WorldWideScience

Sample records for cemented polyethylene cups

  1. Migration and head penetration of Vitamin-E diffused cemented polyethylene cup compared to standard cemented cup in total hip arthroplasty: study protocol for a randomised, double-blind, controlled trial (E1 HIP)

    Science.gov (United States)

    Sköldenberg, Olof; Rysinska, Agata; Chammout, Ghazi; Salemyr, Mats; Muren, Olle; Bodén, Henrik; Eisler, Thomas

    2016-01-01

    Introduction In vitro, Vitamin-E-diffused, highly cross-linked polyethylene (PE) has been shown to have superior wear resistance and improved mechanical properties when compared to those of standard highly cross-linked PE liners used in total hip arthroplasty (THA). The aim of the study is to evaluate the safety of a new cemented acetabular cup with Vitamin-E-doped PE regarding migration, head penetration and clinical results. Methods and analysis In this single-centre, double-blinded, randomised controlled trial, we will include 50 patients with primary hip osteoarthritis scheduled for THA and randomise them in a 1:1 ratio to a cemented cup with either argon gas-sterilised PE (control group) or Vitamin-E-diffused PE (vitamin-e group). All patients and the assessor of the primary outcome will be blinded and the same uncemented stem will be used for all participants. The primary end point will be proximal migration of the cup at 2 years after surgery measured with radiostereometry. Secondary end points include proximal migration at other follow-ups, total migration, femoral head penetration, clinical outcome scores and hip-related complications. Patients will be followed up at 3 months and at 1, 2, 5 and 10 years postoperatively. Results Results will be analysed using 95% CIs for the effect size. A regression model will also be used to adjust for stratification factors. Ethics and dissemination The ethical committee at Karolinska Institutet has approved the study. The first results from the study will be disseminated to the medical community via presentations and publications in relevant medical journals when the last patient included has been followed up for 2 years. Trial registration number NCT02254980. PMID:27388352

  2. Wear and migration of highly cross-linked and conventional cemented polyethylene cups with cobalt chrome or Oxinium femoral heads: a randomized radiostereometric study of 150 patients.

    Science.gov (United States)

    Kadar, Thomas; Hallan, Geir; Aamodt, Arild; Indrekvam, Kari; Badawy, Mona; Skredderstuen, Arne; Havelin, Leif Ivar; Stokke, Terje; Haugan, Kristin; Espehaug, Birgitte; Furnes, Ove

    2011-08-01

    This randomized study was performed to compare wear and migration of five different cemented total hip joint articulations in 150 patients. The patients received either a Charnley femoral stem with a 22.2 mm head or a Spectron EF femoral stem with a 28 mm head. The Charnley articulated with a γ-sterilized Charnley Ogee acetabular cup. The Spectron EF was used with either EtO-sterilized non-cross-linked polyethylene (Reflection All-Poly) or highly cross-linked (Reflection All-Poly XLPE) cups, combined with either cobalt chrome (CoCr) or Oxinium femoral heads. The patients were followed with repeated RSA measurements for 2 years. After 2 years, the EtO-sterilized non-cross-linked Reflection All-Poly cups had more than four times higher proximal penetration than its highly cross-linked counterpart. Use of Oxinium femoral heads did not affect penetration at 2 years compared to heads made of CoCr. Further follow-up is needed to evaluate the benefits, if any, of Oxinium femoral heads in the clinical setting. The Charnley Ogee was not outperformed by the more recently introduced implants in our study. We conclude that this prostheses still represents a standard against which new implants can be measured.

  3. The effect of geometry and abduction angle on the stresses in cemented UHMWPE acetabular cups – finite element simulations and experimental tests

    Directory of Open Access Journals (Sweden)

    Santavirta Seppo S

    2005-05-01

    Full Text Available Abstract Background Contact pressure of UHMWPE acetabular cup has been shown to correlate with wear in total hip replacement (THR. The aim of the present study was to test the hypotheses that the cup geometry, abduction angle, thickness and clearance can modify the stresses in cemented polyethylene cups. Methods Acetabular cups with different geometries (Link®: IP and Lubinus eccentric were tested cyclically in a simulator at 45° and 60° abduction angles. Finite element (FE meshes were generated and two additional designs were reconstructed to test the effects of the cup clearance and thickness. Contact pressures at cup-head and cup-cement interfaces were calculated as a function of loading force at 45°, 60° and 80° abduction angles. Results At the cup-head interface, IP experienced lower contact pressures than the Lubinus eccentric at low loading forces. However, at higher loading forces, much higher contact pressures were produced on the surface of IP cup. An increase in the abduction angle increased contact pressure in the IP model, but this did not occur to any major extent with the Lubinus eccentric model. At the cup-cement interface, IP experienced lower contact pressures. Increased clearance between cup and head increased contact pressure both at cup-head and cup-cement interfaces, whereas a decreased thickness of polyethylene layer increased contact pressure only at the cup-cement interface. FE results were consistent with experimental tests and acetabular cup deformations. Conclusion FE analyses showed that geometrical design, thickness and abduction angle of the acetabular cup, as well as the clearance between the cup and head do change significantly the mechanical stresses experienced by a cemented UHMWPE acetabular cup. These factors should be taken into account in future development of THR prostheses. FE technique is a useful tool with which to address these issues.

  4. Elastoplastic cup model for cement-based materials

    Directory of Open Access Journals (Sweden)

    Yan ZHANG

    2010-03-01

    Full Text Available Based on experimental data obtained from triaxial tests and a hydrostatic test, a cup model was formulated. Two plastic mechanisms, respectively a deviatoric shearing and a pore collapse, are taken into account. This model also considers the influence of confining pressure. In this paper, the calibration of the model is detailed and numerical simulations of the main mechanical behavior of cement paste over a large range of stress are described, showing good agreement with experimental results. The case study shows that this cup model has extensive applicability for cement-based materials and other quasi-brittle and high-porosity materials in a complex stress state.

  5. Wear, bone density, functional outcome and survival in vitamin E-incorporated polyethylene cups in reversed hybrid total hip arthroplasty: design of a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    van der Veen Hugo C

    2012-09-01

    Full Text Available Abstract Background Aseptic loosening of total hip arthroplasties is generally caused by periprosthetic bone resorption due to tissue reactions on polyethylene wear particles. In vitro testing of polyethylene cups incorporated with vitamin E shows increased wear resistance. The objective of this study is to compare vitamin E-stabilized highly cross-linked polyethylene with conventional cross-linked polyethylene in “reversed hybrid” total hip arthroplasties (cemented all-polyethylene cups combined with uncemented femoral stems. We hypothesize that the adjunction of vitamin E leads to a decrease in polyethylene wear in the long-term. We also expect changes in bone mineral density, less osteolysis, equal functional scores and increased implant survival in polyethylene cemented cups incorporated with vitamin E in the long-term. Design A double-blinded randomized controlled trial will be conducted. Patients to be included are aged under 70, suffer from non-inflammatory degenerative joint disease of the hip and are scheduled for a primary total hip arthroplasty. The study group will receive a reversed hybrid total hip arthroplasty with a vitamin E-stabilized highly cross-linked polyethylene cemented cup. The control group will receive a reversed hybrid total hip arthroplasty with a conventional cross-linked polyethylene cemented cup. Radiological follow-up will be assessed at 6 weeks and at 1, 3, 5, 7 and 10 years postoperatively, to determine polyethylene wear and osteolysis. Patient-reported functional status (HOOS, physician-reported functional status (Harris Hip Score and patients’ physical activity behavior (SQUASH will also be assessed at these intervals. Acetabular bone mineral density will be assessed by dual energy X-ray absorptiometry (DEXA at 6 weeks and at 1 year and 2 years postoperatively. Implant survival will be determined at 10 years postoperatively. Discussion In vitro results of vitamin E-stabilized polyethylene are promising

  6. Elastoplastic cup model for cement-based materials

    OpenAIRE

    Zhang, Yan; Shao, Jian-Fu

    2010-01-01

    Based on experimental data obtained from triaxial tests and a hydrostatic test, a cup model was formulated. Two plastic mechanisms, respectively a deviatoric shearing and a pore collapse, are taken into account. This model also considers the influence of confining pressure. In this paper, the calibration of the model is detailed and numerical simulations of the main mechanical behavior of cement paste over a large range of stress are described, showing good agreement with experimental results...

  7. Effects of metal-inlay thickness in polyethylene cups with metal-on-metal bearings.

    NARCIS (Netherlands)

    Verdonschot, N.J.J.; Vena, P.; Stolk, J.; Huiskes, R.

    2002-01-01

    A way to prevent polyethylene wear in total hip replacements is to use metal-on-metal bearings. The cup design of these bearings may be a metal inlay in a polyethylene cup. However, these metal inlays are relatively thin and may deform on loading. The purpose of the current study was to determine wh

  8. Analysis of wear of polyethylene hip joint cup related to its positioning in patient's body.

    Science.gov (United States)

    Rońda, Jacek; Wojnarowski, Paweł

    2013-01-01

    Polyethylene parts of endoprosthesis are the weakest parts of each medical implant. They can be worn out within several years. During this period, a patient can enjoy good physical efficiency until the wear of polyethylene part limits his/her mobility. Then the reoperation is necessary and positioning of all parts of endoprosthesis has an effect on future patient's mobility and durability of implant. Elements of endoprosthesis during exploitation are heavily loaded both by normal and tangential forces and moments. In this paper, the dependence of wear of polyethylene cup on its positioning in pelvis is the major problem. Wear of the cup is determined by two measures: the depth and volume of a material rubbed off from the contact surface. The sensitivity of the depth of rubbing off is evaluated relative to two angles of anteversion and abduction, and radii of the cup. Numerical results are obtained by using Abaqus FE system with data related to patient's activity identified on the basis of medical reports.

  9. Analysis of wear of polyethylene hip joint cup related to its positioning in patient's body.

    Science.gov (United States)

    Rońda, Jacek; Wojnarowski, Paweł

    2013-01-01

    Polyethylene parts of endoprosthesis are the weakest parts of each medical implant. They can be worn out within several years. During this period, a patient can enjoy good physical efficiency until the wear of polyethylene part limits his/her mobility. Then the reoperation is necessary and positioning of all parts of endoprosthesis has an effect on future patient's mobility and durability of implant. Elements of endoprosthesis during exploitation are heavily loaded both by normal and tangential forces and moments. In this paper, the dependence of wear of polyethylene cup on its positioning in pelvis is the major problem. Wear of the cup is determined by two measures: the depth and volume of a material rubbed off from the contact surface. The sensitivity of the depth of rubbing off is evaluated relative to two angles of anteversion and abduction, and radii of the cup. Numerical results are obtained by using Abaqus FE system with data related to patient's activity identified on the basis of medical reports. PMID:23957232

  10. Surface-gradient cross-linked polyethylene acetabular cups: oxidation resistance and wear against smooth and rough femoral balls.

    Science.gov (United States)

    Shen, Fu-Wen; McKellop, Harry

    2005-01-01

    Two methods were developed and evaluated for cross-linking the bearing surface of a polyethylene acetabular cup to a limited depth, in order to improve its resistance to wear without degrading the mechanical properties of the bulk of the component. In the first method, low-energy electron beams were used to cross-link only the bearing surface of the cups to a maximum depth of about 2 mm. The cups then were annealed at 100 degrees C in vacuum for 3 or 6 days to reduce the residual free radicals, and the resultant resistance to oxidation was compared by artificially aging the cups at 80 degrees C in air. Chemically cross-linked surface layers were produced by coating the bearing surfaces of the cups with a thin layer of polyethylene powder mixed with 1% weight peroxide, and compressing them at 6.9 MPa (1000 psi) and 170 degrees C. This resulted in a cross-linked surface layer that extended about 3 mm deep, with a gradual transition to conventional (noncross-linked) polyethylene in the bulk of the implant. In hip simulator wear tests with highly polished (implant quality) femoral balls, both types of surface cross-linking were found to improve markedly the wear resistance of the acetabular cups. In tests with roughened femoral balls, the wear rates were much higher and were comparable to those obtained with similarly roughened balls against noncross-linked polyethylene cups in a previous study, indicating that the full benefit of cross-linking may not be realized under conditions of severe third-body abrasion. Nevertheless, these results show a promising approach for optimizing the wear resistance and the bulk mechanical properties of polyethylene components in total joint arthroplasty.

  11. Wear, bone density, functional outcome and survival in vitamin E-incorporated polyethylene cups in reversed hybrid total hip arthroplasty : design of a randomized controlled trial

    NARCIS (Netherlands)

    van der Veen, H.C.; Akker-Scheek, I.; Bulstra, S.K.; van Raay, J.J.A.M.

    2012-01-01

    Background: Aseptic loosening of total hip arthroplasties is generally caused by periprosthetic bone resorption due to tissue reactions on polyethylene wear particles. In vitro testing of polyethylene cups incorporated with vitamin E shows increased wear resistance. The objective of this study is to

  12. A Novel Method for Assessment of Polyethylene Liner Wear in Radiopaque Tantalum Acetabular Cups

    DEFF Research Database (Denmark)

    Troelsen, Anders; Greene, Meridith E; Ayers, David C;

    2015-01-01

    Conventional radiostereometric analysis (RSA) for wear is not possible in patients with tantalum cups. We propose a novel method for wear analysis in tantalum cups. Wear was assessed by gold standard RSA and the novel method in total hip arthroplasty patients enrolled in a randomized controlled...... trial receiving either titanium or tantalum cups (n=46). The novel method estimated the center of the head using a model based on identification of two proximal markers on the stem and knowledge of the stem/head configuration. The novel method was able to demonstrate a pattern of wear that was similar...... to the gold standard in titanium cups. The novel method offered accurate assessment and is a viable solution for assessment of wear in studies with tantalum cups....

  13. Three Year RSA Evaluation of Vitamin E Diffused Highly Cross-linked Polyethylene Liners and Cup Stability

    DEFF Research Database (Denmark)

    Sillesen, Nanna H; Greene, Meridith E; Nebergall, Audrey K;

    2015-01-01

    Vitamin E diffusion into highly cross-linked polyethylene (E-XLPE) is a method for enhancing oxidative stability of acetabular liners. The purpose of this study was to evaluate in vivo penetration of E-XLPE using radiostereometric analysis (RSA). Eighty-four hips were recruited into a prospective...... 10-year RSA. This is the first evaluation of the multicenter cohort after 3-years. All patients received E-XLPE liners (E1, Biomet) and porous-titanium coated cups (Regenerex, Biomet). There was no difference (P=0.450) in median femoral head penetration into the E-XLPE liners at 3-years comparing...

  14. No Superiority of Cemented Metal-on-Metal vs Metal-on-Polyethylene THA at 5-Year Follow-up

    NARCIS (Netherlands)

    Zijlstra, Wierd P.; Cheung, John; Sietsma, Maurits S.; van Raay, Jos J. A. M.; Deutman, Robert

    2009-01-01

    A randomized controlled trial was performed to compare the cemented Stanmore metal-on-metal (Biomet, Warsaw, Indiana) total hip arthroplasty (THA; 102 hips) to the cemented Stanmore metal-on-polyethylene (Biomet) THA (98 hips). The primary outcome was clinical performance. Radiological performance,

  15. Wear of polyethylene cups in total hip arthroplasty: a parametric mathematical model.

    Science.gov (United States)

    Pietrabissa, R; Raimondi, M; Di Martino, E

    1998-04-01

    This paper presents a parametric mathematical model of the head-cup wear coupling in total hip arthroplasty (THA). The model evaluates the dependence of acetabular volumetric wear upon the characteristic parameters of patient and hip prosthesis. Archard's law is assumed to calculate the wear coupling behaviour. The wear factor is taken from pin-on-disc wear tests as a function of materials and finishing of the articular joint. The forces acting on the hip joint are taken from experimental data found in the literature whilst the load distribution is calculated under the hypotheses of perfectly rigid ideal wear coupling. The sliding distance is obtained by combining the three elementary displacements -- due to rotations around the three axes -- at the generic bearing surface location. The simulations show that the polymeric wear volume per step cycle decreases ranging from fast walking speeds to low running speeds, it increases linearly with patient body weight and with femoral head diameter, it decreases slightly for positive variations of the socket inclination angle and it increases exponentially with femoral head roughness. The volumetric wear rate per year calculated for a standard reference patient is 5.8 mm3. The relevant iso-wear maps show a marginal pattern with the maximum located near the cup superior borderline. At the instant of peak load, the iso-stress maps show a paracentral pattern with the maximum superior to the cup polar point, and the iso-sliding distance maps show a marginal pattern with two maxima located near the cup's superior and inferior borderlines. PMID:9690490

  16. Comparison of wear of ultra-high molecular weight polyethylene acetabular cups against surface-engineered femoral heads.

    Science.gov (United States)

    Galvin, A; Brockett, C; Williams, S; Hatto, P; Burton, A; Isaac, G; Stone, M; Ingham, E; Fisher, J

    2008-10-01

    Alumina ceramic heads have been previously shown to reduce polyethylene wear in comparison to cobalt chrome (CoCr) heads in artificial hip joints. However, there are concerns about the brittle nature of ceramics. It is therefore of interest to investigate ceramic-like coatings on metallic heads. The aim of this study was to compare the friction and wear of ultra-high molecular weight polyethylene (UHMWPE) against alumina ceramic, CoCr, and surface-engineered ceramic-like coatings in a friction simulator and a hip joint simulator. All femoral heads tested were 28 mm diameter and included: Biolox Forte alumina, CoCr, arc evaporative physical vapour deposition (AEPVD) chromium nitride (CrN) coated CoCr, plasma-assisted chemical vapour deposition (PACVD) amorphous diamond-like carbon (aDLC) coated CoCr, sputter CrN coated CoCr, reactive gas controlled arc (RGCA) AEPVD titanium nitride (TiN) coated CoCr, and Graphit-iC coated CoCr. These were articulated against UHMWPE acetabular cups in a friction simulator and a hip joint simulator. Alumina and CoCr gave the lowest wear volumes whereas the sputter coated CrN gave the highest. Alumina also had the lowest friction factor. There was an association between surface parameters and wear. This study indicates that surface topography of surface-engineered femoral heads is more important than friction and wettability in controlling UHMWPE wear.

  17. The effect of bone cement particles on the friction of polyethylene and polyurethane knee bearings

    Science.gov (United States)

    Ash, H. E.; Scholes, S. C.; Unsworth, A.; Jones, E.

    2004-08-01

    Compliant layer knee joints have been considered for use in an attempt to increase the serviceable life of artificial joints. If designed correctly, these joints should operate within the full-fluid film lubrication regime. However, adverse tribological conditions, such as the presence of bone and bone cement particles, may breach the fluid film and cause surface wear. The frictional behaviour of both polyurethane (PU) and conventional polyethylene (PE) tibial components against a metallic femoral component was therefore assessed when bone cement particles were introduced into the lubricant. The bone cement particles caused a large increase in the frictional torque of both the PE and PU bearings; however, the friction produced by the PU bearings was still considerably lower than that produced by the PE bearings. The volume of bone cement particles between each of the bearings and the resultant frictional torque both decreased over time. This occurred more quickly with the PE bearings but greater damage was caused to the surface of the PE bearings than the PU components.

  18. Size of metallic and polyethylene debris particles in failed cemented total hip replacements

    Science.gov (United States)

    Lee, J. M.; Salvati, E. A.; Betts, F.; DiCarlo, E. F.; Doty, S. B.; Bullough, P. G.

    1992-01-01

    Reports of differing failure rates of total hip prostheses made of various metals prompted us to measure the size of metallic and polyethylene particulate debris around failed cemented arthroplasties. We used an isolation method, in which metallic debris was extracted from the tissues, and a non-isolation method of routine preparation for light and electron microscopy. Specimens were taken from 30 cases in which the femoral component was of titanium alloy (10), cobalt-chrome alloy (10), or stainless steel (10). The mean size of metallic particles with the isolation method was 0.8 to 1.0 microns by 1.5 to 1.8 microns. The non-isolation method gave a significantly smaller mean size of 0.3 to 0.4 microns by 0.6 to 0.7 microns. For each technique the particle sizes of the three metals were similar. The mean size of polyethylene particles was 2 to 4 microns by 8 to 13 microns. They were larger in tissue retrieved from failed titanium-alloy implants than from cobalt-chrome and stainless-steel implants. Our results suggest that factors other than the size of the metal particles, such as the constituents of the alloy, and the amount and speed of generation of debris, may be more important in the failure of hip replacements.

  19. Precision of radiostereometric analysis (RSA) of acetabular cup stability and polyethylene wear improved by adding tantalum beads to the liner

    DEFF Research Database (Denmark)

    Nebergall, Audrey K; Rader, Kevin; Palm, Henrik;

    2015-01-01

    Background and purpose - In traditional radiostereometric analysis (RSA), 1 segment defines both the acetabular shell and the polyethylene liner. However, inserting beads into the polyethylene liner permits employment of the shell and liner as 2 separate segments, enabling distinct analysis of th...

  20. The influence of acetabular inclination angle on the penetration of polyethylene and migration of the acetabular component: a prospective, radiostereometric study on cemented acetabular components.

    Science.gov (United States)

    Kadar, T; Furnes, O; Aamodt, A; Indrekvam, K; Havelin, L I; Haugan, K; Espehaug, B; Hallan, G

    2012-03-01

    In this prospective study we studied the effect of the inclination angle of the acetabular component on polyethylene wear and component migration in cemented acetabular sockets using radiostereometric analysis. A total of 120 patients received either a cemented Reflection All-Poly ultra-high-molecular-weight polyethylene or a cemented Reflection All-Poly highly cross-linked polyethylene acetabular component, combined with either cobalt-chrome or Oxinium femoral heads. Femoral head penetration and migration of the acetabular component were assessed with repeated radiostereometric analysis for two years. The inclination angle was measured on a standard post-operative anteroposterior pelvic radiograph. Linear regression analysis was used to determine the relationship between the inclination angle and femoral head penetration and migration of the acetabular component. We found no relationship between the inclination angle and penetration of the femoral head at two years' follow-up (p = 0.9). Similarly, our data failed to reveal any statistically significant correlation between inclination angle and migration of these cemented acetabular components (p = 0.07 to p = 0.9).

  1. Polyethylene; Polyethylene

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    2004-03-01

    Petrochina has chosen the Lupotech T technology of Basell for its use in a low density polyethylene unit of 200000 t/year which should be constructed in Lanzhou (China) for an amount of 82 M of Euros. PTT and its sub-company Thai Olefins are discussing for the repurchase of the firm Bangkok Polyethylene specialized in the high density polyethylene with a capacity of 250000 t/year. Basell should close more than 300000 t/year of capacities of high density polyethylene in Europe. (O.M.)

  2. Performance of Non-Cemented, Hemispherical, Rim-Fit, Hydroxyapatite Coated Acetabular Component.

    Science.gov (United States)

    John, Thomas K; Ghosh, Gaurav; Ranawat, Chitranjan S; Ranawat, Amar S; Meftah, Morteza

    2015-12-01

    The purpose of this study was to assess the durability of a non-cemented, hemispherical rim-fit, hydroxyapatite coated cup with a highly cross-linked polyethylene in 223 total hip arthroplasties. At 6-years follow-up (range, 5-9), there were no cup revisions for osteolysis or loosening. Radiologic evidence of osseointegration was based on presence of Stress Induced Reactive Cancellous Bone and radial trabeculae, seen in 47% and 93% of cups, respectively; both were most prevalent in Zone 1. There was no interference demarcation in any zones. Two cups were revised (0.9%): one for dislocation and another for infection. The Kaplan-Meier survivorship for cup revision for any failure (infection, dislocation) was 99% and for mechanical failure (osteolysis, loosening) was 100%. This design has excellent safety, efficacy and durability. PMID:26235521

  3. Evaluation of compressive strength and water absorption of soil-cement bricks manufactured with addition of pet (polyethylene terephthalate wastes

    Directory of Open Access Journals (Sweden)

    João Alexandre Paschoalin Filho

    2016-04-01

    Full Text Available This paper presents the evaluation of compressive strength of soil-cement bricks obtained by the inclusion in their mixture of PET flakes through mineral water bottles grinding. The Polyethylene Terephthalate (PET has been characterized by its difficulty of disaggregation in nature, requiring a long period for this. On the other hand, with the increase in civil construction activities the demand for raw material also increases, causing considerable environmental impacts. In this context, the objective of this research is to propose a simple methodology, preventing its dumping and accumulation in irregular areas, and reducing the demand of raw materials by the civil construction industry. The results showed that compressive strengths obtained were lower than recommended by NBR 8491 (Associação Brasileira de Normas Técnicas [ABNT], 2012b at seven days of curing time. However, they may be used as an alternative solution in masonry works in order to not submit themselves to great loads or structural functions. The studied bricks also presented water absorption near to recommended values by NBR 8491 (ABNT, 2012b. Manufacturing costs were also determined for this brick, comparing it with the costs of other brick types. Each brick withdrew from circulation approximately 300 g of PET waste. Thus, for an area of 1 m2 the studied bricks can promote the withdrawal of approximately 180 beverage bottles of 2 L capacity.

  4. Hip arthroplasty by matching cups.

    Science.gov (United States)

    Gerard, Y

    1978-01-01

    A total hip surface arthroplasty consisting of matching cups and uncemented prosthetic components is a noteworthy operation. The femoral cup obtains cylindrical support from the femoral head which is reamed in the shape of a cylinder. The acetabular cup is metallic with a polyethylene liner. It is mobile over the bone but its position is constrained by contact with the femoral cup and therefore "self-centering." On the femoral side, the cup must be placed strictly in the axis of the femoral neck. The main consideration in femoral head surface replacement is the vitality of the underlying bone. Necrosis was observed in the earliest clinical trials but there have been no cases of necrosis in the past 3 1/2 years. This is attributed to a more limited surgical approach in which only the anterior part of the gluteus medius is divided and all the posterior elements of the hip are preserved. The acetabulum is sufficiently reamed to receive the cup, which protrudes beyond the external margins of the acetabulum in all positions. Errors have been committed while perfecting the prosthetic material, but the results as determined by a 6 1/2 year follow-up on purely metallic cups are encouraging. Metal-polyethylene cups presently under investigation have almost a 2 year follow-up. The reaction of the acetabulum to an uncemented cup is not yet known. However, the existence of 2 sliding surfaces and the fact that the acetabular cup moves only during the extremes of hip movement, is reason to assume that if the acetabulum is not reamed to expose cancellous bone, the risks of protrusion are minimal or delayed. Total surface arthroplasty by concentric cups has been performed in 335 hips to date. The operation is especially recommended when osteotomy is no longer possible and disabling coxarthrosis is present in relatively young patients. PMID:729253

  5. Oxinium modular femoral heads do not reduce polyethylene wear in cemented total hip arthroplasty at five years: a randomised trial of 120 hips using radiostereometric analysis.

    Science.gov (United States)

    Jonsson, B A; Kadar, T; Havelin, L I; Haugan, K; Espehaug, B; Indrekvam, K; Furnes, O; Hallan, G

    2015-11-01

    We report the five-year outcome of a randomised controlled trial which used radiostereometric analysis (RSA) to assess the influence of surface oxidised zirconium (OxZr, Oxinium) on polyethylene wear in vivo. A total of 120 patients, 85 women and 35 men with a mean age of 70 years (59 to 80) who were scheduled for primary cemented total hip arthroplasty were randomly allocated to four study groups. Patients were blinded to their group assignment and received either a conventional polyethylene (CPE) or a highly cross-linked (HXL) acetabular component of identical design. On the femoral side patients received a 28 mm head made of either cobalt-chromium (CoCr) or OxZr. The proximal head penetration (wear) was measured with repeated RSA examinations over five years. Clinical outcome was measured using the Harris hip score. There was no difference in polyethylene wear between the two head materials when used with either of the two types of acetabular component (p = 0.3 to 0.6). When comparing the two types of polyethylene there was a significant difference in favour of HXLPE, regardless of the head material used (p < 0.001). In conclusion, we found no advantage of OxZr over CoCr in terms of polyethylene wear after five years of follow-up. Our findings do not support laboratory results which have shown a reduced rate of wear with OxZr. They do however add to the evidence on the better resistance to wear of HXLPE over CPE.

  6. Dislocation of a dual mobility total hip replacement following fracture of the polyethylene liner.

    Science.gov (United States)

    Vedrine, Bertrand; Guillaumot, Pierre; Chancrin, Jean-Luc

    2016-05-18

    An eight-year-old male English Setter was referred for management of a dislocation of a cemented dual mobility canine total hip prosthesis that occurred four months after the initial surgery. Revision surgery showed that the dislocation was associated with fracture of the ultra-high molecular weight polyethylene liner. The dislocation was successfully reduced after replacing the liner. A dual mobility acetabular component is composed of a mobile polyethylene liner inside a metallic cemented cup. Chronic wear of the components of a canine dual mobility total hip replacement has not been described previously. The use of this type of implant is fairly recent and limited long term follow-up of the implanted cases may be the explanation. Acute rupture of a polyethylene liner has never been described in humans, the only case of rupture of a polyethylene liner occurred 10 years after implantation. The case presented here of rupture of the polyethylene liner of a dual mobility total hip replacement is a hitherto unreported failure mode in this model of acetabular cup in the dog. PMID:26991949

  7. Is there evidence for accelerated polyethylene wear in uncemented compared to cemented acetabular components? A systematic review of the literature

    NARCIS (Netherlands)

    van der Veen, Hugo; van Jonbergen, H.P.W.; Poolman, R.W.; Bulstra, S.K.; van Raay, J.J.A.M.

    2013-01-01

    Joint arthroplasty registries show an increased rate of aseptic loosening in uncemented acetabular components as compared to cemented acetabular components. Since loosening is associated with particulate wear debris, we postulated that uncemented acetabular components demonstrate a higher polyethyle

  8. Acetabular defect reconstruction with impacted morsellized bone grafts or TCP/HA particles. A study on the mechanical stability of cemented cups in an artificial acetabulum model.

    NARCIS (Netherlands)

    Bolder, S.B.T.; Verdonschot, N.J.J.; Schreurs, B.W.; Buma, P.

    2002-01-01

    In revision surgery of the acetabulum bone defects can be filled with impacted human morsellized bone grafts. Because of a worldwide limited availability of human bone, alternatives are being considered. In this study we compared the initial stability of acetabular cups after reconstructing a cavita

  9. Femoral and obturator nerves palsy caused by pelvic cement extrusion after hip arthroplasty.

    Directory of Open Access Journals (Sweden)

    Pawel Zwolak

    2011-05-01

    Full Text Available Cement extrusion into the pelvis with subsequent palsy of the obturator and femoral nerves is a rare entity after hip replacement surgery. Cemented fixation of the acetabular cup has been considered as a safe and reliable standard procedure with very good long term results. We present a case of fifty year old female patient after hip arthroplasty procedure which suffered an obturator and femoral nerve palsy caused by extrusion of bone cement into the pelvis. Postoperative X-rays and CT-scan of the pelvis demonstrated a huge mass consisted of bone cement in close proximity of femoral and obturator nerves. The surgery charts reported shallow and weak bony substance in postero-superior aspect of the acetabulum. This weak bony acetabular substance may have caused extrusion of bone cement during press-fitting of the polyethylene cup into the acetabulum, and the following damage of the both nerves produced by polymerization of bone cement. The bone cement fragment has been surgically removed 3 weeks after arthroplasty. The female patient underwent intensive postoperative physical therapy and electro stimulation which resulted in full recovery of the patient to daily routine and almost normal electromyography results.

  10. Venture Cup

    OpenAIRE

    Hulshoff, Selma

    2013-01-01

    Abstract Venture Cup began as a small project with a financial purpose mixed with a societal goal. In 2000 when the project could not fulfil the financial goal of being a feeding structure of new client enterprises, it was passed on. This resulted in a structured organisation which has become a cultural change agent in the Danish field of Entrepreneurship. The life cycle process of a cultural change organisation and the influencing factors are the interest of this thesis. The stakeholders...

  11. Exploring Volumetrically Indexed Cups

    Science.gov (United States)

    Jones, Dustin L.

    2011-01-01

    This article was inspired by a set of 12 cylindrical cups, which are volumetrically indexed; that is to say, the volume of cup "n" is equal to "n" times the volume of cup 1. Various sets of volumetrically indexed cylindrical cups are explored. I demonstrate how this children's toy is ripe for mathematical investigation, with connections to…

  12. Fixation strength analysis of cup to bone material using finite element simulation

    Science.gov (United States)

    Anwar, Iwan Budiwan; Saputra, Eko; Ismail, Rifky; Jamari, J.; van der Heide, Emile

    2016-04-01

    Fixation of acetabular cup to bone material is an important initial stability for artificial hip joint. In general, the fixation in cement less-type acetabular cup uses press-fit and screw methods. These methods can be applied alone or together. Based on literature survey, the additional screw inside of cup is effective; however, it has little effect in whole fixation. Therefore, an acetabular cup with good fixation, easy manufacture and easy installation is required. This paper is aiming at evaluating and proposing a new cup fixation design. To prove the strength of the present cup fixation design, the finite element simulation of three dimensional cup with new fixation design was performed. The present cup design was examined with twist axial and radial rotation. Results showed that the proposed cup design was better than the general version.

  13. Exploring volumetrically indexed cups

    Science.gov (United States)

    Jones, Dustin L.

    2011-03-01

    This article was inspired by a set of 12 cylindrical cups, which are volumetrically indexed; that is to say, the volume of cup n is equal to n times the volume of cup 1. Various sets of volumetrically indexed cylindrical cups are explored. I demonstrate how this children's toy is ripe for mathematical investigation, with connections to geometry, algebra and differential calculus. Students with an understanding of these topics should be able to complete the analysis and related exercises contained herein.

  14. Hiboo International Football Cup

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The Hiboo International Cup Soccer Friendly, sponsored by the Hiboo International Group, kicked off on May 13 in Dongguangtou, Fengtai District, Beijing. The event will last until June 10 when the first whistle blows at the FIFA 2006 World Cup games in Germany, and provides the perfect teaser for local soccer fans to get in the World Cup mood. The Hiboo Cup is played between teams from China and seven foreign embassies' representatives, from the United States, Mexico, France, the African Union, Malaysia,...

  15. Three-Cup Chicken

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    Ingredents:500 grams chicken legs,100 grams(about one tea cup)rice wine,50 grams(a small tea cup)sesame oil,50grams refined soy sauce,25 grams white sugar,10grams oyster sauce,chopped scallions,ginger root,garlic,and some hot chili peppers

  16. Rotary cup slurry atomization

    Science.gov (United States)

    Sommer, H. T.; Marnicio, R. J.

    1983-06-01

    The theory of a two-phase flow in a rotating cup atomizer is described. The analysis considers the separation of the solid and liquid media thus realistically modeling the flow of two layers along the inner cup wall: a slurry of increasing solids concentration and a supernatent liquid layer. The analysis is based on the earlier work of Hinze and Milborn (1950) which addressed the flow within a rotary cup for a homogeneous liquid. The superimposition of a settling velocity under conditions of high centrifugal acceleration permits the extended analysis of the separation of the two phases. Appropriate boundary conditions have been applied to the film's free surface and the cup wall and to match the flow characteristics at the liquid-slurry interface. The changing slurry viscosity, increasing nonlinearly with growing solid loading, was also considered. A parameter study illustrates the potential for a cup design to provide optimal slurry and liquid film thicknesses for effective atomization.

  17. Recycling disposable cups into paper plastic composites.

    Science.gov (United States)

    Mitchell, Jonathan; Vandeperre, Luc; Dvorak, Rob; Kosior, Ed; Tarverdi, Karnik; Cheeseman, Christopher

    2014-11-01

    The majority of disposable cups are made from paper plastic laminates (PPL) which consist of high quality cellulose fibre with a thin internal polyethylene coating. There are limited recycling options for PPLs and this has contributed to disposable cups becoming a high profile, problematic waste. In this work disposable cups have been shredded to form PPL flakes and these have been used to reinforce polypropylene to form novel paper plastic composites (PPCs). The PPL flakes and polypropylene were mixed, extruded, pelletised and injection moulded at low temperatures to prevent degradation of the cellulose fibres. The level of PPL flake addition and the use of a maleated polyolefin coupling agent to enhance interfacial adhesion have been investigated. Samples have been characterised using tensile testing, dynamic mechanical analysis (DMA) and thermogravimetric analysis. Use of a coupling agent allows composites containing 40 wt.% of PPL flakes to increase tensile strength of PP by 50% to 30 MPa. The Young modulus also increases from 1 to 2.5 GPa and the work to fracture increases by a factor of 5. The work demonstrates that PPL disposable cups have potential to be beneficially reused as reinforcement in novel polypropylene composites.

  18. Orienteering World Cup hosted by CERN Club

    CERN Multimedia

    Katarina Anthony

    2010-01-01

    Elite runners took to the streets of Geneva for the last leg of the Orienteering World Cup, from 8-10 October. The Geneva finals were hosted by the CERN Orienteering Club and concluded months of competitions held across 5 countries.   Women's World-Cup winner, Simone Niggli (centre).  © Ilknur Colak The final events of the Orienteering World Cup took place in the Old Town of Geneva and Saint-Cergue, with runners following routes prepared by the CERN Orienteering Club. Orienteering is a sport of navigation, using only a compass, map and your sense of direction. The objective is to get to all the points on the map as quickly as possible, choosing your own paths as you run. This was the CERN club’s first successful participation in the World Cup, cementing its reputation as a fixture in the international orienteering world. Orienteering is not your typical Swiss pastime. Developed in Scandinavia, the sport has been gaining popularity internationally. “...

  19. Brazil World Cup Challenges

    Directory of Open Access Journals (Sweden)

    MANSUR, R.

    2012-12-01

    Full Text Available Overcoming the productivity challenge is the main benefit of the 2014 World Cup for Brazilian people. The sustainable development of our cultural tourism industry will catapult the new middle class growing up rate.

  20. Bigger size and defatting of bone chips will increase cup stability.

    Science.gov (United States)

    Ullmark, G

    2000-01-01

    Morcellised bone allograft in an in vitro model was used to test the tendency towards cup rotation using small or larger fragment sizes of an impacted graft bed and different fat contents. A cup cemented on an impacted graft bed of larger sized bone chips from the Howex bone mill containing natural marrow fat was loaded eccentrically until the cup rotated. This required 3450 N. The same chips impacted in the same way, but defatted with warm saline solution required 7000 N for rotation. The smaller sized bone chips from the Tracer bone mill defatted in a similar manner required only 1950 N for cup rotation. The conclusion was that larger sized chips, partly defatted, prevent rotation of a cup cemented on a graft bed.

