraz Branch, Islamic Azad University, Shiraz (Iran, Islamic Republic of); Marvdasht Branch, Islamic Azad University, Marvdasht (Iran, Islamic Republic of); Barati, M. [Department of Physics, Science and Research Branch, Islamic Azad University, Fars (Iran, Islamic Republic of); Zamani, A. [Young Researchers and Elite Club, Zarghan Branch, Islamic Azad University, Zarghan (Iran, Islamic Republic of); Niknam, E. [Marvdasht Branch, Islamic Azad University, Marvdasht (Iran, Islamic Republic of)

    2014-01-15

    The binding energy as well as the linear, third-order nonlinear and total optical absorption coefficient and refractive index changes of an off-center hydrogenic donor impurity in an InAs spherical quantum dot placed at the center of a GaAs cylindrical nano-wire have been investigated. In this regard, the effective-mass approximation approach is considered and eigenvalues and corresponding eigenfunctions are calculated via the finite element method. The binding energy is plotted as a function of the dot size and impurity position along with optical properties as a function of photon energy. In this study two different directions have been considered for impurity position, along the nano-wire axis and perpendicular to it. It has been found that the binding energy, absorption coefficient and refractive index changes are impressively affected not only by the dot radius but also by the position of the impurity and its direction. Additionally, the optical saturation can be tuned by the direction of the impurity and incident optical intensity. -- Highlights: • We consider spherical quantum dot located at the center of a cylindrical nano-wire. • An off-center hydrogenic donor impurity is considered in the system. • Binding energy is affected by orientation of impurity and its distance from center. • Saturation depends on the orientation of impurity position. • By shifting impurity position, orientation and dot radius blue- and red-shifts appear.

  3. Binding energy and optical properties of an off-center hydrogenic donor impurity in a spherical quantum dot placed at the center of a cylindrical nano-wire

    International Nuclear Information System (INIS)

    The binding energy as well as the linear, third-order nonlinear and total optical absorption coefficient and refractive index changes of an off-center hydrogenic donor impurity in an InAs spherical quantum dot placed at the center of a GaAs cylindrical nano-wire have been investigated. In this regard, the effective-mass approximation approach is considered and eigenvalues and corresponding eigenfunctions are calculated via the finite element method. The binding energy is plotted as a function of the dot size and impurity position along with optical properties as a function of photon energy. In this study two different directions have been considered for impurity position, along the nano-wire axis and perpendicular to it. It has been found that the binding energy, absorption coefficient and refractive index changes are impressively affected not only by the dot radius but also by the position of the impurity and its direction. Additionally, the optical saturation can be tuned by the direction of the impurity and incident optical intensity. -- Highlights: • We consider spherical quantum dot located at the center of a cylindrical nano-wire. • An off-center hydrogenic donor impurity is considered in the system. • Binding energy is affected by orientation of impurity and its distance from center. • Saturation depends on the orientation of impurity position. • By shifting impurity position, orientation and dot radius blue- and red-shifts appear

  4. Assessing the occurrence of the dibromide radical (Br{sub 2}{sup -{center_dot}}) in natural waters: Measures of triplet-sensitised formation, reactivity, and modelling

    Energy Technology Data Exchange (ETDEWEB)

    De Laurentiis, Elisa; Minella, Marco; Maurino, Valter; Minero, Claudio [Universita degli Studi di Torino, Dipartimento di Chimica, Via P. Giuria 5, 10125 Torino (Italy); Mailhot, Gilles; Sarakha, Mohamed [Clermont Universite, Universite Blaise Pascal, Institut de Chimie de Clermont-Ferrand, BP 10448, F-63000 Clermont-Ferrand (France); CNRS, UMR 6296, ICCF, F-63171 Aubiere (France); Brigante, Marcello, E-mail: marcello.brigante@univ-bpclermont.fr [Clermont Universite, Universite Blaise Pascal, Institut de Chimie de Clermont-Ferrand, BP 10448, F-63000 Clermont-Ferrand (France); CNRS, UMR 6296, ICCF, F-63171 Aubiere (France); Vione, Davide, E-mail: davide.vione@unito.it [Universita degli Studi di Torino, Dipartimento di Chimica, Via P. Giuria 5, 10125 Torino (Italy); Universita degli Studi di Torino, Centro Interdipartimentale NatRisk, Via Leonardo da Vinci 44, 10095 Grugliasco (Italy)

    2012-11-15

    The triplet state of anthraquinone-2-sulphonate (AQ2S) is able to oxidise bromide to Br{sup {center_dot}}/Br{sub 2}{sup -{center_dot}}, with rate constant (2-4) Dot-Operator 10{sup 9} M{sup -1} s{sup -1} that depends on the pH. Similar processes are expected to take place between bromide and the triplet states of naturally occurring chromophoric dissolved organic matter ({sup 3}CDOM*). The brominating agent Br{sub 2}{sup -{center_dot}} could thus be formed in natural waters upon oxidation of bromide by both {sup {center_dot}}OH and {sup 3}CDOM*. Br{sub 2}{sup -{center_dot}} would be consumed by disproportionation into bromide and bromine, as well as upon reaction with nitrite and most notably with dissolved organic matter (DOM). By using the laser flash photolysis technique, and phenol as model organic molecule, a second-order reaction rate constant of {approx} 3 Dot-Operator 10{sup 2} L (mg C){sup -1} s{sup -1} was measured between Br{sub 2}{sup -{center_dot}} and DOM. It was thus possible to model the formation and reactivity of Br{sub 2}{sup -{center_dot}} in natural waters, assessing the steady-state [Br{sub 2}{sup -{center_dot}}] Almost-Equal-To 10{sup -13}-10{sup -12} M. It is concluded that bromide oxidation by {sup 3}CDOM* would be significant compared to oxidation by {sup {center_dot}}OH. The {sup 3}CDOM*-mediated process would prevail in DOM-rich and bromide-rich environments, the latter because elevated bromide would completely scavenge {sup {center_dot}}OH. Under such conditions, {sup {center_dot}}OH-assisted formation of Br{sub 2}{sup -{center_dot}} would be limited by the formation rate of the hydroxyl radical. In contrast, the formation rate of {sup 3}CDOM* is much higher compared to that of {sup {center_dot}}OH in most surface waters and would provide a large {sup 3}CDOM* reservoir for bromide to react with. A further issue is that nitrite oxidation by Br{sub 2}{sup -{center_dot}} could be an important source of the nitrating agent {sup {center_dot

  5. Evaluation of preoperative simultaneous radiochemotherapy combined with carboplatin and tegafur{center_dot}uracil

    Energy Technology Data Exchange (ETDEWEB)

    Katayama, Akihiro; Nonaka, Satoshi; Bandoh, Nobuyuki; Imada, Masanobu; Hayashi, Tatsuya; Harabuchi, Yasuaki [Asahikawa Medical Coll., Hokkaido (Japan)

    2002-06-01

    We performed preoperative radiochemotherapy including local irradiation with total dose of 40 Gy along with concomitant combination chemotherapy with carboplatin and tegafur(center dot)uracil for 11 head and neck squamous cell carcinomas and evaluated the clinical and histopathological effects as well as the side effects. Seventy-three percent of patients accomplished significant clinical effects equal to or more than PR and significant histopathological effects in surgically resected tissues. Side effects were seen in only one patient with severe hypoleukocytemia, no patients with renal dysfunction, and 34% of patients with severe oral mucositis. These results suggest that our radiochemotherapy may be useful for preoperative treatment for patients with locally advanced head and neck squamous cell carcinomas. (author)

  6. Vibronic relaxation processes of the FA center in RbCl:Li

    International Nuclear Information System (INIS)

    The vibronic relaxation process of FA centers in RbCl:Li, which have Type I emission at low temperatures and Type II emission at high temperatures, has been studied at 10 and 77 K by measuring the resonant secondary radiation (RSR) spectrum from optically excited FA centers with pico-second time-resolved spectroscopy. This study has been prompted by the quest to improve our knowledge on the de-excitation process in the FA centers. The adiabatic potential energy curves are deduced from a theoretical analysis of the measured RSR spectra and compared with those already known. It is shown that Type II relaxation observed at 77 K occurs after Type I relaxation, supporting in turn a model proposed by Baldacchini et al. based on photoluminescence measurements. - Highlights: ► The vibronic relaxation process of FA centers in a laser active material. ► The explanation of the vibronic relaxation process of FA centers with the coexistence of Type I and Type II relaxations. ► Results of the time-resolved resonant secondary radiation (RSR) measurement. ► A new model of the de-excitation process in the FA centers.

  7. Two-center three-electron bonding in ClNH3 revealed via helium droplet infrared laser Stark spectroscopy: Entrance channel complex along the Cl + NH3 → ClNH2 + H reaction.

    Science.gov (United States)

    Moradi, Christopher P; Xie, Changjian; Kaufmann, Matin; Guo, Hua; Douberly, Gary E

    2016-04-28

    Pyrolytic dissociation of Cl2 is employed to dope helium droplets with single Cl atoms. Sequential addition of NH3 to Cl-doped droplets leads to the formation of a complex residing in the entry valley to the substitution reaction Cl + NH3 → ClNH2 + H. Infrared Stark spectroscopy in the NH stretching region reveals symmetric and antisymmetric vibrations of a C3v symmetric top. Frequency shifts from NH3 and dipole moment measurements are consistent with a ClNH3 complex containing a relatively strong two-center three-electron (2c-3e) bond. The nature of the 2c-3e bonding in ClNH3 is explored computationally and found to be consistent with the complexation-induced blue shifts observed experimentally. Computations of interconversion pathways reveal nearly barrierless routes to the formation of this complex, consistent with the absence in experimental spectra of two other complexes, NH3Cl and Cl-HNH2, which are predicted in the entry valley to the hydrogen abstraction reaction Cl + NH3 → HCl + NH2. PMID:27131544

  8. Formation of Cu-related emission centers under thermal doping of ZnS powders with CuCl and CuCl2

    International Nuclear Information System (INIS)

    The photoluminescence (PL), PL excitation and electron paramagnetic resonance spectra of powderlike ZnS doped with Cu from CuCl and CuCl2 compounds at 800 °C with restricted access of atmospheric air or in He flow were investigated. It is shown that the contribution of blue and green PL bands to PL spectra depends on the compounds used for doping and on the annealing conditions. The appearance of Cu clusters on the surface of ZnS microcrystals for both doping compounds is found. These clusters manifest themselves in the presence of broad line in electron paramagnetic resonance spectra and are the additional source for the doping of ZnS powder. The chemical reactions upon doping are analyzed. It is shown that these reactions control the concentration of the recombination centers responsible for blue and green PL bands and are also the reason of Cu clusters appearance. Under annealing in He flow when volatile components are removed by flowing gas, the dominant process can be the doping of ZnS from Cu clusters. This allows obtaining the blue band mainly. The localization of recombination centers responsible for blue and green emissions is discussed. - Highlights: • ZnS powder doped from CuCl and CuCl2 under different conditions was investigated. • The doping from different compounds results in the different ratio of B- and G-centers concentration. • The chemical reactions in the charge control the B- and G-center formation. • Under annealing in He flow the dominant process can be ZnS doping from Cu clusters

  9. Proton production from Si+Au collisions at 14.5 A/center dot/GeV

    International Nuclear Information System (INIS)

    Recent results are presented from the study of central Si+Au → p+X, Si+Au → π/sup +-/+X, and Si+Cu → p+X at 14.5 A/center dot/GeV. The distribution of protons in rapidity indicates that many target protons are found above 0.5 units. The variation of the slope parameter in rapidity is consistent with a thermal source of protons at the geometric center-of-mass rapidity. 4 refs., 4 figs

  10. The Crystal Structure of Impurity Centers Tm^{2+} and Eu^{2+} in SrCl2 : Ab Initio Calculations

    Science.gov (United States)

    Chernyshev, V. A.; Serdcev, A. V.; Petrov, V. P.; Nikiforov, A. E.

    2016-01-01

    Ab initio calculations of the impurity centers Tm^{2+} thulium and europium Eu^{2+} in SrCl2 and MeF2 (Me = Ca, Sr, Ba) were carried out at low (zero) temperature. The crystal structure of impurity centers was investigated. Charge density maps show that the bonds formed by the rare-earth ions have an ionic character. The crystal structures, lattice dynamics, and band structures of MeF2 and SrCl2 were calculated at low temperature. Ab initio calculations were performed in periodic CRYSTAL code within the framework of the MO LCAO approach by using hybrid DFT functionals.

  11. Ternary Isothermal Diffusion Coefficients of NaCl-MgCl2-H2O at 25 C. 7. Seawater Composition

    Energy Technology Data Exchange (ETDEWEB)

    Miller, D G; Lee, C M; Rard, J A

    2007-02-12

    The four diffusion coefficients D{sub ij} of the ternary system NaCl-MgCl{sub 2}-H{sub 2}O at the simplified seawater composition 0.48877 mol {center_dot} dm{sup -3} NaCl and 0.05110 mol {center_dot} dm{sup -3} MgCl{sub 2} have been remeasured at 25 C. The diffusion coefficients were obtained using both Gouy and Rayleigh interferometry with the highly precise Gosting diffusiometer. The results, which should be identical in principle, are essentially the same within or very close to their combined 'realistic' errors. This system has a cross-term D{sub 12} that is larger than the D{sub 22} main-term, where subscript 1 denotes NaCl and 2 denotes MgCl{sub 2}. The results are compared with earlier, less-precise measurements. Recommended values for this system are (D{sub 11}){sub V} = 1.432 x 10{sup -9} m{sup 2} {center_dot} sec{sup -1}, (D{sub 12}){sub V} = 0.750 x 10{sup -9} m{sup 2} {center_dot} sec{sup -1}, (D{sub 21}){sub V} = 0.0185 x 10{sup -9} m{sup 2} {center_dot} sec{sup -1}, and (D{sub 22}){sub V} = 0.728 x 10{sup -9} m{sup 2} {center_dot} sec{sup -1}.

  12. Holes resonant tunneling through double-barrier structure with InAs quantum dots in the center of the GaAs quantum well

    International Nuclear Information System (INIS)

    The influence of InAs quantum dots grown in the center of GaAs quantum well on the tunnel characteristics of the resonant-tunnel diodes based on the p-type AlAs/GaAs/AlAs heterostructure is investigated. The introduction of quantum dots results in the shift and the diffusion of resonant peaks of the volt-ampere characteristics of diodes. However this effect essentially depends on the number of the 2D-subband involving into tunneling. The causes of such dependence are qualitatively explained by generation of the fluctuation potential in the vicinity of the quantum dots layer

  13. The nonlinear optical rectification coefficient of quantum dots and rings with a repulsive scattering center

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Wenfang, E-mail: xiewf@gzhu.edu.cn

    2013-11-15

    By using the matrix diagonalization method within the effective-mass approximation, we have investigated the second-order nonlinear optical rectification coefficient associated with intersubband transitions in quantum dots and rings which include a repulsive scattering centre and are subjected to a perpendicular magnetic field. Based on the computed energies and wave functions, we have studied the effects of impurity and magnetic field in quantum dots and rings on this coefficient. The results show that the nonlinear optical properties of quantum dots and rings are strongly affected by the external magnetic field, the quantum size and the impurity. Also we find that the second-order nonlinear optical rectification coefficient of quantum rings shows the Aharonov–Bohm oscillation as the external magnetic field is increased. -- Highlights: • The nonlinear ORC in quantum dots and rings which include a repulsive scattering centre is investigated. • The nonlinear ORC in quantum rings shows the Aharonov–Bohm oscillation as the magnetic field is increased. • The nonlinear ORC shifts to higher energy and increases when the impurity effect is considered.

  14. Optical excitation in doped quasi-one-dimensional antiferromagnet (CsMnCl3 centre dot 2H2O+Cu2+)

    International Nuclear Information System (INIS)

    In the wide range of wavelengths and temperatures, the spectra of light absorption and luminescence excitation as well as the emission decay kinetics of a quasi-one-dimensional dielectric crystal CsMnCl3 centre dot 2H2O doped with copper ions (molar concentration 0-3%) are studied. The conclusion is made of the exchange of electronic excitation energy being possible between the matrix and dopant subsystems only in the lowest excited state due to migration of excitation and their trapping by excitation traps of the copper origin. From the analysis of the shape of decay kinetics curves of the matrix luminescence of the crystal, the values of hopping (along the chains of manganese ions) and trapping rates of magnetic excitons are determined

  15. AB INITIO STUDY OF THE POSSIBLE SINGLE-CENTER UNITS FOR BINUCLEAR IRON COMPLEX [Fe2(bpym3Cl4

    Directory of Open Access Journals (Sweden)

    Tihonovschi Andrei

    2008-12-01

    Full Text Available In present work we study two possible single-center units for binuclear iron complex Fe2(bpym3Cl4 –[Fe(bpym3]2+ and Fe(bpym2Cl2. The obtained ground states for both studied systems are singlet states. In the case of Fe(bpym2Cl2 the lowest excited states were calculated to be 240cm-1 (triplet and 660cm-1 (quintet above the ground state and so are placed according to Lande rule. These states could be populated at room temperatures. For [Fe(bpym3]2+ first excited state was found to be about 6000cm-1 above the ground state and so cannot be populated at normal temperatures.

  16. From k{center_dot}p to atomic calculations applied to semiconductor heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Pedesseau, L; Cornet, C; Dore, F; Even, J [FOTON-INSA Laboratory, UMR 6058 au CNRS, INSA de Rennes, 20 avenue des Buttes de Coemes, CS 14315, 35043 RENNES Cedex (France); Schliwa, A; Bimberg, D [Institut fuer Festkoerperphysik, Technische Universitaet Berlin, Hardenbergstrasse 36, 10623 Berlin (Germany)], E-mail: laurent.pedesseau@insa-rennes.fr

    2008-03-15

    We present a brief overview of the main results obtained in our group for the simulation of electronic and optical properties of semiconductor heterostructures. A short introduction is given on InAs quantum dots, grown on InP, GaAs and GaP substrates. It is shown that 1-band k.p calculations can be used in the reciprocal space, in order to get a simulation of perfectly ordered array of quantum dots. A semianalytical modeling is also presented, including an axial approximation of the 8*8 band k.p calculations. Linear and nonlinear contributions to piezoelectricity are discussed. A complete 8*8 band k.p approach is then used to show the properties of InAs/InP quantum dots, with different substrate orientations. Finally, a study of the highly strained InAs/GaP interface is performed with a first principle modeling using ABINIT packages. Band lineups and evolution of gap energies are calculated, and compared to those found by Chuang et al.

  17. Temperature-Dependent Exciton and Trap-Related Photoluminescence of CdTe Quantum Dots Embedded in a NaCl Matrix: Implication in Thermometry.

    Science.gov (United States)

    Kalytchuk, Sergii; Zhovtiuk, Olga; Kershaw, Stephen V; Zbořil, Radek; Rogach, Andrey L

    2016-01-27

    Temperature-dependent optical studies of semiconductor quantum dots (QDs) are fundamentally important for a variety of sensing and imaging applications. The steady-state and time-resolved photoluminescence properties of CdTe QDs in the size range from 2.3 to 3.1 nm embedded into a protective matrix of NaCl are studied as a function of temperature from 80 to 360 K. The temperature coefficient is found to be strongly dependent on QD size, with the highest sensitivity obtained for the smallest size of QDs. The emission from solid-state CdTe QD-based powders is maintained with high color purity over a wide range of temperatures. Photoluminescence lifetime data suggest that temperature dependence of the intrinsic radiative lifetime in CdTe QDs is rather weak, and it is mostly the temperature-dependent nonradiative decay of CdTe QDs which is responsible for the thermal quenching of photoluminescence intensity. By virtue of the temperature-dependent photoluminescence behavior, high color purity, photostability, and high photoluminescence quantum yield (26%-37% in the solid state), CdTe QDs embedded in NaCl matrices are useful solid-state probes for thermal imaging and sensing over a wide range of temperatures within a number of detection schemes and outstanding sensitivity, such as luminescence thermochromic imaging, ratiometric luminescence, and luminescence lifetime thermal sensing. PMID:26618345

  18. Why Is the L-Shaped Structure of X-2 center dot center dot center dot X-2 (X = F, Cl, Br, I) Complexes More Stable Than Other Structures?

    Czech Academy of Sciences Publication Activity Database

    Sedlák, Robert; Deepa, Palanisamy; Hobza, Pavel

    2014-01-01

    Roč. 118, č. 21 (2014), s. 3846-3855. ISSN 1089-5639 R&D Projects: GA ČR GBP208/12/G016 Grant ostatní: Operational Program Research and Development for Innovations(XE) CZ 1.05/2.1.00/03/0058 Institutional support: RVO:61388963 Keywords : distributed multipole analysis * density functional theory * consistent basis sets * correlated molecular calculations Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.693, year: 2014

  19. A administração clássica: um estudo aplicado a centrais de atendimento (call center

    Directory of Open Access Journals (Sweden)

    Jairo Moran Carvalho Ribeiro

    2015-04-01

    Full Text Available As organizações modernas, a exemplo de operações de centrais de atendimento, ou call centers, tem atuado em diversas áreas de negócios, que pode ser do simples atendimento, como os serviços de atendimento a clientes - SAC, a grandes empresas com foco em cobrança, televendas ou operações diversas. Assim, a pesquisa buscou apresentar evidências do emprego das teorias clássicas da administração, através de estudo de casos, em dois Call Centers de empresas do Rio Grande do Sul vinculados à rede varejista de eletroeletrônicos e a distribuidora de energia elétrica. Embora, a natureza de atuação diversa entre as duas centrais analisadas, os princípios clássicos da administração se mostraram evidenciados em ambas as operações, a exemplo da racionalização do trabalho, controle das atividades, supervisão atuante, jornadas definidas, prêmios por produção, dentre outros elementos característicos dos princípios defendidos por Taylor, Fayol, Ford entre outros clássicos da administração.

  20. 75 FR 37994 - Airworthiness Directives; Bombardier, Inc. Model CL-600-1A11 (CL-600), CL-600-2A12 (CL-601), CL...

    Science.gov (United States)

    2010-07-01

    ... FR 6862). That NPRM proposed to correct an unsafe condition for the specified products. The MCAI... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3..., Inc. Model CL-600-1A11 (CL- 600), CL-600-2A12 (CL-601), CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-...

  1. Thermodynamic properties of potassium nitrate-magnesium nitrate compound [2KNO{sub 3}{center_dot}Mg(NO{sub 3}){sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, Ramana G., E-mail: rreddy@eng.ua.edu [Department of Metallurgical and Materials Engineering, The University of Alabama, Tuscaloosa, AL 35487-0202 (United States); Wang, Tao; Mantha, Divakar [Department of Metallurgical and Materials Engineering, The University of Alabama, Tuscaloosa, AL 35487-0202 (United States)

    2012-03-10

    Highlights: Black-Right-Pointing-Pointer Thermodynamic properties of 2KNO{sub 3}{center_dot}Mg(NO{sub 3}){sub 2} compound were experimentally determined. Black-Right-Pointing-Pointer The 2KNO{sub 3}{center_dot}Mg(NO{sub 3}){sub 2} compound melting point and heat capacity were determined. Black-Right-Pointing-Pointer The enthalpies of transitions were determined. Black-Right-Pointing-Pointer The enthalpy, entropy and Gibbs energies as function of temperature were reduced. - Abstract: The Mg(NO{sub 3}){sub 2}-KNO{sub 3} binary system phase diagram has a congruent melting compound, 2KNO{sub 3}{center_dot}Mg(NO{sub 3}){sub 2}. The thermodynamic properties for this compound are not available in the literature. In this study, the nitrate compound was synthesized and the melting point and heat capacity were determined using differential scanning calorimetry (DSC). Two endothermic peaks were observed at 404.8 K and 468.83 K corresponding to solid state transition and melting of the compound with the enthalpies of transitions as 2.71 kJ/mol and 20.73 kJ/mol, respectively. The heat capacity data as function of temperature are fit to polynomial function and thermodynamic properties like enthalpy, entropy and Gibbs energies of the compound as function of temperature are subsequently deduced.

  2. Synthesis and photoluminescence properties of aqueous CdWO4 quantum dots with WO66- luminescence center

    International Nuclear Information System (INIS)

    Aqueous CdWO4 QDs were synthesized by the reaction of CdCl2 and Na2WO4 in the presence of mercaptoacetic acid (TGA) as capping reagent. The crystal morphology, particle size and its distribution of as-prepared products were characterized by transmission electron microscopy (TEM, SAED) atomic force microscopy (AFM), high-resolution transmission electron microscopy (HRTEM), and photon correlation spectroscopy (PCS), respectively. Qualitative assays for functional groups on the QDs' surface were measured by fourier transform infrared spectroscopy (FTIR). Photoluminescence properties of QDs were studied by photoluminescence spectroscopy (PL). The results showed that the single QD with diameter of about 8 ± 2 nm was single-crystal. The particle size distribution of QDs was normal. Infrared absorption bands of carboxylic group on the surface of CdWO4 QDs were observed around 1610-1550 cm-1 (nonsymmetrical vibration of -COO-) and 1400 cm-1 (symmetric vibration of C-O). With reaction-time going, PL peak position shifted from 498 to 549 nm and intensity of PL increased first and then decreased. PL peak position of QDs was blue-shift compared with 570 nm WO66- luminescence center of bulk CdWO4.

  3. Genotoxic and oxidative responses in coelomocytes of Eisenia fetida and Hediste diversicolor exposed to lipid-coated CdSe/ZnS quantum dots and CdCl2.

    Science.gov (United States)

    Saez, Gladys; Aye, Mélanie; De Meo, Michel; Aimé, Ahissan; Bestel, Isabelle; Barthélémy, Philippe; Di Giorgio, Carole

    2015-07-01

    The emerging of Quantum Dots utilization in industrial or medicinal fields involved a potentially increase of these nanoparticles in environment. In this work, the genotoxic (comet assay) and oxidative effects (SOD activity, TBARS) of functionalized-QDs and cadmium chloride were investigated on Hediste diversicolor and Eisenia fetida coelomocytes. Results demonstrated that functionalized-QDs (QDNs) and cadmium chloride induced DNA damages through different mechanisms that depended on the nano- or ionic nature of Cd. The minimal genotoxic concentrations for H. diversicolor (<0.001ng/g for QDNs and CdCl2 ) were lower than for E. fetida (between 0.01 and 0.1 ng/g for QDNs, and between 0.001 and 0.01 ng/g for CdCl2 ). These results showed that H. diversicolor was more sensitive than E. fetida. The two contaminants had a low impact on the oxidative stress markers. PMID:24500942

  4. 76 FR 59067 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604...

    Science.gov (United States)

    2011-09-23

    ... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3.... Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY: Federal Aviation...) events have occurred where the Air-Driven Generator (ADG) failed to provide power on CL-600-2B19...

  5. Formation of the center of ignition in a CH3Cl-Cl2 mixture under the action of UV light

    Science.gov (United States)

    Begishev, I. R.; Belikov, A. K.; Komrakov, P. V.; Nikitin, I. S.

    2016-07-01

    The dependence of temperature on time is investigated using a microthermocouple at different distances from a UV light source in a mixture of chlorine and chloromethane. These relationships give an idea of the size and location of a center of photoignition. It is found that if the size of the reaction vessel in the direction of the luminous flux is much greater than the dimensions of the ignition center, the thermal expansion of a reacting gas mixture has a huge impact on such photoignition parameters as the critical concentration limits and the critical intensity of UV radiation. It is found that by increasing the length of the vessel, some chlorinated combustible mixtures lose the ability to ignite when exposed to UV light.

  6. Quantum dots

    CERN Document Server

    Borovitskaya, Elena

    2002-01-01

    In this book, leading experts on quantum dot theory and technology provide comprehensive reviews of all aspects of quantum dot systems. The following topics are covered: (1) energy states in quantum dots, including the effects of strain and many-body effects; (2) self-assembly and self-ordering of quantum dots in semiconductor systems; (3) growth, structures, and optical properties of III-nitride quantum dots; (4) quantum dot lasers. Contents: Low-Dimensional Systems (E Borovitskaya & M S Shur); Energy States in Quantum Dots (A J Williamson); Self-Organized Quantum Dots (A R Woll et al.); Grow

  7. 77 FR 56525 - Special Conditions: Bombardier, Model CL-600-2B16 Airplane (CL-601-3A, CL-601-3R, and CL-604...

    Science.gov (United States)

    2012-09-13

    ... April 11, 2000 (65 FR 19477-19478), as well as at http://DocketsInfo.dot.gov/ . Docket: Background... Administration 14 CFR Part 25 Special Conditions: Bombardier, Model CL-600-2B16 Airplane (CL- 601-3A, CL-601-3R, and CL-604 Variants); Enhanced Flight Vision System AGENCY: Federal Aviation Administration (FAA),...

  8. 76 FR 41653 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A...

    Science.gov (United States)

    2011-07-15

    ... products. That NPRM was published in the Federal Register on January 5, 2011 (76 FR 477). That NPRM...; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034.... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes...

  9. Cation disorder and vacancy distribution in nonstoichiometric magnesium aluminate spinel, MgO{center{underscore}dot}xAl{sub 2}O{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Sheldon, R.I.; Hartmann, T.; Sickafus, K.E.; Ibarra, A.; Scott, B.L.; Argyriou, D.N.; Larson, A.C.; Von Dreele, R.B.

    1999-12-01

    Neutron diffractometry and X-ray diffractometry were used to characterize the cation disorder and vacancy distribution in nonstoichiometric spinel, MgO{center{underscore}dot}xAl{sub 2}O{sub 3}, where x {ge} 1.0. Both synthetic and natural samples were examined. Least-squares refinements of integrated intensities for single crystals and Rietveld profile refinements for powders yielded the average scattering power from tetrahedral and octahedral sites within the almost-perfect cubic close-packed oxygen sublattice. The cation disorder was calculated assuming models in which the vacancies resided on tetrahedral, octahedral, or both types of sites. No degree of cation disorder was consistent with the tetrahedral vacancy model, and vacancies most likely resided on octahedral sites.

  10. Silica-supported (nBuCp)2ZrCl2: Effect of catalyst active center distribution on ethylene-1-hexene copolymerization

    KAUST Repository

    Atiqullah, Muhammad

    2013-08-12

    Metallocenes are a modern innovation in polyolefin catalysis research. Therefore, two supported metallocene catalysts-silica/MAO/(nBuCp)2ZrCl2 (Catalyst 1) and silica/nBuSnCl3/MAO/(nBuCp)2ZrCl2 (Catalyst 2), where MAO is methylaluminoxane-were synthesized, and subsequently used to prepare, without separate feeding of MAO, ethylene-1-hexene Copolymer 1 and Copolymer 2, respectively. Fouling-free copolymerization, catalyst kinetic stability and production of free-flowing polymer particles (replicating the catalyst particle size distribution) confirmed the occurrence of heterogeneous catalysis. The catalyst active center distribution was modeled by deconvoluting the measured molecular weight distribution and copolymer composition distribution. Five different active center types were predicted for each catalyst, which was corroborated by successive self-nucleation and annealing experiments, as well as by an extended X-ray absorption fine structure spectroscopy report published in the literature. Hence, metallocenes impregnated particularly on an MAO-pretreated support may be rightly envisioned to comprise an ensemble of isolated single sites that have varying coordination environments. This study shows how the active center distribution and the design of supported MAO anions affect copolymerization activity, polymerization mechanism and the resulting polymer microstructures. Catalyst 2 showed less copolymerization activity than Catalyst 1. Strong chain transfer and positive co-monomer effect-both by 1-hexene-were common. Each copolymer demonstrated vinyl, vinylidene and trans-vinylene end groups, and compositional heterogeneity. All these findings were explained, as appropriate, considering the modeled active center distribution, MAO cage structure repeat units, proposed catalyst surface chemistry, segregation effects and the literature that concerns and supports this study. While doing so, new insights were obtained. Additionally, future research, along the direction

  11. Electrical and dielectric properties of doped TeO2 center dot PbCl2 center dot PbF2 glasses, prepared in Au or Pt crucibles

    Czech Academy of Sciences Publication Activity Database

    Kubliha, M.; Trnovcová, V.; Labas, V.; Psota, J.; Pedlíková, Jitka; Podolinčiaková, J.

    2011-01-01

    Roč. 13, 11-12 (2011), s. 1493-1497. ISSN 1454-4164 Institutional research plan: CEZ:AV0Z40320502 Keywords : tellurite/lead chloride/lead fluoride glasses * electrical conductivity * TSDC * permittivity Subject RIV: CA - Inorganic Chemistry Impact factor: 0.457, year: 2011

  12. Binding energy and nonlinear optical properties of an on-center hydrogenic impurity in a spherical quantum dot placed at the center of a cylindrical nano-wire: Comparison of hydrogenic donor and acceptor impurities

    Energy Technology Data Exchange (ETDEWEB)

    Safarpour, Gh., E-mail: safarpour.ghasem@gmail.com [Zarghan Branch, Islamic Azad University, Zarghan (Iran, Islamic Republic of); Novzari, M.; Izadi, M.A.; Niknam, E. [Zarghan Branch, Islamic Azad University, Zarghan (Iran, Islamic Republic of); Barati, M. [Science and Research Branch, Islamic Azad University, Fars (Iran, Islamic Republic of)

    2014-03-01

    The binding energies and corresponding wave functions of ground and first excited states (1s, 2p) of on-center hydrogenic donor and acceptor impurities are calculated using finite difference approximation in the effective mass framework. The on-center impurities are assumed to be in an InAs spherical quantum dot which is located at the center of a GaAs cylindrical nano-wire. To test the validity of applied method the eigenvalues of ground and first excited states are compared with reported results which have been calculated by finite element methods and it is shown that the finite difference approximation is more accurate in this particular case. In addition, the oscillator strength, linear, third-order nonlinear and total optical absorption coefficients and refractive index changes have been calculated for 1s–2p transition by means of the compact density matrix approach. The results show that presence of impurity causes a blue shift in optical spectrum which is larger for acceptor impurity. Also, the amplitude of absorption coefficient, refractive index changes and oscillator strength depend on the absence, presence and type of impurity. Moreover, it is found that the saturation condition can be tuned by type of impurity and critical incident optical intensity is enhanced in presence of acceptor impurity.

  13. Binding energy and nonlinear optical properties of an on-center hydrogenic impurity in a spherical quantum dot placed at the center of a cylindrical nano-wire: Comparison of hydrogenic donor and acceptor impurities

    International Nuclear Information System (INIS)

    The binding energies and corresponding wave functions of ground and first excited states (1s, 2p) of on-center hydrogenic donor and acceptor impurities are calculated using finite difference approximation in the effective mass framework. The on-center impurities are assumed to be in an InAs spherical quantum dot which is located at the center of a GaAs cylindrical nano-wire. To test the validity of applied method the eigenvalues of ground and first excited states are compared with reported results which have been calculated by finite element methods and it is shown that the finite difference approximation is more accurate in this particular case. In addition, the oscillator strength, linear, third-order nonlinear and total optical absorption coefficients and refractive index changes have been calculated for 1s–2p transition by means of the compact density matrix approach. The results show that presence of impurity causes a blue shift in optical spectrum which is larger for acceptor impurity. Also, the amplitude of absorption coefficient, refractive index changes and oscillator strength depend on the absence, presence and type of impurity. Moreover, it is found that the saturation condition can be tuned by type of impurity and critical incident optical intensity is enhanced in presence of acceptor impurity

  14. Studies on the local angular distortion and spin Hamiltonian parameters for the trigonal Co2+ center in MgCl2

    International Nuclear Information System (INIS)

    The local angular distortion and spin Hamiltonian parameters (g factor g verticalstrokeverticalstroke, g perpendicularto and the hyperfine structure constants) for the trigonal Co2+ center in MgCl2 are theoretically studied by diagonalizing the 6 x 6 energy matrix of ground 4T1 state for a trigonally distorted octahedral 3d7 cluster. Based on the cluster approach, the contributions from the admixtures of various J (= 1/2, 3/2, 5/2) states and the ligand orbital and spin-orbit coupling interactions are taken into account in a uniform way. The local impurity-ligand bond angle in the Co2+ center is found to be about 3.44 larger than the host metal-ligand bond angle in the pure crystal due to substitution of smaller Mg2+ by bigger Co2+, inducing a further compressed ligand octahedron. The calculated spin Hamiltonian parameters using the above local angular distortion are in good agreement with the experimental data. The present studies on the local structure and the spin Hamiltonian parameters for Co2+ in MgCl2 are tentatively extended to a more general case by comparing the relevant impurity behaviours for Co2+ in various trigonal environments.

  15. Studies on the Local Angular Distortion and Spin Hamiltonian Parameters for the Trigonal Co2+ Center in MgCl2

    Science.gov (United States)

    Hu, Xian-Fen; Wu, Shao-Yi; Kuang, Min-Quan; Li, Guo-Liang

    2014-11-01

    The local angular distortion and spin Hamiltonian parameters (g factors g||, g⊥ and the hyperfine structure constants) for the trigonal Co2+ center in MgCl2 are theoretically studied by diagonalizing the 6×6 energy matrix of ground 4T1 state for a trigonally distorted octahedral 3d7 cluster. Based on the cluster approach, the contributions from the admixtures of various J (= 1/2;3/2;5/2) states and the ligand orbital and spin-orbit coupling interactions are taken into account in a uniform way. The local impurity-ligand bond angle in the Co2+ center is found to be about 3.44° larger than the host metal-ligand bond angle in the pure crystal due to substitution of smaller Mg2+ by bigger Co2+, inducing a further compressed ligand octahedron. The calculated spin Hamiltonian parameters using the above local angular distortion are in good agreement with the experimental data. The present studies on the local structure and the spin Hamiltonian parameters for Co2+ in MgCl2 are tentatively extended to a more general case by comparing the relevant impurity behaviours for Co2+ in various trigonal environments.

  16. 75 FR 59071 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-604 Variants (Including CL-605...

    Science.gov (United States)

    2010-09-27

    ... in the Federal Register on June 2, 2010 (75 FR 30740). That NPRM proposed to correct an unsafe...'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have.... Model CL-600-2B16 (CL- 604 Variants (Including CL-605 Marketing Variant)) Airplanes AGENCY:...

  17. Effects of Supported ( n BuCp) 2 ZrCl 2 Catalyst Active-Center Distribution on Ethylene–1-Hexene Copolymer Backbone Heterogeneity and Thermal Behaviors

    KAUST Repository

    Atiqullah, Muhammad

    2013-07-10

    Two catalysts, denoted as catalyst 1 [silica/MAO/(nBuCp) 2ZrCl2] and catalyst 2 [silica/nBuSnCl 3/MAO/(nBuCp)2ZrCl2] were synthesized and subsequently used to prepare, without separate feeding of methylaluminoxane (MAO), ethylene homopolymer 1 and homopolymer 2, respectively, and ethylene-1-hexene copolymer 1 and copolymer 2, respectively. Gel permeation chromatography (GPC), Crystaf, differential scanning calorimetry (DSC) [conventional and successive self-nucleation and annealing (SSA)], and 13C nuclear magnetic resonance (NMR) polymer characterization results were used, as appropriate, to model the catalyst active-center distribution, ethylene sequence (equilibrium crystal) distribution, and lamellar thickness distribution (both continuous and discrete). Five different types of active centers were predicted in each catalyst, as corroborated by the SSA experiments and complemented by an extended X-ray absorption fine structure (EXAFS) report published in the literature. 13C NMR spectroscopy also supported this active-center multiplicity. Models combined with experiments effectively illustrated how and why the active-center distribution and the variance in the design of the supported MAO anion, having different electronic and steric effects and coordination environments, influence the concerned copolymerization mechanism and polymer properties, including inter- and intrachain compositional heterogeneity and thermal behaviors. Copolymerization occurred according to the first-order Markovian terminal model, producing fairly random copolymers with minor skewedness toward blocky character. For each copolymer, the theoretical most probable ethylene sequences, nE MPDSC-GT and n E MPNMR-Flory, as well as the weight-average lamellar thicknesses, Lwav DSC-GT and Lwav SSA DSC, were found to be comparable. To the best of our knowledge, such a match has not previously been reported. The percentage crystallinities of the homo- and copolymers increased linearly as a function of

  18. Effects of supported (nBuCp)2ZrCl2 catalyst active center multiplicity on crystallization kinetics of ethylene homo- and copolymers

    KAUST Repository

    Atiqullah, Muhammad

    2014-07-01

    Two different supported zirconocene, that is, bis(n-butylcyclopentadienyl) zirconium dichloride (nBuCp)2ZrCl2, catalysts were synthesized. Each catalyst was used to prepare one ethylene homopolymer and one ethylene-1-hexene copolymer. Catalyst active center multiplicity and polymer crystallization kinetics were modeled. Five separate active center types were predicted, which matched the successive self-nucleation and annealing (SSA) peak temperatures. The predicted crystallinity well matched the differential scanning calorimetric (DSC) values for a single Avrami-Erofeev index, which ranged between 2 and 3 for the polymers experimented. The estimated apparent crystallization activation energy Ea did not vary with cooling rates, relative crystallinity α, and crystallization time or temperature. Therefore, the concept of variable/instantaneous activation energy was not found to hold. Ea linearly increased with the weight average lamellar thickness Lwav DSC-GT; and for each homopolymer, it exceeded that of the corresponding copolymer. Higher Ea, hence slower crystallization, was identified as a pre-requisite to attain higher crystallinity. Crystallization parameters were correlated to polymer backbone parameters, which are influenced by catalyst active center multiplicity. © 2013 Taiwan Institute of Chemical Engineers.

  19. The relationship between the hardness and the point-defect-density in neutron-irradiated MgO{center_dot}3.0Al{sub 2}O{sub 3} and AlN

    Energy Technology Data Exchange (ETDEWEB)

    Suematsu, H.; Yatsui, K. [Nagaoka Univ. of Technology, Extreme Energy-Density Research Institute, Nagaoka, Niigata (Japan); Yano, T. [Tokyo Institute of Technology, Research Laboratory for Nuclear Reactors, Tokyo (Japan)

    2001-09-01

    MgO{center_dot}3.0Al{sub 2}O{sub 3} single crystals and sintered AlN polycrystals were irradiated with fast neutrons in various conditions and the hardness of the irradiated and unirradiated samples was measured with a Vickers hardness tester. The hardness of as-irradiated MgO{center_dot}3.0Al{sub 2}O{sub 3} and AlN samples increased by 23 and 51%, respectively. After isochronal annealing, the hardness gradually decreased and mostly recovered to that of the unirradiated one up to 1400degC. Volume of the sample also increased after the irradiation and changed in the same way as the hardness by annealing. A relationship between the hardness and the density of point defects is proposed and the experimental results agree with the relationship. It implies that the point defects generated by the irradiation pin down dislocations and increase the hardness of neutron irradiated MgO{center_dot}3.0Al{sub 2}O{sub 3} samples. (author)

  20. Organically-Templated Zinc Hydrogen Phosphites: Syntheses, Structures and Properties of {alpha}- and {Beta}-ZnHOP{sub 3}{center_dot}N{sub 4}C{sub 2}H{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    HARRISON,WILLIAM T.A.; PHILLIPS,MARK L.F.; STANCHFIELD,JESSE; NENOFF,TINA M.

    2000-07-14

    The syntheses, crystal structures and some properties of {alpha}- and {beta}-ZnHPO{sub 3}{center_dot}N{sub 4}C{sub 2}H{sub 4} are reported. These two polymorphs are the first organically-templated hydrogen phosphites. They are built up from vertex-sharing HPO{sub 3} pseudo pyramids and ZnO{sub 3}N tetrahedra, where the Zn-N bond represents a direct link between zinc and the neutral 2-cyanoguanidine template. {alpha}-ZnHPO{sub 3}{center_dot}N{sub 4}C{sub 2}H{sub 4} is built up from infinite layers of vertex-sharing ZnO{sub 3}N and HPO{sub 3} groups forming 4-rings and 8-rings. {beta}-ZnHPO{sub 3}{center_dot}N{sub 4}C{sub 2}H{sub 4} has strong one-dimensional character, with the polyhedral building units forming 4-ring ladders. Similarities and differences to related zinc phosphates are discussed. Crystal data: {alpha}-ZnHPO{sub 3}{center_dot}N{sub 4}C{sub 2}H{sub 4}, M{sub r} = 229.44, monoclinic, P2{sub 1}/c, a = 9.7718 (5) {angstrom}, b = 8.2503 (4) {angstrom}, c = 9.2491 (5) {angstrom}, {beta} = 104.146 (1){sup 0}, V = 723.1 (1) {angstrom}{sup 3}, R(F) = 2.33%, wR(F) = 2.52%. {beta}-ZnHPO{sub 3}{center_dot}N{sub 4}C{sub 2}H{sub 4}, M{sub r} = 229.44, monoclinic, C2/c, a = 14.5092 (9) {angstrom}, b = 10.5464 (6) {angstrom}, c = 10.3342 (6) {angstrom}, {beta} = 114.290 (1){sup 0}, V = 1441.4 (3) {angstrom}{sup 3}, R(F) = 3.01%, wR(F) = 3.40%.

  1. Valence Shell Charge Concentrations at Pentacoordinate d0 Transition Metal Centers: Non-VSEPR Structures of Me2NbCl3 and Me3NbCl2

    CERN Document Server

    McGrady, G S; Verne, H P; Volden, H V; Downs, A J; Shorokhov, D; Scherer, W; Eickerling, G; Haaland, Arne; Verne, Hans Peter; Volden, Hans Vidar; Downs, Anthony J.; Shorokhov, Dmitry; Scherer, Wolfgang; Eickerling, Georg

    2005-01-01

    The molecular structures of the monomeric, pentacoordinated ethylchloroniobium(V) compounds Me3NbCl2 and Me2NbCl3 have been determined by gas electron diffraction (GED)and Density Functional Theory (DFT) calculations, and, for Me3NbCl2, by single crystal X-ray diffraction. Each of the molecules is found to have a heavy-atom skeleton in the form of a trigonal bipyramid (TBP) with Cl atoms in the axial positions, in accord with their vibrational spectra. The TBP is somewhat distorted in the case of Me2NbCl3 with the two axial Nb-Cl bonds bent away from the equatorial, slightly shorter Nb-Cl bond. In the case of Me3NbCl2, moreover, the X-ray model suggests structural distortions away from the idealized C3h geometry, in line with the results of quantum chemical calculations. The electronic structures of Me2NbCl3 and Me3NbCl2 have been explored by rigorous analysis of both the wavefunction and the topology of the electron density, employing DFT calculations. Hence the structures of these compounds are shown to ref...

  2. Structure and stability of a DNA triple helix in solution: NMR studies on d(T) sub 6 ter dot d(T) sub 6 and its complex with a minor groove binding drug

    Energy Technology Data Exchange (ETDEWEB)

    Umemoto, Kimiko; Sarma, Mukti H.; Gupta, Goutam; Luo, Jia; Sarma, Ramaswamy H. (State Univ. of New York, Albany (USA))

    1990-05-23

    The possibility of both Watson-Crick and Hoogsteen A{center dot}T pairs can result in a triple helical structure for d(T){sub 6}{center dot}d(A){sub 6}{center dot}d(T){sub 6} in solution. In the triple helix the Watson-Crick paired T strand can run antiparallel, while the Hoogsteen paired T strand can run parallel to the A strand. On the basis of 1D/2D NMR studies, we have characterized the structural properties of the triple helix in terms of (a) nature of H-bonding, (b) chain conformations and relative chain orientations, (c) location of triplets T{center dot}A{center dot}T with respect to the helix axis, and (d) effects of NaCl and MgCl{sub 2}. In addition, we experimentally demonstrate that a minor groove specific drug Dst2 (a distamycin analogue) can bind to the triple helix. We show that the nature of thermal transition is altered by Dst2 binding; i.e., the host triple helix shows triple {yields} coil (monophasic) transition in the absence of Dst2, while in its presence the helix shows a triplex {yields} duplex {yields} coil (biphasic) transition.

  3. Spectral shifts and structures of phenol center dot center dot center dot Ar-n clusters

    Czech Academy of Sciences Publication Activity Database

    Armentano, A.; Černý, Jiří; Riese, M.; Taherkhani, M.; Ben Yezzar, M.; Muller-Dethlefs, K.