  1. Demonstrating the Effects of Processing on the Structure and Physical Properties of Plastic Using Disposable PETE Cups

    Science.gov (United States)

    Erk, Kendra A.; Rhein, Morgan; Krafcik, Matthew J.; Ydstie, Sophie

    2015-01-01

    An educational activity is described in which the structure and physical properties of disposable plastic cups were directly related to the method of processing. The mechanical properties of specimens cut from the walls of poly(ethylene terephthalate) (PETE) cups, oriented parallel and perpendicular to the thermoforming direction, were measured in…

  2. Ten-year results with the Morscher press-fit cup: an uncemented, non-modular, porous-coated cup inserted without screws.

    Science.gov (United States)

    Garavaglia, Guido; Lübbeke, Anne; Barea, Christophe; Roussos, Constantinos; Peter, Robin; Hoffmeyer, Pierre

    2011-07-01

    Total hip arthroplasty (THA) with well designed cementless acetabular implants has shown excellent results. The purpose of this study was to assess our clinical and radiological outcomes using an uncemented cup. We conducted a prospective cohort study including all consecutive primary THAs performed with the Morscher press-fit cup, an uncemented non-modular acetabular component, between March 1996 and December 1998. Patients were evaluated at ten years with clinical and radiological follow-up, patient satisfaction and questionnaire assessment using the Harris hip score (HHS), Merle d'Aubigné and Postel score, the UCLA score, the 12-item short-form health survey (SF-12) and a visual analog scale. Five hundred sixty-one THAs were performed in 518 patients. At 120 months (± 7.3 months), 303 patients with 335 THAs were still available for follow-up. None of the patients had required cup revision for aseptic loosening. At ten years, the cup survivorship was 98.8% (95% CI 97.4-99.5) with cup revision for any cause as an endpoint. No radiolucencies were seen around the cups, but osteolytic defects involved 21 stems (8.3%). Mean total linear polyethylene wear was 0.9 mm. The Morscher acetabular replacement cup provides excellent results at ten years. There were no revisions for aseptic loosening of the cup, and no osteolytic defects were found around the cup. Patient satisfaction was high and the clinical results were very good. PMID:20524114

  3. Cup Anemometer Overspeeding

    DEFF Research Database (Denmark)

    Busch, N. E.; Kristensen, Leif

    1976-01-01

    Statistical considerations are applied to a general equation of motion for cup anemometers in a turbulent wind. It is shown that the relative overspeeding ΔS/S can be expressed as ΔS/S = Ih2 · Js(l0/Λs) + cIw2, where Is and Iw are the horizontal and the vertical turbulence intensifies, respectively...

  4. Cement Conundrum

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    China aims to streamline the crowded cement industry Policymakers are looking to build a concrete wall around the cement-making industry as they seek to solidify the fluid cement market and cut excessive production.

  5. The efficacy of a “double-D-shaped” wire marker for radiographic measurement of acetabular cup orientation and wear

    OpenAIRE

    Derbyshire, Brian; Raut, Videshnandan V.

    2013-01-01

    Historically, wire markers were attached to cemented all-plastic acetabular cups to demarcate the periphery and to measure socket wear. The wire shape was either a semi-circle passing over the pole of the cup, or a circle around the cup equator. More recently, “double-D” shaped markers were introduced with a part-circular aspect passing over the pole and a semi-circular aspect parallel to the equatorial plane. This configuration enabled cup retroversion to be distinguished from anteversion. I...

  6. Cup mixing type cup drink vending machine; Cup mixing shiki cup jido hanbaiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-01-10

    Fuji Electric Co. developed a new series of the cup mixing type cup drink vending machine. The system of this machine is not the conventional one in which drink is prepared in the existing mixing ball and pored into the cup, but the system in which raw materials are stirred directly. Main characteristics are as follows. This machine is responsive to the drinks highly viscous which could not be sold by the mixing ball type such as soup and shake and also to new drinks which can be prepared in the future. Moreover, the stirring does not leave the raw material unmelted, and remove gaps among temperatures and among concentrations. Further, complete discharge of the raw material and high cooling conservation of the regular coffee material make the sale of fresh and good-tasted drinks possible. There are few parts of the mixing ball and drink piping being dirty by raw materials. Therefore, the cleaning is not so hard, and the operational efficiency is heightened. (NEDO)

  7. A newly designed big cup nitinol stent for gastric outlet obstruction

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    AIM:To find out whether a newly designed big cup nitinol stent is suitable for treatment of patients with gastric outlet obstruction resulting from gastric cancer.METHODS:The new stent is composed of a proximal big cup segment(20 mm in length and 48-55 mm in diameter),a middle part(60 mm in length and 20 mm in diameter)covered by a polyethylene membrane and a distal sphericity(20 mm in length and 28 mm in diameter).Half of the proximal big cup segment is also covered by a polyethlene membrane,which is adjac...

  8. Field calibration of cup anemometers

    DEFF Research Database (Denmark)

    Schmidt Paulsen, Uwe; Mortensen, Niels Gylling; Hansen, Jens Carsten;

    2007-01-01

    A field calibration method and results are described along with the experience gained with the method. The cup anemometers to be calibrated are mounted in a row on a 10-m high rig and calibrated in the free wind against a reference cup anemometer. The method has been reported [1] to improve the...... statistical bias on the data relative to calibrations carried out in a wind tunnel. The methodology is sufficiently accurate for calibration of cup anemometers used for wind resource assessments and provides a simple, reliable and cost-effective solution to cup anemometer calibration, especially suited for...

  9. World Cup television

    OpenAIRE

    Lopes, Felisbela; Loureiro, Luís Miguel Nunes da Silva; Vieira, Phillipe Carlos Mota

    2012-01-01

    In the last year of the first decade of the 21st century, in the verge of breaking into the era of digital television, it is important to know what kind of television model is available in Portugal. The analysis of the news coverage of the FIFA 2010 World Cup will certainly help in finding the answers. In this article, we present a study that centers its focus on news formats related to this great media event, broadcasted in both generalist as well as cable news networks between the 11th of J...

  10. Failure of dual radius hydroxyapatite-coated acetabular cups

    Directory of Open Access Journals (Sweden)

    Zatti Giovanni

    2008-08-01

    Full Text Available Abstract Introduction Many kind of hydroxyapatite-coated cups were used, with favorable results in short term studies; it was supposed that its use could improve osteointegration of the cup, enhancing thus stability and survivorship. The purpose of this study is to analyze the long term behavior of the hemispheric HA coated, Dual Radius Osteonics cup and to discuss the way of failure through the exam of the revised components and of both periacetabular and osteolysis tissue. Materials and Methods Between 1994 and 1997, at the Department of Orthopedic Sciences of the Insubria University, using the posterolateral approach, were implanted 276 Dual Radius Osteonics® in 256 patients, with mean age of 63 years. Results At a mean follow-up of 10 years (range 8–12 years, 183 cups in 165 patients, were available for clinical and radiographical evaluation. 22 Cups among the 183 were revised (11%. The cause of revision was aseptic loosening in 17 cases, septic loosening in one case, periprosthetic fracture in another case, osteolysis and polyethylene wear in two cases and, finally, recurrent dislocations in the last one. In the remaining patients, mean HHS increased from a preoperative value of 50,15 to a postoperative value of 92,69. The mean polyethylene wear was 1,25 mm (min. 0,08, max. 3,9 mm, with a mean annual wear of 0,17 mm. The mean acetabular migration on the two axis was 1,6 mm and 1,8 mm. Peri-acetabular osteolysis were recorded in 89% of the implants (163 cases. The cumulative survivorship (revision as endpoint at the time was 88,9%. Conclusion Our study confirms the bad behavior of this type of cup probably related to the design, to the method of HA fixation. The observations carried out on the revised cup confirm these hypotheses but did not clarify if the third body wear could be a further problem. Another interesting aspect is the high incidence of osteolysis, which are often asymptomatic becoming a problem for the surgeon as the

  11. Is Cup Positioning Challenged in Hips Previously Treated With Periacetabular Osteotomy?

    DEFF Research Database (Denmark)

    Hartig-Andreasen, Charlotte; Stilling, Maiken; Søballe, Kjeld;

    2014-01-01

    After periacetabular osteotomy (PAO), some patients develop osteoarthritis with need of a total hip arthroplasty (THA). We evaluated the outcome of THA following PAO and explored factors associated with inferior cup position and increased polyethylene wear. Follow-up were performed 4 to 10years...... after THA in 34 patients (38 hips) with previous PAO. Computer analysis evaluated cup position and wear rates. No patient had dislocations or revision surgery. Median scores were: Harris hip 96, Oxford hip 38 and WOMAC 78. Mean cup anteversion and abduction angles were 22(o) (range 7°-43°) and 45......° (range 28°-65°). Outliers of cup abduction were associated with persisting dysplasia (CE...

  12. [Acetabular Osteolysis in Total Hip Replacement - When to Retain the Cup?].

    Science.gov (United States)

    Lutz, B; Faschingbauer, M; Bieger, R; Reichel, H; Kappe, T

    2016-08-01

    Periacetabular osteolysis is a frequent long-term complication of cementless total hip arthroplasty. The decision whether to retain or to revise a cup in the presence of osteolysis remains a challenge. The options are regular clinical and radiological check-ups, isolated liner exchange with and without bone grafting, and complete cup revision. Thorough preoperative diagnostics, including a medical history, examination and imaging, are mandatory for correct decision making. In most patients, computed tomography is useful to assess periacetabular osteolysis. If the cup is well-fixed and positioned in an asymptomatic patient without progressive osteolysis and no implant defect or higher grade polyethylene wear and no signs of infection, continuous clinical and radiological monitoring is preferred. If imaging reveals cup loosening, malposition, osteolysis localised in a weight-bearing area, imminent or present periprosthetic fractures, rapid progressive osteolysis, implant defects or massive inlay wear, surgical treatment may be preferred. Cup revision is usually performed in such patients. If the cup is well-positioned and well-fixed in the X-ray, the procedure has to be discussed with the patient individually. Apart from patient-specific risk factors, the risk of further progression has to be assessed. Isolated liner exchange can be performed if the patient is asymptomatic and the cup proves to be stable intraoperatively. It is still unclear whether filling osteolyses through screw holes or osseous windows is of long-term benefit. PMID:27249047

  13. Spoon-to-Cup Fading as Treatment for Cup Drinking in a Child with Intestinal Failure

    Science.gov (United States)

    Groff, Rebecca A.; Piazza, Cathleen C.; Zeleny, Jason R.; Dempsey, Jack R.

    2011-01-01

    We treated a child with intestinal failure who consumed solids on a spoon but not liquids from a cup. We used spoon-to-cup fading, which consisted of taping a spoon to a cup and then gradually moving the bowl of the spoon closer to the edge of the cup. Spoon-to-cup fading was effective for increasing consumption of liquids from a cup. (Contains 2…

  14. CEMENT SLURRIES FOR GEOTHERMAL WELLS CEMENTING

    OpenAIRE

    Nediljka Gaurina-Međimurec; Davorin Matanović; Gracijan Krklec

    1994-01-01

    During a well cementing special place belongs to the cement slurry design. To ensure the best quality of cementing, a thorough understanding of well parameters is essential, as well as behaviour of cement slurry (especially at high temperatures) and application of proven cementing techniques. Many cement jobs fail because of bad job planning. Well cementing without regarding what should be accomplished, can lead to well problems (channels in the cement, unwanted water, gas or fluid production...

  15. The efficacy of a "double-D-shaped" wire marker for radiographic measurement of acetabular cup orientation and wear.

    Science.gov (United States)

    Derbyshire, Brian; Raut, Videshnandan V

    2013-01-01

    Historically, wire markers were attached to cemented all-plastic acetabular cups to demarcate the periphery and to measure socket wear. The wire shape was either a semi-circle passing over the pole of the cup, or a circle around the cup equator. More recently, "double-D" shaped markers were introduced with a part-circular aspect passing over the pole and a semi-circular aspect parallel to the equatorial plane. This configuration enabled cup retroversion to be distinguished from anteversion. In this study, the accuracy of radiographic measurement of cup orientation and wear was assessed for cups with "double-D" and circular markers. Each cup was attached to a measurement jig which could vary the anteversion/retroversion and internal/external rotation of the cup. A metal femoral head was fixed within the socket and radiographic images were created for all combinations of cup orientation settings. The images were measured using software with automatic edge detection, and cup orientation and zero-wear accuracies were determined for each setting. The median error for cup version measurements was similar for both types of wire marker (0.2° double-D marker, -0.24° circular marker), but measurements of the circular marker were more repeatable. The median inclination errors were 2.05° (double-D marker) and 0.23° (circular marker). The median overall "zero wear" errors were 0.19 mm (double-D marker) and 0.03 mm (circular marker). Measurements of the circular wire marker were much more repeatable.

  16. Cup tool use by squirrel monkeys.

    Science.gov (United States)

    Buckmaster, Christine L; Hyde, Shellie A; Parker, Karen J; Lyons, David M

    2015-12-01

    Captive-born male and female squirrel monkeys spontaneously 'invented' a cup tool use technique to Contain (i.e., hold and control) food they reduced into fragments for consumption and to Contain water collected from a valve to drink. Food cup use was observed more frequently than water cup use. Observations indicate that 68% (n = 39/57) of monkeys in this population used a cup (a plastic slip cap) to Contain food, and a subset of these monkeys, 10% (n = 4/39), also used a cup to Contain water. Cup use was optional and did not replace, but supplemented, the hand/arm-to-mouth eating and direct valve drinking exhibited by all members of the population. Strategies monkeys used to bring food and cups together for food processing activity at preferred upper-level perching areas, in the arboreal-like environment in which they lived, provides evidence that monkeys may plan food processing activity with the cups. Specifically, prior to cup use monkeys obtained a cup first before food, or obtained food and a cup from the floor simultaneously, before transporting both items to upper-level perching areas. After food processing activity with cups monkeys rarely dropped the cups and more often placed the cups onto perching. Monkeys subsequently returned to use cups that they previously placed on perching after food processing activity. The latter behavior is consistent with the possibility that monkeys may keep cups at preferred perching sites for future food processing activity and merits experimental investigation. Reports of spontaneous tool use by squirrel monkeys are rare and this is the first report of population-level tool use. These findings offer insights into the cognitive abilities of squirrel monkeys and provide a new context for behavior studies with this genus and for comparative studies with other primates.

  17. Coffee Cup Atomic Force Microscopy

    Science.gov (United States)

    Ashkenaz, David E.; Hall, W. Paige; Haynes, Christy L.; Hicks, Erin M.; McFarland, Adam D.; Sherry, Leif J.; Stuart, Douglas A.; Wheeler, Korin E.; Yonzon, Chanda R.; Zhao, Jing; Godwin, Hilary A.; Van Duyne, Richard P.

    2010-01-01

    In this activity, students use a model created from a coffee cup or cardstock cutout to explore the working principle of an atomic force microscope (AFM). Students manipulate a model of an AFM, using it to examine various objects to retrieve topographic data and then graph and interpret results. The students observe that movement of the AFM…

  18. Cement Formation

    DEFF Research Database (Denmark)

    Telschow, Samira; Jappe Frandsen, Flemming; Theisen, Kirsten;

    2012-01-01

    Cement production has been subject to several technological changes, each of which requires detailed knowledge about the high multiplicity of processes, especially the high temperature process involved in the rotary kiln. This article gives an introduction to the topic of cement, including......−liquid reactions are discussed, as are the influences of particles sizes on clinker phase formation. Furthermore, a mechanism for clinker phase formation in an industrial rotary kiln reactor is outlined....

  19. Density enhancement of polyethylene solidified wastes

    International Nuclear Information System (INIS)

    To overcome the impediment against practical utilization of the technically already available process of solidifying low- and intermediate-level radioactive wastes for disposal in ocean bottom, arising from the regulatory minimum density of 1.2 prescribed for such solidified wastes, a method is proposed of thickening the polyethylene with 36 -- 38 w/o sodium sulfate anhydride to raise the density above 1.2. The resulting thickened polyethylene loaded with simulated radioactive waste showed a monoaxial compressive strength far exceeding 150 kg/cm2, and proved to possess good stability in deionized water in immersion tests lasting 400 days. Polyethylene was also found to provide a volume reduction factor far higher than obtained with cement or asphalt solidification. (author)

  20. Cupping for Treating Pain: A Systematic Review

    Directory of Open Access Journals (Sweden)

    Jong-In Kim

    2011-01-01

    Full Text Available The objective of this study was to assess the evidence for or against the effectiveness of cupping as a treatment option for pain. Fourteen databases were searched. Randomized clinical trials (RCTs testing cupping in patients with pain of any origin were considered. Trials using cupping with or without drawing blood were included, while trials comparing cupping with other treatments of unproven efficacy were excluded. Trials with cupping as concomitant treatment together with other treatments of unproven efficacy were excluded. Trials were also excluded if pain was not a central symptom of the condition. The selection of studies, data extraction and validation were performed independently by three reviewers. Seven RCTs met all the inclusion criteria. Two RCTs suggested significant pain reduction for cupping in low back pain compared with usual care (P < .01 and analgesia (P < .001. Another two RCTs also showed positive effects of cupping in cancer pain (P < .05 and trigeminal neuralgia (P < .01 compared with anticancer drugs and analgesics, respectively. Two RCTs reported favorable effects of cupping on pain in brachialgia compared with usual care (P = .03 or heat pad (P < .001. The other RCT failed to show superior effects of cupping on pain in herpes zoster compared with anti-viral medication (P = .065. Currently there are few RCTs testing the effectiveness of cupping in the management of pain. Most of the existing trials are of poor quality. Therefore, more rigorous studies are required before the effectiveness of cupping for the treatment of pain can be determined.

  1. Design optimization of cementless metal-backed cup prostheses using the concept of functionally graded material

    Energy Technology Data Exchange (ETDEWEB)

    Hedia, H S; El-Midany, T T; Shabara, M A N; Fouda, N [Production Engineering and M/C Design Department, Faculty of Engineering, Mansoura University, Mansoura (Egypt)

    2006-09-15

    Metal backing has been widely used in acetabular cup design. A stiff backing for a polyethylene liner was initially believed to be mechanically favourable. Yet, recent studies of the load transfer around acetabular cups have shown that a stiff backing causes two problems. It generates higher stress peaks around the acetabular rim than those caused by full polyethylene cups and reduces the stresses transferred to the dome of the acetabulum causing stress shielding. The aim of this study is to overcome these two problems by improving the design of cementless metal-backed acetabular cups using the two-dimensional functionally graded material (FGM) concept through finite-element analysis and optimization techniques. It is found that the optimal 2D FGM model must have three bioactive materials of hydroxyapatite, Bioglass and collagen. This optimal material reduces the stress shielding at the dome of the acetabulum by 40% and 37% compared with stainless steel and titanium metal backing shells, respectively. In addition, using the 2D FGM model reduces the maximum interface shear stress in the bone by 31% compared to the titanium metal backing shell.

  2. [Evaluation of the histocompatibility of endodontic cement in subcutaneous connective tissue using three methods].

    Science.gov (United States)

    Ferraz, S L; Birman, E G; Antoniazzi, J H; Magalhães, J

    1990-01-01

    It was employed three methods to evaluate the histocompatibility of a root canal filling cement, as the N-Rickert paste: implantation of round glass cover slips, polyethylene tubes and pellets of the cement. The results demonstrated qualitative and quantitative differences among the methods utilized indicating as a good toll the use of glass cover slips covered by the cement, since they provide good conditions of work, major areas of study, as also facilities in obtaining the specimens for study. The pellets didn't simulate the clinical conditions of the cement and the very small areas of study of the polyethylene tubes don't give definitive conclusions. PMID:2135431

  3. Applied exploration of shape-stabilized polyethylene glycol/silicon dioxide composites as phase change materials in asphalt and cement environment%PEG/SiO2定形相变材料在沥青及水泥环境中应用的可行性

    Institute of Scientific and Technical Information of China (English)

    何丽红; 李菁若; 曹长斌; 罗阳明; 朱洪洲

    2013-01-01

    Based on physical blend methods,asphalt or cement shape-stabilized phase change materials composites (CPCMs) were prepared by polyethylene glycol/silicon dioxide shape-stabilized phase change materials (PEG/SiO2 ss-PCMs) and asphalt or cement.Thermal energy storage and thermal stability of CPCMs are characterized using synthesized thermal analyzer,and the chemical compatibility of CPCMs is characterized using FT-IR.The feasibility of ss-PCMs applied to asphalt and cement environment was explored.The results showed that CPCMs had high phase change enthalpy,good thermal stability and chemical compatibility.Ss-PCMs can be used in road to achieve solar energy conversion or storage and actively control pavement temperature,and this is a more effective way of reducing pavement surface temperature and temperature diseases in high temperature conditions and at the same time,relieving urban heat island effect,therefore,ss-PCMs have broad application foregrounds in road engineering.%以聚乙二醇/二氧化硅(PEG/SiO2)定形相变材料与沥青、水泥为原料,采用物理共混法制备出沥青或水泥复合定形相变材料.利用综合热分析仪(TG-DSC)测试复合相变材料的储热性能及热稳定性,通过FT-IR对复合相变材料的兼容性进行了表征,探讨PEG/SiO2定形相变材料在沥青、水泥环境中应用的可行性.试验表明,复合定形相变材料具有较高的相变焓,良好的热稳定性和兼容性.将PEG/SiO2定形相变材料应用于公路工程中,可实现太阳能量转换与储存,主动调节路面的使用温度,并在高温条件下可有效降低路表温度,减少温度对路面的病害,缓解城市热岛效应,改善人居环境,其应用前景广阔.

  4. Analysis of bone ingrowth on a tantalum cup

    Directory of Open Access Journals (Sweden)

    D′Angelo F

    2008-01-01

    Full Text Available Background: Trabecular Metal (TM is a new highly porous material made of tantalum (Zimmer, Warsaw, Indiana, USA. Its three-dimensional structure is composed of a series of interconnected dodecahedron pores that are on average 550 μm in diameter. This size is considered optimal for bone ingrowth and is similar to trabecular bone. The elastic modulus of TM (3 GPa is more similar to that of cancellous (0,1-1,5 GPa or cortical (112-18 GPa bone and is significantly less similar to that of Titanium (110 GPa and Co-Cr alloys (220 GPa. These features enable bone apposition and remodeling. The purpose of the present study was to evaluate the histology of the bone-implant interface in a human specimen. Materials and Methods: A highly porous tantalum cup (Zimmer, Warsaw, Indiana, USA was removed for recurrent dislocations three years after implantation. In order to obtain a slice of the cup, two cuts were made on the centre using an Exakt cutting machine. Then the slice was embedded in a Technovit resin and a Hematoxylin-eosin stain was used to study the bone tissue. Bone ingrowth was calculated using a method based on simple calculations of planar geometry. Results: The histological evaluation of the periprosthetic tissues revealed a typical chronic inflammation with few particles of polyethylene that were birefringent using polarized light. The quantitative evaluation of bone ingrowth revealed that more than 95% of voids were filled with bone. Discussion: In the literature, a lot of studies focused on tantalum were carried on animal model. Up to now little information is available about the histology of the bone-tantalum interface in a human artificial joint. We had an opportunity to remove a well integrated cup hence this study. The histology confirmed the strong relationship between the structure of this material and bone. The morphometric analysis revealed a high percentage of bone ingrowth.

  5. Failure of Polyethylene Inlays in Cementless Total Hip Arthroplasty: A Retrieval Analysis

    Directory of Open Access Journals (Sweden)

    Ulrike Mueller

    2016-01-01

    Full Text Available A retrieval analysis has been performed on 50 polyethylene inlays of cementless screw ring implants (Mecring, Mecron, Berlin, Germany to investigate the failure mechanism of this specific open cup hip arthroplasty design that has shown a high clinical failure rate. Design-specific damage modes like rim creep, collar fatigue, and backside wear were assessed. Furthermore, the inlays were measured using a CMM to determine deformation. In 90% backside wear was observed and collar fatigue occurred in 68% of the cases. Rim creep was present in 38% of the polyethylene inlays. In 90% of the cases the cup opening diameter was 32.1 mm or less and 46% had a diameter less than 32 mm. It seems that creep and deformation of the polyethylene leads to a reduced diameter at the cup opening and consequently decreased clearance. To avoid this type of failure, polyethylene inlays should be supported at the back by the cup to reduce the risk of ongoing creep deformation.

  6. Bone remodeling around cementless tantalum cups

    NARCIS (Netherlands)

    Grillo, J. -C.; Flecher, X.; Bouvenot, J.; Argenson, J. -N.

    2008-01-01

    Purpose of the study.-Most studies have reported a significant decrease in periacetabular bone stock one year after implantation of a cementless cup. The purpose of this work was to study the bone-implant interface of the tantalum cup using plain X-rays and dual-energy X-ray absorptiometry (DEXA). M

  7. Soccer jersey sponsors and the world cup

    NARCIS (Netherlands)

    Groot, L.F.M.; Ferwerda, J.

    2014-01-01

    The market for soccer jerseys is a multibillion market dominated by Adidas, Nike and Puma. This paper investigates whether jersey sponsorship has a non-arbitrary effect on the outcomes of World Cup knockout matches. The results show that in the knockout stages of the last four World Cup tournaments,

  8. Conventional Versus Cross-Linked Polyethylene for Total Hip Arthroplasty.

    Science.gov (United States)

    Surace, Michele F; Monestier, Luca; Vulcano, Ettore; Harwin, Steven F; Cherubino, Paolo

    2015-09-01

    The clinical and radiographic outcomes of 88 patients who underwent primary total hip arthroplasty with either conventional polyethylene or cross-linked polyethylene (XLPE) from the same manufacturer were compared. There were no significant differences between the 2 subpopulations regarding average age, gender, side affected, or prosthetic stem and cup size. The average follow-up was 104 months (range, 55 to 131 months). To the authors' knowledge, this is the longest follow-up for this particular insert. Clinical and radiographic evaluations were performed at 1, 3, 6, and 12 months and then annually. Results showed that XLPE has a significantly greater wear reduction than that of standard polyethylene in primary total hip arthroplasty. At the longest available follow-up for these specific inserts, XLPE proved to be effective in reducing wear. PMID:26375527

  9. Fourier analysis of the aerodynamic behavior of cup anemometers

    International Nuclear Information System (INIS)

    The calibration results (the transfer function) of an anemometer equipped with several cup rotors were analyzed and correlated with the aerodynamic forces measured on the isolated cups in a wind tunnel. The correlation was based on a Fourier analysis of the normal-to-the-cup aerodynamic force. Three different cup shapes were studied: typical conical cups, elliptical cups and porous cups (conical-truncated shape). Results indicated a good correlation between the anemometer factor, K, and the ratio between the first two coefficients in the Fourier series decomposition of the normal-to-the-cup aerodynamic force. (paper)

  10. Sound analysis of a cup drum

    International Nuclear Information System (INIS)

    The International Young Physicists’ Tournament (IYPT) is a worldwide tournament that evaluates a high-school student's ability to solve various physics conundrums that have not been fully resolved in the past. The research presented here is my solution to the cup drum problem. The physics behind a cup drum has never been explored or modelled. A cup drum is a musical instrument that can generate different frequencies and amplitudes depending on the location of a cup held upside-down over, on or under a water surface. The tapping sound of a cup drum can be divided into two components: standing waves and plate vibration. By individually researching the nature of these two sounds, I arrived at conclusions that could accurately predict the frequencies in most cases. When the drum is very close to the surface, qualitative explanations are given. In addition, I examined the trend of the tapping sound amplitude at various distances and qualitatively explained the experimental results. (paper)

  11. A study on the UNDEX cup forming

    Directory of Open Access Journals (Sweden)

    A.E. El Mokadem*, A.S. Wifi, I. Salama

    2009-12-01

    Full Text Available Purpose: This work investigates the use of the underwater explosion (UNDEX for the free and plug assisted cup forming processes.Design/methodology/approach: A 3D finite element model is built to simulate the process of the UNDEX cup forming using ABAQUS finite element code. Johnson-Cook (JC material plasticity model is used to represent strain rate sensitivity of the used materials. Johnson- Cook damage criterion is employed to detect the onset of damage in the cup forming process.Findings: Both relatively hard and soft plugs are considered and the effects of using different plug materials on cup profile, strains and the limiting drawing ratios are given. The onset of damage in this process is also indicated. The results suggest that a relatively hard plug can enhance the control of the cup shape and the uniformity of strain distribution leading to increased limiting drawing ratio.Research limitations/implications: This work suggests a methodology for the prediction of shape, different strain distribution, the limiting drawing ratio and the energy required for UNDEX cup forming process.Practical implications: This study could be useful in non-conventional high energy rate forming industry.Originality/value: The study reveals the possibility of producing flat-bottomed cup by the relatively hard plug assisted UNDEX forming technique.

  12. LCA of beverage cups with special focus on the effect of end-of-life scenarios on the assessment results

    Energy Technology Data Exchange (ETDEWEB)

    Haekkinen, T.; Vares, S.

    2009-12-15

    Environmental impacts of a beverage cup concept were studied with help of life cycle assessment methodology with specific focus on end-of life scenarios. Carton based products were compared with polymer based products. The cartonbased cups were covered either with polyethene (PE) or polylactide (PLA). The polymer based cups were made of polyethylene terephthalate (PET). The paper studies the environmental impacts of production and alternative end-of-life scenarios and discusses the significance of the research frame related decisions. The focus is on global warming potential. The paper shows that significant improvements can be achieved through the choice of raw materials and optimal end-of-life. In order to avoid a situation where the results provoke more confusion than develop improved understanding, the LCA results should not be taken as fixed but the LCA should rather be seen as a tool which supports the manufacturer in the formulation of guidelines for product's end-of-life. (orig.)

  13. Clear plastic cups: a childhood choking hazard.

    Science.gov (United States)

    Weiss, R L; Goldstein, M N; Dharia, A; Zahtz, G; Abramson, A L; Patel, M

    1996-11-01

    The disposable plastic beverage cup is not usually regarded as hazardous to young children. Certain varieties of these products however, are manufactured from a brittle, clear plastic that easily cracks and fragments. While most conscientious parents keep their children safe from peanuts, balloons, and other known choking hazards, a child can surreptitiously bite a cup edge and aspirate the fragment. We report two cases of foreign body aspiration involving clear plastic cups that went undetected one of which remained 21 months following a negative rigid bronchoscopy. Diagnostic difficulties are related to the transparency and radiolucency of these objects. When suspicious of foreign body aspiration in children, otolaryngologists should inquire about the availability of clear plastic cups in the household and be mindful of the diagnostic pitfalls. Further investigations including CT scanning and repeat bronchoscopy may be helpful in cases of suspected missed foreign bodies. An educational campaign aimed at prevention and placement of product package warning labels should be established.

  14. Does Cupping = Success for Olympic Athletes?

    Science.gov (United States)

    ... news/fullstory_160301.html Does 'Cupping' = Success for Olympic Athletes? Telltale red circles of ancient Chinese practice ... Eyebrows raised in Rio over the weekend when Olympic athletes like swimmer Michael Phelps started showing up ...

  15. Soccer jersey sponsors and the world cup

    OpenAIRE

    Groot, L.F.M.; Ferwerda, J

    2014-01-01

    The market for soccer jerseys is a multibillion market dominated by Adidas, Nike and Puma. This paper investigates whether jersey sponsorship has a non-arbitrary effect on the outcomes of World Cup knockout matches. The results show that in the knockout stages of the last four World Cup tournaments, especially national teams sponsored by Adidas perform significantly better than expected, while teams sponsored by any other company than Adidas, Puma or Nike perform worse. The average advantage ...

  16. A modified cementing technique using BoneSource to augment fixation of the acetabulum in a sheep model.

    NARCIS (Netherlands)

    Timperley, A.J.; Nusem, I.; Wilson, K.; Whitehouse, S.L.; Buma, P.; Crawford, R.W.

    2010-01-01

    BACKGROUND AND PURPOSE: Our aim was to assess in an animal model whether the use of HA paste at the cement-bone interface in the acetabulum improves fixation. We examined, in sheep, the effect of interposing a layer of hydroxyapatite cement around the periphery of a polyethylene socket prior to fixi

  17. Design of the Faraday Cups in Diamond

    CERN Document Server

    Morgan, A F D

    2005-01-01

    This paper details the work done on the design of the Faraday cups for the Diamond injector. Faraday cups are a basic charge capture device which can be used as reference points for current measurement calibration. Diamond has Faraday cups in positions covering the complete energy range of the injector from the electron gun to the booster synchrotron extraction. Specifically there are cups at 90 keV, 4 MeV, 100 MeV and 3 GeV. An initial design decision was made to make the designs passive to increase reliability and reduce complexity. The 90 keV and 4 MeV cups were modified from an existing design using analytical formulae and MathCAD, while the high energy 100 MeV and 3 GeV designs were done using the EGSnrc Monte Carlo code and MatLAB. The EGSnrc led designs achieved a theoretical electron capture of around 99%, allowing them to be used with reasonable certainty as calibration references. Due to the modest 5Hz repetition rate, power loading of the structures is minimal and active cooling is not required for...

  18. An updated review of the efficacy of cupping therapy.

    Directory of Open Access Journals (Sweden)

    Huijuan Cao

    Full Text Available BACKGROUND: Since 1950, traditional Chinese medicine (TCM cupping therapy has been applied as a formal modality in hospitals throughout China and elsewhere in the world. Based on a previous systematic literature review of clinical studies on cupping therapy, this study presents a thorough review of randomized controlled trials (RCTs to evaluate the therapeutic effect of cupping therapy. METHOD: Six databases were searched for articles published through 2010. RCTs on cupping therapy for various diseases were included. Studies on cupping therapy combined with other TCM treatments versus non-TCM therapies were excluded. RESULTS: 135 RCTs published from 1992 through 2010 were identified. The studies were generally of low methodological quality. Diseases for which cupping therapy was commonly applied were herpes zoster, facial paralysis (Bell palsy, cough and dyspnea, acne, lumbar disc herniation, and cervical spondylosis. Wet cupping was used in most trials, followed by retained cupping, moving cupping, and flash cupping. Meta-analysis showed cupping therapy combined with other TCM treatments was significantly superior to other treatments alone in increasing the number of cured patients with herpes zoster, facial paralysis, acne, and cervical spondylosis. No serious adverse effects were reported in the trials. CONCLUSIONS: Numerous RCTs on cupping therapy have been conducted and published during the past decades. This review showed that cupping has potential effect in the treatment of herpes zoster and other specific conditions. However, further rigorously designed trials on its use for other conditions are warranted.

  19. Asphalt cement poisoning

    Science.gov (United States)

    ... petroleum material that hardens when it cools. Asphalt cement poisoning occurs when someone swallows asphalt. If hot ... found in: Road paving materials Roofing materials Tile cements Asphalt may also be used for other purposes.

  20. Management of knee osteoarthritis with cupping therapy

    OpenAIRE

    Asim Ali Khan; Umar Jahangir; Shaista Urooj

    2013-01-01

    The study aimed to evaluate the effect of cupping therapy at a clinical setting for knee osteoarthritis. A randomized, controlled clinical trial was conducted. Cupping was performed on 0-6 th day; 9-11 th day and 14 th day, i.e., 11 sittings follow-up to determine longer term carryover of treatment effects utilizing both objective and subjective assessment. The assessment was performed before and after treatment spreading over a period of 15 days. The results of this study shows significant a...

  1. Modulo computably enumerable degrees by cupping partners

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Cupping partners of an element in an upper semilattice with a greatest element 1 are those joining the element to 1. We define a congruence relation on such an upper semilattice by considering the elements having the same cupping partners as equivalent. It is interesting that this congruence relation induces a non-dense quotient structure of computably enumerable Turing degrees. Another main interesting phenomenon in this article is that on the computably enumerable degrees, this relation is different from that modulo the noncuppable ideal, though they define a same equivalent class for the computable Turing degree.

  2. World Cup:Brands Gamble Began

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    As I click the first word on board,eight days,17 hours and one minute later,the 2010 FIFA World Cup South AfricaTM would star t its month-long competition.Who would like to be awarded the World Cup Trophy at last has already aroused the enthusiasm of the whole world.Furthermore,the worldwide famous sports brands also have launched their adventure to bet which team they sponsored would be at the top of the competition.One month later,we could know who will win eventually.

  3. Football business models: Why did Germany win the World Cup?

    DEFF Research Database (Denmark)

    Cortsen, Kenneth

    2014-01-01

    This article looks into the managerial aspects related to why and how Germany won the 2014 FIFA World Cup.......This article looks into the managerial aspects related to why and how Germany won the 2014 FIFA World Cup....

  4. Superior accuracy of model-based radiostereometric analysis for measurement of polyethylene wear

    OpenAIRE

    Stilling, M.; Kold, S.; De Raedt, S.; Andersen, N. T.; Rahbek, O.; Søballe, K.

    2012-01-01

    Objectives The accuracy and precision of two new methods of model-based radiostereometric analysis (RSA) were hypothesised to be superior to a plain radiograph method in the assessment of polyethylene (PE) wear. Methods A phantom device was constructed to simulate three-dimensional (3D) PE wear. Images were obtained consecutively for each simulated wear position for each modality. Three commercially available packages were evaluated: model-based RSA using laser-scanned cup models (MB-RSA), mo...

  5. ACCUWIND - Methods for classification of cup anemometers

    Energy Technology Data Exchange (ETDEWEB)

    Dahlberg, J.Aa.; Friis Pedersen, T.; Busche, P.