    2011-01-01

    Roč. 13, č. 13 (2011), s. 6077-6084. ISSN 1463-9076 Institutional research plan: CEZ:AV0Z50520701 Keywords : VAN-DER-WAALS * BENZENE-ARGON CLUSTERS * INFRARED-SPECTRA Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.573, year: 2011

  4. Training effects on peak (VO2)-O-center dot, specific of the mode of movement, in rehabilitation of patients with coronary artery disease

    NARCIS (Netherlands)

    Nieuwland, W; Berkhuysen, MA; Landsman, MLJ; Lie, KI; Rispens, P

    1998-01-01

    Training effects on peak oxygen consumption ((V) over dot O-2), specific to the mode of movement, are well-known in exercise training of young, healthy adults. However, these specific training effects were never studied in patients with coronary artery disease, but may be important in the evaluation

  5. Synthesis and characterization of hepta coordinated tin(IV) complexes. X-ray crystal structure of [{sup n}Bu{sub 2} Sn(dappt)]{center_dot}(Me{sub 2} CO){sub 0.5} [H{sub 2}dappt 2,6-diacetyl pyridine bis(4-phenyl thiosemicarbazone)

    Energy Technology Data Exchange (ETDEWEB)

    Sousa, Gerimario F. de; Deflon, Victor M. [Universidade de Brasilia (UnB), DF (Brazil). Inst. de Quimica; Niquet, Elke [Tuebingen Univ. (Germany). Inst. fuer Anorganische Chemie; Abras, Anuar [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte (Brazil). Dept. de Fisica

    2001-08-01

    The reactions of the 2,6-diacetyl pyridine bis(4-phenyl thiosemicarbazone) ligand, H{sub 2}dappt, with R{sub 4-m} SnX{sub m} (m = 2, 3; R = Me, {sup n}Bu, Ph and X = Cl) led to the formation of four new hepta coordinated organotin(IV) complexes, which were characterized by microanalyses and by IR and Moessbauer spectroscopies. The n-butyl derivative [{sup n}Bu{sub 2} Sn(dappt)]{center_dot}(Me{sub 2} CO){sub 0.5} was also analyzed by a single crystal X-ray diffraction study. It crystallized in the monoclinic system with a space group C 2/c, with a = 36.164(14), b 9.7050(15), c = 26.194(11) Angstrom, {beta} = 132.00(2) deg C, Z=8. The structure determination revealed a neutral complex of Sn(IV) in a distorted pentagonal bipyramidal (PBP) geometry, with the equatorial plane defined by the SNNNS donor system of the ligand and with the two n-butyl groups in the axial positions. Also, a correlation between Moessbauer and X-ray data based on the point-charge model is discussed. (author)

  6. Thermodynamic properties of LiNO{sub 3}-NaNO{sub 3}-KNO{sub 3}-2KNO{sub 3}{center_dot}Mg(NO{sub 3}){sub 2} system

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Tao; Mantha, Divakar [Department of Metallurgical and Materials Engineering, The University of Alabama, Tuscaloosa, AL 35487-0202 (United States); Reddy, Ramana G., E-mail: rreddy@eng.ua.edu [Department of Metallurgical and Materials Engineering, The University of Alabama, Tuscaloosa, AL 35487-0202 (United States)

    2013-01-10

    Highlights: Black-Right-Pointing-Pointer Novel LiNO{sub 3}-NaNO{sub 3}-KNO{sub 3}-2KNO{sub 3}{center_dot}Mg(NO{sub 3}){sub 2} quaternary system was developed. Black-Right-Pointing-Pointer The melting point of the salt mixture was determined. Black-Right-Pointing-Pointer The heat capacity of the salt mixture was determined. Black-Right-Pointing-Pointer The enthalpy, entropy and Gibbs energies as function of temperature were deduced. - Abstract: A novel low melting eutectic salt was predicted in the LiNO{sub 3}-NaNO{sub 3}-KNO{sub 3}-2KNO{sub 3}{center_dot}Mg(NO{sub 3}){sub 2} quaternary system using thermodynamic modeling. The melting point of the eutectic salt was predicted to be 374.90 K. Differential scanning calorimetry (DSC) was used to experimentally determine the melting point and specific heat capacity of the quaternary system. The mixture was measured to be completely melted at 373.90 {+-} 0.78 K which is in an excellent agreement with the predicted value. The measured heat capacity data as function of temperature are fit to polynomial function. Subsequently, the thermodynamic properties such as enthalpy, entropy and Gibbs energies of this novel quaternary eutectic salt were deduced as function of temperature.

  7. Simultaneous effects of external electric field and aluminum concentration on the binding energy of a laser-dressed donor impurity in a spherical quantum dot confined at the center of a cylindrical nano-wire

    International Nuclear Information System (INIS)

    Based on the effective-mass approximation, the effects of external electric field and laser radiation on the binding energy and Stark shifts of electronic energy levels of a system consist of an on-center hydrogenic donor impurity in a spherical quantum dot which is located at the center of a cylindrical nano-wire have been studied. The energy eigenvalues and corresponding wave functions are calculated using the finite difference approximation. The binding energy and Stark shifts dependencies are reported upon the electric field strength, aluminum concentration and laser radiation. The results reveal that Stark shifts of ground and first excited states are strongly affected by presence of impurity, laser radiation and Al concentration. Additionally, the binding energies decreases as the electric field increases and become negligible for large values of electric field; decreases as the laser radiation increases and increases as the Al concentration increases

  8. Perfil de sujeitos de pesquisa clínica em um centro ambulatorial independente Profile of clinical research subjects in an independent outpatient center

    Directory of Open Access Journals (Sweden)

    Paulo Gustavo Sampaio Lacativa

    2008-06-01

    Full Text Available Este artigo tem como objetivos avaliar a qualidade de atendimento de um centro de pesquisa clínica e o entendimento do termo de consentimento informado (TCLE; determinar os motivos da participação e detalhar níveis socioeconômicos. Foi feito um estudo transversal em centro de pesquisa ambulatorial, através de questionário auto-explicativo. Dos cem questionários avaliados, todos os sujeitos de pesquisa consideraram o centro como ótimo (86% ou bom (9%. A quase totalidade foi bem informada do conteúdo do TCLE e o conhecimento do direito "confidencialidade", comum a todos os TCLEs, foi seis vezes maior que " acesso aos dados", que não faz parte. Os principais motivos para participarem foram para "saber mais sobre a sua saúde" (59% e para "beneficiar outras pessoas no futuro" (47%. A principal faixa de renda salarial dos participantes foi entre dois e cinco salários mínimos (48% e a maioria (66% concluiu pelo menos até a 4º série do ensino fundamental. A população possui o mesmo perfil econômico do Rio de Janeiro, nível de escolaridade suficiente para assinar e compreender o que está assinando, conhecendo não só a existência do TCLE, mas demonstrando conhecer seu conteúdo. O motivo principal para participação é para autobenefício e por atitude altruísta.This paper assesses the quality of assistance in a clinical trial outpatient center as well as the patients´understanding of the informed consent (IC; determine the reasons why they participate and detail socio-economic levels. A cross-sectional study was adopted in a clinical trial outpatient center using a self-explanatory questionnaire. All 100 respondents considered the assistance at the center excellent (86% or good (9%. Almost all of them were well informed about the content of the IC. Their knowledge about the right to "confidentiality", present in all ICs, was 6 times higher than their knowledge about their right to "access the results", generally not included

  9. Chemiluminescence behavior of the carbon dots and the reduced state carbon dots

    Energy Technology Data Exchange (ETDEWEB)

    Teng, Ping [Key Laboratory on Luminescence and Real-Time Analysis, Ministry of Education, College of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Xie, Jianxin [College of Resources and Environment, Yuxi Normal University, Yuxi, Yunnan 653100 (China); Long, Yijuan; Huang, Xiaoxiao; Zhu, Rui; Wang, Xiliang; Liang, Liping [Key Laboratory on Luminescence and Real-Time Analysis, Ministry of Education, College of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Huang, Yuming, E-mail: ymhuang@swu.edu.cn [Key Laboratory on Luminescence and Real-Time Analysis, Ministry of Education, College of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Zheng, Huzhi, E-mail: zhenghz@swu.edu.cn [Key Laboratory on Luminescence and Real-Time Analysis, Ministry of Education, College of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China)

    2014-02-15

    Potassium permanganate (KMnO{sub 4}) can react with two different carbon nanoparticles, i.e., carbon dots (CDs) and reduced state carbon dots (r-CDs), in a strong acid medium to generate chemiluminescence (CL). Furthermore, the different CL intensities and CL behaviors due to the different surface groups on these two kinds of carbon nanoparticles were confirmed. CL spectra, fluorescence spectra, UV–vis absorption spectra, and electron paramagnanetic resonance spectra were applied to investigate the CL mechanism. The main reaction pathways were proposed as follows: for the CL reaction between CDs and KMnO{sub 4}, the excited states of CDs (CDs{sup ⁎}) and Mn(II) (Mn(II){sup ⁎}) emerged as KMnO{sub 4} could inject holes into CDs, then, the CDs{sup ⁎} and Mn(II){sup ⁎} acted as luminophors to yield CL; in the r-CDs-KMnO{sub 4} system, r-CDs were oxidized by KMnO{sub 4} directly, and CDs{sup ⁎} and Mn(II){sup ⁎} were produced, at the same time, CL occurred. What is more interesting is that the CL intensity of the r-CD system is stronger than that of the CD system, which confirms that functional groups have strong effect on the CL behavior. It inspired us that new carbon nanoparticles with excellent luminous performance can be designed by tuning their surface groups. -- Highlights: • Carbon dots (CDs) and reduced state carbon dots (r-CDs) can react with potassium permanganate (KMnO{sub 4}) in a strong acid to generate chemiluminescence (CL). • With different surface groups, the CL intensity of r-CDs-KMnO{sub 4} system is different from that of CDs-KMnO{sub 4} system. • The CL mechanisms of the two systems were investigated.

  10. Activation of silicon quantum dots for emission

    Institute of Scientific and Technical Information of China (English)

    Huang Wei-Qi; Miao Xin-Jian; Huang Zhong-Mei; Liu Shi-Rong; Qin Chao-Jian

    2012-01-01

    The emission of silicon quantum dots is weak when their surface is passivated well. Oxygen or nitrogen on the surface of silicon quantum dots can break the passivation to form localized electronic states in the band gap to generate active centers where stronger emission occurs.From this point of view,we can build up radiative matter for emission.Emissions of various wavelengths can be obtained by controlling the surface bonds of silicon quantum dots.Our experimental results demonstrate that annealing is important in the treatment of the activation,and stimulated emissions at about 600 and 700 nm take place on active silicon quantum dots.

  11. Analytical investigation of AlCl[3]/SO[2]Cl[2] catholyte materials for secondary fuze reserve batteries.

    Energy Technology Data Exchange (ETDEWEB)

    Butler, Paul Charles; Rodriguez, Mark Andrew; Segall, Judith M.; Malizia, Louis A., Jr.; Cherry, Brian Ray; Andrews, Nicholas L.; Clark, Nancy H.; Alam, Todd Michael; Ingersoll, David T.; Tallant, David Robert; Simpson, Regina Lynn; Boyle, Timothy J.; Garcia, Manuel Joseph

    2004-05-01

    Exploration of the fundamental chemical behavior of the AlCl{sub 3}/SO{sub 2}Cl{sub 2} catholyte system for the ARDEC Self-Destruct Fuze Reserve Battery Project under accelerated aging conditions was completed using a variety of analytical tools. Four different molecular species were identified in this solution, three of which are major. The relative concentrations of the molecular species formed were found to depend on aging time, initial concentrations, and storage temperature, with each variable affecting the kinetics and thermodynamics of this complex reaction system. We also evaluated the effect of water on the system, and determined that it does not play a role in dictating the observed molecular species present in solution. The first Al-containing species formed was identified as the dimer [Al({mu}-Cl)Cl{sub 2}]{sub 2}, and was found to be in equilibrium with the monomer, AlCl{sub 3}. The second species formed in the reaction scheme was identified by single crystal X-ray diffraction studies as [Cl{sub 2}Al({mu}-O{sub 2}SCl)]{sub 2} (I), a scrambled AlCl{sub 3}{center_dot}SO{sub 2} adduct. The SO{sub 2}(g) present, as well as CL{sub 2}(g), was formed through decomposition of SO{sub 2}CL{sub 2}. The SO{sub 2}(g) generated was readily consumed by AlCl{sub 3} to form the adduct 1 which was experimentally verified when 1 was also isolated from the reaction of SO{sub 2}(g) and AlCl {sub 3}. The third species found was tentatively identified as a compound having the general formula {l_brace}[Al(O)Cl{sub 2}][OSCl{sub 2}]{r_brace}{sub n}. This was based on {sup 27}Al NMR data that revealed a species with tetrahedrally coordinated Al metal centers with increased oxygen coordination and the fact that the precipitate, or gel, that forms over time was shown by Raman spectroscopic studies to possess a component that is consistent with SOCl{sub 2}. The precursor to the precipitate should have similar constituents, thus the assignment of {l_brace}[Al(O)Cl{sub 2}][OSCl{sub 2

  12. Quantum dot spectroscopy

    DEFF Research Database (Denmark)

    Leosson, Kristjan

    Semiconductor quantum dots ("solid-state atoms") are promising candidates for quantum computers and future electronic and optoelectronic devices. Quantum dots are zero-dimensional electronic systems and therefore have discrete energy levels, similar to atoms or molecules. The size distribution...... of quantum dots, however, results in a large inhomogeneous broadening of quantum dot spectra. Work on self-assembled InGaAs/GaAs quantum dots will be presented. Properties of atom-like single-dot states are investigated optically using high spatial and spectral resolution. Single-dot spectra can be used...

  13. Quantum dot spectroscopy

    DEFF Research Database (Denmark)

    Leosson, Kristjan

    1999-01-01

    Semiconductor quantum dots ("solid state atoms") are promising candidates for quantum computers and future electronic and optoelectronic devices. Quantum dots are zero-dimensional electronic systems and therefore have discrete energy levels, similar to atoms or molecules. The size distribution...... of quantum dots, however, results in a large inhomogeneous broadening of quantum dot spectra.Work on self-assembled InGaAs/GaAs quantum dots will be presented. Properties of atom-like single-dots states are investigated optically using high spatial and spectral resolution. Single-dot spectra can be used...

  14. Optically active centers in Eu implanted, Eu in situ doped GaN, and Eu doped GaN quantum dots

    International Nuclear Information System (INIS)

    A comparison is presented between Eu implanted and Eu in situ doped GaN thin films showing that two predominant Eu sites are optically active around 620 nm in both types of samples with below and above bandgap excitation. One of these sites, identified as a Ga substitutional site, is common to both types of Eu doped GaN samples despite the difference in the GaN film growth method and in the doping technique. High-resolution photoluminescence (PL) spectra under resonant excitation reveal that in all samples these two host-sensitized sites are in small amount compared to the majority of Eu ions which occupy isolated Ga substitutional sites and thus cannot be excited through the GaN host. The relative concentrations of the two predominant host-sensitized Eu sites are strongly affected by the annealing temperature for Eu implanted samples and by the group III element time opening in the molecular beam epitaxy growth. Red luminescence decay characteristics for the two Eu sites reveal different excitation paths. PL dynamics under above bandgap excitation indicate that Eu ions occupying a Ga substitutional site are either excited directly into the 5D0 level or into higher excited levels such as 5D1, while Eu ions sitting in the other site are only directly excited into the 5D0 level. These differences are discussed in terms of the spectral overlap between the emission band of a nearby bound exciton and the absorption bands of Eu ions. The study of Eu doped GaN quantum dots reveals the existence of only one type of Eu site under above bandgap excitation, with Eu PL dynamics features similar to Eu ions in Ga substitutional sites

  15. On the lodging households and the side jobs. At old map in Hirato on 1792; Dokyo setai to kengyo jokyo. Hirato rokuchozu {center_dot} Kansei 4 nen (1792)

    Energy Technology Data Exchange (ETDEWEB)

    Kojina, Kyoji; Iida, Toshihiko; Oya, Maki

    1999-09-01

    . At the lodging households Fishmongers and Daylaborers were both two. Then the 2nd Job were 26, the 3rd Job were 5, the 4th Job were 2 and sum up 33 side jobs whose were rate 35.9 percents. On the side jobs Notions were 7, Tofu Makers and Miso {center_dot} Su {center_dot} Shoyu Shops were both 4, Malted Rice Shops were 3 and so. At 'Shin-machi' were 133 lots and 122 households, lodging households were 9. At the lodging households were 3 Day laborers, Shipwrights and Unemployeds both two and so. Then the 2nd Job were 13, the 3rd Job were 5 and sum up 18 side Jobs whose rate 14.7 percents. On the side jobs Notions and Salt {center_dot} Tea Shops were both two and so. At 'Shokunin-machi' were 262 lots and 226 households, lodging households were 27. At the lodging households were 9 Carpenters, 5 Dyers and 4 Unemployeds, Blacksmiths and Daylaborers were both two. Then the 2nd Job were 5 and sum up 5 side Jobs whose rate 2.2 percents. On the side these jobs five kinds were each different. (author)

  16. Redetermination of adeninium dichloride: the question of centrosymmetry

    OpenAIRE

    Lewis, T. C.; Tocher, D. A.

    2005-01-01

    The low-temperature redetermination of adeninium(2+) dichloride, C(5)H(7)N(5)(2+)center dot 2Cl(-), obtained as part of an experimental polymorph screen on adenine, is reported here. The crystal structure is shown to be centrosymmetric. Cations and anions are connected through N - H center dot center dot center dot N and N - H center dot center dot center dot Cl hydrogen bonds [ N center dot center dot center dot N = 2.899 ( 2) angstrom and N center dot center dot center dot Cl = 3.0274 ( 14)...

  17. First observation of intra-5f fluorescence from an actinyl center: Np(VI) near-IR emission in Cs2U(Np)O2Cl4

    International Nuclear Information System (INIS)

    Fluorescence from an excited 5f state of Np(VI) has been observed in the doped impurity system Cs2U(Np)O2Cl4. This is the first intra-5f fluorescence transition that has been detected at room temperature in a condensed-phase system with an actinyl (An(VI)O22+) core, and it is a rare example of fluorescence of any kind from non-uranyl ions of this type. The emission originates from an excited state approximately 6890cm-1 above the ground state. Its emission spectrum and fluorescence lifetime at 295K will be discussed. Vibronic structure in the emission spectrum is assigned based on comparison with the detailed analysis of the absorption spectra published by Denning et al

  18. 75 FR 70109 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440), CL...

    Science.gov (United States)

    2010-11-17

    ... published in the Federal Register on March 15, 2010 (75 FR 12152). That NPRM proposed to correct an unsafe... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3..., Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440), CL-600-2C10 (Regional Jet Series 700,...

  19. 75 FR 38011 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-604 Variant) Airplanes

    Science.gov (United States)

    2010-07-01

    ... products. That NPRM was published in the Federal Register on January 4, 2010 (75 FR 91). That NPRM proposed... Order 12866; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR.... Model CL-600-2B16 (CL- 604 Variant) Airplanes AGENCY: Federal Aviation Administration (FAA),...

  20. Lanthanide tetrad effect in kimuraite [CaY[sub 2](CO[sub 3])[sub 4][center dot]6H[sub 2]O]: Implication for a new geochemical index

    Energy Technology Data Exchange (ETDEWEB)

    Akagi, Tasuku (Tokyo Univ. of Agriculture and Technology (Japan)); Masuda, Akimasa; Shabani, M.B. (Univ. of Tokyo (Japan))

    1993-06-01

    Close analysis of REEs in a REE carbonate mineral, kimuraite [CaY[sub 2](CO[sub 3])[sub 4][center dot]6H[sub 2]O], has been conducted using isotope dilution-mass spectrometry (ID-MS) and inductively coupled plasma-mass spectrometry (ICP-MS). A standard solution whose REE composition matches kimuraite was used for the ICP-MS measurement. The resultant chondrite-normalized REE pattern revealed four distinct concave-upward segments, each segment covering four elements. The features of the patterns are characteristic of the lanthanide tetrad effect, which is theoretically understood in terms of the interelectron repulsion of electrons of 4f orbitals and has been observed prominently in the chemistry of lanthanide chelates. It is undeniable that the REE pattern of kimuraite very clearly reflects the tetrad effect. This conclusion will influence, in due course, the interpretation of the complicated REE patterns of a wide variety of other natural samples, such as seawater and marine products. The tetrad effect could be a unique geochemical index of chelating phenomena in nature.

  1. Simultaneous Effects of External Electric Field and Conduction Band Nonparabolicity on Optical Properties of a GaAs Quantum Dot Embedded at the Center of a GaAlAs Nano-Wire

    International Nuclear Information System (INIS)

    An investigation of the optical properties of a GaAs spherical quantum dot which is located at the center of a Ga1−xAlxAs cylindrical nano-wire has been performed in the presence of an external electric held. The band nonparabolicity effect is also considered using the energy dependent effective mass approximation. The energy eigenvalues and corresponding wave functions are calculated by finite difference approximation and the reliability of calculated wave functions is checked by computing orthogonality. Using computed energy eigenvalues and wave functions, the linear, third-order nonlinear and total optical absorption coefficients and refractive index changes are examined in detail. It is found that (i) Presence of electric field causes both blue and red shifts in absorption spectrum; (ii) The absorption coefficients shift toward lower energies by taking into account the conduction band nonparabolicity; (iii) For large values of electric field the effect of conduction band nonparabolicity is less dominant and parabolic band is estimated correctly; (iv) In the presence of electric field and conduction band nonparabolicity the nonlinear term of absorption coefficient rapidly increases by increasing incident optical intensity. In other words, the saturation in optical spectrum occurs at lower incident optical intensities. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  2. Preparation, configurational and DFT-NBO analysis of nickel(II) complexes with edta-type ligands containing six-membered backbone ring : crystal structure of [Ni(H2O)(6)][Ni(1,3-pdta)]center dot 2H(2)O

    NARCIS (Netherlands)

    Belosevic, Svetlana; Vasojevic, Miorad M.; Jeremic, Marija S.; Meetsma, Auke; Matovic, Zoran D.

    2013-01-01

    New hexadentate nickel(II) complex Mg[Ni(1,3-pd3ap)]center dot 10H(2)O containing unsymmetrical edta-type ligand, 1,3-propanediamine-N,N,N '-triacetate-N-3-propionate (1,3-pd3ap), has been prepared, chromatographically separated, and characterized. Only one [trans(O-5)] of the two possible geometric

  3. 75 FR 47249 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-08-05

    ... Order 12866; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes, CL-600-2C10 (Regional Jet Series 700, 701, & 702) Airplanes, CL-600-2D15 (Regional Jet Series 705) Airplanes, and CL-600-2D24 (Regional Jet...

  4. 75 FR 17884 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-04-08

    ... rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes; Model CL-600-2C10 (Regional Jet Series 700, 701, & 702) Airplanes; Model CL-600-2D15 (Regional Jet Series 705) and Model CL-600-2D24 (Regional...

  5. Outline in 1997 Japan compound material academic meeting technological prize winning technology. Kenchiku, doboku kozobutsu no hoshu[center dot]hokyo yo forukatousito no kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Iba, Yoshitomo.; Uemura, Masahiko.; Murakami, Shinkichi.; Saito, Makoto.; Kobayashi, Akira. (Nittetsu Composite Corp., Tokyo (Japan))

    1999-03-15

    That function declines in the sutra time target, and it is finally destroyed, or a construction structure thing bears putting off that life by managing efficient maintenance it is possible. The factor of the function decline of the structure thing, the degree of the decline, and so on are grasped quantitatively, and efficient repair reinforcement time and a method of construction are chosen, and you must carry it out for that. It is paying attention to the development of the method of construction to reinforce the maintenance repair of the construction structure thing by using the tip compound factor from such a viewpoint. In the beginning, a material cost was very expensive, and the recognition not to use it was very general in such a construction field. In such recognition, in Tonen Corp. incorporated company, it has paid attention to the use possibility in the construction field of the tip compound factor since early, research and development have been done continuously from 1980, that It succeeds in, and it is the method of construction that a repair reinforces a concrete structure thing by the tip material that the method of construction which got the technological prize of the Japan compound material academic meeting in 1997 moved carbon fiber to the center. (NEDO)

  6. Outline in 1997 Japan compound material academic meeting technological prize winning technology; Kenchiku, doboku kozobutsu no hoshu{center_dot}hokyo yo forukatousito no kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Iba, Yoshitomo.; Uemura, Masahiko.; Murakami, Shinkichi.; Saito, Makoto.; Kobayashi, Akira. [Nittetsu Composite Corp., Tokyo (Japan)

    1999-03-15

    That function declines in the sutra time target, and it is finally destroyed, or a construction structure thing bears putting off that life by managing efficient maintenance it is possible. The factor of the function decline of the structure thing, the degree of the decline, and so on are grasped quantitatively, and efficient repair reinforcement time and a method of construction are chosen, and you must carry it out for that. It is paying attention to the development of the method of construction to reinforce the maintenance repair of the construction structure thing by using the tip compound factor from such a viewpoint. In the beginning, a material cost was very expensive, and the recognition not to use it was very general in such a construction field. In such recognition, in Tonen Corp. incorporated company, it has paid attention to the use possibility in the construction field of the tip compound factor since early, research and development have been done continuously from 1980, that It succeeds in, and it is the method of construction that a repair reinforces a concrete structure thing by the tip material that the method of construction which got the technological prize of the Japan compound material academic meeting in 1997 moved carbon fiber to the center. (NEDO)

  7. On the origin of the substantial stabilisation of the electron-donor 1,3-dithiole-2-thione-4-carboxyclic acid center dot center dot center dot I-2 and DABCO center dot center dot center dot I-2 complexes

    Czech Academy of Sciences Publication Activity Database

    Deepa, Palanisamy; Sedlák, Robert; Hobza, Pavel

    2014-01-01

    Roč. 16, č. 14 (2014), s. 6679-6686. ISSN 1463-9076 R&D Projects: GA ČR GBP208/12/G016 Grant ostatní: Operational Program Research and Development for Innovations(XE) CZ 1.05/2.1.00/03/0058 Institutional support: RVO:61388963 Keywords : density functional theory * Kohn-Sham orbitals * basis set limit Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.493, year: 2014

  8. Photocatalytic production of {sup 1}O{sub 2} and {center_dot}OH mediated by silver oxidation during the photoinactivation of Escherichia coli with TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Castro, Camilo A. [Centro de Investigaciones en Catalisis, Escuela de Ingenieria Quimica, Universidad Industrial de Santander (UIS), A.A. 678, Bucaramanga (Colombia); Institute of Chemical Sciences and Engineering, GGEC, Swiss Federal Institute of Technology (EPFL), Station 6, CH-1015, Lausanne (Switzerland); Osorio, Paula [Institute of Chemical Sciences and Engineering, GGEC, Swiss Federal Institute of Technology (EPFL), Station 6, CH-1015, Lausanne (Switzerland); Sienkiewicz, Andrzej [Laboratory of Complex Matter Physics, Institute of Physics of Condensed Matter, EPFL, Station 3, CH-1015, Lausanne (Switzerland); Pulgarin, Cesar, E-mail: cesar.pulgarin@epfl.ch [Institute of Chemical Sciences and Engineering, GGEC, Swiss Federal Institute of Technology (EPFL), Station 6, CH-1015, Lausanne (Switzerland); Centeno, Aristobulo [Centro de Investigaciones en Catalisis, Escuela de Ingenieria Quimica, Universidad Industrial de Santander (UIS), A.A. 678, Bucaramanga (Colombia); Giraldo, Sonia A., E-mail: sgiraldo@uis.edu.co [Centro de Investigaciones en Catalisis, Escuela de Ingenieria Quimica, Universidad Industrial de Santander (UIS), A.A. 678, Bucaramanga (Colombia)

    2012-04-15

    Highlights: Black-Right-Pointing-Pointer Metallic silver enhances the Ag-TiO{sub 2} photoinactivation of Escherichia coli under Vis irradiation. Black-Right-Pointing-Pointer {sup 1}O{sub 2} and {center_dot}OH were identified in Vis irradiated Ag-TiO{sub 2} suspensions. Black-Right-Pointing-Pointer UV oxidized the Ag metallic species in the material decreasing photoactivity. Black-Right-Pointing-Pointer Dark contact of the UV oxidized material with E. coli regenerates the photocatalyst. - Abstract: Ag loaded TiO{sub 2} was applied in the photocatalytic inactivation of Escherichia coli under ultraviolet (UV) and visible (Vis) light irradiations. Ag enhanced the TiO{sub 2} photodisinfecting effect under Vis irradiation promoting the formation of singlet oxygen and hydroxyl radicals as identified by EPR analyses. Ag nanoparticles, determined on TEM analyses, undergo an oxidation process on the TiO{sub 2}'s surface under UV or Vis irradiation as observed by XPS. In particular, UV pre-irradiation of the material totally diminished its photodisinfection activity under a subsequent Vis irradiation test. Under UV, photodegradation of dichloroacetic acid (DCA), attributed to photoproduced holes in TiO{sub 2}, was inhibited by the presence of Ag suggesting that oxidation of Ag{sup 0} to Ag{sup +} and Ag{sup 2+} is faster than the oxidative path of the TiO{sub 2}'s holes on DCA molecules. Furthermore, photoassisted increased of Ag{sup +} concentration on TiO{sub 2}'s surface enhances the bacteriostatic activity of the material in dark periods. Indeed, this latter dark contact of Ag{sup +}-TiO{sub 2} and E. coli seems to induce recovering of the Vis light photoactivity promoted by the surface Ag photoactive species.

  9. Detection and control of charge states in a quintuple quantum dot

    OpenAIRE

    Ito, Takumi; Otsuka, Tomohiro; Amaha, Shinichi; Delbecq, Matthieu R.; NAKAJIMA, TAKASHI; Yoneda, Jun; Takeda, Kenta; Allison, Giles; Noiri, Akito; Kawasaki, Kento; Tarucha, Seigo

    2016-01-01

    A semiconductor quintuple quantum dot with two charge sensors and an additional contact to the center dot from an electron reservoir is fabricated to demonstrate the concept of scalable architecture. This design enables formation of the five dots as confirmed by measurements of the charge states of the three nearest dots to the respective charge sensor. The gate performance of the measured stability diagram is well reproduced by a capacitance model.These results provide an important step towa...

  10. Polyol-mediated C-dot formation showing efficient Tb3+/Eu3+ emission.

    Science.gov (United States)

    Dong, Hailong; Kuzmanoski, Ana; Gössl, Dorothee M; Popescu, Radian; Gerthsen, Dagmar; Feldmann, Claus

    2014-07-18

    C-dots (3-5 nm in diameter) obtained by most simple heating of polyols (glycerol, diethylene glycol and PEG 400) show intense blue and green emission (50% quantum yield). Upon modification with TbCl3/EuCl3, energy transfer from the C-dots to the rare-earth metal results in line-type Tb(3+) (green)/Eu(3+) (red) emission with quantum yields up to 85%. PMID:24887063

  11. Development of CuCl(Aq)/Hcl(Aq) electrolyzer for hydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Y.; Chalkova, E.; Fedkin, M.; Lvov, S. [Dept. of Energy and Mineral Engineering, Pennsylvania State Univ., University Park, Pennsylvania (United States)

    2009-07-01

    'Full text': The Cu-Cl thermochemical cycle is regarded as one of the most promising hydrogen production technologies, which can be compatible with the next generation of nuclear power plants. This cycle is a three-step process, with one of the steps involving the electrolytic hydrogen-generating reaction: 2CuCl(aq) + 2HCl(aq) {center_dot} 2CuCl{sub 2}(aq) + H{sub 2}(g). Detailed investigation of this electrolysis process was performed using a newly constructed electrolysis system, which was based on a 5-cm{sup 2} Electrochem Inc. fuel cell design. A key component of the CuCl(aq)/HCl(aq) electrolytic system is an anion exchange membrane (AEM) which separates anodic and cathodic compartments. To provide a high performance, the AEM needs to have high chloride ion conductivity and selectivity as well as good mechanical properties to withstand the aggressive concentrated chloride environment. To select the best membrane for the CuCl(aq)/HCl(aq) electrolyzer, a variety of commercial membranes were evaluated, including ACM, ACS, AHA, AMX (Tokuyama Soda); ASV, AAV, AHT (Asahi Glass); and AMI-7001(Membrane International Inc.). Membrane swelling, ion exchange capacity (IEC), and conductivity were measured at ambient temperature. The conductivity was measured in a specially designed 'clip' conductivity cell using Electrochemical Impedance Spectroscopy (EIS). The EIS data were fitted to the circuit model to extract the bulk resistance. The membrane resistance was estimated as the difference between the cell resistance with and without membrane at the same conditions. The membrane conductivity ({center_dot}) was calculated as {center_dot}=l/RA, where l, R and A are the membrane thickness, resistance and surface area of the cell, respectively. The membrane conductivity was measured in HCl(aq) solutions of concentrations 0.7-6 M and in 2M HCl-CuCl solution, which represents a model of the electrolyzer anolyte. Thus far, the AHA membrane demonstrated the

  12. Spintronic transport through an interacting Rashba dot

    International Nuclear Information System (INIS)

    We investigate the spin-dependent transport property through a quantum wire with local Rashba interaction based on fRG method. The Rashba field forms quasi-bound states which couple to the continuum states with an opposite spin direction. It is found that the transport through the Rashba dot strongly depends on an assumed spin polarization of the continuum states and on the Coulomb interaction U in the dot. The interaction U (U>UC) leads to the appearance of three conductance peaks. Two outer peaks are associated with the Coulomb blockade and the center peak is induced by correlation of the electrons with different spin

  13. Nuclear magnetic relaxation in the ferrimagnetic chain compound NiCu(C{sub 7}H{sub 6}N{sub 2}O{sub 6})(H{sub 2}O){sub 3}{center_dot}2H{sub 2}O : three-magnon scattering?

    Energy Technology Data Exchange (ETDEWEB)

    Hori, Hiromitsu; Yamamoto, Shoji [Division of Physics, Hokkaido University, Sapporo 060-0810 (Japan)

    2004-12-15

    Recent proton spin-lattice relaxation-time (T{sub 1}) measurements on the ferrimagnetic chain compound NiCu(C{sub 7}H{sub 6}N{sub 2}O{sub 6})(H{sub 2}O){sub 3}{center_dot}2H{sub 2}O are explained by an elaborately modified spin-wave theory. We give strong evidence of the major contribution to 1/T{sub 1} being made by the three-magnon scattering rather than the Raman scattering.

  14. The Effectiveness of Family-Based DOTS versus Professional-Family Mix DOTS in Treating Smears Positive Tuberculosis

    Directory of Open Access Journals (Sweden)

    Hassan Yekrang Sis

    2014-07-01

    Full Text Available Background: The present study compared the effectiveness of Family-Based DOTS (FB-DOTS versus Professional-Family Mix DOTS (PFM-DOTS in smear positive tuberculosis (TB patients. Methods: This semi-experimental study was performed in Tuberculosis and Lung Diseases Research Center of Tabriz in 2011-2012, among 57 TB patients recruited into either FB-DOTS or PFM-DOTS groups. At the baseline of the study, knowledge of both patients and their supervisors were assessed while at the end point, smear and culture of sputum, quality of life, knowledge and satisfaction of the patients along with the knowledge and satisfaction of their super-visors were assessed. Results: The difference for sputum smear negative (culture was 16.2 (4.8% and 7.7(6.9% for the PFM-DOTS in comparison with FB DOTS by the end of the second and forth months of treatment, respectively. A significant difference was observed between the two groups in relation to knowledge, satisfaction (patients and supervisors and all four domains of quality of life: physical health (P=0.036, psychological health (P<0.001, social relations (P=0.026 and environmental health (P<0.001. Conclusion: The PFM-DOTS treatment strategy in which health experts follow the patients in their homes seems to be among most appropriate strategies in treating TB.

  15. Environmental conditions influence for real-time hologram formation on dichromated polyvinyl alcohol NiCl{sub 2}{center_dot}6H{sub 2}O doped films

    Energy Technology Data Exchange (ETDEWEB)

    Fontanilla-Urdaneta, R C; Olivares-Perez, A; Fuentes-Tapia, I; Rios-Velasco, M A, E-mail: rfontanilla@inaoep.mx, E-mail: olivares@inaoep.mx, E-mail: ifuentes@inaoep.mx, E-mail: moni_arv@hotmail.com [Instituto Nacional de Astrofisica, Optica y Electronica (INAOE), Luis Enrique Erro No. 1 Tonantzintla, Puebla (Mexico)

    2011-01-01

    The real-time holographic gratings recording are studied by the presence of a metallic salt. The experimental process refers to analysis of diffraction efficiency by the influence of humidity in the coating solution on holograms formation in presence of electrical potential. The diffraction efficiency is measured as a function of the exposure energy until reach the saturation. The influence of the hologram parameters to get the diffraction efficiency is studied at room conditions.

  16. Quantum Dots: Theory

    Energy Technology Data Exchange (ETDEWEB)

    Vukmirovic, Nenad; Wang, Lin-Wang

    2009-11-10

    This review covers the description of the methodologies typically used for the calculation of the electronic structure of self-assembled and colloidal quantum dots. These are illustrated by the results of their application to a selected set of physical effects in quantum dots.

  17. Ultrasmall silicon quantum dots

    NARCIS (Netherlands)

    Zwanenburg, F.A.; Van Loon, A.A.; Steele, G.A.; Rijmenam, C.E.W.M.; Balder, T.; Fang, Y.; Lieber, C.M.; Kouwenhoven, L.P.

    2009-01-01

    We report the realization of extremely small single quantum dots in p-type silicon nanowires, defined by Schottky tunnel barriers with Ni and NiSi contacts. Despite their ultrasmall size the NiSi–Si–NiSi nanowire quantum dots readily allow spectroscopy of at least ten consecutive holes, and addition

  18. Quantum Dots: Theory

    OpenAIRE

    Vukmirovic, Nenad

    2010-01-01

    This review covers the description of the methodologies typically used for the calculation of the electronic structure of self-assembled and colloidal quantum dots. These are illustrated by the results of their application to a selected set of physical effects in quantum dots.

  19. 76 FR 33658 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2011-06-09

    ... rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979), 3. Will not... Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440); Model CL-600-2C10 (Regional Jet Series 700, 701, & 702); Model CL-600-2D15 (Regional Jet Series 705); and Model...

  20. 75 FR 27665 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2C10 (Regional Jet Series 700, 701 & 702...

    Science.gov (United States)

    2010-05-18

    ... Order 12866; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR.... Model CL-600-2C10 (Regional Jet Series 700, 701 & 702), Model CL-600-2D15 (Regional Jet Series 705), and Model CL-600-2D24 (Regional Jet Series 900) Airplanes AGENCY: Federal Aviation Administration (FAA),...

  1. 75 FR 34657 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-06-18

    ... rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes; Model CL-600-2C10 (Regional Jet Series 700, 701, & 702) Airplanes; Model CL-600-2D15 (Regional Jet Series 705) Airplanes; and Model...

  2. Barrier Li Quantum Dots in Magnetic Fields

    Institute of Scientific and Technical Information of China (English)

    LIUYi-Min; LIXiao-Zhu; YANWen-Hong; BAOCheng-Guang

    2003-01-01

    The methods for the few-body system are introduced to investigate the states of the barrier Li quantum dots (QDs) in an arbitrary strength of magnetic field. The configuration, which consists of a positive ion located on the z-axis at a distaneed from the two-dimensional QD plane (the x-y plane) and three electrons in the dot plane bound by the positive ion, is called a barrier Li center. The system, which consists of three electrons in the dot plane bound by the ion,is called a barrier Li QD. The dependence of energy of the state of the barrier Li QD on an external magnetic field B and the distance d is obtained. The angular momentum L of the ground states is found to jump not only with the variation orB but also with d.

  3. Dielectrophoretic Manipulation and Separation of Microparticles Using Microarray Dot Electrodes

    Directory of Open Access Journals (Sweden)

    Bashar Yafouz

    2014-04-01

    Full Text Available This paper introduces a dielectrophoretic system for the manipulation and separation of microparticles. The system is composed of five layers and utilizes microarray dot electrodes. We validated our system by conducting size-dependent manipulation and separation experiments on 1, 5 and 15 μm polystyrene particles. Our findings confirm the capability of the proposed device to rapidly and efficiently manipulate and separate microparticles of various dimensions, utilizing positive and negative dielectrophoresis (DEP effects. Larger size particles were repelled and concentrated in the center of the dot by negative DEP, while the smaller sizes were attracted and collected by the edge of the dot by positive DEP.

  4. NMR structural studies of intramolecular (Y+) sub n ter dot (R+) sub n (Y minus ) sub n DNA triplexes in solution: Imino and amino proton and nitrogen markers of Gter dot TA base triple formation

    Energy Technology Data Exchange (ETDEWEB)

    Radhakrishnan, I.; de los Santos, C.; Patel, D.J. (Columbia Univ., New York, NY (United States)); Gao, Xiaolian (Glaxo Research Inst., Research Triangle Park, NC (United States)); Live, D. (California Inst. of Tech., Pasadena (United States))

    1991-09-17

    The authors reported previously on NMR studies of (Y+){sub n}{center dot}(R+){sub n}(Y{minus}){sub n}DNA triple helices containing one oligopurine strand (R){sub n} and two oligopyrimidine strands (Y){sub n} stabilized by T{center dot}AT and C{sup +}{center dot}GC base triples. Recently, it has been established that guanosine can recognize a thymidine{center dot}adenosine base pair to form a G{center dot}TA triple in an otherwise (Y+){sub n}{center dot}(R+){sub n}(Y{minus}){sub n} triple-helix motif. The present study extends the NMR research to the characterization of structural features of a 31-mer deoxyoligonucleotide that folds intramolecularly into a 7-mer (Y+){sub n}{center dot}(R+){sub n}(Y{minus}){sub n} triplex with the strands linked through two T{sub 5} loops and that contains a central G{center dot}TA triple flanked by T{center dot}AT triples. The NMR data are consistent with the proposed pairing alignment for the G{center dot}TA triple where the guanosine in an anti orientation pairs through a single hydrogen bond from one of its 2-amino protons to the 4-carbonyl group of thymidine in the Watson-Crick TA pair. They detect a set of NOEs between adjacent triples that establishes that the G{center dot}TA triple stacks between flanking T{center dot}AT triples in the G{center dot}TA triplex. These results demonstrate the capabilities of the NMR approach in monitoring individual base triples and their pairing alignments, as well as establishing that the G{center dot}TA triple can be readily accommodated in an otherwise intramolecular (Y+){sub n}{center dot}(R+){sub n}(Y{minus}){sub n} triple helix in solution.

  5. Quantum Dots for Biophotonics

    OpenAIRE

    Ken-Tye Yong

    2012-01-01

    This theme issue provides an excellent collection of reviews and original research articles on the study of various bioconjugated quantum dot formulations for diagnostics and therapy applications using biophotonic imaging and sensing approaches.

  6. Graphene quantum dots

    CERN Document Server

    Güçlü, Alev Devrim; Korkusinski, Marek; Hawrylak, Pawel

    2014-01-01

    This book reflects the current status of theoretical and experimental research of graphene based nanostructures, in particular quantum dots, at a level accessible to young researchers, graduate students, experimentalists and theorists. It presents the current state of research of graphene quantum dots, a single or few monolayer thick islands of graphene. It introduces the reader to the electronic and optical properties of graphite, intercalated graphite and graphene, including Dirac fermions, Berry's phase associated with sublattices and valley degeneracy, covers single particle properties of

  7. SPECTRAL PROPERTIES OF SHUNGITE QUANTUM DOTS

    OpenAIRE

    RAZBIRIN B.S.; ROZHKOVA N.N.; Sheka, E. F.; Nelson, D. K.; Starukhin, A. N.; Goryunov, A. S.

    2014-01-01

    A low-temperature study has been performed for aqueous shungite, carbon tetrachloride, and toluene dispersions. Spectral characteristics for graphene quantum dots (GQDs) of shungite, attributed to individual fragments of reduced graphene oxide (rGO), reveal a dual character of the dispersions emitting centers: individual GQDs are responsible for the spectra position while fractal structure of GQD colloids provides large broadening of the spectra due to structural inhomogeneity of the colloida...

  8. Quadra-Quantum Dots and Related Patterns of Quantum Dot Molecules: Basic Nanostructures for Quantum Dot Cellular Automata Application

    OpenAIRE

    Somsak Panyakeow

    2010-01-01

    Laterally close-packed quantum dots (QDs) called quantum dot molecules (QDMs) are grown by modified molecular beam epitaxy (MBE). Quantum dots could be aligned and cross hatched. Quantum rings (QRs) created from quantum dot transformation during thin or partial capping are used as templates for the formations of bi-quantum dot molecules (Bi-QDMs) and quantum dot rings (QDRs). Preferable quantum dot nanostructure for quantum computation based on quantum dot cellular automata (QCA) is late...

  9. Inmunodeficiencias humorales: Un estudio en tres Centros de Inmunología Clínica de adultos en la Ciudad de Buenos Aires Antibody deficiencies: A survey from three Clinical Immunology Centers for adults in Buenos Aires City

    Directory of Open Access Journals (Sweden)

    Diego S. Fernández Romero

    2011-08-01

    Full Text Available Las inmunodeficiencias humorales (IDH comprenden a un grupo de enfermedades caracterizadas por la imposibilidad de desarrollar una respuesta inmune efectiva mediada por anticuerpos. Estos pacientes presentan infecciones, principalmente por bacterias extracelulares capsuladas, del tracto respiratorio. El objetivo de nuestro estudio fue describir las características clínicas de una población de 128 pacientes derivados con sospecha o diagnóstico de IDH a tres centros para inmunodeficiencias de adultos, asistidos entre junio de 2004 y diciembre de 2009. Tres (2.3% consultaron por infecciones recurrentes en una sola oportunidad sin datos suficientes para su adecuada clasificación y fueron excluidos del estudio. De los 125 pacientes restantes, en 21 (16.8% se descartó IDH, en 8 (6.4% se diagnosticó inmunodeficiencia humoral secundaria (IDHS y en 96 (76.8% inmunodeficiencia humoral primaria (IDHP. Las causas de IDHS fueron: en un caso enfermedad renal, en uno uso de fenitoína, dos casos: gammapatía monoclonal y en 4 linfoma B. Las causas de las 96 IDHP fueron: 57 inmunodeficiencia común variable, 12 agammaglobulinemia ligada al cromosoma X, 10 deficiencia selectiva de IgA, 7 deficiencia de IgG1, 3 síndrome hiper-IgM, 3 deficiencia de IgM, 2 síndrome linfoproliferativo ligado al cromosoma X, un síndrome de Good y una deficiencia funcional de anticuerpos. Sesenta y siete pacientes estaban en seguimiento en el momento de la finalización del estudio, 25 de ellos estaban en seguimiento al iniciarse el estudio. De los 58 pacientes en seguimiento con indicación de tratamiento sustitutivo con gammaglobulina, 54 se encontraban en tratamiento al finalizar el estudio. En cuatro pacientes no se pudo confirmar el diagnóstico de IDHP.Antibody deficiency (AD comprises a group of diseases characterized by the inability to develop an effective antibody mediated immune response. These patients suffer mainly of encapsulated extracellular bacterial

  10. The multilayered spherical quantum dot under a magnetic field

    International Nuclear Information System (INIS)

    The binding energy of an impurity located at the center of multilayered spherical quantum dot (MSQD) is reported as a function of the dot and barrier thickness for different alloy compositions under the influence of a magnetic field. Within the effective mass approximation, the binding energy has been calculated using the fourth order Runge-Kutta method without magnetic field. A variational approach has been employed if a magnetic field is present. The binding energy in MSQD with equal dot and barrier thickness is calculated. It is shown that the binding energy in MSQD differs from that of a single quantum dot. Also, the geometry is dominant on the binding energy for thin MSQDs, but the magnetic field becomes more effective for thick MSQDs.

  11. Phase equilibria and structural species in NdCl3-NaCl, NdCl3-CaCl2, PrCl3-NaCl, and PrCl3-CaCl2 systems

    International Nuclear Information System (INIS)

    This paper reports that equilibrium phase diagrams for the systems NdCl3---CaCl2 and NdCl3---NaCl were determined by differential thermal analysis. A simple eutectic was observed at 59 ± 1 mol% CaCl2 and 600 degrees ± 2 degrees C in the NdCl3---CaCl2 system. A compound NaCl · 3NdCl3 which melts incongruently at 545 degrees ± 5 degrees C to NdCl3 and a liquid containing approximately 47 mol% NaCl, and a eutectic at 68 mol% NaCl and 439 degrees ± 2 degrees C were found in the NdCl3---NaCl system. On the basis of agreements between the activities calculated by the Clausius-Clapeyron equation and Temkin's model using the present data for the NdCl3---CaCl2 system and the literature data for the PrCl3---CaCl2 system, the melts in the former system consist of Nd3+, Ca2+, and Cl- ions and in the latter system of Pr3+, Ca2+, and Cl- ions. The above approach indicates the presence of Na+, Cl-, and NdCl4- in the NdCl3-rich melts in the NdCl3--NaCl system

  12. A new uranium(VI) monophosphate with a layered structure: Ba{sub 3}[UO{sub 2}(PO{sub 4})(PO{sub 3}(OH))]{sub 2}{center_dot}xH{sub 2}O (x {approx} 0.4)

    Energy Technology Data Exchange (ETDEWEB)

    Guesdon, A.; Raveau, B. [Univ. de Caen (France). Lab. CRISMAT

    1998-11-01

    A new uranium(VI) phosphate containing barium has been synthesized hydrothermally: Ba{sub 3}[UO{sub 2}(PO{sub 4})(PO{sub 3}(OH))]{sub 2}{center_dot}xH{sub 2}O (x {approx} 0.4). The structure determination and refinement have been performed using single-crystal X-ray diffraction in the P2{sub 1}/c space group with Z = 2. The presence of hydroxyl groups and water molecules in the structure has been evidenced by IR and TGA studies. The U-P-O host lattice consists of puckered layers resulting from the connection of UO{sub 7} pentagonal bipyramids and monophosphate groups; the barium cations are distributed over two sites between these layers.

  13. Quantum dot cascade laser

    OpenAIRE

    Zhuo, Ning; Liu, Feng Qi; Zhang, Jin Chuan; Wang, Li Jun; Liu, Jun Qi; Zhai, Shen Qiang; Wang, Zhan Guo

    2014-01-01

    We demonstrated an unambiguous quantum dot cascade laser based on InGaAs/GaAs/InAs/InAlAs heterostructure by making use of self-assembled quantum dots in the Stranski-Krastanow growth mode and two-step strain compensation active region design. The prototype generates stimulated emission at λ ~ 6.15 μm and a broad electroluminescence band with full width at half maximum over 3 μm. The characteristic temperature for the threshold current density within the temperature range of 82 to 162 K is up...