    2006-05-15

    Errors associated with the measurement of wind speed are the major sources of uncertainties in power performance testing of wind turbines. Field comparisons of well-calibrated anemometers show significant and not acceptable difference. The European CLASSCUP project posed the objectives to quantify the errors associated with the use of cup anemometers, and to develop a classification system for quantification of systematic errors of cup anemometers. This classification system has now been implemented in the IEC 61400-12-1 standard on power performance measurements in annex I and J. The classification of cup anemometers requires general external climatic operational ranges to be applied for the analysis of systematic errors. A Class A category classification is connected to reasonably flat sites, and another Class B category is connected to complex terrain, General classification indices are the result of assessment of systematic deviations. The present report focuses on methods that can be applied for assessment of such systematic deviations. A new alternative method for torque coefficient measurements at inclined flow have been developed, which have then been applied and compared to the existing methods developed in the CLASSCUP project and earlier. A number of approaches including the use of two cup anemometer models, two methods of torque coefficient measurement, two angular response measurements, and inclusion and exclusion of influence of friction have been implemented in the classification process in order to assess the robustness of methods. The results of the analysis are presented as classification indices, which are compared and discussed. (au)

  6. ULTRA-LIGHTWEIGHT CEMENT

    International Nuclear Information System (INIS)

    The objective of this project is to develop an improved ultra-lightweight cement using ultra-lightweight hollow glass spheres (ULHS). Work reported herein addresses Task 1: Assess Ultra-Lightweight Cementing Issues, Task 2: Review Russian Ultra-Lightweight Cement Literature, Task 3: Test Ultra-Lightweight Cements, and Task 8: Develop Field ULHS Cement Blending and Mixing Techniques. Results reported this quarter include: preliminary findings from a literature review focusing on problems associated with ultra-lightweight cements; summary of pertinent information from Russian ultra-lightweight cement literature review; laboratory tests comparing ULHS slurries to foamed slurries and sodium silicate slurries for two different applications; and initial laboratory studies with ULHS in preparation for a field job

  7. Polyethylene encapsulatin of nitrate salt wastes: Waste form stability, process scale-up, and economics

    International Nuclear Information System (INIS)

    A polyethylene encapsulation system for treatment of low-level radioactive, hazardous, and mixed wastes has been developed at Brookhaven National Laboratory. Polyethylene has several advantages compared with conventional solidification/stabilization materials such as hydraulic cements. Waste can be encapsulated with greater efficiency and with better waste form performance than is possible with hydraulic cement. The properties of polyethylene relevant to its long-term durability in storage and disposal environments are reviewed. Response to specific potential failure mechanisms including biodegradation, radiation, chemical attack, flammability, environmental stress cracking, and photodegradation are examined. These data are supported by results from extensive waste form performance testing including compressive yield strength, water immersion, thermal cycling, leachability of radioactive and hazardous species, irradiation, biodegradation, and flammability. The bench-scale process has been successfully tested for application with a number of specific ''problem'' waste streams. Quality assurance and performance testing of the resulting waste form confirmed scale-up feasibility. Use of this system at Rocky Flats Plant can result in over 70% fewer drums processed and shipped for disposal, compared with optimal cement formulations. Based on the current Rocky Flats production of nitrate salt per year, polyethylene encapsulation can yield an estimated annual savings between $1.5 million and $2.7 million, compared with conventional hydraulic cement systems. 72 refs., 23 figs., 16 tabs

  8. The contact mechanics and occurrence of edge loading in modular metal-on-polyethylene total hip replacement during daily activities.

    Science.gov (United States)

    Hua, Xijin; Li, Junyan; Jin, Zhongmin; Fisher, John

    2016-06-01

    The occurrence of edge loading in hip joint replacement has been associated with many factors such as prosthetic design, component malposition and activities of daily living. The present study aimed to quantify the occurrence of edge loading/contact at the articulating surface and to evaluate the effect of cup angles and edge loading on the contact mechanics of a modular metal-on-polyethylene (MoP) total hip replacement (THR) during different daily activities. A three-dimensional finite element model was developed based on a modular MoP bearing system. Different cup inclination and anteversion angles were modelled and six daily activities were considered. The results showed that edge loading was predicted during normal walking, ascending and descending stairs activities under steep cup inclination conditions (≥55°) while no edge loading was observed during standing up, sitting down and knee bending activities. The duration of edge loading increased with increased cup inclination angles and was affected by the cup anteversion angles. Edge loading caused elevated contact pressure at the articulating surface and substantially increased equivalent plastic strain of the polyethylene liner. The present study suggested that correct positioning the component to avoid edge loading that may occur during daily activities is important for MoP THR in clinical practice.

  9. Cemented total hip arthroplasty with impacted morcellized bone-grafts to restore acetabular bone defects in congenital hip dysplasia.

    NARCIS (Netherlands)

    Bolder, S.B.T.; Melenhorst, J.; Gardeniers, J.W.M.; Slooff, T.J.J.H.; Veth, R.P.H.; Schreurs, B.W.

    2001-01-01

    We evaluated the results of 27 acetabular reconstructions in 21 patients with secondary osteoarthritis resulting from congenital dysplasia of the hip in which the acetabular bone defects were restored with impacted morcellized bone-grafts in combination with a cemented cup. At an average follow-up o

  10. A Procedure for Classification of Cup-Anemometers

    DEFF Research Database (Denmark)

    Friis Pedersen, Troels; Paulsen, Uwe Schmidt

    1997-01-01

    The paper proposes a classification procedure for cup-anemometers based on similar principles as for power converters. A range of operational parameters are established within which the response of the cup-anemometer is evaluated. The characteristics of real cup-anemometers are fitted to a...... realistic 3D cup-anemometer model. Afterwards, the model is used to calculate the response under the range of operational conditions which are set up for the classification. Responses are compared to the normal linear calibration relationship, derived from Wind tunnel calibrations. Results of the 3D cup...

  11. Aqueous polyethylene oxide solutions

    International Nuclear Information System (INIS)

    A number of aspects concerning the reorientation of polymer, water and ion hydration complexes have been studied in aqueous solution of polyethylene oxide (PEO). The polymer dynamics are investigated by 1H-PEO and 13C-PEO nuclear relaxation experiments. 162 refs.; 30 figs.; 19 tabs

  12. ULTRA-LIGHTWEIGHT CEMENT

    International Nuclear Information System (INIS)

    The objective of this project is to develop an improved ultra-lightweigh cement using ultralight hollow glass spheres (ULHS). Work reported herein addresses Task 1: Assess Ultra-Lightweight Cementing Problems, Task 2: Review Russian Ultra-Lightweight Cement Literature, and Task 3: Test Ultra-Lightweight Cements. Results reported this quarter include a review and summary surface pipe and intermediate casing cementing conditions historically encountered in the US and establishment of average design conditions for ULHS cements. Russian literature concerning development and use of ultra-lightweight cements employing either nitrogen or ULHS was reviewed, and a summary is presented. Quality control testing of materials used to formulate ULHS cements in the laboratory was conducted to establish baseline material performance standards. A testing protocol was developed employing standard procedures as well as procedures tailored to evaluate ULHS. This protocol is presented and discussed. finally, results of initial testing of ULHS cements is presented along with analysis to establish cement performance design criteria to be used during the remainder of the project

  13. Flow distortion on boom mounted cup anemometers

    DEFF Research Database (Denmark)

    Lindelöw, Per Jonas Petter; Friis Pedersen, Troels; Gottschall, Julia;

    in the measurement of wind turbine power performance, wind resource assessment and for providing purposeful in-field comparisons between different sensors, e.g. lidar anemometers. With the proposed method, direction dependent errors can be extracted and the mast flow distortion effect on the wind measurements......In this report we investigate on wind direction dependent errors in the measurement of the horizontal wind speed by boom mounted cup anemometers. The boom mounting on the studied lattice tower is performed according to IEC standard design rules, yet, larger deviations than predicted by flow models...... are observed. The errors on the measurements are likely caused by an underestimation of the flow distortions around the tower. In this paper an experimental method for deriving a correction formula and an in-field calibration is suggested. The method is based on measurements with two cup anemometers mounted...

  14. Analysis of Earing in Deep Drawn Cups

    Science.gov (United States)

    Aretz, Holger; Aegerter, Johannes; Engler, Olaf

    2010-06-01

    The cup-drawing of a strongly anisotropic sheet metal is simulated using a commercial finite element software along with a user material subroutine. In order to accurately describe the plastic anisotropy of the material the well-known recent yield function `Yld2004-18p' is extended. Regarding the experimental characterization of the considered material the occurrence of dynamic strain aging lead to an oscillating signal of the width change of the tensile samples, which prevented a reliable determination of plastic strain ratios (r-values). Thus, an improved measurement concept was developed that leads to a very robust and reproducible determination of r-values. Furthermore, a novel plane-strain tensile test sample is presented which is used for the characterization of the plastic anisotropy in biaxial loading states. A quantitative comparison with measured earing profiles of deep drawn cups illustrates the predictive capabilities of the numerical simulation.

  15. Reasoning about RoboCup Soccer Narratives

    CERN Document Server

    Hajishirzi, Hannaneh; Mueller, Erik T; Amir, Eyal

    2012-01-01

    This paper presents an approach for learning to translate simple narratives, i.e., texts (sequences of sentences) describing dynamic systems, into coherent sequences of events without the need for labeled training data. Our approach incorporates domain knowledge in the form of preconditions and effects of events, and we show that it outperforms state-of-the-art supervised learning systems on the task of reconstructing RoboCup soccer games from their commentaries.

  16. Management of knee osteoarthritis with cupping therapy

    Directory of Open Access Journals (Sweden)

    Asim Ali Khan

    2013-01-01

    Full Text Available The study aimed to evaluate the effect of cupping therapy at a clinical setting for knee osteoarthritis. A randomized, controlled clinical trial was conducted. Cupping was performed on 0-6 th day; 9-11 th day and 14 th day, i.e., 11 sittings follow-up to determine longer term carryover of treatment effects utilizing both objective and subjective assessment. The assessment was performed before and after treatment spreading over a period of 15 days. The results of this study shows significant and better results in the overall management of knee osteoarthritis, particularly in relieving pain, edema, stiffness and disability. The efficacy of treatment with cupping therapy in relieving signs and symptoms of knee osteoarthritis is comparable to that of acetaminophen 650 mg thrice a day orally, in terms of analgesia, anti-inflammatory and resolution of edema with minimal and temporary side-effects like echymosis and blister formation while as control drug has greater side-effects particularly on upper gastrointestinal tract. It is recommended that further studies are conducted with a larger study samples and of longer duration.

  17. Compilation of LLNL CUP-2 Data

    Energy Technology Data Exchange (ETDEWEB)

    Eppich, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kips, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Lindvall, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-07-31

    The CUP-2 uranium ore concentrate (UOC) standard reference material, a powder, was produced at the Blind River uranium refinery of Eldorado Resources Ltd. in Canada in 1986. This material was produced as part of a joint effort by the Canadian Certified Reference Materials Project and the Canadian Uranium Producers Metallurgical Committee to develop a certified reference material for uranium concentration and the concentration of several impurity constituents. This standard was developed to satisfy the requirements of the UOC mining and milling industry, and was characterized with this purpose in mind. To produce CUP-2, approximately 25 kg of UOC derived from the Blind River uranium refinery was blended, homogenized, and assessed for homogeneity by X-ray fluorescence (XRF) analysis. The homogenized material was then packaged into bottles, containing 50 g of material each, and distributed for analysis to laboratories in 1986. The CUP-2 UOC standard was characterized by an interlaboratory analysis program involving eight member laboratories, six commercial laboratories, and three additional volunteer laboratories. Each laboratory provided five replicate results on up to 17 analytes, including total uranium concentration, and moisture content. The selection of analytical technique was left to each participating laboratory. Uranium was reported on an “as-received” basis; all other analytes (besides moisture content) were reported on a “dry-weight” basis.

  18. Management of knee osteoarthritis with cupping therapy.

    Science.gov (United States)

    Khan, Asim Ali; Jahangir, Umar; Urooj, Shaista

    2013-10-01

    The study aimed to evaluate the effect of cupping therapy at a clinical setting for knee osteoarthritis. A randomized, controlled clinical trial was conducted. Cupping was performed on 0-6(th) day; 9-11(th) day and 14(th) day, i.e., 11 sittings follow-up to determine longer term carryover of treatment effects utilizing both objective and subjective assessment. The assessment was performed before and after treatment spreading over a period of 15 days. The results of this study shows significant and better results in the overall management of knee osteoarthritis, particularly in relieving pain, edema, stiffness and disability. The efficacy of treatment with cupping therapy in relieving signs and symptoms of knee osteoarthritis is comparable to that of acetaminophen 650 mg thrice a day orally, in terms of analgesia, anti-inflammatory and resolution of edema with minimal and temporary side-effects like echymosis and blister formation while as control drug has greater side-effects particularly on upper gastrointestinal tract. It is recommended that further studies are conducted with a larger study samples and of longer duration. PMID:24350053

  19. Distance constant of the Risø cup anemometer

    DEFF Research Database (Denmark)

    Kristensen, L.; Frost Hansen, O.

    2002-01-01

    The theory for cup-anemometer dynamics is presented in some detail and two methods of obtaining the distance constant lo are discussed. The first method is based on wind tunnel measurements: with a constant wind speed the cup anemometer is released from alocked position of the rotor and the incre......The theory for cup-anemometer dynamics is presented in some detail and two methods of obtaining the distance constant lo are discussed. The first method is based on wind tunnel measurements: with a constant wind speed the cup anemometer is released from alocked position of the rotor...... resolution which is significantly better than that which can be obtained by a cup anemometer. The ratio between the measured power spectra of the horizontal windspeed by the two instruments contains the necessary information for determining the response characteristics of the cup anemometer and thereby lo...

  20. Tympanoplasty with ionomeric cement

    DEFF Research Database (Denmark)

    Kjeldsen, A D; Grøntved, A M

    2000-01-01

    of > 10 dB, in 4 there was a slight improvement and in 2 a decline. The difference was not statistically significant. Hearing improvement using ionomeric cement in type II tympanoplasty was satisfactory. Reconstruction of the ossicular chain with ionomeric cement is recommended, as the procedure is easy...

  1. Wear numbers for ball cup and journal bearings

    OpenAIRE

    Ligterink, D.J.; Moes, H.

    1980-01-01

    A wear number is defined for ball cup bearings and for journal bearings where the cup and the cylindrical bearing are made of soft material. This dimensionless wear number provides a relation between the following five quantities: the radius of the ball or the length of the journal bearing in millimetres, the wear modulus in newtons per square millimetre, the maximum wear depth rate of the cup or the cylindrical bearing in millimetres per second, the force between the mating surfaces in newto...

  2. Perceptual elements in Penn & Teller's "Cups and Balls" magic trick.

    Science.gov (United States)

    Rieiro, Hector; Martinez-Conde, Susana; Macknik, Stephen L

    2013-01-01

    Magic illusions provide the perceptual and cognitive scientist with a toolbox of experimental manipulations and testable hypotheses about the building blocks of conscious experience. Here we studied several sleight-of-hand manipulations in the performance of the classic "Cups and Balls" magic trick (where balls appear and disappear inside upside-down opaque cups). We examined a version inspired by the entertainment duo Penn & Teller, conducted with three opaque and subsequently with three transparent cups. Magician Teller used his right hand to load (i.e. introduce surreptitiously) a small ball inside each of two upside-down cups, one at a time, while using his left hand to remove a different ball from the upside-down bottom of the cup. The sleight at the third cup involved one of six manipulations: (a) standard maneuver, (b) standard maneuver without a third ball, (c) ball placed on the table, (d) ball lifted, (e) ball dropped to the floor, and (f) ball stuck to the cup. Seven subjects watched the videos of the performances while reporting, via button press, whenever balls were removed from the cups/table (button "1") or placed inside the cups/on the table (button "2"). Subjects' perception was more accurate with transparent than with opaque cups. Perceptual performance was worse for the conditions where the ball was placed on the table, or stuck to the cup, than for the standard maneuver. The condition in which the ball was lifted displaced the subjects' gaze position the most, whereas the condition in which there was no ball caused the smallest gaze displacement. Training improved the subjects' perceptual performance. Occlusion of the magician's face did not affect the subjects' perception, suggesting that gaze misdirection does not play a strong role in the Cups and Balls illusion. Our results have implications for how to optimize the performance of this classic magic trick, and for the types of hand and object motion that maximize magic misdirection.

  3. Plus cupping degrees do not form an ideal

    Institute of Scientific and Technical Information of China (English)

    LI Angsheng; ZHAO Yicheng

    2004-01-01

    A computably enumerable (c.e., for short) degree a is called plus cupping, if every c.e.degree x with o<x≤a is cuppable. Let PC be the set of all plus cupping degrees. In the present paper, we show that PC is not closed under the join operation ∨ by constructing two plus cupping degrees which join to a high degree. So by the Harrington's noncupping theorem, PC is not an ideal of ε.

  4. ULTRA-LIGHTWEIGHT CEMENT

    Energy Technology Data Exchange (ETDEWEB)

    Fred Sabins

    2002-01-23

    The objective of this project is to develop an improved ultra-lightweight cement using ultra-lightweight hollow glass spheres (ULHS). This report includes results from laboratory testing of ULHS systems along with other lightweight cement systems: foamed and sodium silicate slurries. Comparison studies of the three cement systems examined several properties: tensile strength, Young's modulus, water permeability, and shear bond. Testing was also done to determine the effect that temperature cycling has on the shear bond properties of the cement systems. In addition, analysis was carried out to examine alkali silica reactivity of slurries containing ULHS. Data is also presented from a study investigating the effects of mixing and pump circulation on breakage of ULHS. Information is also presented about the field application of ULHS in cementing a 7-in. intermediate casing in south Texas.

  5. The biomaterials challenge: A comparison of polyethylene wear using a hip joint simulator.

    Science.gov (United States)

    Affatato, Saverio; Freccero, Nadia; Taddei, Paola

    2016-01-01

    Although hip arthroplasty is an established procedure that relieves pain and improves functions, problems remain with wear and osteolysis. Highly cross-linked polyethylene and Vitamin-E-stabilized polyethylene were introduced in the last years to solve these problems. In this study we compared the in vitro wear behaviour of cross-linked polyethylene (XLPE) versus Vitamin-E diffused XLPE (XLPE_VE) versus conventional ultra-high molecular weight polyethylene (UHMWPE) acetabular cups. The test was performed using a hip joint simulator run for two millions cycles under bovine calf serum as lubricant. Mass loss was found to decrease along the series UHMWPE>XLPE_VE>XLPE, although statistically significant differences were found only between the mass losses of XLPE and UHMWPE at 1.2 and 2 million cycles. The mass loss data were explained in relation to the crystalline morphology of the control unworn cups, as investigated by non-destructive micro-Raman spectroscopy. This technique allowed to disclose a different wear behaviour of the three sets of cups. Wear testing produced a stress-induced crystallisation in UHMWPE, with increases in both amorphous (αa) and orthorhombic (αo) phases at the expense of the third phase (αb), which decreased upon wear. Moreover, the all-trans content decreased, while the ortho-trans content increased, contrarily to the trend observed for XLPE and XLPE_VE, for which no statistically significant changes in αo, αa and αb contents were detected. The XLPE_VE specimens underwent the least significant changes in the spectroscopic markers of micromorphology upon mechanical stress, probably due to their lower starting amorphous content. PMID:26301318

  6. Sponsoroinnin hakija : case KaleidosCup-opiskelijakilpailu

    OpenAIRE

    Multanen, Matti

    2013-01-01

    Tässä opinnäytteessä tarkasteltiin sponsorointia erityisesti tapahtuman näkökannalta. Opinnäytetyö liittyi Kaleidoskooppi-hankkeeseen ja siinä järjestettyyn KaleidosCup- opiskelijakilpailuun. Hankkeen tavoitteena oli luoda yhteistyöverkosto meri- ja metalliteollisuuden sekä luovan alan yritysten, korkeakoulujen ja aluekehittäjien välille. Yhteistyöllä pyrittiin uudenlaisiin ratkaisuihin yritysten kilpailukyvyn kasvattamiseksi. Opinnäytetyön tavoitteena oli kehittää kilpailun sponsorointia teo...

  7. ACCUWIND - Methods for classification of cup anemometers

    DEFF Research Database (Denmark)

    Dahlberg, J.-Å.; Friis Pedersen, Troels; Busche, P.

    2006-01-01

    of assessment of systematic deviations. The present report focuses on methods that can beapplied for assessment of such systematic deviations. A new alternative method for torque coefficient measurements at inclined flow have been developed, which have then been applied and compared to the existing methods...... developed in the CLASSCUP projectand earlier. A number of approaches including the use of two cup anemometer models, two methods of torque coefficient measurement, two angular response measurements, and inclusion and exclusion of influence of friction have been implemented in theclassification process...

  8. Comparison of cooling ability of asbestic-cement and mesh sprinkler of cooling tower

    OpenAIRE

    Кравченко, Владимир Петрович; Морозов, Евгений Николаевич; Галацан, Марк Петрович

    2012-01-01

    The technological calculation of a cooling tower with a pass checker from the asbestos-cement and modern reticulated checker from a polyethylene is executed. Got results, allow executing the feasibility study of reconstruction of cooling tower with pass checker substituting by a modern construction

  9. Radiation processing of polyethylene

    Science.gov (United States)

    Barlow, A.; Biggs, J. W.; Meeks, L. A.

    This paper covers two areas (a) the use of high energy radiation for the synthesis and improvement of polymer properties and (b) the formulation of radiation curable compounds for automotive/appliance wire applications and high voltage insulation. The first part discusses the use of gamma radiation for the bulk polymerization of ethylene and the properties of the polymer produced. The use of low dose radiation to increase polymer molecular weight and modify polydispersity is also described together with its projected operational cost. An update is provided of the cost savings that can be realized when using radiation crosslinked heavy duty film, which expands its applications, compared with noncrosslinked materials. The second section of the paper considers the advantages and disadvantages of radiation vs. peroxide curing of wire and cable compounds. The formulation of a radiation curable, automotive/appliance wire compound is discussed together with the interactions between the various ingredients; i.e., base resin, antioxidants, flame retardant filler, coupling agents, processing aids and radiation to achieve the desired product. In addition, the general property requirements of a radiation curable polyethylene for high voltage insulation are discussed; these include crosslinking efficiency, thermal stability, wet tree resistance and satisfactory dielectric properties. Preliminary data generated in the development of a 230KV radiation crosslinked polyethylene insulation are included.

  10. ULTRA-LIGHTWEIGHT CEMENT

    Energy Technology Data Exchange (ETDEWEB)

    Fred Sabins

    2003-01-31

    The objective of this project is to develop an improved ultra-lightweight cement using ultra-lightweight hollow glass spheres (ULHS). This report discusses testing that was performed for analyzing the alkali-silica reactivity of ULHS in cement slurries. DOE joined the Materials Management Service (MMS)-sponsored joint industry project ''Long-Term Integrity of Deepwater Cement under Stress/Compaction Conditions.'' Results of the project contained in two progress reports are also presented in this report.

  11. FEA OF RECTANGULAR CUP DEEP DRAWING PROCESS

    Directory of Open Access Journals (Sweden)

    Awad D.S

    2012-08-01

    Full Text Available Deep drawing is a process for shaping flat sheets into cup shaped articles without fracture or excessive localized thinning. The complex deep drawing of thin metallic sheets is widely used during industrial material forming applications. It allows production of thin walled parts with complicated shapes such as automotive panels or structural parts. The process consists of the plastic deformation of an initial at blank subjected to the action of a rigid punch and die while constrained on the periphery by a blank holder. Conventional design processes for sheet metal forming are usually based on a empirical approach. However, due to the requirement of high precision and reliability in shaped parts, these methods are far away from a final and reliable solution. Nowadays, Finite Element Method (FEM is being gradually adopted by industry to envisage the formability properties of sheet metals. The design and control of a deep drawing process depends not only on the work piece material, but also on the condition at the tool work piece interface, the mechanics of plastic deformation and the equipment used. In this paper, rectangular cup component of EDDQ Steel and Mild Steel is simulated using HYPERMESH 11 by varying various process parameters.

  12. Flow distortion on boom mounted cup anemometers

    Energy Technology Data Exchange (ETDEWEB)

    Lindeloew-Marsden, P.; Pedersen, Troels F.; Gottschall, J.; Vesth, A.; Paulsen, R.W.U.; Courtney, M.S.

    2010-08-15

    In this report we investigate on wind direction dependent errors in the measurement of the horizontal wind speed by boom mounted cup anemometers. The boom mounting on the studied lattice tower is performed according to IEC standard design rules, yet, larger deviations than predicted by flow models are observed. The errors on the measurements are likely caused by an underestimation of the flow distortions around the tower. In this paper an experimental method for deriving a correction formula and an in-field calibration is suggested. The method is based on measurements with two cup anemometers mounted with booms at the same height but pointing in 60 deg. different directions. In the examined case of a 1.9 m wide equilateral triangular lattice tower with booms protruding 4.1 m at 80 m height the measurement errors are observed to reach up to +- 2 %. Errors of this magnitude are severely problematic in the measurement of wind turbine power performance, wind resource assessment and for providing purposeful in-field comparisons between different sensors, e.g. lidar anemometers. With the proposed method, direction dependent errors can be extracted and the mast flow distortion effect on the wind measurements corrected to an uncertainty estimated to better than 0.5%. This level of uncertainty is probably acceptable for the above mentioned applications. (author)

  13. Photo destruction of polyethylene terephthalate

    International Nuclear Information System (INIS)

    Present article is devoted to photo destruction of polyethylene terephthalate. The photo destruction of polyethylene terephthalate was studied by means of different methods under the conditions of irradiation of fibers in the open air and in the vacuum by wide ultraviolet spectre and monochromatic radiation.

  14. POZZOLAN AND CEMENTS WITH POZZOLAN

    OpenAIRE

    Kaplan, Hasan; Hanifi BİNİCİ

    1995-01-01

    Cement, one of the basic material of construction engineering, has an important place in view of strength and cost of structures. Cement consumption is increasing parallel to development of building construction sector. For cement producers, minimal cost is desired by using new and economical material sources. On the other hand, the controllers and contractors need cheaper, safer and higher strength materials. From this respect cement industry tends to use cement with pozzolan. In Türkiye, ce...

  15. A critical comparison of ten disposable cup LCAs

    Energy Technology Data Exchange (ETDEWEB)

    Harst, Eugenie van der, E-mail: eugenie.vanderharst@wur.nl [Environmental Systems Analysis Group, Wageningen University, P.O. Box 47, NL-6700 AA Wageningen (Netherlands); Potting, José, E-mail: jose.potting@wur.nl [Environmental Systems Analysis Group, Wageningen University, P.O. Box 47, NL-6700 AA Wageningen (Netherlands); Environmental Strategies Research (fms), KTH Royal Institute of Technology, SE-110 44 Stockholm (Sweden)

    2013-11-15

    Disposable cups can be made from conventional petro-plastics, bioplastics, or paperboard (coated with petro-plastics or bioplastics). This study compared ten life cycle assessment (LCA) studies of disposable cups with the aim to evaluate the robustness of their results. The selected studies have only one impact category in common, namely climate change with global warming potential (GWP) as its category indicator. Quantitative GWP results of the studies were closer examined. GWPs within and across each study show none of the cup materials to be consistently better than the others. Comparison of the absolute GWPs (after correction for the cup volume) also shows no consistent better or worse cup material. An evaluation of the methodological choices and the data sets used in the studies revealed their influence on the GWP. The differences in GWP can be attributed to a multitude of factors, i.e., cup material and weight, production processes, waste processes, allocation options, and data used. These factors basically represent different types of uncertainty. Sensitivity and scenario analyses provided only the influence of one factor at once. A systematic and simultaneous use of sensitivity and scenario analyses could, in a next research, result in more robust outcomes. -- Highlights: • Conflicting results from life cycle assessment (LCA) on disposable cups • GWP results of LCAs did not point to a best or worst cup material. • Differences in GWP results are due to methodological choices and data sets used. • Standardized LCA: transparency of LCA studies, but still different in approaches.

  16. Nutrient disorders of 'Evolution' mealy-cup sage

    Science.gov (United States)

    To produce popular floriculture crops like mealy-cup sage (Salvia farinacea (Benth.)), growers must be equipped with cultural information including the ability to recognize and characterize disorders. Diagnostic criteria of nutrient disorders of mealy-cup sage are absent from the literature. Theref...

  17. Prevalence of disc cupping in non-glaucomatous eyes.

    Science.gov (United States)

    Chiappe, José Pablo; Nahum, Pablo; Casiraghi, Javier F; Iribarren, Rafael

    2015-01-01

    This study assessed optic disc size and cupping, using a commercially available ophthalmoscope, in order to show norms of these values for clinical practice. Subjects were office-workers referred from their respective workplaces for a routine medical examination, which included eye examination. The optic disc size was classified as small, medium or large, for having a diameter 1.5 times (respectively) the diameter of the ophthalmoscope's selected light spot on the posterior pole. The cupping was classified as the ratio of the vertical cupping diameter and the vertical disc diameter on a relative decimal scale from 0.0 to 1.0.This study included 184 subjects with a mean age of 40.5 ± 9.5 years; 149 (81%) were males. Their mean ocular pressure was 12.4 ± 1.5 mmHg (range 10-17 mmHg). There was a high correlation between optic disc sizes and cupping in the right and left eyes (Pearson Correlation r = 0.866, p definition, the optic discs in these eyes comprised 27 (14.7%) small, 141 (76.6%) medium and 16 (8.7%) large. The small optic discs were rarely cupped, and the large optic discs were always cupped. Optic disc cupping greater than 0.7 was rarely found and should be suspect of glaucoma. Clinical doctors should be aware of this and refer those subjects with abnormal cupping to the specialist.

  18. Frictional torque numbers for ball cup and journal bearings

    NARCIS (Netherlands)

    Ligterink, D.J.

    1982-01-01

    Plastic bearing material wears in ball cup and journal bearings. Contact areas in the ball cup and the journal bearing increase. The frictional torque needed to rotate the ball or journal also increases. When the coefficient of friction is assumed to be constant during wearing out, the frictional t

  19. Frictional torque numbers for ball cup and journal bearings

    OpenAIRE

    Ligterink, D.J.

    1982-01-01

    Plastic bearing material wears in ball cup and journal bearings. Contact areas in the ball cup and the journal bearing increase. The frictional torque needed to rotate the ball or journal also increases. When the coefficient of friction is assumed to be constant during wearing out, the frictional torque increases to a maximum of 1.273 times the frictional torque at zero wear.

  20. Wear numbers for ball cup and journal bearings

    NARCIS (Netherlands)

    Ligterink, D.J.; Moes, H.

    1980-01-01

    A wear number is defined for ball cup bearings and for journal bearings where the cup and the cylindrical bearing are made of soft material. This dimensionless wear number provides a relation between the following five quantities: the radius of the ball or the length of the journal bearing in millim

  1. A critical comparison of ten disposable cup LCAs

    International Nuclear Information System (INIS)

    Disposable cups can be made from conventional petro-plastics, bioplastics, or paperboard (coated with petro-plastics or bioplastics). This study compared ten life cycle assessment (LCA) studies of disposable cups with the aim to evaluate the robustness of their results. The selected studies have only one impact category in common, namely climate change with global warming potential (GWP) as its category indicator. Quantitative GWP results of the studies were closer examined. GWPs within and across each study show none of the cup materials to be consistently better than the others. Comparison of the absolute GWPs (after correction for the cup volume) also shows no consistent better or worse cup material. An evaluation of the methodological choices and the data sets used in the studies revealed their influence on the GWP. The differences in GWP can be attributed to a multitude of factors, i.e., cup material and weight, production processes, waste processes, allocation options, and data used. These factors basically represent different types of uncertainty. Sensitivity and scenario analyses provided only the influence of one factor at once. A systematic and simultaneous use of sensitivity and scenario analyses could, in a next research, result in more robust outcomes. -- Highlights: • Conflicting results from life cycle assessment (LCA) on disposable cups • GWP results of LCAs did not point to a best or worst cup material. • Differences in GWP results are due to methodological choices and data sets used. • Standardized LCA: transparency of LCA studies, but still different in approaches

  2. COMPOSITE POLYMERICADDITIVESDESIGNATED FORCONCRETEMIXES BASED ONPOLYACRYLATES, PRODUCTS OF THERMAL DECOMPOSITION OF POLYAMIDE-6 AND LOW-MOLECULAR POLYETHYLENE

    Directory of Open Access Journals (Sweden)

    Polyakov Vyacheslav Sergeevich

    2012-07-01

    4 the optimal composite additive that increases the time period of stiffening of the cement grout , improves the water resistance and the compressive strength of concrete, represents the composition of polyacrylates and polymethacrylates, products of thermal decomposition of polyamide-6 and low-molecular polyethylene in the weight ratio of 1:1:0.5.

  3. The pros and cons of polyethylene sterilization with gamma irradiation.

    Science.gov (United States)

    Hopper, Robert H; Engh, C Anderson; Fowlkes, LaTonya B; Engh, Charles A

    2004-12-01

    This retrospective study evaluated the implant, patient and surgical factors associated with polyethylene wear for one type of porous-coated hemispheric total hip arthroplasty cup. Radiographic wear measurements among 567 Duraloc cups (512 patients) revealed that liners sterilized by gamma-irradiation wore 0.085 mm/year less than those that were sterilized by gas-plasma, a noncross-linking chemical surface treatment. The substantially decreased wear rate associated with gamma-irradiation was attributed to sterilization-induced polyethylene cross-linking. Shelf-aging adversely affected liners that were gamma irradiated in air. On average, highly crystalline Hylamer liners showed a 0.064 mm/year increase in wear rates for each year of shelf storage after terminal sterilization with gamma-irradiation in air. Among conventional Enduron liners, the effect of shelf aging after gamma-irradiation in air was more modest, increasing wear rates by 0.014 mm/year for each year of shelf storage. Because Hylamer's wear performance degraded at about five times the rate of Enduron's, the improved wear resistance associated with gamma-irradiation in air would be lost after 1.3 years of shelf aging for Hylamer compared with 6.1 years for Enduron. For every additional year of age at the time of surgery, the wear rate decreased by 0.003 mm/year. Increased body mass index, a preoperative diagnosis of inflammatory arthritis, and a ceramic femoral head also were associated with decreased wear rates. PMID:15577466

  4. Intraoperative monitoring for safety of total hip arthroplasty using third-generation cementing technique

    Institute of Scientific and Technical Information of China (English)

    LI Zi-jian; ZHANG Ke; YANG Hong; LIU Yan; L(U) Jing-qiao

    2009-01-01

    Background Controversies on the safety of the cement application between cemented and uncemented total hip arthroplasty (THA) have been existing for decades. The purpose of this study was to observe the changes in mean arterial pressure (MAP), heart rate (HR) and oxygen pressure (PaO2) during cemented THA, and to evaluate the intraoperative safety of using the third-generation cementing technique and investigate whether the intraoperative risk is higher in acute femoral neck fracture patients than non-traumatic patients. Methods Forty-two patients who underwent cemented THA between November 2005 and September 2007 were prospectively included in this study. The third-generation cementing technique as vacuum mixing and pulsatile lavage was used strictly. The MAP and HR were monitored and documented during each operation. Blood gas analysis was performed at exposure, cup implantation, stem implantation and wound closure. MAP, HR and PaO2 were compared between pre- and post-cement application. Comparisons of MAP, HR and PaO2 between patients with acute femoral neck fracture and non-traumatic patiens were performed as well. Results No intraoperative cardiopulmonary complication occurred in these cases. No obvious changes were observed in MAP, HR and PaO2 after cement application. There was no significant difference in MAP, HR and PaO2 between acute femoral fracture patients (18 patients) and non-traumatic patients (24 patients).Conclusions The results of this study suggested that the invasive blood pressure monitoring and blood gas analysis are essential for patients undergoing cemented THA, especially for patients with femoral neck fracture. The third-generation cementing technique is safe to use in THA.

  5. Male gender, Charnley class C, and severity of bone defects predict the risk for aseptic loosening in the cup of ABG I hip arthroplasty

    Directory of Open Access Journals (Sweden)

    Lostak Jiri

    2010-10-01

    Full Text Available Abstract Background We studied which factor could predict aseptic loosening in ABG I hip prosthesis with hydroxyapatite coating. Aseptic loosening and periprosthetic osteolysis are believed to be caused, at least in part, by increased polyethylene (PE wear rate via particle disease. Based on it, increased PE wear rate should be associated with aseptic loosening regardless of the type of implant. Methods We analyzed data from 155 revisions of ABG I hip prostheses to examine the influence of patient, implant, surgery, and wear related factors on the rate of aseptic loosening at the site of the cup. This was calculated by stepwise logistic regression analysis. The stability of the implant and severity of bone defects were evaluated intraoperatively. Results We found that men (odds ratio, OR = 5.6; p = 0.004, patients with Charnley class C (OR = 6.71; p = 0.013, those having more severe acetabular bone defects (OR = 4 for each degree of severity; p = 0.002, and longer time to revision surgery (OR = 1.51 for each additional year; p = 0.012 had a greater chance of aseptic loosening of the cup. However, aseptic loosening was not directly predicted by polyethylene wear rate in our patients. Conclusion Severity of bone defects predicts the risk for aseptic loosening in ABG I cup. Factors potentially associated with the quality of bone bed and biomechanics of the hip might influence on the risk of aseptic loosening in this implant.

  6. Assessment of Accuracy and Reliability in Acetabular Cup Placement Using an iPhone/iPad System.

    Science.gov (United States)

    Kurosaka, Kenji; Fukunishi, Shigeo; Fukui, Tomokazu; Nishio, Shoji; Fujihara, Yuki; Okahisa, Shohei; Takeda, Yu; Daimon, Takashi; Yoshiya, Shinichi

    2016-07-01

    Implant positioning is one of the critical factors that influences postoperative outcome of total hip arthroplasty (THA). Malpositioning of the implant may lead to an increased risk of postoperative complications such as prosthetic impingement, dislocation, restricted range of motion, polyethylene wear, and loosening. In 2012, the intraoperative use of smartphone technology in THA for improved accuracy of acetabular cup placement was reported. The purpose of this study was to examine the accuracy of an iPhone/iPad-guided technique in positioning the acetabular cup in THA compared with the reference values obtained from the image-free navigation system in a cadaveric experiment. Five hips of 5 embalmed whole-body cadavers were used in the study. Seven orthopedic surgeons (4 residents and 3 senior hip surgeons) participated in the study. All of the surgeons examined each of the 5 hips 3 times. The target angle was 38°/19° for operative inclination/anteversion angles, which corresponded to radiographic inclination/anteversion angles of 40°/15°. The simultaneous assessment using the navigation system showed mean±SD radiographic alignment angles of 39.4°±2.6° and 16.4°±2.6° for inclination and anteversion, respectively. Assessment of cup positioning based on Lewinnek's safe zone criteria showed all of the procedures (n=105) achieved acceptable alignment within the safe zone. A comparison of the performances by resident and senior hip surgeons showed no significant difference between the groups (P=.74 for inclination and P=.81 for anteversion). The iPhone/iPad technique examined in this study could achieve acceptable performance in determining cup alignment in THA regardless of the surgeon's expertise. [Orthopedics. 2016; 39(4):e621-e626.].