  14. Quantum dot solar cells

    CERN Document Server

    Wu, Jiang

    2013-01-01

    The third generation of solar cells includes those based on semiconductor quantum dots. This sophisticated technology applies nanotechnology and quantum mechanics theory to enhance the performance of ordinary solar cells. Although a practical application of quantum dot solar cells has yet to be achieved, a large number of theoretical calculations and experimental studies have confirmed the potential for meeting the requirement for ultra-high conversion efficiency. In this book, high-profile scientists have contributed tutorial chapters that outline the methods used in and the results of variou

  15. Effect of the length of ligands passivating quantum dots on the electrooptical characteristics of organic light-emitting diodes

    International Nuclear Information System (INIS)

    The electrooptical characteristics of organic light-emitting diodes with quantum dots passivated with organic ligands of different lengths as emitting centers are investigated. It is established that the thickness of the ligand coating covering the quantum dots has little effect on the Förster energy transfer in the diodes, but significantly affects the direct injection of charge carriers into the quantum-dot layer. It is shown that the thickness of the passivation coating covering the quantum dots in a close-packed nanoparticle layer is deter- mined both by the length of passivating ligands and the degree of quantum-dot coverage with ligands

  16. Barrier Li Quantum Dots in Magnetic Fields

    Institute of Scientific and Technical Information of China (English)

    LIU Yi-Min; LI Xiao-Zhu; YAN Wen-Hong; BAO Cheng-Guang

    2003-01-01

    The methods for the few-body system are introduced to investigate the states of the barrier Li quantumdots (QDs) in an arbitrary strength of magnetic field. The configuration, which consists of a positive ion located on thez-axis at a distance d from the two-dimensional QD plane (the x-y plane) and three electrons in the dot plane boundby the positive ion, is called a barrier Li center. The system, which consists of three electrons in the dot plane bound bythe ion, is called a barrier Li QD. The dependence of energy of the state of the barrier Li QD on an external magneticfield B and the distance d is obtained. The angular momentum L of the ground states is found to jump not only withthe variation of B but also with d.

  17. Magnetoconductance fluctuations in open bismuth quantum dots

    Science.gov (United States)

    Hackens, B.; Minet, J. P.; Farhi, G.; Crahay, A.; Faniel, S.; Gustin, C.; Bayot, V.

    2002-03-01

    We investigate the low temperature (300 mK - 10 K) magnetoconductance of open circular bismuth quantum dots (diameter: 500 nm). The structures are fabricated using a combination of electron beam lithography, lift off and plasma etching techniques on bismuth thin films evaporated on heated SiO2 substrates. We observe reproducible magnetoconductance fluctuations (UCFs) up to 5T, qualitatively similar to conductance fluctuations evidenced in open quantum dots patterned in high mobility semiconductor heterostructures. In our samples, UCFs are superposed on a slowly varying negative magnetoconductance background. We also observe a sharp conductance maximum centered in B=0, which is reminescent of the spin-orbit induced anti-localisation phenomenon. The behavior of UCFs and of the conductance maximum is discussed as a function of the temperature, thickness and degree of cristallinity of the cavity.

  18. Fuzzy Dot Structure of BG-algebras

    OpenAIRE

    Tapan Senapati; Monoranjan Bhowmik; Madhumangal Pal

    2014-01-01

    In this paper, the notions of fuzzy dot subalgebras is introduced together with fuzzy normal dot subalgebras and fuzzy dot ideals of BG-algebras. The homomorphic image and inverse image are investigated in fuzzy dot subalgebras and fuzzy dot ideals of BG-algebras. Also, the notion of fuzzy relations on the family of fuzzy dot subalgebras and fuzzy dot ideals of BG-algebras are introduced with some related properties.

  19. Electron correlations in quantum dots

    CERN Document Server

    Tipton, D L J

    2001-01-01

    Quantum dot structures confine electrons in a small region of space. Some properties of semiconductor quantum dots, such as the discrete energy levels and shell filling effects visible in addition spectra, have analogies to those of atoms and indeed dots are sometimes referred to as 'artificial atoms'. However, atoms and dots show some fundamental differences due to electron correlations. For real atoms, the kinetic energy of electrons dominates over their mutual Coulomb repulsion energy and for this reason the independent electron approximation works well. For quantum dots the confining potential may be shallower than that of real atoms leading to lower electron densities and a dominance of mutual Coulomb repulsion over kinetic energy. In this strongly correlated regime the independent electron picture leads to qualitatively incorrect results. This thesis concentrates on few-electron quantum dots in the strongly correlated regime both for quasi-one-dimensional and two-dimensional dots in a square confining p...

  20. Colloidal Double Quantum Dots

    Science.gov (United States)

    2016-01-01

    Conspectus Pairs of coupled quantum dots with controlled coupling between the two potential wells serve as an extremely rich system, exhibiting a plethora of optical phenomena that do not exist in each of the isolated constituent dots. Over the past decade, coupled quantum systems have been under extensive study in the context of epitaxially grown quantum dots (QDs), but only a handful of examples have been reported with colloidal QDs. This is mostly due to the difficulties in controllably growing nanoparticles that encapsulate within them two dots separated by an energetic barrier via colloidal synthesis methods. Recent advances in colloidal synthesis methods have enabled the first clear demonstrations of colloidal double quantum dots and allowed for the first exploratory studies into their optical properties. Nevertheless, colloidal double QDs can offer an extended level of structural manipulation that allows not only for a broader range of materials to be used as compared with epitaxially grown counterparts but also for more complex control over the coupling mechanisms and coupling strength between two spatially separated quantum dots. The photophysics of these nanostructures is governed by the balance between two coupling mechanisms. The first is via dipole–dipole interactions between the two constituent components, leading to energy transfer between them. The second is associated with overlap of excited carrier wave functions, leading to charge transfer and multicarrier interactions between the two components. The magnitude of the coupling between the two subcomponents is determined by the detailed potential landscape within the nanocrystals (NCs). One of the hallmarks of double QDs is the observation of dual-color emission from a single nanoparticle, which allows for detailed spectroscopy of their properties down to the single particle level. Furthermore, rational design of the two coupled subsystems enables one to tune the emission statistics from single

  1. Colloidal Double Quantum Dots.

    Science.gov (United States)

    Teitelboim, Ayelet; Meir, Noga; Kazes, Miri; Oron, Dan

    2016-05-17

    Pairs of coupled quantum dots with controlled coupling between the two potential wells serve as an extremely rich system, exhibiting a plethora of optical phenomena that do not exist in each of the isolated constituent dots. Over the past decade, coupled quantum systems have been under extensive study in the context of epitaxially grown quantum dots (QDs), but only a handful of examples have been reported with colloidal QDs. This is mostly due to the difficulties in controllably growing nanoparticles that encapsulate within them two dots separated by an energetic barrier via colloidal synthesis methods. Recent advances in colloidal synthesis methods have enabled the first clear demonstrations of colloidal double quantum dots and allowed for the first exploratory studies into their optical properties. Nevertheless, colloidal double QDs can offer an extended level of structural manipulation that allows not only for a broader range of materials to be used as compared with epitaxially grown counterparts but also for more complex control over the coupling mechanisms and coupling strength between two spatially separated quantum dots. The photophysics of these nanostructures is governed by the balance between two coupling mechanisms. The first is via dipole-dipole interactions between the two constituent components, leading to energy transfer between them. The second is associated with overlap of excited carrier wave functions, leading to charge transfer and multicarrier interactions between the two components. The magnitude of the coupling between the two subcomponents is determined by the detailed potential landscape within the nanocrystals (NCs). One of the hallmarks of double QDs is the observation of dual-color emission from a single nanoparticle, which allows for detailed spectroscopy of their properties down to the single particle level. Furthermore, rational design of the two coupled subsystems enables one to tune the emission statistics from single photon

  2. 76 FR 18957 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2C10 (Regional Jet Series 700, 701 & 702...

    Science.gov (United States)

    2011-04-06

    ... published in the Federal Register on May 18, 2010 (75 FR 27665). That earlier NPRM proposed to require... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979), (3) Will..., Inc. Model CL-600-2C10 (Regional Jet Series 700, 701 & 702), Model CL-600-2D15 (Regional Jet...

  3. 75 FR 35613 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2C10 (Regional Jet Series 700 & 701...

    Science.gov (United States)

    2010-06-23

    ..., 2009 (74 FR 55493). That NPRM proposed to correct an unsafe condition for the specified products. The...'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have.... Model CL-600-2C10 (Regional Jet Series 700 & 701) Airplanes, Model CL-600-2D15 (Regional Jet Series...

  4. 75 FR 59073 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-09-27

    ... to the specified products. That NPRM was published in the Federal Register on April 8, 2010 (75 FR... Order 12866; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes; Model CL-600-2C10 (Regional Jet Series...

  5. 75 FR 69609 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-11-15

    ... 12866; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes AGENCY: Federal Aviation Administration (FAA... Part 2, ``Airworthiness Limitations,'' of the Bombardier CL-600-2B19 Maintenance Requirements...

  6. 75 FR 25788 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-05-10

    ... 12866; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes AGENCY: Federal Aviation Administration (FAA...) sufficient heat switches/sensors on CL-600-2B19 aircraft are located at the inboard end of each wing...

  7. 75 FR 60604 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-10-01

    ... (75 FR 34657). That NPRM proposed to correct an unsafe condition for the specified products. The MCAI...'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes; Model CL-600-2C10 (Regional Jet Series...

  8. Mixed-valence, layered, cation radical salts of the ethane-bridged dimeric tetrathiafulvalene [(EDT-TTF-CH2-)2#centre dot#+] [X-][THF]0.5, X-=FeCl4-, GaCl4-

    DEFF Research Database (Denmark)

    Mézière, C.; Fourmigué, M.; Canadell, E.;

    2000-01-01

    other give rise to both 1D- and 2D-type HOMO ... HOMO interactions whose origin is correlated with the details of the peculiar overlap patterns obtained with those dimeric tetrathiafulvalenes. The weak paramagnetism observed in the GaCl4- salt due to the organic spins of the conducting slabs is hidden...

  9. 75 FR 6862 - Airworthiness Directives; Bombardier, Inc. Model CL-600-1A11 (CL-600), CL-600-2A12 (CL-601), CL...

    Science.gov (United States)

    2010-02-12

    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-1A11 (CL- 600), CL-600-2A12 (CL-601), CL-600-2B16 (CL-601-3A, CL-601-3R, and CL- 604 Variants (Including CL-605 Marketing Variant)) Airplanes AGENCY: Federal Aviation Administration (FAA),...

  10. Quantum Dot Sensitized Photoelectrodes

    OpenAIRE

    Thomas Nann; Thomas J. Macdonald

    2011-01-01

    Quantum Dots (QDs) are promising alternatives to organic dyes as sensitisers for photocatalytic electrodes. This review article provides an overview of the current state of the art in this area. More specifically, different types of QDs with a special focus on heavy-metal free QDs and the methods for preparation and adsorption onto metal oxide electrodes (especially titania and zinc oxide) are discussed. Eventually, the key areas of necessary improvements are identified and assessed.

  11. Quantum Dot Sensitized Photoelectrodes

    Directory of Open Access Journals (Sweden)

    Thomas Nann

    2011-11-01

    Full Text Available Quantum Dots (QDs are promising alternatives to organic dyes as sensitisers for photocatalytic electrodes. This review article provides an overview of the current state of the art in this area. More specifically, different types of QDs with a special focus on heavy-metal free QDs and the methods for preparation and adsorption onto metal oxide electrodes (especially titania and zinc oxide are discussed. Eventually, the key areas of necessary improvements are identified and assessed.

  12. Plasmonic fluorescent quantum dots

    OpenAIRE

    Jin, Yongdong; Gao, Xiaohu

    2009-01-01

    Combining multiple discrete components into a single multifunctional nanoparticle could be useful in a variety of applications. Retaining the unique optical and electrical properties of each component after nanoscale integration is, however, a long-standing problem1,2. It is particularly difficult when trying to combine fluorophores such as semiconductor quantum dots with plasmonic materials such as gold, because gold and other metals can quench the fluorescence3,4. So far, the combination of...

  13. Quantum dots in graphene

    OpenAIRE

    Silvestrov, P.G.; Efetov, K. B.

    2006-01-01

    We suggest a way of confining quasiparticles by an external potential in a small region of a graphene strip. Transversal electron motion plays a crucial role in this confinement. Properties of thus obtained graphene quantum dots are investigated theoretically for different types of the boundary conditions at the edges of the strip. The (quasi)bound states exist in all systems considered. At the same time, the dependence of the conductance on the gate voltage carries an information about the s...

  14. Quantum dot nanostructures

    Directory of Open Access Journals (Sweden)

    Mohamed Henini

    2002-06-01

    These sophisticated technologies for the growth of high quality epitaxial layers of compound semiconductor materials on single crystal semiconductor substrates are becoming increasingly important for the development of the semiconductor electronics industry. This article is intended to convey the flavor of the subject by focusing on the technology and applications of self-assembled quantum dots (QDs and to give an introduction to some of the essential characteristics.

  15. Esterification of oleic acid for biodiesel production catalyzed by SnCl{sub 2}: a kinetic investigation

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, A. L.; Gonzaga Neves, S. C.; Silva, M. J. da [Departament of Chemistry, Federal University of Vicosa, Vicosa, Minas Gerais, 36570-000 (Brazil)

    2008-07-01

    The production of biodiesel from low-cost raw materials which generally contain high amounts of free fatty acids (FFAs) is a valuable alternative that would make their production costs more competitive than petroleum-derived fuel. Currently, the production of biodiesel from this kind of raw materials comprises a two-stage process, which requires an initial acid-catalyzed esterification of the FFA, followed by a basecatalyzed transesterification of the triglycerides. Commonly, the acid H{sub 2}SO{sub 4} is the catalyst on the first step of this process. It must be said, however, that major drawbacks such as substantial reactor corrosion and the great generation of wastes, including the salts formed due to neutralization of the mineral acid, are negative and virtually unsurmountable aspects of this protocol. In this paper, tin(II) chloride dihydrate (SnCl{sub 2}{center_dot}2H{sub 2}O), an inexpensive Lewis acid, was evaluated as catalyst on the ethanolysis of oleic acid, which is the major component of several fat and vegetable oils feedstocks. Tin chloride efficiently promoted the conversion of oleic acid into ethyl oleate in ethanol solution and in soybean oil samples, under mild reaction conditions. The SnCl{sub 2} catalyst was shown to be as active as the mineral acid H{sub 2}SO{sub 4}. Its use has relevant advantages in comparison to mineral acids catalysts, such as less corrosion of the reactors and as well as avoiding the unnecessary neutralization of products. Herein, the effect of the principal parameters of reaction on the yield and rate of ethyl oleate production has been investigated. Kinetic measurements revealed that the esterification of oleic acid catalyzed by SnCl{sub 2}{center_dot}2H{sub 2}O is first-order in relation to both FFAs and catalyst concentration. Experimentally, it was verified that the energy of activation of the esterification reaction of oleic acid catalyzed by SnCl{sub 2} was very close to those reported for H{sub 2}SO{sub 4

  16. Quantum dot solar cell

    International Nuclear Information System (INIS)

    Full text: The much awaited desire of replacing fossil fuel with photovoltaic will remain a fairy tale if the myriad of issues facing solar cell development are marginalized. Foremost in the list is the issue of cost. Silicon has reached a stage where its use on large scale can no longer be lavishly depended upon. The demand for high grade silicon from the microelectronics and solar industries has soared leading to scarcity. New approach has to be sought. Notable is the increased attention on thin films such as cadmium telluride, copper indium gallium diselenide, amorphous silicon, and the not so thin non-crystalline family of silicon. While efforts to address the issues of stability, toxicity and efficiency of these systems are ongoing, another novel approach is quietly making its appearance - quantum dots. Quantum dots seem to be promising candidates for solar cells because of the opportunity to manipulate their energy levels allowing absorption of a wider solar spectrum. Utilization of minute quantity of these nano structures is enough to bring the cost of solar cell down and to ascertain sustainable supply of useful material. The paper outlines the progress that has been made on quantum dot solar cells. (author)

  17. Intracellular distribution of nontargeted quantum dots after natural uptake and microinjection

    Directory of Open Access Journals (Sweden)

    Damalakiene L

    2013-02-01

    Full Text Available Leona Damalakiene,1 Vitalijus Karabanovas,2 Saulius Bagdonas,1 Mindaugas Valius,3 Ricardas Rotomskis1,21Biophotonics Group, Laser Research Center, Faculty of Physics, 2Biomedical Physics Laboratory, Institute of Oncology, 3Proteomics Center, Institute of Biochemistry, Vilnius University, Vilnius, LithuaniaBackground: The purpose of this study was to elucidate the mechanism of natural uptake of nonfunctionalized quantum dots in comparison with microinjected quantum dots by focusing on their time-dependent accumulation and intracellular localization in different cell lines.Methods: The accumulation dynamics of nontargeted CdSe/ZnS carboxyl-coated quantum dots (emission peak 625 nm was analyzed in NIH3T3, MCF-7, and HepG2 cells by applying the methods of confocal and steady-state fluorescence spectroscopy. Intracellular colocalization of the quantum dots was investigated by staining with Lysotracker®.Results: The uptake of quantum dots into cells was dramatically reduced at a low temperature (4°C, indicating that the process is energy-dependent. The uptake kinetics and imaging of intracellular localization of quantum dots revealed three accumulation stages of carboxyl-coated quantum dots at 37°C, ie, a plateau stage, growth stage, and a saturation stage, which comprised four morphological phases: adherence to the cell membrane; formation of granulated clusters spread throughout the cytoplasm; localization of granulated clusters in the perinuclear region; and formation of multivesicular body-like structures and their redistribution in the cytoplasm. Diverse quantum dots containing intracellular vesicles in the range of approximately 0.5–8 µm in diameter were observed in the cytoplasm, but none were found in the nucleus. Vesicles containing quantum dots formed multivesicular body-like structures in NIH3T3 cells after 24 hours of incubation, which were Lysotracker-negative in serum-free medium and Lysotracker-positive in complete medium. The

  18. Inter-dot coupling effects on transport through correlated parallel coupled quantum dots

    Indian Academy of Sciences (India)

    Shyam Chand; G Rajput; K C Sharma; P K Ahluwalia

    2009-05-01

    Transport through symmetric parallel coupled quantum dot system has been studied, using non-equilibrium Green function formalism. The inter-dot tunnelling with on-dot and inter-dot Coulomb repulsion is included. The transmission coefficient and Landaur–Buttiker like current formula are shown in terms of internal states of quantum dots. The effect of inter-dot tunnelling on transport properties has been explored. Results, in intermediate inter-dot coupling regime show signatures of merger of two dots to form a single composite dot and in strong coupling regime the behaviour of the system resembles the two decoupled dots.

  19. From single dots to interacting arrays

    OpenAIRE

    Gudmundsson, Vidar; Manolescu, Andrei; Krahne, Roman; Heitmann, Detlef

    2001-01-01

    We explore the structural changes in charge the density and the electron configuration of quantum dots caused by the presence of other dots in an array, and the interaction of neighboring dots. We discuss what recent measurements and calculation of the far-infrared absorption reveal about almost isolated quantum dots and investigate some aspects of the complex transition from isolated dots to dots with strongly overlapping electron density. We also address the the effects on the magnetization...

  20. Geometry-induced quantum dots on surfaces with Gaussian bumps

    Science.gov (United States)

    Silva, Kamilla V. R. A.; de Freitas, Cesar F.; Filgueiras, Cleverson

    2013-04-01

    In this work we investigate the two dimensional electron gas on surfaces showing Gaussian bumps. Due to confinement on two dimensional curved space, a geometry-induced potential appears. For surfaces showing single bumps, the geometrical potential gives rise to a geometry-induced quantum ring, as showed in a previous work. For surfaces with multiples bumps, the charge carries may be trapped around the center of these surfaces, which could gives rise to a geometry-induced quantum dot. Our results can be realized on bilayer graphene sheets and we hope that it would lead to new technics of building quantum dots.

  1. Neural network approach to magnetic dot arrays modeling

    International Nuclear Information System (INIS)

    Two-dimensional square lattice model of the magnetic dot array is presented. The intradot self-energy is predicted using the neural network approach and interdot magnetostatic coupling is approximated by the several dipolar terms. The model is applied to disk-shaped cluster involving 193 ultrathin square dots with 772 interaction centers. Among the intradot magnetic structures retrieved by neural networks the important role play single-vortex intradot magnetostatic modes. Several aspects of the model have been understood by the numerical study using the simulated annealing method

  2. Templating growth of gold nanostructures with a CdSe quantum dot array

    Science.gov (United States)

    Paul, Neelima; Metwalli, Ezzeldin; Yao, Yuan; Schwartzkopf, Matthias; Yu, Shun; Roth, Stephan V.; Müller-Buschbaum, Peter; Paul, Amitesh

    2015-05-01

    In optoelectronic devices based on quantum dot arrays, thin nanolayers of gold are preferred as stable metal contacts and for connecting recombination centers. The optimal morphology requirements are uniform arrays with precisely controlled positions and sizes over a large area with long range ordering since this strongly affects device performance. To understand the development of gold layer nanomorphology, the detailed mechanism of structure formation are probed with time-resolved grazing incidence small-angle X-ray scattering (GISAXS) during gold sputter deposition. Gold is sputtered on a CdSe quantum dot array with a characteristic quantum dot spacing of ~7 nm. In the initial stages of gold nanostructure growth, a preferential deposition of gold on top of quantum dots occurs. Thus, the quantum dots act as nucleation sites for gold growth. In later stages, the gold nanoparticles surrounding the quantum dots undergo a coarsening to form a complete layer comprised of gold-dot clusters. Next, growth proceeds dominantly via vertical growth of gold on these gold-dot clusters to form an gold capping layer. In this capping layer, a shift of the cluster boundaries due to ripening is found. Thus, a templating of gold on a CdSe quantum dot array is feasible at low gold coverage.

  3. LiCl(NaCl)-CeCl3-H2O systems at 25 deg C

    International Nuclear Information System (INIS)

    It has been found by the method of isothermal solubility that aqueous ternary systems LiCl(NaCl)-CeCl3-H2O at 25 deg C refer to the eutonic type with crystallization of the initial components LiClxH2O, NaCl, and CeCl3x7H2O

  4. Reassessing the role of DotF in the Legionella pneumophila type IV secretion system.

    Directory of Open Access Journals (Sweden)

    Molly C Sutherland

    Full Text Available Legionella pneumophila, the causative agent of a severe pneumonia termed Legionnaires' Disease, survives and replicates within both protozoan hosts and human alveolar macrophages. Intracellular survival is dependent upon secretion of a plethora of protein effectors that function to form a replicative vacuole, evade the endocytic pathway and subvert host immune defenses. Export of these factors requires a type IV secretion system (T4SS called Dot/Icm that is composed of twenty-seven proteins. This report focuses on the DotF protein, which was previously postulated to have several different functions, one of which centered on binding Dot/Icm substrates. In this report, we examined if DotF functions as the T4SS inner membrane receptor for Dot/Icm substrates. Although we were able to recapitulate the previously published bacterial two-hybrid interaction between DotF and several substrates, the interaction was not dependent on the Dot/Icm substrates' signal sequences as predicted for a substrate:receptor interaction. In addition, binding did not require the cytoplasmic domain of DotF, which was anticipated to be involved in recognizing substrates in the cytoplasm. Finally, inactivation of dotF did not abolish intracellular growth of L. pneumophila or translocation of substrates, two phenotypes dependent on the T4SS receptor. These data strongly suggest that DotF does not act as the major receptor for Dot/Icm substrates and therefore likely performs an accessory function within the core-transmembrane subcomplex of the L. pneumophila Dot/Icm type IV secretion system.

  5. Quantifying Local and Cooperative Components in the Ferroelectric Distortion of BaTiO3: Learning from the Off-Center Motion in the MnCl65– Complex Formed in KCl:Mn+

    DEFF Research Database (Denmark)

    García Lastra, Juan Maria; García-Fernández, P.; Calle-Vallejo, F.;

    2014-01-01

    The delicate balance between cooperative and local contributions in the ferroelectric distortions of BaTiO3 is explored by means of ab initio calculations. As a salient feature, it is found that a single Ti4+ ion in BaTiO3 is not allowed to move off-center at ambient pressure, while this is no lo......The delicate balance between cooperative and local contributions in the ferroelectric distortions of BaTiO3 is explored by means of ab initio calculations. As a salient feature, it is found that a single Ti4+ ion in BaTiO3 is not allowed to move off-center at ambient pressure, while...

  6. Electrochromic nanocrystal quantum dots.

    Science.gov (United States)

    Wang, C; Shim, M; Guyot-Sionnest, P

    2001-03-23

    Incorporating nanocrystals into future electronic or optoelectronic devices will require a means of controlling charge-injection processes and an understanding of how the injected charges affect the properties of nanocrystals. We show that the optical properties of colloidal semiconductor nanocrystal quantum dots can be tuned by an electrochemical potential. The injection of electrons into the quantum-confined states of the nanocrystal leads to an electrochromic response, including a strong, size-tunable, midinfrared absorption corresponding to an intraband transition, a bleach of the visible interband exciton transitions, and a quench of the narrow band-edge photoluminescence. PMID:11264530

  7. Determination of atropine using Mn-doped ZnS quantum dots as novel luminescent sensitizers

    International Nuclear Information System (INIS)

    A novel chemiluminescence (CL) method using water-soluble Mn-doped ZnS quantum dots (QDs) as sensitizers is proposed for the chemiluminometric determination of atropine in pharmaceutical formulation. Water-soluble Mn-doped ZnS QDs were synthesized by using L-cysteine as stabilizer in aqueous solutions. The nanoparticles were structurally and optically characterized by X-ray powder diffraction (XRD), dynamic light scattering (DLS), Fourier transform infrared spectroscopy (FTIR), UV–vis absorption spectroscopy and photoluminescence (PL) emission spectroscopy. It was found that ZnS quantum dots acted as enhancers of the weak CL emission produced upon oxidation of sulfite by Ce(IV) in acidic medium. Trace amounts of atropine improved the sensitize effect of ZnS quantum dots yielding a significant chemiluminescence enhancement of the Ce(IV)–SO32−–ZnS QD system. Therefore, a new CL analysis system was developed for the determination of atropine. Under the optimum conditions, there is a good linear relationship between the relative chemiluminescence intensity and the concentration of atropine in the range of 1×10−9–1×10−6 M of atropine with a correlation coefficient (R2) of 0.9992. The limit of detection of this system was found to be 2.54×10−10 M. This method is not only simple, sensitive and low cost, but also reliable for practical applications. -- Highlights: • Mn-doped ZnS quantum dots could enhance the chemiluminescence (CL) of cerium(IV)–sodium sulfite system. • ZnS quantum dots were used as the nanocatalyst. • Trace amounts of atropine improved the sensitize effect of ZnS quantum dots. • This work is introduced as a new method for the determination of atropine commercial drugs. • Detection limit of atropine was obtained 2.54×10−10 mol L−1

  8. Isomerization effect of counter anion on the spin crossover transition in [Fe(4-NH{sub 2}trz){sub 3}](CH{sub 3}C{sub 6}H{sub 4}SO{sub 3}){sub 2{center_dot}}nH{sub 2}O

    Energy Technology Data Exchange (ETDEWEB)

    Sugahara, A; Enomoto, M; Kojima, N, E-mail: cnori@mail.ecc.u-tokyo.ac.j [Graduate School of Arts and Sciences, University of Tokyo, Komaba, 3-8-1, Meguro-ku, Tokyo 153-8902 (Japan)

    2010-03-01

    We have investigated the spin crossover transition of the triazole bridged one dimensional Fe{sup II} complexes, [Fe(4-NH{sub 2}trz){sub 3}](o-, m-, p-tos){sub 2{center_dot}}nH{sub 2}O (tosH = toluenesulfonic acid), in order to study the isomerization effect of counter anion on the spin crossover phenomenon by means of {sup 57}Fe Moessbauer spectroscopy and magnetic susceptibility measurement. In the heating process, the spin transition of the all salts occurs around room temperatures, i.e. those of o-, m-, p-tos salts are 330 K, 319 K and 320 and 350 K, respectively. In the cooling process, the structural isomerization effect of counter anion on the spin crossover phenomenon is more remarkable than that in the heating process. In the case of o-tos salt, the spin transition occurs at 250 K with thermal hysteresis of 80 K. On the other hand, in the case of the m-tos salt, the spin transition occurs abruptly at 319 K with negligible small hysteresis. In the case of the p-tos salt, the spin transition occurs abruptly at 295 K in the cooling process in spite of stepwise spin transitions in the heating process.

  9. Printer model for dot-on-dot halftone screens

    Science.gov (United States)

    Balasubramanian, Raja

    1995-04-01

    A printer model is described for dot-on-dot halftone screens. For a given input CMYK signal, the model predicts the resulting spectral reflectance of the printed patch. The model is derived in two steps. First, the C, M, Y, K dot growth functions are determined which relate the input digital value to the actual dot area coverages of the colorants. Next, the reflectance of a patch is predicted as a weighted combination of the reflectances of the four solid C, M, Y, K patches and their various overlays. This approach is analogous to the Neugebauer model, with the random mixing equations being replaced by dot-on-dot mixing equations. A Yule-Neilsen correction factor is incorporated to account for light scattering within the paper. The dot area functions and Yule-Neilsen parameter are chosen to optimize the fit to a set of training data. The model is also extended to a cellular framework, requiring additional measurements. The model is tested with a four color xerographic printer employing a line-on-line halftone screen. CIE L*a*b* errors are obtained between measurements and model predictions. The Yule-Neilsen factor significantly decreases the model error. Accuracy is also increased with the use of a cellular framework.

  10. Quantum dot cascade laser

    Science.gov (United States)

    2014-01-01

    We demonstrated an unambiguous quantum dot cascade laser based on InGaAs/GaAs/InAs/InAlAs heterostructure by making use of self-assembled quantum dots in the Stranski-Krastanow growth mode and two-step strain compensation active region design. The prototype generates stimulated emission at λ ~ 6.15 μm and a broad electroluminescence band with full width at half maximum over 3 μm. The characteristic temperature for the threshold current density within the temperature range of 82 to 162 K is up to 400 K. Moreover, our materials show the strong perpendicular mid-infrared response at about 1,900 cm-1. These results are very promising for extending the present laser concept to terahertz quantum cascade laser, which would lead to room temperature operation. PACS 42.55.Px; 78.55.Cr; 78.67.Hc PMID:24666965

  11. ANALYTICAL REVIEW FOR DIFFERENT ASPECTS OF DOT GAIN

    OpenAIRE

    Parag Dnyandeo Nathe

    2013-01-01

    This document gives information about Dot reproduction, Dot gain, factors affecting dot gain, calculation of dot gain measurement and control over dot gain in different controlling parameters. Dot generation in print reproduction and different aspects which causes dot gain during image generation with photochemical process, during printing with mechanical process and during visual inspection of print dot gain is occurred. This document gives information about all causes of dot gain and contr...

  12. Optimization of Quantum-Dot Molecular Beam Epitaxy for Broad Spectral Bandwidth Devices

    KAUST Repository

    Majid, M. A.

    2012-12-01

    The optimization of the key growth parameters for broad spectral bandwidth devices based on quantum dots is reported. A combination of atomic force microscopy, photoluminescence of test samples, and optoelectronic characterization of superluminescent diodes (SLDs) is used to optimize the growth conditions to obtain high-quality devices with large spectral bandwidth, radiative efficiency (due to a reduced defective-dot density), and thus output power. The defective-dot density is highlighted as being responsible for the degradation of device performance. An SLD device with 160 nm of bandwidth centered at 1230 nm is demonstrated.

  13. Estado nutricional de pacientes com esquizofrenia frequentadores do Centro de Atenção Psicossocial (CAPS do Hospital de Clínicas de Porto Alegre Nutritional status of patients with schizophrenia who attend the Psychosocial Care Center (CAPS, Hospital de Clínicas de Porto Alegre

    Directory of Open Access Journals (Sweden)

    Karine Zortéa

    2010-01-01

    Full Text Available OBJETIVO: Avaliar o estado nutricional de pacientes com esquizofrenia, atendidos por um programa de reabilitação social (CAPS. MÉTODOS: Foi realizado um estudo transversal com 40 pacientes com diagnóstico de esquizofrenia, em uso de antipsicóticos, atendidos no CAPS do Hospital de Clínicas de Porto Alegre. Foram verificados medidas antropométricas (peso, estatura, circunferência abdominal, percentual de gordura corporal, pressão arterial e tabagismo. RESULTADOS: A amostra constitui-se de 65% de homens. A média de peso encontrada foi de 75,39 ± 15,73 kg. O índice de massa corporal médio apresentou-se dentro dos parâmetros de sobrepeso (26,76 ± 4,78 kg/m², sendo 55% dos pacientes com sobrepeso ou obesidade segundo a classificação da OMS/1998. A circunferência abdominal e o percentual de gordura corporal apresentaram-se elevados na maioria dos pacientes (62,5% e 92,5%, respectivamente. Adicionalmente, não houve associação significativa entre IMC e a classificação de antipsicóticos (típicos, atípicos, clozapina. Encontrou-se uma correlação entre o tempo de doença com o percentual de gordura (r = 0,39, p = 0,033 e escolaridade com o peso (r = 0,362, p = 0,046 e IMC (r = 0,372, p = 0,039. Na regressão linear, 13% da variabilidade do percentual de gordura foi explicada pelo tempo de doença (r² = 0,131, B = 0,233, p = 0,049; 13% da variação do peso foi explicada pela escolaridade (r² = 0,131, B = 1,415, p = 0,046 e 13,8% da variação do IMC foi explicada pela escolaridade (r² = 0,138, B = 0,411, p = 0,039. CONCLUSÃO: Os pacientes apresentaram níveis aumentados de circunferência abdominal, percentual de gordura corporal e peso. Aparentemente, o ganho de peso ocorre em todos os pacientes expostos a antipsicóticos, independentemente do tipo de medicação e de resposta clínica, e a qualquer momento ao longo da evolução da doença. Sugere-se que, adicionalmente, a avaliação dos hábitos alimentares e o

  14. Phosphorus As a Simultaneous Electron-Pair Acceptor in Intermolecular P center dot center dot center dot N Pnicogen Bonds and Electron-Pair Donor to Lewis Acids

    Czech Academy of Sciences Publication Activity Database

    Del Bene, J. E.; Alkorta, I.; Sanchez-Sanz, Goar; Elguero, J.

    2013-01-01

    Roč. 117, č. 14 (2013), s. 3133-3141. ISSN 1089-5639 Institutional support: RVO:61388963 Keywords : spin coupling-constants * Gaussian-basis sets * correlated molecular calculations * noncovalent interaction Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.775, year: 2013

  15. Selective induced polarization through electron transfer in acetone and pyrazole ester derivatives via C-H center dot center dot center dot O=C interaction

    Czech Academy of Sciences Publication Activity Database

    Tewari, A. K.; Srivastava, P.; Singh, V. P.; Singh, P.; Kumar, R.; Khanna, R. S.; Srivastava, Pa.; Gnanasekaran, Ramachandran; Hobza, Pavel

    2014-01-01

    Roč. 38, č. 10 (2014), s. 4885-4892. ISSN 1144-0546 R&D Projects: GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : O hydrogen bonds * noncovalent interactions * pi interactions Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.086, year: 2014

  16. Influence of hydrophobic residues on the binding of CB[7] toward diammonium ions of common ammonium center dot center dot center dot ammonium distance

    Czech Academy of Sciences Publication Activity Database

    Cao, L.; Škalamera, D.; Zavalij, P. Y.; Hostaš, Jiří; Hobza, Pavel; Mlinaric-Majerski, K.; Glaser, R.; Isaacs, L.

    2015-01-01

    Roč. 13, č. 22 (2015), s. 6249-6254. ISSN 1477-0520 R&D Projects: GA ČR GBP208/12/G016 Institutional support: RVO:61388963 Keywords : continuous symmetry measures * high-energy water * driving force Subject RIV: CC - Organic Chemistry Impact factor: 3.562, year: 2014

  17. Felodipine-diazabicyclo 2.2.2 octane-water (1/1/1)

    DEFF Research Database (Denmark)

    Solanko, K. A.; Surov, A. O.; Perlovich, G. L.;

    2012-01-01

    The title compound, C18H19Cl2NO4 center dot C6H12N2 center dot H2O, is a cocrystal hydrate containing the active pharmaceutical ingredient felodipine and diazabicyclo[2.2.2]octane (DABCO). The DABCO and water molecules are linked through O-H center dot center dot center dot N hydrogen bonds into...

  18. Semiconductor nanocrystals inside spherical microcavities: A case of quantum dots in photonic dots

    OpenAIRE

    Artemyev, M. V.

    2003-01-01

    Quantum dots in photonic dots, a new type of microstructures involving highly luminescent II-VI semiconductor nanocrystals has been proposed and realized by incorporating nanocrystals (quantum dots) into glass and polymeric microspheres. The high quality micron-size microspheres represent simplest fully three-dimensional microcavities (photonic dots). Coupling of discrete electron states of quantum dots and photon states inside photonic dots strongly affects onto both stationary and dynamic p...

  19. Quantum dots: Rethinking the electronics

    Science.gov (United States)

    Bishnoi, Dimple

    2016-05-01

    In this paper, we demonstrate theoretically that the Quantum dots are quite interesting for the electronics industry. Semiconductor quantum dots (QDs) are nanometer-scale crystals, which have unique photo physical, quantum electrical properties, size-dependent optical properties, There small size means that electrons do not have to travel as far as with larger particles, thus electronic devices can operate faster. Cheaper than modern commercial solar cells while making use of a wider variety of photon energies, including "waste heat" from the sun's energy. Quantum dots can be used in tandem cells, which are multi junction photovoltaic cells or in the intermediate band setup. PbSe (lead selenide) is commonly used in quantum dot solar cells.

  20. DOT Official County Highway Map

    Data.gov (United States)

    Minnesota Department of Natural Resources — The County Highway Map theme is a scanned and rectified version of the original MnDOT County Highway Map Series. The cultural features on some of these maps may be...

  1. Spin pumping through quantum dots

    OpenAIRE

    Rojek, Stephan; Governale, Michele; König, Jürgen

    2013-01-01

    We propose schemes for generating spin currents into a semiconductor by adiabatic or non-adiabatic pumping of electrons through interacting quantum dots. The appeal of such schemes lies in the possibility to tune the pumping characteristics via gate voltages that control the properties of the quantum dot. The calculations are based on a systematic perturbation expansion in the tunnel-coupling strength and the pumping frequency, expressed within a diagrammatic real-time technique. Special focu...

  2. Photonics of shungite quantum dots

    OpenAIRE

    Razbirin, Boris S.; Rozhkova, Natalia N.; Sheka, Elena F.

    2014-01-01

    Shungite quantum dots are associated with nanosize fragments of reduced graphene oxide similarly to synthetic graphene quantum dots thus forming a common class of GQDs. Colloidal dispersions of powdered shungite in water, carbon tetrachloride, and toluene form the ground for the GQD photonic peculiarities manifestation. Morphological study shows a steady trend of GQDs to form fractals and a drastic change in the colloids fractal structure caused by solvent was reliably established. Spectral s...

  3. Quadra-Quantum Dots and Related Patterns of Quantum Dot Molecules: Basic Nanostructures for Quantum Dot Cellular Automata Application

    Directory of Open Access Journals (Sweden)

    Somsak Panyakeow

    2010-10-01

    Full Text Available Laterally close-packed quantum dots (QDs called quantum dot molecules (QDMs are grown by modified molecular beam epitaxy (MBE. Quantum dots could be aligned and cross hatched. Quantum rings (QRs created from quantum dot transformation during thin or partial capping are used as templates for the formations of bi-quantum dot molecules (Bi-QDMs and quantum dot rings (QDRs. Preferable quantum dot nanostructure for quantum computation based on quantum dot cellular automata (QCA is laterally close-packed quantum dot molecules having four quantum dots at the corners of square configuration. These four quantum dot sets are called quadra-quantum dots (QQDs. Aligned quadra-quantum dots with two electron confinements work like a wire for digital information transmission by Coulomb repulsion force, which is fast and consumes little power. Combination of quadra-quantum dots in line and their cross-over works as logic gates and memory bits. Molecular Beam Epitaxial growth technique called 'Droplet Epitaxy' has been developed for several quantum nanostructures such as quantum rings and quantum dot rings. Quantum rings are prepared by using 20 ML In-Ga (15:85 droplets deposited on a GaAs substrate at 390'C with a droplet growth rate of 1ML/s. Arsenic flux (7'8'10-6Torr is then exposed for InGaAs crystallization at 200'C for 5 min. During droplet epitaxy at a high droplet thickness and high temperature, out-diffusion from the centre of droplets occurs under anisotropic strain. This leads to quantum ring structures having non-uniform ring stripes and deep square-shaped nanoholes. Using these peculiar quantum rings as templates, four quantum dots situated at the corners of a square shape are regrown. Two of these four quantum dots are aligned either or, which are preferable crystallographic directions of quantum dot alignment in general.

  4. 76 FR 46597 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A...

    Science.gov (United States)

    2011-08-03

    .... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes... Bombardier, Inc. model-- Task(s)-- Initial compliance time (whichever occurs later)-- CL-600-2A12 (CL-601... icing. accumulation of 4,800 after the effective inclusive; and CL-600-2B16 (CL- total flight hours;...

  5. Fractals of graphene quantum dots in photoluminescence of shungite

    OpenAIRE

    RAZBIRIN B.S.; ROZHKOVA N.N.; Sheka, E. F.; Nelson, D. K.; Starukhin, A. N.; Goryunov, A. S.

    2013-01-01

    Photoluminescence of graphene quantum dots (GQDs) of shungite, attributed to individual fragments of reduced graphene oxide (rGO), has been studied for the frozen rGO colloidal dispersions in water, carbon tetrachloride, and toluene. Morphological study shows a steady trend of GQDs to form fractals and a drastic change in the colloids fractal structure caused by solvent was reliably established. Spectral study reveals a dual character of emitting centers: individual GQDs are responsible for t...

  6. Quantum Mechanics of Semiconductor Quantum Dots and Rings

    OpenAIRE

    I. Filikhin; Matinyan, S. G.; Vlahovic, B.

    2012-01-01

    We consider the several phenomena which are taking place in Quantum Dots (QD) and Quantum Rings (QR): The connection of the Quantum Chaos (QC) with the reflection symmetry of the QD, Disappearance of the QC in the tunnel coupled chaotic QD, electron localization and transition between Double Concentric QR in the transverse magnetic field, transition of electron from QR to the QD located in the center of QR. Basis of this consideration is the effective Schr\\"odinger equation for the correspond...

  7. Scalable Quantum Computing with "Enhancement" Quantum Dots

    CERN Document Server

    Lyanda-Geller, Y B; Yang, M J

    2005-01-01

    We propose a novel scheme of solid state realization of a quantum computer based on single spin "enhancement mode" quantum dots as building blocks. In the enhancement quantum dots, just one electron can be brought into initially empty dot, in contrast to depletion mode dots based on expelling of electrons from multi-electron dots by gates. The quantum computer architectures based on depletion dots are confronted by several challenges making scalability difficult. These challenges can be successfully met by the approach based on ehnancement mode, capable of producing square array of dots with versatile functionalities. These functionalities allow transportation of qubits, including teleportation, and error correction based on straightforward one- and two-qubit operations. We describe physical properties and demonstrate experimental characteristics of enhancement quantum dots and single-electron transistors based on InAs/GaSb composite quantum wells. We discuss the materials aspects of quantum dot quantum compu...

  8. A hydrochemical investigation using 36Cl/Cl in groundwaters

    OpenAIRE

    Metcalfe, R.

    2003-01-01

    This report describes 36Cl studies which were undertaken during the H14 financial year. 6 groundwater samples were collected for 36Cl analysis. The results of this study suggest that 36Cl data could potentially be useful for interpreting groundwater origins and flow paths.

  9. Concerted evolution of the tandemly repeated genes encoding primate U2 small nuclear RNA (the RNU2 locus) does not prevent rapid diversification of the (CT){sub n} {center_dot} (GA){sub n} microsatellite embedded within the U2 repeat unit

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.; Weiner, A.M. [Yale Univ., New Haven, CT (United States)

    1995-12-10

    The RNU2 locus encoding human U2 small nuclear RNA (snRNA) is organized as a nearly perfect tandem array containing 5 to 22 copies of a 5.8-kb repeat unit. Just downstream of the U2 snRNA gene in each 5.8-kb repeat unit lies a large (CT){sub n}{center_dot}(GA){sub n} dinucleotide repeat (n {approx} 70). This form of genomic organization, in which one repeat is embedded within another, provides an unusual opportunity to study the balance of forces maintaining the homogeneity of both kinds of repeats. Using a combination of field inversion gel electrophoresis and polymerase chain reaction, we have been able to study the CT microsatellites within individual U2 tandem arrays. We find that the CT microsatellites within an RNU2 allele exhibit significant length polymorphism, despite the remarkable homogeneity of the surrounding U2 repeat units. Length polymorphism is due primarily to loss or gain of CT dinucleotide repeats, but other types of deletions, insertions, and substitutions are also frequent. Polymorphism is greatly reduced in regions where pure (CT){sub n} tracts are interrupted by occasional G residues, suggesting that irregularities stabilize both the length and the sequence of the dinucleotide repeat. We further show that the RNU2 loci of other catarrhine primates (gorilla, chimpanzee, ogangutan, and baboon) contain orthologous CT microsatellites; these also exhibit length polymorphism, but are highly divergent from each other. Thus, although the CT microsatellite is evolving far more rapidly than the rest of the U2 repeat unit, it has persisted through multiple speciation events spanning >35 Myr. The persistence of the CT microsatellite, despite polymorphism and rapid evolution, suggests that it might play a functional role in concerted evolution of the RNU2 loci, perhaps as an initiation site for recombination and/or gene conversion. 70 refs., 5 figs.

  10. Influence of calcium on transport properties, band spectrum and superconductivity of YBa{sub 2}Cu{sub 3}O{sub y} and YBa{sub 1.5}La{sub 0.5}Cu{sub 3}O{sub y}{sup {center_dot}}

    Energy Technology Data Exchange (ETDEWEB)

    Gasumyants, V.E.; Vladimirskaya, E.V. [State Technical Univ., St. Petersburg (Russian Federation); Patrina, I.B. [Institute of Silicate Chemistry, St. Petersburg (Russian Federation)

    1994-12-31

    The comparative investigation of transport phenomena in Y{sub 1-x}Ca{sub x}Ba{sub 2}Cu{sub 3}O{sub y} (0y>6.87 and 6.73y>6.96) and YBa{sub 2-x}La{sub x}Cu{sub 3}O{sub y} (0center_dot}}. The results obtained suggest that Ca gives rise to some peculiarities in band spectrum of this compound.

  11. Fuzzy dot ideals and fuzzy dot H-ideals of BCH-algebras

    Institute of Scientific and Technical Information of China (English)

    PENG Jia-yin

    2008-01-01

    The notions of fuzzy dot ideals and fuzzy dot H-ideals in BCH-algebras are intro duced,several appropriate examples are provided,and their some properties are investigated.The relations among fuzzy ideal,fuzzy H-ideal,fuzzy dot ideal and fuzzy dot H-ideals in BCH algebras are discussed,several equivalent depictions of fuzzy dot ideal are obtained. How to deal with the homomorphic image and inverse image of fuzzy dot ideals (fuzzy dot H-ideals) are studied. The relations between a fuzzy dot ideal (fuzzy dot H-ideal) in BCH-algebras and a fuzzy dot ideal (fuzzy dot H-ideal) in the product algebra of BCH-algebras are given.

  12. Translocation of PEGylated quantum dots across rat alveolar epithelial cell monolayers

    Directory of Open Access Journals (Sweden)

    Fazlollahi F

    2011-11-01

    Full Text Available Farnoosh Fazlollahi1,8, Arnold Sipos1,2, Yong Ho Kim1,2, Sarah F Hamm-Alvarez6, Zea Borok1–3, Kwang-Jin Kim1,2,5–7, Edward D Crandall1,2,4,8 1Will Rogers Institute Pulmonary Research Center, 2Department of Medicine, 3Department of Biochemistry and Molecular Biology, 4Department of Pathology, 5Department of Physiology and Biophysics, 6Department of Pharmacology and Pharmaceutical Sciences, 7Department of Biomedical Engineering, 8Mork Family Department of Chemical Engineering and Materials Science, University of Southern California, Los Angeles, CA, USA Background: In this study, primary rat alveolar epithelial cell monolayers (RAECM were used to investigate transalveolar epithelial quantum dot trafficking rates and underlying transport mechanisms. Methods: Trafficking rates of quantum dots (PEGylated CdSe/ZnS, core size 5.3 nm, hydrodynamic size 25 nm in the apical-to-basolateral direction across RAECM were determined. Changes in bioelectric properties (ie, transmonolayer resistance and equivalent active ion transport rate of RAECM in the presence or absence of quantum dots were measured. Involvement of endocytic pathways in quantum dot trafficking across RAECM was assessed using specific inhibitors (eg, methyl-ß-cyclodextrin, chlorpromazine, and dynasore for caveolin-, clathrin-, and dynamin-mediated endocytosis, respectively. The effects of lowering tight junctional resistance on quantum dot trafficking were determined by depleting Ca2+ in apical and basolateral bathing fluids of RAECM using 2 mM EGTA. Effects of temperature on quantum dot trafficking were studied by lowering temperature from 37°C to 4°C. Results: Apical exposure of RAECM to quantum dots did not elicit changes in transmonolayer resistance or ion transport rate for up to 24 hours; quantum dot trafficking rates were not surface charge-dependent; methyl-ß-cyclodextrin, chlorpromazine, and dynasore did not decrease quantum dot trafficking rates; lowering of temperature

  13. Biosensing with Luminescent Semiconductor Quantum Dots

    Directory of Open Access Journals (Sweden)

    Hedi Mattoussi

    2006-08-01

    Full Text Available Luminescent semiconductor nanocrystals or quantum dots (QDs are a recentlydeveloped class of nanomaterial whose unique photophysical properties are helping tocreate a new generation of robust fluorescent biosensors. QD properties of interest forbiosensing include high quantum yields, broad absorption spectra coupled to narrow sizetunablephotoluminescent emissions and exceptional resistance to both photobleaching andchemical degradation. In this review, we examine the progress in adapting QDs for severalpredominantly in vitro biosensing applications including use in immunoassays, asgeneralized probes, in nucleic acid detection and fluorescence resonance energy transfer(FRET - based sensing. We also describe several important considerations when workingwith QDs mainly centered on the choice of material(s and appropriate strategies forattaching biomolecules to the QDs.

  14. Behavior under gamma irradiation of single crystals of NaCl doped with divalent cations

    International Nuclear Information System (INIS)

    Thermally stimulated luminescence and optical absorption measurements were performed on NaCl single crystals, both single and double doped. The NaCl single crystals were exposed to gamma rays from a 60Co source at both low and room temperatures. The radiation-induced defects were mainly F and H centers, and the absorption bands for the F centers were centered at 464 nm. Bleaching with F-light showed the participation of the F center generated by gamma radiation on the TL phenomenon. The results suggest that NaCl single crystals, both single and double doped can be used as dosimeters, within certain doses. (author)

  15. A novel chemiluminescence method for determination of bisphenol Abased on the carbon dot-enhanced HCO3−–H2O2 system

    International Nuclear Information System (INIS)

    A simple and sensitive chemiluminescence (CL) method on the basis of carbon dot (C-dot) enhanced HCO3−–H2O2 system, is designed for the determination of bisphenol A (BPA). The very weak CL of the HCO3−–H2O2 system is enhanced by a factor of ∼100 in the presence of C-dots. Possible mechanisms that lead to the effect were elucidated by recording fluorescence and CL spectra and studying the effect of some radical scavengers. This enhancement is inhibited by BPA in the concentration range from 1.0 to 100 µg L−1. This is exploited for its trace determination with a detection limit (3 s) of 0.3 µg L−1. The established method was applied to the determination of BPA in baby bottle and water samples with satisfactory results. - Highlights: • The effect of carbon dots on HCO3−–H2O2 chemiluminescence reaction is studied. • Carbon dots greatly enhance the CL signal of this reaction (∼100 fold). • The new CL system was applied to determination of bisphenol A in real samples

  16. Constitutional Isomerism of BiW6Cl15: (BiCl)[W6Cl14] and (BiCl2)[W6Cl13

    OpenAIRE

    Meyer, Hans-Juergen

    2009-01-01

    Abstract The compound (BiCl)[W6Cl14] was previously characterized as a product of the reduction of tungsten hexachloride with elemental bismuth. Another modification of BiW6Cl15 is now presented as (BiCl2)[W6Cl13], based on the results of an X-ray single crystal structure determination (space group P21/c, a = 1354.3(2) pm, b = 1234.4(2) pm, c = 1538.9(2) pm, and ? = 118.76(1) ?). The structure of (BiCl2)[W6Cl13] contains chains of [(W6Cl8i)Cl4aCl2/2a-a]- clusters bridged by chlorin...

  17. Resonant electronic transport through a triple quantum-dot with Λ-type level structure under dual radiation fields

    International Nuclear Information System (INIS)

    Due to quantum interference, light can transmit through dense atomic media, a phenomenon known as electromagnetically induced transparency (EIT). We propose that EIT is not limited to light transmission and there is an electronic analog where resonant transparency in charge transport in an opaque structure can be induced by electromagnetic radiation. A triple-quantum-dots system with Λ-type level structure is generally opaque due to the level in the center dot being significantly higher and therefore hopping from the left dot to the center dot is almost forbidden. We demonstrate that an electromagnetically induced electron transparency (EIET) in charge of transport can indeed occur in the Λ-type system. The direct evidence of EIET is that an electron can travel from the left dot to the right dot, while the center dot apparently becomes invisible. We analyze EIET and the related shot noise in both the zero and strong Coulomb blockade regimes. It is found that the EIET (position, height, and symmetry) can be tuned by several controllable parameters of the radiation fields, such as the Rabi frequencies and detuning frequencies. The result offers a transparency/opaque tuning technique in charge transport using interfering radiation fields

  18. Optical Fiber Sensing Using Quantum Dots

    OpenAIRE

    Faramarz Farahi; José Luís Santos; Tito Trindade; Manuel António Martins; Pedro Jorge

    2007-01-01

    Recent advances in the application of semiconductor nanocrystals, or quantum dots, as biochemical sensors are reviewed. Quantum dots have unique optical properties that make them promising alternatives to traditional dyes in many luminescence based bioanalytical techniques. An overview of the more relevant progresses in the application of quantum dots as biochemical probes is addressed. Special focus will be given to configurations where the sensing dots are incorporated in sol...

  19. Quantum dot field effect transistors

    Directory of Open Access Journals (Sweden)

    Frederik Hetsch

    2013-09-01

    Full Text Available Solution processed colloidal semiconductor quantum dots offer a high potential for decreasing costs and expanding versatility of many electronic and optoelectronic devices. Initially used as a research tool to study charge carrier mobilities in closely packed quantum dot thin films, field effect transistors with quantum dots as the active layer have recently experienced a breakthrough in performance (achievement of mobilities higher than 30 cm2 V−1 s−1 as a result of a proper choice of surface ligands and/or improved chemical treatment of the nanoparticle films during device processing. Here we review these innovative developments and the continuing work that may soon lead to commercial grade electronic components.

  20. Fabrication and single-electron-transfer operation of a triple-dot single-electron transistor

    International Nuclear Information System (INIS)

    A triple-dot single-electron transistor was fabricated on silicon-on-insulator wafer using pattern-dependent oxidation. A specially designed one-dimensional silicon wire having small constrictions at both ends was converted to a triple-dot single-electron transistor by means of pattern-dependent oxidation. The fabrication of the center dot involved quantum size effects and stress-induced band gap reduction, whereas that of the two side dots involved thickness modulation because of the complex edge structure of two-dimensional silicon. Single-electron turnstile operation was confirmed at 8 K when a 100-mV, 1-MHz square wave was applied. Monte Carlo simulations indicated that such a device with inhomogeneous tunnel and gate capacitances can exhibit single-electron transfer

  1. Photolithography enhancement by incorporating photoluminescent nanoscale cesium iodide molecular dots into the photoresists

    International Nuclear Information System (INIS)

    This work demonstrated an enhancement effect of photolithograph by the incorporation of photoluminescent nanoscale cesium iodide molecular dots into ultraviolet photoresists. Cesium iodide molecular dots with the size of about 0.4 nm acted as centers of ultraviolet absorption and luminescence which enabled the improvement of the morphology of the figure edges and photosensitivity of photoresist pattern. These photoluminescent molecular dots decreased the light interference while increasing the resist sensitization of the photoresist. The detailed mechanism about the enhancement effects of photoluminescent molecular dots incorporated into photoresists on the ultraviolet absorption, photosensitivity, and light interference has been proposed. This increased effect in the enhancement of photoresists makes way for their potential use for future nanoscale photolithography

  2. Fabrication and single-electron-transfer operation of a triple-dot single-electron transistor

    Energy Technology Data Exchange (ETDEWEB)

    Jo, Mingyu, E-mail: mingyujo@eis.hokudai.ac.jp; Uchida, Takafumi; Tsurumaki-Fukuchi, Atsushi; Arita, Masashi; Takahashi, Yasuo [Graduate School of Information Science and Technology, Hokkaido University, Sapporo 060-0814 (Japan); Fujiwara, Akira; Nishiguchi, Katsuhiko [NTT Basic Research Laboratories, NTT Corporation, 3-1 Morinosato Wakamiya, Atsugi 243-0198 (Japan); Ono, Yukinori [Graduate School of Science and Engineering, University of Toyama, 3190 Gofuku, Toyama 930-8555 (Japan); Inokawa, Hiroshi [Research Institute of Electronics, Shizuoka University, 3-5-1, Johoku, Hamamatsu 432-8011 (Japan)

    2015-12-07

    A triple-dot single-electron transistor was fabricated on silicon-on-insulator wafer using pattern-dependent oxidation. A specially designed one-dimensional silicon wire having small constrictions at both ends was converted to a triple-dot single-electron transistor by means of pattern-dependent oxidation. The fabrication of the center dot involved quantum size effects and stress-induced band gap reduction, whereas that of the two side dots involved thickness modulation because of the complex edge structure of two-dimensional silicon. Single-electron turnstile operation was confirmed at 8 K when a 100-mV, 1-MHz square wave was applied. Monte Carlo simulations indicated that such a device with inhomogeneous tunnel and gate capacitances can exhibit single-electron transfer.

  3. Production of three-dimensional quantum dot lattice of Ge/Si core–shell quantum dots and Si/Ge layers in an alumina glass matrix

    International Nuclear Information System (INIS)

    We report on the formation of Ge/Si quantum dots with core/shell structure that are arranged in a three-dimensional body centered tetragonal quantum dot lattice in an amorphous alumina matrix. The material is prepared by magnetron sputtering deposition of Al2O3/Ge/Si multilayer. The inversion of Ge and Si in the deposition sequence results in the formation of thin Si/Ge layers instead of the dots. Both materials show an atomically sharp interface between the Ge and Si parts of the dots and layers. They have an amorphous internal structure that can be crystallized by an annealing treatment. The light absorption properties of these complex materials are significantly different compared to films that form quantum dot lattices of the pure Ge, Si or a solid solution of GeSi. They show a strong narrow absorption peak that characterizes a type II confinement in accordance with theoretical predictions. The prepared materials are promising for application in quantum dot solar cells. (paper)

  4. Beer's law in semiconductor quantum dots

    CERN Document Server

    Adamashvili, G T

    2010-01-01

    The propagation of a coherent optical linear wave in an ensemble of semiconductor quantum dots is considered. It is shown that a distribution of transition dipole moments of the quantum dots changes significantly the polarization and Beer's absorption length of the ensemble of quantum dots. Explicit analytical expressions for these quantities are presented.

  5. Quantum-dot emitters in photonic nanostructures

    DEFF Research Database (Denmark)

    Hvam, Jørn Märcher; Stobbe, Søren; Lodahl, Peter

    2010-01-01

    The spontaneous emission from self-assembled semiconductor quantum dots is strongly influenced by the environment in which they are placed. This can be used to determine fundamental optical properties of the quantum dots as well as to manipulate and control the quantum-dot emission itself....

  6. Chaos and Interactions in Quantum Dots

    OpenAIRE

    Alhassid, Y.

    2001-01-01

    Quantum dots are small conducting devices containing up to several thousand electrons. We focus here on closed dots whose single-electron dynamics are mostly chaotic. The mesoscopic fluctuations of the conduction properties of such dots reveal the effects of one-body chaos, quantum coherence and electron-electron interactions.

  7. A colloidal quantum dot spectrometer

    Science.gov (United States)

    Bao, Jie; Bawendi, Moungi G.

    2015-07-01

    Spectroscopy is carried out in almost every field of science, whenever light interacts with matter. Although sophisticated instruments with impressive performance characteristics are available, much effort continues to be invested in the development of miniaturized, cheap and easy-to-use systems. Current microspectrometer designs mostly use interference filters and interferometric optics that limit their photon efficiency, resolution and spectral range. Here we show that many of these limitations can be overcome by replacing interferometric optics with a two-dimensional absorptive filter array composed of colloidal quantum dots. Instead of measuring different bands of a spectrum individually after introducing temporal or spatial separations with gratings or interference-based narrowband filters, a colloidal quantum dot spectrometer measures a light spectrum based on the wavelength multiplexing principle: multiple spectral bands are encoded and detected simultaneously with one filter and one detector, respectively, with the array format allowing the process to be efficiently repeated many times using different filters with different encoding so that sufficient information is obtained to enable computational reconstruction of the target spectrum. We illustrate the performance of such a quantum dot microspectrometer, made from 195 different types of quantum dots with absorption features that cover a spectral range of 300 nanometres, by measuring shifts in spectral peak positions as small as one nanometre. Given this performance, demonstrable avenues for further improvement, the ease with which quantum dots can be processed and integrated, and their numerous finely tuneable bandgaps that cover a broad spectral range, we expect that quantum dot microspectrometers will be useful in applications where minimizing size, weight, cost and complexity of the spectrometer are critical.

  8. CL2QCD - Lattice QCD based on OpenCL

    CERN Document Server

    Philipsen, Owe; Sciarra, Alessandro; Bach, Matthias

    2014-01-01

    We present the Lattice QCD application CL2QCD, which is based on OpenCL and can be utilized to run on Graphic Processing Units as well as on common CPUs. We focus on implementation details as well as performance results of selected features. CL2QCD has been successfully applied in LQCD studies at finite temperature and density and is available at http://code.compeng.uni-frankfurt.de/projects/clhmc.

  9. High 36Cl/Cl ratios in Chernobyl groundwater

    International Nuclear Information System (INIS)

    After the explosion of the Chernobyl Nuclear Power Plant in April 1986, contaminated material was buried in shallow trenches within the exclusion zone. A 90Sr plume was evidenced downgradient of one of these trenches, trench T22. Due to its conservative properties, 36Cl is investigated here as a potential tracer to determine the maximal extent of the contamination plume from the trench in groundwater. 36Cl/Cl ratios measured in groundwater, trench soil water and leaf leachates are 1–5 orders of magnitude higher than the theoretical natural 36Cl/Cl ratio. This contamination occurred after the Chernobyl explosion and currently persists. Trench T22 acts as an obvious modern point source of 36Cl, however other sources have to be involved to explain such contamination. 36Cl contamination of groundwater can be explained by dilution of trench soil water by uncontaminated water (rainwater or deep groundwater). With a plume extending further than that of 90Sr, radionuclide which is impacted by retention and decay processes, 36Cl can be considered as a suitable tracer of contamination from the trench in groundwater provided that modern release processes of 36Cl from trench soil are better characterized. - Highlights: • High 36Cl/Cl ratios measured in the Chernobyl Pilot Site groundwater. • Trench T22 acts as a modern source of groundwater contamination by 36Cl but other sources are involved. • Contamination results from dilution of a contaminated “T22” soil water with rainwater. • Processes involved in the modern release need to be investigated

  10. 75 FR 63054 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-10-14

    ... published in the Federal Register on January 5, 2010 (75 FR 258). That NPRM proposed to correct an unsafe...'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes AGENCY: Federal Aviation Administration...

  11. 76 FR 8605 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 and 440...

    Science.gov (United States)

    2011-02-15

    ... Register on November 15, 2010 (75 FR 69609). That NPRM proposed to correct an unsafe condition for the...'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have.... Model CL-600-2B19 (Regional Jet Series 100 and 440) Airplanes AGENCY: Federal Aviation...

  12. 75 FR 31324 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-06-03

    ... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes AGENCY: Federal Aviation Administration (FAA..., dated May 7, 2008, to Appendix A--Certification Maintenance Requirements of Part 2 of the Bombardier...

  13. 75 FR 64636 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2010-10-20

    ... 12866; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes AGENCY: Federal Aviation Administration (FAA... of on-ground hydraulic accumulator screw cap/end cap failure have been experienced on...

  14. 76 FR 18024 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B19 (Regional Jet Series 100 & 440...

    Science.gov (United States)

    2011-04-01

    ... (75 FR 25788). That NPRM proposed to correct an unsafe condition for the specified products. The MCAI... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3.... Model CL-600-2B19 (Regional Jet Series 100 & 440) Airplanes AGENCY: Federal Aviation Administration...

  15. A novel silica-coated multiwall carbon nanotube with CdTe quantum dots nanocomposite

    Science.gov (United States)

    Fei, Qiang; Xiao, Dehai; Zhang, Zhiquan; Huan, Yanfu; Feng, Guodong

    2009-10-01

    A novel silica-coated multiwall carbon nanotube (MWNTs) with CdTe quantum dots nanocomposite was synthesized in this paper. Here, we show the in situ growth of crystalline CdTe quantum dots on the surfaces of oxidized MWNTs. The approach proposed herein differs from previous attempts to synthesize nanotube assemblies in that we mix the oxidized MWNTs into CdCl 2 solution of CdTe nanocrystals synthesized in aqueous solution. Reinforced the QD-MWNTs heterostructures with silica coating, this method is not invasive and does not introduce defects to the structure of carbon nanotubes (CNTs), and it ensures high stability in a range of organic solvents. Furthermore, a narrow SiO 2 layer on the MWNT-CdTe heterostructures can eliminate the biological toxicity of quantum dots and carbon nanotubes. This is not only a breakthrough in the synthesis of one-dimensional nanostructures, but also taking new elements into bio-nanotechnology.

  16. High (36)Cl/Cl ratios in Chernobyl groundwater.

    Science.gov (United States)

    Roux, Céline; Le Gal La Salle, Corinne; Simonucci, Caroline; Van Meir, Nathalie; Fifield, L Keith; Diez, Olivier; Bassot, Sylvain; Simler, Roland; Bugai, Dmitri; Kashparov, Valery; Lancelot, Joël

    2014-12-01

    After the explosion of the Chernobyl Nuclear Power Plant in April 1986, contaminated material was buried in shallow trenches within the exclusion zone. A (90)Sr plume was evidenced downgradient of one of these trenches, trench T22. Due to its conservative properties, (36)Cl is investigated here as a potential tracer to determine the maximal extent of the contamination plume from the trench in groundwater. (36)Cl/Cl ratios measured in groundwater, trench soil water and leaf leachates are 1-5 orders of magnitude higher than the theoretical natural (36)Cl/Cl ratio. This contamination occurred after the Chernobyl explosion and currently persists. Trench T22 acts as an obvious modern point source of (36)Cl, however other sources have to be involved to explain such contamination. (36)Cl contamination of groundwater can be explained by dilution of trench soil water by uncontaminated water (rainwater or deep groundwater). With a plume extending further than that of (90)Sr, radionuclide which is impacted by retention and decay processes, (36)Cl can be considered as a suitable tracer of contamination from the trench in groundwater provided that modern release processes of (36)Cl from trench soil are better characterized. PMID:25128774

  17. 75 FR 30740 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-604 Variants (Including CL-605...

    Science.gov (United States)

    2010-06-02

    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or... Directives; Bombardier, Inc. Model CL-600-2B16 (CL- 604 Variants (Including CL-605 Marketing Variant... addition to Bombardier Inc. Models CL-600-2B19, CL-600-2C10 and CL-600-2D24. The latter three models...

  18. Spin storage in quantum dot ensembles and single quantum dots

    International Nuclear Information System (INIS)

    This thesis deals with the investigation of spin relaxation of electrons and holes in small ensembles of self-assembled quantum dots using optical techniques. Furthermore, a method to detect the spin orientation in a single quantum dot was developed in the framework of this thesis. A spin storage device was used to optically generate oriented electron spins in small frequency selected quantum dot ensembles using circularly polarized optical excitation. The spin orientation can be determined by the polarization of the time delayed electroluminescence signal generated by the device after a continuously variable storage time. The degree of spin polarized initialization was found to be limited to 0.6 at high magnetic fields, where anisotropic effects are compensated. The spin relaxation was directly measured as a function of magnetic field, lattice temperature and s-shell transition energy of the quantum dot by varying the spin storage time up to 30 ms. Very long spin lifetimes are obtained with a lower limit of T1=20 ms at B=4 T and T=1 K. A strong magnetic field dependence T1∝B-5 has been observed for low temperatures of T=1 K which weakens as the temperature is increased. In addition, the temperature dependence has been determined with T1∝T-1. The characteristic dependencies on magnetic field and temperature lead to the identification of the spin relaxation mechanism, which is governed by spin-orbit coupling and mediated by single phonon scattering. This finding is qualitatively supported by the energy dependent measurements. The investigations were extended to a modified device design that enabled studying the spin relaxation dynamics of heavy holes in self-assembled quantum dots. The measurements show a polarization memory effect for holes with up to 0.1 degree of polarization. Furthermore, investigations of the time dynamics of the hole spin relaxation reveal surprisingly long lifetimes T1h in the microsecond range, therefore, comparable with electron spin

  19. Spin storage in quantum dot ensembles and single quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Heiss, Dominik

    2009-10-15

    This thesis deals with the investigation of spin relaxation of electrons and holes in small ensembles of self-assembled quantum dots using optical techniques. Furthermore, a method to detect the spin orientation in a single quantum dot was developed in the framework of this thesis. A spin storage device was used to optically generate oriented electron spins in small frequency selected quantum dot ensembles using circularly polarized optical excitation. The spin orientation can be determined by the polarization of the time delayed electroluminescence signal generated by the device after a continuously variable storage time. The degree of spin polarized initialization was found to be limited to 0.6 at high magnetic fields, where anisotropic effects are compensated. The spin relaxation was directly measured as a function of magnetic field, lattice temperature and s-shell transition energy of the quantum dot by varying the spin storage time up to 30 ms. Very long spin lifetimes are obtained with a lower limit of T{sub 1}=20 ms at B=4 T and T=1 K. A strong magnetic field dependence T{sub 1}{proportional_to}B{sup -5} has been observed for low temperatures of T=1 K which weakens as the temperature is increased. In addition, the temperature dependence has been determined with T{sub 1}{proportional_to}T{sup -1}. The characteristic dependencies on magnetic field and temperature lead to the identification of the spin relaxation mechanism, which is governed by spin-orbit coupling and mediated by single phonon scattering. This finding is qualitatively supported by the energy dependent measurements. The investigations were extended to a modified device design that enabled studying the spin relaxation dynamics of heavy holes in self-assembled quantum dots. The measurements show a polarization memory effect for holes with up to 0.1 degree of polarization. Furthermore, investigations of the time dynamics of the hole spin relaxation reveal surprisingly long lifetimes T{sub 1}{sup h

  20. Marketing na clínica : High Care Center

    OpenAIRE

    Mariz, Leandro Ferreira.

    2011-01-01

    O desenvolvimento do presente trabalho tem como finalidade descrever todas as actividades realizadas durante o período de estágio, numa empresa inserida no sector de serviços, mais concretamente no mercado de saúde e estética. Desta forma, a revisão de literatura teve como foco principal o contexto de Marketing de Serviços e Marketing Relacional, com o objectivo primário de entender as especificidades associadas aos serviços, a forma como se produz e as técnicas para avaliação desse mesmo ser...

  1. Strong enhancement of the chemiluminescence of the cerium(IV)-thiosulfate reaction by carbon dots, and its application to the sensitive determination of dopamine

    International Nuclear Information System (INIS)

    We show that the very weak chemiluminescence (CL) of the Ce(IV)-thiosulfate system is enhanced by a factor of ∼150 in the presence of fluorescent carbon dots (C-dots). The C-dots were prepared by a solvothermal method and characterized by fluorescence spectra and transmission electron microscopy. Possible mechanisms that lead to the effect were elucidated by recording fluorescence and CL spectra. It is found that dopamine at even nanomolar levels exerts a diminishing effect on the enhancement of CL. This was exploited to design a method for the determination of dopamine in the concentration range from 2.5 nM to 20 μM, with a limit of detection (at 3 s) of 1.0 nM. Dopamine was determined by this method in spiked human plasma samples with satisfactory results. (author)

  2. 76 FR 477 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A...

    Science.gov (United States)

    2011-01-05

    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY... applicability of the directive for CL-600-2A12 aircraft, serial numbers 3001 through 3066, and for CL-...

  3. 76 FR 66203 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604...

    Science.gov (United States)

    2011-10-26

    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY: Federal Aviation... Bombardier, Inc. Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) airplanes, certificated...

  4. Enhanced chemiluminescence CdSe quantum dots by histidine and tryptophan

    Science.gov (United States)

    Hosseini, Morteza; Ganjali, Mohammad Reza; Jarrahi, Afsaneh; Vaezi, Zahra; Mizani, Farhang; Faridbod, Farnoush

    2014-11-01

    The enhancing effect of histidine and tryptophan on chemiluminescence (CL) of CdSe quantum dots (QDs)-H2O2 system was studied. This reaction is based on the catalytic effect of amino acids, causing a significant increase in the light emission, as a result of the reaction of quantum dots (QDs) with hydrogen peroxide. In the optimum conditions, this method was satisfactorily described by linear calibration curve in the range of 0.66-35.5 μM and 0.83-35.1 μM for histidine and tryptophan, respectively. The effect of various parameters such as concentration of CdSe QDs, concentration of H2O2 and concentration of imidazole on the intensity of CL system were studied. The main experimental advantage of the proposed method is it's selective to two amino acids compared with other amino acids.

  5. 76 FR 6536 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10 (CL-215), CL-215-6B11 (CL-215T...

    Science.gov (United States)

    2011-02-07

    ... products. That NPRM was published in the Federal Register on November 9, 2010 (75 FR 68728). That NPRM... Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant.... Model CL-215-1A10 (CL- 215), CL-215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant)...

  6. Perfil clínico-epidemiológico dos pacientes diagnosticados com hanseníase em um centro de referência na região nordeste do Brasil Clinical and epidemiological profile of patients diagnosed with leprosy in a reference center in the notheast of Brazil

    Directory of Open Access Journals (Sweden)

    Cícero Cláudio Dias Gomes

    2005-12-01

    Full Text Available FUNDAMENTOS: A hanseníase permanece sério problema de saúde pública mundial. O conhecimento das características epidemiológicas da doença é importante ferramenta para o controle da endemia. OBJETIVO: Descrever as características clínicas e epidemiológicas dos pacientes diagnosticados com hanseníase no ano de 2004 em um centro de referência da Região Nordeste do Brasil. MÉTODO: Foram avaliados prontuários de pacientes que deram entrada no registro ativo do Centro de Dermatologia Dona Libânia, em Fortaleza, Ceará, no período de janeiro a dezembro de 2004. RESULTADOS: dos 967 casos que deram entrada nesse Centro naquele ano, 909 foram casos novos. Cerca de 7,7% eram pacientes entre zero e 14 anos de idade, e a distribuição por gênero foi de 483 (49,95% homens e 484 (50,05% mulheres. A maioria apresentava a forma clínica dimorfa (54,6%, sendo 82,2% dos pacientes provenientes de Fortaleza, CE. Foi realizada a avaliação do grau de incapacidades no diagnóstico em 94,2% dos pacientes, com 21,7% apresentando grau diferente de zero no diagnóstico. CONCLUSÃO: Com base nos resultados obtidos, constatou-se a presença de elevado percentual (7,7% de casos detectados em menores de 15 anos, associado a baixo percentual (5,8% de pacientes diagnosticados na forma indeterminada e elevado percentual (21,7% de casos com incapacidade ao diagnóstico.BACKGROUND: Leprosy continues to represent a serious public health problem worldwide. Knowledge of epidemiological characteristics of the disease is an important tool for the endemy control. OBJECTIVES: To describe the clinical and epidemiological characteristics of patients diagnosed with leprosy during 2004, in a Reference Center in the Northeast of Brazil. METHODS: We analyzed the records referring to patients who entered de active register of the Center of Dermatology Dona Libânia, in Fortaleza, Ceará, from January to december 2004. RESULTS: Out of 967 cases that entered this Center in

  7. Luminescent Surface Quaternized Carbon Dots

    KAUST Repository

    Bourlinos, Athanasios B.

    2012-01-10

    Thermal oxidation of a salt precursor made from the acid base combination of tris(hydroxymethyl)aminomethane and betaine hydrochloride results in light-emitting surface quaternized carbon dots that are water-dispersible, display anion exchange properties, and exhibit uniform size/surface charge. © 2011 American Chemical Society.

  8. On triaxial ellipsoidal quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Voon, L C Lew Yan; Willatzen, M [Mads Clausen Institute, University of Southern Denmark, Grundtvigs Alle 150, DK-6400 Soenderborg (Denmark)

    2004-02-25

    The bound-state problem for triaxial ellipsoidal infinite-barrier quantum dots has been solved. It is exactly solvable in terms of ellipsoidal coordinates and the eigenmodes are written in terms of Lame wavefunctions. The need for all eight types of functions is shown. This presents a generalization over previous work on spheres and spheroids. Splitting of degeneracy and level crossing are obtained.

  9. DOT strategies versus orbiter strategies

    NARCIS (Netherlands)

    Rutten, R.J.

    2001-01-01

    The Dutch Open Telescope is a high-resolution solar imager coming on-line at La Palma. The definition of the DOT science niche, strategies, and requirements resemble Solar Orbiter considerations and deliberations. I discuss the latter in the light of the former, and claim that multi-line observation

  10. Quantum dot photonic crystal lasers

    OpenAIRE

    Yoshie, T.; Shchekin, O. B.; Chen, H.; Deppe, D. G.; Scherer, A.

    2002-01-01

    Coupled cavity designs on two-dimensional square lattice photonic crystal slabs were used to demonstrate optically pumped indium arsenide quantum dot photonic crystal lasers at room temperature. Threshold pump powers of 120 and 370 μW were observed for coupled cavities including two and four defect cavities defined in optimised photonic crystals.

  11. Hyperdense dots mimicking microcalcifications : Mammographic findings

    International Nuclear Information System (INIS)

    To differentiate fine hyperdense dots mimicking microcalcifications from true microcalcifications on mammography. Mammograms showing hyperdense dots in ten patients (mean age, 59 years) were evaluated. Two radiologists were asked to differentiate with the naked eye the hyperdense dots seen on ten mammograms and proven microcalcifications seen on ten mammograms. Densitometry was also performed for all lesions and the contrast index was calculated. The shape and distribution of the hyperdense dots were evaluated and enquires were made regarding any history of breast disease and corresponding treatment. Biopsies were performed for two patients with hyperdense dots. Two radiologists made correct diagnoses in 19/20 cases(95%). The contrast index was 0.10-0.88 (mean 0.58) for hyperdense dots and 0.02-0.45 (mean 0.17) for true microcalcifications. The hyperdense dots were finer and homogeneously rounder than the microcalcifications. Distribution of the hyperdense dots was more superficial in subcutaneous fat (seven cases) and subareolar area (six cases). All ten patients with hyperdense dots had history of mastitis and abscesses and had been treated by open drainage (six cases) and/or folk remedy (four cases). In eight patients, herb patches had been attached. Biopsies of hyperdense dots did not show any microcalcification or evidence of malignancy. These hyperdense dots were seen mainly in older patients. Their characteristic density, shape, distribution and clinical history makes differential diagnosis from true microcalcifications easy and could reduce unnecessary diagnostic procedures such as surgical biopsy

  12. Hyperdense dots mimicking microcalcifications : Mammographic findings

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Nam Hyeon; Park, Jeong Mi; Goo, Hyun Woo; Bang, Sun Woo [Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea, Republic of)

    1996-12-01

    To differentiate fine hyperdense dots mimicking microcalcifications from true microcalcifications on mammography. Mammograms showing hyperdense dots in ten patients (mean age, 59 years) were evaluated. Two radiologists were asked to differentiate with the naked eye the hyperdense dots seen on ten mammograms and proven microcalcifications seen on ten mammograms. Densitometry was also performed for all lesions and the contrast index was calculated. The shape and distribution of the hyperdense dots were evaluated and enquires were made regarding any history of breast disease and corresponding treatment. Biopsies were performed for two patients with hyperdense dots. Two radiologists made correct diagnoses in 19/20 cases(95%). The contrast index was 0.10-0.88 (mean 0.58) for hyperdense dots and 0.02-0.45 (mean 0.17) for true microcalcifications. The hyperdense dots were finer and homogeneously rounder than the microcalcifications. Distribution of the hyperdense dots was more superficial in subcutaneous fat (seven cases) and subareolar area (six cases). All ten patients with hyperdense dots had history of mastitis and abscesses and had been treated by open drainage (six cases) and/or folk remedy (four cases). In eight patients, herb patches had been attached. Biopsies of hyperdense dots did not show any microcalcification or evidence of malignancy. These hyperdense dots were seen mainly in older patients. Their characteristic density, shape, distribution and clinical history makes differential diagnosis from true microcalcifications easy and could reduce unnecessary diagnostic procedures such as surgical biopsy.

  13. Systematic safety evaluation on photoluminescent carbon dots

    Science.gov (United States)

    Wang, Kan; Gao, Zhongcai; Gao, Guo; Wo, Yan; Wang, Yuxia; Shen, Guangxia; Cui, Daxiang

    2013-03-01

    Photoluminescent carbon dots (C-dots) were prepared using the improved nitric acid oxidation method. The C-dots were characterized by tapping-mode atomic force microscopy, and UV-vis absorption spectroscopy. The C-dots were subjected to systematic safety evaluation via acute toxicity, subacute toxicity, and genotoxicity experiments (including mouse bone marrow micronuclear test and Salmonella typhimurium mutagenicity test). The results showed that the C-dots were successfully prepared with good stability, high dispersibility, and water solubility. At all studied C-dot dosages, no significant toxic effect, i.e., no abnormality or lesion, was observed in the organs of the animals. Therefore, the C-dots are non-toxic to mice under any dose and have potential use in fluorescence imaging in vivo, tumor cell tracking, and others.

  14. Highly efficient potentiometric glucose biosensor based on functionalized InN quantum dots

    OpenAIRE

    Alvi, Naveed ul Hassan; Soto Rodríguez, Paul; Gómez Hernández, Víctor Jesús; Kumar, Praveen; Amin, G.; Nur, O; Willander, Magnus; Nötzel, R.

    2012-01-01

    We present a fast, highly sensitive, and efficient potentiometric glucose biosensor based on functionalized InN quantum-dots (QDs). The InN QDs are grown by molecular beam epitaxy. The InN QDs are bio-chemically functionalized through physical adsorption of glucose oxidase (GOD). GOD enzyme-coated InN QDs based biosensor exhibits excellent linear glucose concentration dependent electrochemical response against an Ag/AgCl reference electrode over a wide logarithmic glucose concentration range ...

  15. Biomimetic, Mild Chemical Synthesis of CdTe-GSH Quantum Dots with Improved Biocompatibility

    OpenAIRE

    Pérez-Donoso, José M.; Monrás, Juan P; Denisse Bravo; Adam Aguirre; Quest, Andrew F.; Igor O Osorio-Román; Aroca, Ricardo F.; Chasteen, Thomas G.; Vásquez, Claudio C.

    2012-01-01

    Multiple applications of nanotechnology, especially those involving highly fluorescent nanoparticles (NPs) or quantum dots (QDs) have stimulated the research to develop simple, rapid and environmentally friendly protocols for synthesizing NPs exhibiting novel properties and increased biocompatibility. In this study, a simple protocol for the chemical synthesis of glutathione (GSH)-capped CdTe QDs (CdTe-GSH) resembling conditions found in biological systems is described. Using only CdCl(2), K(...

  16. Quadra-quantum Dots and Related Patterns of Quantum Dot Molecules:

    Directory of Open Access Journals (Sweden)

    Somsak Panyakeow

    2010-10-01

    Full Text Available Abstract Laterally close-packed quantum dots (QDs called quantum dot molecules (QDMs are grown by modified molecular beam epitaxy (MBE. Quantum dots could be aligned and cross hatched. Quantum rings (QRs created from quantum dot transformation during thin or partial capping are used as templates for the formations of bi-quantum dot molecules (Bi-QDMs and quantum dot rings (QDRs. Preferable quantum dot nanostructure for quantum computation based on quantum dot cellular automata (QCA is laterally close-packed quantum dot molecules having four quantum dots at the corners of square configuration. These four quantum dot sets are called quadra-quantum dots (QQDs. Aligned quadra-quantum dots with two electron confinements work like a wire for digital information transmission by Coulomb repulsion force, which is fast and consumes little power. Combination of quadra-quantum dots in line and their cross-over works as logic gates and memory bits. Molecular Beam Epitaxial growth technique called ‘‘Droplet Epitaxy” has been developed for several quantum nanostructures such as quantum rings and quantum dot rings. Quantum rings are prepared by using 20 ML In-Ga (15:85 droplets deposited on a GaAs substrate at 390°C with a droplet growth rate of 1ML/s. Arsenic flux (7–8×10-6Torr is then exposed for InGaAs crystallization at 200°C for 5 min. During droplet epitaxy at a high droplet thickness and high temperature, out-diffusion from the centre of droplets occurs under anisotropic strain. This leads to quantum ring structures having non-uniform ring stripes and deep square-shaped nanoholes. Using these peculiar quantum rings as templates, four quantum dots situated at the corners of a square shape are regrown. Two of these four quantum dots are aligned either or , which are preferable crystallographic directions of quantum dot alignment in general.

  17. Preparation and formation mechanism of strong violet luminescent CdS quantum dots by using a ligand exchange strategy

    International Nuclear Information System (INIS)

    A simple and general method has been proposed for preparing strong violet emitting CdS quantum dots, in which a ligand exchange strategy was applied to surface passivation and functionalization with good reproducibility. The resulting quantum dots showed a visible violet luminescence with emission peak centered near 423 nm and photoluminescence quantum yields reached over 30%. Additionally, different mercapto-compounds used as ligands can make different functionalized surfaces, favoring quantum dots dispersion in different media and their further applications. It was observed that the band edge emission has the main contribution to the bright violet luminescence

  18. Novel Au+-doped Zn xCd1−xS/ZnS core/shell quantum dots

    International Nuclear Information System (INIS)

    Au+ ions have been successfully incorporated into the lattice of ZnxCd1−xS quantum dots as luminescent centers via an aqueous method. The dopant emission can be tuned in the range of 445 to 570 nm, and the highest quantum yield can reach as high as 30%. Our results showed that Au+ ions can be used as an excellent luminescent dopant in doped quantum dots. Finally, these water-soluble quantum dots can be used directly in PL imaging of HepG2 cells without conjugating any biological targets, indicating a high potential application in bio-labeling. (papers)

  19. ClEST cluster :Cl_singleton2103 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2103 brain ... protein 44 Cimex lectularius nuclear gene 353 CACCAAGAAAATTACAAGTTTCTGCAG ... ATTCCGAAGAACGTGTTTATGTGCTTTGTGAACCTATCAA mb13004 1 brain ... protein 44 [Culex quinquefasciatus] XP_001847023 8 ...

  20. ClEST cluster :Cl_singleton0405 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0405 isoform a Cimex lectularius nuclear gene 310 CACCGACGCCACTCAGAGAGGGAGAGCTAAGCAG ... GAAGATTCAAGACTCTGTACCGCTGCTAAAAGGCCGCCAG fb20013 1 brain ... peptide IDL-like protein [Tribolium castaneum] EFA ...

  1. ClEST cluster :Cl_singleton0355 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0355 acyl- synthetase long- isoform b Cimex lectularius nuclear gene 19...GGAAGGTGCATTGGGAGCAATAAAAGCGATCGCATTTGTCTGTGATATCATCACTTATCCAGTGTACCTTATTCTACAACGGCCATGGG fb18010 1 acyl-CoA synthetase [Gl

  2. ClEST cluster :Cl_singleton0763 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0763 aldo-keto reductase Cimex lectularius nuclear gene 591 CACCGGGTAGG...GTGAATAAAGGCTTAGTTAGGTCAATCGGACTATCCAATTTCAACAAAAGACAGATCGAAGATGTTT fs09012 1 aldo-keto reductase [Gl

  3. 1,4-Bis(4-chlorophenylseleno)-2,5-dimethoxybenzene

    DEFF Research Database (Denmark)

    Sørensen, Henning Osholm; Stuhr-Hansen, Nicolai

    2009-01-01

    The title compound, C20H16Cl2O2Se2, utilizes the symmetry of the crystallographic inversion center. Molecular chains are formed through symmetric C-H center dot center dot center dot Cl interactions around inversion centers, mimicking the commonly observed symmetric hydrogen-bonded dimer pattern...

  4. Interaction of different poisons with MgCl2/TiCl4 based Ziegler-Natta catalysts

    Science.gov (United States)

    Bahri-Laleh, Naeimeh

    2016-08-01

    Adsorption of different poison molecules on activated MgCl2 is investigated within DFT using a cluster model of the MgCl2 surface with (MgCl2)16 formula containing four 4-coordinated and eight 5-coordinated Mg atoms as (110) and (104) surfaces, respectively. Studied poison molecules are chosen as possible impurities in hydrocarbon solvents and monomer feeds and contain water, hydrogensulfide, carbondioxide, molecular oxygen and methanol. First, adsorption of 1-4 molecules of different poisons to the (104) and (110) lateral cuts of MgCl2, as well as their adsorption on [MgCl2]/TiCl2Et active center and AlEt3 cocatalyst is considered. Results reveal that poisons strongly stabilize both crystal surfaces, mostly Ti active center relative to the unpoisoned solid. Second, energy barrier (ETS) for ethylene insertion in the presence of different poisons located on the first and second Mg atom relative to the active Ti is calculated. While poison molecule located on the second Mg does not change ETS, coordination of it into the first Mg atom increases ETS by 0.9-1.2 kcal mol-1. In the last part of this manuscript, the stereoselective behavior of active Ti species, with and without poison molecules and external electron donor, is fully explored.

  5. Senior Centers

    Medline Plus

    Full Text Available ... to do as long as they can. Senior centers, adult day care, transportation, and meals programs are ... older adults to remain in their homes. Senior centers are places where older adults who live independently ...

  6. Spin wave eigenmodes in single and coupled sub-150 nm rectangular permalloy dots

    Energy Technology Data Exchange (ETDEWEB)

    Carlotti, G., E-mail: giovanni.carlotti@fisica.unipg.it; Madami, M. [Dipartimento di Fisica e Geologia, Università di Perugia, Perugia (Italy); Tacchi, S. [Istituto Officina dei Materiali del CNR (CNR-IOM), Dipartimento di Fisica e Geologia, Perugia (Italy); Gubbiotti, G.; Dey, H.; Csaba, G.; Porod, W. [Center for Nano Science and Technology, Department of Electrical Engineering, University of Notre Dame, Notre Dame, Indiana 46556 (United States)

    2015-05-07

    We present the results of a Brillouin light scattering investigation of thermally excited spin wave eigenmodes in square arrays of either isolated rectangular dots of permalloy or twins of dipolarly coupled elements, placed side-by-side or head-to-tail. The nanodots, fabricated by e-beam lithography and lift-off, are 20 nm thick and have the major size D in the range between 90 nm and 150 nm. The experimental spectra show the presence of two main peaks, corresponding to modes localized either at the edges or in the center of the dots. Their frequency dependence on the dot size and on the interaction with adjacent elements has been measured and successfully interpreted on the basis of dynamical micromagnetic simulations. The latter enabled us also to describe the spatial profile of the eigenmodes, putting in evidence the effects induced by the dipolar interaction between coupled dots. In particular, in twinned dots the demagnetizing field is appreciably modified in proximity of the “internal edges” if compared to the “external” ones, leading to a splitting of the edge mode. These results can be relevant for the exploitation of sub-150 nm magnetic dots in new applications, such as magnonic metamaterials, bit-patterned storage media, and nano-magnetic logic devices.

  7. One-electron oxidation of the hydroquinonic form of vitamin K by OHter dot and N sub 3 ter dot free radicals. A steady-state gamma radiolysis study. Activation radicalaire d'un modele de vitamine K par les radicaux OHter dot et N sub 3 ter dot. Etude par radiolyse gamma

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen Van Binh, E.; Gardes-Albert, M.; Ferradini, C.; Acher, F.; Azerad, R. (Paris-5 Univ., 75 (FR))

    1991-06-01

    The oxidation of a water-soluble model of vitamin K hydroquinone, symbolised by KH{sub 2}p, has been studied by {gamma} radiolysis using OH{center dot} or N{sub 3}{center dot} free radicals as oxidants. Irradiation doses were up to 300 Gy. The analysis of final products by spectrophotometric absorption and HPLC allowed to characterize the formation of the quinone K and to estimate the initial yield of KH{sub 2}p-disappearance and K-formation. N{sub 3}{center dot} radicals led selectively to the formation of the quinone K with a G-value of (3.0 {+-} 0.3) x 10{sup -7} mol/J, thus involving a simple one-electron oxidation mechanism. On the contrary, when OH{center dot} radicals oxidized KH{sub 2}p, in addition to the quinone, other non identified species were simultaneously produced during the radiolysis, thus requiring a more complex oxidation mechanism.

  8. Excel Center

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Citigroup,one of the World top 500 companies,has now settled in Excel Center,Financial Street. The opening ceremony of Excel Center and the entry ceremony of Citigroup in the center were held on March 31.Government leaders of Xicheng District,the Excel CEO and the heads of Asia-Pacific Region leaders of Citibank all participated in the ceremony.

  9. Frecuencia de virus respiratorios y características clínicas de niños que acuden a un hospital en México Frequency of respiratory viruses and clinical characteristics in children attending a care center in Mexico City

    Directory of Open Access Journals (Sweden)

    Rosa María Wong-Chew

    2010-12-01

    Full Text Available OBJETIVO. Describir la frecuencia de virus respiratorios y características clínicas en niños con cuadros respiratorios de un hospital de tercer nivel en México. MATERIAL Y MÉTODOS. Se incluyeron niños con diagnóstico de infección respiratoria y un resultado positivo por inmunofluorescencia de enero 2004 a octubre 2006. RESULTADOS. De 986 muestras nasofaríngeas, 138 (14% fueron positivas. La frecuencia fue: 80% virus sincicial respiratorio (VSR, 8% parainfluenza 1, 5% parainfluenza3, 2% adenovirus, 2% influenza A, 1% parainfluenza 2 y 1% influenza B. CONCLUSIONES. La frecuencia de virus respiratorios fue de 14%. El VSR se identificó asociado con más frecuencia, a neumonía y bronquiolitis en menores de 3 años.OBJECTIVE. To describe the frequency of respiratory viruses and clinical characteristics in children with respiratory signs and symptoms in a tertiary care center in Mexico. MATERIAL AND METHODS. Patients with a clinical diagnosis of respiratory infection and a positive immunofluorescence result (Light Diagnostics from January 2004 to October 2006 were included. RESULTS. From the 986 nashopharyngeal samples, 138 (14% were positive by immunofluorescence. The frequency was: 80% RSV, 8% parainfluenza 1, 5% parainfluenza 3, 2% adenovirus, 2% influenza A, 1% parainfluenza 2 and 1% influenza B. CONCLUSIONS. Respiratory viruses were detected in 14% of samples tested. RSV was the most frequently identified virus and was associated with pneumonia and bronchiolitis in children younger than 3 years old.

  10. Determination of atropine using Mn-doped ZnS quantum dots as novel luminescent sensitizers

    Energy Technology Data Exchange (ETDEWEB)

    Azizi, Seyed Naser [Analytical Division, Faculty of Chemistry, University of Mazandaran, Babolsar 4741695447 (Iran, Islamic Republic of); Chaichi, Mohammad Javad, E-mail: jchaichi@yahoo.com [Analytical Division, Faculty of Chemistry, University of Mazandaran, Babolsar 4741695447 (Iran, Islamic Republic of); Shakeri, Parmis [Analytical Division, Faculty of Chemistry, University of Mazandaran, Babolsar 4741695447 (Iran, Islamic Republic of); Bekhradnia, Ahmadreza [Pharmaceutical Sciences Research Center, Department of Medicinal Chemistry, Mazandaran University of Medical Sciences, Sari (Iran, Islamic Republic of)

    2013-12-15

    A novel chemiluminescence (CL) method using water-soluble Mn-doped ZnS quantum dots (QDs) as sensitizers is proposed for the chemiluminometric determination of atropine in pharmaceutical formulation. Water-soluble Mn-doped ZnS QDs were synthesized by using L-cysteine as stabilizer in aqueous solutions. The nanoparticles were structurally and optically characterized by X-ray powder diffraction (XRD), dynamic light scattering (DLS), Fourier transform infrared spectroscopy (FTIR), UV–vis absorption spectroscopy and photoluminescence (PL) emission spectroscopy. It was found that ZnS quantum dots acted as enhancers of the weak CL emission produced upon oxidation of sulfite by Ce(IV) in acidic medium. Trace amounts of atropine improved the sensitize effect of ZnS quantum dots yielding a significant chemiluminescence enhancement of the Ce(IV)–SO{sub 3}{sup 2−}–ZnS QD system. Therefore, a new CL analysis system was developed for the determination of atropine. Under the optimum conditions, there is a good linear relationship between the relative chemiluminescence intensity and the concentration of atropine in the range of 1×10{sup −9}–1×10{sup −6} M of atropine with a correlation coefficient (R{sup 2}) of 0.9992. The limit of detection of this system was found to be 2.54×10{sup −10} M. This method is not only simple, sensitive and low cost, but also reliable for practical applications. -- Highlights: • Mn-doped ZnS quantum dots could enhance the chemiluminescence (CL) of cerium(IV)–sodium sulfite system. • ZnS quantum dots were used as the nanocatalyst. • Trace amounts of atropine improved the sensitize effect of ZnS quantum dots. • This work is introduced as a new method for the determination of atropine commercial drugs. • Detection limit of atropine was obtained 2.54×10{sup −10} mol L{sup −1}.