  7. Assessment of Accuracy and Reliability in Acetabular Cup Placement Using an iPhone/iPad System.

    Science.gov (United States)

    Kurosaka, Kenji; Fukunishi, Shigeo; Fukui, Tomokazu; Nishio, Shoji; Fujihara, Yuki; Okahisa, Shohei; Takeda, Yu; Daimon, Takashi; Yoshiya, Shinichi

    2016-07-01

    Implant positioning is one of the critical factors that influences postoperative outcome of total hip arthroplasty (THA). Malpositioning of the implant may lead to an increased risk of postoperative complications such as prosthetic impingement, dislocation, restricted range of motion, polyethylene wear, and loosening. In 2012, the intraoperative use of smartphone technology in THA for improved accuracy of acetabular cup placement was reported. The purpose of this study was to examine the accuracy of an iPhone/iPad-guided technique in positioning the acetabular cup in THA compared with the reference values obtained from the image-free navigation system in a cadaveric experiment. Five hips of 5 embalmed whole-body cadavers were used in the study. Seven orthopedic surgeons (4 residents and 3 senior hip surgeons) participated in the study. All of the surgeons examined each of the 5 hips 3 times. The target angle was 38°/19° for operative inclination/anteversion angles, which corresponded to radiographic inclination/anteversion angles of 40°/15°. The simultaneous assessment using the navigation system showed mean±SD radiographic alignment angles of 39.4°±2.6° and 16.4°±2.6° for inclination and anteversion, respectively. Assessment of cup positioning based on Lewinnek's safe zone criteria showed all of the procedures (n=105) achieved acceptable alignment within the safe zone. A comparison of the performances by resident and senior hip surgeons showed no significant difference between the groups (P=.74 for inclination and P=.81 for anteversion). The iPhone/iPad technique examined in this study could achieve acceptable performance in determining cup alignment in THA regardless of the surgeon's expertise. [Orthopedics. 2016; 39(4):e621-e626.]. PMID:27322169

  8. Higher wear-rate of third-generation metal-backed Reflection cups with eto-sterilised UHMWPE at a mean 13 years follow-up.

    Science.gov (United States)

    Hengst, David M; Thomsen, Per B; Homilius, Morten; Hansen, Torben B; Stilling, Maiken

    2014-12-01

    Polyethylene (PE) wear and osteolysis is a recognised problem with non-cross linked PE liners and first generation modular cup designs. Wear particles induce osteolysis leading to aseptic loosening. We retrospectively compared the linear PE wear and implant survival and revision rates of the Reflection Cup and the Duraloc 300. After a mean clinical follow-up of 13 years (range 11-15 years), the 2D linear PE wear-rate of the Reflection liner (n = 68) was 0.23 mm/year, with a mean total wear of 3.14 mm (1.04-7.36), SD 1.45. The wear-rate of the Duraloc 300 cups (n = 32) was 0.14 mm/year, with a mean total wear of 1.84 mm (0.55-4.63), SD 1.07. The difference in PE wear-rate as well as mean total wear was highly significant (p = 0.0001). There was a positive correlation between wear-rate and both Oxford Hip Score and Harris Hip Score (p = 0.02). Large acetabular cup size (>54 mm), HA coating on the stem and age <50 years did not influence PE wear. The higher wear-rate in the Reflection liners could be related to the EtO sterilisation. Intermediate and long-term follow-up is advisable.

  9. Feeding Neonates by Cup: A Systematic Review of the Literature.

    Science.gov (United States)

    McKinney, Christy M; Glass, Robin P; Coffey, Patricia; Rue, Tessa; Vaughn, Matthew G; Cunningham, Michael

    2016-08-01

    Objective WHO and UNICEF recommend cup feeding for neonates unable to breastfeed in low-resource settings. In developed countries, cup feeding in lieu of bottle feeding in the neonatal period is hypothesized to improve breastfeeding outcomes for those initially unable to breastfeed. Our aim was to synthesize the entire body of evidence on cup feeding. Methods We searched domestic and international databases for original research. Our search criteria required original data on cup feeding in neonates published in English between January 1990 and December 2014. Results We identified 28 original research papers. Ten were randomized clinical trials, 7 non-randomized intervention studies, and 11 observational studies; 11 were conducted in developing country. Outcomes evaluated included physiologic stability, safety, intake, duration, spillage, weight gain, any and exclusive breastfeeding, length of hospital stay, compliance, and acceptability. Cup feeding appears to be safe though intake may be less and spillage greater relative to bottle or tube feeding. Overall, slightly higher proportions of cup fed versus bottle fed infants report any breastfeeding; a greater proportion of cup fed infants reported exclusive breastfeeding at discharge and beyond. Cup feeding increases breastfeeding in subgroups (e.g. those who intend to breastfeed or women who had a Caesarean section). Compliance and acceptability is problematic in certain settings. Conclusions Further research on long-term breastfeeding outcomes and in low-resource settings would be helpful. Research data on high risk infants (e.g. those with cleft palates) would be informative. Innovative cup feeding approaches to minimize spillage, optimize compliance, and increase breastfeeding feeding are needed. PMID:27016350

  10. Bone impaction grafting and a cemented cup after acetabular fracture at 3-18 years.

    NARCIS (Netherlands)

    Schreurs, B.W.; Zengerink, M.; Welten, M.L.M.; Kampen, A. van; Slooff, T.J.J.H.

    2005-01-01

    The outcome of total hip arthroplasty after acetabular fracture is compromised. We studied if the bone impaction grafting technique could provide long-term prosthesis survival in deformed and irregular acetabula. We studied 20 hips in 20 patients (mean age, 53.3 years; range, 35-75 years) that were

  11. Miniature modified Faraday cup for micro electron beams

    Science.gov (United States)

    Teruya, Alan T.; Elmer, John W.; Palmer, Todd A.; Walton, Chris C.

    2008-05-27

    A micro beam Faraday cup assembly includes a refractory metal layer with an odd number of thin, radially positioned traces in this refractory metal layer. Some of the radially positioned traces are located at the edge of the micro modified Faraday cup body and some of the radially positioned traces are located in the central portion of the micro modified Faraday cup body. Each set of traces is connected to a separate data acquisition channel to form multiple independent diagnostic networks. The data obtained from the two diagnostic networks are combined and inputted into a computed tomography algorithm to reconstruct the beam shape, size, and power density distribution.

  12. ULTRA-LIGHTWEIGHT CEMENT

    Energy Technology Data Exchange (ETDEWEB)

    Fred Sabins

    2001-10-23

    The objective of this project is to develop an improved ultra-lightweight cement using ultra-lightweight hollow glass spheres (ULHS). Work reported herein addresses tasks performed in the fourth quarter as well as the other three quarters of the past year. The subjects that were covered in previous reports and that are also discussed in this report include: Analysis of field laboratory data of active cement applications from three oil-well service companies; Preliminary findings from a literature review focusing on problems associated with ultra-lightweight cements; Summary of pertinent information from Russian ultra-lightweight cement literature review; and Comparison of compressive strengths of ULHS systems using ultrasonic and crush methods Results reported from the fourth quarter include laboratory testing of ULHS systems along with other lightweight cement systems--foamed and sodium silicate slurries. These comparison studies were completed for two different densities (10.0 and 11.5 lb/gal) and three different field application scenarios. Additional testing included the mechanical properties of ULHS systems and other lightweight systems. Studies were also performed to examine the effect that circulation by centrifugal pump during mixing has on breakage of ULHS.

  13. Process for irradiation of polyethylene

    International Nuclear Information System (INIS)

    Irradiation of polyethylene affects its processabiltiy in the fabrication of products and affects the properties of products already fabricated. The present invention relates to a process for the irradiation of polyethylene, and especially to a process for the irradiation of homopolymers of ethylene and copolymers of ethylene and higher α-olefins, in the form of granules, with low levels of electron or gamma irradiation in the presence of an atomsphere of steam

  14. PART II. HYDRATED CEMENTS

    Directory of Open Access Journals (Sweden)

    Milan Drabik

    2014-09-01

    Full Text Available Essential focus of the study has been to acquire thermoanalytical events, incl. enthalpies of decompositions - ΔH, of technological materials based on two types of Portland cements. The values of thermoanalytical events and also ΔH of probes of technological compositions, if related with the data of a choice of minerals of calcium-silicate-sulfate-aluminate hydrates, served as a valued input for the assessment of phases present and phase changes due to the topical hydraulic processes. The results indicate mainly the effects of "standard humidity" or "wet storage" of the entire hydration/hydraulic treatment, but also the presence of cement residues alongside calcium-silicate-sulfate-aluminate hydrates (during the tested period of treatment. "A diluting" effect of unhydrated cement residues upon the values of decomposition enthalpies in the studied multiphase system is postulated and discussed

  15. Reducing cement's CO2 footprint

    Science.gov (United States)

    van Oss, Hendrik G.

    2011-01-01

    The manufacturing process for Portland cement causes high levels of greenhouse gas emissions. However, environmental impacts can be reduced by using more energy-efficient kilns and replacing fossil energy with alternative fuels. Although carbon capture and new cements with less CO2 emission are still in the experimental phase, all these innovations can help develop a cleaner cement industry.

  16. Cement Mason's Curriculum. Instructional Units.

    Science.gov (United States)

    Hendirx, Laborn J.; Patton, Bob

    To assist cement mason instructors in providing comprehensive instruction to their students, this curriculum guide treats both the skills and information necessary for cement masons in commercial and industrial construction. Ten sections are included, as follow: related information, covering orientation, safety, the history of cement, and applying…

  17. Cement og politik

    DEFF Research Database (Denmark)

    Lund, Joachim

    2012-01-01

    as well as in the public sphere. Most of the extensive job creating measures he carried out as a minister for public works necessarily involved the use of great amounts of cement – the primary produce of F.L. Smidth & Co. Gunnar Larsen thus became an easy target for Communist propaganda, picturing him...... of the Soviet Union (including an F.L. Smidth & Co. cement plant in former Estonia). He spent the last 15 months of the occupation in Sweden and was arrested after having returned to Copenhagen in May, 1945. Although a Copenhagen city court prison sentence for economic collaboration was reversed, he had...

  18. Technology Roadmaps: Cement

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2009-07-01

    To support its roadmap work focusing on key technologies for emissions reductions, the International Energy Agency (IEA) also investigated one particular industry: cement. Cement production includes technologies that are both specific to this industry and those that are shared with other industries (e.g., grinding, fuel preparation, combustion, crushing, transport). An industry specific roadmap provides an effective mechanism to bring together several technology options. It outlines the potential for technological advancement for emissions reductions in one industry, as well as potential cross-industry collaboration.

  19. Coffee to Go: Woman "Thinks" First Cup in 15 Years

    Science.gov (United States)

    ... this page please turn Javascript on. Feature: NIBIB Robotics Coffee to Go: Woman "Thinks" First Cup in ... own—using her thoughts alone to direct a robotic arm to her lips. The feat was made ...

  20. Figuring out the Statistics of the ICC World Cup 2011

    Science.gov (United States)

    Shiwalkar, Jyoti P.; Deshpande, M. N.

    2013-01-01

    This paper deals with the analysis of cricket match results from the ICC World Cup 2011. We believe that such data provide good material for interesting classroom exercises. (Contains 7 tables and 1 figure.)

  1. Can a cup anemometer 'underspeed'? A heretical question

    DEFF Research Database (Denmark)

    Kristensen, L.

    2002-01-01

    calibration function is included. The conclusion is that neither longitudinal nor lateral velocity fluctuations can contribute significantly to a negative bias. However, if a cup anemometer has an angular response that falls below the ideal cosine response, there will, as demonstrated in the concluding......An analysis of cup-anemometer dynamics has been carried out in order to determine whether the mean-wind velocity can have a negative bias. This would be contrary to the general belief that cup anemometers always overspeed. Compared to prior analyses, the effect of a possible nonlinearity of the...... discussion, be a negative contribution from the vertical velocity fluctuations to the total bias, and this contribution may even outbalance the positive contributions from the longitudinal velocity fluctuations. Concrete evidence of such exotic cup anemometer behaviour has not been reported in the literature....

  2. Degradation of protective organic coatings after cupping test

    Energy Technology Data Exchange (ETDEWEB)

    Deflorian, F.; Fedrizzi, L.; Rossi, S.

    1999-11-01

    Coil coating products generally are shaped by deforming and bending after coating. These deformations can produce defects inducing a significant deterioration of the protective properties of the organic coating. An empirical method for the evaluation of the deformation effects is the cupping test. in the present work, effects of the cupping test were studied by using electrochemical impedance spectroscopy (EIS) measurements to study the influence of deformation conditions on the mechanisms of degradation of the protective properties. The materials studied were environmentally friendly coatings based on ion exchange pigments. In addition to the electrochemical characterizations, a finite element model was developed for the estimation of the strain after the cupping test and some adhesion measurements were performed. The cupping test with an electrochemical characterization with EIS is a valid method for the evaluation of the protective behavior of coil coating products after deformation.

  3. Hip Revision with Cup Removal System and Revision Shell

    Medline Plus

    Full Text Available The Zimmer® Explant® Cup Removal System and Trabecular Metal™ Revision Shell You must have Javascript enabled in your web browser. View Program Transcript Click Here to view ...

  4. Cementing a wellbore using cementing material encapsulated in a shell

    Science.gov (United States)

    Aines, Roger D.; Bourcier, William L.; Duoss, Eric B.; Spadaccini, Christopher M.; Cowan, Kenneth Michael

    2016-08-16

    A system for cementing a wellbore penetrating an earth formation into which a pipe extends. A cement material is positioned in the space between the wellbore and the pipe by circulated capsules containing the cement material through the pipe into the space between the wellbore and the pipe. The capsules contain the cementing material encapsulated in a shell. The capsules are added to a fluid and the fluid with capsules is circulated through the pipe into the space between the wellbore and the pipe. The shell is breached once the capsules contain the cementing material are in position in the space between the wellbore and the pipe.

  5. The mechanical effect of the existing cement mantle on the in-cement femoral revision.

    LENUS (Irish Health Repository)

    Keeling, Parnell

    2012-08-01

    Cement-in-cement revision hip arthroplasty is an increasingly popular technique to replace a loose femoral stem which retains much of the original cement mantle. However, some concern exists regarding the retention of the existing fatigued and aged cement in such cement-in-cement revisions. This study investigates whether leaving an existing fatigued and aged cement mantle degrades the mechanical performance of a cement-in-cement revision construct.

  6. Analysis of movement pattern among referee in 2012 Malaysian Cup

    OpenAIRE

    Adnan, Rahmat; Muzayin, Nasriq; Sulaiman, Norasrudin

    2013-01-01

    This study is to determine the contributing factors of the movement patterns toward the total distance covered by the football referees during the Malaysia Soccer Cup 2012. Seven (7) of referees who officiated the 2012 Malaysian Cup matches were been chosen into this study. All seven matches from the tournament were recorded using Astro beyond decoder and were coding with SportCode Elite Software on the selected performance indicators (P.I) as main movement patterns variables. This movement p...

  7. FIFA World Cup 2006 Germany: An opportunity for union revitalisation?

    OpenAIRE

    Schwetz, Wilfried; McGuire, Donna

    2008-01-01

    Given their global dimension and centrality to late modern capitalist development mega sports events like the Olympics and the FIFA World Cup can provide space for public discussion about the impact of globalisation and the opportunity for union revitalisation. This paper examines the activities of selected German unions and civil society organisations, both in the lead up to and during the FIFA World Cup in Germany 2006, in order to determine the extent to which unions were able to utilise s...

  8. Prevalence of disc cupping in non-glaucomatous eyes

    Directory of Open Access Journals (Sweden)

    José Pablo Chiappe

    2015-02-01

    Full Text Available This study assessed optic disc size and cupping, using a commercially available ophthalmoscope, in order to show norms of these values for clinical practice. Subjects were office-workers referred from their respective workplaces for a routine medical examination, which included eye examination. The optic disc size was classified as small, medium or large, for having a diameter 1.5 times (respectively the diameter of the ophthalmoscope's selected light spot on the posterior pole. The cupping was classified as the ratio of the vertical cupping diameter and the vertical disc diameter on a relative decimal scale from 0.0 to 1.0.This study included 184 subjects with a mean age of 40.5 ± 9.5 years; 149 (81% were males. Their mean ocular pressure was 12.4 ± 1.5 mmHg (range 10-17 mmHg. There was a high correlation between optic disc sizes and cupping in the right and left eyes (Pearson Correlation r = 0.866, p < 0.001; therefore, for simplicity only the data for right eyes are presented. According to our definition, the optic discs in these eyes comprised 27 (14.7% small, 141 (76.6% medium and 16 (8.7% large. The small optic discs were rarely cupped, and the large optic discs were always cupped. Optic disc cupping greater than 0.7 was rarely found and should be suspect of glaucoma. Clinical doctors should be aware of this and refer those subjects with abnormal cupping to the specialist.

  9. Produktie van cement

    NARCIS (Netherlands)

    Smit JRK; Coenen PWHG; Matthijsen AJCM; LAE; TAUW

    1995-01-01

    This document on cement production has been published within the SPIN project. In this project information has been collected on industrial plants or industrial processes to afford support to governmental policy on emission reduction. This document contains information on the processes, emission sou

  10. Osteotransductive bone cements.

    Science.gov (United States)

    Driessens, F C; Planell, J A; Boltong, M G; Khairoun, I; Ginebra, M P

    1998-01-01

    Calcium phosphate bone cements (CPBCs) are osteotransductive, i.e. after implantation in bone they are transformed into new bone tissue. Furthermore, due to the fact that they are mouldable, their osteointegration is immediate. Their chemistry has been established previously. Some CPBCs contain amorphous calcium phosphate (ACP) and set by a sol-gel transition. The others are crystalline and can give as the reaction product dicalcium phosphate dihydrate (DCPD), calcium-deficient hydroxyapatite (CDHA), carbonated apatite (CA) or hydroxyapatite (HA). Mixed-type gypsum-DCPD cements are also described. In vivo rates of osteotransduction vary as follows: gypsum-DCPD > DCPD > CDHA approximately CA > HA. The osteotransduction of CDHA-type cements may be increased by adding dicalcium phosphate anhydrous (DCP) and/or CaCO3 to the cement powder. CPBCs can be used for healing of bone defects, bone augmentation and bone reconstruction. Incorporation of drugs like antibiotics and bone morphogenetic protein is envisaged. Load-bearing applications are allowed for CHDA-type, CA-type and HA-type CPBCs as they have a higher compressive strength than human trabecular bone (10 MPa).

  11. Analysis of Femoral Components of Cemented Total Hip Arthroplasty

    Science.gov (United States)

    Singh, Shantanu; Harsha, A. P.

    2015-10-01

    There have been continuous on-going revisions in design of prosthesis in Total Hip Arthroplasty (THA) to improve the endurance of hip replacement. In the present work, Finite Element Analysis was performed on cemented THA with CoCrMo trapezoidal, CoCrMo circular, Ti6Al4V trapezoidal and Ti6Al4V circular stem. It was observed that cross section and material of femoral stem proved to be critical parameters for stress distribution in femoral components, distribution of interfacial stress and micro movements. In the first part of analysis, designs were investigated for micro movements and stress developed, for different stem materials. Later part of the analysis focused on investigations with respect to different stem cross sections. Femoral stem made of Titanium alloy (Ti6Al4V) resulted in larger debonding of stem at cement-stem interface and increased stress within the cement mantle in contrast to chromium alloy (CoCrMo) stem. Thus, CoCrMo proved to be a better choice for cemented THA. Comparison between CoCrMo femoral stem of trapezium and circular cross section showed that trapezoidal stem experiences lesser sliding and debonding at interfaces than circular cross section stem. Also, trapezium cross section generated lower peak stress in femoral stem and cortical femur. In present study, femur head with diameter of 36 mm was considered for the analysis in order to avoid dislocation of the stem. Also, metallic femur head was coupled with cross linked polyethylene liner as it experiences negligible wear compared to conventional polyethylene liner and unlike metallic liner it is non carcinogenic.

  12. Degradable polyethylene: fantasy or reality.

    Science.gov (United States)

    Roy, Prasun K; Hakkarainen, Minna; Varma, Indra K; Albertsson, Ann-Christine

    2011-05-15

    Plastic waste disposal is one of the serious environmental issues being tackled by our society today. Polyethylene, particularly in packaging films, has received criticism as it tends to accumulate over a period of time, leaving behind an undesirable visual footprint. Degradable polyethylene, which would enter the eco-cycle harmlessly through biodegradation would be a desirable solution to this problem. However, the "degradable polyethylene" which is presently being promoted as an environmentally friendly alternative to the nondegradable counterpart, does not seem to meet this criterion. This article reviews the state of the art on the aspect of degradability of polyethylene containing pro-oxidants, and more importantly the effect these polymers could have on the environment in the long run. On exposure to heat, light, and oxygen, these polymers disintegrate into small fragments, thereby reducing or increasing the visual presence. However, these fragments can remain in the environment for prolonged time periods. This article also outlines important questions, particularly in terms of time scale of complete degradation, environmental fate of the polymer residues, and possible accumulation of toxins, the answers to which need to be established prior to accepting these polymers as environmentally benign alternatives to their nondegradable equivalents. It appears from the existing literature that our search for biodegradable polyethylene has not yet been realized. PMID:21495645

  13. The effect of cement creep and cement fatigue damage on the micromechanics of the cement-bone interface.

    NARCIS (Netherlands)

    Waanders, D.; Janssen, D.; Mann, K.A.; Verdonschot, N.J.J.

    2010-01-01

    The cement-bone interface provides fixation for the cement mantle within the bone. The cement-bone interface is affected by fatigue loading in terms of fatigue damage or microcracks and creep, both mostly in the cement. This study investigates how fatigue damage and cement creep separately affect th

  14. Phase equilibria in polyethylene systems

    OpenAIRE

    Hemmingsen, Pål Viggo

    2000-01-01

    The background for this work is a need to better understand the production of high density polythylene (HDPE). HDPE particles grow in a loop slurry reactor, and particle swelling and slurry viscosity are critical parts in the process. This thesis is concerned with the thermodynamic aspects of liquid and solid polyethylene, and liquid-liquid and solid-liquid equilibria in solvent-polyethylene systems. It also covers studies of vapor-liquid and solid-liquid equilibria in solvent-n-alkane system...

  15. POZZOLAN AND CEMENTS WITH POZZOLAN

    Directory of Open Access Journals (Sweden)

    Hasan KAPLAN

    1995-02-01

    Full Text Available Cement, one of the basic material of construction engineering, has an important place in view of strength and cost of structures. Cement consumption is increasing parallel to development of building construction sector. For cement producers, minimal cost is desired by using new and economical material sources. On the other hand, the controllers and contractors need cheaper, safer and higher strength materials. From this respect cement industry tends to use cement with pozzolan. In Türkiye, cement with pozzolan is produced by adding the pozzolan, which has a large reservoir in the country, in cement in sertain amount. However this type of cement is consumed in the construction sector, sortage of scientific investigation and speculative news on the subject.are worried the users and producers. In this paper, prior to an experimental study on the cements having pozzolan additive, historical development of pozzolan, reservoir of Turkiye, and comparison with portland cement is carried out. Advantages and disadvantages of pozzolan are also discussed in some points.

  16. Mineral resource of the month: hydraulic cement

    Science.gov (United States)

    van Oss, Hendrik G.

    2012-01-01

    Hydraulic cements are the binders in concrete and most mortars and stuccos. Concrete, particularly the reinforced variety, is the most versatile of all construction materials, and most of the hydraulic cement produced worldwide is portland cement or similar cements that have portland cement as a basis, such as blended cements and masonry cements. Cement typically makes up less than 15 percent of the concrete mix; most of the rest is aggregates. Not counting the weight of reinforcing media, 1 ton of cement will typically yield about 8 tons of concrete.

  17. An integral test of FLUKA nuclear models with 160 MeV proton beams in multi-layer Faraday cups

    CERN Document Server

    Rinaldi, I; Parodi, K; Ferrari, A; Sala, P; Mairani, A

    2011-01-01

    Monte Carlo (MC) codes are useful tools to simulate the complex processes of proton beam interactions with matter. In proton therapy, nuclear reactions influence the dose distribution. Therefore, the validation of nuclear models adopted in MC codes is a critical requisite for their use in this field. A simple integral test can be performed using a multi-layer Faraday cup (MLFC). This method allows separation of the nuclear and atomic interaction processes, which are responsible for secondary particle emission and the finite primary proton range, respectively. In this work, the propagation of 160 MeV protons stopping in two MLFCs made of polyethylene and copper has been simulated by the FLUKA MC code. The calculations have been performed with and without secondary electron emission and transport, as well as charge sharing in the dielectric layers. Previous results with other codes neglected those two effects. The impact of this approximation has been investigated and found to be relevant only in the proximity ...

  18. US cement industry

    Energy Technology Data Exchange (ETDEWEB)

    Nisbet, M.A.

    1997-12-31

    This paper describes the cement and concrete industry, and provides data on energy use and carbon dioxide emissions. The potential impact of an energy tax on the industry is briefly assessed. Opportunities identified for reducing carbon dioxide emissions include improved energy efficiency, alternative fuels, and alternative materials. The key factor in determining CO{sub 2} emissions is the level of domestic production. The projected improvement in energy efficiency and the relatively slow growth in domestic shipments indicate that CO{sub 2} emissions in 2000 should be about 5% above the 1990 target. However, due to the cyclical nature of cement demand, emissions will probably be above target levels during peak demand and below target levels during demand troughs. 7 figs., 2 tabs.

  19. Dielectric elastomer actuators for octopus inspired suction cups.

    Science.gov (United States)

    Follador, M; Tramacere, F; Mazzolai, B

    2014-09-25

    Suction cups are often found in nature as attachment strategy in water. Nevertheless, the application of the artificial counterpart is limited by the dimension of the actuators and their usability in wet conditions. A novel design for the development of a suction cup inspired by octopus suckers is presented. The main focus of this research was on the modelling and characterization of the actuation unit, and a first prototype of the suction cup was realized as a proof of concept. The actuation of the suction cup is based on dielectric elastomer actuators. The presented device works in a wet environment, has an integrated actuation system, and is soft. The dimensions of the artificial suction cups are comparable to proximal octopus suckers, and the attachment mechanism is similar to the biological counterpart. The design approach proposed for the actuator allows the definition of the parameters for its development and for obtaining a desired pressure in water. The fabricated actuator is able to produce up to 6 kPa of pressure in water, reaching the maximum pressure in less than 300 ms.

  20. Octopus-like suction cups: from natural to artificial solutions.

    Science.gov (United States)

    Tramacere, F; Follador, M; Pugno, N M; Mazzolai, B

    2015-05-13

    Octopus suckers are able to attach to all nonporous surfaces and generate a very strong attachment force. The well-known attachment features of this animal result from the softness of the sucker tissues and the surface morphology of the portion of the sucker that is in contact with objects or substrates. Unlike artificial suction cups, octopus suckers are characterized by a series of radial grooves that increase the area subjected to pressure reduction during attachment. In this study, we constructed artificial suction cups with different surface geometries and tested their attachment performances using a pull-off setup. First, smooth suction cups were obtained for casting; then, sucker surfaces were engraved with a laser cutter. As expected, for all the tested cases, the engraving treatment enhanced the attachment performance of the elastomeric suction cups compared with that of the smooth versions. Moreover, the results indicated that the surface geometry with the best attachment performance was the geometry most similar to octopus sucker morphology. The results obtained in this work can be utilized to design artificial suction cups with higher wet attachment performance.

  1. Octopus-like suction cups: from natural to artificial solutions.

    Science.gov (United States)

    Tramacere, F; Follador, M; Pugno, N M; Mazzolai, B

    2015-06-01

    Octopus suckers are able to attach to all nonporous surfaces and generate a very strong attachment force. The well-known attachment features of this animal result from the softness of the sucker tissues and the surface morphology of the portion of the sucker that is in contact with objects or substrates. Unlike artificial suction cups, octopus suckers are characterized by a series of radial grooves that increase the area subjected to pressure reduction during attachment. In this study, we constructed artificial suction cups with different surface geometries and tested their attachment performances using a pull-off setup. First, smooth suction cups were obtained for casting; then, sucker surfaces were engraved with a laser cutter. As expected, for all the tested cases, the engraving treatment enhanced the attachment performance of the elastomeric suction cups compared with that of the smooth versions. Moreover, the results indicated that the surface geometry with the best attachment performance was the geometry most similar to octopus sucker morphology. The results obtained in this work can be utilized to design artificial suction cups with higher wet attachment performance. PMID:25970079

  2. Classification of operational characteristics of commercial cup-anemometers

    Energy Technology Data Exchange (ETDEWEB)

    Friis Pedersen, T.; Schmidt Paulsen, U. [Risoe National Lab., Wind Energy and Atmospheric Physics Dept., Roskilde (Denmark)

    1999-03-01

    The present classification of cup-anemometers is based on a procedure for classification of operational characteristics of cup-anemometers that was proposed at the EWEC `97 conference in Dublin 1997. Three definitions of wind speed are considered. The average longitudinal wind speed (ID), the average horizontal wind speed (2D) and the average vector wind speed (3D). The classification is provided in these terms, and additionally, the turbulence intensities, which are defined from the same wind speed definitions. The commercial cup-anemometers have all been calibrated in wind tunnel for the normal calibrations and angular characteristics. Friction was measured by blywheel testing, where the surrounding temperatures were varied over a wide range. The characteristics of the cup-anemometers have been fitted to the heuristic dynamic model, and the response has been calculated in time domain for prescribed ranges of external operational conditions. The results are presented in ranges of maximum deviations of `measured` average wind speed. For each definition of wind speed and turbulence intensity, the cup-anemometers are ranked according to the most precise instrument. Finally, the most important systematic error sources are commented. (au)

  3. Dielectric elastomer actuators for octopus inspired suction cups

    International Nuclear Information System (INIS)

    Suction cups are often found in nature as attachment strategy in water. Nevertheless, the application of the artificial counterpart is limited by the dimension of the actuators and their usability in wet conditions. A novel design for the development of a suction cup inspired by octopus suckers is presented. The main focus of this research was on the modelling and characterization of the actuation unit, and a first prototype of the suction cup was realized as a proof of concept. The actuation of the suction cup is based on dielectric elastomer actuators. The presented device works in a wet environment, has an integrated actuation system, and is soft. The dimensions of the artificial suction cups are comparable to proximal octopus suckers, and the attachment mechanism is similar to the biological counterpart. The design approach proposed for the actuator allows the definition of the parameters for its development and for obtaining a desired pressure in water. The fabricated actuator is able to produce up to 6 kPa of pressure in water, reaching the maximum pressure in less than 300 ms. (paper)

  4. Mathematical analysis of the effect of rotor geometry on cup anemometer response.

    Science.gov (United States)

    Sanz-Andrés, Ángel; Pindado, Santiago; Sorribes-Palmer, Félix

    2014-01-01

    The calibration coefficients of two commercial anemometers equipped with different rotors were studied. The rotor cups had the same conical shape, while the size and distance to the rotation axis varied. The analysis was based on the 2-cup positions analytical model, derived using perturbation methods to include second-order effects such as pressure distribution along the rotating cups and friction. The comparison with the experimental data indicates a nonuniform distribution of aerodynamic forces on the rotating cups, with higher forces closer to the rotating axis. The 2-cup analytical model is proven to be accurate enough to study the effect of complex forces on cup anemometer performance.

  5. Performance of Cement Containing Laterite as Supplementary Cementing Material

    Directory of Open Access Journals (Sweden)

    Abbas Bukhari, Z. S.

    2013-03-01

    Full Text Available The utilization of different industrial waste, by-products or other materials such as ground granulated blast furnace slag, silica fume, fly ash, limestone, and kiln dust, etc. as supplemen- tary cementing materials has received considerable attention in recent years. A study has been conducted to look into the performance of laterite as Supplementary Cementing Materials (SCM. The study focuses on compressive strength performance of blended cement containing different percentage of laterite. The cement is replaced accordingly with percentage of 2 %, 5 %, 7 % and 10 % by weight. In addition, the effect of use of three chemically different laterites have been studied on physical performance of cement as in setting time, Le-Chatlier expansion, loss on ignition, insoluble residue, free lime and specifically compressive strength of cement cubes tested at the age of 3, 7, and 28 days. The results show that the strength of cement blended with laterite as SCM is enhanced. Key words: Portland cement, supplementary cementing materials (SCM, laterite, compressive strength KUI – 6/2013 Received January 4, 2012 Accepted February 11, 2013

  6. Tympanoplasty with ionomeric cement.

    Science.gov (United States)

    Kjeldsen, A D; Grøntved, A M

    2000-01-01

    Patients with isolated erosion of the long incus process suffer from severe hearing loss caused by lack of continuity of the ossicular chain. This study is a retrospective evaluation of the hearing results using two different surgical procedures. Since January 1993, 12 consecutive patients with isolated erosion of the long incus process have been treated with a new surgical technique in which the ossicular chain was rebuilt with ionomeric cement. The results in hearing performance (mean pure-tone average (PTA) 0.5, 1 and 2 kHz) were evaluated pre- and post-surgery, and compared to those in a group of 20 historical controls who underwent surgery in 1991 and 1992 using incus autograft interposition. Among the 12 index patients, 7 (58%) achieved improvement in PTA of > 10 dB, in 3 there was no difference and in 2 a slight decline. Among the 20 controls, 14 (70%) achieved improvement in PTA of > 10 dB, in 4 there was a slight improvement and in 2 a decline. The difference was not statistically significant. Hearing improvement using ionomeric cement in type II tympanoplasty was satisfactory. Reconstruction of the ossicular chain with ionomeric cement is recommended, as the procedure is easy to perform, presents less risk of damage to the stapes and cochlea, requires less extensive surgery and does not exclude other surgical methods in cases of reoperation. PMID:10909000

  7. Comparative studies of indoor radon concentration levels in Jordan using CR-39 based bag and cup dosimeters.

    Science.gov (United States)

    Ahmad, N; Matiullah; Khatibeh, A J

    1998-07-01

    Indoor radon concentration levels have been measured in 9 major cities of Jordan using CR(-3)9 detectors placed in punched polyethylene bags to measure both radon and thoron, and in cups to measure radon only. The average value of indoor radon and thoron concentration levels measured with bag dosimeters vary from 32 to 107 Bq m(-3) and the indoor radon concentration levels measured with cup dosimeters vary from 27 to 88 Bq m(-3). The indoor radon concentration levels in Irbid and Zaraka are comparable to the world average of 27 Bq m(-3). In Ajloun, Jerash, Salt, Tafilah and Amman, the indoor radon levels are greater than the world average by a factor of up to 2, and in Madaba and Karak these levels are greater than the world average by a factor of more than 3. The large variation in the measured radon levels may be attributed to the large variation in the 226Ra activity in the soil of the region. PMID:9645667

  8. Comparative studies of indoor radon concentration levels in Jordan using CR-39 based bag and cup dosimeters.

    Science.gov (United States)

    Ahmad, N; Matiullah; Khatibeh, A J

    1998-07-01

    Indoor radon concentration levels have been measured in 9 major cities of Jordan using CR(-3)9 detectors placed in punched polyethylene bags to measure both radon and thoron, and in cups to measure radon only. The average value of indoor radon and thoron concentration levels measured with bag dosimeters vary from 32 to 107 Bq m(-3) and the indoor radon concentration levels measured with cup dosimeters vary from 27 to 88 Bq m(-3). The indoor radon concentration levels in Irbid and Zaraka are comparable to the world average of 27 Bq m(-3). In Ajloun, Jerash, Salt, Tafilah and Amman, the indoor radon levels are greater than the world average by a factor of up to 2, and in Madaba and Karak these levels are greater than the world average by a factor of more than 3. The large variation in the measured radon levels may be attributed to the large variation in the 226Ra activity in the soil of the region.

  9. [Haemotoxicity of dental luting cements].

    Science.gov (United States)

    Anders, A; Welker, D

    1989-06-01

    A glass ionomer luting cement (AquaCem) shows a relatively low haemolytic activity in comparison with two zinc phosphate cements. Especially the initial irritation by this cement is smaller. Although it is possible that AquaCem particularly, in unfavourable cases, may damage the pulpa dentin system; this is due to the slowly decrease of the haemolytic activity with increasing of the probes. We found that Adhesor showed in dependence of the batches a varying quality. PMID:2626769

  10. Cement penetration after patella venting.

    Science.gov (United States)

    Jones, Christopher W; Lam, Li-On; Butler, Adam; Wood, David J; Walsh, William R

    2009-01-01

    There is a high rate of patellofemoral complications following total knee arthroplasty. Optimization of the cement-bone interface by venting and suction of the tibial plateau has been shown to improve cement penetration. Our study was designed to investigate if venting the patella prior to cementing improved cement penetration. Ten paired cadaver patellae were allocated prior to resurfacing to be vented or non-vented. Bone mineral density (BMD) was measured by DEXA scanning. In vented specimens, a 1.6 mm Kirschner wire was used to breach the anterior cortex at the center. Specimens were resurfaced with standard Profix instrumentation and Versabond bone cement (Smith and Nephew PLC, UK). Cement penetration was assessed from Faxitron and sectioned images by a digital image software package (ImageJ V1.38, NIH, USA). Wilcoxon rank sum test was used to assess the difference in cement penetration between groups. The relationship between BMD and cement penetration was analyzed by Pearson correlation coefficient. There was a strong negative correlation between peak BMD and cement penetration when analyzed independent of experimental grouping (r(2)=-0.812, p=0.004). Wilcoxon rank sum testing demonstrated no significant difference (rank sum statistic W=27, p=0.579) in cement penetration between vented (10.53%+/-4.66; mean+/-std dev) and non-vented patellae (11.51%+/-6.23; mean+/-std dev). Venting the patella using a Kirschner wire does not have a significant effect on the amount of cement penetration achieved in vitro using Profix instrumentation and Versabond cement. PMID:19010682

  11. Treatment of Obstinate Diseases by Acupuncture and Cupping

    Institute of Scientific and Technical Information of China (English)

    杨容

    2001-01-01

    @@Acupuncture treatment integrated with cupping for enhancing the therapeutic effect is a technique in Yang's school of acupuncture carried forward from generation to generation. The author's grandfather created Yang's shallow puncturing and cupping therapy to enhance the effect of promoting blood flow and removing blood stasis in the light of his clinical experience. In this therapy, the gentle puncturing and heavy tapping are carried out with the seven-star needle until light bleeding occurs, followed by drawing out of pituita or stagnant blood and coagula by cupping, in an attempt to promote tissue regeneration by removing blood stasis for promoting the flow of qi and blood in the meridians. The therapy has been developed by Dr. Yang Yifang (the author's father) in clinical practice over the past six decades. Satisfactory therapeutic results have been obtained in clinical practice, which are introduced with examples below.