  11. Properties of strong-coupling magneto-bipolaron qubit in quantum dot under magnetic field

    Science.gov (United States)

    Xu-Fang, Bai; Ying, Zhang; Wuyunqimuge; Eerdunchaolu

    2016-07-01

    Based on the variational method of Pekar type, we study the energies and the wave-functions of the ground and the first-excited states of magneto-bipolaron, which is strongly coupled to the LO phonon in a parabolic potential quantum dot under an applied magnetic field, thus built up a quantum dot magneto-bipolaron qubit. The results show that the oscillation period of the probability density of the two electrons in the qubit decreases with increasing electron–phonon coupling strength α, resonant frequency of the magnetic field ω c, confinement strength of the quantum dot ω 0, and dielectric constant ratio of the medium η the probability density of the two electrons in the qubit oscillates periodically with increasing time t, angular coordinate φ 2, and dielectric constant ratio of the medium η the probability of electron appearing near the center of the quantum dot is larger, and the probability of electron appearing away from the center of the quantum dot is much smaller. Project supported by the Natural Science Foundation of Hebei Province, China (Grant No. E2013407119) and the Items of Institution of Higher Education Scientific Research of Hebei Province and Inner Mongolia, China (Grant Nos. ZD20131008, Z2015149, Z2015219, and NJZY14189).

  12. Dot-in-Well Quantum-Dot Infrared Photodetectors

    Science.gov (United States)

    Gunapala, Sarath; Bandara, Sumith; Ting, David; Hill, cory; Liu, John; Mumolo, Jason; Chang, Yia Chung

    2008-01-01

    Dot-in-well (DWELL) quantum-dot infrared photodetectors (QDIPs) [DWELL-QDIPs] are subjects of research as potentially superior alternatives to prior QDIPs. Heretofore, there has not existed a reliable method for fabricating quantum dots (QDs) having precise, repeatable dimensions. This lack has constituted an obstacle to the development of uniform, high-performance, wavelength-tailorable QDIPs and of focal-plane arrays (FPAs) of such QDIPs. However, techniques for fabricating quantum-well infrared photodetectors (QWIPs) having multiple-quantum- well (MQW) structures are now well established. In the present research on DWELL-QDIPs, the arts of fabrication of QDs and QWIPs are combined with a view toward overcoming the deficiencies of prior QDIPs. The longer-term goal is to develop focal-plane arrays of radiationhard, highly uniform arrays of QDIPs that would exhibit high performance at wavelengths from 8 to 15 m when operated at temperatures between 150 and 200 K. Increasing quantum efficiency is the key to the development of competitive QDIP-based FPAs. Quantum efficiency can be increased by increasing the density of QDs and by enhancing infrared absorption in QD-containing material. QDIPs demonstrated thus far have consisted, variously, of InAs islands on GaAs or InAs islands in InGaAs/GaAs wells. These QDIPs have exhibited low quantum efficiencies because the numbers of QD layers (and, hence, the areal densities of QDs) have been small typically five layers in each QDIP. The number of QD layers in such a device must be thus limited to prevent the aggregation of strain in the InAs/InGaAs/GaAs non-lattice- matched material system. The approach being followed in the DWELL-QDIP research is to embed In- GaAs QDs in GaAs/AlGaAs multi-quantum- well (MQW) structures (see figure). This material system can accommodate a large number of QD layers without excessive lattice-mismatch strain and the associated degradation of photodetection properties. Hence, this material

  13. Adiabatic pumping through quantum dots

    International Nuclear Information System (INIS)

    A finite charge can be pumped through a mesoscopic system in the absence of an applied bias voltage by changing periodically in time some parameters of the system. If these parameters change slowly with respect to all internal time scales of the system, pumping is adiabatic. The scope of this work is to investigate adiabatic pumping through a quantum dot, in particular the influence of Coulomb interaction between electrons in the dot on the pumped charge. On one hand we develop a formalism based on Green's functions, in order to calculate the pumped charge from the weak-tunnel-coupling regime down to the Kondo regime. We extend our calculations to a system with a superconducting contact. On the other hand we use a systematic perturbation expansion for the calculation of the pumped charge, giving us the possibility to analyze processes which contribute to charge pumping and to highlight the important role of interaction-induced level renormalization. (orig.)

  14. Quantum dots: promises and accomplishments

    Directory of Open Access Journals (Sweden)

    Dieter Bimberg

    2011-09-01

    Full Text Available Exploration of the Stranski-Krastanow growth of strained semiconductor heterostructures marked the major breakthrough for easy fabrication of defect-free quantum dots (QDs. For the first time, single QDs are facilitating the development of electrically operated emitters of single polarized or entangled photons on demand: an essential component for quantum communication systems. QDs inserted in quantum wells, stacked in planes upon each other, have led to semiconductor lasers that can operate at wavelengths that were previously impossible, or at least difficult to reach, for a given semiconductor family. These lasers show excellent temperature stability, large radiation resistance, and excellent temporal and spatial stability. In this review we discuss recent progress in the field of quantum dot devices.

  15. Job center

    Science.gov (United States)

    To better meet the needs of AGU members, a program has been started to increase the effectiveness of the Job Center activity at the Spring and Fall Meetings. As a result, participation in the Job Center at the 1988 AGU Spring Meeting in Baltimore increased substantially compared to previous Spring Meetings. The number of employers, applicants, and interviews scheduled more than doubled compared to the 1987 Spring Job Center.In order to make the meeting Job Centers even better, a survey is being conducted of employers and applicants who participated in the 1988 Spring Job Center. Evaluation of this survey will be useful in continuing increased participation in and the effectiveness of the Job Center at the 1988 Fall Meeting. Past participants and those interested in the future of the Job Center are encouraged to forward comments and suggestions to AGU, Member Programs Division, 2000 Florida Ave., N.W., Washington, DC 20009.

  16. OpenCL programming guide

    CERN Document Server

    Munshi, Aaftab; Mattson, Timothy G; Fung, James; Ginsburg, Dan

    2011-01-01

    Using the new OpenCL (Open Computing Language) standard, you can write applications that access all available programming resources: CPUs, GPUs, and other processors such as DSPs and the Cell/B.E. processor. Already implemented by Apple, AMD, Intel, IBM, NVIDIA, and other leaders, OpenCL has outstanding potential for PCs, servers, handheld/embedded devices, high performance computing, and even cloud systems. This is the first comprehensive, authoritative, and practical guide to OpenCL 1.1 specifically for working developers and software architects. Written by five leading OpenCL authorities, OpenCL Programming Guide covers the entire specification. It reviews key use cases, shows how OpenCL can express a wide range of parallel algorithms, and offers complete reference material on both the API and OpenCL C programming language. Through complete case studies and downloadable code examples, the authors show how to write complex parallel programs that decompose workloads across many different devices. They...

  17. Enhanced chemiluminescence of CdTe quantum dots-H₂O₂ by horseradish peroxidase-mimicking DNAzyme.

    Science.gov (United States)

    Zhang, Junli; Li, Baoxin

    2014-05-01

    In this study, it was found that horseradish peroxidase (HRP)-mimicking DNAzyme could effectively enhance the CL emission of CdTe quantum dots (QDs)-H2O2 system, whereas HRP could not enhance the CL intensity. The CL enhancement mechanism was investigated, and the CL enhancement was supposed to originate from the catalysis of HRP-mimicking DNAzyme on the CL reaction between CdTe QDs and H2O2. Meantime, compared with CdTe QDs-H2O2 CL system, H2O2 concentration was markedly decreased in QDs-H2O2-HRP-mimicking DNAzyme CL system, improving the stability of QDs-H2O2 CL system. The QDs-based CL system was used to detect sensitively CdTe QDs and HRP-mimicking DNAzyme (as biologic labels). This work gives a path for enhancing CL efficiency of QDs system, and will be helpful to promote the step of QDs application in various fields such as bioassay and trace detection of analyte. PMID:24556131

  18. Charging graphene nanoribbon quantum dots

    OpenAIRE

    Żebrowski, D. P.; B. Szafran

    2015-01-01

    We describe charging a quantum dot induced electrostatically within a semiconducting graphene nanoribbon by electrons or holes. The applied model is based on a tight-binding approach with the electron-electron interaction introduced by a mean field local spin density approximation. The numerical approach accounts for the charge of all the $p_z$ electrons and screening of external potentials by states near the charge neutrality point. Both a homogenous ribbon and a graphene flake embedded with...

  19. FRET sensor with quantum dot

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, M.; Foret, František

    Veszprém: PANNON Egyetem, 2015 - (Mizsey, P.), s. 20-23 ISBN 978-963-396-072-1. [Műszaki Kémiai Napok 2015. Veszprém (HU), 21.04.2015-23.04.2015] R&D Projects: GA ČR(CZ) GA14-28254S; GA TA ČR(CZ) TA02010672 Institutional support: RVO:68081715 Keywords : FRET * quantum dot * sensor Subject RIV: CB - Analytical Chemistry, Separation

  20. FRET sensor with quantum dot

    Czech Academy of Sciences Publication Activity Database

    Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, M.; Foret, František

    Veszprém : PANNON Egyetem, 2015 - (Mizsey, P.), s. 20-23 ISBN 978-963-396-072-1. [Műszaki Kémiai Napok 2015. Veszprém (HU), 21.04.2015-23.04.2015] R&D Projects: GA ČR(CZ) GA14-28254S; GA TA ČR(CZ) TA02010672 Institutional support: RVO:68081715 Keywords : FRET * quantum dot * sensor Subject RIV: CB - Analytical Chemistry, Separation

  1. Chemiluminescence reaction of glucose-derived graphene quantum dots with hypochlorite, and its application to the determination of free chlorine

    International Nuclear Information System (INIS)

    Graphene quantum dots (GQDs) were prepared by a new and facile procedure, and their chemiluminescence (CL) reaction with hypochlorite was studied. It was found that hypochlorite can directly oxidize GQDs to give rise to CL emission, and that the surfactant cetyl trimethyl ammonium bromide enhances CL by a factor of about 18. CL and fluorescence spectra were acquired, and the effect of radical scavengers on the reaction was studied. This CL system was used to develop a simple and sensitive method for the determination of hypochlorite in the 0.5 μM to 1.0 mM concentration range, with a detection limit of 0.3 μM. The method was successfully applied to the determination of free chlorine in (spiked) samples of tap water and pool water. (author)

  2. Semiconductor quantum-dot lasers and amplifiers

    DEFF Research Database (Denmark)

    Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.;

    2002-01-01

    We have produced GaAs-based quantum-dot edge-emitting lasers operating at 1.16 mu m with record-low transparency current, high output power, and high internal quantum efficiencies. We have also realized GaAs-based quantum-dot lasers emitting at 1.3 mu m, both high-power edge emitters and low-power...... biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...... surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier is...

  3. Ultrasmall colloidal PbS quantum dots

    International Nuclear Information System (INIS)

    Ultrasmall colloidal lead sulfide quantum dots can increase the open circuit voltages of quantum-dot-based solar cells because of their large energy gap. Their small size and visible or near infrared light-emitting property make them attractive to the applications of biological fluorescence labeling. Through a modified organometallic route, we can synthesize lead sulfide quantum dots as small as 1.6 nm in diameter. The low reaction temperature and the addition of a chloroalkane cosolvent decrease the reaction rate, making it possible to obtain the ultrasmall quantum dots. - Highlights: • Ultrasmall colloidal PbS quantum dots as small as 1.6 nm in diameter are synthesized. • The quantum dots emit red light with photoluminescence peak at 760 nm. • The growth temperature is as low as 50 °C. • Addition of cosolvent 1,2-dichloroethane in the reaction decreases the reaction rate

  4. Few-electron quantum dots

    International Nuclear Information System (INIS)

    We review some electron transport experiments on few-electron, vertical quantum dot devices. The measurement of current versus source-drain voltage and gate voltage is used as a spectroscopic tool to investigate the energy characteristics of interacting electrons confined to a small region in a semiconducting material. Three energy scales are distinguished: the single-particle states, which are discrete due to the confinement involved; the direct Coulomb interaction between electron charges on the dot; and the exchange interaction between electrons with parallel spins. To disentangle these energies, a magnetic field is used to reorganize the occupation of electrons over the single-particle states and to induce changes in the spin states. We discuss the interactions between small numbers of electrons (between 1 and 20) using the simplest possible models. Nevertheless, these models consistently describe a large set of experiments. Some of the observations resemble similar phenomena in atomic physics, such as shell structure and periodic table characteristics, Hund's rule, and spin singlet and triplet states. The experimental control, however, is much larger than for atoms: with one device all the artificial elements can be studied by adding electrons to the quantum dot when changing the gate voltage. (author)

  5. Photoactivation of silicon quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Lockwood, R., E-mail: rossl@ualberta.c [Department of Physics, University of Alberta, Edmonton, Alberta, T6G 2G7 (Canada); McFarlane, S. [Department of Physics, University of Alberta, Edmonton, Alberta, T6G 2G7 (Canada); Rodriguez Nunez, J.R. [Department of Chemistry, University of Alberta, Edmonton, Alberta, T6G 2G2 (Canada); Wang, X.Y. [Department of Physics, University of Alberta, Edmonton, Alberta, T6G 2G7 (Canada); Veinot, J.G.C. [Department of Chemistry, University of Alberta, Edmonton, Alberta, T6G 2G2 (Canada); Meldrum, A. [Department of Physics, University of Alberta, Edmonton, Alberta, T6G 2G7 (Canada)

    2011-07-15

    We show that free-standing silicon quantum dots (QDs) can be photoactivated by blue or UV optical irradiation. The luminescence intensity increases by an order of magnitude for irradiation times of several minutes under moderate optical power. The cut-off energy for photoactivation is between 2.1 and 2.4 eV, not very different from the activation energy for hydrogen dissociation from bulk silicon surfaces. We propose the mechanism for this effect is associated with silicon-hydride bond breaking and the subsequent oxidation of dangling bonds. This phenomenon could be used to 'write' luminescent quantum dots into pre-determined arrays. - Research highlights: {yields}Laser light causes increased photoluminescence intensity in silicon quantum dots. {yields} The photoactivation process is effective for wavelengths of 514 nm and shorter. {yields} Hydrogen bound to the Si-QDs is replaced by oxygen in a two-step process. {yields} Patterning is possible but limited by physical dispersion of Si-QDs.

  6. Historia clínica

    OpenAIRE

    Juan Martínez Hernández

    2006-01-01

    La historia clínica ha estado regulada hasta la actualidad por diferentes disposiciones legislativas con base en la Ley General de Sanidad 14/1986, de 25 de abril. Con la Ley 41/2002, de 14 de noviembre, básica y reguladora de la autonomía del paciente y de derechos y obligaciones en materia de información y documentación clínica, se actualizan los derechos y obligaciones de los pacientes o usuarios y profesionales, entre ellos los relativos a la historia clínica. En el pres...

  7. Computation of relativistic terms in a spherical quantum dot

    International Nuclear Information System (INIS)

    We studied a hydrogenic impurity located at the center of a spherical quantum dot with an infinite spherical confining potential and calculated energy levels and wavefunctions using Quantum Genetic Algorithm(QGA) and Hartree–Fock Roothaan (HFR) method. In addition, we investigated the first-order relativistic terms such as the relativistic correction to the kinetic energy, Darwin and spin–orbit interaction term. These terms were calculated using the first-order perturbation theory. The electronic charge density for the Darwin term was carried out from a global operator defined by Hiller, Sucher and Feinberg. The results revealed that the relativistic corrections are important in small dot radii and they should not be neglected to improve the accuracy of calculations. - Highlights: ► A spherical quantum dot with an infinite spherical confining potential has been considered. ► Quantum Genetic Algorithm and Hartree–Fock Roothaan method have been used to calculate the wave functions and the total energy. ► The relativistic terms have been calculated using the first-order perturbation theory. ► The electronic charge density for the Darwin term was carried out from a global operator defined by Hiller, Sucher and Feinberg.

  8. Computation of relativistic terms in a spherical quantum dot

    Energy Technology Data Exchange (ETDEWEB)

    Yakar, Yusuf, E-mail: yuyakar@yahoo.com [Physics Department, Faculty of Arts and Science, Aksaray University, Campus 68100 Aksaray (Turkey); Cak Latin-Small-Letter-Dotless-I r, Bekir, E-mail: bcakir@selcuk.edu.tr [Physics Department, Faculty of Science, Selcuk University, Campus 42031 Konya (Turkey); Oezmen, Ayhan [Physics Department, Faculty of Science, Selcuk University, Campus 42031 Konya (Turkey)

    2013-02-15

    We studied a hydrogenic impurity located at the center of a spherical quantum dot with an infinite spherical confining potential and calculated energy levels and wavefunctions using Quantum Genetic Algorithm(QGA) and Hartree-Fock Roothaan (HFR) method. In addition, we investigated the first-order relativistic terms such as the relativistic correction to the kinetic energy, Darwin and spin-orbit interaction term. These terms were calculated using the first-order perturbation theory. The electronic charge density for the Darwin term was carried out from a global operator defined by Hiller, Sucher and Feinberg. The results revealed that the relativistic corrections are important in small dot radii and they should not be neglected to improve the accuracy of calculations. - Highlights: Black-Right-Pointing-Pointer A spherical quantum dot with an infinite spherical confining potential has been considered. Black-Right-Pointing-Pointer Quantum Genetic Algorithm and Hartree-Fock Roothaan method have been used to calculate the wave functions and the total energy. Black-Right-Pointing-Pointer The relativistic terms have been calculated using the first-order perturbation theory. Black-Right-Pointing-Pointer The electronic charge density for the Darwin term was carried out from a global operator defined by Hiller, Sucher and Feinberg.

  9. Charge State Hysteresis in Semiconductor Quantum Dots

    OpenAIRE

    Yang, C. H.; Rossi, A; Lai, N. S.; Leon, R.; Lim, W. H.; Dzurak, A.S.

    2014-01-01

    Semiconductor quantum dots provide a two-dimensional analogy for real atoms and show promise for the implementation of scalable quantum computers. Here, we investigate the charge configurations in a silicon metal-oxide-semiconductor double quantum dot tunnel coupled to a single reservoir of electrons. By operating the system in the few-electron regime, the stability diagram shows hysteretic tunnelling events that depend on the history of the dots charge occupancy. We present a model which acc...

  10. Optical Fiber Sensing Using Quantum Dots

    Directory of Open Access Journals (Sweden)

    Faramarz Farahi

    2007-12-01

    Full Text Available Recent advances in the application of semiconductor nanocrystals, or quantumdots, as biochemical sensors are reviewed. Quantum dots have unique optical properties thatmake them promising alternatives to traditional dyes in many luminescence basedbioanalytical techniques. An overview of the more relevant progresses in the application ofquantum dots as biochemical probes is addressed. Special focus will be given toconfigurations where the sensing dots are incorporated in solid membranes and immobilizedin optical fibers or planar waveguide platforms.

  11. Spintronics and Quantum Computing with Quantum Dots

    OpenAIRE

    Recher, P.; Loss, D.; Levy, J

    2000-01-01

    The creation, coherent manipulation, and measurement of spins in nanostructures open up completely new possibilities for electronics and information processing, among them quantum computing and quantum communication. We review our theoretical proposal for using electron spins in quantum dots as quantum bits. We present single- and two qubit gate mechanisms in laterally as well as vertically coupled quantum dots and discuss the possibility to couple spins in quantum dots via superexchange. We ...

  12. Resonant electron transfer between quantum dots

    OpenAIRE

    Openov, Leonid A.

    1999-01-01

    An interaction of electromagnetic field with a nanostructure composed of two quantum dots is studied theoretically. An effect of a resonant electron transfer between the localized low-lying states of quantum dots is predicted. A necessary condition for such an effect is the existence of an excited bound state whose energy lies close to the top of the barrier separating the quantum dots. This effect may be used to realize the reversible quantum logic gate NOT if the superposition of electron s...

  13. Generation of heralded entanglement between distant quantum dot hole spins

    Science.gov (United States)

    Delteil, Aymeric

    Entanglement plays a central role in fundamental tests of quantum mechanics as well as in the burgeoning field of quantum information processing. Particularly in the context of quantum networks and communication, some of the major challenges are the efficient generation of entanglement between stationary (spin) and propagating (photon) qubits, the transfer of information from flying to stationary qubits, and the efficient generation of entanglement between distant stationary (spin) qubits. In this talk, I will present such experimental implementations achieved in our team with semiconductor self-assembled quantum dots.Not only are self-assembled quantum dots good single-photon emitters, but they can host an electron or a hole whose spin serves as a quantum memory, and then present spin-dependent optical selection rules leading to an efficient spin-photon quantum interface. Moreover InGaAs quantum dots grown on GaAs substrate can profit from the maturity of III-V semiconductor technology and can be embedded in semiconductor structures like photonic cavities and Schottky diodes.I will report on the realization of heralded quantum entanglement between two semiconductor quantum dot hole spins separated by more than five meters. The entanglement generation scheme relies on single photon interference of Raman scattered light from both dots. A single photon detection projects the system into a maximally entangled state. We developed a delayed two-photon interference scheme that allows for efficient verification of quantum correlations. Moreover the efficient spin-photon interface provided by self-assembled quantum dots allows us to reach an unprecedented rate of 2300 entangled spin pairs per second, which represents an improvement of four orders of magnitude as compared to prior experiments carried out in other systems.Our results extend previous demonstrations in single trapped ions or neutral atoms, in atom ensembles and nitrogen vacancy centers to the domain of

  14. Evidència científica en l’ús dels antídots

    OpenAIRE

    Corominas Garcia, Núria

    2012-01-01

    L’objectiu principal d’aquesta tesi es identificar i avaluar l’evidència científica, pel que fa a l’eficàcia i seguretat, que recolza l’ús dels següents antídots inclosos a la Guia d’antídots de l’Hospital Clínic (GAHC): Anticossos Fab antidigoxina en la intoxicació per digoxina, Flumazenil per revertir els efectes centrals de la sobredosificació per benzodiazepines, Fomepizol en la intoxicació per la ingesta de metanol i etilenglicol, Hidroxocobalamina en la intoxicació per cianur, i N-acet...

  15. Random Feature Maps for Dot Product Kernels

    CERN Document Server

    Kar, Purushottam

    2012-01-01

    Approximating non-linear kernels using feature maps has gained a lot of interest in recent years due to applications in reducing training and testing times of SVM classifiers and other kernel based learning algorithms. We extend this line of work and present low distortion embeddings for dot product kernels into linear Euclidean spaces. We base our results on a classical result in harmonic analysis characterizing all dot product kernels and use it to define randomized feature maps into explicit low dimensional Euclidean spaces in which the native dot product provides an approximation to the dot product kernel with high confidence.

  16. Thermoelectric energy harvesting with quantum dots

    International Nuclear Information System (INIS)

    We review recent theoretical work on thermoelectric energy harvesting in multi-terminal quantum-dot setups. We first discuss several examples of nanoscale heat engines based on Coulomb-coupled conductors. In particular, we focus on quantum dots in the Coulomb-blockade regime, chaotic cavities and resonant tunneling through quantum dots and wells. We then turn toward quantum-dot heat engines that are driven by bosonic degrees of freedom such as phonons, magnons and microwave photons. These systems provide interesting connections to spin caloritronics and circuit quantum electrodynamics. (topical review)

  17. C-Cl activation by group IV metal oxides in solid argon matrixes: matrix isolation infrared spectroscopy and theoretical investigations of the reactions of MOx (M = Ti, Zr; x = 1, 2) with CH3Cl.

    Science.gov (United States)

    Zhao, Yanying

    2013-07-11

    Reactions of the ground-state titanium and zirconium monoxide and dioxide molecules with monochloromethane in excess argon matrixes have been investigated in solid argon by infrared absorption spectroscopy and density functional theoretical calculations. The results show that the ground-state MOx (M = Ti, Zr; x = 1, 2) molecules react with CH3Cl to first form the weakly bound MO(CH3Cl) and MO2(CH3Cl) complexes. The MO(CH3Cl) complexes can rearrange to the CH3M(O)Cl isomers with the Cl atom of CH3Cl coordination to the metal center of MO upon UV light irradiation (λ MO + CH3Cl reaction to the more stable CH3M(O)Cl molecules via the MO(CH3Cl) complexes traversing their corresponding transition states. The MO2(CH3Cl) complexes can isomerize to the more stable CH3OM(O)Cl molecules with the addition of the C-Cl bond of CH3Cl to one of the O═M bonds of MO2 upon annealing after broad-band light irradiation. The C-Cl activation by the MOx mechanism was interpreted by the calculated potential energy profiles. PMID:23763350

  18. Quadro clínico e nutricional de pacientes com fibrose cística: 20 anos de seguimento no HC-UFMG Clinical and nutritional aspects of a Center of Cystic Fibrosis-HC-UFMG: 20 years of follow-up

    Directory of Open Access Journals (Sweden)

    F. J. C. Reis

    2000-10-01

    Full Text Available OBJETIVOS: A fibrose cística (FC é a doença genética letal, de herança autossômica recessiva, mais comum entre pacientes de cor branca. O presente estudo foi realizado com o objetivo de identificar o quadro clínico e nutricional à admissão dos pacientes no Centro de Tratamento de FC do HC-UFMG e avaliar a sobrevida a longo prazo. PACIENTES E MÉTODOS: Em um período de 20 anos, 127 pacientes portadores de FC foram acompanhados longitudinalmente e submetidos a protocolo previamente estabelecido, após confirmação do diagnóstico pelo teste do suor. Foram obtidos na admissão dados demográficos, da apresentação clínica, nutricionais e laboratoriais. O genótipo foi obtido de 106 pacientes pela técnica do PCR. Os pacientes foram seguidos por mediana de 44 meses. A análise de sobrevida foi realizada utilizando-se o método de Kaplan-Meier. RESULTADOS: A mediana da idade do diagnóstico da FC foi de 33 meses. A manifestação clínica predominante na época do diagnóstico foi a associação de sintomas respiratórios e gastrointestinais crônicos, presentes em 61% das crianças. A mutação mais freqüente encontrada foi a deltaF508: 17 pacientes (16% eram homozigotos para essa mutação e 30 (28% eram heterozigotos. Houve uma prevalência de desnutrição à admissão de 63% tendo sido reduzida para 45% ao final do seguimento. Um total 20 pacientes (15,7% evoluiu para o óbito. A probabilidade estimada de sobrevida nos primeiros 12 meses após o diagnóstico foi de 96% e após 5 anos de seguimento de 80%. CONCLUSÕES: O diagnóstico da FC é ainda tardio em nosso meio e a sobrevida é menor quando comparada a dados internacionais. O seguimento desses pacientes em centro especializado permitiu uma melhora no estado nutricional apesar da inerente evolução da doença.BACKGROUND: Cystic fibrosis (CF is the most common severe autosomal recessive disease in caucasian population. The life expectancy of patients with CF has improved

  19. Functional Centering

    CERN Document Server

    Hahn, M

    1996-01-01

    Based on empirical evidence from a free word order language (German) we propose a fundamental revision of the principles guiding the ordering of discourse entities in the forward-looking centers within the centering model. We claim that grammatical role criteria should be replaced by indicators of the functional information structure of the utterances, i.e., the distinction between context-bound and unbound discourse elements. This claim is backed up by an empirical evaluation of functional centering.

  20. Study and application of Dot 3.5 computer code in radiation shielding problems

    International Nuclear Information System (INIS)

    The application of nuclear transportation code S sub(N), Dot 3.5, to radiation shielding problems is revised. Aiming to study the better available option (convergence scheme, calculation mode), of DOT 3.5 computer code to be applied in radiation shielding problems, a standard model from 'Argonne Code Center' was selected and a combination of several calculation options to evaluate the accuracy of the results and the computational time was used, for then to select the more efficient option. To illustrate the versatility and efficacy in the application of the code for tipical shielding problems, the streaming neutrons calculation along a sodium coolant channel is ilustrated. (E.G.)

  1. A novel chemiluminescence method for determination of bisphenol Abased on the carbon dot-enhanced HCO{sub 3}{sup −}–H{sub 2}O{sub 2} system

    Energy Technology Data Exchange (ETDEWEB)

    Amjadi, Mohammad, E-mail: amjadi@tabrizu.ac.ir; Manzoori, Jamshid L.; Hallaj, Tooba

    2015-02-15

    A simple and sensitive chemiluminescence (CL) method on the basis of carbon dot (C-dot) enhanced HCO{sub 3}{sup −}–H{sub 2}O{sub 2} system, is designed for the determination of bisphenol A (BPA). The very weak CL of the HCO{sub 3}{sup −}–H{sub 2}O{sub 2} system is enhanced by a factor of ∼100 in the presence of C-dots. Possible mechanisms that lead to the effect were elucidated by recording fluorescence and CL spectra and studying the effect of some radical scavengers. This enhancement is inhibited by BPA in the concentration range from 1.0 to 100 µg L{sup −1}. This is exploited for its trace determination with a detection limit (3 s) of 0.3 µg L{sup −1}. The established method was applied to the determination of BPA in baby bottle and water samples with satisfactory results. - Highlights: • The effect of carbon dots on HCO{sub 3}{sup −}–H{sub 2}O{sub 2} chemiluminescence reaction is studied. • Carbon dots greatly enhance the CL signal of this reaction (∼100 fold). • The new CL system was applied to determination of bisphenol A in real samples.

  2. Pathways for the OH + Cl2 → HOCl + Cl and HOCl + Cl → HCl + ClO Reactions.

    Science.gov (United States)

    Wang, Hongyan; Qiu, Yudong; Czakó, Gábor; Schaefer, Henry F

    2015-07-16

    High level coupled-cluster theory, with spin-orbit coupling evaluated via the Breit-Pauli operator in the interacting-states approach, is used to investigate the OH radical reaction with Cl2 and the subsequent reaction HOCl + Cl. The entrance complex, transition state, and exit complex for both reactions have been determined using the CCSD(T) method with correlation consistent basis sets up to cc-pV6Z. Also reported are CCSDT computations. The OH + Cl2 reaction is predicted to be endothermic by 2.2 kcal/mol, compared to the best experiments, 2.0 kcal/mol. The above theoretical results include zero-point vibrational energy corrections and spin-orbit contributions. The activation energy (Ea) of the OH + Cl2 reaction predicted here, 2.3 kcal/mol, could be as much as 1 kcal/mol too high, but it falls among the four experimental Ea values, which span the range 1.1-2.5 kcal/mol. The exothermicity of the second reaction HOCl + Cl → HCl + ClO is 8.4 kcal/mol, compared to experiment 8.7 kcal/mol. The activation energy for latter reaction is unknown experimentally, but predicted here to be large, 11.5 kcal/mol. There are currently no experiments relevant to the theoretical entrance and exit complexes predicted here. PMID:25965106

  3. Historia clínica

    Directory of Open Access Journals (Sweden)

    Juan Martínez Hernández

    2006-01-01

    Full Text Available La historia clínica ha estado regulada hasta la actualidad por diferentes disposiciones legislativas con base en la Ley General de Sanidad 14/1986, de 25 de abril. Con la Ley 41/2002, de 14 de noviembre, básica y reguladora de la autonomía del paciente y de derechos y obligaciones en materia de información y documentación clínica, se actualizan los derechos y obligaciones de los pacientes o usuarios y profesionales, entre ellos los relativos a la historia clínica. En el presente artículo, se expone el contenido de la Ley 41/2002 y referencias a otras normas legislativas y fuentes bibliográficas. La Ley define la historia clínica, sus contenidos, funciones y usos, su soporte y conservación, aclara la propiedad de la historia clínica y recoge las características de acceso y custodia, así como la privacidad y confidencialidad de la historia clínica.

  4. Phase diagrams for the binary systems NdCl3-LiCl and PrCl3-LiCl

    International Nuclear Information System (INIS)

    Equilibrium diagrams for the binary systems NdCl3-LiCl and PrCl3-LiCl were studied over the temperature range 200-800degC by differential thermal analysis techniques. A peritectic was observed in the NdCl3-LiCl system. The eutectic occurred at 456±2degC and 30.7mol% NdCl3 and the peritectic occurred at 467±1degC. A single eutectic was observed in the PrCl3-LiCl system with no evidence of solid solution or compound formation. The eutectic occurred at 464±1degC and 30.6mol% PrCl3 in the PrCl3-LiCl system. Binary phase diagrams for the two systems were proposed from the DTA results. (author)

  5. Quantum Dot Spectrum Converters for Enhanced High Efficiency Photovoltaics Project

    Data.gov (United States)

    National Aeronautics and Space Administration — This research proposes to enhance solar cell efficiency, radiation resistance and affordability. The Quantum Dot Spectrum Converter (QDSC) disperses quantum dots...

  6. Controllable synthesis, growth mechanism and optical properties of the ZnSe quantum dots and nanoparticles with different crystalline phases

    International Nuclear Information System (INIS)

    Graphical abstract: The ZnSe quantum dots (3.5 nm) with the wurtzite structure exhibited a strong near band-edge emission (NBE) peak centered at 422 nm. The zinc blende ZnSe nanoparticles (21 nm) exhibited near-band-edge luminescence peak centered at 472 nm. Highlights: ► The results of TEM showed that the ZnSe quantum dots were about 3.5 nm. ► The ZnSe quantum dots exhibited a near band-edge emission peak centered at 422 nm. ► The ZnSe nanoparticles exhibited near-band-edge luminescence peak centered at 472 nm. - Abstract: ZnSe precursors were prepared by a solvothermal method at 180 °C without any surface-active agents. ZnSe quantum dots and nanoparticles were obtained by annealing the precursors at 300 °C for 2 h in argon atmosphere. The ZnSe quantum dots were about 3.5 nm, while the ZnSe nanoparticles were about 21 nm, as observed using TEM. The growth mechanisms for the two samples were discussed; this proved that the high coordination ability of ethylenediamine to zinc played an important role in the final phase of the products. The ZnSe quantum dots with the wurtzite structure exhibited a strong near band-edge emission (NBE) peak centered at 422 nm, which was blue-shifted in comparison to that of the bulk ZnSe, which was mainly caused by the quantum confinement effect. However, the zinc blende ZnSe nanoparticles exhibited a near-band-edge luminescence peak centered at 472 nm

  7. Calidad de vida en el trabajo: Profesionales de la salud de Clínica Río Blanco y Centro de Especialidades Médicas Quality of life at work: Health Professionals Clinica Rio Blanco and Center Especialidades Médicas

    Directory of Open Access Journals (Sweden)

    Diemen Delgado García

    2012-09-01

    Full Text Available Objetivo: Identificar un constructo sobre la calidad de vida en el trabajo de los médicos/as y enfermeros/as de Clínica Río Blanco y Centro de Especialidades Médicas. Métodos y Materiales: Estudio transversal y analítico. Se aplicó un cuestionario de datos socio-laborales integrados por 10 ítems y el instrumento CVT-GOHISALO, el cual consta de 74 ítems y mide la calidad de vida en el trabajo en siete dimensiones Resultados: En un grupo de 20 trabajadores entre médicos/as y enfermeros/as, el 40 % cuenta con dos trabajos, el 20 % reporta ausentismo por enfermedad el año previo. El 60 % se desempeñan principalmente en turno mixto. El 40 % tiene una antigüedad de dos a cinco años y el 30 % menos de dos años. El número de horas semanales que dedican al descanso es menor a 20 horas en un 50 % de los trabajadores. Las siete dimensiones evaluadas: soporte institucional para el trabajo, seguridad en el trabajo, integración al puesto de trabajo, satisfacción por el trabajo, bienestar a través del trabajo, desarrollo personal y administración del tiempo libre, reflejan grados de insatisfacción en la calidad de vida en el trabajo. Conclusiones: Los trabajadores de la salud evaluados muestran una serie de percepciones subjetivas que reflejan una realidad de su medio laboral.Objective: To identify a construct on quality of life in the work of doctors and nurses Clínica Río Blanco and Center Especialidades Médicas. Methods and Materials: Cross-sectional and analytical. A questionnaire was social and labor data consisting of 10 question and CVT-GOHISALO instrument, which consists of 74 question and measures the quality of life at work in seven dimensions. Results: In a group of 20 workers among doctors and nurses, 40 % have two jobs, 20 % reported absenteeism due to illness the previous year. 60 % work mainly in mixed shift. 40 % have a length of two to five years and 30 % less than two years. The number of hours per week devoted to rest

  8. 75 FR 68728 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10 (CL-215), CL-215-6B11 (CL-215T...

    Science.gov (United States)

    2010-11-09

    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or.... Model CL-215-1A10 (CL- 215), CL-215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant) Airplanes...: * * * * * Seven cases of on-ground hydraulic accumulator screw cap or end cap failure have been experienced on...

  9. PREFACE: Quantum dots as probes in biology

    Science.gov (United States)

    Cieplak, Marek

    2013-05-01

    photosynthetic systems. The next paper, by Olejnik et al, discussed metallic QDs which enhance photosynthetic function in light-harvesting biomolecular complexes. Such hybrid structures with gold QDs are shown to exhibit a strong increase in the fluorescence quantum yield. The next two papers, by Sikora et al and Kaminska et al deal with the ZnO nanoparticles passivated by MgO. In the first of these two papers, the authors describe the behavior of ZnO/MgO when introduced to human cancer cells. In the second, the authors describe the QDs with an extra outer layer of Fe2O3 which makes the nanoparticles superparamagnetic and also capable of generation of reactive oxygen species which could be applied to form localized centers of toxicity for cancer treatment. Finally, in the last paper by Yatsunenko et al, the authors discuss several semiconducting QDs like ZnO with various rare-earth dopands. They propose a microwave-driven hydrothermal technology to make them, characterize their luminescence and demonstrate their usefulness in the early recognition of cancer tissues. Quantum dots as probes in biology contents Quantum dots as probes in biologyMarek Cieplak Luminescent nanoparticles and their applications in the life sciencesVarun K A Sreenivasan, Andrei V Zvyagin and Ewa M Goldys Ferredoxin:NADP+ oxidoreductase in junction with CdSe/ZnS quantum dots: characteristics of an enzymatically active nanohybrid Krzysztof Szczepaniak, Remigiusz Worch and Joanna Grzyb Spectroscopic studies of plasmon coupling between photosynthetic complexes and metallic quantum dotsMaria Olejnik, Bartosz Krajnik, Dorota Kowalska, Guanhua Lin and Sebastian Mackowski Luminescence of colloidal ZnO nanoparticles synthesized in alcohols and biological application of ZnO passivated by MgOBożena Sikora, Krzysztof Fronc, Izabela Kamińska, Kamil Koper, Piotr Stępień and Danek Elbaum Novel ZnO/MgO/Fe2O3 composite optomagnetic nanoparticles I Kamińska, B Sikora, K Fronc, P Dziawa, K Sobczak, R Minikayev, W

  10. ClEST cluster :Cl_singleton1875 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1875 beta-carotene -monooxygenase Cimex lectularius nuclear gene 443 CAGACGAAGACATGT ... CGCTTTATGGAAGTACAGATACAAGTGTGAAG mb05043 1 Retinal pigment ... epithelium-specific protein b [Danio rerio] AAH921 ...

  11. ClEST cluster :Cl_contig0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0243 barrier-to-autointegration factor Cimex lectularius nuclear gene 428 ...TAATAAATACAGTATGATGTGCG fb29038 fs25084 mb23031 3 barrier to autointegration factor [Rhodnius prolixus] AEL79235 5.9E-56 GO:0003677 ...

  12. ClEST cluster :Cl_singleton0811 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0811 nuclear ... transcription factor gamma Cimex lectularius nuclear ... gene 506 GATGGTTGG ... GGGTACATACTGAGGATAACAAACGTCGAACTTTACAGCG fs11035 1 nuclear ... transcription factor Y gamma isoform 1 [Nasonia vi ...

  13. ClEST cluster :Cl_singleton1046 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1046 u2 small nuclear ... ribonucleoprotein a Cimex lectularius nuclear ... gene 633 TTGTTTG ... CGCTCACGAGC fs21006 1 PREDICTED: probable U2 small nuclear ... ribonucleoprotein A'-like [Bombus terrestris] XP_0 ...

  14. ClEST cluster :Cl_singleton1703 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1703 p8 nuclear ... protein Cimex lectularius nuclear ... gene 541 AGTCGTTCGACAACGTTCAAACAAT ... AACGGTTAAGCATTTGTACTTACGTTAT fw21041 1 DNA-binding nuclear ... protein p8 [Triatoma infestans] ABR27869 2.01616E- ...

  15. ClEST cluster :Cl_singleton2134 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2134 rna-binding region ... rnp-1 domain-containing protein Cimex lectularius nuclear ge ... GTGTACCTTGCAAAAGTGATTTATCATC mb16086 1 RNA-binding region ... RNP-1 domain-containing protein [Dictyostelium dis ...

  16. ClEST cluster :Cl_singleton1569 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1569 b-cell ... receptor-associated protein 31-like Cimex lectularius nuclear gene 410 C ... CTCTGTTCCTCTCCATTGTGATTCGACGATTCGTGTCT fw16029 1 B-cell ... receptor-associated protein 31-like [Acyrthosiphon ...

  17. ClEST cluster :Cl_singleton2269 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2269 germ cell -less protein Cimex lectularius nuclear gene 466 CACACACGCGCTTCATAAAAA ... TCAATATTCTTGA mb21032 1 PREDICTED: similar to germ cell -less protein [Tribolium castaneum] XP_967783 3.440 ...

  18. ClEST cluster :Cl_singleton0908 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0908 bone marrow stromal cell -derived ubiquitin-like protein Cimex lectularius nucle ... s15049 1 PREDICTED: similar to bone marrow stromal cell -derived ubiquitin-like protein [Tribolium castaneu ...

  19. ClEST cluster :Cl_singleton0360 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0360 cell ... cycle control protein 50a-like isoform 1 Cimex lectularius nuclear gene 41 ... ACAAAATGCATGAATGCCTTGTCACCAAC fb18030 1 PREDICTED: cell ... cycle control protein 50A-like isoform 2 [Nasonia ...

  20. ClEST cluster :Cl_contig0436 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0436 lethal essential for life ... l2efl Cimex lectularius nuclear gene 432 TAAGAATCTCTCCCG ... GACGTTATT fs18066 fw18019 2 lethal(2)essential for life ... protein-like protein [Maconellicoccus hirsutus] AB ...

  1. ClEST cluster :Cl_singleton1657 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1657 pumilio ... 2 Cimex lectularius nuclear gene 590 TGATGATGAAAGATCAGTACGCCAATTATGTCGT ... ATATGATACATCAAATAAATTATTTGAGA fw20025 1 PREDICTED: pumilio ... homolog 2-like isoform 1 [Acyrthosiphon pisum] XP_ ...

  2. ClEST cluster :Cl_singleton2448 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2448 probable gdp-fucose ... transporter-like Cimex lectularius nuclear gene 314 ACGAATT ... AAAGTTTTCCCTGTCA mb31096 1 PREDICTED: probable GDP-fucose ... transporter-like [Acyrthosiphon pisum] XP_00194993 ...

  3. ClEST cluster :Cl_singleton1765 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1765 rab11 family -interacting protein 4a-like Cimex lectularius nuclear gene 578 GGT ... GGCGAGGGTTTTGATGCTTGAAG fw23061 1 PREDICTED: rab11 family -interacting protein 4A-like isoform 1 [Acyrthosiph ...

  4. ClEST cluster :Cl_singleton0942 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0942 tbc1 domain family ... member 4-like Cimex lectularius nuclear gene 488 GCATTCGTATT ... CCACCATAAAGGAGCAA fs16074 1 PREDICTED: TBC1 domain family ... member 4-like [Acyrthosiphon pisum] XP_001947975 6 ...

  5. ClEST cluster :Cl_contig0251 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0251 member ras oncogene family ... Cimex lectularius nuclear gene 413 GAGTGTGTAAACTTAAAATA ... 3 PREDICTED: similar to RAB18 member RAS oncogene family ... [Tribolium castaneum] XP_970378 2.6E-29 ...

  6. ClEST cluster :Cl_singleton0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0243 solute carrier family ... 35 member f5-like Cimex lectularius nuclear gene 403 GAAA ... AATAAAACTCCCAA fb12090 1 PREDICTED: solute carrier family ... 35 member F5-like [Nasonia vitripennis] XP_0016016 ...

  7. ClEST cluster :Cl_singleton1038 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1038 pleckstrin homology domain- family ... a (phosphoinositide binding specific) member ... : similar to pleckstrin homology domain-containing family ... A (phosphoinositide binding specific) member 3 [Tr ...

  8. ClEST cluster :Cl_singleton0344 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0344 l antigen family ... member 3 Cimex lectularius nuclear gene 461 CCAAGTAAAAATTTAAAT ... AGGGCAAATTATGGCTTCGCCCTCTATCTG fb17054 1 L antigen family ... member 3 isoform 1 [Nasonia vitripennis] NP_001155 ...

  9. ClEST cluster :Cl_singleton1438 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1438 sodium pump ... alpha subunit Cimex lectularius nuclear gene 282 GAGTCTGGTTCCAGTGCT ... ACTGGACTCACACACGCCAAAGCT fw09093 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 1.10687E ...

  10. ClEST cluster :Cl_singleton0353 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0353 sodium pump ... alpha subunit Cimex lectularius nuclear gene 155 GGCTGTCGGACCTCCACC ... CATAAAATATCTGTAGAAGAACTA fb18007 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 2.28502E ...

  11. ClEST cluster :Cl_singleton1521 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1521 Histone-lysine ... N-methyltransferase SETMAR Cimex lectularius nuclear gene 357 CT ... TTCATAAAGATATTTGAAAGTTTCGTTCAACT fw14041 1 Histone-lysine ... N-methyltransferase SETMAR [Harpegnathos saltator] ...

  12. ClEST cluster :Cl_contig0318 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0318 histone-lysine ... n-methyltransferase setmar Cimex lectularius nuclear gene 571 TTTGA ... AATTTTCGAGTTTTTTCACTTTTC fw04055 mb08029 2 histone-lysine ... N-methyltransferase SETMAR [Bos taurus] NP_0010771 ...

  13. ClEST cluster :Cl_singleton1580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1580 histone-lysine ... n-methyltransferase setmar-like Cimex lectularius nuclear gene 3 ... AGTACATTAACTCATCTTTTC fw17018 1 PREDICTED: histone-lysine ... N-methyltransferase SETMAR-like [Bombus terrestris ...

  14. ClEST cluster :Cl_singleton0551 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0551 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... CTATCTATCCCGTCTG fb26037 1 PREDICTED: RNA-directed DNA ... polymerase from mobile element jockey-like [Acyrth ...

  15. ClEST cluster :Cl_singleton1396 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1396 dna ... repair and recombination protein rad54b-like Cimex lectularius nuclear gene ... ACGATTACTATTTTTTTCCTTCGAGCCTT fw08090 1 PREDICTED: DNA ... repair and recombination protein RAD54B-like [Acyr ...

  16. ClEST cluster :Cl_singleton0669 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0669 n -adenine-specific dna ... methyltransferase 2-like Cimex lectularius nuclear gene ... GATGATAAAACTGTAAAAA fs03050 1 N-6 adenine-specific DNA ... methyltransferase 2 [Nasonia vitripennis] NP_00112 ...

  17. ClEST cluster :Cl_singleton1305 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1305 dna -directed rna polymerase ii kda polypeptide Cimex lectularius nuclear gene 4 ... TGAAGAAAGATTCAAAGAGGCGATCAAGGACAGGAAGGAA fw05060 1 DNA -directed RNA polymerase II 13.3 kda polypeptide [T ...

  18. ClEST cluster :Cl_singleton0185 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0185 dna -directed rna polymerases and iii subunit rpabc1-like Cimex lectularius nucl ... CTTCTGCTAAGCAATCACTCGTGGACATG fb10023 1 PREDICTED: DNA -directed RNA polymerases I II and III subunit RPAB ...

  19. ClEST cluster :Cl_singleton0563 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0563 dna -directed rna polymerases i and iii subunit rpac1 Cimex lectularius nuclear ... GTGAAATGCACTAAAAACCCACACTGCCG fb27031 1 PREDICTED: DNA -directed RNA polymerases I and III subunit RPAC1 [ ...

  20. ClEST cluster :Cl_singleton0580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0580 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... ACCTTTATTAATCACATTCCGAGCCTA fb28040 1 RNA-directed DNA ... polymerase from mobile element jockey [Harpegnatho ...

  1. ClEST cluster :Cl_singleton0423 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0423 dna ... replication licensing factor mcm9-like Cimex lectularius nuclear gene 423 C ... CAAAGAAAGAGTGAGGCGTTAAATGCATC fb20074 1 PREDICTED: DNA ... replication licensing factor MCM9-like [Bos taurus ...

  2. ClEST cluster :Cl_singleton2256 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2256 aminopeptidase -like Cimex lectularius nuclear gene 480 GTACACACTACACAGCACTGAGT ... TCACGTTTTCCCAAGACAAAGCTTG mb20082 1 PREDICTED: LOW QUALITY ... PROTEIN: putative aminopeptidase W07G4.4-like [Bom ...

  3. ClEST cluster :Cl_singleton0131 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0131 hemicentin 1 Cimex lectularius nuclear gene 552 TATCAGCACCAATTCCTTCAATTCCTGAAGA ... TACATGTGTCAGGGGAGCAACAAAG fb07055 1 PREDICTED: LOW QUALITY ... PROTEIN: hemicentin-1-like [Meleagris gallopavo] X ...

  4. ClEST cluster :Cl_singleton0993 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0993 low quality ... protein: wd repeat and fyve domain-containing protein 3-like Cimex ... GTGTTTCGCACGCCGCAGTGGTGGC fs18057 1 PREDICTED: LOW QUALITY ... PROTEIN: WD repeat and FYVE domain-containing prot ...

  5. ClEST cluster :Cl_singleton0484 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0484 protein polybromo-1 Cimex lectularius nuclear gene 500 GGGAGTCGTGAAGATGGTCGTGAA ... TAAGACTGACGAGTATGATGATATA fb23037 1 PREDICTED: LOW QUALITY ... PROTEIN: protein polybromo-1-like [Bombus terrestr ...

  6. ClEST cluster :Cl_singleton0415 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0415 ctp synthase Cimex lectularius nuclear gene 485 CGGTGAAACGTACGTTCTTGATGATGGAGGG ... CTTTCACCAGACCTCATTGTTTGCC fb20048 1 PREDICTED: LOW QUALITY ... PROTEIN: CTP synthase-like [Bombus impatiens] XP_0 ...