  12. Characterisation and classification of RISØ P2546 cup anemometer

    DEFF Research Database (Denmark)

    Friis Pedersen, Troels

    2003-01-01

    The characteristics of the RISØ P2546 cup anemometer were investigated in detail by wind tunnel and laboratory tests. The characteristics include accredited calibration, tilt response measurements for tilt angles between -40° to 40°, gust responsemeasurements at 8m/s and turbulence intensities of...... 10%, 16% and 23%, step response measurements at step wind speeds 3,7, 8, 11,9 and 15,2m/s, measurement of torque characteristics at 8m/s, rotor inertia measurements and measurements of friction ofbearings at temperatures -20°C to 40°C. Characteristics were fitted to a time domain cup anemometer model....... The characteristics were transformed into the CLASSCUP classification scheme, and were related to the cup anemometer requirements in the Danishcertification system and in the IEC 61400-121 Committee Draft....

  13. Characterisation and classification of RISØ P2546 cup anemometer

    DEFF Research Database (Denmark)

    Friis Pedersen, Troels

    2004-01-01

    The characteristics of the RISØ P2546 cup anemometer were investigated in detail by wind tunnel and laboratory tests. The characteristics include accredited calibration, tilt response measurements for tilt angles between -40° to 40°, gust responsemeasurements at 8m/s and turbulence intensities of...... 10%, 16% and 23%, step response measurements at step wind speeds 3,7, 8, 11,9 and 15,2m/s, measurement of torque characteristics at 8m/s, rotor inertia measurements and measurements of friction ofbearings at temperatures -20°C to 40°C. Characteristics were fitted to a time domain cup anemometer model....... The characteristics were transformed into the CLASSCUP classification scheme, and were related to the cup anemometer requirements in the Danishcertification system and in the IEC 61400-121 Committee Draft....

  14. DTU-team vinder kategori i VentureCup 2015

    DEFF Research Database (Denmark)

    Lassen, Lisbeth

    2015-01-01

    Teamet EDS, Ecological Disposal Systems, har vundet kategorien Cleantech & Environment i VentureCup’s årlige konkurrence StartUp Competition, og som vinder går holdet videre sammen med de andre vindere til University Startup World Cup som afholdes i København i midten af september.......Teamet EDS, Ecological Disposal Systems, har vundet kategorien Cleantech & Environment i VentureCup’s årlige konkurrence StartUp Competition, og som vinder går holdet videre sammen med de andre vindere til University Startup World Cup som afholdes i København i midten af september....

  15. Numerical Analysis of Hydroforming DeepDrawing of Conical Cup

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Aided by the FE-code, analysis is carried to find the proper hydroforming deep-drawing condition for the perfect forming of a conical cup that can not be drawn successfully by conventional deep drawing method. Hydraulic counter pressure must be reasonably controlled, otherwise defects such as fracture and wrinkling can not be avoided. Therefore, the forming procedure is divided into three stages, and the counter pressure is adjusted intentionally to make the blank clamped onto the punch at a suitable time, then deformation at dangerous area is resisted by the effect of the counter pressure and the conical cup can be formed without defects.

  16. Sectoral labour market effects of the 2006 FIFA World Cup

    DEFF Research Database (Denmark)

    Feddersen, Arne; Maennig, Wolfgang

    2012-01-01

    Using the case of the 2006 FIFA World Cup, this study is the first to test the employment effects of a mega-sporting event on the basis of data that combines both regional and sectoral data. It is also the first study of sporting events to use a semi-parametric test method. Earlier studies on the...... on the World Cup could hardly identify any employment effects. In contrast, we find a small but significant positive employment effect on the hospitality sector. © 2012 Elsevier B.V....

  17. The age grading and the Chen-Ruan cup product

    DEFF Research Database (Denmark)

    A. Hepworth, Richard

    2010-01-01

    We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....

  18. Respiratory Health among Cement Workers in Ethiopia

    OpenAIRE

    Zeleke, Zeyede K.

    2011-01-01

    Background: Little is known on dust exposure and respiratory health among cement cleaners. There are only a few follow-up studies on respiratory health among cement factory workers and also studies on acute effects of cement dust exposure are limited in numbers. Objective: This study aimed at assessing cement dust exposure and adverse respiratory health effects among Ethiopian cement production workers, with particular focus on cement cleaners. Method: The first paper was...

  19. Thermal Shock-resistant Cement

    Energy Technology Data Exchange (ETDEWEB)

    Sugama T.; Pyatina, T.; Gill, S.

    2012-02-01

    We studied the effectiveness of sodium silicate-activated Class F fly ash in improving the thermal shock resistance and in extending the onset of hydration of Secar #80 refractory cement. When the dry mix cement, consisting of Secar #80, Class F fly ash, and sodium silicate, came in contact with water, NaOH derived from the dissolution of sodium silicate preferentially reacted with Class F fly ash, rather than the #80, to dissociate silicate anions from Class F fly ash. Then, these dissociated silicate ions delayed significantly the hydration of #80 possessing a rapid setting behavior. We undertook a multiple heating -water cooling quenching-cycle test to evaluate the cement’s resistance to thermal shock. In one cycle, we heated the 200 and #61616;C-autoclaved cement at 500 and #61616;C for 24 hours, and then the heated cement was rapidly immersed in water at 25 and #61616;C. This cycle was repeated five times. The phase composition of the autoclaved #80/Class F fly ash blend cements comprised four crystalline hydration products, boehmite, katoite, hydrogrossular, and hydroxysodalite, responsible for strengthening cement. After a test of 5-cycle heat-water quenching, we observed three crystalline phase-transformations in this autoclaved cement: boehmite and #61614; and #61543;-Al2O3, katoite and #61614; calcite, and hydroxysodalite and #61614; carbonated sodalite. Among those, the hydroxysodalite and #61614; carbonated sodalite transformation not only played a pivotal role in densifying the cementitious structure and in sustaining the original compressive strength developed after autoclaving, but also offered an improved resistance of the #80 cement to thermal shock. In contrast, autoclaved Class G well cement with and without Class F fly ash and quartz flour failed this cycle test, generating multiple cracks in the cement. The major reason for such impairment was the hydration of lime derived from the dehydroxylation of portlandite formed in the autoclaved

  20. Supercritical CO2 impregnation of polyethylene components for medical purposes

    Directory of Open Access Journals (Sweden)

    Gamse Thomas

    2007-01-01

    Full Text Available Modem hip and knee endoprosthesis are produced in titanium and to reduce the friction at the contact area polymer parts, mainly ultra-high molecular weight polyethylene (UHMW-PE, are installed. The polyethylene is impregnated with a-tocopherol (vitamin E before processing for remarkable decrease of oxidative degradation. Cross linked UHMW-PE offers much higher stability, but a-tocopherol cannot be added before processing, because a-tocopherol hinders the cross linking process accompanied by a heavy degradation of the vitamin. The impregnation of UHMW-PE with a-tocopherol has to be performed after the cross linking process and an accurate concentration has to be achieved over the cross section of the whole material. In the first tests UHMW-PE-cubes were stored in pure a-tocopherol under inert atmosphere at temperatures from 100 to 150 °C resulting in a high mass fraction of a-tocopherol in the edge zones and no constant concentration over the cross section. For better distribution and for regulating the mass fraction of a-tocopherol in the cross linked UHMW-PE material supercritical CO2 impregnation tests were investigated. Again UHMW-PE-cubes were impregnated in an autoclave with a-tocopherol dissolved in supercritical CO2 at different pressures and temperatures with variable impregnation times and vitamin E concentrations. Based on the excellent results of supercritical CO2 impregnation standard hip and knee cups were stabilized nearly homogeneously with varying mass fraction of a-tocopherol.

  1. Facility arrangements and the environmental performance of disposable and reusable cups

    OpenAIRE

    Potting, José; Harst-Wintraecken, van der, E.J.M.

    2015-01-01

    Purpose: This paper integrates two complementary life cycle assessment (LCA) studies with the aim to advice facility managers on the sustainable use of cups, either disposable or reusable. Study 1 compares three disposable cups, i.e., made from fossil-based polystyrene (PS), biobased and compostable plastic (polylactic acid; PLA) and paper lined with PLA (biopaper). Study 2 compares the disposable PS cup with reusable cups that are handwashed or dishwashed. Methods: Existing LCA studies show ...

  2. Radiolysis effects on polyethylene terephtalate

    Energy Technology Data Exchange (ETDEWEB)

    Zaharescu, Traian [ICPE-CA, Advanced Institute for Electrical Engineering, 313 Splaiul Unirii, P.O. Box 87, Bucharest 030138 (Romania)]. E-mail: zaharescut@gw-chimie.math.unibuc.ro; Ciuprina, Florin [' POLITEHNICA' University of Bucharest, 313 Splaiul Independentei, Bucharest 060042 (Romania)

    2005-07-01

    The effects of high energy exposure of polyethylene terephtalate, the main electrical insulator for the conduction bars in alternative current generators, is presented. For comparison {gamma}-irradiation was performed in distilled water and air at various doses, up to about 200 kGy. The dependencies of current on time for radiation processed PET sheets allow to depict the variation in the resistivity values as a measure of chemical changes in polyethylene terephtalate macromolecules. The comparison between the evolution of currents in irradiated specimens and spectral analysis bring about a light on the accumulation of radiolysis product in PET matrix. The high energy exposure of PET in air causes an increase of final value of current, while similar experiments in water produces a contrary effect. Some considerations of degradation mechanism are presented.

  3. Radiolysis effects on polyethylene terephtalate

    Science.gov (United States)

    Zaharescu, Traian; Ciuprina, Florin

    2005-07-01

    The effects of high energy exposure of polyethylene terephtalate, the main electrical insulator for the conduction bars in alternative current generators, is presented. For comparison γ-irradiation was performed in distilled water and air at various doses, up to about 200 kGy. The dependencies of current on time for radiation processed PET sheets allow to depict the variation in the resistivity values as a measure of chemical changes in polyethylene terephtalate macromolecules. The comparison between the evolution of currents in irradiated specimens and spectral analysis bring about a light on the accumulation of radiolysis product in PET matrix. The high energy exposure of PET in air causes an increase of final value of current, while similar experiments in water produces a contrary effect. Some considerations of degradation mechanism are presented.

  4. 76 FR 58108 - Safety Zone; Ryder Cup Captain's Duel Golf Shot, Chicago River, Chicago, IL

    Science.gov (United States)

    2011-09-20

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Ryder Cup Captain's Duel Golf Shot, Chicago.... Background and Purpose The Ryder Cup Captain's Duel Golf Shot event takes place on the Chicago River near.... 165.T09-0847 to read as follows: Sec. 165.T09-0847 Safety Zone; Ryder Cup Captain's Duel Golf...

  5. 77 FR 20846 - Certain Food Containers, Cups, Plates, Cutlery, and Related Items and Packaging Thereof...

    Science.gov (United States)

    2012-04-06

    ... COMMISSION Certain Food Containers, Cups, Plates, Cutlery, and Related Items and Packaging Thereof... importation of certain food containers, cups, plates, cutlery, and related items and packaging thereof by... importation of certain food containers, cups, plates, cutlery, and related items and packaging thereof...

  6. The Sorption Behavior of Wood Studied by Means of an Improved Cup Method

    DEFF Research Database (Denmark)

    Eitelberger, Johannes; Svensson, Staffan

    2012-01-01

    inwards the cup. In contrast to the common cup method, the herein presented method uses a data logger for relative humidity and temperature placed inside the cup. The use of thin cross-cut specimens allows for explicit separation of the different processes occurring during transient moisture transport...

  7. 78 FR 36426 - Safety Zone; Queen's Cup; Lake Michigan; Milwaukee, WI

    Science.gov (United States)

    2013-06-18

    ... DHS Department of Homeland Security FR Federal Register NPRM Notice of Proposed Rulemaking TFR... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Queen's Cup; Lake Michigan; Milwaukee, WI... Queen's Cup Regatta. The Queen's Cup Regatta is a race from Milwaukee, WI to Ludington, MI that...

  8. Prediction of the Setting Properties of Calcium Phosphate Bone Cement

    Directory of Open Access Journals (Sweden)

    Seyed Mahmud Rabiee

    2012-01-01

    Full Text Available Setting properties of bone substitutes are improved using an injectable system. The injectable bone graft substitutes can be molded to the shape of the bone cavity and set in situ when injected. Such system is useful for surgical operation. The powder part of the injectable bone cement is included of β-tricalcium phosphate, calcium carbonate, and dicalcium phosphate and the liquid part contains poly ethylene glycol solution with different concentrations. In this way, prediction of the mechanical properties, setting times, and injectability helps to optimize the calcium phosphate bone cement properties. The objective of this study is development of three different adaptive neurofuzzy inference systems (ANFISs for estimation of compression strength, setting time, and injectability using the data generated based on experimental observations. The input parameters of models are polyethylene glycol percent and liquid/powder ratio. Comparison of the predicted values and measured data indicates that the ANFIS model has an acceptable performance to the estimation of calcium phosphate bone cement properties.

  9. Prediction of the setting properties of calcium phosphate bone cement.

    Science.gov (United States)

    Rabiee, Seyed Mahmud; Baseri, Hamid

    2012-01-01

    Setting properties of bone substitutes are improved using an injectable system. The injectable bone graft substitutes can be molded to the shape of the bone cavity and set in situ when injected. Such system is useful for surgical operation. The powder part of the injectable bone cement is included of β-tricalcium phosphate, calcium carbonate, and dicalcium phosphate and the liquid part contains poly ethylene glycol solution with different concentrations. In this way, prediction of the mechanical properties, setting times, and injectability helps to optimize the calcium phosphate bone cement properties. The objective of this study is development of three different adaptive neurofuzzy inference systems (ANFISs) for estimation of compression strength, setting time, and injectability using the data generated based on experimental observations. The input parameters of models are polyethylene glycol percent and liquid/powder ratio. Comparison of the predicted values and measured data indicates that the ANFIS model has an acceptable performance to the estimation of calcium phosphate bone cement properties. PMID:22919372

  10. Observation on Therapeutic Effects of Cupping Therapy for Allergic Rhinitis

    Institute of Scientific and Technical Information of China (English)

    许荣正; 朱雪兰; 吴国民; 黄国琪

    2010-01-01

    @@ Allergic rhinitis is mainly characterized by the symptoms of sneezing,tickling sensation in the nose,runny nose,and nasal obstruction,and often occurs after invasion of pathogenic wind and cold.The author has treated 50 cases of this disease by applying cupping therapy on Shenque (CV 8).Now,the report is given as follows.

  11. RoboCup Rescue Robot and Simulation Leagues

    NARCIS (Netherlands)

    H.L. Akin; N. Ito; A. Jacoff; A. Kleiner; J. Pellenz; A. Visser

    2013-01-01

    The RoboCup Rescue Robot and Simulation competitions have been held since 2000. The experience gained during these competitions has increased the maturity level of the field, which allowed deploying robots after real disasters (for example, Fukushima Daiichi nuclear disaster). This article provides

  12. Teaching Transport Phenomena around a Cup of Coffee

    Science.gov (United States)

    Condoret, Jean Stephane

    2007-01-01

    The very common situation of waiting for the cooling of a cup of coffee is addressed through a conventional engineering approach, where several important concepts of heat and mass transfer are used. A numerical and analytical solution of the differential equations of the problem are proposed, and assessed by comparing to simple experiments.…

  13. Ryder Cup ning rahvusvaheline kogemus teenindusvaldkonnast / Liis Meeras

    Index Scriptorium Estoniae

    Meeras, Liis

    2006-01-01

    Iirimaal Dublini lähedal Kildare maakonna provintsis asuvas K-Clubis 22.-24. septembrini toimunud 36. Ryder Cup turniirist, mis on üks prestiizhikaim golfiüritus maailmas. Oma muljetest räägivad üritusel teenindanud turismitudengid TÜ Pärnu kolledzhist

  14. Faraday cup on board Japan's first interplanetary probe 'SAKIGAKE'

    International Nuclear Information System (INIS)

    Faraday cup on board Japan's 1st interplanetary test probe 'SAKIGAKE' is described. The contents include the description of the principle of the measurement, structure of the sensor, accuracy of the measurement of bulk velocity, ion density and temperature of the solar wind plasma, data processing, and the thorough system of the experiment including telemetry allocation, status words and command system. (author)

  15. The cryptic enhancer elements of the tCUP promoter.

    Science.gov (United States)

    Wu, Keqiang; Hu, Ming; Martin, Teresa; Wang, Changming; Li, Xiu-Qing; Tian, Lining; Brown, Dan; Miki, Brian

    2003-02-01

    Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter. PMID:12602866

  16. Treatment of Acute Lumbar Sprain by Acupuncture plus Cupping

    Institute of Scientific and Technical Information of China (English)

    WANG Jun-ying; WANG Si-you

    2003-01-01

    Fifty cases of acute lumbar sprain were treated by the combination of acupuncture, cupping and kinesitherapy. Forty-three cases were cured and 7 cases improved, the total effective rate being 100%. This therapy has an exact effect with a short course of treatment.

  17. Evaluating The RoboCup 2009 Virtual Robot Rescue Competition

    NARCIS (Netherlands)

    S. Balakirsky; S. Carpin; A. Visser

    2009-01-01

    The 2009 RoboCup Competitions took place in Graz Austria in July of 2009. The Virtual Robot Rescue Competition included 11 competitors from 10 different countries. The main objective of this competition is to utilize teams of robots to perform an urban search and rescue (USAR) mission over both indo

  18. The economic value of the 2010 Soccer World Cup

    Directory of Open Access Journals (Sweden)

    M. Saayman

    2008-12-01

    Full Text Available Purpose: The purpose of this article is to estimate the potential economic value of the 2010 Soccer World Cup for South Africa. Problem investigated: The Soccer World Cup (SWC is regarded as the largest sporting event to be hosted and South Africa is investing billions of Rand in the hosting thereof. Based on this the question that comes to mind is, what is the potential economic value of such an event? Previous research attempts to determine the economic value were limited in their focus on what should be included when economic modelling of events is conducted. Most of these studies were done by consultants on behalf of various government departments and consequently, the results of these attempts are criticised for their over-inflating and overestimations by various other researchers. Methodology: The literature review identified many aspects that need to be taken into account when modelling the economic impact of such an event together with aspects identified in the literature review. Lessons from the 2002 Korea/Japan and 2006 Germany Soccer World Cups were used as premise for our estimations. In this article, Computable General Equilibrium (CGE modelling is used to estimate the potential economic value. Findings: The results showed that the 2010 Soccer World Cup would in all probability have positive impacts on the economy of the country in terms of GDP growth and employment, with possible negative effects that include higher inflation and net export losses. Value of research: The value of this research lies in the approach that was followed firstly, by introducing lessons learned from previous World Cups as well as aspects not taken into consideration previously in economic modelling and secondly, by using CGE modelling in determining the economic value. Conclusion: The hosting of the 2010 Soccer World Cup is a major achievement not only for South Africa, but also for the rest of Africa, especially from a marketing point of view. From an

  19. No effect of additional screw fixation of a cementless, all-polyethylene press-fit socket on migration, wear, and clinical outcome.

    Science.gov (United States)

    Minten, Michiel J M; Heesterbeek, Petra J C; Spruit, Maarten

    2016-08-01

    Background and purpose - Additional screw fixation of the all-polyethylene press-fit RM cup (Mathys) has no additional value for migration, in the first 2 years after surgery. However, the medium-term and long-term effects of screw fixation remain unclear. We therefore evaluated the influence of screw fixation on migration, wear, and clinical outcome at 6.5 years using radiostereometric analysis (RSA). Patients and methods - This study involved prolonged follow-up from a previous randomized controlled trial (RCT). We analyzed RSA radiographs taken at baseline and at 1-, 2-, and 6.5-year follow-up. Cup migration and wear were assessed using model-based RSA software. Wear was calculated as translation of the femoral head model in relation to the cup model. Total translation, rotation, and wear were calculated mathematically from results of the orthogonal components. Results - 27 patients (15 with screw fixation and 12 without) were available for follow-up at 6.5 (5.6-7.2) years. Total translation (0.50 mm vs. 0.56 mm) and rotation (1.01 degrees vs. 1.33 degrees) of the cup was low, and was not significantly different between the 2 groups. Wear increased over time, and was similar between the 2 groups (0.58 mm vs. 0.53 mm). Wear rate (0.08 mm/year vs. 0.09 mm/year) and clinical outcomes were also similar. Interpretation - Our results indicate that additional screw fixation of all-polyethylene press-fit RM cups has no additional value regarding medium-term migration and clinical outcome. The wear rate was low in both groups. PMID:27299418

  20. Magnesium oxychloride cement concrete

    Indian Academy of Sciences (India)

    A K Misra; Renu Mathur

    2007-06-01

    The scope of magnesium oxychloride (MOC) cement in concrete works has been evaluated. MOC cement concrete compositions of varying strengths having good placing and finishing characteristics were prepared and investigated for their compressive and flexural strengths, -values, abrasion resistance etc. The durability of MOC concrete compositions against extreme environmental conditions viz. heating–cooling, freezing–thawing, wetting–drying and penetration and deposition of salts etc were investigated. The results reveal that MOC concrete has high compressive strength associated with high flexural strength and the ratio of compressive to flexural strength varies between 6 and 8. The elastic moduli of the compositions studied are found to be 23–85 GPa and the abrasion losses between 0.11 and 0.20%. While alternate heating–cooling cycles have no adverse effect on MOC concrete, it can be made durable against freezing–thawing and the excessive exposure to water and salt attack by replacing 10% magnesium chloride solution by magnesium sulphate solution of the same concentration.

  1. Radiological diagnostics in CUP syndrome; Radiologische Diagnostik des CUP-Syndroms

    Energy Technology Data Exchange (ETDEWEB)

    Kazmierczak, P.M.; Nikolaou, K.; Graser, A.; Reiser, M.F.; Cyran, C.C. [Klinikum der Ludwig-Maximilians-Universitaet, Campus Grosshadern, Institut fuer Klinische Radiologie, Muenchen (Germany); Rominger, A. [Klinikum der Ludwig-Maximilians-Universitaet, Campus Grosshadern, Klinik und Poliklinik fuer Nuklearmedizin, Muenchen (Germany)

    2014-02-15

    Imaging plays an essential role in the therapeutic management of cancer of unknown primary (CUP) patients for localizing the primary tumor, for the identification of tumor entities for which a dedicated therapy regimen is available and for the characterization of clinicopathological subentities that direct the subsequent diagnostic and therapeutic strategy. Modalities include conventional x-ray, computed tomography (CT), magnetic resonance imaging (MRI) and ultrasound as well as positron emission tomography (PET)-CT and MRI-PET. In whole body imaging CT has a high sensitivity for tumor entities which frequently present as a metastasized cancer illness. According to the current literature CT is diagnostic in 86% of patients with pancreatic carcinoma, in 36% of patients with colon carcinoma and in 74% of patients with lung carcinoma. Additionally a meta-analysis showed that for patients with squamous cell carcinoma and cervical lymph node metastases a positive diagnosis was possible in 22% of the cases using CT, in 36% using MRI and in 28-57% using 18F-fluorodeoxyglucose PET-CT ({sup 18}F-FDG PET-CT). In addition, MRI plays an important role in the localization of primary occult tumors (e.g. breast and prostate) because of its high soft tissue contrast and options for functional imaging. At the beginning of the diagnostic algorithm stands the search for a possible primary tumor and CT of the neck, thorax and abdomen is most frequently used for whole body staging. Subsequent organ-specific imaging examinations follow, e.g. mammography in women with axillary lymphadenopathy. For histological and immunohistochemical characterization of tumor tissue, imaging is also applied to identify the most accessible and representative tumor manifestation for biopsy. Tumor biopsy may be guided by CT, MRI or ultrasound and MRI also plays a central role in the localization of primary occult tumors because of superior soft tissue contrast and options for functional imaging (perfusion

  2. Automatic cup vending machine series (1999 machine); Cup jido hanbaiki series (99 nenki)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-01-10

    A new automatic cup vending machine series is developed, higher in operating efficiency and energy saving, which will attract more customers. The external design and internal layout were completely changed, and new types have joined the series, such as a BIB (bag in box) machine or a flavor card machine to enrich the series. The new product is characterized in that (1) it is equipped with a door on which a bill validator (paper money identifier) and a card reader are installed to enable the machine to accept both money and card for attracting customers without missing a selling opportunity; that (2) it is equipped with novel mixing bowls that may be attached or removed with an one-touch action; that (3) it is equipped with a novel coffee brewer for which paper filters may be loaded from the front side; and that (4) it runs on an energy saving mode with help of temperature and time controls to work for the devices in the chamber. (translated by NEDO)

  3. 21 CFR 888.4200 - Cement dispenser.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cement dispenser. 888.4200 Section 888.4200 Food... DEVICES ORTHOPEDIC DEVICES Surgical Devices § 888.4200 Cement dispenser. (a) Identification. A cement dispenser is a nonpowered syringe-like device intended for use in placing bone cement (§ 888.3027)...

  4. Influence of bismuth oxide concentration on the pH level and biocompatibility of white Portland cement

    Directory of Open Access Journals (Sweden)

    Marina Angélica MARCIANO

    2014-07-01

    Full Text Available Objectives: To investigate if there is a relation between the increase of bismuth oxide and the decrease of pH levels and an intensification of toxicity in the Portland cement. Material and Methods: White Portland cement (WPC was mixed with 0, 15, 20, 30 and 50% bismuth oxide, in weight. For the pH level test, polyethylene tubes were filled with the cements and immersed in Milli-Q water for 15, 30 and 60 days. After each period, the increase of the pH level was assessed. For the biocompatibility, two polyethylene tubes filled with the cements were implanted in ninety albino rats (n=6. The analysis of the intensity of the inflammatory infiltrate was performed after 15, 30 and 60 days. The statistical analysis was performed using the Kruskal-Wallis, Dunn and Friedman tests for the pH level and the Kruskal-Wallis and Dunn tests for the biological analysis (p0.05. For the inflammatory infiltrates, no significant statistical differences were found among the groups in each period (p>0.05. The 15% WPC showed a significant decrease of the inflammatory infiltrate from 15 to 30 and 60 days (p<0.05. Conclusions: The addition of bismuth oxide into Portland cement did not affect the pH level and the biological response. The concentration of 15% of bismuth oxide resulted in significant reduction in inflammatory response in comparison with the other concentrations evaluated.

  5. Design and Research on Auto-vending Machine for Cupped Beverage

    Directory of Open Access Journals (Sweden)

    Xiaowei Jiang

    2014-12-01

    Full Text Available The aim of this research is to design an auto-vending machine for cupped beverage, specifically researching its working principle, the design of beverage powder transporting mechanism, paper cups detaching mechanism and paper cups slide mechanism. The article elaborates that the design of beverage powder transporting mechanism is mainly the selection of electromagnet and the determination of electromagnet stroke, requiring that the electromagnet stroke and the maximum weight that the electromagnet could bear should have rationality, to ensure its safe operation; the design of paper cups detaching mechanism mainly includes selecting electric motor and V belt; the design of paper cups slide mechanism includes the design of slide structure and the force analysis when the paper cup slides on the slide. And then the working principle and working process of the auto-vending machine for cupped beverage is introduced, based on which the conclusion has been reached.

  6. Cements in Radioactive Waste Disposal

    International Nuclear Information System (INIS)

    The use of cement and concrete to immobilise radioactive waste is complicated by the wide- ranging nature of inorganic cementing agents available as well as the range of service environments in which cement is used and the different functions expected of cement. For example, Portland cement based concretes are widely used as structural materials for construction of vaults and tunnels. These constructions may experience a long pre-closure performance lifetime during which they are required to protect against collapse and ingress of water: strength and impermeability are key desirable characteristics. On the other hand, cement and concrete may be used to form backfills, ranging in permeability. Permeable formulations allow gas readily to escape, while impermeable barriers retard radionuclide transport and reduce access of ground water to the waste. A key feature of cements is that, while fresh, they pass through a fluid phase and can be formed into any shape desired or used to infiltrate other materials thereby enclosing them into a sealed matrix. Thereafter, setting and hardening is automatic and irreversible. Where concrete is used to form structural elements, it is also natural to use cement in other applications as it minimises potential for materials incompatibility. Thus cement- mainly Portland cement- has been widely used as an encapsulant for storage, transport and as a radiation shield for active wastes. Also, to form and stabilise structures such as vaults and silos. Relative to other potential matrices, cement also has a chemical immobilisation potential, reacting with and binding with many radionuclides. The chemical potential of cements is essentially sacrificial, thus limiting their performance lifetime. However performance may also be required in the civil engineering sense, where strength is important, so many factors, including a geochemical description of service conditions, may require to be assessed in order to predict performance lifetime. The

  7. Cement/slag chemistry studies

    International Nuclear Information System (INIS)

    The performance of cement-based matrices intended for radwaste immobilization is assessed. The long-term performance of the matrix is characterized by thermodynamic evaluation of experimental data. The results are presented in a general form, amenable to a range of specific formulations. The interaction of specific radwaste components with cements has been studied, using Iodine as an example. It occurs as both I- and IO3- species, but these differ sharply in sorption characteristics. The effect of ionizing radiation of the pH and Eh of cement matrices is reported. (author)

  8. Poly(ethylene oxide) functionalization

    Energy Technology Data Exchange (ETDEWEB)

    Pratt, Russell Clayton

    2014-04-08

    A simple procedure is provided by which the hydroxyl termini of poly(ethylene oxide) can be appended with functional groups to a useful extent by reaction and precipitation. The polymer is dissolved in warmed toluene, treated with an excess of organic base and somewhat less of an excess of a reactive acylating reagent, reacted for several hours, then precipitated in isopropanol so that the product can be isolated as a solid, and salt byproducts are washed away. This procedure enables functionalization of the polymer while not requiring laborious purification steps such as solvent-solvent extraction or dialysis to remove undesirable side products.

  9. Phasenverhalten von Polyethylen in Mischsystemen

    OpenAIRE

    Schnell, Matthias

    2003-01-01

    Die vorliegende Arbeit beschäftigt sich mit dem Phasenverhalten von Polyethylen (PE) in nicht-reaktiven und in reaktiven Systemen. Von drei eng verteilten Polyethylenen (Mw = 6,4, 82 bzw. 380 kg/mol) in n-Hexan sowie für das System 2,2-Dimethylbutan / PE 82 wurde die Entmischung in Abhängigkeit von der Zusammensetzung, dem Druck und der Temperatur experimentell bestimmt. Die Modellierung der Trübungskurven erfolgte nach der Theorie von Sanchez und Lacombe. Dieser Ansatz beschreibt die Ergebni...

  10. Cementing porcelain-fused-to-metal crowns.

    Science.gov (United States)

    Vadachkoria, D

    2009-12-01

    The clinical success of fixed prosthodontic restorations can be complex and involve multifaceted procedures. Preparation design, oral hygiene/micro flora, mechanical forces, and restorative materials are only a few of the factors which contribute to overall success. One key factor to success is choosing the proper cement. Popular use of cements for PFM crowns has shifted from zinc phosphate and glass ionomer cements to resin-reinforced glass ionomer, or RRGI, cements. This change has been rapid and profound. Dental cements have always been less than ideal materials, but this is shift to the relatively new RRGI category justified. Resin-reinforced glass ionomer (RRGI) cements appear to be better than zinc phosphate and glass ionomer cements when placing porcelain-to-metal crowns. RRGI cements, such as RelyX Luting, Fuji Plus and Vitremer Luting Cement, satisfy more of the ideal characteristics of PFM cementation than any other previous cement. Expansion of all three cements has not caused any apparent problems with the cements when used with PFM or metal crowns, but these cements, however, should be avoided when cementing all-ceramic crowns. PMID:20090144

  11. Assessment of Natural Radioactivity Levels of Cements and Cement Composites in the Slovak Republic

    OpenAIRE

    Adriana Eštoková; Lenka Palaščáková

    2013-01-01

    The radionuclide activities of 226Ra, 232Th and 40K and radiological parameters (radium equivalent activity, gamma and alpha indices, the absorbed gamma dose rate and external and internal hazard indices) of cements and cement composites commonly used in the Slovak Republic have been studied in this paper. The cement samples of 8 types of cements from Slovak cement plants and five types of composites made from cement type CEM I were analyzed in the experiment. The radionuclide activities in t...

  12. Assessment of the compatibility of wood and plastic with cement for their recycling in cement composites

    OpenAIRE

    Andrade, André De; Caldeira, Fernando

    2010-01-01

    The compatibility between maritime pine wood and cement, and between plastic (LDPE) and cement, was assessed for the recycling of wood and plastic in cement composites. Temperature vs. time profiles of cement setting were registered and compatibility indices were calculated. Results indicate that recycling of plastics in plastic-cement composites does not pose any questions regarding chemical compatibility. However, maritime pine hinders cement setting in some extent. So, in or...

  13. HYMNOGRAPHIC TRADITION IN IVAN SHMELEV'S SHORT NOVEL "THE INEXHAUSTIBLE CUP"

    Directory of Open Access Journals (Sweden)

    Nikolay Ivanovich Sobolev

    2013-11-01

    Full Text Available The article examines the influence of the Orthodox hymnography on Ivan Shmelev's works, using his short novel The Inexhaustible Cup as an example. The author analyzes the hymnographic level of the novel; identifies specific features of adapting liturgical poetry to the literary (fiction text; defines the functionality of liturgical texts in the ideological and thematic, as well as imaginative and motive structure of a literary work. Comparative analysis shows that novel's poetic attributes are similar to theological terminological metaphors typical for hymnography. Moreover, the content plane of The Inexhaustible Cup, due to the semantic parallelism with Akathist and, more broadly, with the hymnographic tradition, forms the Christian dogmatic metatext, which can be called Being in Christ. This enables the reader to identify intuitively Shmelev's novel as a piece of writing, related to poetic and didactic Christian texts in its spirit and language.

  14. World Cup 2014 – Professional Training Program for Brazilian Hotels

    Directory of Open Access Journals (Sweden)

    Silvone Alves Assis

    2011-08-01

    Full Text Available This paper presents an experience of implementing a professional training program for the Brazilian hospitality industry in the 12 cities that will be the headquarters of the World Cup in 2014. This project was developed in the context of the program “Welcoming Cup”, of the Brazilian Ministry of Tourism, whose objective is to enable the tourism industry to attain international standards of quality in tourism services.

  15. Mechanisms of suppressing cup-burner flame with water vapor

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The mechanisms of suppressing a laminar methane-air co-flow diffusion flame formed on a cup burner with water vapor have been studied experimentally and numerically. The methane burned in a steel cup surrounded by a glass chimney. A mist generator produced fine droplets delivered though the glass chimney with air. These droplets were heated into water vapor when they went though the diffuser. The extinguishing limit was obtained by gradually increasing the amount of water vapor to replace the air in the coflowing oxidizer stream. Results showed that the agent concentration required for extinguishment was constant over a wide range of the oxidizer velocity, i.e., a so-called "plateau region". The measured extinguishing mass fractions of the agents were: (16.7 ± 0.6)% for H2O, (15.9 ± 0.6)% for CO2, and (31.9 ± 0.6)% for N2. The computation used the Fire Dynamics Simulator (FDS) de- veloped by the NIST. The numerical simulations showed that the predicted water vapor extinguishing limits and the flickering frequency were in good agreements with the experimental observations and, more importantly, revealed that the sup- pression of cup-burner flames occurred via a partial extinction mechanism (in which the flame base drifts downstream and then blows off) rather than the global extinction mechanism of typical counter-flow diffusion flames. And the flame-base oscillation just before the blow-off was the key step for the non-premixed flame extinction in the cup burner.

  16. Mechanisms of suppressing cup-burner flame with water vapor

    Institute of Scientific and Technical Information of China (English)

    CONG BeiHua; LIAO GuangXuan

    2008-01-01

    The mechanisms of suppressing a laminar methane-air co-flow diffusion flame formed on a cup burner with water vapor have been studied experimentally and numerically. The methane burned in a steel cup surrounded by a glass chimney. A mist generator produced fine droplets delivered though the glass chimney with air. These droplets were heated into water vapor when they went though the diffuser. The extinguishing limit was obtained by gradually increasing the amount of water vapor to replace the air in the coflowing oxidizer stream. Results showed that the agent concentration required for extinguishment was constant over a wide range of the oxidizer velocity, i.e., a so-called "plateau region". The measured extinguishing mass fractions of the agents were: (16.7±0.6)% for H2O, (15.9±0.6)% for CO2, and (31.9±0.6)% for N2. The computation used the Fire Dynamics Simulator (FDS) de-veloped by the NIST. The numerical simulations showed that the predicted water vapor extinguishing limits and the flickering frequency were in good agreements with the experimental observations and, more importantly, revealed that the sup-pression of cup-burner flames occurred via a partial extinction mechanism (in which the flame base drifts downstream and then blows off) rather than the global extinction mechanism of typical counter-flow diffusion flames. And the flame-base oscillation just before the blow-off was the key step for the non-premixed flame extinction in the cup burner.

  17. HYMNOGRAPHIC TRADITION IN IVAN SHMELEV'S SHORT NOVEL "THE INEXHAUSTIBLE CUP"

    OpenAIRE

    Nikolay Ivanovich Sobolev

    2013-01-01

    The article examines the influence of the Orthodox hymnography on Ivan Shmelev's works, using his short novel The Inexhaustible Cup as an example. The author analyzes the hymnographic level of the novel; identifies specific features of adapting liturgical poetry to the literary (fiction) text; defines the functionality of liturgical texts in the ideological and thematic, as well as imaginative and motive structure of a literary work. Comparative analysis shows that novel's poetic attributes a...

  18. Brazilian World cup 2014: Terrorism, tourism, and social conflict

    OpenAIRE

    Tzanelli, R; Korstanje, M.; Clayton, A

    2014-01-01

    The World cup transcends the interests of culture and nations worldwide. Every 4 years, delegations from the four corners of the world compete for a month. The mass tourist demand an event of this caliber generates prompts policy makers and tourism scholars to devote considerable time in planning in detail the infrastructure and service industry for the benefit of incomers. Unfortunately, in areas of the world plagued by political instability, some groups may use the media events to communica...

  19. The microwave absorption of ceramic-cup microwave ion source

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    An experiment system of ceramic-cup microwave ion source has been built here. Its microwave absorption efficiency as a function of the magnetic field and the pressure is presented. When the microwave incident power is 300~500W the microwave absorption efficiencies are more than 90% if the system is optimized and the magnetic field at the microwave window is 0.095T.

  20. Amylase polymorphism affects growth in the cupped oyster Crassostrea gigas

    OpenAIRE

    Huvet, Arnaud; Samain, Jean-francois; Boudry, Pierre; Bedier, Edouard; Ropert, Michel; Van Wormhoudt, A

    2005-01-01

    The better understanding of physiological and environmental factors that determine optimal food conversion efficiencies is of major interest for the cupped oyster Crassostrea gigas for which the strong increase of aquaculture has been correlated in France with a decrease in productivity due to competition between aquatic species for limited food supplies at grow-out sites. To investigate the non-neutrality of the polymorphism of amylase, a key enzyme for carbohydrate assimilation, in oyster p...

  1. Does it pay to win the Stanley Cup?

    OpenAIRE

    Derek Lanoue

    2015-01-01

    Yes, it does indeed pay to win the Stanley Cup (SC). Professional sports offer a unique opportunity to examine the relationship between a player’s salary and their performance. Salary statistics have become widely available and enable individual performance scrutiny in relation to remuneration level. There is an extensive literature explaining which factors in‡uence the players’ salary in the National Hockey League (NHL), using data sets from different seasons and including various performanc...

  2. Sphere anemometer - a faster alternative solution to cup anemometry

    Science.gov (United States)

    Hölling, M.; Schulte, B.; Barth, S.; Peinke, J.

    2007-07-01

    We present an anemometer technique characterized by an instrument in a sealed enclosure without moving parts. Measurements taken with our improved sphere anemometer in comparison to cup anemometer and hot-wire anemometer data subjected to wind gusts are discussed. The hot-wire anemometer serves as a reference with high temporal and spacial resolution. A manually driven "gust generator" produced gusts at low frequencies of about 1Hz. All measurements were carried out in the wind tunnel at the University of Oldenburg.

  3. From Tonic-cups to Bitter-cups: Kwasi bita beker from Suriname Determination, past and present use of an ancient galenic artefact.

    Science.gov (United States)

    Odonne, G; Bourdy, G; Beauchêne, J; Houël, E; Stien, D; Chevolot, L; Deharo, E

    2007-03-21

    In the main markets of Paramaribo (Suriname), many stands offer what is locally called "Bitter-cups", or "Kwasi bita beker", small footed-cups, roughly carved from a whitish wood. The use of these cups is strictly medicinal and it seems to be restricted to Suriname, as they are not found in neighbouring countries (Guyana, French Guiana). The aim of this study was to identify the botanical origin of Bitter-cups still in use in the Saramaka traditional medicine (as information from field people was controversial), and document the ethnopharmacology of this original galenical artefact. Microscopic and high performance liquid chromatography (HPLC) analyses were carried out on Bitter-cup, and anatomical criteria (marginal parenchyma band, size of intervessel and vessel-ray pits, rays width and rays composition, vessels clustering, frequency and size of parenchyma pits) together with HPLC profiles of the macerates showed that the wood cup was similar to Quassia amara L. (Simaroubaceae) wood. Ethnopharmacological investigation indicates that the use of these cups is simply due to the pharmacological properties attributed to "bitters", and is strongly linked to tradition and cultural attitudes. This study also emphasizes the long lasting use of these cups, now restricted to Suriname only, with almost no variation over one century.

  4. Reaction of rat subcutaneous tissue to mineral trioxide aggregate and Portland cement: A secondary level biocompatibility test

    Directory of Open Access Journals (Sweden)

    P Karanth

    2013-01-01

    Full Text Available Objectives: This secondary-level animal study was conducted to assess and compare the subcutaneous tissue reaction to implantation of white mineral trioxide aggregate (MTA and white Portland cement. Study Design: Polyethylene tubes filled with either freshly mixed white MTA (Group I or white Portland cement (Group II were implanted subcutaneously into 12 Wistar Albino rats. Each animal also received an empty polyethylene tube as the control (Group III. After 7, 14, 21 and 30 days, the implants, together with surrounding tissues were excised. Two pathologists blinded to the experimental procedure, evaluated sections taken from the biopsy specimens for the severity of the inflammatory response, calcification and the presence and thickness of fibrous capsule surrounding the implant. Statistical analysis was performed using the Cross-tabs procedure, Univariate analysis of the variance two-way and the Pearson product moment correlation to assess inter-rater variability between the two evaluators. Results: At 7 days, there was no significant difference in the severity of inflammation between the control group, white MTA, and white Portland cement groups. In the 14 day, 21 day and 30 day test periods, control group had significantly less inflammation than white MTA and white Portland cement. There was no significant difference in the grading of inflammation between white MTA and white Portland cement. All materials exhibited thick capsule at 7 days and thin capsule by 30 days. Conclusion: Both white MTA and white Portland cement were not completely non-irritating at the end of 30 days as evidenced by the presence of mild inflammation. However, the presence of a thin capsule around the materials, similar to the control group, indicates good tissue tolerance. White MTA and white Portland cement seem to be materials of comparable biocompatibility.

  5. Technology development for the Solar Probe Plus Faraday Cup

    Science.gov (United States)

    Freeman, Mark D.; Kasper, Justin; Case, Anthony W.; Daigneau, Peter; Gauron, Thomas; Bookbinder, Jay; Brodu, Étienne; Balat-Pichelin, Marianne; Wright, Kenneth

    2013-09-01

    The upcoming Solar Probe Plus (SPP) mission requires novel approaches for in-situ plasma instrument design. SPP's Solar Probe Cup (SPC) instrument will, as part of the Solar Wind Electrons, Alphas, and Protons (SWEAP) instrument suite, operate over an enormous range of temperatures, yet must still accurately measure currents below 1 pico-amp, and with modest power requirements. This paper discusses some of the key technology development aspects of the SPC, a Faraday Cup and one of the few instruments on SPP that is directly exposed to the solar disk, where at closest approach to the Sun (less than 10 solar radii (Rs) from the center of the Sun) the intensity is greater than 475 earth-suns. These challenges range from materials characterization at temperatures in excess of 1400°C to thermal modeling of the behavior of the materials and their interactions at these temperatures. We discuss the trades that have resulted in the material selection for the current design of the Faraday Cup. Specific challenges include the material selection and mechanical design of insulators, particularly for the high-voltage (up to 8 kV) grid and coaxial supply line, and thermo-optical techniques to minimize temperatures in the SPC, with the specific intent of demonstrating Technology Readiness Level 6 by the end of 2013.

  6. Energy balance and dietary habits of America's Cup sailors.

    Science.gov (United States)

    Bernardi, Elisabetta; Delussu, Sofia A; Quattrini, Filippo M; Rodio, Angelo; Bernardi, Marco

    2007-08-01

    This research, which was conducted with crew members of an America's Cup team, had the following objectives: (a) to assess energy expenditure and intake during training; (b) to evaluate the sailors' diet, and (c) to identify any dietary flaws to determine the appropriate intake of nutrients, correct possible dietary mistakes, and improve their food habits. Energy expenditure was estimated on 15 sailors using direct measurements (oxygen consumption) and a 3-day activity questionnaire. Oxygen consumption was measured on sailors during both on-water America's Cup sailing training and dry-land fitness training. Composition of the diet was estimated using a 3-day food record. Average daily energy expenditure of the sailors ranged from 14.95 to 24.4 MJ, depending on body mass and boat role, with the highest values found in grinders and mastmen. Daily energy intake ranged from 15.7 to 23.3 MJ (from +6% to -18% of energy expenditure). The contributions of carbohydrate, protein, and fat to total energy intake were 43%, 18%, and 39% respectively, values that are not in accord with the recommended guidelines for athletes. Our results show the importance of assessing energy balance and food habits for America's Cup sailors performing different roles. The practical outcome of this study was that the sailors were given dietary advice and prescribed a Mediterranean diet, explained in specific nutrition lectures. PMID:17613739

  7. Manufacture and properties of fluoride cement

    Science.gov (United States)

    Malata-Chirwa, Charles David

    This research work aimed at characterising composition, hydration and physical properties of fluoride cement, by studying samples of the cement obtained from Malawi, and comparing them to ordinary Portland cement. By confirming the suitable characteristics of fluoride cement through this work, the results of the research work provide a good basis for the wider adoption of fluoride cement as an alternative to ordinary Portland cement, especially in developing economies. Numerous accounts have been cited regarding the production and use of fluoride cement. Since there have not been conclusive agreement as to its properties, this study was limited to the theories of successful incorporation of fluoride compounds in the manufacture of fluoride cement. Hence, the properties and characteristics reported in this study relate to the cement currently manufactured in Malawi, and, on a comparative basis only, to that manufactured in other parts of the world. Samples of the fluoride cement used in the study were obtained by synthetic manufacture of the cement using common raw materials for the manufacture of fluoride cement that is limestone, silica sand, and fluorspar. These samples were subjected to several comparative tests used to characterise cements including examination under x-ray diffractometer, scanning electron microscopy and tests for setting time and compressive strength. Under similar laboratory conditions, it was possible to prove that fluoride cement hardens more rapidly than ordinary Portland cement. Also observed during the experimental work is that fluoride cement develops higher compressive strengths than ordinary Portland cement. The hardening and setting times are significantly different between the two cements. Also the nature of the hydration products, that is the microstructural development is significantly different in the two cements. The differences brought about between the two cements are because of the presence of fluorine during the clinkering

  8. Low pH Cements

    Energy Technology Data Exchange (ETDEWEB)

    Savage, David; Benbow, Steven [Quintessa Ltd., Henley-on-Thames (United Kingdom)

    2007-05-15

    The development of low-pH cements for use in geological repositories for radioactive waste stems from concerns over the potential for deleterious effects upon the host rock and other EBS materials (notably bentonite) under the hyperalkaline conditions (pH > 12) of cement pore fluids. Low pH cement (also known as low heat cement) was developed by the cement industry for use where large masses of cement (e.g. dams) could cause problems regarding heat generated during curing. In low pH cements, the amount of cement is reduced by substitution of materials such as fly ash, blast furnace slag, silica fume, and/or non-pozzolanic silica flour. SKB and Posiva have ruled out the use of blast furnace slag and fly-ash and are focusing on silica fume as a blending agent. Currently, no preferred composition has been identified by these agencies. SKB and Posiva have defined a pH limit {<=} 11 for cement grout leachates. To attain this pH, blending agents must comprise at least 50 wt % of dry materials. Because low pH cement has little, or no free portlandite, the cement consists predominantly of calcium silicate hydrate (CSH) gel with a Ca/Si ratio {<=} 0.8. Although there are potential implications for the performance of the spent fuel and cladding due to the presence of hyperalkaline fluids from cement, the principal focus for safety assessment lies with the behaviour of bentonite. There are a number of potential constraints on the interaction of hyperalkaline cement pore fluids with bentonite, including mass balance, thermodynamic issues, mass transport, and kinetics, but none of these is likely to be limiting if conventional OPC cements are employed in repository construction. Nevertheless: Low-pH cements may supply approximately 50 % less hydroxyl ions than conventional OPC for a given volume of cement, but mass balance constraints are complicated by the uncertainty concerning the type of secondary minerals produced during cement-bentonite interaction. The change of aqueous

  9. Properties of Polyethylene Naphthalate Track Membranes

    CERN Document Server

    Akimenko, S N; Orelovich, O L; Maekawa, J; Ioshida, M; Apel, P Yu

    2002-01-01

    Basic characteristics of track membranes made of polyethylene naphthalate (which is a polyester synthesized from dimethyl naphthalate and ethylene glycol) are studied and presented. Polyethylene naphthalate possesses some properties (mechanical strength, thermal and chemical stability), which make this polymer a promising material for the production of track membranes. Water flow rate and air flow rate characteristics, burst strength, wettability, and amount of extractables are determined. Surface structure and pore structure are examined using scanning electron microscopy. It is found that the pores in the membranes are cylindrical in shape. The measured water and air flow rates follow known theoretical relations for the transport in narrow capillaries. The burst strength of polyethylene naphthalate membranes is found to be similar to that of polyethylene terephthalate track membranes. Polyethylene naphthalate track membranes can be categorized as moderately hydrophilic. Being treated with boiling water, pol...

  10. Cementation of Loose Sand Particles based on Bio-cement

    Institute of Scientific and Technical Information of China (English)

    RONG Hui; QIAN Chunxiang

    2014-01-01

    Loose sand particles could be cemented to sandstone by bio-cement (microbial induced magnesium carbonate). The bio-sandstone was firstly prepared, and then the compressive strength and the porosity of the sandstone cemented by microbial induced magnesium carbonate were tested to characterize the cementation effectiveness. In addition, the formed mineral composition and the microstructure of bio-sandstone were analyzed by X-ray diffraction (XRD) and scanning electron microscopy (SEM), respectively. The experimental results show that the feasibility of binding loose sand particles using microbial induced magnesium carbonate precipitation is available and the acquired compressive strength of bio-sandstone can be excellent at certain ages. Moreover, the compressive strength and the porosity could be improved with the increase of microbial induced magnesium carbonate content. XRD results indicate that the morphology of magnesium carbonate induced by microbe appears as needles and SEM results show that the cementation of loose sand particles to sandstone mainly relies on the microbial induced formation of magnesium carbonate precipitation around individual particles and at particle-particle contacts.

  11. Molecular deformation mechanisms in polyethylene

    CERN Document Server

    Coutry, S

    2001-01-01

    adjacent labelled stems is significantly larger when the DPE guest is a copolymer molecule. Our comparative studies on various types of polyethylene lead to the conclusion that their deformation behaviour under drawing has the same basis, with additional effects imputed to the presence of tie-molecules and branches. Three major points were identified in this thesis. The changes produced by drawing imply (1) the crystallisation of some of the amorphous polymer and the subsequent orientation of the newly formed crystals, (2) the re-orientation of the crystalline ribbons and (3) the beginning of crystallite break-up. However, additional effects were observed for the high molecular weight linear sample and the copolymer sample and were attributed, respectively, to the presence of tie-molecules and of branches. It was concluded that both the tie-molecules and the branches are restricting the molecular movement during deformation, and that the branches may be acting as 'anchors'. This work is concerned with details...

  12. 21 CFR 888.3027 - Polymethylmethacrylate (PMMA) bone cement.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Polymethylmethacrylate (PMMA) bone cement. 888... Polymethylmethacrylate (PMMA) bone cement. (a) Identification. Polymethylmethacrylate (PMMA) bone cement is a device...: Polymethylmethacrylate (PMMA) Bone Cement.”...

  13. Accuracy and Precision of Three-Dimensional Low Dose CT Compared to Standard RSA in Acetabular Cups: An Experimental Study

    Directory of Open Access Journals (Sweden)

    Cyrus Brodén

    2016-01-01

    Full Text Available Background and Purpose. The gold standard for detection of implant wear and migration is currently radiostereometry (RSA. The purpose of this study is to compare a three-dimensional computed tomography technique (3D CT to standard RSA as an alternative technique for measuring migration of acetabular cups in total hip arthroplasty. Materials and Methods. With tantalum beads, we marked one cemented and one uncemented cup and mounted these on a similarly marked pelvic model. A comparison was made between 3D CT and standard RSA for measuring migration. Twelve repeated stereoradiographs and CT scans with double examinations in each position and gradual migration of the implants were made. Precision and accuracy of the 3D CT were calculated. Results. The accuracy of the 3D CT ranged between 0.07 and 0.32 mm for translations and 0.21 and 0.82° for rotation. The precision ranged between 0.01 and 0.09 mm for translations and 0.06 and 0.29° for rotations, respectively. For standard RSA, the precision ranged between 0.04 and 0.09 mm for translations and 0.08 and 0.32° for rotations, respectively. There was no significant difference in precision between 3D CT and standard RSA. The effective radiation dose of the 3D CT method, comparable to RSA, was estimated to be 0.33 mSv. Interpretation. Low dose 3D CT is a comparable method to standard RSA in an experimental setting.

  14. Accuracy and Precision of Three-Dimensional Low Dose CT Compared to Standard RSA in Acetabular Cups: An Experimental Study

    Science.gov (United States)

    Olivecrona, Henrik; Maguire, Gerald Q.; Noz, Marilyn E.; Zeleznik, Michael P.

    2016-01-01

    Background and Purpose. The gold standard for detection of implant wear and migration is currently radiostereometry (RSA). The purpose of this study is to compare a three-dimensional computed tomography technique (3D CT) to standard RSA as an alternative technique for measuring migration of acetabular cups in total hip arthroplasty. Materials and Methods. With tantalum beads, we marked one cemented and one uncemented cup and mounted these on a similarly marked pelvic model. A comparison was made between 3D CT and standard RSA for measuring migration. Twelve repeated stereoradiographs and CT scans with double examinations in each position and gradual migration of the implants were made. Precision and accuracy of the 3D CT were calculated. Results. The accuracy of the 3D CT ranged between 0.07 and 0.32 mm for translations and 0.21 and 0.82° for rotation. The precision ranged between 0.01 and 0.09 mm for translations and 0.06 and 0.29° for rotations, respectively. For standard RSA, the precision ranged between 0.04 and 0.09 mm for translations and 0.08 and 0.32° for rotations, respectively. There was no significant difference in precision between 3D CT and standard RSA. The effective radiation dose of the 3D CT method, comparable to RSA, was estimated to be 0.33 mSv. Interpretation. Low dose 3D CT is a comparable method to standard RSA in an experimental setting. PMID:27478832

  15. Accuracy and Precision of Three-Dimensional Low Dose CT Compared to Standard RSA in Acetabular Cups: An Experimental Study.

    Science.gov (United States)

    Brodén, Cyrus; Olivecrona, Henrik; Maguire, Gerald Q; Noz, Marilyn E; Zeleznik, Michael P; Sköldenberg, Olof

    2016-01-01

    Background and Purpose. The gold standard for detection of implant wear and migration is currently radiostereometry (RSA). The purpose of this study is to compare a three-dimensional computed tomography technique (3D CT) to standard RSA as an alternative technique for measuring migration of acetabular cups in total hip arthroplasty. Materials and Methods. With tantalum beads, we marked one cemented and one uncemented cup and mounted these on a similarly marked pelvic model. A comparison was made between 3D CT and standard RSA for measuring migration. Twelve repeated stereoradiographs and CT scans with double examinations in each position and gradual migration of the implants were made. Precision and accuracy of the 3D CT were calculated. Results. The accuracy of the 3D CT ranged between 0.07 and 0.32 mm for translations and 0.21 and 0.82° for rotation. The precision ranged between 0.01 and 0.09 mm for translations and 0.06 and 0.29° for rotations, respectively. For standard RSA, the precision ranged between 0.04 and 0.09 mm for translations and 0.08 and 0.32° for rotations, respectively. There was no significant difference in precision between 3D CT and standard RSA. The effective radiation dose of the 3D CT method, comparable to RSA, was estimated to be 0.33 mSv. Interpretation. Low dose 3D CT is a comparable method to standard RSA in an experimental setting. PMID:27478832

  16. Research on Design Method of Intelligent Vending Machine for Cupped Beverage

    Directory of Open Access Journals (Sweden)

    Xiaowei Jiang

    2014-09-01

    Full Text Available The purpose of this study is to design an intelligent vending machine for cupped beverage, specifically researching its humanized design, shape design, color design and the main mechanism design including the beverage powder transporting mechanism, paper cups detaching mechanism and paper cups slide mechanism. The study elaborates that the design of beverage powder transporting mechanism is mainly the selection of electromagnet and the determination of electromagnet stroke, requiring that the electromagnet stroke and the maximum weight that the electromagnet could bear should have rationality, to ensure its safe operation; the design of paper cups detaching mechanism mainly includes selecting electric motor and V belt; the design of paper cups slide mechanism mainly presents the design of slide structure. And then the design of control modules of the intelligent vending machine for cupped beverage is introduced, based on which the conclusion has been reached.

  17. Fracture strength of endodontically treated teeth reconstructed with woven polyethylene fiber posts and biological posts

    Directory of Open Access Journals (Sweden)

    Kátia Rodrigues Reis

    2009-01-01

    Full Text Available Objective: To investigate the fracture strength and mode of endodontically treated teeth with structurally weakened roots reconstructed with woven polyethylene fiber posts and biological posts. Methods: After removing the crowns, 60 endodontically treated maxillary canines were distributed into 4 groups: 1 conventional root canal preparation and reconstruction with polyethylene fiber posts; 2 conventional root canal preparation and reconstruction with biological posts; 3 moderately flared root canals and reconstruction with biological posts; 4 widely flared root canals and reconstruction with biological posts. The posts were cemented with resin cement Enforce (Dentsply Ind. e Com., Petrópolis, Rio de Janeiro, Brasil and the core was constructed with Ti-Core (EssentialDental Systems, S. Hackensack, NJ, USA resin composite. The specimens were tested under compression in a universal testing machine. Results: The following fracture strength values were obtained: Group 1 – 45.46kgf; Group 2 – 53.30kgf; Group 3 – 58.67kgf; Group 4 – 47.91kgf, with statistically significant differences between Groups 1 and 3 (p<0.05. The following fracture modes were observed: Group 1 – predominance of fracture of the coronal portion of the post; Groups 2 and 3 – various fracture patterns; Group 4 – all roots fractured. Conclusion: Both posts were shown to be promising (adequate fracture strength and favorable pattern of fracture. Biological posts appear to be capable of reinforcing the root to some extent; however, fracture occured in all roots with widely flared root canals.

  18. The concentric all-polyethylene Exeter acetabular component in primary total hip replacement.

    Science.gov (United States)

    Veitch, S W; Whitehouse, S L; Howell, J R; Hubble, M J W; Gie, G A; Timperley, A J

    2010-10-01

    We report the outcome of the flangeless, cemented all-polyethylene Exeter acetabular component at a mean of 14.6 years (10 to 17) after operation. Of the 263 hips in 243 patients, 122 prostheses are still in situ; 112 patients (119 hips) have died, 18 hips have been revised, and three patients (four hips) were lost to follow-up. Radiographs at the final review were available for 110 of the 122 surviving hips. There were acetabular radiolucent lines in 54 hips (49%). Two acetabular components had migrated but neither patient required revision. The Kaplan-Meier survivorship at 15 years with 61 hips at risk with revision for any cause as the endpoint was 89.9% (95% confidence interval (CI) 84.6 to 95.2) and for aseptic loosening of the acetabular component or lysis 91.7% (95% CI 86.6 to 96.8). In 210 hips with a diagnosis of primary osteoarthritis, survivorship with revision for any cause as the endpoint was 93.2% (95% CI 88.1 to 98.3), and for aseptic loosening of the acetabular component 95.0% (95% CI 90.3 to 99.7). The cemented all-polyethylene Exeter acetabular component has an excellent long-term survivorship.

  19. Primary structure and transcription of an amplified genetic locus: the CUP1 locus of yeast.

    OpenAIRE

    Karin, M; Najarian, R; Haslinger, A; Valenzuela, P; Welch, J; Fogel, S

    1984-01-01

    Copper resistance in yeast is controlled by the CUP1 locus. The level of resistance is proportional to the copy number of this locus, which can be found in up to 15 tandemly iterated copies. To elucidate the molecular mechanisms controlling the amplification and expression of the CUP1, locus, we determined its full nucleotide sequence. We have also identified and mapped two transcription units within the basic amplification unit of CUP1 in laboratory yeast strains. One of those transcription ...

  20. Design and Research on Auto-vending Machine for Cupped Beverage

    OpenAIRE

    Xiaowei Jiang; Yonghong Sun

    2014-01-01

    The aim of this research is to design an auto-vending machine for cupped beverage, specifically researching its working principle, the design of beverage powder transporting mechanism, paper cups detaching mechanism and paper cups slide mechanism. The article elaborates that the design of beverage powder transporting mechanism is mainly the selection of electromagnet and the determination of electromagnet stroke, requiring that the electromagnet stroke and the maximum weight that the electrom...

  1. Research on Design Method of Intelligent Vending Machine for Cupped Beverage

    OpenAIRE

    Xiaowei Jiang

    2014-01-01

    The purpose of this study is to design an intelligent vending machine for cupped beverage, specifically researching its humanized design, shape design, color design and the main mechanism design including the beverage powder transporting mechanism, paper cups detaching mechanism and paper cups slide mechanism. The study elaborates that the design of beverage powder transporting mechanism is mainly the selection of electromagnet and the determination of electromagnet stroke, requiring that the...

  2. Qualidade da bebida do café Icatu Coffee cup quality - cup quality variabiltty in the Icatu cultivar

    Directory of Open Access Journals (Sweden)

    L. C. Fazuoli

    1977-01-01

    Full Text Available Analisaram-se as características da bebida de alguns cafeeiros híbridos (Coffea arabica x C. canephora que deram origem ao icatu, e de plantas pertencentes a nove populações deste cultivar. A qualidade da bebida dos cafeeiros originais mostrou-se semelhante à do arábica, variando de "mole" a "apenas mole". Nas populações de icatu foram efetuadas 1953 determinações. Verificou-se que a bebida não difere daquela produzida pelo cultivar acaiá (C. arabica, tomada como padrão. Em escala de cinco pontos, 63 (3,2% determinações deram bebida "dura" e 1324 (67,8%, "mole", enquanto o acaiá apresentou bebida "mole". Na escala de 10 pontos o número 3 foi dado a nove determinações (0,5% e o máximo de nove pontos a 677 (34,6%, sendo de 7,7 a média de pontos conferida ao acaiá. Verificou-se que as populações H 3849-7, H 3851-4 e H 4782-7 apresentaram médias de pontos mais elevadas e que as populações H 3849-14-2 e H 3849-14-3 deram as menores médias, nas duas escalas de valores. As populações examinadas não diferem do acaiá quanto à qualidade da bebida, podendo ser utilizadas comercialmente.Cup quality determination was undertaken for a group of coffee seed samples of interespecific (Coffea arabica x C. canephora trees, which gave rise to the Icatu cultivar and also for nine Icatu coffee populations. The original hybrid plants showed cup quality similar to the Arabica control, with exception of one single plant which gave lower quality. For these populations a total of 1953 cup quality determinations were made by three independent coffee drinker experts. Two scale ranking from 0-5 and 1-10 were used for the evaluation. It was verified that the average grades of each one of the nine Icatu populations did not differ from the Arabica. In the scale (0-5 the grade "Hard" occurred in 63 determinations (3.2% an the "Soft" cup quality in 1324 determinations (67.8%. In the 10 points scale 3 points were attributed to nine determinations

  3. Qualidade da bebida do café: efeito do acondicionamento e do tempo de conservação Coffee cup quality: effect of storage time

    Directory of Open Access Journals (Sweden)

    A. A. Teixeira

    1977-01-01

    Full Text Available O efeito do tempo de armazenamento sobre a qualidade da bebida de café do cultivar mundo novo de Coffea arabica foi estudado em Campinas, no período de junho de 1974 a março de 1976. Planejou-se o delineamento em blocos ao acaso para as amostras, sendo analisada a bebida do café despolpado e beneficiado conservado em latas hermeticamente fechadas, em sacos de plástico, de aniagem, de tecido de algodão e de papel. Para os testes de bebida adotou-se o delineamento de blocos ao acaso. Três séries de amostras foram retiradas 5, 16 e 21 meses, após o inicio do experimento e analisadas quanto à qualidade da bebida, usando-se a escala de 0-5 pontos, normalmente empregada para essas avaliações. Não se notaram efeitos de embalagem nas amostras analisadas na primeira época, tendo as médias de pontos variado de 3,2 a 3,3. Para a segunda e terceira épocas, notaram-se diferenças significativas, sendo obtidas médias de pontos maiores nas amostras conservadas em latas e em sacos de plástico, que constituem as melhores embalagens. O tempo de armazenamento influiu desfavoravelmente para os tratamentos. Quanto à cor dos grãos, as amostras conservadas em latas e em sacos de plástico revelaram-se inalteradas, enquanto as demais pioraram, tornando-se esbranquiçadas. O teor de umidade revelou-se menor nas latas e nos sacos plásticos, bem como os valores da peneira média. Nessas embalagens observou-se maior peso de sementes de algumas peneiras.The effect of storage time on the Coffea arabica cv. Mundo Novo bean cup quality was analysed from June 1974 to March 1976. Five container types were used as follows: can, cotton and jute sacks, polyethylene and kraft paper bags. A randomized block design was used with five replications for each container. Coffee sarnples were analysed 5, 16, and 21 months after the beginning of the experiment. Coffee cup quality was determined by three independent coffee experts, using randomized block design and a five

  4. A modified PMMA cement (Sub-cement) for accelerated fatigue testing of cemented implant constructs using cadaveric bone.

    Science.gov (United States)

    Race, Amos; Miller, Mark A; Mann, Kenneth A

    2008-10-20

    Pre-clinical screening of cemented implant systems could be improved by modeling the longer-term response of the implant/cement/bone construct to cyclic loading. We formulated bone cement with degraded fatigue fracture properties (Sub-cement) such that long-term fatigue could be simulated in short-term cadaver tests. Sub-cement was made by adding a chain-transfer agent to standard polymethylmethacrylate (PMMA) cement. This reduced the molecular weight of the inter-bead matrix without changing reaction-rate or handling characteristics. Static mechanical properties were approximately equivalent to normal cement. Over a physiologically reasonable range of stress-intensity factor, fatigue crack propagation rates for Sub-cement were higher by a factor of 25+/-19. When tested in a simplified 2 1/2-D physical model of a stem-cement-bone system, crack growth from the stem was accelerated by a factor of 100. Sub-cement accelerated both crack initiation and growth rate. Sub-cement is now being evaluated in full stem/cement/femur models. PMID:18774136

  5. Plastic cup traps equipped with light-emitting diodes for monitoring adult Bemisia tabaci (Homoptera: Aleyrodidae).

    Science.gov (United States)

    Chu, Chang-Chi; Jackson, Charles G; Alexander, Patrick J; Karut, Kamil; Henneberry, Thomas J

    2003-06-01

    Equipping the standard plastic cup trap, also known as the CC trap, with lime-green light-emitting diodes (LED-plastic cup trap) increased its efficacy for catching Bemisia tabaci by 100%. Few Eretmocerus eremicus Rose and Zolnerowich and Encarsia formosa Gahan were caught in LED-plastic cup traps. The LED-plastic cup traps are less expensive than yellow sticky card traps for monitoring adult whiteflies in greenhouse crop production systems and are more compatible with whitefly parasitoids releases for Bemisia nymph control.

  6. Seating load parameters impact on dental ceramic reinforcement conferred by cementation with resin-cements.

    LENUS (Irish Health Repository)

    Addison, Owen

    2010-09-01

    Cementation of all-ceramic restorations with resin-cements has been demonstrated to reduce the incidence of fracture in service. The aim was to investigate the influence of loading force and loading duration applied during cementation on the reinforcement conferred by a resin-cement on a leucite reinforced glass-ceramic.

  7. Cement radwaste solidification studies third annual report

    International Nuclear Information System (INIS)

    This report summarises cement radwaste studies carried out at AEE Winfrith during 1981 on the encapsulation of medium and low active waste in cement. During the year more emphasis has been placed on the work which is directly related to the solidification of SGHWR active sludge. Information has been obtained on the properties of 220 dm3 drums of cemented waste. The use of cement grouts for the encapsulation of solid items has also been investigated during 1981. (U.K.)

  8. Power output during women's World Cup road cycle racing.

    Science.gov (United States)

    Ebert, Tammie R; Martin, David T; McDonald, Warren; Victor, James; Plummer, John; Withers, Robert T

    2005-12-01

    Little information exists on the power output demands of competitive women's road cycle racing. The purpose of our investigation was to document the power output generated by elite female road cyclists who achieved success in FLAT and HILLY World Cup races. Power output data were collected from 27 top-20 World Cup finishes (19 FLAT and 8 HILLY) achieved by 15 nationally ranked cyclists (mean +/- SD; age: 24.1+/-4.0 years; body mass: 57.9+/-3.6 kg; height: 168.7+/-5.6 cm; VO2max 63.6+/-2.4 mL kg(-1) min(-1); peak power during graded exercise test (GXT(peak power)): 310+/-25 W). The GXT determined GXT(peak power), VO2peak lactate threshold (LT) and anaerobic threshold (AT). Bicycles were fitted with SRM powermeters, which recorded power (W), cadence (rpm), distance (km) and speed (km h(-1)). Racing data were analysed to establish time in power output and metabolic threshold bands and maximal mean power (MMP) over different durations. When compared to HILLY, FLAT were raced at a similar cadence (75+/-8 vs. 75+/-4 rpm, P=0.93) but higher speed (37.6+/-2.6 vs. 33.9+/-2.7 km h(-1), P=0.008) and power output (192+/-21 vs. 169+/-17 W, P=0.04; 3.3+/-0.3 vs. 3.0+/-0.4 W kg(-1), P=0.04). During FLAT races, riders spent significantly more time above 500 W, while greater race time was spent between 100 and 300 W (LT-AT) for HILLY races, with higher MMPs for 180-300 s. Racing terrain influenced the power output profiles of our internationally competitive female road cyclists. These data are the first to define the unique power output requirements associated with placing well in both flat and hilly women's World Cup cycling events. PMID:16151832

  9. Power output during women's World Cup road cycle racing.

    Science.gov (United States)

    Ebert, Tammie R; Martin, David T; McDonald, Warren; Victor, James; Plummer, John; Withers, Robert T

    2005-12-01

    Little information exists on the power output demands of competitive women's road cycle racing. The purpose of our investigation was to document the power output generated by elite female road cyclists who achieved success in FLAT and HILLY World Cup races. Power output data were collected from 27 top-20 World Cup finishes (19 FLAT and 8 HILLY) achieved by 15 nationally ranked cyclists (mean +/- SD; age: 24.1+/-4.0 years; body mass: 57.9+/-3.6 kg; height: 168.7+/-5.6 cm; VO2max 63.6+/-2.4 mL kg(-1) min(-1); peak power during graded exercise test (GXT(peak power)): 310+/-25 W). The GXT determined GXT(peak power), VO2peak lactate threshold (LT) and anaerobic threshold (AT). Bicycles were fitted with SRM powermeters, which recorded power (W), cadence (rpm), distance (km) and speed (km h(-1)). Racing data were analysed to establish time in power output and metabolic threshold bands and maximal mean power (MMP) over different durations. When compared to HILLY, FLAT were raced at a similar cadence (75+/-8 vs. 75+/-4 rpm, P=0.93) but higher speed (37.6+/-2.6 vs. 33.9+/-2.7 km h(-1), P=0.008) and power output (192+/-21 vs. 169+/-17 W, P=0.04; 3.3+/-0.3 vs. 3.0+/-0.4 W kg(-1), P=0.04). During FLAT races, riders spent significantly more time above 500 W, while greater race time was spent between 100 and 300 W (LT-AT) for HILLY races, with higher MMPs for 180-300 s. Racing terrain influenced the power output profiles of our internationally competitive female road cyclists. These data are the first to define the unique power output requirements associated with placing well in both flat and hilly women's World Cup cycling events.

  10. Neutron Scattering Studies of Cement

    Science.gov (United States)

    Allen, Andrew

    2010-03-01

    Despite more than a century of research, basic questions remain regarding both the internal structure and the role of water in Ordinary Portland cement (OPC) concrete, the world's most widely used manufactured material. Most such questions concern the primary hydration product and strength-building phase of OPC paste, the calcium silicate hydrate (C-S-H) gel. When cement and water are mixed, this phase precipitates as clusters of nanoscale (nearly amorphous) colloidal particles with an associated water-filled inter-particle pore system. Most attempts to characterize the C-S-H gel and the behavior of the associated water involve drying or other processes that, themselves, change the bound water content within and around the gel. Neutron scattering methods do not suffer from this disadvantage. Furthermore, the neutron isotope effect and the neutron's sensitivity to molecular motion have enabled considerable progress to be made in recent years by: (i) determining the C-S-H composition, density and gel structure in small-angle neutron scattering (SANS) H/D contrast variation studies; (ii) elucidating the changing state of water within cement as hydration progresses using quasielastic neutron scattering (QENS); and (iii) measuring the production and consumption of nanoscale calcium hydroxide (CH), a by-product of cement hydration that co-exists with the C-S-H gel, using inelastic neutron scattering (INS). These experiments have provided new insights into the physics and chemistry of cement hydration, and have implications for the design of new concretes with pozzolanic cement additions that are intended to address environmental concerns and sustainability issues.

  11. Development of a classification system for cup anemometers - CLASSCUP

    DEFF Research Database (Denmark)

    Friis Pedersen, Troels

    2003-01-01

    Errors associated with the measurements of the wind speed are the major sources of uncertainties in power performance testing of wind turbines. Field comparisons of well-calibrated anemometers show a significant and not acceptable difference. TheEuropean CLASSCUP research project posed......). The classification of three commercial cup anemometersshowed that for the normal category, the best class for horizontal wind speed measurements was class 2 and for vector measurements class 3. The CLASSCUP prototype anemometer got a class 2 as a horizontal anemometer and class 1 as a vector anemometer. Forthe...

  12. Speech teams of wrestling at the European Nations Cup 2015

    Directory of Open Access Journals (Sweden)

    Pavel Panov

    2015-12-01

    Full Text Available Purpose: to analyze the performance of national teams of wrestling at the European Nations Cup in 2015. Material and Methods: the analysis of 208 wrestlers highly. Results: determined that, among other factors, the advantage of the strongest wrestlers is successful and stable use of technical and tactical actions during the fight and the ability to impose his opponent style of fighting. Conclusions: it was found that in the competitive technology dominated the offensive, the fight is ongoing at a fast pace, techniques are performed after prior training and if the athlete is confident that the reception will be executed

  13. Mild pro-p-groups with trivial cup-product

    OpenAIRE

    Gärtner, Jochen

    2011-01-01

    Generalizing previous results due to A. Schmidt and J. Labute, we prove sufficient criteria involving higher Massey products for finitely presented pro-p-groups to be mild and hence of cohomological dimension 2. Further investigations are pursued in the special case of one-relator pro-p-groups. We construct a class of mild pro-2-groups having trivial cup-product, which occur as Galois groups of the maximal 2-extensions of the rationals with ramification restricted to given finite sets of plac...

  14. Team Handball World Cup Championship 2013 - Analysis Study

    OpenAIRE

    Hassan, Amr

    2014-01-01

    The world cup of men’s handball team championships was analysed using data from all matches in order to determine tactical differences at the elite level. The first aim of this study was to conduct a technical analysis of current handball and to determine factors related to success in this sport discipline. The second aim was to compare the data of first eight teams with other next teams. An analysis of the performance of the participating teams’ video tapes and CD’s, in the collection of mat...

  15. PERFORMANCE OF PULVERIZED SLAG-SUBSTITUTED CEMENT

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    The Portland cement is equivalently substituted by slag micropowders with various specific areas. The workability,activity and acid-corrosion resistance of the slag-substituted cements are investigated,the activation of gypsum is discussed,also the porosity and pore distribution of mortars of the slag micropowders cement are determined by mercury intrusion porosimetry.