  7. ClEST cluster :Cl_contig0368 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0368 astakine variant 1 Cimex lectularius nuclear gene 522 GAACAGTTTCAGTCGGCGACTGGTTGAC ... CAGTAAATAACTGTGAT fb05079 mb05073 2 PREDICTED: LOW QUALITY ... PROTEIN: astakine-like [Bombus terrestris] XP_0034 ...

  8. ClEST cluster :Cl_singleton0904 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0904 male -specific lethal 3 homolog Cimex lectularius nuclear gene 394 CTCGCAGGTTGAG ... GAATTCGACTTGGGATAGATTCGTTACCG fs15038 1 PREDICTED: male -specific lethal 3 homolog [Acyrthosiphon pisum] XP ...

  9. ClEST cluster :Cl_singleton1087 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1087 calreticulin Cimex lectularius nuclear gene 333 CGAAACCCAGCTCGAGACGATGAGGGCTCTT ... calreticulin [Rhodnius prolixus] ACI23246 4.17952E-42 ... GO:0006457 GO:0005783 GO:0051082 GO:0005509 ...

  10. ClEST cluster :Cl_contig0178 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0178 transposase-like Cimex lectularius nuclear gene 625 AACTTCGTCAGAAAATAAAACTCTCTTCCA ... asGA2_TC010512 [Tribolium castaneum] EFA01186 1.5E-42 ... GO:0004803 GO:0015074 GO:0006313 GO:0003677 ...

  11. ClEST cluster :Cl_contig0085 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0085 leucine aminopeptidase Cimex lectularius nuclear gene 650 ACTACTCAAAATTTTTGTTTCTGG ... 1 5 GJ21638 [Drosophila virilis] XP_002049525 2.0E-42 ... GO:0008238 GO:0007498 ...

  12. ClEST cluster :Cl_singleton2379 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2379 tubulin polymerization ... promoting protein Cimex lectularius nuclear gene 406 AAA ... TTGCGGATTACAACAAATTCCTCGAGGATCTG mb25089 1 tubulin polymerization ... promoting protein [Triatoma matogrossensis] ADN299 ...

  13. ClEST cluster :Cl_singleton0582 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0582 stress -induced-phosphoprotein 1 Cimex lectularius nuclear gene 592 GGAAAAGGTTAT ... AAGGCACGAGAAATTATTCCCACCGATATTACATTTTACA fb28049 1 Stress -induced-phosphoprotein 1 [Acromyrmex echinatior] E ...

  14. ClEST cluster :Cl_singleton0472 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...

  15. ClEST cluster :Cl_singleton1313 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1313 27 kda hemolymph ... Cimex lectularius nuclear gene 441 CCATTACGGCCGGGGAGAGTGGAATGA ... GAGGTGTTGATGAAAGAAATAA fw05075 1 PREDICTED: 27 kDa hemolymph ... protein-like [Acyrthosiphon pisum] XP_001947666 2. ...

  16. ClEST cluster :Cl_contig0283 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0283 bladder cancer -associated Cimex lectularius nuclear gene 641 AGAGTCAGGATTGACTGTTTC ... TTAAAATATAAGC fb02042 fs13007 2 PREDICTED: bladder cancer -associated protein-like [Nasonia vitripennis] XP_0 ...

  17. ClEST cluster :Cl_contig0334 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0334 1-acyl-sn-glycerol-3-phosphate ... acyltransferase Cimex lectularius nuclear gene 551 ... fw03026 fw07037 2 PREDICTED: 1-acyl-sn-glycerol-3-phosphate ... acyltransferase alpha-like isoform 2 [Acyrthosipho ...

  18. ClEST cluster :Cl_singleton0136 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0136 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 573 GTACG ... TTTTTCAGCTCTGGCTGACAT fb07076 1 Putative inorganic phosphate ... cotransporter [Harpegnathos saltator] EFN85104 8.7 ...

  19. ClEST cluster :Cl_singleton1944 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1944 deoxyribose-phosphate ... aldolase Cimex lectularius nuclear gene 535 GATATCTGAAATG ... TG mb07072 1 PREDICTED: similar to 2-deoxyribose-5-phosphate ... aldolase homolog [Tribolium castaneum] XP_972358 7 ...

  20. ClEST cluster :Cl_singleton0117 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0117 phosphatidylinositol-4-phosphate ... 3-kinase c2 domain-containing beta polypeptide ... CAAAAG fb07013 1 PREDICTED: phosphatidylinositol-4-phosphate ... 3-kinase C2 domain-containing subunit alpha-like [ ...

  1. ClEST cluster :Cl_singleton2005 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2005 glycerol-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 411 ATCGAGCTC ... GTATTGCTGATCTTGTCACCACTTGTTAC mb09081 1 glycerol-3-phosphate ... dehydrogenase [Drosophila ficusphila] BAB39756 2.6 ...

  2. ClEST cluster :Cl_singleton0341 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0341 ribose-phosphate ... pyrophosphokinase Cimex lectularius nuclear gene 379 TTCTATGTG ... TGCTGTTATTCCATATTTGCCCTATAGCAAGCA fb17043 1 ribose-phosphate ... pyrophosphokinase 1 2 [Culex quinquefasciatus] XP_ ...

  3. ClEST cluster :Cl_contig0206 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0206 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 554 TCTAGTCG ... 8 mb18034 3 PREDICTED: similar to sodium-dependent phosphate ... transporter [Tribolium castaneum] XP_001809051 9.4 ...

  4. ClEST cluster :Cl_singleton0167 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0167 sugar phosphate ... exchanger 2-like isoform 2 Cimex lectularius nuclear gene 506 C ... TATTCGCATACGCTGCATCAATG fb09027 1 PREDICTED: sugar phosphate ... exchanger 2-like isoform 2 [Apis mellifera] XP_397 ...

  5. ClEST cluster :Cl_singleton1124 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1124 glyceraldehyde-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 609 CTC ... TTTGAATTGTTA fs25045 1 PREDICTED: glyceraldehyde-3-phosphate ... dehydrogenase-like [Acyrthosiphon pisum] XP_001943 ...

  6. ClEST cluster :Cl_singleton0888 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0888 mannose-6-phosphate ... isomerase Cimex lectularius nuclear gene 314 GTTGGCTTGTGTGG ... AAGGAGTTGGCTGCTGTAC fs14088 1 PREDICTED: mannose-6-phosphate ... isomerase-like [Bombus impatiens] XP_003491147 1.3 ...

  7. ClEST cluster :Cl_singleton1290 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1290 glucose-6-phosphate ... 1-epimerase-like Cimex lectularius nuclear gene 605 AGAGGAA ... CGAATGTGGTCTCAGGAAG fw05014 1 PREDICTED: glucose-6-phosphate ... 1-epimerase-like [Apis mellifera] XP_003251860 4.4 ...

  8. ClEST cluster :Cl_singleton1771 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1771 inorganic phosphate ... cotransporter Cimex lectularius nuclear gene 540 GGTTTTAAAA ... AGGTCCGATT fw23080 1 PREDICTED: putative inorganic phosphate ... cotransporter-like isoform 2 [Acyrthosiphon pisum] ...

  9. ClEST cluster :Cl_singleton1772 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1772 myosin heavy chain Cimex lectularius nuclear gene 539 GAGTCAGACTCGCTCCAGCTCCCTC ... AACAAAGAAA fw23081 1 PREDICTED: myosin heavy chain muscle ... isoform 1 [Acyrthosiphon pisum] XP_001952092 5.076 ...

  10. ClEST cluster :Cl_contig0096 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0096 muscle ... lim protein Cimex lectularius nuclear gene 588 AACTTGTTAGTGTGATAAAACCGTCGGC ... TCTGAATA fw01077 fw02081 fw16071 fw23005 fw24093 5 muscle ... LIM protein isoform 2 [Bombyx mori] NP_001037398 6 ...

  11. ClEST cluster :Cl_contig0487 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0487 synaptic glycoprotein sc2 Cimex lectularius nuclear gene 366 GTTGTTTTATCTGATTCGGAG ... PREDICTED: steroid Alpha ReducTase family member (art -1)-like [Saccoglossus kowalevskii] XP_002732370 2. ...

  12. ClEST cluster :Cl_singleton0302 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0302 150 kda oxygen-regulated protein Cimex lectularius nuclear gene 290 CGATCGAGACT ... AAAGAGAAGGGGACAGTGGAGCTCCCAAG fb15026 1 PREDICTED: hypoxia ... up-regulated protein 1-like isoform 4 [Nasonia vit ...

  13. ClEST cluster :Cl_singleton0264 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0264 dnaj homolog subfamily a member 2 Cimex lectularius nuclear gene 633 GGACTTTTGA ... TGGCAGTAGAATGGCCAAAGAGATCAGGACAATGTGTAGT fb13059 1 molecular ... chaperone [Rhodnius prolixus] AEL79216 3.81379E-61 ...

  14. ClEST cluster :Cl_singleton0071 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0071 nucleosome-remodeling factor subunit nurf301 Cimex lectularius nuclear gene 605 ... GGCACCGTCATC fb05014 1 PREDICTED: similar to fetal alzheimer ... antigen falz [Tribolium castaneum] XP_001811424 2. ...

  15. ClEST cluster :Cl_singleton1298 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1298 nadh dehydrogenase Cimex lectularius nuclear gene 236 GAGTTCTAAGTCGTCTGGTCCTGAA ... TTTGAAAA fw05041 1 NADH dehydrogenase [ubiquinone] iron -sulfur protein 5 [Acyrthosiphon pisum] NP_00115530 ...

  16. ClEST cluster :Cl_contig0235 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0235 tyrosine tryptophan ... Cimex lectularius nuclear gene 453 CGACCCTGATGGACGGTGGAAATTACA ... GACATTGCCT fb16033 fw14092 mb16034 3 phenylalanine-tryptophan ... hydroxylase [Gryllus bimaculatus] BAJ83477 2.8E-78 ...

  17. ClEST cluster :Cl_singleton0416 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0416 ornithine aminotransferase Cimex lectularius nuclear gene 438 TATC...CAGTTTGCCGAGTATATCACCCGTTATTT fb20049 1 PREDICTED: probable ornithine aminotransferase-like [Glycine max] XP_003531161 4.30167E-26 GO:0008483 ...

  18. ClEST cluster :Cl_singleton2093 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2093 selenoprotein t Cimex lectularius nuclear gene 435 GAGAAGGAGATTCCG...GAGACGGGAAGAATA mb12059 1 selenoprotein T [Glossina morsitans morsitans] ADD19835 7.29481E-59 GO:0045454 GO:0008430 GO:0005575 ...

  19. ClEST cluster :Cl_contig0079 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0079 death -associated protein Cimex lectularius nuclear gene 811 GAGTGATCATAGTGAGAACGGT ... ATTCTGTA fb07073 fb13017 fs15001 fw07030 mb18092 5 death -associated protein-like protein [Maconellicoccus h ...

  20. ClEST cluster :Cl_singleton1627 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1627 death -associated protein kinase 1 Cimex lectularius nuclear gene 571 TCCCAATGGG ... CCTACAGCGGAGT fw19023 1 PREDICTED: similar to DAP (Death -Associated Protein) Kinase homolog family member ( ...

  1. ClEST cluster :Cl_singleton0883 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0883 dehydrogenase domain protein Cimex lectularius nuclear gene 257 TCGATTACAACTGAA ... AAAAGGCTACTGACG fs14067 1 unnamed protein product [Azospirillum ... lipoferum 4B] YP_005037771 4.11457E-19 GO:0016616 ...

  2. ClEST cluster :Cl_singleton0781 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0781 membrane magnesium ... transporter 1-like Cimex lectularius nuclear gene 546 TCTAAA ... TACATGAATTGTTTAGTTTAATTATCTCTGT fs09088 1 Membrane magnesium ... transporter 1-B [Acromyrmex echinatior] EGI59871 6 ...

  3. Distribution center

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    Distribution center is a logistics link fulfill physical distribution as its main functionGenerally speaking, it's a large and hiahly automated center destined to receive goods from various plants and suppliers,take orders,fill them efficiently,and deliver goods to customers as quickly as possible.

  4. Nitrogen-Doped Carbon Dots for "green" Quantum Dot Solar Cells.

    Science.gov (United States)

    Wang, Hao; Sun, Pengfei; Cong, Shan; Wu, Jiang; Gao, Lijun; Wang, Yun; Dai, Xiao; Yi, Qinghua; Zou, Guifu

    2016-12-01

    Considering the environment protection, "green" materials are increasingly explored for photovoltaics. Here, we developed a kind of quantum dots solar cell based on nitrogen-doped carbon dots. The nitrogen-doped carbon dots were prepared by direct pyrolysis of citric acid and ammonia. The nitrogen-doped carbon dots' excitonic absorption depends on the N-doping content in the carbon dots. The N-doping can be readily modified by the mass ratio of reactants. The constructed "green" nitrogen-doped carbon dots solar cell achieves the best power conversion efficiency of 0.79 % under AM 1.5 G one full sun illumination, which is the highest efficiency for carbon dot-based solar cells. PMID:26781285

  5. Quantum Gates Between Two Spins in a Triple Dot System with an Empty Dot

    CERN Document Server

    Coello, Jose Garcia

    2011-01-01

    We propose a scheme for implementing quantum gates and entanglement between spin qubits in the outer dots of a triple-dot system with an empty central dot. The voltage applied to the central dot can be tuned to realize the gate. Our scheme exemplifies the possibility of quantum gates outside the regime where each dot has an electron, so that spin-spin exchange interaction is not the only relevant mechanism. Analytic treatment is possible by mapping the problem to a t-J model. The fidelity of the entangling quantum gate between the spins is analyzed in the presence of decoherence stemming from a bath of nuclear spins, as well as from charge fluctuations. Our scheme provides an avenue for extending the scope of two qubit gate experiments to triple-dots, while requiring minimal control, namely that of the potential of a single dot, and may enhance the qubit separation to ease differential addressability.

  6. Optical anisotropy in vertically coupled quantum dots

    DEFF Research Database (Denmark)

    Yu, Ping; Langbein, Wolfgang Werner; Leosson, Kristjan;

    1999-01-01

    We have studied the polarization of surface and edge-emitted photoluminescence (PL) from structures with vertically coupled In0.5Ga0.5As/GaAs quantum dots (QD's) grown by molecular beam epitaxy. The PL polarization is found to be strongly dependent on the number of stacked layers. While single...... number due to increasing dot size....

  7. Double Acceptor Interaction in Semimagnetic Quantum Dot

    Directory of Open Access Journals (Sweden)

    A. Merwyn Jasper D. Reuben

    2011-01-01

    Full Text Available The effect of geometry of the semimagnetic Quantum Dot on the Interaction energy of a double acceptor is computed in the effective mass approximation using the variational principle. A peak is observed at the lower dot sizes as a magnetic field is increased which is attributed to the reduction in confinement.

  8. Thick-shell nanocrystal quantum dots

    Science.gov (United States)

    Hollingsworth, Jennifer A.; Chen, Yongfen; Klimov, Victor I.; Htoon, Han; Vela, Javier

    2011-05-03

    Colloidal nanocrystal quantum dots comprising an inner core having an average diameter of at least 1.5 nm and an outer shell, where said outer shell comprises multiple monolayers, wherein at least 30% of the quantum dots have an on-time fraction of 0.80 or greater under continuous excitation conditions for a period of time of at least 10 minutes.

  9. Photoinduced electron transfers with carbon dots

    OpenAIRE

    Wang, Xin; Cao, Li; Lu, Fushen; Meziani, Mohammed J.; Li, Heting; Qi, Gang; Zhou, Bing; Harruff, Barbara A.; Kermarrec, Fabien; Sun, Ya-Ping

    2009-01-01

    The photoluminescence in carbon dots (surface-passivated small carbon nanoparticles) could be quenched efficiently by electron acceptor or donor molecules in solution, namely that photo-excited carbon dots are both excellent electron donors and excellent electron acceptors, thus offering new opportunities for their potential uses in light energy conversion and related applications.

  10. Photoluminescence of hybrid quantum dots

    Czech Academy of Sciences Publication Activity Database

    Král, Karel; Menšík, Miroslav

    Bratislava: Slovak Expert Group of Solid State Chemistry and Physics , 2013 - (Koman, M.; Jorík, V.; Kožíšek, Z.). s. 28-28 ISBN 978-80-970896-5-8. [Joint Seminar – Development of materials science in research and education /23./. 09.09.2013-13.09.2013, Kežmarské Žľaby] R&D Projects: GA MŠk LH12236; GA MŠk LH12186 Institutional support: RVO:68378271 ; RVO:61389013 Keywords : energy transfer * quantum dots Subject RIV: BM - Solid Matter Physics ; Magnetism; JA - Electronics ; Optoelectronics, Electrical Engineering (UMCH-V)

  11. Coherent control of quantum dots

    DEFF Research Database (Denmark)

    Johansen, Jeppe; Lodahl, Peter; Hvam, Jørn Märcher

    In recent years much effort has been devoted to the use of semiconductor quantum dotsystems as building blocks for solid-state-based quantum logic devices. One importantparameter for such devices is the coherence time, which determines the number ofpossible quantum operations. From earlier...... measurements the coherence time of the selfassembledquantum dots (QDs) has been reported to be limited by the spontaneousemission rate at cryogenic temperatures1.In this project we propose to alter the coherence time of QDs by taking advantage of arecent technique on modifying spontaneous emission rates with...

  12. Semiconductor double quantum dot micromaser.

    Science.gov (United States)

    Liu, Y-Y; Stehlik, J; Eichler, C; Gullans, M J; Taylor, J M; Petta, J R

    2015-01-16

    The coherent generation of light, from masers to lasers, relies upon the specific structure of the individual emitters that lead to gain. Devices operating as lasers in the few-emitter limit provide opportunities for understanding quantum coherent phenomena, from terahertz sources to quantum communication. Here we demonstrate a maser that is driven by single-electron tunneling events. Semiconductor double quantum dots (DQDs) serve as a gain medium and are placed inside a high-quality factor microwave cavity. We verify maser action by comparing the statistics of the emitted microwave field above and below the maser threshold. PMID:25593187

  13. Impurity modulated excitation profile of doped quantum dot subject to oscillatory magnetic field

    International Nuclear Information System (INIS)

    Research highlights: → The excitation profile of quantum dot subject to periodically fluctuating magnetic field has been investigated. → The quantum dot is doped with a repulsive Gaussian impurity. → The impurity domain and impurity location delicately modulate the excitation profile. → The ratio of cyclotron frequency and harmonic confinement potential has important impact on excitation rate. → The findings could have important engineering applications. - Abstract: We explore the excitation profile of a repulsive impurity doped quantum dot under periodically fluctuating magnetic field. We have considered Gaussian impurity centers. The investigation reveals the roles subtly played by the dopant coordinate and the region of influence of the dopant to modulate the excitation pattern. The rate of transition to the excited states has been invoked to analyze the interplay between the above two impurity parameters in influencing the excitation process. The ratio of cyclotron frequency and harmonic confinement potential has important impact on excitation rate.

  14. Model-based clustered-dot screening

    Science.gov (United States)

    Kim, Sang Ho

    2006-01-01

    I propose a halftone screen design method based on a human visual system model and the characteristics of the electro-photographic (EP) printer engine. Generally, screen design methods based on human visual models produce dispersed-dot type screens while design methods considering EP printer characteristics generate clustered-dot type screens. In this paper, I propose a cost function balancing the conflicting characteristics of the human visual system and the printer. By minimizing the obtained cost function, I design a model-based clustered-dot screen using a modified direct binary search algorithm. Experimental results demonstrate the superior quality of the model-based clustered-dot screen compared to a conventional clustered-dot screen.

  15. Photoluminescence of a quantum-dot molecule

    International Nuclear Information System (INIS)

    The coherent coupling of quantum dots is a sensitive indicator of the energy and phase relaxation processes taking place in the nanostructure components. We formulate a theory of low-temperature, stationary photoluminescence from a quantum-dot molecule composed of two spherical quantum dots whose electronic subsystems are resonantly coupled via the Coulomb interaction. We show that the coupling leads to the hybridization of the first excited states of the quantum dots, manifesting itself as a pair of photoluminescence peaks with intensities and spectral positions strongly dependent on the geometric, material, and relaxation parameters of the quantum-dot molecule. These parameters are explicitly contained in the analytical expression for the photoluminescence differential cross section derived in the paper. The developed theory and expression obtained are essential in interpreting and analyzing spectroscopic data on the secondary emission of coherently coupled quantum systems

  16. Delay in DOTS for new pulmonary tuberculosis patient from rural area of Wardha District, India

    Directory of Open Access Journals (Sweden)

    Shilpa Bawankule

    2010-07-01

    Full Text Available Vast majority of active tuberculosis patients seeks treatment, do so promptly, still many patients spend a great deal of time and money “shopping for health” and too often they do not receive either accurate diagnosis or effective treatment, despite spending considerable resources. Objective: To find out the time taken to, for diagnosis of tuberculosis and to put patient on DOTS from the onset of symptoms and pattern of health seeking behavior of new pulmonary tuberculosis patients. A cross-sectional rapid assessment using qualitative (FGD and quantitative (Interview methods conducted at DOTS center of tertiary care hospital from rural Wardha. Participants: 53 pulmonary tuberculosis patients already on DOTS, in intensive phase. Main outcome measure: Delay in initiation of DOTS & health seeking behavior Results: Median total delay for starting DOTS was 111 days, (range: 10 to 321 days. Patient delay was more than provider delay. Patients delay was more in patients above 60 years, illiterate, per-capita income below 650 Rupees and HIV TB co-infection. Pattern of health seeking behavior was complex. Family physician was the preferred health care provider. Patient visited on an average four providers and spent around 1450 rupees (only direct cost before DOTS begin. Time taken from the onset of symptoms and start of DOT is a cause of concern for the tuberculosis control program. Early case detection is important rather than mere achieving target of 70% new case detection. Program manager needs to implement locally relevant & focused strategies for early case detection to improve the treatment success, especially in rural area of India.

  17. The Montreal classification for Crohn's disease: clinical application to a Brazilian single-center cohort of 90 consecutive patients Classificação de Montreal para doença de Crohn: aplicação clínica em uma coorte brasileira de 90 pacientes consecutivos

    Directory of Open Access Journals (Sweden)

    Ulysses dos Santos Torres

    2010-09-01

    Full Text Available CONTEXT: Crohn's disease presents very heterogeneous features from a clinical point of view, and classifying Crohn's disease patients in homogeneous subgroups in the light of genetic, molecular and clinical aspects is challenging. The Montreal Classification for Crohn's disease was proposed in 2005 as an effort to characterize Crohn's disease patients according to recent clinical and research advances in the field of inflammatory bowel disease. Since its proposition, the Montreal Classification needs an ample validation and application among different populations around the world. To date, there are no known studies applying the Montreal Classification to a Brazilian cohort of Crohn's disease patients. OBJECTIVES: To apply the Montreal Classification to a Brazilian cohort of Crohn's disease patients at a referral center for inflammatory bowel disease in Northwestern São Paulo State, Brazil. METHODS: We selected 90 consecutive well-characterized Crohn's disease patients assisted at Inflammatory Bowel Disease Outpatient Clinic between January 1992 and January 2007, with a minimum follow-up of 2 years; data concerning demographic characteristics, clinical onset of disease, age at diagnosis, time of disease, location and behavior of disease, presence of extraintestinal manifestations, familial occurrence, perianal involvement, treatment with biological drugs, and history of surgical treatment were evaluated. RESULTS: Male patients were predominant (54%, with a mean age at diagnosis of 33 ± 14 years old, and a median followup of 5.5 years. Most of the patients were diagnosed between 17 and 40 years old (59%, and had disease located in terminal ileum 46%, with a nonstricturing, nonpenetrating behavior (71%. Time of disease was correlated with necessity of biological treatment, disease behavior, and surgical treatment (PCONTEXTO: A doença de Crohn apresenta características bastante heterogêneas clinicamente, de modo que a classificação dos

  18. Ultra-large scale synthesis of high electrochemical performance SnO2 quantum dots within 5 min at room temperature following a growth self-termination mechanism

    International Nuclear Information System (INIS)

    Highlights: • SnO2 quantum dots were prepared at an ultra-large scale at room temperature within 5 min. • The grinding of SnCl2⋅2H2O and ammonium persulphate with morpholine produces quantum dots. • The reactions were self-terminated through the rapid consumption of water. • The obtained SnO2 quantum dots own high electrochemical performance. - Abstract: SnO2 quantum dots are prepared at an ultra-large scale by a productive synthetic procedure without using any organic ligand. The grinding of solid mixture of SnCl2⋅2H2O and ammonium persulphate with morpholine in a mortar at room temperature produces 1.2 nm SnO2 quantum dots within 5 min. The formation of SnO2 is initiated by the reaction between tin ions and hydroxyl groups generated from hydrolysis of morpholine in the released hydrate water from SnCl2⋅2H2O. It is considered that as water is rapidly consumed by the hydrolysis reaction of morpholine, the growth process of particles is self-terminated immediately after their transitory period of nucleation and growth. As a result of simple procedure and high toleration to scaling up of preparation, at least 50 g of SnO2 quantum dots can be produced in one batch in our laboratory. The as prepared quantum dots present high electrochemical performance due to the effective faradaic reaction and the alternative trapping of electrons and holes

  19. Quantum dots as mineral- and matrix-specific strain gages for bone biomechanical studies

    Science.gov (United States)

    Zhu, Peizhi; Xu, Jiadi; Morris, Michael; Ramamoorthy, Ayyalusamy; Sahar, Nadder; Kohn, David

    2009-02-01

    We report the use of quantum dots (Qdots) as strain gages in the study of bone biomechanics using solid state nuclear magnetic resonance (NMR) spectroscopy. We have developed solid state NMR sample cells for investigation of deformations of bone tissue components at loads up to several Mega Pascal. The size constraints of the NMR instrumentation limit the bone specimen diameter and length to be no greater than 2-3 mm and 30 mm respectively. Further, magic angle spinning (MAS) solid state NMR experiments require the use of non-metallic apparatus that can be rotated at kilohertz rates. These experimental constraints preclude the use of standard biomechanical measurement systems. In this paper we explore the use of quantum dot center of gravity measurement as a strain gage technology consistent with the constraints of solid state NMR. We use Qdots that bind calcium (625 nm emission) and collagen (705 nm emission) for measurement of strain in these components. Compressive loads are applied to a specimen in a cell through a fine pitch screw turned with a mini-torque wrench. Displacement is measured as changes in the positions of arrays of quantum dots on the surface of a specimen. Arrays are created by spotting the specimen with dilute suspensions of Qdots. Mineral labeling is achieved with 705 nm carboxylated dots and matrix labeling with 565 nm quantum dots conjugated to collagen I antibodies. After each load increment the new positions of the quantum dots are measured by fluorescence microscopy. Changes in Qdot center of gravity as a function of applied load can be measured with submicron accuracy.

  20. Electron transport in quantum dots

    CERN Document Server

    2003-01-01

    When I was contacted by Kluwer Academic Publishers in the Fall of 200 I, inviting me to edit a volume of papers on the issue of electron transport in quantum dots, I was excited by what I saw as an ideal opportunity to provide an overview of a field of research that has made significant contributions in recent years, both to our understanding of fundamental physics, and to the development of novel nanoelectronic technologies. The need for such a volume seemed to be made more pressing by the fact that few comprehensive reviews of this topic have appeared in the literature, in spite of the vast activity in this area over the course of the last decade or so. With this motivation, I set out to try to compile a volume that would fairly reflect the wide range of opinions that has emerged in the study of electron transport in quantum dots. Indeed, there has been no effort on my part to ensure any consistency between the different chapters, since I would prefer that this volume instead serve as a useful forum for the...

  1. Silicon quantum dots: surface matters

    International Nuclear Information System (INIS)

    Silicon quantum dots (SiQDs) hold great promise for many future technologies. Silicon is already at the core of photovoltaics and microelectronics, and SiQDs are capable of efficient light emission and amplification. This is crucial for the development of the next technological frontiers—silicon photonics and optoelectronics. Unlike any other quantum dots (QDs), SiQDs are made of non-toxic and abundant material, offering one of the spectrally broadest emission tunabilities accessible with semiconductor QDs and allowing for tailored radiative rates over many orders of magnitude. This extraordinary flexibility of optical properties is achieved via a combination of the spatial confinement of carriers and the strong influence of surface chemistry. The complex physics of this material, which is still being unraveled, leads to new effects, opening up new opportunities for applications. In this review we summarize the latest progress in this fascinating research field, with special attention given to surface-induced effects, such as the emergence of direct bandgap transitions, and collective effects in densely packed QDs, such as space separated quantum cutting. (topical review)

  2. Electronic states in vertically ordered Ge/Si quantum dots detected by photocurrent spectroscopy

    Science.gov (United States)

    Yakimov, A. I.; Kirienko, V. V.; Armbrister, V. A.; Bloshkin, A. A.; Dvurechenskii, A. V.

    2014-07-01

    We report on intraband photocurrent spectroscopy of sixfold stacked Ge/Si quantum dots embedded in a Si matrix and aligned along the growth direction. The dots are formed in a shape of pyramids with the average lateral size of 18 nm. The n-type heterostructures show broad spectral response ranging from 5 to 20 μm, depending on the polarization of the incoming infrared light. The normal incidence photocurrent peak centered around 12-15 μm is attributed to the transitions from the electron states localized in the Si region adjacent to the dots to continuum states of the Si matrix. The electron confinement is caused by a modification of the conduction band alignment induced by inhomogeneous tensile strain in Si around the buried Ge/Si quantum dots. Using the Ge content and dot shape determined by Raman and scanning tunneling microscopy analysis as input parameters for three-dimensional band structure simulations, a good agreement between measured and calculated electron binding energy is obtained. Photoluminescence spectroscopy and measurements of temperature dependence of dark conductance are used to correlate photocurrent results.

  3. Senior Centers

    Medline Plus

    Full Text Available ... variety of social and recreational activities. [Karen Albers] We provide a wide variety of activities -- physical, health, ... senior centers also offer exercise programs. [Karen Albers] We offer aerobics, tai chi, tap dancing, ballroom dancing, ...

  4. Senior Centers

    Medline Plus

    Full Text Available ... transportation, and meals programs are long-term care services available in the community which make it easier ... about senior centers and other long-term care services available in your community, contact the Eldercare Locator ...

  5. Senior Centers

    Medline Plus

    Full Text Available ... Karen Albers] We provide a wide variety of activities -- physical, health, mental health programs with Senior Plus, cognitive ... of games. [Narrator] Many senior centers also offer exercise programs. [Karen Albers] We offer aerobics, tai chi, ...

  6. Senior Centers

    Medline Plus

    Full Text Available [Narrator] Living independently at home is something many older adults would like to do as long as they can. Senior centers, adult day care, transportation, and meals programs are ...

  7. Senior Centers

    Medline Plus

    Full Text Available ... Living independently at home is something many older adults would like to do as long as they can. Senior centers, adult day care, transportation, and meals programs are long- ...

  8. Senior Centers

    Medline Plus

    Full Text Available ... of games. [Narrator] Many senior centers also offer exercise programs. [Karen Albers] We offer aerobics, tai chi, ... chi, tap dancing, ballroom dancing, square dancing, chair exercise, arthritis classes, yoga, and lots of dancing. [Narrator] ...

  9. Senior Centers

    Medline Plus

    Full Text Available ... something many older adults would like to do as long as they can. Senior centers, adult day care, transportation, ... adults who live independently can go to find a variety of social and recreational activities. [Karen Albers] ...

  10. Carbon-dot-decorated TiO₂ nanotube arrays used for photo/voltage-induced organic pollutant degradation and the inactivation of bacteria.

    Science.gov (United States)

    Feng, Lingyan; Sun, Hanjun; Ren, Jinsong; Qu, Xiaogang

    2016-03-18

    Photoluminescent carbon dots (c-dots) have recently attracted growing interest as a new member of the carbon-nanomaterial family. Here, we report for the first time that c-dot-decorated TiO2 nanotube arrays (c-dot/TiNTs) exhibit highly enhanced abilities regarding photo/voltage-induced organic pollutant degradation and bacterial inactivation. By applying UV irradiation (365 nm) or an electrochemical potential over 3 V (versus Ag/AgCl), an organic dye and a herbicide were efficiently degraded. Moreover, the inactivation of Gram-positive S. aureus and Gram-negative E. coli bacteria was realized on a c-dot/TiNT film. The c-dots were able to absorb light efficiently resulting in multiple exciton generation and also a reduction in the recombination of the e(-)/h(+) pair produced in c-dot/TiNT film during photo/voltage-induced degradation. It was also possible to readily regenerate the surface using ultraviolet light irradiation, leaving the whole film structure undamaged and with high reproducibility and stability. PMID:26870882

  11. Carbon-dot-decorated TiO2 nanotube arrays used for photo/voltage-induced organic pollutant degradation and the inactivation of bacteria

    Science.gov (United States)

    Feng, Lingyan; Sun, Hanjun; Ren, Jinsong; Qu, Xiaogang

    2016-03-01

    Photoluminescent carbon dots (c-dots) have recently attracted growing interest as a new member of the carbon-nanomaterial family. Here, we report for the first time that c-dot-decorated TiO2 nanotube arrays (c-dot/TiNTs) exhibit highly enhanced abilities regarding photo/voltage-induced organic pollutant degradation and bacterial inactivation. By applying UV irradiation (365 nm) or an electrochemical potential over 3 V (versus Ag/AgCl), an organic dye and a herbicide were efficiently degraded. Moreover, the inactivation of Gram-positive S. aureus and Gram-negative E. coli bacteria was realized on a c-dot/TiNT film. The c-dots were able to absorb light efficiently resulting in multiple exciton generation and also a reduction in the recombination of the e-/h+ pair produced in c-dot/TiNT film during photo/voltage-induced degradation. It was also possible to readily regenerate the surface using ultraviolet light irradiation, leaving the whole film structure undamaged and with high reproducibility and stability.

  12. Nonadiabatic dynamics in the CH3+HCl→CH4+Cl(2PJ) reaction

    International Nuclear Information System (INIS)

    Nonadiabatic dynamics in the title reaction have been investigated by 2+1 REMPI detection of the Cl(2P3/2) and Cl*(2P1/2) products. Reaction was initiated by photodissociation of CH3I at 266 nm within a single expansion of a dilute mixture of CH3I and HCl in argon, giving a mean collision energy of 7800 cm-1 in the center-of-mass frame. Significant production of Cl* was observed, with careful checks made to ensure that no additional photochemical or inelastic scattering sources of Cl* perturbed the measurements. The fraction of the total yield of Cl(2PJ) atoms formed in the J=(1/2) level at this collision energy was 0.150±0.024, and must arise from nonadiabatic dynamics because the ground potential energy surface correlates to CH4+Cl(2P3/2) products

  13. Extracellular biosynthesis of CdTe quantum dots by the fungus Fusarium oxysporum and their anti-bacterial activity

    Science.gov (United States)

    Syed, Asad; Ahmad, Absar

    2013-04-01

    The growing demand for semiconductor [quantum dots (Q-dots)] nanoparticles has fuelled significant research in developing strategies for their synthesis and characterization. They are extensively investigated by the chemical route; on the other hand, use of microbial sources for biosynthesis witnessed the highly stable, water dispersible nanoparticles formation. Here we report, for the first time, an efficient fungal-mediated synthesis of highly fluorescent CdTe quantum dots at ambient conditions by the fungus Fusarium oxysporum when reacted with a mixture of CdCl2 and TeCl4. Characterization of these biosynthesized nanoparticles was carried out by different techniques such as Ultraviolet-visible (UV-Vis) spectroscopy, Photoluminescence (PL), X-ray Diffraction (XRD), X-ray Photoelectron spectroscopy (XPS), Transmission Electron Microscopy (TEM) and Fourier Transformed Infrared Spectroscopy (FTIR) analysis. CdTe nanoparticles shows antibacterial activity against Gram positive and Gram negative bacteria. The fungal based fabrication provides an economical, green chemistry approach for production of highly fluorescent CdTe quantum dots.

  14. Energies and wave functions of an off-centre donor in hemispherical quantum dot: Two-dimensional finite difference approach and ritz variational principle

    Science.gov (United States)

    Nakra Mohajer, Soukaina; El Harouny, El Hassan; Ibral, Asmaa; El Khamkhami, Jamal; Assaid, El Mahdi

    2016-09-01

    Eigenvalues equation solutions of a hydrogen-like donor impurity, confined in a hemispherical quantum dot deposited on a wetting layer and capped by an insulating matrix, are determined in the framework of the effective mass approximation. Conduction band alignments at interfaces between quantum dot and surrounding materials are described by infinite height barriers. Ground and excited states energies and wave functions are determined analytically and via one-dimensional finite difference approach in case of an on-center donor. Donor impurity is then moved from center to pole of hemispherical quantum dot and eigenvalues equation is solved via Ritz variational principle, using a trial wave function where Coulomb attraction between electron and ionized donor is taken into account, and by two-dimensional finite difference approach. Numerical codes developed enable access to variations of donor total energy, binding energy, Coulomb correlation parameter, spatial extension and radial probability density with respect to hemisphere radius and impurity position inside the quantum dot.

  15. Study of thermoluminescence in K Cl crystals doped with Sr2+

    International Nuclear Information System (INIS)

    An attempt is made to correlate the F and Z1 (F center modified by the presence of a two-valence impurity pair and and positive ion vacancy) and a V center, with the T L curve peaks observed in pure K Cl crystals doped with Sr2+, irradiated at room temperature. (L.C.J.A.)

  16. High-resolution photocurrent microscopy using near-field cathodoluminescence of quantum dots

    Directory of Open Access Journals (Sweden)

    Heayoung P. Yoon

    2013-06-01

    Full Text Available We report a fast, versatile photocurrent imaging technique to visualize the local photo response of solar energy devices and optoelectronics using near-field cathodoluminescence (CL from a homogeneous quantum dot layer. This approach is quantitatively compared with direct measurements of high-resolution Electron Beam Induced Current (EBIC using a thin film solar cell (n-CdS / p-CdTe. Qualitatively, the observed image contrast is similar, showing strong enhancement of the carrier collection efficiency at the p-n junction and near the grain boundaries. The spatial resolution of the new technique, termed Q-EBIC (EBIC using quantum dots, is determined by the absorption depth of photons. The results demonstrate a new method for high-resolution, sub-wavelength photocurrent imaging measurement relevant for a wide range of applications.

  17. Quantitative cathodoluminescence (CL) spectroscopy of minerals: possibilities and limitations

    International Nuclear Information System (INIS)

    The luminescence spectrum of a mineral contains complex information related to the intrinsic crystal and the defect structure. For quantitative analysis of cathodoluminescence (CL) the spectra have to be deconvoluted by fitting and filtering procedures to identify and measure individual peaks. Peak-width, peak-position and transition probability of the luminescence centers are influenced by effects such as interactions within the defects themselves, and interaction between defects and the surrounding crystal lattice. For calcite and feldspar a linear correlation between the defect concentration of manganese and the Mn2+-activated CL-intensity is documented. Combined micro-particle induced x-ray emission (μ-PIXE) and CL-spectroscopy analyses of REE-doped synthetic calcite suggest a linear correlation between REE-activated CL intensity and REE-concentration at REE-concentration levels below approximately 500 ppm. Sensitizing and quenching by other REE are dominant effects yielding strong variations in the correlation between the REE-activated CL-intensity and the REE-content. (author)

  18. Photoluminescence and Scintulation properties of Pb2+ based quantum dots in CsCl host crystal

    Czech Academy of Sciences Publication Activity Database

    Nikl, Martin; Nitsch, Karel; Dafinei, T.; Lecoque, P.; Pazzi, G.P.; Fabeni, P.; Gurioli, M.

    Pittsburh : Materials Research Society, 1994 - (Weber, M.; Lecoq, P.; Ruchti, R.; Wiidy, C.; Yen, W.; Zhu, R.), s. 6-12 ISBN 1-55899-248-0. - (Materials Research Society Symposium Proceedings.. 348). [MRS Spring Meeting 1994. San Francisco (US), 04.04.1994-08.04.1994] Grant ostatní: EC Network (EU) CIPDCT940037

  19. Photoluminescence and scintillation properties of Pb2+ based quantum dots in CsCl host crystal

    Czech Academy of Sciences Publication Activity Database

    Nikl, Martin; Nitsch, Karel; Dafinei, I.; Lecoq, P.; Pazzi, G.P.; Fabeni, P.; Gurioli, M.

    Pittsburgh : Materials Research Society, 1994 - (Weber, M.; Lecog, P.; Ruchti, R.), s. 155-160 ISBN 1-55899-248-0. - (Materials Research Society Symposium Proceedings.. 348). [Scintillator and Phosphor Materials. San Francisco (US), 06.04.1994-08.04.1994] R&D Projects: GA ČR 02/93/2033 Grant ostatní: EC Network (EU) CIPDCT940037

  20. Time-bin Entanglement from Quantum Dots

    CERN Document Server

    Weihs, Gregor; Predojević, Ana

    2016-01-01

    The desire to have a source of single entangled photon pairs can be satisfied using single quantum dots as emitters. However, we are not bound to pursue only polarization entanglement, but can also exploit other degrees of freedom. In this chapter we focus on the time degree of freedom, to achieve so-called time-bin entanglement. This requires that we prepare the quantum dot coherently into the biexciton state and also build special interferometers for analysis. Finally this technique can be extended to achieve time-bin and polarization hyper-entanglement from a suitable quantum dot.

  1. Magnon-driven quantum dot refrigerators

    Science.gov (United States)

    Wang, Yuan; Huang, Chuankun; Liao, Tianjun; Chen, Jincan

    2015-12-01

    A new model of refrigerator consisting of a spin-splitting quantum dot coupled with two ferromagnetic reservoirs and a ferromagnetic insulator is proposed. The rate equation is used to calculate the occupation probabilities of the quantum dot. The expressions of the electron and magnon currents are obtained. The region that the system can work in as a refrigerator is determined. The cooling power and coefficient of performance (COP) of the refrigerator are derived. The influences of the magnetic field, applied voltage, and polarization of two leads on the performance are discussed. The performances of two different magnon-driven quantum dot refrigerators are compared.

  2. Introduction to the physics of quantum dots

    International Nuclear Information System (INIS)

    Quantum dots contain only a few well-defined energy levels for electron and/or holes as a result of the confinement of charge in all three spatial dimensions. Here, we describe both the application of photoluminescence spectroscopy and transport measurements to the characterisation of quantum dots and the novel phenomena that they exhibit. These include the Coulomb blockade, single electron tunneling and single photon detection. The impact of quantum dots on future electronics and directions for future research, such as in quantum computing and cryptography, are discussed. (author)

  3. Nonuniform magnetization reversals in elliptical permalloy dots

    Energy Technology Data Exchange (ETDEWEB)

    Lai, M.-F.; Wei, Z.-H. E-mail: zhwei@phys.ntu.edu.tw; Chang, Ching-Ray; Usov, N.A.; Wu, J.C.; Lai, Jun-Yang

    2004-11-01

    Reversible and irreversible magnetization processes of the single-domain elliptical permalloy dot are studied by simulation. The magnetization curve of the reversible process obtained by applying the field along the hard axis of the elliptical dot is almost linear, as is the case in the single-domain ellipsoidal particle. Due to the occurrence of the non uniform reversal, the switching field is reduced significantly compared to that predicted by the Stoner-Wohlfarth model. The nucleation fields of elliptical dots are calculated as a function of ellipse's aspect ratio, and the function reveals a step-like behavior.

  4. Structural and optical characterization of Si/Ge quantum dots

    OpenAIRE

    Wigblad, Dan

    2008-01-01

    In this study silicon-germanium quantum dots grown on silicon have been investigated. The aim of the work was to find quantum dots suitable for use as a thermistor material. The quantum dots were produced at KTH, Stockholm, using a RPCVD reactor that is designed for industrial production. The techniques used to study the quantum dots were: HRSEM, AFM, HRXRD, FTPL, and Raman spectroscopy. Quantum dots have been produced in single and multilayer structures. As a result of this work a multilayer...

  5. The white dot syndromes Síndromes dos pontos brancos retinianos

    Directory of Open Access Journals (Sweden)

    Raul Nunes Galvarro Vianna

    2007-06-01

    Full Text Available Several entities must be considered when a patient presents with a white dot syndrome. In most cases these can be distinguished from one another based on the appearance or distribution of the lesions, the clinical course, or patient variables such as age, sex, laterality, and functional and image examinations. In this paper we review the distinctive and shared features of the white dot syndromes, highlighting the clinical findings, diagnostic test results, proposed etiologies, treatment, and prognosis.Várias doenças devem ser consideradas quando nos deparamos com paciente com uma entidade clínica incluída no grupo das "síndromes dos pontos brancos retinianos". O diagnóstico diferencial na maioria das vezes é baseado na aparência e/ou na distribuição das lesões, no curso clínico, ou por algumas variáveis relacionadas ao paciente, tais como idade, sexo, lateralidade, bem como por meio de exames funcionais e de imagem. O presente artigo revisa os achados clínicos das doenças que fazem parte do grupo das "síndromes dos pontos brancos retinianos", enfatizando as similaridades e as diferenças entre essas entidades. Os exames complementares, bem como a etiologia, o tratamento e o prognóstico de cada uma delas são descritos e comentados.

  6. Evolução clínica de um grupo de pacientes com TB multirresistente atendidos em um centro de referência na cidade do Rio de Janeiro Clinical evolution of a group of patients with multidrug-resistant TB treated at a referral center in the city of Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Helio Ribeiro de Siqueira

    2009-01-01

    Full Text Available OBJETIVO: Analisar as características clínicas e a evolução de um grupo de pacientes com culturas de escarro positivas para Mycobacterium tuberculosis multirresistente (MR e tratados em um centro de referência no município do Rio de Janeiro. MÉTODOS: A partir dos resultados de M. tuberculosis MR em culturas de escarro, foram selecionados 50 pacientes cujos dados clínicos foram obtidos através do Banco de Dados TBMR do Ministério da Saúde. Foram considerados a frequência de abandono, as recidivas, as falências e os tratamentos prévios para TB até o diagnóstico de TBMR. O padrão radiológico foi classificado em uni- ou bilateral, e cavitário ou não. Dois anos após o término do tratamento padronizado para TBMR, o desfecho (cura, falência, abandono ou óbito de cada paciente foi avaliado e repetido a cada dois anos. O período de seguimento foi de oito anos após o tratamento. RESULTADOS: A média do número de tratamentos prévios foi de 2,3 ± 0,9. O tempo médio entre o diagnóstico inicial e o desenvolvimento de TBMR foi de 2 ± 1,7 anos. Após dois anos do tratamento inicial para TBMR houve 2 abandonos, 8 óbitos, 18 curas e 22 falências. A análise bivariada mostrou que o comprometimento pulmonar bilateral e o padrão cavitário reduziram acentuadamente a chance de cura, com risco relativo de 1-0,6 (40% e 1-0,7 (30%, respectivamente. Ao final do seguimento, houve 2 abandonos, 9 falências, 17 curas e 22 óbitos. CONCLUSÕES: O comprometimento pulmonar bilateral e lesões cavitárias reduziram a possibilidade de cura dos pacientes com TBMR. A maioria dos pacientes com falha de tratamento evoluiu para óbito no período de 8 anos.OBJECTIVE: To analyze the clinical characteristics and evolution of a group of patients with positive sputum cultures for multidrug-resistant (MDR Mycobacterium tuberculosis and treated at a referral center in the city of Rio de Janeiro, Brazil. METHODS: Based on the positive results in sputum

  7. Orifice diseases project - experience of the "Hospital das Clínicas" University of São Paulo Medical Center in day-hospital of anorectal disease Projeto doenças orificiais experiência do HCFMUSP em hospital-dia e doenças anorretais

    Directory of Open Access Journals (Sweden)

    Sergio Carlos Nahas

    1999-06-01

    Full Text Available The treatment of malignant or benign colorectal pathologies that require more complex management are priorities in tertiary hospitals such as "Hospital das Clínicas" University of São Paulo Medical Center (HCFMUSP. Therefore, benign, uncomplicated orifice conditions are relegated to second place. The number of patients with hemorrhoids, perianal fistulas, fissures, condylomas and pilonidal cysts who seek treatment at the HFMUSP is very great, resulting in over-crowding in the outpatient clinics and a long waiting list for recommended surgical treatment (at times over 18 months. The authors describe the experience of the HCFMUSP over an eight-day period with day-hospital surgery in which 140 patients underwent surgery. Data was prospectively taken on the patients undergoing surgery for benign orifice pathologies including age, sex, diagnosis, surgery performed, immediate and late postoperative complications, and follow-up. 140 patients operated on over eight days were studied. 68 were males (48.75% with ages ranging from 25 to 62 (mean 35.2 yrs.. Hemorrhoids was the most frequent condition encountered (82 hemorrhoidectomies, 58.6%, followed by perineal fistula (28 fistula repairs, 20.0%. The most common complication was headache secondary to rachianesthesia occurring in 9 patients (6.4%. One patient (0.7% developed bleeding immediately PO that required reoperation. Mean follow-up was 104 days. Day-surgery characterized by quality care and low morbidity is feasible in tertiary public hospitals, permitting surgery for benign orifice pathologies on many patients within a short period of time.O tratamento das patologias colorretais malignas ou benignas, que necessitam tratamento com maior grau de complexidade são prioridades em hospitais terciários, como é o Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo (HCFMUSP, permanecendo assim as patologias orificiais benignas em um segundo plano. Todavia devido à sua

  8. A simple turn on fluorescent sensor for the selective detection of thiamine using coconut water derived luminescent carbon dots.

    Science.gov (United States)

    Purbia, Rahul; Paria, Santanu

    2016-05-15

    In this study microwave-assisted hydrothermal method was used to prepare highly luminescent carbon dots (1-6 nm size) within a minute from tender coconut (Cocos nucifera) water. The synthesized carbon dots (C-dots) exhibit emission of blue and green lights while excited at 390 and 450 nm wavelengths, respectively. As an application, these C-dots were tested for a simple "turn on" fluorescent sensor for rapid detection of thiamine (vitamin B1). The detection of thiamine in human body is very important to prevent various diseases such as beriberi, neurological disorders, optic neuropathy, etc. The fluorescence emission intensity of C-dots quenches after addition of Cu(2+) ion and then again increases selectively (turn on) after the addition of thiamine. The fluorescence emission intensity enhancement of Cu(2+) ion modified C-dots in the presence of thiamine exhibits a linear relationship within the thiamine concentration range of 10-50 μM. The limit of detection was found to be 280 nM from this study. The selectivity of the detection was also tested in the presence of different organic molecules and inorganic ions (Ca(2+), Mg(2+), Na(+), K(+), Cl(-), SO4(2-), and NO3(-)) which are present in blood serum and urine and found to be almost no interference in the detection. Finally, to see the applicability in real samples a commercial vitamin capsule was tested and found less than 3% error in the detected concentration. The C-dots were also used for bioimaging of fungus and the results show they are also suitable for this application too. PMID:26745793

  9. ClEST cluster :Cl_singleton1421 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1421 atp-binding sub-family ... a member 4 Cimex lectularius nuclear gene 647 CTTGTATTTG ... AGAATGACTATGACG fw09043 1 ATP-binding cassette sub-family ... A (ABC1) member 4 [Bos taurus] DAA31386 ...

  10. ClEST cluster :Cl_contig0172 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0172 solute carrier family ... 25 member 38-like Cimex lectularius nuclear gene 712 GCATTAA ... 028 fw22041 3 PREDICTED: similar to solute carrier family ... 25 member 38 [Tribolium castaneum] XP_973832 3.3E- ...

  11. ClEST cluster :Cl_singleton1312 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleto n1312 1-o -acylceramide synthase Cimex lectularius nuclear gene 643 GAGATGCAAACACAAGCT ... GTGAGAGTTAATATTTTGTAAATGAAA fw05074 1 PREDICTED: gro up XV pho spho lipase A2-like iso fo rm 1 [Acyrtho sipho ... n pisum] XP_001951433 1.03386E-80 GO :0008415 ...

  12. ClEST cluster :Cl_contig0274 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_co ntig0274 apo lipo pro tein o -like Cimex lectularius nuclear gene 708 TCAAGCAAGGAGTCGGGTAATAGGA ... ACTCCTTTACACCACTGCAGGCGGTTCTG fs20086 mb19060 2 hypo thetical pro tein SINV_00148 [So leno psis invicta] EF ... Z14864 9.0E-17 N:GO :0035556 GO :0005834 GO :0004871 GO :0007186 ...

  13. ClEST cluster :Cl_singleton2087 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleto n2087 3-hydro xyiso butyrate dehydro genase Cimex lectularius nuclear gene 440 GAGTTTAGC ... TGAGTACAATCGATCCATCAGTTTCAAAAGAACT mb12038 1 3-hydro xyiso butyrate dehydro genase [Vibrio ... vulnificus MO 6- ... 24/O ] YP_004191179 1.0524E-25 GO :0005488 GO :0044281 GO : ... 0044237 GO :0016616 ...

  14. ClEST cluster :Cl_contig0030 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_co ntig0030 farneso ic acid o -methyl transferase Cimex lectularius nuclear gene 558 GCCAGTTAAGT ... 07060 fw08004 fw10082 fw14025 10 uncharacterized pro tein LO C100164577 [Acyrtho sipho n pisum] NP_00123309 ... 2 3.0E-48 GO :0016740 ...

  15. ClEST cluster :Cl_contig0419 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0419 vacuolar atp synthase ... subunit e ... Cime x le ctularius nucle ar ge ne ... 450 GGGCACTCGCAGTTA ... ACC fs20066 fw20016 2 Vacuolar proton pump subunit E ... [Camponotus floridanus] E FN63114 2.4E -37 GO:004277 ...

  16. ClEST cluster :Cl_contig0422 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig042 2 dead box atp-dependent rna Cimex lectularius nuclear gene 448 CATTTTAGCTGGAGTTTCAC ... AACATATCTTGCAACTTACAACCAAGTGTTCGAGAG fb07086 fw20024 2 ... DEAD box ATP-dependent RNA helicase putative [Ixo ... des scapularis] XP_002407896 4.7E-42 ...

  17. ClEST cluster :Cl_singleton0812 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0812 s-phase kinase-associated protein 1 Cimex lectularius nuclear gene 430 GGCCTCTT ... kinase-associated protein [Danaus plexippus] EHJ6542 9 6.56821E-42 ... GO:0016301 GO:0016310 GO:0006511 GO:0 ...

  18. ClEST cluster :Cl_singleton1538 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1538 dead (asp-glu-ala-asp) box polypeptide 5 Cimex lectularius nuclear...fw14079 1 similar to DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase 68kDa) [Xenopus laevis] NP_001079703 6.59566E-23 ...

  19. Photostimulated process in CsBrCl:Eu2+: a promising image screen phosphor

    International Nuclear Information System (INIS)

    CsBrCl and CsBrCl:Eu2+ have been grown by 'Double Run Bridgman technique'. Optical investigations have been carried out on the samples. The formation of F(Br-) and F(Cl-) centers have been confirmed by optical absorption bands at 640 and 615 nm, respectively. The photoluminescence (PL) spectra for europium (100 ppm) doped CsBrCl samples give emission of europium at 442 nm. This 442 nm emission is due to the transition from T2g component of 4f65d configuration to the ground state 8S of europium. The emission due to the presence of impurities in the host lattice is detected by PL technique. The OH- impurity in the host lattice due to decomposition of the salt in open air gives out emission at 395 and 365 nm. The O2- emission is observed at 465 and 468 nm. Photostimulated luminescence (PSL) process is studied in the samples by exciting them at F-absorption wavelength after irradiation. No PSL is observed for the undoped CsBrCl samples grown in vacuum. The PSL of vacuum grown CsBrCl:Eu2+ samples for excitations at 640 nm [F(Br-)] and 615 nm [F(Cl-)] is observed at 420 nm. It is deciphered that both F(Cl-) and F(Br-) centers contribute to PSL. The two F-centers noticed in absorption are stimulated separately; the resulting PSL signal confirms the participation of F-centers in photostimulated process. The lifetime of the PSL emission for CsBrCl:Eu2+ is determined to be 0.69 μs. Application of the material as a prospective image screen phosphor is elaborated based on PSL results

  20. Sociodemographic and clinical characteristics of a diabetic population at a primary level health care center Características sociodemográficas y clínicas de una población diabética en el nivel primario de atención a la salud Características sociodemográficas e clínicas de portadores de diabetes em um serviço de atenção básica à saúde

    Directory of Open Access Journals (Sweden)

    Liudmila Miyar Otero

    2007-10-01

    Full Text Available This study aimed to analyze the social-demographic, clinical and life habits characteristics of a diabetic population being treated in the primary level of a healthcare center. A total of 52 diabetic patients, enrolled, in 2006, in a Research and Extension Center linked to a University in Sao Paulo, participated in the study. The data were collected through interviews, using appropriated forms, after the patients consent. The results showed other illness associated to diabetes and an unsatisfactory metabolic control. These data can support health professionals' actions in order to effectively prevent and manage diabetes in the basic health services. The conclusion, in face of the obtained results, is that there is the need to develop courses to the health professionals of education in diabetes, aiming to meet the complexity of the care and progression of the disease in this clientele.Este estudio tiene como objetivo analizar las características sociodemográficas, clínicas y los hábitos de vida de una población diabética atendida en el nivel primario de atención a la salud. Participaron 52 diabéticos registrados en un Centro de Investigación y Extensión Universitaria en el interior del Estado de San Paulo, en 2006. Los datos fueron recolectados mediante entrevista, utilizando-se dos formularios, después del consentimiento de los sujetos. Los resultados mostraron que los sujetos presentaban otras enfermedades asociadas a la diabetes y controle metabólico insatisfactorio. Esos datos pueden subsidiar las acciones de los profesionales de salud para la efectiva prevención y el manejo de la diabetes en los servicios de atención básica de salud. Ante los resultados conseguidos, se concluye que es necesario incrementar cursos de calificación en educación en la diabetes para los profesionales de salud, con el objetivo de atender a la complejidad del cuidado y a la progresión de la enfermedad en esta población.Este estudo teve como

  1. Quantum dot devices for optical communications

    DEFF Research Database (Denmark)

    Mørk, Jesper

    2005-01-01

    record-low threshold currents and amplifiers with record-high power levels. In this tutorial we will review the basic properties of quantum dots, emphasizing the properties which are important for laser and amplifier applications, as well as devices for all-optical signal processing. The high....... The main property of semiconductor quantum dots compared to bulk material or even quantum well structures is the discrete nature of the allowed states, which means that inversion of the medium can be obtained for very low electron densities. This has led to the fabrication of quantum dot lasers with......Semiconductor quantum dots are often described as "artificial atoms": They are small nanometre-sized structures in which electrons only are allowed to exist at certain discrete levels due to size quantization, thus allowing the engineering of fundamental properties such as the coupling to light...

  2. Ge Quantum Dot Infrared Imaging Camera Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Luna Innovations Incorporated proposes to develop a high performance Ge quantum dots-based infrared (IR) imaging camera on Si substrate. The high sensitivity, large...

  3. Large quantum dots with small oscillator strength

    DEFF Research Database (Denmark)

    Stobbe, Søren; Schlereth, T.W.; Höfling, S.;

    2010-01-01

    We have measured the oscillator strength and quantum efficiency of excitons confined in large InGaAs quantum dots by recording the spontaneous emission decay rate while systematically varying the distance between the quantum dots and a semiconductor-air interface. The size of the quantum dots is...... measured by in-plane transmission electron microscopy and we find average in-plane diameters of 40 nm. We have calculated the oscillator strength of excitons of that size assuming a quantum-dot confinement given by a parabolic in-plane potential and a hard-wall vertical potential and predict a very large...... oscillator strength due to Coulomb effects. This is in stark contrast to the measured oscillator strength, which turns out to be so small that it can be described by excitons in the strong confinement regime. We attribute these findings to exciton localization in local potential minima arising from alloy...

  4. Quantum Phase Transitions in Quantum Dots

    OpenAIRE

    Rau, I. G.; Amasha, S.; Oreg, Y.; Goldhaber-Gordon, D.

    2013-01-01

    This review article describes theoretical and experimental advances in using quantum dots as a system for studying impurity quantum phase transitions and the non-Fermi liquid behavior at the quantum critical point.

  5. Density of Trap States and Auger-mediated Electron Trapping in CdTe Quantum-Dot Solids.

    Science.gov (United States)

    Boehme, Simon C; Azpiroz, Jon Mikel; Aulin, Yaroslav V; Grozema, Ferdinand C; Vanmaekelbergh, Daniël; Siebbeles, Laurens D A; Infante, Ivan; Houtepen, Arjan J

    2015-05-13

    Charge trapping is an ubiquitous process in colloidal quantum-dot solids and a major limitation to the efficiency of quantum dot based devices such as solar cells, LEDs, and thermoelectrics. Although empirical approaches led to a reduction of trapping and thereby efficiency enhancements, the exact chemical nature of the trapping mechanism remains largely unidentified. In this study, we determine the density of trap states in CdTe quantum-dot solids both experimentally, using a combination of electrochemical control of the Fermi level with ultrafast transient absorption and time-resolved photoluminescence spectroscopy, and theoretically, via density functional theory calculations. We find a high density of very efficient electron traps centered ∼0.42 eV above the valence band. Electrochemical filling of these traps increases the electron lifetime and the photoluminescence quantum yield by more than an order of magnitude. The trapping rate constant for holes is an order of magnitude lower that for electrons. These observations can be explained by Auger-mediated electron trapping. From density functional theory calculations we infer that the traps are formed by dicoordinated Te atoms at the quantum dot surface. The combination of our unique experimental determination of the density of trap states with the theoretical modeling of the quantum dot surface allows us to identify the trapping mechanism and chemical reaction at play during charge trapping in these quantum dots. PMID:25853555

  6. Synthesis, characterization, and third-order nonlinear optical properties of copper quantum dots embedded in sodium borosilicate glass

    International Nuclear Information System (INIS)

    Highlights: ► The sodium borosilicate glass doped Cu quantum dots have been prepared by sol–gel route. ► The crystal structure and composition of as-prepared glass were investigated by XRD and XPS. ► Size and distribution of indium nanocrystals was determined by TEM and STEM. ► The third-order optical nonlinearity was investigated by using Z-scan technique. - Abstract: Copper quantum dots embedded in sodium borosilicate glass matrix were fabricated and analyzed in terms of their structural, chemical, and optical properties. X-ray powder diffraction (XRD) and X-ray photoelectron spectroscopy (XPS) analyses revealed that copper quantum dots were in face-centered-cubic crystalline phase and in the metallic state. Size and distribution of the quantum dots were measured by transmission electron microscopy (TEM) as well as high-resolution transmission electron microscopy (HRTEM). The results showed spherical shape have formed uniformly in the glass, and the size of these quantum dots were range from 1.5 to 5 nm with the average particle size about 2.7 nm. The third-order nonlinear optical properties of copper quantum dots doped glass were investigated by using Z-scan technique at the wavelength of 800 nm with femtosecond Ti: sapphire laser radiation. The value of third-order optical nonlinear susceptibility χ(3) of the glass was estimated to be 2.41 × 10−11 esu.

  7. Senior Centers

    Medline Plus

    Full Text Available ... provide a wide variety of activities -- physical, health, mental health programs with Senior Plus, cognitive programs, a wide variety of general activities, billiards, Bingo, lots of games. [Narrator] Many senior centers also offer exercise programs. [Karen Albers] We offer aerobics, tai chi, ...

  8. Hastings Center

    Science.gov (United States)

    ... BLOG We have long had the ability, we humans, to work outside the bounds of evolution. Dairy cattle, maize, and all sorts of dog ... intervention. However, in the past, the scope of human intervention was rather… Read more Share: ... Evolution? Read more HASTINGS NEWS Hastings Center research scholar ...

  9. Senior Centers

    Medline Plus

    Full Text Available ... dancing. [Narrator] These centers can provide entree to new activities and expand a person’s social contacts. [Karen ... meeting all their interests and introducing them to new things; whether it’s an arts and crafts project, ...

  10. Senior Centers

    Medline Plus

    Full Text Available ... transportation, and meals programs are long-term care services available in the community which make it easier for older adults to ... about senior centers and other long-term care services available in your community, contact the Eldercare Locator at 1-800-677- ...

  11. Magnetic resonance study of the radiolysis products in chlorinated SrCl2:Fe crystals

    International Nuclear Information System (INIS)

    The main objective of the research presented in this thesis has been to investigate by magnetic resonance techniques and Electron Nuclear Double Resonance (EPR and ENDOR) the atomic structure and properties of the impurity associated paramagnetic point defects produced by X-ray irradiation at low temperature (T=80 K) in chlorinated SrCl2 crystals doped with iron. The original results can be summarized as follows: 1. The tetragonal Fe+ (I) center, produced after X-ray irradiation at liquid nitrogen temperature of chlorinated SrCl2:Fe2+ single crystals and stable up to 700 K, has been studied with X- and Q- band ENDOR. The shf interactions of the unpaired electrons with the Cl nuclei of the first ligand shell and with the central 57Fe nucleus have been identified in the ENDOR spectra. The reconstruction of the X-band EPR spectrum using the ENDOR data showed that all eight Cl ions in the first shell are equivalent. Hence the center has D4h symmetry. Moreover, the ENDOR data strongly suggested that the first shell of Cl ions exhibits a tetragonal compression, confirming the EPR analysis. The simplest structural model which can explain all experimental data consists of an interstitial Fe+ ion with two neighboring substitutional cation impurities, most likely K+, on opposite sites along the tetragonal axis of the center. 2. The tetragonal Fe+ (II) center, produced after X-ray irradiation at liquid nitrogen temperature of chlorinated SrCl2:Fe crystals, which is unstable at RT, has been studied by X- and Q- band ENDOR. Interaction of the unpaired electrons with the Cl nuclei of the first ligand shell and with an impurity lying along the tetragonal axis of the center have been identified and analyzed in the ENDOR spectra. The experimental values of the isotropic and anisotropic shf constants for the first 3''5Cl shell have been used to determine the unpaired spin densities in the 3s and 3p chlorine orbitals as f3s = 0.27% and f3p = 1.95 % respectively, resulting in a total

  12. Measurement of the absorption cross sections of SiCl_4, SiCl_3, SiCl_2 and Cl at H Lyman-α wavelength

    OpenAIRE

    Mével, R.; Catoire, L.; M. Fikri; Roth, P.

    2013-01-01

    Atomic resonance absorption spectroscopy coupled with a shock tube is a powerful technique for studying high temperature dynamics of reactive systems. Presently, high temperature pyrolysis of SiCl_4–Ar mixtures has been studied behind reflected shock waves. Using time-resolved absorption profiles at 121.6 nm and a detailed reaction model, the absorption cross sections of SiCl_4, SiCl_3, SiCl_2 and Cl have been measured. Results agree well with available data for SiCl_4 and constitute, to our ...

  13. Magnetic quantum dots and magnetic edge states

    International Nuclear Information System (INIS)

    Starting with defining the magnetic edge state in a magnetic quantum dot, which becomes quite popular nowadays conjunction with a possible candidate for a high density memory device or spintronic materials, various magnetic nano-quantum structures are reviewed in detail. We study the magnetic edge states of the two dimensional electron gas in strong perpendicular magnetic fields. We find that magnetic edge states are formed along the boundary of the magnetic dot, which is formed by a nonuniform distribution of magnetic fields. These magnetic edge states circulate either clockwise or counterclockwise, depending on the number of missing flux quanta, and exhibit quite different properties, as compared to the conventional ones which are induced by electrostatic confinements in the quantum Hall system. We also find that a close relation between the quantum mechanical eigenstates and the classical trajectories in the magnetic dot. When a magnetic dot is located inside a quantum wire, the edge-channel scattering mechanism by the magnetic quantum dot is very different from that by electrostatic dots. Here, the magnetic dot is formed by two different magnetic fields inside and outside the dot. We study the ballistic edge-channel transport and magnetic edge states in this situation. When the inner field is parallel to the outer one, the two-terminal conductance is quantized and shows the features of a transmission barrier and a resonator. On the other hand, when the inner field is reversed, the conductance is not quantized and all channels can be completely reflected in some energy ranges. The difference between the above two cases results from the distinct magnetic confinements. We also describe successfully the edge states of magnetic quantum rings and others in detail

  14. Coherent scattering in a small quantum dot

    International Nuclear Information System (INIS)

    Ballistic transport in an open small (100 nm) three-terminal quantum dot based on the high-mobility two-dimensional electron gas of the AlGaAs/GaAs heterojunction has been analyzed. It has been shown that the gate oscillations of resistance of such a dot arise due to the coherent scattering of electrons on its quasidiscrete levels being suppressed by a weak magnetic field

  15. Exploring Extragalactic Emission: The Hα Dot Survey

    Science.gov (United States)

    Rampalli, Rayna; Salzer, John Joseph

    2016-01-01

    The Hα Dot Survey was established as a result of finding point sources of strong line emission in the data obtained for the ALFALFA Hα Survey (Van Sistine et al. 2015). In the latter survey, broad-band R and narrow-band Hα filters were used to examine target galaxies from the ALFALFA blind HI survey (Giovanelli et al. 2005, Haynes et al. 2011). In the process of reducing the ALFALFA Hα Survey data the "Hα Dots" were discovered (Kellar et al. 2008, 2012). Using specialized image analysis tools, a large population of dots has already been detected in the more than 1500 ALFALFA Hα narrow-band images taken with the 0.9m WIYN and 2.1m KPNO telescopes. Follow-up spectra of over 200 Hα Dots discovered from the 0.9m images reveal that these objects are a mix of nearby low-luminosity star-forming galaxies, compact starbursts and Seyfert 2 galaxies at intermediate redshifts, and high-redshift QSOs. Here we present the first list of Hα Dots detected using 2.1m telescope data. The 2.1m images yield a sample of Dots that average almost two magnitudes fainter than those detected with the 0.9m. The current REU project is designed to characterize the set of Hα Dots detected in the deeper 2.1m telescope images, while the broad goals of the Hα Dot Survey include the desire to understand better the chemical evolution of galaxies over cosmic time. This project was supported in part by the NSF REU grant 1358980, by the Maria Mitchell Association (Nantucket, MA), and by the Massachusetts Space Grant Consortium.

  16. Quantum dot cascade laser: Arguments in favor

    OpenAIRE

    Dmitriev, I. A.; Suris, R. A.

    2007-01-01

    Quantum cascade lasers are recognized as propitious candidates for future terahertz optoelectronics. Here we demonstrate several definite advantages of quantum dot cascade structures over quantum well devices, which suffer fundamental performance limitations owing to continuous carrier spectrum. The discrete spectrum of quantum dots opens an opportunity to control the non-radiative relaxation and optical loss and also provides for more flexibility in the choice of an optical and electrical de...

  17. Electronic Commerce Beyond the "dot com" Boom

    OpenAIRE

    James A. Senn

    2000-01-01

    The explosion of interest in electronic commerce stemming from commercial use of the Internet triggered high expectations, and accompanying high stock market value for public companies specializing in the delivery of products and services through this channel. However, the boom in the market value of these so-called "dot com" companies appears to be over. This paper examines the factors underlying the fall off in the value of "dot com" companies, focusing on the manner in which fundamental bu...

  18. clOpenCL - supporting distributed heterogeneous computing in HPC clusters

    OpenAIRE

    Alves, Albano; Rufino, José; Pina, António; Santos, Luis Paulo

    2013-01-01

    Clusters that combine heterogeneous compute device architectures, coupled with novel programming models, have created a true alternative to traditional (homogeneous) cluster computing, allowing to leverage the performance of parallel applications. In this paper we introduce clOpenCL, a platform that supports the simple deployment and efficient running of OpenCL-based parallel applications that may span several cluster nodes, expanding the original single-node OpenCL model. clOpenCL is deploye...

  19. Positioning of quantum dots on metallic nanostructures

    International Nuclear Information System (INIS)

    The capability to position individual emitters, such as quantum dots, near metallic nanostructures is highly desirable for constructing active optical devices that can manipulate light at the single photon level. The emergence of the field of plasmonics as a means to confine light now introduces a need for high precision and reliability in positioning any source of emission, which has thus far been elusive. Placing an emission source within the influence of plasmonic structures now requires accuracy approaching molecular length scales. In this paper we report the ability to reliably position nanoscale functional objects, specifically quantum dots, with sub-100-nm accuracy, which is several times smaller than the diffraction limit of a quantum dot's emission light. Electron beam lithography-defined masks on metallic surfaces and a series of surface chemical functionalization processes allow the programmed assembly of DNA-linked colloidal quantum dots. The quantum dots are successfully functionalized to areas as small as (100 nm)2 using the specific binding of thiolated DNA to Au/Ag, and exploiting the streptavidin-biotin interaction. An analysis of the reproducibility of the process for various pattern sizes shows that this technique is potentially scalable to the single quantum dot level with 50 nm accuracy accompanied by a moderate reduction in yield.

  20. Formation and ordering of epitaxial quantum dots

    Science.gov (United States)

    Atkinson, Paola; Schmidt, Oliver G.; Bremner, Stephen P.; Ritchie, David A.

    2008-10-01

    Single quantum dots (QDs) have great potential as building blocks for quantum information processing devices. However, one of the major difficulties in the fabrication of such devices is the placement of a single dot at a pre-determined position in the device structure, for example, in the centre of a photonic cavity. In this article we review some recent investigations in the site-controlled growth of InAs QDs on GaAs by molecular beam epitaxy. The method we use is ex-situ patterning of the GaAs substrate by electron beam lithography and conventional wet or dry etching techniques to form shallow pits in the surface which then determine the nucleation site of an InAs dot. This method is easily scalable and can be incorporated with marker structures to enable simple post-growth lithographic alignment of devices to each site-controlled dot. We demonstrate good site-control for arrays with up to 10 micron spacing between patterned sites, with no dots nucleating between the sites. We discuss the mechanism and the effect of pattern size, InAs deposition amount and growth conditions on this site-control method. Finally we discuss the photoluminescence from these dots and highlight the remaining challenges for this technique. To cite this article: P. Atkinson et al., C. R. Physique 9 (2008).

  1. Quantum-dot-in-perovskite solids

    KAUST Repository

    Ning, Zhijun

    2015-07-15

    © 2015 Macmillan Publishers Limited. All rights reserved. Heteroepitaxy - atomically aligned growth of a crystalline film atop a different crystalline substrate - is the basis of electrically driven lasers, multijunction solar cells, and blue-light-emitting diodes. Crystalline coherence is preserved even when atomic identity is modulated, a fact that is the critical enabler of quantum wells, wires, and dots. The interfacial quality achieved as a result of heteroepitaxial growth allows new combinations of materials with complementary properties, which enables the design and realization of functionalities that are not available in the single-phase constituents. Here we show that organohalide perovskites and preformed colloidal quantum dots, combined in the solution phase, produce epitaxially aligned \\'dots-in-a-matrix\\' crystals. Using transmission electron microscopy and electron diffraction, we reveal heterocrystals as large as about 60 nanometres and containing at least 20 mutually aligned dots that inherit the crystalline orientation of the perovskite matrix. The heterocrystals exhibit remarkable optoelectronic properties that are traceable to their atom-scale crystalline coherence: photoelectrons and holes generated in the larger-bandgap perovskites are transferred with 80% efficiency to become excitons in the quantum dot nanocrystals, which exploit the excellent photocarrier diffusion of perovskites to produce bright-light emission from infrared-bandgap quantum-tuned materials. By combining the electrical transport properties of the perovskite matrix with the high radiative efficiency of the quantum dots, we engineer a new platform to advance solution-processed infrared optoelectronics.

  2. Coherent transport through interacting quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Hiltscher, Bastian

    2012-10-05

    The present thesis is composed of four different works. All deal with coherent transport through interacting quantum dots, which are tunnel-coupled to external leads. There a two main motivations for the use of quantum dots. First, they are an ideal device to study the influence of strong Coulomb repulsion, and second, their discrete energy levels can easily be tuned by external gate electrodes to create different transport regimes. The expression of coherence includes a very wide range of physical correlations and, therefore, the four works are basically independent of each other. Before motivating and introducing the different works in more detail, we remark that in all works a diagrammatic real-time perturbation theory is used. The fermionic degrees of freedom of the leads are traced out and the elements of the resulting reduced density matrix can be treated explicitly by means of a generalized master equation. How this equation is solved, depends on the details of the problem under consideration. In the first of the four works adiabatic pumping through an Aharonov-Bohm interferometer with a quantum dot embedded in each of the two arms is studied. In adiabatic pumping transport is generated by varying two system parameters periodically in time. We consider the two dot levels to be these two pumping parameters. Since they are located in different arms of the interferometer, pumping is a quantum mechanical effect purely relying on coherent superpositions of the dot states. It is very challenging to identify a quantum pumping mechanism in experiments, because a capacitive coupling of the gate electrodes to the leads may yield an undesired AC bias voltage, which is rectified by a time dependent conductance. Therefore, distinguishing features of these two transport mechanisms are required. We find that the dependence on the magnetic field is the key feature. While the pumped charge is an odd function of the magnetic flux, the rectified current is even, at least in

  3. Coherent transport through interacting quantum dots

    International Nuclear Information System (INIS)

    The present thesis is composed of four different works. All deal with coherent transport through interacting quantum dots, which are tunnel-coupled to external leads. There a two main motivations for the use of quantum dots. First, they are an ideal device to study the influence of strong Coulomb repulsion, and second, their discrete energy levels can easily be tuned by external gate electrodes to create different transport regimes. The expression of coherence includes a very wide range of physical correlations and, therefore, the four works are basically independent of each other. Before motivating and introducing the different works in more detail, we remark that in all works a diagrammatic real-time perturbation theory is used. The fermionic degrees of freedom of the leads are traced out and the elements of the resulting reduced density matrix can be treated explicitly by means of a generalized master equation. How this equation is solved, depends on the details of the problem under consideration. In the first of the four works adiabatic pumping through an Aharonov-Bohm interferometer with a quantum dot embedded in each of the two arms is studied. In adiabatic pumping transport is generated by varying two system parameters periodically in time. We consider the two dot levels to be these two pumping parameters. Since they are located in different arms of the interferometer, pumping is a quantum mechanical effect purely relying on coherent superpositions of the dot states. It is very challenging to identify a quantum pumping mechanism in experiments, because a capacitive coupling of the gate electrodes to the leads may yield an undesired AC bias voltage, which is rectified by a time dependent conductance. Therefore, distinguishing features of these two transport mechanisms are required. We find that the dependence on the magnetic field is the key feature. While the pumped charge is an odd function of the magnetic flux, the rectified current is even, at least in

  4. Experiments towards size and dopant control of germanium quantum dots for solar applications

    OpenAIRE

    Brittany L. Oliva-Chatelain; Barron, Andrew R.

    2015-01-01

    While the literature for the doping of silicon quantum dots (QDs) and nanocrystals (NCs) is extensive, reports of doping their germanium analogs are sparse. We report a range of attempts to dope Ge QDs both during and post-synthesis. The QDs have been characterized by TEM, XPS, and I/V measurements of SiO2 coated QD thin films in test cells using doped Si substrates. The solution synthesis of Ge QDs by the reduction of GeCl4 with LiAlH4 results in Ge QDs with a low level of chlorine atoms on ...

  5. Effect of tunneling injection on the modulation response of quantum dot lasers

    Directory of Open Access Journals (Sweden)

    Y. Yekta kiya

    2014-03-01

    Full Text Available In this paper, modulation bandwidth characteristics of InGaAs/GaAs quantum dot (QD laser were theoretically investigated. Simulation was done by using the fourth order Runge-Kutta method. Effect of carrier relaxation life time, temperature and current density on characteristics of tunneling injection QD laser (TIL and conventional QD laser (CL were analyzed. Results showed that tunneling injection in QD laser increases the modulation bandwidth indicating that it is very useful for using in the fiber optic communication systems.

  6. Study on Interaction Between Chitosan and CdS Quantum Dots via Photoluminescence Spectra

    Institute of Scientific and Technical Information of China (English)

    Zhan LI; Yu Min DU; Yan WEN

    2004-01-01

    The interaction between CdS quantum dots and amino polysaccharide chitosan in aqueous solution was studied via photoluminescence(PL)spectra. The surface binding of chitosan with different molecular weight(MW)quenched the luminescence of QDs due to the elimination of radioactive anion vacancy centers.This process fits well with the Perrin model;lower MW chitosan exhibits higher quenching efficiency due to better availability to the surface.

  7. Templating growth of gold nanostructures with a CdSe quantum dot array

    OpenAIRE

    Paul, Neelima; Metwalli, Ezzeldin; Yao, Yuan; Schwartzkopf, Matthias; Yu, Shun; Roth, Stephan V.; Müller-Buschbaum, Peter; Paul, Amitesh

    2015-01-01

    In optoelectronic devices based on quantum dot arrays, thin nanolayers of gold are preferred as stable metal contacts and for connecting recombination centers. The optimal morphology requirements are uniform arrays with precisely controlled positions and sizes over a large area with long range ordering since this strongly affects device performance. To understand the development of gold layer nanomorphology, the detailed mechanism of structure formation are probed with time-resolved grazing i...

  8. Structure and function of collectin liver 1 (CL-L1) and collectin 11 (CL-11, CL-K1)

    DEFF Research Database (Denmark)

    Selman, Lana; Hansen, Soren

    2012-01-01

    The collectins are a group of innate immune proteins structurally characterized by their content of a carbohydrate recognition domain and a collagen-like region. Collectin liver 1 (CL-L1) and collectin 11 (CL-11, alias collectin kidney 1, CL-K1) are the more recently described members of this group...

  9. Comparison of two methods for selegiline determination: A flow-injection chemiluminescence method using cadmium sulfide quantum dots and corona discharge ion mobility spectrometry

    Science.gov (United States)

    Khataee, Alireza; Lotfi, Roya; Hasanzadeh, Aliyeh; Iranifam, Mortaza; Zarei, Mahmoud; Joo, Sang Woo

    2016-01-01

    Two analytical approaches including chemiluminescence (CL) and corona discharge ionization ion mobility spectrometry (CD-IMS) were developed for sensitive determination of selegiline (SG). We found that the CL intensity of the KMnO4-Na2S2O3 CL system was significantly enhanced in the presence of L-cysteine capped CdS quantum dots (QDs). A possible CL mechanism for this CL reaction is proposed. In the presence of SG, the enhanced CL system was inhibited. Based on this inhibition, a simple and sensitive flow-injection CL method was proposed for the determination of SG. Under optimum experimental conditions, the decreased CL intensity was proportional to SG concentration in the range of 0.01 to 30.0 mg L- 1. The detection limit (3σ) was 0.004 mg L- 1. Also, SG was determined using CD-IMS, and under optimum conditions of CD-IMS, calibration curves were linear in the range of 0.15 to 42.0 mg L- 1, with a detection limit (3σ) of 0.03 mg L- 1. The precision of the two methods was calculated by analyzing samples containing 5.0 mg L- 1 of SG (n = 11). The relative standard deviations (RSDs%) of the flow-injection CL and CD-IMS methods are 2.17% and 3.83%, respectively. The proposed CL system exhibits a higher sensitivity and precision than the CD-IMS method for the determination of SG.

  10. The interaction of CsCl with films of solid water

    CERN Document Server

    Borodin, A; Krischok, S; Kempter, V

    2003-01-01

    The interaction of CsCl molecules with films of solid water (three layers thick, typically), deposited on a tungsten crystal at 130 K, was studied. Metastable impact electron spectroscopy (MIES) and UPS(HeI) were applied to study the emission from Cl3p and Cs5p and the highest occupied states 1b sub 1 , 3a sub 1 and 1b sub 2 of molecular water. Below a critical stoichiometry of about CsCl centre dot nH sub 2 O with n=6 the UPS spectra are quite similar to those from chlorides solvated in liquid water in as much as the relative positions and intensities of the water and salt features are concerned; very little emission from the ionization of Cl3p and Cs5p is observed with MIES. We conclude that the CsCl molecules become solvated in the water film. As long as n>6, the water spectrum remains characteristic for condensed water; at n6, water molecules not involved directly into the hydration of the salt molecules desorb around 140 K. Around 160 K all water has disappeared from the surface. Above this temperature o...

  11. Condensation of flowing steam with binary nucleation of NaCl and water

    OpenAIRE

    Šejna M.; Šťastný M.

    2007-01-01

    The effects of chemistry on the flowing steam nucleation are in particular unexplained. An approach is used in the paper which is based on binary nucleation of main impurity NaCl and water. Physical and mathematical models are described and are applied on the steam flow with condensation in convergent-divergent nozzle. Binary nucleation numerical model is applied for the calculation of the flow with condensation in nozzle with expansion rate in divergent nozzle part dot{ar{P}} = 4 500 1/s. Th...

  12. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  13. Centered Pyramids

    OpenAIRE

    Brigger, P.; F. Müller; Illgner, K.; Unser, M.

    1999-01-01

    Quadtree-like pyramids have the advantage of resulting in a multiresolution representation where each pyramid node has four unambiguous parents. Such a centered topology guarantees a clearly defined up-projection of labels. This concept has been successfully and extensively used in applications of contour detection, object recognition and segmentation. Unfortunately, the quadtree-like type of pyramid has poor approximation powers because of the employed piecewise-constant image model. This pa...

  14. ZZ DLC-2D/100G, 100 Neutron-Group Cross-Section Library by SUPERTOG Calculation for ANISN, DOT

    International Nuclear Information System (INIS)

    1 - Nature of physical problem solved: Format: ANISN, DOT or DTF-4; Number of groups: 100; Nuclides: H, D, He, He-3, Li-6, Li-7, Be-9, B-10, B-11, C-12, N-14, O-16, Na-23, Mg, Al-27, Si, Cl, K, Ca, V, Cr, Mn-55, Fe, Co-59, Ni, Cu, Cu-63, Cu-65, Nb, Mo, Ag-107, Xe-135, Cs-133, Sm-149, Eu-151, Eu-153, Gd, Dy-164, Lu-175, Lu-176, Ta-181, Ta-182, W-182, W-183, W-184, W-186, Re-185, Re-187, Au-197, Pb, Th-232, Pa-233, U-234, U-235, U-238, Pu-238, Pu-239, Pu-240, Pu-241, Pu-242, Am-241, Am-243, and Cm-244. Origin: The nuclides in DLC-2 are those which have been released as category I ENDF/B by the National Neutron Cross Section Center, Brookhaven National Laboratory. Weighting spectrum: The explicit assumption was made that the flux has the shape of a fission spectrum joined at 0.0674 MeV by a 1/E tail. Neutron transport calculations can be performed with DLC-2 data. Since the data are intended for use in multigroup discrete-ordinates or Monte Carlo transport codes which treat anisotropic scattering, possible cross section angular expansion is limited only by the options available in the particular code used. Specifically, the retrieval program manipulates DLC-2 such that it conforms to input requirements of the ANISN, DOT, or DTF-4 codes, or any computer code using data in the ANISN or DTF-4 format. The nuclides in DLC-2 are those which have been released as category I ENDF/B by the National Neutron Cross Section Center, Brookhaven National Laboratory. The library contains data for H, D, He, 3-He, 6-Li, 7-Li, 9-Be, 10-B, 11-B, 12-C, 14-N, 16-O, 23-Na, Mg, 27-Al, Si, Cl, K, Ca, V, Cr, 55-Mn, Fe, 59-Co, Ni, Cu, 63-Cu, 65-Cu, Nb, Mo, 107-Ag, 135-Xe, 133-Cs, 149-Sm, 151-Eu, 153-Eu, Gd, 164-Dy, 175-Lu, 176-Lu, 181-Ta, 182-Ta, 182-W, 183-W, 184-W, 186-W, 185-Re, 187-Re, 197-Au, Pb, 232-Th, 233-Pa, 234-U, 235-U, 238-U, 238-Pu, 239-Pu, 240-Pu, 241-Pu, 242-Pu, 241-Am, 243-Am, and 244-Cm. 2 - Method of solution: DLC-2 was generated by SUPERTOG from nuclear data in either point

  15. Realistic model of a vertical pillar quantum dot: Analysis of individual dot data

    NARCIS (Netherlands)

    Maksym, P.A.; Nishi, Y.; Austing, D.G.; Hatano, T.; Kouwenhoven, L.P.; Aoki, H.; Tarucha, S.

    2009-01-01

    An accurate model of a vertical pillar quantum dot is described. The full three-dimensional structure of the device containing the dot is taken into account and this leads to an effective two-dimensional model in which electrons move in the two lateral dimensions, the confinement is parabolic, and t

  16. IRASM Center

    International Nuclear Information System (INIS)

    IRASM is a national center for radiation processing developed around an industrial Co60 gamma irradiator. Being a department in an R and D national institute, IRASM Center is dealing with radiation treatment, pre/post microbiological control, validation of irradiation sterilization, detection of irradiated foodstuffs. Training is available for operators of new irradiation facilities focused on radiation technologies, dosimetry, sterilization, food treatment, conservation by irradiation of cultural heritage, quality assurance. Expertise on proper choosing the plastics for packaging versus dose is offered to the potential clients. IRASM Center is also involved in interdisciplinary applied research like chitosan treatment, sterile male technique or implementation of irradiation step in production of pharmaceuticals. All important activities: irradiation treatment, dosimetry, microbiology, detection of irradiated food, radioprotection, nuclear safety, physical protection. are performed in accordance with the proper standards in the frame of a certified quality management system. In this way Co60 industrial sources, a byproduct of certain nuclear power plants like Candu type, appear to be the key of a large technical and R and D domain. (authors)

  17. Near-infrared luminescence in bismuth-doped TlCl crystal

    CERN Document Server

    Plotnichenko, V G; Philippovskiy, D V; Lisitsky, E M Dianov I S; Kouznetsov, M S; Zaramenskikh, K S; 10.1364/OL.38.000362

    2013-01-01

    Experimental and theoretical studies of spectral properties of crystalline TlCl:Bi are performed. Two broad near-infrared luminescence bands with a lifetime about 0.25 ms are observed: a strong band near 1.18 mkm excited by 0.40, 0.45, 0.70 and 0.80 mkm radiation, and a weak band at > 1.5 mkm excited by 0.40 and 0.45 mkm radiation. Computer modeling of Bi-related centers in TlCl lattice suggests that Bi^+__V^-(Cl) center (Bi^+ in Tl site and a negatively charged Cl vacancy in the nearest anion site) is most likely responsible for the IR luminescence.

  18. (In,Mn)As multilayer quantum dot structures

    International Nuclear Information System (INIS)

    (In,Mn)As multilayer quantum dots structures were grown by molecular beam epitaxy using a Mn selective doping of the central parts of quantum dots. The study of the structural and magneto-optical properties of the samples with three and five layers of (In,Mn)As quantum dots has shown that during the quantum dots assembly, the out-diffusion of Mn from the layers with (In,Mn)As quantum dots can occur resulting in the formation of the extended defects. To produce a high quality structures using the elaborated technique of selective doping, the number of (In,Mn)As quantum dot layers should not exceed three

  19. Tendencias de cesáreas en relación con factores no clínicos en un centro de educación para el parto en la Ciudad de México Trends in caesarean sections associated with non-clinical factors in a Birthing Educational Center in Mexico City

    OpenAIRE

    Lourdes Campero; Bernardo Hernández; Ahidée Leyva; Fátima Estrada; Jomo Osborne; Sara Morales

    2007-01-01

    OBJETIVOS: Describir las tendencias de la operación cesárea (OC) asociadas con factores no clínicos en mujeres que asistieron al Centro de Educación para el Parto (CEPAPAR) en la Ciudad de México. MATERIAL Y MÉTODOS: Se analizó información de 992 nacimientos de 847 mujeres, ocurridos entre 1988 y 2000. Se utilizó el método de regresión lineal para identificar el comportamiento de factores no clínicos con respecto a la tendencia de OC. RESULTADOS: La incidencia global de OC fue de 32.8%, con 8...

  20. Submonolayer Quantum Dot Infrared Photodetector

    Science.gov (United States)

    Ting, David Z.; Bandara, Sumith V.; Gunapala, Sarath D.; Chang, Yia-Chang

    2010-01-01

    A method has been developed for inserting submonolayer (SML) quantum dots (QDs) or SML QD stacks, instead of conventional Stranski-Krastanov (S-K) QDs, into the active region of intersubband photodetectors. A typical configuration would be InAs SML QDs embedded in thin layers of GaAs, surrounded by AlGaAs barriers. Here, the GaAs and the AlGaAs have nearly the same lattice constant, while InAs has a larger lattice constant. In QD infrared photodetector, the important quantization directions are in the plane perpendicular to the normal incidence radiation. In-plane quantization is what enables the absorption of normal incidence radiation. The height of the S-K QD controls the positions of the quantized energy levels, but is not critically important to the desired normal incidence absorption properties. The SML QD or SML QD stack configurations give more control of the structure grown, retains normal incidence absorption properties, and decreases the strain build-up to allow thicker active layers for higher quantum efficiency.

  1. Non-Equilibrium Electron Transport through a Double Quantum Dot System: Study of Two Exchange Coupled Quantum Dots in a 4-Terminal Geometry

    OpenAIRE

    Koerting, Verena

    2007-01-01

    In this thesis we study two exchange-coupled quantum dots with an emphasis on non-equilibrium physics. Assuming a single electron on each quantum dot, the double quantum dot system is characterized by an interplay between the Kondo spin coupling of the dots with the leads and the spin-exchange coupling between the dots. We find that a finite voltage on one quantum dot drives the other quantum dot out of equilibrium.

  2. Thermodynamic modeling and experimental investigations of the CsCl-CaCl2-PuCl3 system

    International Nuclear Information System (INIS)

    The CsCl-CaCl2-PCl3 ternary diagram was calculated from the known binary diagrams. The various principle features, ternary eutectics and peritectics, were verified experimentally by differential thermal analysis. Also, the phase boundaries lying in the polythermal section between a PuCL3 mole fraction of 0.4 on the CsCl-PuCl3 binary and CaCl2 were determined experimentally in some detail. Because the measurements agree well with the prediction, it is assumed that the calculation together with the experimental verification of some of the points has established the entire ternary phase diagram. In addition, d-spacing data from the X-ray diffraction pattern of the compound CsPu2Cl7 are reported. (orig.)

  3. Diamagnetic susceptibility of a confined donor in inhomogeneous quantum dots

    Science.gov (United States)

    Rahmani, K.; Zorkani, I.; Jorio, A.

    2011-03-01

    The binding energy and diamagnetic susceptibility χdia are estimated for a shallow donor confined to move in GaAs-GaAlAs inhomogeneous quantum dots. The calculation was performed within the effective mass approximation and using the variational method. The results show that the binding energy and the diamagnetic susceptibility χdia depend strongly on the core radius and the shell radius. We have demonstrated that there is a critical value of the ratio of the inner radius to the outer radius which may be important for nanofabrication techniques. The binding energy Eb shows a minimum for a critical value of this ratio depending on the value of the outer radius and shows a maximum when the donor is placed at the center of the spherical layer. The diamagnetic susceptibility is more sensitive to variations of the radius for a large spherical layer. The binding energy and diamagnetic susceptibility depend strongly on the donor position.

  4. Profiling the local carrier concentration across a semiconductor quantum dot

    Energy Technology Data Exchange (ETDEWEB)

    Walrath, J. C.; Lin, Yen-Hsiang [Department of Physics, University of Michigan, Ann Arbor, Michigan 48109 (United States); Huang, S. [Department of Materials Science and Engineering, University of Michigan, Ann Arbor, Michigan 48109 (United States); Goldman, R. S., E-mail: rsgold@umich.edu [Department of Physics, University of Michigan, Ann Arbor, Michigan 48109 (United States); Department of Materials Science and Engineering, University of Michigan, Ann Arbor, Michigan 48109 (United States)

    2015-05-11

    We profile the local carrier concentration, n, across epitaxial InAs/GaAs quantum dots (QDs) consisting of 3D islands on top of a 2D alloy layer. We use scanning thermoelectric microscopy to measure a profile of the temperature gradient-induced voltage, which is converted to a profile of the local Seebeck coefficient, S. The S profile is then converted to a conduction band-edge profile and compared with Poisson-Schrodinger band-edge simulations. Our combined computational-experimental approach suggests a reduced carrier concentration in the QD center in comparison to that of the 2D alloy layer. The relative roles of free carrier trapping and/or dopant expulsion are discussed.

  5. Solar System Portrait - Earth as 'Pale Blue Dot

    Science.gov (United States)

    1990-01-01

    This narrow-angle color image of the Earth, dubbed 'Pale Blue Dot', is a part of the first ever 'portrait' of the solar system taken by Voyager 1. The spacecraft acquired a total of 60 frames for a mosaic of the solar system from a distance of more than 4 billion miles from Earth and about 32 degrees above the ecliptic. From Voyager's great distance Earth is a mere point of light, less than the size of a picture element even in the narrow-angle camera. Earth was a crescent only 0.12 pixel in size. Coincidentally, Earth lies right in the center of one of the scattered light rays resulting from taking the image so close to the sun. This blown-up image of the Earth was taken through three color filters -- violet, blue and green -- and recombined to produce the color image. The background features in the image are artifacts resulting from the magnification.

  6. Magnetic alteration of entanglement in two-electron quantum dots

    CERN Document Server

    Simonovic, N S

    2015-01-01

    Quantum entanglement is analyzed thoroughly in the case of the ground and lowest states of two-electron axially symmetric quantum dots under a perpendicular magnetic field. The individual-particle and the center-of-mass representations are used to study the entanglement variation at the transition from interacting to noninteracting particle regimes. The mechanism of symmetry breaking due to the interaction, that results in the states with symmetries related to the later representation only, being entangled even at the vanishing interaction, is discussed. The analytical expression for the entanglement measure based on the linear entropy is derived in the limit of noninteracting electrons. It reproduces remarkably well the numerical results for the lowest states with the magnetic quantum number M>2 in the interacting regime. It is found that the entanglement of the ground state is a discontinuous function of the field strength. A method to estimate the entanglement of the ground state, characterized by the quan...

  7. Diamagnetic susceptibility of a confined donor in inhomogeneous quantum dots

    International Nuclear Information System (INIS)

    The binding energy and diamagnetic susceptibility χdia are estimated for a shallow donor confined to move in GaAs-GaAlAs inhomogeneous quantum dots. The calculation was performed within the effective mass approximation and using the variational method. The results show that the binding energy and the diamagnetic susceptibility χdia depend strongly on the core radius and the shell radius. We have demonstrated that there is a critical value of the ratio of the inner radius to the outer radius which may be important for nanofabrication techniques. The binding energy Eb shows a minimum for a critical value of this ratio depending on the value of the outer radius and shows a maximum when the donor is placed at the center of the spherical layer. The diamagnetic susceptibility is more sensitive to variations of the radius for a large spherical layer. The binding energy and diamagnetic susceptibility depend strongly on the donor position.