  16. 21 CFR 872.3275 - Dental cement.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Dental cement. 872.3275 Section 872.3275 Food and... DENTAL DEVICES Prosthetic Devices § 872.3275 Dental cement. (a) Zinc oxide-eugenol—(1) Identification... filling or as a base cement to affix a temporary tooth filling, to affix dental devices such as crowns...

  17. ADVANCED CEMENTS FOR GEOTHERMAL WELLS

    Energy Technology Data Exchange (ETDEWEB)

    SUGAMA,T.

    2007-01-01

    Using the conventional well cements consisting of the calcium silicate hydrates (CaO-SiO{sub 2}-H{sub 2}O system) and calcium aluminum silicate hydrates (CaO-Al{sub 2}O{sub 3}-SiO{sub 2}-H{sub 2}O system) for the integrity of geothermal wells, the serious concern confronting the cementing industries was their poor performance in mechanically supporting the metallic well casing pipes and in mitigating the pipe's corrosion in very harsh geothermal reservoirs. These difficulties are particularly acute in two geological regions: One is the deep hot downhole area ({approx} 1700 m depth at temperatures of {approx} 320 C) that contains hyper saline water with high concentrations of CO{sub 2} (> 40,000 ppm) in conjunction with {approx} 100 ppm H{sub 2}S at a mild acid of pH {approx} 5.0; the other is the upper well region between the well's surface and {approx} 1000 m depth at temperatures up to 200 C. The specific environment of the latter region is characterized by highly concentrated H{sub 2}SO{sub 4} (pH < 1.5) brine containing at least 5000 ppm CO{sub 2}. When these conventional cements are emplaced in these harsh environments, their major shortcoming is their susceptibility to reactions with hot CO{sub 2} and H{sub 2}SO4, thereby causing their deterioration brought about by CO{sub 2}-catalyzed carbonation and acid-initiated erosion. Such degradation not only reduced rapidly the strength of cements, lowering the mechanical support of casing pipes, but also increased the extent of permeability of the brine through the cement layer, promoting the rate of the pipe's corrosion. Severely carbonated and acid eroded cements often impaired the integrity of a well in less than one year; in the worst cases, casings have collapsed within three months, leading to the need for costly and time-consuming repairs or redrilling operations. These were the reasons why the geothermal well drilling and cementing industries were concerned about using conventional well

  18. Microscale Investigation of Arsenic Distribution and Species in Cement Product from Cement Kiln Coprocessing Wastes

    OpenAIRE

    Yufei Yang; Jingchuan Xue; Qifei Huang

    2013-01-01

    To improve the understanding of the immobilization mechanism and the leaching risk of Arsenic (As) in the cement product from coprocessing wastes using cement kiln, distribution and species of As in cement product were determined by microscale investigation methods, including electron probe microanalysis (EPMA) and X-ray absorption spectroscopy. In this study, sodium arsenate crystals (Na3AsO412H2O) were mixed with cement production raw materials and calcined to produce cement clinker. Then, ...

  19. The comparison between sulfate salt weathering of portland cement paste and calcium sulfoaluminate cement paste

    OpenAIRE

    Liu, Zanqun; Deng, Dehua; De Schutter, Geert

    2015-01-01

    In this paper, the damage performances of sulfate salt weathering of Portland cement paste and calcium sulfoaluminate (CSA) cement paste were compared according to authors' previous studies. It was found that the evaporation zone of speciments partially immersed in 10% Na2SO4 solution were both severely deteriorated for Portland cement and CSA cement. However, the differences were more significant: (1) the CSA cement paste were damaged just after 7 days exposure compared to the 5 months expos...

  20. Comparison of the results between polyethylene liners articulated with zirconia ceramic and cobalt-chrome femoral heads in vivo

    Institute of Scientific and Technical Information of China (English)

    Feng Liu; James P. Waddell

    2005-01-01

    Objective: The aseptic loosening of the implants is the main contributor to the long-term failure of hip arthroplasty.One of the alternatives is to choose ceramic head instead of the traditional CoCr head. This study is conducted to determine the clinicalefficacy of a zirconia ceramic head. Methods: Twenty-six cementless total hip arthroplasties in 24 patients were performed using a zirconiahead coupled with polyethylene. All hips were followed for an average of 9 years (range, 6-13 years). A matched group of 26 hips in 26patients using cobalt-chrome heads coupled with polyethylene were also followed for average of 10 years (range, 5-14 years). The twogroups of patients were evaluated clinically and radiographically respectively. Results: The average scores of functional hip according toHarris standard improved from 46 (preoperatively) to 86 (at the final follow-up) in the Zirconia group, and from 50 to 88 in the CrCogroup. The mean liner wear rate of zirconia-polyethylene coupling was 0. 118 mm/year (range, 0. 064-0. 175 mm/year), and the linearwear rate of CrCo-polyethylene was 0.113 mm/year (range, 0.056-0.190 mm/year). There were 10 hips (27%) revised due to looseningor extensive osteolysis of the.cup in the Zirconia group, and only 4 hips (11.5%) in CrCo group. Conclusion: Results of the studysuggest that a zirconia ceramic femoral head has little advantage over a cobalt-chrome head in decreasing polyethylene wear in vivo. Ourstudy demonstrates that although changes in designs and materials may offer theoretical advantages over current components, their effectsremain questionable in vivo.

  1. Reuse of polyethylene waste in road construction.

    Science.gov (United States)

    Raju, S S S V Gopala; Murali, M; Rengaraju, V R

    2007-01-01

    The cost of construction of flexible pavements depends on thickness of the pavement layers. The thickness of pavement mainly depends on the strength of the subgrade. By suitable improvement to the strength of the subgrade, considerable saving in the scarce resources and economy can be achieved. Because of their lightweight, easy handling, non-breakable and corrosion free nature, polyethylene have surpassed all other materials in utility. But polyethylene waste has been a matter of concern to environmentalists as it is non-biodegradable. In this investigation, an attempt has been made to study the improvement of California Bearing Ratio (CBR) value of soils stabilized with waste polyethylene bags. This alternative material is mixed in different proportions to the gravel and clay to determine the improvement ofCBR value. Use of the waste polyethylene bags observed to have a significant impact on the strength and economy in pavement construction, when these are available locally in large quantities.

  2. Reuse of polyethylene waste in road construction.

    Science.gov (United States)

    Raju, S S S V Gopala; Murali, M; Rengaraju, V R

    2007-01-01

    The cost of construction of flexible pavements depends on thickness of the pavement layers. The thickness of pavement mainly depends on the strength of the subgrade. By suitable improvement to the strength of the subgrade, considerable saving in the scarce resources and economy can be achieved. Because of their lightweight, easy handling, non-breakable and corrosion free nature, polyethylene have surpassed all other materials in utility. But polyethylene waste has been a matter of concern to environmentalists as it is non-biodegradable. In this investigation, an attempt has been made to study the improvement of California Bearing Ratio (CBR) value of soils stabilized with waste polyethylene bags. This alternative material is mixed in different proportions to the gravel and clay to determine the improvement ofCBR value. Use of the waste polyethylene bags observed to have a significant impact on the strength and economy in pavement construction, when these are available locally in large quantities. PMID:18472564

  3. Positrons trapped in polyethylene: Electric field effect

    International Nuclear Information System (INIS)

    The intensity of the iot2-component of positrons annihilated in polyethylene is found to increase with increasing electric field, while the formation probability of the positron state responsible for this component remains independent of the field. (orig.) 891 HPOE

  4. Clinical research evidence of cupping therapy in China: a systematic literature review

    Directory of Open Access Journals (Sweden)

    Wang Qian

    2010-11-01

    Full Text Available Abstract Background Though cupping therapy has been used in China for thousands of years, there has been no systematic summary of clinical research on it. This review is to evaluate the therapeutic effect of cupping therapy using evidence-based approach based on all available clinical studies. Methods We included all clinical studies on cupping therapy for all kinds of diseases. We searched six electronic databases, all searches ended in December 2008. We extracted data on the type of cupping and type of diseases treated. Results 550 clinical studies were identified published between 1959 and 2008, including 73 randomized controlled trials (RCTs, 22 clinical controlled trials, 373 case series, and 82 case reports. Number of RCTs obviously increased during past decades, but the quality of the RCTs was generally poor according to the risk of bias of the Cochrane standard for important outcome within each trials. The diseases in which cupping was commonly employed included pain conditions, herpes zoster, cough or asthma, etc. Wet cupping was used in majority studies, followed by retained cupping, moving cupping, medicinal cupping, etc. 38 studies used combination of two types of cupping therapies. No serious adverse effects were reported in the studies. Conclusions According to the above results, quality and quantity of RCTs on cupping therapy appears to be improved during the past 50 years in China, and majority of studies show potential benefit on pain conditions, herpes zoster and other diseases. However, further rigorous designed trials in relevant conditions are warranted to support their use in practice.

  5. Blending of polyethylene materials for pipe applications

    OpenAIRE

    Wright, Wayne Clifton Augustus

    1989-01-01

    This thesis was submitted for the degree of Doctor of Philosophy and awarded by Brunel University. Melt blending of polyethylene, in particularly HDPE and LLDPE, have been shown to be a major success, especially in the film markets. In this thesis studies are reported on the stress rupture performance of pipes produced from selected polyethylene materials blended to a chosen MDPE pipe grade. The pipes were tested, notched or unnotched, at a single temperature of 80oC and at internal pressu...

  6. Mechanism of electric charge formation polyethylene

    International Nuclear Information System (INIS)

    The electric charge formation in irradiated dielectrics is a phenomenon resulting from interaction of radiation with matter. Using pressure-pulse techniques the general mechanism of eletric charge accumulation and space distribution in electron- and gamma-irradiated polyethylene (low and high density) was studied. The relationship between the charge accumulation and structural and radiation-induced defects in polyethylene was established. Results obtained are applied to other organic materials

  7. Morphology of polyethylene ski base materials.

    Science.gov (United States)

    Fischer, Jörg; Wallner, Gernot M; Pieber, Alois

    2010-03-01

    We used high-resolution Raman spectroscopy and differential scanning calorimetry for a comprehensive analysis of carbon black-filled polyethylene ski base grades at processing stages from the raw material to the structured ski base. Based on Raman mapping, we assessed the applicability of an advanced evaluation procedure for amorphous, disordered, and crystalline phase fractions of polyethylene for polyethylene extrusion and sinter grades. For sinter grades, a sufficient segregation between carbon black and polyethylene was confirmed, allowing for a comprehensive Raman spectroscopic morphological analysis. Significant morphological changes in polyethylene due to processing from the raw material to the semi-finished film and to the structured ski base were identified. Throughout the processing chain, we observed a decrease in crystallinity and an increase in the amorphous phase fraction. Although the raw material and the sintered semi-finished film exhibited a different but uniform polyethylene morphology, the morphological changes due to structuring of the ski base are limited to the top surface layer. The highest amorphous phase fractions were detected in the surface of the structured ski bases.

  8. Studies in Cup Drawing Behavior of Polymer Laminated Sheet Metal

    Science.gov (United States)

    Elnagmi, M.; Jain, M.; Bruhis, M.; Nielsen, K.

    2011-08-01

    Axisymmetric deep drawing behavior of a polymer laminated sheet metal (PLSM) is investigated using an axisymmetric cup drawing test. PLSMs are of interest as a replacement for painted finishes for automotive applications as they have the potential to achieve good quality long lasting and aesthetically appealing surfaces on stamped parts. However, there is limited understanding of PLSMs in automotive deep drawing situations to produce complex 3-D parts. The tests are carried out using well-controlled, laboratory-based, dual-action, servo-hydraulic forming presses under blank-holder force and punch displacement control conditions. An optical strain mapping system is used to measure the surface strains (and to construct 3D strain maps) from the film side of the deformed samples for a range of forming conditions. Deep drawing characteristics such as punch load versus punch displacement traces, strain distribution along the cup profile, flange wrinkling and fracture characteristics are experimentally assessed for stainless steel-plastic film laminated sheet materials. Also the effect of lamination pressure on wrinkling and delamination is investigated for a decorative pressure sensitive adhesive film affixed to the stainless steel sheet.

  9. Thoughts on the Current Cement Industry Development

    Institute of Scientific and Technical Information of China (English)

    Gan Zhihe

    2003-01-01

    According to the analysis of cement capacity andits relations with macro economy running index, the mainreasons for the present rapid development of cement capacityare the rapid development of economy and the shot up ofwhole society fixed asset investment. According to the presentspeed of economy development, cement still enjoys a po-tential increase, So here has not been an overall excessivepopularity of cement industry. The best way to prevent lowlevel repeated construction is to promote the development ofnew dry- process cement as well as try to get rid of blindness.

  10. Effect of temporary cements on the shear bond strength of luting cements

    Directory of Open Access Journals (Sweden)

    Marco Fiori-Júnior

    2010-02-01

    Full Text Available OBJECTIVE: The purpose of this study was to evaluate, by shear bond strength (SBS testing, the influence of different types of temporary cements on the final cementation using conventional and self-etching resin-based luting cements. Material and Methods: Forty human teeth divided in two halves were assigned to 8 groups (n=10: I and V (no temporary cementation; II and VI: Ca(OH2-based cement; III and VII: zinc oxide (ZO-based cement; IV and VIII: ZO-eugenol (ZOE-based cement. Final cementation was done with RelyX ARC cement (groups I to IV and RelyX Unicem cement (groups V to VIII. Data were analyzed statistically by ANOVA and Tukey's test at 5% significance level. RESULTS: Means were (MPa: I - 3.80 (±1.481; II - 5.24 (±2.297; III - 6.98 (±1.885; IV - 6.54 (±1.459; V - 5.22 (±2.465; VI - 4.48 (±1.705; VII - 6.29 (±2.280; VIII - 2.47 (±2.076. Comparison of the groups that had the same temporary cementation (Groups II and VI; III and VII; IV and VIII showed statistically significant difference (p0.05 for the different luting cements (RelyX TM ARC and RelyX TM Unicem. The groups that had no temporary cementation (Groups I and V did not differ significantly from each other either (p>0.05. CONCLUSION: When temporary cementation was done with ZO- or ZOE-based cements and final cementation was done with RelyX ARC, there was an increase in the SBS compared to the control. In the groups cemented with RelyX Unicem, however, the use of a ZOE-based temporary cement affected negatively the SBS of the luting agent used for final cementation.

  11. False set in aireated cements

    Directory of Open Access Journals (Sweden)

    Vázquez, T.

    1986-06-01

    Full Text Available The influence of aireation on the appearance or elimination of the false setting in industrial portland cements is studied by means of infrared spectroscopy.

    Se estudia por medio de la espectroscopia infrarroja la influencia de la aireación sobre la aparición o eliminación del fraguado, en cemento portland industriales.

  12. 77 FR 54815 - Safety Zone: America's Cup World Series Regattas, San Francisco Bay; San Francisco, CA

    Science.gov (United States)

    2012-09-06

    ... INFORMATION: Table of Acronyms ACRM America's Cup Race Management DHS Department of Homeland Security FR... public dockets in the January 17, 2008, issue of the Federal Register (73 FR 3316). 4. Public Meeting We... Alcatraz Island. This rule will regulate the on-water activities associated with 2012 America's Cup...

  13. Automated detection of kinks from blood vessels for optic cup segmentation in retinal images

    Science.gov (United States)

    Wong, D. W. K.; Liu, J.; Lim, J. H.; Li, H.; Wong, T. Y.

    2009-02-01

    The accurate localization of the optic cup in retinal images is important to assess the cup to disc ratio (CDR) for glaucoma screening and management. Glaucoma is physiologically assessed by the increased excavation of the optic cup within the optic nerve head, also known as the optic disc. The CDR is thus an important indicator of risk and severity of glaucoma. In this paper, we propose a method of determining the cup boundary using non-stereographic retinal images by the automatic detection of a morphological feature within the optic disc known as kinks. Kinks are defined as the bendings of small vessels as they traverse from the disc to the cup, providing physiological validation for the cup boundary. To detect kinks, localized patches are first generated from a preliminary cup boundary obtained via level set. Features obtained using edge detection and wavelet transform are combined using a statistical approach rule to identify likely vessel edges. The kinks are then obtained automatically by analyzing the detected vessel edges for angular changes, and these kinks are subsequently used to obtain the cup boundary. A set of retinal images from the Singapore Eye Research Institute was obtained to assess the performance of the method, with each image being clinically graded for the CDR. From experiments, when kinks were used, the error on the CDR was reduced to less than 0.1 CDR units relative to the clinical CDR, which is within the intra-observer variability of 0.2 CDR units.

  14. Acquisition of cup drinking using previously refused foods as positive and negative reinforcement.

    OpenAIRE

    Kelley, Michael E; Piazza, Cathleen C; Fisher, Wayne W; Oberdorff, Amanda J

    2003-01-01

    We used previously refused foods as positive and negative reinforcement in the acquisition of cup drinking. Cup drinking increased with positive and negative reinforcement, both alone and in combination (without escape extinction), indicating that treatment of food refusal can establish some foods as appetitive stimuli whereas others remain aversive.

  15. Facility arrangements, food safety, and the environmental performance of disposable and reusable cups

    NARCIS (Netherlands)

    Potting, J.; Harst, van der E.J.M.

    2014-01-01

    Conventional disposable cups, made of fossil-based plastic or paper with inner lining of fossil-based plastic, are typically associated with an unnecessary use of scarce resources and a superfluous production of waste. An alternative has become available in disposable cups from bio-based and biodegr

  16. FIFA World Cup 2018: An Ex Ante Input Output Analysis for the Netherlands

    NARCIS (Netherlands)

    Heijman, W.J.M.; Jongenburger, B.

    2011-01-01

    Together with Belgium, the Netherlands was one of the candidates to host the FIFA World Cup 2018. There is an ongoing debate about whether this event would have been beneficiary for the Netherlands. Several studies point out that the expected benefits for previous FIFA World Cups did not materialize

  17. Facility arrangements and the environmental performance of disposable and reusable cups

    NARCIS (Netherlands)

    Potting, José; Harst-Wintraecken, van der Eugenie

    2015-01-01

    Purpose: This paper integrates two complementary life cycle assessment (LCA) studies with the aim to advice facility managers on the sustainable use of cups, either disposable or reusable. Study 1 compares three disposable cups, i.e., made from fossil-based polystyrene (PS), biobased and composta

  18. Athletic Departments' Operating Expenses as a Predictor of Their Directors' Cup Standing

    Science.gov (United States)

    Magner, Amber

    2014-01-01

    The NACDA Directors' Cup is a competition utilizing an unbiased scoring system that encourages a broad based athletic department as the standard for defining intercollegiate athletic success. Therefore, for NCAA DI athletic administrators the Directors' Cup should be the standard for defining intercollegiate athletic success. The purpose of this…

  19. 77 FR 25073 - Special Local Regulation; Hebda Cup Rowing Regatta, Trenton Channel; Detroit River, Wyandotte, MI

    Science.gov (United States)

    2012-04-27

    ... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Hebda Cup Rowing Regatta... on the navigable waters immediately prior to, during, and immediately after the Hebda Cup Rowing... Purpose On April 28, 2012, the Wyandotte Boat Club is holding a rowing race that will require...

  20. 78 FR 24063 - Special Local Regulation; Hebda Cup Rowing Regatta, Trenton Channel; Detroit River, Wyandotte, MI

    Science.gov (United States)

    2013-04-24

    ... INFORMATION: Table of Acronyms DHS Department of Homeland Security FR Federal Register NPRM Notice of Proposed... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Hebda Cup Rowing Regatta... on the navigable waters immediately prior to, during, and immediately after the Hebda Cup...

  1. Pressurization of bioactive bone cement in vitro.

    Science.gov (United States)

    Fujita, H; Iida, H; Kawanabe, K; Okada, Y; Oka, M; Masuda, T; Kitamura, Y; Nakamura, T

    1999-01-01

    We have developed a bioactive bone cement consisting of MgO-CaO-SiO2-P2O5-CaF2 glass-ceramic powder (AW glass-ceramic powder), silica glass powder as an inorganic filler, and bisphenol-a-glycidyl methacrylate (bis-GMA) based resin as an organic matrix. The efficacy of this bioactive bone cement was investigated by evaluating its pressurization in a 5-mm hole and small pores using a simulated acetabular cavity. Two types of acetabular components were used (flanged and unflanged sockets) and a commercially available polymethylmethacrylate (PMMA) bone cement (CMW 1 Radiopaque Bone Cement) was selected as a comparative control. Bioactive bone cement exerted greater intrusion volume in 5-mm holes than PMMA bone cement in both the flanged and unflanged sockets 10 minutes after pressurization (p anchor holes than PMMA bone cement.

  2. Leaching of tritium from a cement composite

    International Nuclear Information System (INIS)

    Leaching of tritium from cement composites into an aqueous phase has been studied to evaluate the safety of incorporation of the tritiated liquid waste into cement. Leaching tests were performed by the method recommended by the International Atomic Energy Agency. The Leaching fraction was measured as functions of waste-cement ratio (Wa/C), temperature of leachant and curing time. The tritium leachability of cement in the long term test follows the order: alumina cement portland cement slag cement. The fraction of tritium leached increases with increasing Wa/C and temperature and decreasing curing period. A deionized water as a leachant gives a slightly higher leachability than synthetic sea water. The amount leached of tritium from a 200 l drum size specimen was estimated on the basis of the above results. (author)

  3. Understanding cement mechanical behavior in SAGD wells

    Energy Technology Data Exchange (ETDEWEB)

    Xie, J.; Zahacy, T. A. [C-FER Technologies (Canada)

    2011-07-01

    In the heavy oil industry, the steam assisted gravity drainage process is often used to enhance oil recovery but it can cause cracks in the cement sheath. These cracks are the result of high steam temperatures and thermal expansion. In order to mitigate this risk, improved well designs are required. The aim of this paper is to present the mechanical behavior of the cement sheath during the heating phase. An analysis of the impact of design and operating parameters was conducted through thermal hydraulic and thermal mechanical analyses to assess cement integrity. These analyses were then performed on an example of an SAGD project in the southern part of the Athabasca oilsands region to assess the performance of the cement sheath. Results showed that potential damage to the cement can be reduced by slow heating and a lower Young's modulus cement blend. This paper makes recommendations for optimizing cement design in thermal recovery wells.

  4. A new formulation for the prediction of polyethylene wear in artificial hip joints.

    Science.gov (United States)

    Liu, F; Galvin, A; Jin, Z; Fisher, J

    2011-01-01

    Artificial joints employing ultra-high molecular weight polyethylene (UHMWPE) are widely used to treat joint diseases and trauma. Wear of the polymer bearing surface largely limits the use of these joints in younger and more active patients. Previous studies have shown the wear factor used in Archard's law for the conventional polyethylene to be highly dependent on contact pressure and this has produced variability in experimental data and has constrained the reliability and applicability of previous computational predictions. A new wear law is proposed, based on wear volume being dependent on, and proportional to, the product of the sliding distance and contact area. The dimensionless proportional constant, wear coefficient, which was independent of contact pressure, was determined from a multi-directional pin on plate study. This was used in computational predictions of the wear of the conventional UHMWPE hip joints. The wear of the polyethylene cup was independently experimentally determined in physiological full hip joint simulator studies. The predicted wear rate from the new computational model was generally increased, with an improved agreement with the experimental measurement compared with the previous computational model. It was shown that wear in the UHMWPE hip joints increased as head size and contact area increased. This resulted in a much larger increase in the wear rate as the head size increased, compared with the previous computational model, and is consistent with clinical observations. This new understanding of the wear mechanism in artificial joints using the UHMWPE bearing surfaces, and the improved ability to predict wear independently and to address previously described discrepancies offer new opportunities to optimize design parameters. PMID:21381484

  5. Mesoscale texture of cement hydrates.

    Science.gov (United States)

    Ioannidou, Katerina; Krakowiak, Konrad J; Bauchy, Mathieu; Hoover, Christian G; Masoero, Enrico; Yip, Sidney; Ulm, Franz-Josef; Levitz, Pierre; Pellenq, Roland J-M; Del Gado, Emanuela

    2016-02-23

    Strength and other mechanical properties of cement and concrete rely upon the formation of calcium-silicate-hydrates (C-S-H) during cement hydration. Controlling structure and properties of the C-S-H phase is a challenge, due to the complexity of this hydration product and of the mechanisms that drive its precipitation from the ionic solution upon dissolution of cement grains in water. Departing from traditional models mostly focused on length scales above the micrometer, recent research addressed the molecular structure of C-S-H. However, small-angle neutron scattering, electron-microscopy imaging, and nanoindentation experiments suggest that its mesoscale organization, extending over hundreds of nanometers, may be more important. Here we unveil the C-S-H mesoscale texture, a crucial step to connect the fundamental scales to the macroscale of engineering properties. We use simulations that combine information of the nanoscale building units of C-S-H and their effective interactions, obtained from atomistic simulations and experiments, into a statistical physics framework for aggregating nanoparticles. We compute small-angle scattering intensities, pore size distributions, specific surface area, local densities, indentation modulus, and hardness of the material, providing quantitative understanding of different experimental investigations. Our results provide insight into how the heterogeneities developed during the early stages of hydration persist in the structure of C-S-H and impact the mechanical performance of the hardened cement paste. Unraveling such links in cement hydrates can be groundbreaking and controlling them can be the key to smarter mix designs of cementitious materials. PMID:26858450

  6. Preparation and characterization of injectable calcium phosphate cement paste modified by polyethylene glycol-6000

    International Nuclear Information System (INIS)

    An ICPC with high structure recoverability and paste stability was successfully developed directly incorporating PEG-6000 into the liquid phase of CPC. The rheological behavior of ICPC was investigated with rheometric scientific ARES902-30004 controlled strain rheometer. Novel approaches of flow rate, shear thinning index (SI), shear stress slowdown (Δτ) and thixotropy loop area have been applied to assess the injectability and structure recoverability of the ICPC paste. The addition of PEG-6000 to ICPC resulted in a thixotrophic structure with shortened setting time, slightly increased viscosity, larger thixotropic hysteresis loop area and lower Δτ, with the improvement largely dependent on the PEG-6000 content. With acceptable injectability and shortened setting time, ICPC (1%) showed the lowest Δτ and the highest SI, endowing the paste good structure recoverability and paste stability. The ICPC (1%) was bioactive and facilitated cell attachment and proliferation. The optimized ICPC (1%) paste with a relatively good structure stability and paste stability may serve as a good candidate for tooth root-canal fillings and percutaneous vertebroplasty in microinvasive surgery.

  7. Preparation and characterization of injectable calcium phosphate cement paste modified by polyethylene glycol-6000

    Energy Technology Data Exchange (ETDEWEB)

    Chen Fangping, E-mail: chenfangping06@yahoo.com.cn [The State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237 (China); Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Liu Changsheng, E-mail: liucs@ecust.edu.cn [The State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237 (China); Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Wei Jie [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237 (China); Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology, Shanghai 200237 (China); Chen Xiao; Zhao Zhen; Gao Yanli [Engineering Research Center for Biomedical Materials of Ministry of Education, East China University of Science and Technology, Shanghai 200237 (China)

    2011-02-15

    An ICPC with high structure recoverability and paste stability was successfully developed directly incorporating PEG-6000 into the liquid phase of CPC. The rheological behavior of ICPC was investigated with rheometric scientific ARES902-30004 controlled strain rheometer. Novel approaches of flow rate, shear thinning index (SI), shear stress slowdown ({Delta}{tau}) and thixotropy loop area have been applied to assess the injectability and structure recoverability of the ICPC paste. The addition of PEG-6000 to ICPC resulted in a thixotrophic structure with shortened setting time, slightly increased viscosity, larger thixotropic hysteresis loop area and lower {Delta}{tau}, with the improvement largely dependent on the PEG-6000 content. With acceptable injectability and shortened setting time, ICPC (1%) showed the lowest {Delta}{tau} and the highest SI, endowing the paste good structure recoverability and paste stability. The ICPC (1%) was bioactive and facilitated cell attachment and proliferation. The optimized ICPC (1%) paste with a relatively good structure stability and paste stability may serve as a good candidate for tooth root-canal fillings and percutaneous vertebroplasty in microinvasive surgery.

  8. A Study To Evaluate Skills Of Ophthalmic Assistants For Assessment Of Cup Disc Ratio

    Directory of Open Access Journals (Sweden)

    Malik J.S

    1999-01-01

    Full Text Available Research question: 1. Whether paramedical ophthalmic assistants can be trained to examine vertical cup disc ratio? 2. Can the PMO As detect abnormal cup disc ratio after training? Objectives: 1. T o train ophthalmic assistants in cup disc ratio examination 2. To evaluate skills of trained ophthalmic assistants in cup disc ratio examination Study design: Cross sectional Setting: OPD of Ophthalmology department, Pt. B.D. Sharma PGIMS, Rohtak Participants: Five paramedical ophthalmic assistants, one ophthalmologist and 322 patients above 40 years of age. Statistical analysis: Sensitivity, specificity, Kappa values. Results: Data analysis of 322 cases was found by PMO As and ophthalmologist revealed sensitivity between 50-65% and specificity between 84.5-92.62%. A good agreement was found among all the examiners on computation of Kappa Values. It was concluded that ophthalmic assistants can examine vertical cup disc ratio after five days training.

  9. The pvc Operon Regulates the Expression of the Pseudomonas aeruginosa Fimbrial Chaperone/Usher Pathway (Cup) Genes

    OpenAIRE

    Uzma Qaisar; Liming Luo; Haley, Cecily L.; Brady, Sean F.; Carty, Nancy L.; Colmer-Hamood, Jane A.; Hamood, Abdul N.

    2013-01-01

    The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC) contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clus...

  10. The pvc operon regulates the expression of the Pseudomonas aeruginosa fimbrial chaperone/usher pathway (cup genes.

    Directory of Open Access Journals (Sweden)

    Uzma Qaisar

    Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.

  11. The pvc operon regulates the expression of the Pseudomonas aeruginosa fimbrial chaperone/usher pathway (cup) genes.

    Science.gov (United States)

    Qaisar, Uzma; Luo, Liming; Haley, Cecily L; Brady, Sean F; Carty, Nancy L; Colmer-Hamood, Jane A; Hamood, Abdul N

    2013-01-01

    The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC) contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators. PMID:23646138

  12. A Coarse-Grained Model for Polyethylene Oxide and Polyethylene Glycol : Conformation and Hydrodynamics

    NARCIS (Netherlands)

    Lee, Hwankyu; de Vries, Alex H.; Marrink, Siewert-Jan; Pastor, Richard W.

    2009-01-01

    A coarse-grained (CG) model for polyethylene oxide (PEO) and polyethylene glycol (PEG) developed within the framework of the MARTINI CG force field (FF) using the distributions of bonds, angles, and dihedrals from the CHARMM all-atom FF is presented. Densities of neat low molecular weight PEO agree

  13. Radiotherapeutic concepts in cancer of unknown primary site; Strahlentherapeutische Konzepte beim CUP-Syndrom

    Energy Technology Data Exchange (ETDEWEB)

    Krug, D.; Debus, J.; Sterzing, F. [Universitaetsklinikum Heidelberg, Klinik fuer Radioonkologie und Strahlentherapie, Heidelberg (Germany)

    2014-02-15

    The term cancer of unknown primary (CUP) encompasses a group of entities which differ to a great extent regarding etiology, prognosis and therapeutic management. The aim of the study was an elaboration of the role of radiotherapy in CUP syndrome. Systematic literature search and specification of the available treatment options. Radiotherapy is an integral part of interdisciplinary management approaches for patients with CUP in both curative and palliative situations. Radio-oncological techniques, such as intensity-modulated radiotherapy and stereotactic body radiotherapy increase the therapeutic window. Modern diagnostic modalities from radiology and nuclear medicine are the cornerstone of radiotherapeutic interventions, especially in terms of target volume definition and pretherapeutic staging. In the interdisciplinary setting radiation oncology offers the possibility of curative and often organ preserving approaches in patients with axillary and cervical CUP. In addition, improvement and preservation of quality of life can be achieved in patients with metastatic disease. Radiation oncology is a crucial component of the interdisciplinary management of patients with CUP. Therapeutic decisions in patients with CUP should be made in an interdisciplinary setting. (orig.) [German] Das Cancer-of-unknown-primary(CUP)-Syndrom fasst eine Gruppe von Erkrankungen zusammen, die durch eine ausgepraegte Heterogenitaet hinsichtlich Aetiologie, Therapie und Prognose gepraegt sind. Darstellung der Rolle der Strahlentherapie beim CUP-Syndrom. Systematische Literaturrecherche und Erlaeuterung der Behandlungsoptionen. Die Strahlentherapie ist beim CUP-Syndrom sowohl in adjuvanten und definitiven Therapiekonzepten wie auch in palliativer Intention etabliert. Technisch innovative Verfahren wie die intensitaetsmodulierte Radiotherapie und die stereotaktische Bestrahlung im Koerperstammbereich ermoeglichen eine Vergroesserung der therapeutischen Breite. Eine leistungsfaehige und moderne

  14. The cement recycling of the earthquake disaster debris by Hachinohe Cement Co., Ltd

    International Nuclear Information System (INIS)

    A tremendous quantity of earthquake disaster debris and tsunami sediment was resulted by the Great East Japan Earthquake on March 11, 2011. Hachinohe Cement Co., Ltd., a Sumitomo Osaka Cement subsidiary, was the first cement industry company to receive and process such waste materials outside of their usual prefecture area, while the company is performing their treatment and recycling services locally in Hachinohe City and Aomori Prefecture. This report provides an explanation about the recycling mechanism of waste materials and by-products in cement manufacturing process, and introduces an example of actual achievements for the disaster debris treatment by utilizing the cement recycling technologies at the Hachinohe Cement Plant. (author)

  15. Making continuous bubble type polyethylene foam incombustible

    International Nuclear Information System (INIS)

    Since continuous bubble type plastic foam has excellent compression characteristics and sound absorption characteristics, it has been widely used as cushion material, sealing material, sound insulating material and so on. However, the most part of plastic foam is taken by air, therefore at the time of fires, it becomes a very dangerous material. At present, the material used mostly as the seat cushions for airliners, railroad coaches, automobiles and others is polyurethane foam, but since it contains C-N couples in its molecules, it is feared to generate cyanic gas according to the condition of combustion. As the plastic foam that does not generate harmful gas at the time of fires, there is continuous bubble type polyethylene which is excellent in its weathering property and chemical resistance. A reactive, phosphorus-containing oligomer has large molecular weight and two or more double couplings in a molecule, therefore, it does not enter the inside of polyethylene, and polymerizes and crosslinks on the surfaces of bubble walls in the foam, accordingly it is expected that the apparent graft polymerization is carried out, and it is very effective for making polyethylene foam incombustible. The method of making graft foam, the properties of graft foam and so on are reported. When the graft polymerization of this oligomer to continuous bubble type polyethylene foam was tried, highly incombustible polyethylene foam was obtained. (K.I.)

  16. Media value of the Basketball World Cup 2006

    Directory of Open Access Journals (Sweden)

    Pedro Garcia-del-Barrio

    2007-10-01

    Full Text Available The number of businesses whose activities are based on immaterial assets is growing very rapidly, which demands new ways of evaluating the economic relevance of intangible assets. The aim of this study is precisely to examine the Basketball World Cup 2006 -a particular experience within the industry of spectacle - through applying a novel methodology. The analysis of this sport event is an interesting exercise in itself, since it allows achieving important lessons and conclusions. Yet, the scope of this paper is broader, including another major goal. Effectively, the present study illustrates the potential capacity that ESIrg methodology has for evaluating intangible assets of different types and character (that must not necessary be linked to the sport industry.

  17. Cup waveguide antenna with integrated polarizer and OMT

    Science.gov (United States)

    Acosta, Roberto J. (Inventor); Kory, Carol (Inventor); Lambert, Kevin M. (Inventor)

    2011-01-01

    A cup waveguide antenna with integrated polarizer and OMT for simultaneously communicating left and right hand circularly polarized electromagnetic waves is adjustable to obtain efficient propagation and reception of electromagnetic waves. The antenna includes a circular waveguide having an orthomode transducer utilizing first and second pins longitudinally spaced apart and oriented orthogonally with respect to each other. Six radially-oriented adjustable polarizer screws extend from the exterior to the interior of the waveguide. A septum intermediate the first and second pins is aligned with the first pin. Adjustment of the polarizer screws enables maximized propagation of and/or response to left hand circularly polarized electromagnetic waves by the first pin while simultaneously enabling maximized propagation of and/or response to right hand circularly polarized electromagnetic waves by the second pin.

  18. The Sphere Anemometer - A Fast Alternative to Cup Anemometry

    Science.gov (United States)

    Heißelmann, Hendrik; Hölling, Michael; Peinke, Joachim

    The main problem of cup anemometry is the different response time for increasing and decreasing wind velocities due to its moment of inertia. This results in an overestimation of wind speed under turbulent wind conditions, the so-called over-speeding. Additionally, routine calibrations are necessary due to the wear of bearings. Motivated by these problems the sphere anemometer, a new simple and robust sensor for wind velocity measurements without moving parts, was developed at the University of Oldenburg. In contrast to other known thrust-based sensors, the sphere anemometer uses the light pointer principle to detect the deflection of a bending tube caused by the drag force acting on a sphere mounted at its top. This technique allows the simultaneous determination of wind speed and direction via a two-dimensional position sensitive detector.

  19. VOCALS-CUpEx: the Chilean Upwelling Experiment

    Science.gov (United States)

    Garreaud, R. D.; Rutllant, J. A.; Muñoz, R. C.; Rahn, D. A.; Ramos, M.; Figueroa, D.

    2011-03-01

    The VAMOS Ocean-Cloud-Atmosphere-Land Study Regional Experiment (VOCALS-REx) was a major field experiment conducted in spring of 2008 off southern Peru and northern Chile, aimed at better understanding the coupled climate systems of the southeast Pacific. Because of logistical constrains, the coastal area around 30° S was not sampled during VOCALS-REx. This area not only marks the poleward edge of the subtropical stratocumulus cloud regime (thus acting as a source of transient disturbances) but is also one of the most active upwelling centers and source of surface ocean kinetic energy along the Chilean coast. To fill such an observational gap, a small, brief, but highly focused field experiment was conducted in late spring 2009 in the near-shore region around 30° S. The Chilean Upwelling Experiment (CUpEx) was endorsed by VOCALS as a regional component. CUpEx included long-term monitoring, an intensive two-week field campaign and off-shore research flights. Our goal was to obtain an atmospheric/oceanic dataset with enough temporal and spatial coverage to be able to document (a) the mean diurnal cycles of the lower-troposphere and upper-ocean in a region of complex topography and coastline geometry, and (b) the ocean-atmosphere response to the rapid changes in coastal winds from strong, upwelling-favorable equatorward flow (southerly winds) to downwelling-favorable poleward flow (northerly winds). In this paper we describe the measurement platforms and sampling strategy, and provide an observational overview, highlighting some key mean-state and transient features.