  8. Impurity-modulated Aharonov-Bohm oscillations and intraband optical absorption in quantum dot-ring nanostructures

    Science.gov (United States)

    Barseghyan, M. G.; Manaselyan, A. Kh.; Laroze, D.; Kirakosyan, A. A.

    2016-07-01

    In this work we study the electronic states in quantum dot-ring complex nanostructures with an on-center hydrogenic impurity. The influence of the impurity on Aharonov-Bohm energy spectra oscillations and intraband optical absorption is investigated. It is shown that in the presence of a hydrogenic donor impurity the Aharonov-Bohm oscillations in quantum dot-ring structures become highly tunable. Furthermore, the presence of the impurity drastically changes the intraband absorption spectra due to the strong controllability of the electron localization type.

  9. Surface plasmon-assisted optical bistability in the quantum dot-metal nanoparticle hybrid system

    Science.gov (United States)

    Bao, Chengjun; Qi, Yihong; Niu, Yueping; Gong, Shangqing

    2016-07-01

    We theoretically investigated optical bistability (OB) of a coupled excition-plasmon hybrid system in a unidirectional ring cavity. It is found that the threshold and the region of OB can be tuned by adjusting the center-center distance between the quantum dot and metal nanoparticle (MNP), the Rabi frequency of the control field and the radius of the MNP. Due to the significantly enhanced optical nonlinearity by the surface plasmon effect, the threshold of OB can be decreased greatly when the probe field is parallel to the major axis of the hybrid system. The enhanced OB may have promising applications in optical switching and optical storage.

  10. Heterogeneous Computing with OpenCL

    CERN Document Server

    Gaster, Benedict; Kaeli, David R; Mistry, Perhaad; Schaa, Dana

    2011-01-01

    Heterogeneous Computing with OpenCL teaches OpenCL and parallel programming for complex systems that may include a variety of device architectures: multi-core CPUs, GPUs, and fully-integrated Accelerated Processing Units (APUs) such as AMD Fusion technology. Designed to work on multiple platforms and with wide industry support, OpenCL will help you more effectively program for a heterogeneous future. Written by leaders in the parallel computing and OpenCL communities, this book will give you hands-on OpenCL experience to address a range of fundamental parallel algorithms. The authors explore m

  11. CL from ZnO nanowires and microneedles Co-doped with N and Mn

    International Nuclear Information System (INIS)

    Cathodoluminescence (CL) was used to study the luminescence emission of ZnO : N, Mn nanowires and microneedles grown by thermal evaporation. CL spectra acquired at room temperature showed the presence of near band edge and defect-related emissions. The defect related emission comprised two bands centered at 2.28 and 2.5 eV. The first component was attributed to the formation of spinel ZnMn2O4 and the second to the well-known ZnO green emission. CL spectra acquired at 100 K showed two emissions centered at 3.22 and 3.25 eV that were attributed to donor–acceptor pair (DAP) and FA transitions, respectively. It was proposed that substitutional nitrogen (NO) and zinc interstitial (Zni) were acceptor and shallow-donor centers in the DAP transition. (paper)

  12. CL from ZnO nanowires and microneedles Co-doped with N and Mn

    Science.gov (United States)

    Herrera, M.; Morales, A.; Díaz, J. A.

    2014-05-01

    Cathodoluminescence (CL) was used to study the luminescence emission of ZnO : N, Mn nanowires and microneedles grown by thermal evaporation. CL spectra acquired at room temperature showed the presence of near band edge and defect-related emissions. The defect related emission comprised two bands centered at 2.28 and 2.5 eV. The first component was attributed to the formation of spinel ZnMn2O4 and the second to the well-known ZnO green emission. CL spectra acquired at 100 K showed two emissions centered at 3.22 and 3.25 eV that were attributed to donor-acceptor pair (DAP) and FA transitions, respectively. It was proposed that substitutional nitrogen (NO) and zinc interstitial (Zni) were acceptor and shallow-donor centers in the DAP transition.

  13. Donor energy levels of a spherical quantum dot subject to parallel electric and magnetic fields

    Energy Technology Data Exchange (ETDEWEB)

    Souza, Gustavo V.B. de; Bruno-Alfonso, Alexys [UNESP, SP (Brazil)

    2011-07-01

    Full text. Quantum dots are quasi-zero-dimensional semiconductor structures that have been intensively investigated in the last two decades. On the one hand, they are interesting for basic science, because they can be seen as artificial atoms. Therefore, the theories of one and several particles in atoms and molecules may be tested and developed in a different scale. On the other hand, they are technologically relevant because their absorption and emission of light may be tailored by controlling their sizes, shapes and composition. Moreover, the addition of impurities and the application of electromagnetic fields further affect the electronic and optical properties of the quantum dots. In this work, the ground and excited states of a donor impurity at the center of a spherical semiconductor quantum dot, in the presence of parallel electric and magnetic fields, are calculated within the effective-mass approximation. The confining barrier of the dot is assumed to be infinitely high and the Schroedinger equation is solved by a finite-difference technique. This involves the derivation of appropriate boundary conditions and the computational diagonalization of large sparse matrices. The numerical results for the energy levels and the binding and transition energies are compared with available variational values. The iso-probability surfaces of the calculated states are displayed for different strengths of the applied fields. In this way, we are able to discuss the confining and ionizing effects of the fields

  14. Reactions Between Humic Acid Solutions and Excessive ClO2 or Cl2

    Institute of Scientific and Technical Information of China (English)

    GE Yuan-xin; ZHU Zhi-liang; MA Hong-mei; ZHAO Jian-fu

    2007-01-01

    Reactions between humic acid solutions and excessive ClO2 or Cl2 have been investigated. Under various experimental conditions, the removal efficiency of TOC, UV254 and A140 from humic acid solutions were examined. The relationship between the removal efficiency and the consumption of ClO2 or Cl2 was discussed. The results showed that the maximum demand of ClO2 was 2.19 mg/mg TOC for the humic acid solution under the experimental conditions, and that of Cl2 was 1.88 mg/mg TOC. The variation tendency of ClO2 consumption was similar to that of Cl2. TOC of humic acid solutions decreased 15.2% and 15.6% after the reaction with ClO2 or Cl2 respectively. Under the experimental conditions, 21.4% of unsaturated bonds and 52.8% of humic acid color were removed by ClO2 in 168 h. As for Cl2, removal efficiency of unsaturated bonds and humic acid color were 16.8% and 41.7% respectively. Larger molecules from humic acid were oxidized to smaller molecules by ClO2 and Cl2. Higher oxidation potential of ClO2 than that of Cl2 was also indicated by variation of UV254/A410 ratios. The similar tendency, that exhibited faster variation in the initial 24 h, existed for all the research factors.

  15. Satisfaction levels among patients availing DOTS services in Bundelkhand Region (UP, India: Evidence from patient exit-interviews

    Directory of Open Access Journals (Sweden)

    Shalini Srivastav

    2014-01-01

    Full Text Available Context: Patient satisfaction is a determinant of treatment uptake and adherence to Directly Observed Treatment Short course (DOTS therapy for Tuberculosis (TB. Waiting time, staff′s attitude and improvement in symptoms may affect patient′s satisfaction. Aims: The rationale of the present study is to assess the levels of satisfaction among patients utilizing the DOTS services and the factors contributing toward patient satisfaction. Settings and Design: Cross-sectional study. Study Duration: Jan 2009 to March 2009. Study Area: Four Designated Microscopic Centers (DMCs of District Jhansi. Materials and Methods: Exit interviews of all the patients who were diagnosed as TB cases and put on DOTS in the first quarter of 2009 (i.e., subjects registered from 1 st January 2009 to 31 st March 2009 at four selected DMCs were taken on pre-tested questionnaire. Statistical Analysis: Results are expressed in percentages. Results: Average waiting time at center reported was 5-10 minutes by majority of cases (42.7%. Approx.78.6% patients were fully satisfied with the services provided at the centers. Lack of financial burden was the most common reason for satisfaction (95.4%, followed by improvement in symptoms (75%. Most common problems faced by the patients was difficult in coming on alternate days (30.0% followed by loss of wages and transport charges (26.8%. Conclusion: The study findings could potentially be explored to improve DOTS services to attain maximum satisfaction among TB patients.

  16. Colloidal Quantum dot photovoltaics: Tuning optoelectronic properties

    International Nuclear Information System (INIS)

    Full text: Colloidal quantum dots combine processing from the solution phase with tunability of the bandgap. Via the size-effect the optical properties can be matched to the solar spectrum for a wide-range photon harvesting. To engineer photovoltaic devices, quantum dots are compressed from their colloidal form into a close-packed nanocrystal matrix, while undergoing a systematic layer-by-layer process. The resulting quantum dot solid is treated as semiconductor medium - one having electron-hole mobilites, free carrier densities and a dielectric constant. While the size-effect determined the band-gap before, it is now the nature of ligand and the treatment route, that influences mentioned electronic parameters. We took the view on the processing steps and found a concept for analysing trap states, moblility and device performance in real quantum dot solids. Our findings emphasize the interplay of mobility and trap-distribution with routes that take special care on the nanocrystal surface and hence conserve optoelectronic qualities of quantum dots for efficient photovoltaic cells. (author)

  17. ESR of trapped centers in γ irradiated silver chlorates single crystals

    International Nuclear Information System (INIS)

    The paramagnetic centers O-3, ClO2, and (ClO2--Cl)- have been identified in irradiated AgClO3 single crystals by X and Q band ESR experiments at room temperatures and by the optical absorption bands at 480 and 360 nm, characteristic of the first two centers, respectively. The ESR spectrum and its angular dependence show that the first two centers have two magnetically inequivalent sites per unit cell. The third center was clearly observed only at certain orientations. The data for ClO2 show that the principal directions of the g and A tensors do not coincide; the two magnetically inequivalent sites have similar principal values of the g and A tensors related by a 900 rotation about the tetragonal crystal axis of symmetry, and can therefore be assumed to be chemically equivalent. It is found that the ClO2 center is formed substitutionally in the ClO-3 ion position, but that the ozonide O-3 is not. The thermal annealing of the γ irradiated AgClO3 has revealed an increase in the concentration of the O-3 radical that seems to be connected with the simultaneous destruction of the ClO2 center

  18. un clúster empresarial

    Directory of Open Access Journals (Sweden)

    Laura Marcela López Posada

    2006-01-01

    Full Text Available Los clústeres empresariales se han constituido en mecanismos para impulsar la competitividad de sectores en regiones y tradicionalmente han sido analizados desde la perspectiva económica (por su aporte en variables macroeconómicas, pero para su consolidación todo conglomerado empresarial requiere la comprensión de relaciones sociales, culturales y políticas. Resulta difícil estudiar estas relaciones desde teorías organizacionales tradicionales como la estructuralista o la contingencial, y se debe recurrir a otras perspectivas como el neoinstitucionalismo sociológico, enfoque que es utilizado en la presente investigación. La investigación fundamento del artículo se hizo en un sector considerado dinámico para el eje cafetero como es el de herramientas, la cual fue abordada desde un enfoque cualitativo mediante la aplicación de dos guías de entrevista semiestructurada (se aplicaron a treinta empresas de la cadena productiva y a nueve entidades de apoyo, diario de campo y análisis de fuentes documentales. Se concluye que en el clúster predominan el individualismo, la descon- fianza y la ausencia de elementos identitarios, simultáneamente con fuertes lazos comerciales y prácticas de gestión que se han institucionalizado por procesos isomórficos.

  19. Cs3ScCl6.

    Science.gov (United States)

    Ward, Matthew D; Ibers, James A

    2014-06-01

    Crystals of tricaesium scandium(III) hexa-chloride were obtained as a side product from the reaction of U, SnCl2, Sc, and S in a CsCl flux at 1073 K. Cs3ScCl6 crystallizes in the Rb3YCl6 structure type. The asymmetric unit comprises three Cs sites, two Sc sites, and six Cl sites, all of which have site symmetry 1, except for the two Sc sites that have site symmetries of 2 and -1, respectively. The structure is composed of isolated [ScCl6](3-) octa-hedra that are surrounded by Cs(+) cations. Two Cs(+) cations have inter-actions with eight Cl(-) anions, while the third has inter-actions with ten Cl(-) anions. PMID:24940185

  20. Integration of informal medical practitioners in DOTS implementation to improve case detection rate

    International Nuclear Information System (INIS)

    To integrate informal registered medical practitioners (IRMP) in Directly Observed Therapy Short Course (DOTS) implementation to improve case detection rate. This interventional study was conducted in the settlement area of Malir district whereas New Karachi was taken as control, between February to November 2005. All registered health care providers within 5 kilometer around Tuberculosis (T8) DOTS center Malir were included. New sputum positive and sputum direct smear negative cases of pulmonary Tuberculosis above 15 years residing in the catechumen's area were included as target population. Informal registered medical practitioners were trained for the referral of suspected cases to the TB DOTs center where three sputum samples were taken, and X-ray chest was done to confirm if sputum direct smear (D/S) was negative. Demographic data regarding age, gender, address, case number, onset of symptoms, treatment given, response, compliance to treatment was all collected. Out of 64 health care providers there were a drop out of 6 leaving 58 informal registered medical practitioners (36 homeopathic/ 22 Hakims) who referred 54 cases, of these 16 cases were actual suspects. Two out of these 16 (12.5%) were Tuberculosis positive. One was Sputum D/S positive and the other sputum direct smear negative with X-ray chest positive. Comparison of data (Malir and New Karachi diagnostic center) showed that by incorporating homeopathic and Hakims an increase in the proportion of case identification (0.477) was significantly higher in Malir (intervention area) vs New Karachi (non-intervention area) (0.316). Integration of informal registered medical practitioners was found to be effective in DOTS implementation hence they can be incorporated in other national programmes to improve public health (JPMA 60:33; 2010). (author)

  1. Nanosized Carbon Dots from Organic Matter and Biomass

    Institute of Scientific and Technical Information of China (English)

    LI Yuanyuan; CHEN Tong; MA Yulong

    2016-01-01

    Carbon nanoparticles (C-dots) were prepared by relfuxing the combustion soots of candles and corn stalk in nitric acid. The synthesized C-dots were characterized. The results showed a sharp increase in oxygen content and a sharp decrease in carbon content after oxidation. The C-dots had -OH and -CO2H groups introduced which made them hydrophilic. However, their difference was also obvious. The C-dots from candle soot had a 10-45 nm broad particle size distribution, and those from corn stalk soot had a 6-18 nm relatively small and narrow size distribution. The C-dots were mainly ofsp2 andsp3 carbon structure different from the C-dots of diamond-like structure from candle soot. Interestingly, two kinds of C-dots all exhibited unique photoluminescent properties. The obtained C-dots have potential applications in a broad range of areas.

  2. Origins and optimization of entanglement in plasmonically coupled quantum dots

    Science.gov (United States)

    Otten, Matthew; Larson, Jeffrey; Min, Misun; Wild, Stefan M.; Pelton, Matthew; Gray, Stephen K.

    2016-08-01

    A system of two or more quantum dots interacting with a dissipative plasmonic nanostructure is investigated in detail by using a cavity quantum electrodynamics approach with a model Hamiltonian. We focus on determining and understanding system configurations that generate multiple bipartite quantum entanglements between the occupation states of the quantum dots. These configurations include allowing for the quantum dots to be asymmetrically coupled to the plasmonic system. Analytical solution of a simplified limit for an arbitrary number of quantum dots and numerical simulations and optimization for the two- and three-dot cases are used to develop guidelines for maximizing the bipartite entanglements. For any number of quantum dots, we show that through simple starting states and parameter guidelines, one quantum dot can be made to share a strong amount of bipartite entanglement with all other quantum dots in the system, while entangling all other pairs to a lesser degree.

  3. Quantum dot optoelectronic devices: lasers, photodetectors and solar cells

    International Nuclear Information System (INIS)

    Nanometre-scale semiconductor devices have been envisioned as next-generation technologies with high integration and functionality. Quantum dots, or the so-called ‘artificial atoms’, exhibit unique properties due to their quantum confinement in all 3D. These unique properties have brought to light the great potential of quantum dots in optoelectronic applications. Numerous efforts worldwide have been devoted to these promising nanomaterials for next-generation optoelectronic devices, such as lasers, photodetectors, amplifiers, and solar cells, with the emphasis on improving performance and functionality. Through the development in optoelectronic devices based on quantum dots over the last two decades, quantum dot devices with exceptional performance surpassing previous devices are evidenced. This review describes recent developments in quantum dot optoelectronic devices over the last few years. The paper will highlight the major progress made in 1.3 μm quantum dot lasers, quantum dot infrared photodetectors, and quantum dot solar cells. (topical review)

  4. Inorganic passivation and doping control in colloidal quantum dot photovoltaics

    KAUST Repository

    Hoogland, Sjoerd H.

    2012-01-01

    We discuss strategies to reduce midgap trap state densities in colloidal quantum dot films and requirements to control doping type and magnitude. We demonstrate that these improvements result in colloidal quantum dot solar cells with certified 7.0% efficiency.

  5. National Health Information Center

    Science.gov (United States)

    ... ODPHP National Health Information Center National Health Information Center The National Health Information Center (NHIC) is sponsored ... interest View the NHO calendar . Federal Health Information Centers and Clearinghouses Federal Health Information Centers and Clearinghouses ...

  6. Thermodynamic Optimization of DyCl3 -NaCl System

    Institute of Scientific and Technical Information of China (English)

    叶信宇; 孙益民; 张静; 谈君君

    2005-01-01

    In this paper, the phase diagram of the DyCl3 -NaCl system is optimized and calculated with CALPHAD ( calculation of phase diagram ) technology. A set of thermodynamic functions of compounds Na3 DyCl6, NaDyCl4, and NaDY2 Cl7 have been optimized and calculated based on an interactive computer-assisted analysis. The optimized thermodynamic parameters, calculated phase diagram and experimental phase diagram are thermodynamically serf-consistent.

  7. Solubility polytherms of NaCl(KCl)-GdCl3-H2O system

    International Nuclear Information System (INIS)

    The isothermal method in the temperature range from 25 up to 100 deg C has been used to study the solubility in the NaCl-GdCl3-H2O and KCl-GdCl3-H2O systems. The limits of the NaCl, KCl and GdCl3x6H2O crystallization are discriminated. Solubility polytherms of the systems are plotted

  8. Few-quantum-dot lasing in photonic crystal nanocavities

    DEFF Research Database (Denmark)

    Liu, Jin; Ates, Serkan; Stobbe, Søren; Lorke, Michael; Lodahl, Peter

    2012-01-01

    A very smooth lasing transition in photonic crystal nanocavities with embedded quantum dots is observed and compared to the theory. Decay rate measurements reveal that only a few quantum dots are feeding the cavity.......A very smooth lasing transition in photonic crystal nanocavities with embedded quantum dots is observed and compared to the theory. Decay rate measurements reveal that only a few quantum dots are feeding the cavity....

  9. Luminescence Spectra of a Quantum-Dot Cascade Laser

    OpenAIRE

    Apalkov, Vadim; Chakraborty, Tapash

    2000-01-01

    A quantum cascade laser where the quantum wells in the active regions are replaced by quantum dots with their atom-like discrete energy levels is an interesting system to study novel features in optical spectroscopy. We study structures suitable for diagonal lasing transitions in coupled dots, and vertical lasing transitions in a single dot, in the active regions of the laser device. The luminescence spectra as a function of electron number and dot size show that for diagonal transitions, a s...

  10. Short-wave infrared colloidal quantum dot photodetectors on silicon

    OpenAIRE

    Hu, Chen; Gassenq, Alban; Justo, Yolanda; Yakunin, Sergii; Heiss, Wolfgang; Hens, Zeger; Roelkens, Gunther

    2013-01-01

    In this paper, two kinds of colloidal quantum dots, PbS and HgTe, are explored for SWIR photodetectors application. The colloidal dots are prepared by hot injection chemical synthesis, with organic ligands around the dots keeping them stable in solution. For the purpose of achieving efficient carrier transport between the dots in a film, these long organic ligands are replaced by shorter, inorganic ligands. We report uniform, ultra-smooth colloidal QD films without cracks realized by dip-coat...

  11. Optical properties of a Quantum-Dot Cascade Structure

    OpenAIRE

    Apalkov, V. M.; Chakraborty, Tapash

    2001-01-01

    We report on our theoretical studies of the luminescence spectra of a quantum cascade laser where the quantum wells in the active regions are replaced by parabolic quantum dots. We analyze the influence of shape and size of the dots on the luminescence spectra. The emission spectra have interaction induced blueshift which increases almost linearly with increasing electron number. The blueshift is smaller for larger and non-circular dots. For large dots, shape of the emission line has weak dep...

  12. Excitonic Properties in GaAs Parabolic Quantum Dots

    OpenAIRE

    Jaziri, S.; Bennaceur, R.

    1995-01-01

    Certain classes of semiconductor quantum dots being actually fabricated exhibit a nearly parabolic confinement for both the electron and the hole. In undoped quantum dots, excitonic effects are important. In this work, first we present theoretical results on exciton properties in parabolic quantum dots: resonance energy, binding energy and oscillator strength. Then, we investigate the effects of external electric and magnetic fields on exciton in quantum dots.

  13. Nanoscale fluorescence lifetime imaging with a single diamond NV center

    CERN Document Server

    Beams, Ryan; Johnson, Timothy W; Oh, Sang-Hyun; Novotny, Lukas; Vamivakas, Nick

    2013-01-01

    Solid-state quantum emitters, such as artificially engineered quantum dots or naturally occurring defects in solids, are being investigated for applications ranging from quantum information science and optoelectronics to biomedical imaging. Recently, these same systems have also been studied from the perspective of nanoscale metrology. In this letter we study the near-field optical properties of a diamond nanocrystal hosting a single nitrogen vacancy center. We find that the nitrogen vacancy center is a sensitive probe of the surrounding electromagnetic mode structure. We exploit this sensitivity to demonstrate nanoscale fluorescence lifetime imaging microscopy (FLIM) with a single nitrogen vacancy center by imaging the local density of states of an optical antenna.

  14. Branch management into micropipeline joint dot

    Directory of Open Access Journals (Sweden)

    Dimitar Tyanev

    2011-11-01

    Full Text Available This paper considers problems related to hardware implementation of computational process with conditional jumps. Hardware refers to asynchronous pipeline organization at microoperational level. Exploration is dedicated to one of the tasks presented in (Tyanev, D., 2009 concerning to micropipeline controller design to control micropipeline stage into joint dot of branch algorithm. Joint dot is the point at which few preceding branches are combined. It appears inevitably into conditional jump structures and this is the reason for the actuality of its problem. Analysis of this new task is presented and request arbitration functioning principles are formulated for the incoming to joint dot requests. The arbiter is responsible for the fair choice on which depends steady peformance of separate pipeline brances. Paper also describes pipeline controller synthesis and analysis of its operation in two variants: about 2-phase and 4-phase data transfer protocol. The synthesized asynchronous arbiter scheme is invariant to the type of pipeline protocol.

  15. Tuberculose associada à AIDS: características demográficas, clínicas e laboratoriais de pacientes atendidos em um serviço de referência do sul do Brasil Tuberculosis associated to AIDS: demographic, clinical and laboratory characteristics of patients cared for at a reference center in the south of Brazil

    OpenAIRE

    Maria Marta Santos Boffo; Ivo Gomes de Mattos; Marta Osório Ribeiro; Isabel Cristina de Oliveira Neto

    2004-01-01

    INTRODUÇÃO: A sinergia entre a tuberculose e o vírus da imunodeficiência humana é responsável pelo aumento da morbi-mortalidade dos pacientes com AIDS. OBJETIVO: Delinear o perfil de pacientes com tuberculose e AIDS na cidade de Rio Grande (RS) relacionando dados demográficos, clínicos e laboratoriais. MÉTODO: A amostra foi constituída por todos os casos de tuberculose confirmados pelo isolamento de Mycobacterium tuberculosis ocorridos no Serviço de AIDS do Hospital Universitário/FURG entre s...

  16. Centering research

    DEFF Research Database (Denmark)

    Katan, Lina Hauge; Baarts, Charlotte

    share as the common aim of both research and education. Despite some similarities, we find that how the two groups engage in and benefit from reading and writing diverges significantly. Thus we have even more reason to believe that centering practice-based teaching on these aspects of research is a good......’ exercises tend to dominate the common understandings of research-based learning. Here we address a specific area of inquiry overlooked by previous studies: whether and how reading, thinking and writing indeed share the same learning potentials as the practical foundation for research-based teaching....... In the humanities and social sciences, integrated acts of reading, writing and thinking account for an obvious and substantial overlap in student and researcher practices, creating a clear opportunity for research-based teaching. Moreover, our empirical data point to reading, thinking and writing as quintessential...

  17. Chemiluminescence of carbon dots induced by diperiodato-nicklate (IV) in alkaline solution and its application to a quenchometric flow-injection assays of paracetamole, L-cysteine and glutathione

    International Nuclear Information System (INIS)

    Aqueous solutions of carbon dots (C-dots) were prepared by microwave-assisted thermal carbonization of poly(ethylene glycol). They were investigated by transmission electron microscopy, absorption and fluorescence spectra. It is shown that diperiodato-nicklate(IV), a strong oxidant, induces the chemiluminescence (CL) of C-dots in strongly alkaline solution without use of an additional reagent. A mechanism for this reaction is suggested. It is also found that the CL of the system is quenched by paracetamole, L-cysteine and glutathione. Under the optimized conditions, the calibration plot is linear with a correlation coefficient (r) of >0.995. The limits of detection are 90, 8, and 60 µg L-1 for paracetamole, L-cysteine, and glutathione, respectively. Spiked urine and serum samples were analyzed and gave recoveries in the range from 84.38 to 116.0 %, with an RSD of 1.2–2.7 %. (author)

  18. Impact of Community-Based DOT on Tuberculosis Treatment Outcomes: A Systematic Review and Meta-Analysis

    Science.gov (United States)

    Zhang, HaiYang; Ehiri, John; Yang, Huan; Tang, Shenglan; Li, Ying

    2016-01-01

    self-administered treatment. Conclusions CB-DOT did improved TB treatment outcomes according to the pooled results of included studies in this review. Studies on strategies for implementation of patient-centered and community-centered CB-DOT deserve further attention. PMID:26849656

  19. A flow injection chemiluminescence method for determination of nalidixic acid based on KMnO4-morin sensitized with CdS quantum dots

    Science.gov (United States)

    Khataee, Alireza; Lotfi, Roya; Hasanzadeh, Aliyeh; Iranifam, Mortaza; Joo, Sang Woo

    2016-02-01

    A simple and sensitive flow injection chemiluminescence (CL) method was developed for determination of nalidixic acid by application of CdS quantum dots (QDs) in KMnO4-morin CL system in acidic medium. Optical and structural features of L-cysteine capped CdS quantum dots which were synthesized via hydrothermal approach were investigated using X-ray diffraction (XRD), scanning electron microscopy (SEM), photoluminescence (PL), and ultraviolet-visible (UV-Vis) spectroscopy. Moreover, the potential mechanism of the proposed CL method was described using the results of the kinetic curves of CL systems, the spectra of CL, PL and UV-Vis analyses. The CL intensity of the KMnO4-morin-CdS QDs system was considerably increased in the presence of nalidixic acid. Under the optimum condition, the enhanced CL intensity was linearly proportional to the concentration of nalidixic acid in the range of 0.0013 to 21.0 mg L- 1, with a detection limit of (3σ) 0.003 mg L- 1. Also, the proposed CL method was utilized for determination of nalidixic acid in environmental water samples, and commercial pharmaceutical formulation to approve its applicability. Furthermore, corona discharge ionization ion mobility spectrometry (CD-IMS) method was utilized for determination of nalidixic acid and the results of real sample analysis by two proposed methods were compared. Comparison the analytical features of these methods represented that the proposed CL method is preferable to CD-IMS method for determination of nalidixic acid due to its high sensitivity and precision.

  20. Bright infrared LEDs based on colloidal quantum-dots

    KAUST Repository

    Sun, Liangfeng

    2013-01-01

    Record-brightness infrared LEDs based on colloidal quantum-dots have been achieved through control of the spacing between adjacent quantum-dots. By tuning the size of quantum-dots, the emission wavelengths can be tuned between 900nm and 1650nm. © 2013 Materials Research Society.

  1. Correlated Coulomb drag in capacitively coupled quantum-dot structures

    DEFF Research Database (Denmark)

    Kaasbjerg, Kristen; Jauho, Antti-Pekka

    2016-01-01

    We study theoretically Coulomb drag in capacitively coupled quantum dots (CQDs) -- a biasdriven dot coupled to an unbiased dot where transport is due to Coulomb mediated energy transfer drag. To this end, we introduce a master-equation approach which accounts for higher-order tunneling (cotunneli...

  2. Weak localization in arrays of metallic quantum dots

    OpenAIRE

    Golubev, Dmitri S.; Zaikin, Andrei D.

    2006-01-01

    Combining scattering matrix formalism with non-linear $\\sigma$-model technique we analyze weak localization effects in arrays of chaotic quantum dots connected via barriers with arbitrary distribution of channel transmissions. With the aid of our approach we evaluate magnetoconductance of two arbitrarily connected quantum dots as well as of $N\\times M$ arrays of identical quantum dots.

  3. AHE measurements of very thin films and nanosized dots

    NARCIS (Netherlands)

    Kikuchi, N.; Murillo, R.; Lodder, J.C.

    2005-01-01

    In this paper we present anomalous Hall effect analysis from very thin Co (0.5 nm) film, Co/Pt multilayers and large areas of nanosized dots as well as from a few magnetic dots having a diameter of 120 nm. The dot arrayis prepared from Co/Pt multilayer by using laser interference lithography (LIL) w

  4. Optical properties of charged semiconductor quantum dots

    Science.gov (United States)

    Jha, Praket P.

    The effect of n-type doping on the luminescence properties of II-VI quantum dots is studied. The addition of two shells of CdS on CdSe quantum dots prevents the creation of surface traps and makes the system stable under reducing environment. The injection of electrons into films of quantum dots leads to lower photoluminescence (PL) efficiency, with the extent of quenching dependent on both the number and the quantum states of the spectator charges in the nanocrystal. It is found that a 1Pe electron is an eightfold better PL quencher than the 1Se electron. Reduced threshold for stimulated emission is also observed in doped CdSe/CdS films. Time resolved photoluminescence measurements are used to extract the recombination rates of a charged exciton, called trion. It is observed that the negative trion has a radiative rate ˜2.2 +/- 0.4x faster than a neutral exciton, while its non-radiative recombination rate is slower than the biexciton non-radiative recombination rate by a factor of 7.5 +/- 1.7. The knowledge of the recombination rates of the trion enables us to calculate the quantum yield of a negative trion to be ˜10% for the nanocrystals investigated in our work. This is larger than the off state quantum yield from a single quantum dot photoluminescence trajectory and eliminates the formation of negative trion as the possible reason for the PL blinking of single quantum dots. Single quantum dot electrochemistry has also been achieved. It is shown that by varying the Fermi level of the system electrons can be reversibly injected into and extracted out of single CdSe/CdS and CdSe/ZnS nanoparticles to modulate the photoluminescence.

  5. Raman spectroscopic study of molten SmCl3-ACl systems (A=Li,Na,K)

    International Nuclear Information System (INIS)

    Raman spectra of molten SmCl3-ACl systems (A=Li, Na, K) were measured at different compositions and temperatures. The spectra showed polarized peaks centered at about 256 cm-1 in the whole range of concentration and depolarized peaks at about 120 cm-1 in the low concentration range of SmCl3. These Raman shifts were identified as the totally symmetric stretching vibration υ1 and the degenerate bending vibration υ5 of octahedral SmCl63- complex anion, respectively. Peak splitting of the isotropic component was recognized clearly in the reduced Raman spectra of mixtures. Clustering of complex anions is thought to occur in the melts. However, the clustering might be restrained when the SmCl3 concentration became relatively low by adding LiCl, NaCl or KCl. The υ5 peak was the strongest at the SmCl3 concentration of 25 mol% in the SmCl3-KCl system among the three systems. The temperature effect on the Raman shift, reflecting the structural change, was negligibly small between 823 K and 1023 K. (orig.)

  6. Optical studies of capped quantum dots

    OpenAIRE

    Wuister, S.F.

    2005-01-01

    This thesis describes the synthesis and spectroscopy of CdSe and CdTe semiconductor quantum dots (QDs). The first chapter gives an introduction into the unique size dependent properties of semiconductor quantum dots. Highly luminescent QDs of CdSe and CdTe were prepared via a high temperature method in a glovebox. These QDs are soluble in organics but can be transferred into water or ethanol after exchange of the surfactants by various thiols (HS-R). For CdTe the exchange with thiols has a be...

  7. Nonuniform micromagnetic states in thin circular dots

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Z.-H. E-mail: zhwei@phys.ntu.edu.tw; Lai, M.-F.; Chang, C.-R.; Usov, N.A.; Wu, J.C.; Lai, J.-Y

    2004-11-01

    Micromagnetic states are strongly related to sizes of nano-dots. The quasiuniform state becomes unstable and transforms to a new nonuniform state as the diameter of the permalloy circular dot exceeds some critical size. The magnetization curvature increases gradually as the diameter increases. Finally, when the diameter is larger than another critical size, the new nonuniform state becomes unstable and a vortex enters the particle. Hence the new nonuniform state plays an intermediate role in the evolution from the quasiuniform state to the vortex state as the diameter increases.

  8. Cadmium telluride quantum dots advances and applications

    CERN Document Server

    Donegan, John

    2013-01-01

    Optical Properties of Bulk and Nanocrystalline Cadmium Telluride, Núñez Fernández and M.I. VasilevskiyAqueous Synthesis of Colloidal CdTe Nanocrystals, V. Lesnyak, N. Gaponik, and A. EychmüllerAssemblies of Thiol-Capped CdTe Nanocrystals, N. GaponikFörster Resonant Energy Transfer in CdTe Nanocrystal Quantum Dot Structures, M. Lunz and A.L. BradleyEmission of CdTe Nanocrystals Coupled to Microcavities, Y.P. Rakovich and J.F. DoneganBiological Applications of Cadmium Telluride Semiconductor Quantum Dots, A. Le Cign

  9. Engineered Quantum Dot Single Photon Sources

    CERN Document Server

    Buckley, Sonia; Vuckovic, Jelena

    2012-01-01

    Fast, high efficiency, and low error single photon sources are required for implementation of a number of quantum information processing applications. The fastest triggered single photon sources to date have been demonstrated using epitaxially grown semiconductor quantum dots (QDs), which can be conveniently integrated with optical microcavities. Recent advances in QD technology, including demonstrations of high temperature and telecommunications wavelength single photon emission, have made QD single photon sources more practical. Here we discuss the applications of single photon sources and their various requirements, before reviewing the progress made on a quantum dot platform in meeting these requirements.

  10. Recycling Of Bomb Produced Cl 36

    Science.gov (United States)

    Lazarev, V.; Blinov, A.; Huber, Th.; Kubo, F.; Nolte, E.

    The success of accelerated mass-spectrometry (AMS) has allowed the measuring of very small quantities of radioactive nuclides with the ratio to their stable isotope up to 10-14. With the help of this method the concentration of 36Cl in natural samples can be investigated. The main sources of 36Cl in the atmosphere are a) The natural production in nuclear reactions induced by the interaction of high energy cosmic rays with atmospheric Ar. b) The production by the interaction of high neutron fluxes emitted by the nuclear weapon tests with stable chlorine. c) The production in different reactors with the following release (e.g. Chernobyl accident). The analysis of 36Cl time profile in Greenland showed the fast removal of chlorine from the atmosphere so that nowadays only the natural production of 36Cl is of importance. However the measurement of 36Cl in modern precipitation revealed the significant excess of its concentration over the simulated predictions. The recycling of chlorine as an explanation of the observed discrepancy is ar- gued. The biosphere could take up a part of the fallen down bomb produced 36Cl and releases it into the troposphere in the form of CH3Cl. To check the hypothesis the experiment to collect methyl chloride from the air and to measure 36Cl was set up. The high observed ratio 36 Cl/Cl proves that the chlorine recycling really takes place. Additionally, in order to get more information about the distribution of 36Cl the measurements of its concentration in lakes with long flushing times were performed. With the help of modeling the different sources of 36Cl can be distinguished. The dominant source of 36Cl in many Alpine lakes is chlorine, released during the accident on the Chernobyl nuclear power plant.

  11. Optical and structural characterisation of III-V semiconductor quantum wire and quantum dot structures

    International Nuclear Information System (INIS)

    This thesis describes an extensive study of the optical and structural properties of GaAs/AlGaAs V-groove quantum wire and InAs/GaAs self-organised quantum dot structures. For the optical characterisation, the spectroscopic techniques of photoluminescence (PL), photoluminescence excitation (PLE), cathodoluminescence (CL) and electroluminescence (EL) have been used. In addition important information concerning the structural properties of the quantum wires and quantum dots has been obtained by high resolution transmission electron microscopy (TEM) measurements. Initial characterisation and optimisation of the quantum wire structures was conducted using CL and TEM imaging. Further optical characterisation of optimised structures was performed using a micro-focusing PL set-up which produced a laser spot size of ∼2μm, allowing individual wires to be studied. Excitation under both high and low power density conditions revealed important information concerning the quality of the growth and the nature of the one-dimensional confinement within the structure. Structures were grown with the quantum wires placed in the intrinsic region of a p-i-n junction. EL spectroscopy measurements allowed the observation of subband filling effects and an enhanced luminescence intensity for the quantum wire for low forward bias currents. This latter behaviour has important implications for device applications. An investigation of these p-i-n samples in magnetic fields up to 14T, revealed further evidence for 1D confinement in the quantum wires and 2D confinement of carriers in a vertical quantum well. This vertical quantum well, a feature that arises automatically during the growth, appears to channel carriers into the quantum wire, providing a possible mechanism for the enhanced wire electroluminescence intensity observed. In addition, evidence is presented for a possible excitonic-free carrier transition which is observed for high carrier densities in the wires. TEM structural

  12. En el camino para acortar los tratamientos de la tuberculosis: los ensayos clínicos de la Unitat d'Investigació en la Tuberculosi de Barcelona impulsados por los Centres for Disease Control and Prevention On the way to shortening tuberculosis treatments: clinical trials of the Unitat d' Investagació en Tuberculosi de Barcelona supported by the Centers for Disease Control and Prevention

    Directory of Open Access Journals (Sweden)

    Antonio Moreno

    2010-04-01

    Full Text Available El control de la tuberculosis exige nuevas pautas terapéuticas que superen las actuales, disponibles desde hace más de 30 años. En virtud de una cuerdo, siete centros de la Unitat d’ Investigació en Tuberculosi de Barcelona (UITB vienen colaborando con la División para la Eliminación de la Tuberculosis de los Centers for Disease Control de Estados Unidos en el desarrollo de diversos ensayos clínicos en el tratamiento de la infección y la enfermedad tuberculosa. La colaboración se inició en 2004 con el Estudio 26, que compara la eficacia y la tolerabilidad de rifapentina + isoniazida administradas una vez por semana durante tres meses frente a la pauta estándar, para la forma latente. Incluimos 246 sujetos (3 % del total. En febrero de 2008 se cerró la inclusión general. El estudio permanece abierto para sujetos VIH positivos y niños. Tratar con 12 dosis y no con 270 (terapia estándar supondrán un éxito evidente. Habrá que esperar, sin embargo, hasta 2010 para conocer el análisis. El Estudio 28 (iniciado en 2006 comparó, para el tratamiento de la tuberculosis pulmonar, la pauta estándar con una experimental en la cual la isoniazida se sustituyo por moxifloxacino. La UITB incluyó 15 pacientes (3,5 % del total. Los resultados provisionales (presentados en la 47º Interscience Conference on Antimicrobial Agentsand Chemotherapy de Chicago de 2007 no mostraron diferencias entre las dos pautas en la conversión del esputo a las 8 semanas de tratamiento. Recientemente hemos comenzado el Estudio 29, en el cual la rifapentina sustituye a la rifampicina en la pauta estándar de tratamiento.New treatment guidelines are required to improve the tuberculosis control strategies that have been used for 30 years. Seven centers of the Barcelona Tuberculosis Research Unit (BTRU (Unitat d’ Investigació en Tuberculosi de Barcelona are collaborating with the Division of Tuberculosis Elimination of the United States Centers for Disease

  13. Ultra-large scale synthesis of high electrochemical performance SnO{sub 2} quantum dots within 5 min at room temperature following a growth self-termination mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Hongtao, E-mail: htcui@ytu.edu.cn; Xue, Junying; Ren, Wanzhong; Wang, Minmin

    2015-10-05

    Highlights: • SnO{sub 2} quantum dots were prepared at an ultra-large scale at room temperature within 5 min. • The grinding of SnCl{sub 2}⋅2H{sub 2}O and ammonium persulphate with morpholine produces quantum dots. • The reactions were self-terminated through the rapid consumption of water. • The obtained SnO{sub 2} quantum dots own high electrochemical performance. - Abstract: SnO{sub 2} quantum dots are prepared at an ultra-large scale by a productive synthetic procedure without using any organic ligand. The grinding of solid mixture of SnCl{sub 2}⋅2H{sub 2}O and ammonium persulphate with morpholine in a mortar at room temperature produces 1.2 nm SnO{sub 2} quantum dots within 5 min. The formation of SnO{sub 2} is initiated by the reaction between tin ions and hydroxyl groups generated from hydrolysis of morpholine in the released hydrate water from SnCl{sub 2}⋅2H{sub 2}O. It is considered that as water is rapidly consumed by the hydrolysis reaction of morpholine, the growth process of particles is self-terminated immediately after their transitory period of nucleation and growth. As a result of simple procedure and high toleration to scaling up of preparation, at least 50 g of SnO{sub 2} quantum dots can be produced in one batch in our laboratory. The as prepared quantum dots present high electrochemical performance due to the effective faradaic reaction and the alternative trapping of electrons and holes.

  14. Pure zinc sulfide quantum dot as highly selective luminescent probe for determination of hazardous cyanide ion

    Energy Technology Data Exchange (ETDEWEB)

    Shamsipur, Mojtaba, E-mail: mshamsipur@yahoo.com [Department of Chemistry, Razi University, Kermanshah (Iran, Islamic Republic of); Rajabi, Hamid Reza, E-mail: h.rajabi@mail.yu.ac.ir [Chemistry Department, Yasouj University, Yasouj 75918-74831 (Iran, Islamic Republic of)

    2014-03-01

    A rapid and simple fluorescence method is presented for selective and sensitive determination of hazardous cyanide ion in aqueous solution based on functionalized zinc sulfide (ZnS) quantum dot (QD) as luminescent prob. The ultra-small ZnS QDs were synthesized using a chemical co-precipitation method in the presence of 2-mercaptoethanol (ME) as an efficient capping agent. The prepared pure ZnS QDs was applied as an optical sensor for determination of cyanide ions in aqueous solutions. ZnS nanoparticles have exhibited a strong fluorescent emission at about 424 nm. The fluorescence intensity of QDs is linearly proportional to the cyanide ion concentration in the range 2.44 × 10{sup −6} to 2.59 × 10{sup −5} M with a detection limit of 1.70 × 10{sup −7} M at pH 11. The designed fluorescent sensor possesses remarkable selectivity for cyanide ion over other anions such as Cl{sup −}, Br{sup −}, F{sup −}, I{sup −}, IO{sub 3}{sup −}, ClO{sub 4}{sup −}, BrO{sub 3}{sup −}, CO{sub 3}{sup 2−}, NO{sub 2}{sup −}, NO{sub 3}{sup −}, SO{sub 4}{sup 2−}, S{sub 2}O{sub 4}{sup 2−}, C{sub 2}O{sub 4}{sup 2−}, SCN{sup −}, N{sub 3}{sup −}, citrate and tartarate with negligible influences on the cyanide detection by fluorescence spectroscopy. - Highlights: • Preparation of functionalized ZnS quantum dots in aqueous media • Highly selective quantum dot based luminescent probe for determination of cyanide • Fast and sensitive determination of hazardous CN{sup −} by fluorescence quenching.

  15. 76 FR 34014 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10, CL-215-6B11 (CL-215T Variant), and...

    Science.gov (United States)

    2011-06-10

    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or.... Model CL-215-1A10, CL- 215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant) Airplanes AGENCY.... Model CL-215-1A10 airplanes, serial numbers 1051 through 1125 inclusive; Model CL-215- 6B11...

  16. Development of cadmium-free quantum dot for intracellular labelling through electroporation or lipid-calcium-phosphate

    Science.gov (United States)

    Liu, Ying-Feng; Hung, Wei-Ling; Hou, Tzh-Yin; Huang, Hsiu-Ying; Lin, Cheng-An J.

    2016-04-01

    Traditional fluorescent labelling techniques has severe photo-bleaching problem such as organic dyes and fluorescent protein. Quantum dots made up of traditional semiconductor (CdSe/ZnS) material has sort of biological toxicity. This research has developed novel Cd-free quantum dots divided into semiconductor (Indium phosphide, InP) and noble metal (Gold). Former has lower toxicity compared to traditional quantum dots. Latter consisting of gold (III) chloride (AuCl3) and toluene utilizes sonochemical preparation and different stimulus to regulate fluorescent wavelength. Amphoteric macromolecule surface technology and ligand Exchange in self-Assembled are involved to develop hydrophilic nanomaterials which can regulate the number of grafts per molecule of surface functional groups. Calcium phosphate (CaP) nanoparticle (NP) with an asymmetric lipid bilayer coating technology developed for intracellular delivery and labelling has synthesized Cd-free quantum dots possessing high brightness and multi-fluorescence successfully. Then, polymer coating and ligand exchange transfer to water-soluble materials to produce liposome nanomaterials as fluorescent probes and enhancing medical applications of nanotechnology.

  17. Quantum phase transition in trigonal triple quantum dots: The case of quantum dots deviated from particle–hole symmetric point

    International Nuclear Information System (INIS)

    We consider a triple quantum dot system in a triangular geometry with one of the dots connected to metallic leads. We investigate quantum phase transition between local moment phase and Kondo screened strong coupling phase in triple quantum dots where energy levels of dots are deviated from the particle–hole symmetric point. The effect of on-site energy of dots on quantum phase transition between local moment phase and Kondo screened strong coupling phase in triple quantum dots is studied based on the analytical arguments and the numerical renormalization group method. The results show that the critical value of tunnel coupling between side dots decreases when the energy level of embedded dot rises up from the symmetric point to the Fermi level and the critical value increases when the energy levels of two side dots rise up. The study of the influence of on-site-energy changes on the quantum phase transitions in triple quantum dots has the importance for clarifying the mechanism of Kondo screening in triple quantum dots where energy levels of dots are deviated from the particle–hole symmetric point

  18. THE GALACTIC CENTER WEATHER FORECAST

    International Nuclear Information System (INIS)

    In accretion-based models for Sgr A*, the X-ray, infrared, and millimeter emission arise in a hot, geometrically thick accretion flow close to the black hole. The spectrum and size of the source depend on the black hole mass accretion rate M-dot . Since Gillessen et al. have recently discovered a cloud moving toward Sgr A* that will arrive in summer 2013, M-dot may increase from its present value M-dot0. We therefore reconsider the 'best-bet' accretion model of Mościbrodzka et al., which is based on a general relativistic MHD flow model and fully relativistic radiative transfer, for a range of M-dot . We find that for modest increases in M-dot the characteristic ring of emission due to the photon orbit becomes brighter, more extended, and easier to detect by the planned Event Horizon Telescope submillimeter Very Long Baseline Interferometry experiment. If M-dot ∼>8 M-dot0, this 'silhouette' of the black hole will be hidden beneath the synchrotron photosphere at 230 GHz, and for M-dot ∼>16 M-dot0 the silhouette is hidden at 345 GHz. We also find that for M-dot > 2 M-dot0 the near-horizon accretion flow becomes a persistent X-ray and mid-infrared source, and in the near-infrared Sgr A* will acquire a persistent component that is brighter than currently observed flares.

  19. Heterogeneous computing with OpenCL

    CERN Document Server

    2013-01-01

    Heterogeneous Computing with OpenCL teaches OpenCL and parallel programming for complex systems that may include a variety of device architectures: multi-core CPUs, GPUs, and fully-integrated Accelerated Processing Units (APUs) such as AMD Fusion technology. Designed to work on multiple platforms and with wide industry support, OpenCL will help you more effectively program for a heterogeneous future. Written by leaders in the parallel computing and OpenCL communities, this book will give you hands-on OpenCL experience to address a range of fundamental parallel algorithms. The authors explore memory spaces, optimization techniques, graphics interoperability, extensions, and debugging and profiling. Intended to support a parallel programming course, Heterogeneous Computing with OpenCL includes detailed examples throughout, plus additional online exercises and other supporting materials.

  20. A study of the lunisolar secular resonance $2\\dot{\\omega}+\\dot{\\Omega}=0$

    CERN Document Server

    Celletti, Alessandra

    2016-01-01

    The dynamics of small bodies around the Earth has gained a renewed interest, since the awareness of the problems that space debris can cause in the nearby future. A relevant role in space debris is played by lunisolar secular resonances, which might contribute to an increase of the orbital elements, typically of the eccentricity. We concentrate our attention on the lunisolar secular resonance described by the relation $2\\dot{\\omega}+\\dot{\\Omega}=0$, where $\\omega$ and $\\Omega$ denote the argument of perigee and the longitude of the ascending node of the space debris. We introduce three different models with increasing complexity. We show that the growth in eccentricity, as observed in space debris located in the MEO region at the inclination about equal to $56^\\circ$, can be explained as a natural effect of the secular resonance $2\\dot{\\omega}+\\dot{\\Omega}=0$, while the chaotic variations of the orbital parameters are the result of interaction and overlapping of nearby resonances.