  20. WHITE CEMENT IN SUSTAINABLE DEVELOPMENT

    OpenAIRE

    Y.C.P RAMANA BABU; B.SAI DOONDI; N. M .V .VAMSI KRISHNA; K.Prasanthi

    2013-01-01

    India is one among the fast developing countries in the world in the areas of Infrastructure. Now a day, Carbon monoxide (CO) and carbon dioxide (CO2) are the temporary atmospheric pollutants in the environment chiefly emitted from the fuel burning vehicles and street lights which lead to global warming and pose a major threat tothe survival and sustainable development. This paper deals with the principal purpose of use of white cement in pavement design which will take care of the Green hous...

  1. ROTARY SCREW SYSTEMS IN CEMENT

    OpenAIRE

    Taratuta V. D.; Belokur K. A.; Serga G. V.

    2016-01-01

    The article presents results of research of rotary-screw systems in relation to the creation of rotary kilns for the annealing of-cuttings in the preparation of cement clinker. Using the proposed design, in comparison with known designs of similar purpose, it significantly improves performance, reduces size and power consumption through the use of rotary screw systems in the form of screw rotors and drums made hollow with sidewalls assembled from separate strips or plates of different geometr...

  2. Effects of Aluminum Addition on Tensile and Cup Forming Properties of Three Twinning Induced Plasticity Steels

    Science.gov (United States)

    Hong, Seokmin; Shin, Sang Yong; Kim, Hyoung Seop; Lee, Sunghak; Kim, Sung-Kyu; Chin, Kwang-Geun; Kim, Nack J.

    2012-06-01

    In the present study, a high Mn twinning induced plasticity (TWIP) steel and two Al-added TWIP steels were fabricated, and their microstructures, tensile properties, and cup formability were analyzed to investigate the effects of Al addition on deformation mechanisms in tensile and cup forming tests. In the high Mn steel, the twin formation was activated to increase the strain hardening rate and ultimate tensile strength, which needed the high punch load during the cup forming test. In the Al-added TWIP steels, the twin formation was reduced, while the slip activation increased, thereby leading to the decrease in strain hardening rate and ultimate tensile strength. As twins and slips were homogeneously formed during the tensile or cup forming test, the punch load required for the cup forming and residual stresses were relatively low, and the tensile ductility was sufficiently high even after the cup forming test. This indicated that making use of twins and slips simultaneously in TWIP steels by the Al addition was an effective way to improve overall properties including cup formability.

  3. Uncertainties in pesticide monitoring using suction cups: Evidences from numerical simulations

    Science.gov (United States)

    Weihermüller, L.; Kasteel, R.; Vanderborght, J.; Šimůnek, J.; Vereecken, H.

    2009-04-01

    Risk assessment of pesticide leaching towards the groundwater becomes more and more prescribed by the authorities. Various methods are available to monitor transport and leaching of pesticides in the vadose zone. For experiments at the field scale, soil coring or in-situ sampling using capillary wicks, porous plates, and suction cups are used. The advantage of the in-situ sampling systems resides in the high temporal resolution of solute extraction at different depths or horizons. Especially suction cups seem to play an important role in pesticide monitoring due to their easy installation and low costs. In literature, most studies analyzing suction cup behavior focused on conservative substances, steady state infiltration, and homogeneous soils. In our numerical study, we analyzed breakthrough curves from suction cups in heterogeneous soils under atmospheric conditions. To account for reactive transport, two pesticides were also simulated, whereby each one represents a different physico-chemical behavior. Finally, we simulated two different operation modes of the suction cups: i) permanent suction according to a measured reference tensiometer plus additional offset, and ii) weekly operation with constant suction of -600 cm. The results show that the breakthrough as well as the mass recovery and the mean concentration depends on the physico-chemical properties of the substance and location of the suction cup within the heterogeneous flow field. Second, the total mass as well as the mean concentration depends on the operation mode of the suction cup system.

  4. A Facile Approach to Evaluate Thermal Insulation Performance of Paper Cups

    Directory of Open Access Journals (Sweden)

    Yudi Kuang

    2015-01-01

    Full Text Available Paper cups are ubiquitous in daily life for serving water, soup, coffee, tea, and milk due to their convenience, biodegradability, recyclability, and sustainability. The thermal insulation performance of paper cups is of significance because they are used to supply hot food or drinks. Using an effective thermal conductivity to accurately evaluate the thermal insulation performance of paper cups is complex due to the inclusion of complicated components and a multilayer structure. Moreover, an effective thermal conductivity is unsuitable for evaluating thermal insulation performance of paper cups in the case of fluctuating temperature. In this work, we propose a facile approach to precisely analyze the thermal insulation performance of paper cups in a particular range of temperature by using an evaluation model based on the MISO (Multiple-Input Single-Output technical theory, which includes a characterization parameter (temperature factor and a measurement apparatus. A series of experiments was conducted according to this evaluation model, and the results show that this evaluation model enables accurate characterization of the thermal insulation performance of paper cups and provides an efficient theoretical basis for selecting paper materials for paper cups.

  5. WHITE CEMENT IN SUSTAINABLE DEVELOPMENT

    Directory of Open Access Journals (Sweden)

    Y.C.P RAMANA BABU

    2013-04-01

    Full Text Available India is one among the fast developing countries in the world in the areas of Infrastructure. Now a day, Carbon monoxide (CO and carbon dioxide (CO2 are the temporary atmospheric pollutants in the environment chiefly emitted from the fuel burning vehicles and street lights which lead to global warming and pose a major threat tothe survival and sustainable development. This paper deals with the principal purpose of use of white cement in pavement design which will take care of the Green house gases (i.e., CO and CO2 and also saves lot of money in the long run process. A small amount of these gases in environment can cause major problems over time. Use of white cement in composite pavement design where there is heavy traffic loads are acting as well as number of vehicles are more such as junctions, bus stops, check posts etc., can perform better and acts asenvironment friendly. Its light colour reflects more than bituminous pavement so that it can be easily identified and avoid accidents to some extent. White cement helps to lower the average bus stop, junction temperature providing comfort to the people because it has high solar reflectance there by reducing “urban heat island” effect. In addition to this it has some more advantages which increase the sustainability, durability and workability of the pavements.

  6. Scanning electron microscopy analysis of dental cements

    Directory of Open Access Journals (Sweden)

    Radosavljević Radivoje D.

    2009-01-01

    Full Text Available The aim of this study was to compare in vitro the characteristics of different types of luting cements (zinc phosphate, glass-ionomer and resin based composite cement using scanning electron microscopy (SEM analysis and microleakage for the quality range of materials. Dental cements were mixed in accordance with the manufacturer's instructions and formed with posts in dental root canals of extracted teeth. The quality of cement was determined by SEM observation on horizontal sectioned roots with fixed posts according to specific pore and marginal gap diameter. The microleakage was measured on specimens immersed in Lofler (methylene blue solution. The mean values of the maximal diameter of pores, marginal gaps and microleakage of conventional cements are remarkably larger in comparison with composite luting agents. In conclusion, the quality and efficiency of composite luting agents in comparison with conventional cements are more successful in protecting the interior of tooth from penetration of oral fluids, bacteria and bacterial toxins into unprotected dentine.

  7. Cement replacement materials. Properties, durability, sustainability

    Energy Technology Data Exchange (ETDEWEB)

    Ramezanianpour, Ali Akbar [Amirkabir Univ. of Technology, Tehran (Iran, Islamic Republic of). Concrete Technology Center

    2014-04-01

    The aim of this book is to present the latest findings in the properties and application of Supplementary Cementing Materials and blended cements currently used in the world in concrete. Sustainability is an important issue all over the world. Carbon dioxide emission has been a serious problem in the world due to the greenhouse effect. Today many countries agreed to reduce the emission of CO2. Many phases of cement and concrete technology can affect sustainability. Cement and concrete industry is responsible for the production of 7% carbon dioxide of the total world CO2 emission. The use of supplementary cementing materials (SCM), design of concrete mixtures with optimum content of cement and enhancement of concrete durability are the main issues towards sustainability in concrete industry.

  8. Development of radiation crosslinked of polyethylene

    International Nuclear Information System (INIS)

    The polyethylene, LDPE, LLDPE, and HDPE were subjected to electron beam irradiation at doses ranging from 0 to 250 kGy. The effect of irradiation dose and dose rate, various additives such as crosslinking accelerator, anti-oxidant (AO), flame retardant (FR) and pigments were evaluated in relation to changes of physical and mechanical properties of the crosslinked polyethylene (XLPE). The objective of the studies is to establish relevant data required in development PE compounds suitable for certain applications such as wire and cables insulation, foamed products and shrinkable tubes. 43 figs., 5 tabs

  9. CONFORMATIONAL PROPERTIES OF STRETCHED POLYETHYLENE CHAIN

    Institute of Scientific and Technical Information of China (English)

    Lin-xi Zhang; De-lu Zhao

    2000-01-01

    When polyethylene chains are stretched, the chains are regarded as being confined in an infinite cylinder with decreasing diameter. The conformational properties of polyethylene chains confined in an infinite cylinder are investigated by using rotational isomeric state model. Using the average conformational energy and entropy and the average length, we can determine the elastic force f, or the fraction of the energy term to the total force fe/f, where fe=(б)/(б)/(б). Comparisons with experimental data are also made. The results of these microscopic calculations are discussed in terms of the macroscopic phenomena of rubber elasticity.

  10. Tensile Deformation of Polyethylenes: Crystallinity Effects

    Science.gov (United States)

    Crist, Buckley; Metaxas, Costas

    2004-03-01

    The crystalline fraction of polyethylene can be reduced by increasing the cooling rate, the molecular weight or the fraction of comonomer. All three methods have been used in this study of tensile deformation which shows that true stress - true strain behavior depends systematically on morphology. The dependence of uniaxial yield stress on crystal thickness is well understood in terms of dislocation nucleation. Post yield flow is dominated by the strain hardening rate that is larger in polyethylenes of lower crystallinity. Noncrystalline polymer evidently reduces the plastic compliance while providing for elastic (reversible) strains. These observations are examined in terms of old and new theories for deformation of semicrystalline polymers.

  11. Exact Topological Twistons in Crystalline Polyethylene

    CERN Document Server

    Ventura, E; Bazeia, D

    2000-01-01

    We investigate the presence of topological twistons in crystalline polyethylene. We describe crystalline polyethylene with a model that couples the torsional and longitudinal degrees of freedom of the polymeric chain by means of a system of two real scalar fields. This model supports topological twistons, which are described by exact and stable topological solutions that appear when the interaction between torsional and longitudinal fields is polynomial, containing up to the sixth power in the fields. We calculate the energy of the topological twiston, and the result is in very good agreement with the value obtained via molecular simulation.

  12. ACCUWIND - Accurate wind speed measurements in wind energy - Summary report[Cup and sonic anemometers

    Energy Technology Data Exchange (ETDEWEB)

    Friis Pedersen, T.; Dahlberg, J.Aa.; Cuerva, A.; Mouzakis, F.; Busche, P.; Eecen, P.; Sanz-Andres, A.; Franchini, S.; Markkilde Petersen, S.

    2006-07-15

    The cup anemometer is at present the standard instrument used for mean wind speed measurement in wind energy. It is being applied in high numbers around the world for wind energy assessments. It is also applied exclusively for accredited power performance measurements for certification and verification purposes, and for purposes of optimisation in research and development. The revised IEC standard on power performance measurements has now included requirements for classification of cup anemometers. The basis for setting up such requirements of cup anemometers is two EU projects SITEPARIDEN and CLASSCUP from which the proposed classification method for cup anemometers was developed for the IEC standard. While cup anemometers at present are the standard anemometer being used for average wind speed measurements, sonic anemometers have been developed significantly over the last years, and prices have come down. The application of sonic anemometers may increase in wind energy if they prove to have comparable or better operational characteristics compared to cup anemometers, and if similar requirements to sonic anemometers are established as for cup anemometers. Sonic anemometers have historically been used by meteorologists for turbulence measurements, but have also found a role on wind turbine nacelles for wind speed and yaw control purposes. The report on cup and sonic anemometry deals with establishment of robustness in assessment and classification by focus on methods and procedures for analysis of characteristics of cup and sonic anemometers. The methods and procedures provide a platform, hopefully for use in meeting the requirements of the IEC standard on power performance measurements, as well as for development of improved instruments. (au)

  13. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.

    Science.gov (United States)

    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal

    2016-04-01

    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed. PMID:26838420

  14. Sustainable Development of the Cement Industry and Blended Cements to Meet Ecological Challenges

    OpenAIRE

    Konstantin Sobolev

    2003-01-01

    The world production of cement has greatly increased in the past 10 years. This trend is the most significant factor affecting technological development and the updating of manufacturing facilities in the cement industry. Existing technology for the production of cement clinker is ecologically damaging; it consumes much energy and natural resources and also emits pollutants. A new approach to the production of blended or high-volume mineral additive (HVMA) cement helps to improve its ecologi...

  15. Global Cement Industry: Competitive and Institutional Dimensions

    OpenAIRE

    Selim, Tarek; Salem, Ahmed

    2010-01-01

    The cement industry is a capital intensive, energy consuming, and vital industry for sustaining infrastructure of nations. The international cement market –while constituting a small share of world industry output—has been growing at an increasing rate relative to local production in recent years. Attempts to protect the environment in developed countries –especially Europe—have caused cement production plants to shift to countries with less stringent environmental regulations. Along with con...

  16. Characterization of cement composites with mineral additives

    OpenAIRE

    Korat, Lidija

    2015-01-01

    Doctoral dissertation is aimed at characterizing cement composites with mineral additives representing the industrial waste material (fly ash, granulated blast furnace slag and biomass fly ash). Their usage can replace high cement shares in individual cases and is, however, favourable due to the production costs reduction and environment burden decrease, including the decreased emission of greenhouse gases as well as lower energy use. Cement composites (in fresh or hardened state)...

  17. Premixed calcium silicate cement for endodontic applications

    OpenAIRE

    Persson, Cecilia; Engqvist, Håkan

    2011-01-01

    Calcium silicate-based materials (also called MTA) are increasingly being used in endodontic applications. However, the handling properties of MTA are not optimal when it comes to injectability and cohesion. Premixing the cements using glycerol avoids these issues. However, there is a lack of data on the effect of common cement variables on important properties of premixed cements for endodontic applications. In this study, the effects of liquid-to-powder ratio, amount of radiopacifier and am...

  18. Water dynamics in glass ionomer cements

    Science.gov (United States)

    Berg, M. C.; Jacobsen, J.; Momsen, N. C. R.; Benetti, A. R.; Telling, M. T. F.; Seydel, T.; Bordallo, H. N.

    2016-07-01

    Glass ionomer cements (GIC) are an alternative for preventive dentistry. However, these dental cements are complex systems where important motions related to the different states of the hydrogen atoms evolve in a confined porous structure. In this paper, we studied the water dynamics of two different liquids used to prepare either conventional or resin-modified glass ionomer cement. By combining thermal analysis with neutron scattering data we were able to relate the water structure in the liquids to the materials properties.

  19. Numerical Model for the Lateral Compression Response of a Plastic Cup

    OpenAIRE

    Dapic, Ignacio

    2003-01-01

    A numerical analysis based on the finite element method is developed to simulate the mechanical response of a typical sixteen-ounce plastic drink cup subjected to a lateral compressive load. The aim of the analysis is to simulate a test in which the cup is supported horizontally in a fixture on a testing machine platen, and a loading nose attached to the actuator is displaced downward into the cup. The numerical model is developed using the software packages MSC.Patran, ABAQUS/CAE, and ABAQUS...

  20. Perceptual elements in Penn & Teller’s “Cups and Balls” magic trick

    Directory of Open Access Journals (Sweden)

    Hector Rieiro

    2013-02-01

    Full Text Available Magic illusions provide the perceptual and cognitive scientist with a toolbox of experimental manipulations and testable hypotheses about the building blocks of conscious experience. Here we studied several sleight-of-hand manipulations in the performance of the classic “Cups and Balls” magic trick (where balls appear and disappear inside upside-down opaque cups. We examined a version inspired by the entertainment duo Penn & Teller, conducted with three opaque and subsequently with three transparent cups. Magician Teller used his right hand to load (i.e. introduce surreptitiously a small ball inside each of two upside-down cups, one at a time, while using his left hand to remove a different ball from the upside-down bottom of the cup. The sleight at the third cup involved one of six manipulations: (a standard maneuver, (b standard maneuver without a third ball, (c ball placed on the table, (d ball lifted, (e ball dropped to the floor, and (f ball stuck to the cup. Seven subjects watched the videos of the performances while reporting, via button press, whenever balls were removed from the cups/table (button “1” or placed inside the cups/on the table (button “2”. Subjects’ perception was more accurate with transparent than with opaque cups. Perceptual performance was worse for the conditions where the ball was placed on the table, or stuck to the cup, than for the standard maneuver. The condition in which the ball was lifted displaced the subjects’ gaze position the most, whereas the condition in which there was no ball caused the smallest gaze displacement. Training improved the subjects’ perceptual performance. Occlusion of the magician’s face did not affect the subjects’ perception, suggesting that gaze misdirection does not play a strong role in the Cups and Balls illusion. Our results have implications for how to optimize the performance of this classic magic trick, and for the types of hand and object motion that

  1. Design and Application on Auto-vending Machine for Cupped Beverage

    OpenAIRE

    Xiaowei Jiang; Yonghong Sun

    2014-01-01

    The purpose of this study is to design an auto-vending machine for cupped beverage, specifically studying its shape design and color design. The article elaborates that the shape design of this auto-vending machine for cupped beverage should follow the art rule of variation and unity and meanwhile the whole shape still should be simple and direct; the color design of the auto-vending machine for cupped beverage not only should satisfy the request of man-machine coordination and environment an...

  2. Retention of Root Canal Posts: Effect of Cement Film Thickness, Luting Cement, and Post Pretreatment.

    Science.gov (United States)

    Sahafi, A; Benetti, A R; Flury, S; Peutzfeldt, A

    2015-01-01

    The aim of this study was to investigate the effect of the cement film thickness of a zinc phosphate or a resin cement on retention of untreated and pretreated root canal posts. Prefabricated zirconia posts (CosmoPost: 1.4 mm) and two types of luting cements (a zinc phosphate cement [DeTrey Zinc] and a self-etch adhesive resin cement [Panavia F2.0]) were used. After removal of the crowns of 360 extracted premolars, canines, or incisors, the root canals were prepared with a parallel-sided drill system to three different final diameters. Half the posts did not receive any pretreatment. The other half received tribochemical silicate coating according to the manufacturer's instructions. Posts were then luted in the prepared root canals (n=30 per group). Following water storage at 37°C for seven days, retention of the posts was determined by the pull-out method. Irrespective of the luting cement, pretreatment with tribochemical silicate coating significantly increased retention of the posts. Increased cement film thickness resulted in decreased retention of untreated posts and of pretreated posts luted with zinc phosphate cement. Increased cement film thickness had no influence on retention of pretreated posts luted with resin cement. Thus, retention of the posts was influenced by the type of luting cement, by the cement film thickness, and by the post pretreatment. PMID:25764045

  3. The mechanical effects of different levels of cement penetration at the cement-bone interface.

    NARCIS (Netherlands)

    Waanders, D.; Janssen, D.; Mann, K.A.; Verdonschot, N.J.J.

    2010-01-01

    The mechanical effects of varying the depth of cement penetration in the cement-bone interface were investigated using finite element analysis (FEA) and validated using companion experimental data. Two FEA models of the cement-bone interface were created from micro-computed tomography data and the p

  4. The influence of ultrasound on removal of prefabricated metal post cemented with different resin cements

    Directory of Open Access Journals (Sweden)

    Atiyeh Feiz

    2013-01-01

    Conclusion: Ultrasonic energy did not decrease the retention of posts cemented with Panavia or Maxcem Elite cements. Furthermore, it seems that there is no significant difference between removal force of self-etch (Panavia and the self-etch self-adhesive (Maxcem Elite resin cements.

  5. A new method to analyze copolymer based superplasticizer traces in cement leachates.

    Science.gov (United States)

    Guérandel, Cyril; Vernex-Loset, Lionel; Krier, Gabriel; De Lanève, Michel; Guillot, Xavier; Pierre, Christian; Muller, Jean François

    2011-03-15

    Enhancing the flowing properties of fresh concrete is a crucial step for cement based materials users. This is done by adding polymeric admixtures. Such additives have enabled to improve final mechanicals properties and the development of new materials like high performance or self compacting concrete. Like this, the superplasticizers are used in almost cement based materials, in particular for concrete structures that can have a potential interaction with drinking water. It is then essential to have suitable detection techniques to assess whether these organic compounds are dissolved in water after a leaching process or not. The main constituent of the last generation superplasticizer is a PolyCarboxylate-Ester copolymer (PCE), in addition this organic admixture contains polyethylene oxide (free PEO) which constitutes a synthesis residue. Numerous analytical methods are available to characterize superplasticizer content. Although these techniques work well, they do not bring suitable detection threshold to analyze superplasticizer traces in solution with high mineral content such as leachates of hardened cement based materials formulated with superplasticizers. Moreover those techniques do not enable to distinguish free PEO from PCE in the superplasticizer. Here we discuss two highly sensitive analytical methods based on mass spectrometry suitable to perform a rapid detection of superplasticizer compounds traces in CEM I cement paste leachates: MALDI-TOF mass spectrometry, is used to determine the free PEO content in the leachate. However, industrial copolymers (such as PCE) are characterized by high molecular weight and polymolecular index. These two parameters lead to limitation concerning analysis of copolymers by MALDI-TOFMS. In this study, we demonstrate how pyrolysis and a Thermally assisted Hydrolysis/Methylation coupled with a triple-quadrupole mass spectrometer, provides good results for the detection of PCE copolymer traces in CEM I cement paste

  6. Case Study of the California Cement Industry

    OpenAIRE

    Coito, Fred; Powell, Frank; Worrell, Ernst; Price, Lynn; Friedmann, Rafael

    2005-01-01

    California is the largest cement producing state in the U.S., accounting for between 10 percent and 15 percent of U.S. cement production and cement industry employment. The cement industry in California consists of 31 sites that consume large amounts of energy, annually: 1,600 GWh of electricity, 22 million therms of natural gas, 2.3 million tons of coal, 0.25 tons of coke, and smaller amounts of waste materials, including tires. The case study summarized in this paper focused on providi...

  7. Shrinkage Properties of Cement Stabilized Gravel

    DEFF Research Database (Denmark)

    Lund, Mia Schou Møller; Hansen, Kurt Kielsgaard

    2014-01-01

    Cement stabilized gravel is an attractive material in road construction because its strength prop-erties are accommodating the increasingly higher requirements to the bearing capacity of a base course. However, reflection cracking of cement stabilized gravel is a major concern. In this pa......-per the shrinkage properties of cement stabilized gravel have been documented under various temperature and relative humidity conditions. Two cement contents corresponding to a 28-days compressive strength of 6.2 MPa and 12.3 MPa have been tested and compared. It is found that the coefficient of linear expansion...

  8. Immobilisation of radwaste in cement based matrices

    International Nuclear Information System (INIS)

    The solubilities and influence on cement pH are reported for calcium aluminate and aluminosulphate hydrates. The solubility of Ca(OH)2 is reported to 700 bars. Polymerization of C-S-H is investigated by NMR. Specific interactions of U6+ and iodine (I-, IO3-) with cement components are described. The impact of radiation on cements and the influence of higher temperature are documented. The role of dissolved Ca and CO2 in groundwaters as dissolution media for cements are reported. (author)

  9. Acoustic evaluation of cementing quality using obliquely incident ultrasonic signals

    Institute of Scientific and Technical Information of China (English)

    Duan Wen-Xing; Qiao Wen-Xiao; Che Xiao-Hua; Xie Hui

    2014-01-01

    Ultrasonic cement bond logging is a widely used method for evaluating cementing quality. Conventional ultrasonic cement bond logging uses vertical incidence and cannot accurately evaluate lightweight cement bonding. Oblique incidence is a new technology for evaluating cement quality with improved accuracy for lightweight cements. In this study, we simulated models of acoustic impedance of cement and cementing quality using ultrasonic oblique incidence, and we obtained the relation between cementing quality, acoustic impedance of cement, and the acoustic attenuation coeffi cient of the A0-mode and S0-mode Lamb waves. Then, we simulated models of different cement thickness and we obtained the relation between cement thickness and the time difference of the arrival between the A0 and A0′ modes.

  10. Design and manufacture of Portland cement Application of statistical analysis

    OpenAIRE

    Svinning, Ketil

    2011-01-01

    The purpose of the work is to enable design and manufacture of cement with emphasis on the quality and the properties of cement. Data used in the design and manufacture were collected from predictions of properties and characteristics of cement. The properties of cement were predicted from its characteristics and from the production conditions in cement kiln and mill. The cement characteristics were in some investigations predicted from the production conditions. The design was based on sensi...

  11. Polyethylene glycol-grafted polystyrene particles

    NARCIS (Netherlands)

    Meng, Fenghua; Engbers, Gerard H.M.; Feijen, Jan

    2004-01-01

    Densely pegylated particles that can serve as a model system for artificial cells were prepared by covalently grafting amino polyethylene glycol (PEG, molecular weight 3400 or 5000) onto carboxyl polystyrene particles (PS-COOH) using carbodiimide chemistry. PEG-modified particles (PS-PEG) were chara

  12. Evaluation of Paulownia elongata wood polyethylene composites

    Science.gov (United States)

    Paulownia wood flour (PWF), a byproduct of milling lumber, was employed as a bio-filler and blended with high density polyethylene (HDPE) via extrusion. Paulownia wood (PW) shavings were milled through a 1-mm screen then separated via shaking into various particle fractions using sieves (#30 - < #2...

  13. Dynamic compressive behavior of foamed polyethylene film

    Directory of Open Access Journals (Sweden)

    Tateyama Kohei

    2015-01-01

    Full Text Available The foamed film as the shock absorption material has attracted much attention because it is thin (100 μm ∼ 400 μm and has a closed cell structure. However, the dynamic mechanical properties have not been reported in the foamed film. The purpose of this study is to elucidate the compressive behavior of the foamed polyethylene film at the wide strain rate range. First, the new compressive test apparatus for the dynamic strain rate, the drop-weight testing machine with opposed load cell, was developed, which can be also evaluated the dynamic stress equilibrium of the specimen. It is confirmed that the compressive flow stress increased with increasing the strain rate, regardless of the film thickness. The foamed polyethylene film has the high strain rate sensitivity in the quasi-static deformation. On the other hand, there is almost no change of the strain rate sensitivity in the dynamic and the impact deformation. In order to investigate the mechanism of strain rate dependence, the foamed polyethylene film was observed by X-ray computed tomography scanner before and after compressive test. The fracture of the closed cell only occurred in the quasi-static deformation. It was clarified that the strain rate sensitivity of the foamed film depends strongly on that of the construction material, polyethylene.

  14. Structure and morphology of the polyaniline / polyethylene terephthalate / polyaniline films

    OpenAIRE

    Hnizdyukh, Yulya; Zastavs?ka, Galyna; Yatsyshyn, ?ykhaylo

    2013-01-01

    It was investigated the possibility of the modifying of polyethylene \\ terephtalate films substrates by polyaniline during chemical oxidative polycondensation under the different concentrations of aniline in 0.5 M citrate acid aqueous solution. Structure and morphology of bilateral polyaniline films on polyethylene terephtalate substrates (polyaniline / polyethylene terephtalate / polyaniline) has been studied by UVvisible and FTIR spectroscopy, X-ray diffraction analysis, optical microscopy ...

  15. Radiation-crosslinked polyethylene for wire and cable applications

    Science.gov (United States)

    Ueno, Keiji; Uda, Ikujiro; Tada, Shotaro

    Polyethylene is used as an insulation material for wires and cables because of its excellent electrical properties. Polyethylene is also a typical irradiated crosslinked polymer. The characteristics of irradiated polyethylene, the effects of density, molecular weight and so on, were studied.

  16. Antibacterial activity of selected glass ionomer cements

    Directory of Open Access Journals (Sweden)

    Elżbieta Łuczaj-Cepowicz

    2014-01-01

    Full Text Available Introduction: The aim of the paper was to determine the antibacterial activity of four glass ionomer cements against bacteria of the genera Streptococcus and Lactobacillus. Material and methods: Four capsulated glass ionomer cements were applied in the study: Fuji Triage (GC, Fuji IX (GC, Ketac Molar (3M Espe and Ketac Silver (3M Espe. Four standard bacterial strains were used to assess the antibacterial activity of the studied cements: Streptococcus mutans, S. sanguis, S. salivarius and Lactobacillus casei. The antibacterial activity was determined by the agar diffusion method. The bacterial suspension was spread with a cotton swab on TSA plates. For each material six wells (7 mm diameter, 5 mm deep were made with a cork borer. Each well was then filled with freshly prepared cements. The results were obtained by measuring the bacterial growth inhibition zone after 1, 2, 3 and 7 days. Results: Fuji Triage cement inhibited the growth of all bacterial strains. Fuji IX cement demonstrated the most potent antibacterial activity against S. sanguis. Ketac Molar showed antibacterial activity against S. sanguis and S. salivarius, whereas Ketac Silver was efficient against S. mutans as well. Neither of the Ketac cements inhibited growth of the standard L. casei strain. Discussion: Antibacterial activity of glass ionomer cements has attracted the interest of scientists in recent years. Most authors, including us, carried out experiments using the agar diffusion method and demonstrated antibacterial activity of glass ionomer cements. Different antibacterial activity of glass ionomer cements, observed in our study and studies of other authors, depended on the evaluated cement, bacterial strain and period of evaluation.

  17. Rheological and mechanical properties of recycled poly(ethylene terephtalate)/high density polyethylene blends

    OpenAIRE

    Guessoum M.; Medjdoub N.; Nekkaa S.; Haddaoui N.

    2013-01-01

    Triphenylphosphite (TPP) has been used as a chain extender to regenerate polyethylene terephtalate (PET) and high density polyethylene (HDPE) wastes and to improve the properties of PET/HDPE system based on recycled materials. TPP incorporation in PET and HDPE showed a noticeable increase of the torque as a function of the mixing time and proved that the degradation reactions are considerably decreased. In the case of PET/ HDPE blends, the increase of the torque was strongly dependent on the ...

  18. Microscopic evaluation regarding time behavior of orthodontic cements used for disjunctor cementing

    Directory of Open Access Journals (Sweden)

    Ruxandra Bartok

    2015-11-01

    Full Text Available In order to fulfill their function, orthodontic devices must be cemented on teeth using orthodontic rings. The retention of the orthodontic ring is influenced mainly by the type of dental-ring adhesion. This study was initiated to determine possible microleakage events while using zinc phosphate cement Adhesor (Spofa Dental, conventional glass ionomer Ketac Cem (3M ESPE and Fuji Ortho (GC and a compomer Transbond Plus (3M Unitek. The results of the study are consistent with those reported in the literature reference, the compomer is the preferred adhesive material for cementing the orthodontic rings, compared to conventional glass ionomer cements and zinc-phosphate cement.

  19. Consolidation behavior of cement-and lime/cement-mixed column foundations

    Institute of Scientific and Technical Information of China (English)

    蔡袁强; 徐长节

    2002-01-01

    The consolidation behavior of mixed in place cement- and lime/cement-mixed column was studied. Consolidation of the composite foundation was modeled as a three-dimensional axi-symmetric problem. The authors used the finite difference method to obtain the pore pressure variation with time at any location below the surface. A computer program developed by the authors was used to draw some interesting conclusions about the consolidation behaviors of cement- and lime/cement-mixed pile foundation. Finally, a combined model including the permeability coefficients of cement-mixed piles and soil, was studied and its feasibility was evaluated.

  20. Forecasting a winner for Malaysian Cup 2013 using soccer simulation model

    Science.gov (United States)

    Yusof, Muhammad Mat; Fauzee, Mohd Soffian Omar; Latif, Rozita Abdul

    2014-07-01

    This paper investigates through soccer simulation the calculation of the probability for each team winning Malaysia Cup 2013. Our methodology used here is we predict the outcomes of individual matches and then we simulate the Malaysia Cup 2013 tournament 5000 times. As match outcomes are always a matter of uncertainty, statistical model, in particular a double Poisson model is used to predict the number of goals scored and conceded for each team. Maximum likelihood estimation is use to measure the attacking strength and defensive weakness for each team. Based on our simulation result, LionXII has a higher probability in becoming the winner, followed by Selangor, ATM, JDT and Kelantan. Meanwhile, T-Team, Negeri Sembilan and Felda United have lower probabilities to win Malaysia Cup 2013. In summary, we find that the probability for each team becominga winner is small, indicating that the level of competitive balance in Malaysia Cup 2013 is quite high.

  1. HIE-ISOLDE Faraday cups tested with ion beams at TRIUMF

    CERN Document Server

    Cantero, E D

    2014-01-01

    The future HIE-ISOLDE Faraday cups for both the intercryomodule regions and the HEBTs have been tested using 34S+7, 4He+, 23Na+6 and 20Ne+5 beams from the ISAC-II accelerator at TRIUMF. Their performance has been characterized together with the Faraday cups from REX-ISOLDE and those from ISAC-II. The measurements were done at E/A = 1.5, 2.85 and 5.5 MeV/u, with beam intensities in the range of 100 pA to 4 nA. The performance of these Faraday cups has been compared under the same beam conditions for different bias voltages up to -350 V. Within the experimental uncertainties, most of them coming from fluctuations in beam intensity, all devices showed similar results. Biasing the Faraday cup repeller ring to voltages of at least -60 V, the escape of secondary electrons was suppressed.

  2. Clinical Observation of 82 Cases of Enuresis Treated by Ginger-partitioned Moxibustion plus Cupping Therapy

    Institute of Scientific and Technical Information of China (English)

    ZHU Wei-ping; HUANG Guo-qi

    2003-01-01

    Purpose: To observe the clinical therapeutic effect in the treatment of enuresis by ginger-partitioned moxibustion plus cupping therapy. Methods: Ginger-par -titioned moxibustion was applied on Guanyuan (CV 4)and bilateral Zusanli (ST 36) and cupping therapy was applied on Shenque (CV 8) in the treatment of 82 cases of enuresis, in comparison with 76 cases treated by Chinese herbal medicine. Results: The effective rate was 84.1% in the treatment by ginger-partitioned moxibustion plus cupping therapy and was 64.5% in the treatment by Chinese herbal medicine. Conclusion: Ginger-partitio -ned moxibustion plus cupping therapy was better than Chinese herbal medicine in the treatment of enuresis (P <0.05).

  3. Design and Application on Auto-vending Machine for Cupped Beverage

    Directory of Open Access Journals (Sweden)

    Xiaowei Jiang

    2014-12-01

    Full Text Available The purpose of this study is to design an auto-vending machine for cupped beverage, specifically studying its shape design and color design. The article elaborates that the shape design of this auto-vending machine for cupped beverage should follow the art rule of variation and unity and meanwhile the whole shape still should be simple and direct; the color design of the auto-vending machine for cupped beverage not only should satisfy the request of man-machine coordination and environment and function, but also should value the choice of tone, match the new age request of appreciation beauty and notice novelty. And then the working principle and working process of the auto-vending machine for cupped beverage is introduced, based on which the conclusion has been reached.

  4. Region-based multi-step optic disk and cup segmentation from color fundus image

    Science.gov (United States)

    Xiao, Di; Lock, Jane; Manresa, Javier Moreno; Vignarajan, Janardhan; Tay-Kearney, Mei-Ling; Kanagasingam, Yogesan

    2013-02-01

    Retinal optic cup-disk-ratio (CDR) is a one of important indicators of glaucomatous neuropathy. In this paper, we propose a novel multi-step 4-quadrant thresholding method for optic disk segmentation and a multi-step temporal-nasal segmenting method for optic cup segmentation based on blood vessel inpainted HSL lightness images and green images. The performance of the proposed methods was evaluated on a group of color fundus images and compared with the manual outlining results from two experts. Dice scores of detected disk and cup regions between the auto and manual results were computed and compared. Vertical CDRs were also compared among the three results. The preliminary experiment has demonstrated the robustness of the method for automatic optic disk and cup segmentation and its potential value for clinical application.

  5. Announcement on the 9th FOSECO Cup for Excellent Foundry Papers (2006)

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ The final evaluation of the 9th FOSECO Cup for Excellent Foundry Papers (2006) organized by Foundry Institution of Chinese Mechanical Engineering Society (FICMES) was carried out on April 14-17, 2007 in Guilin, Guangxi Zhuang Autonomous Region.

  6. Announcement on the 10th FOSECO Cup for Excellent Foundry Papers (2007)

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ The final evaluation of the 10th FOSECO Cup for Excellent Foundry Papers (2007) organized by Foundry Institution of Chinese Mechanical Engineering Society (FICMES) was carried out on July 21-24, 2008 in Guiyang, Guizhou province.

  7. An overview of systematic reviews of clinical evidence for cupping therapy

    Directory of Open Access Journals (Sweden)

    Huijuan Cao

    2015-01-01

    Conclusions: Cupping therapy may be beneficial for pain-related conditions, acne, and facial paralysis. However, a firm conclusion could not be drawn due to the insufficient number of included reviews and the low quality of the original studies.

  8. Application of rare- earth and nano elements on diamond cup wheels

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Diamond cup wheel is used widely as an important tool for machining ceramic tile. In this paper,nano rare - earth oxide and nano carbide were added in the segments of seven kinds of diamond cup wheels.The performance of diamond cup wheels were tested on a special designed test machine by grinding two kinds of ceramic tiles. The surface morphology of the segments was examined by Scanning Election Microscopy (SEM) and the micro-hardness of segments was measured. The results showed that nano rare-earth oxide and nano carbide can fine segment micro structure, make grain boundary clear and increase grasping of diamond grits. They can increase also the wear resistance of diamond cup wheels as well as the grinding ratio.

  9. Microbial analysis of biofilms on cement surfaces: An investigation in cement-associated peri-implantitis.

    Science.gov (United States)

    Korsch, Michael; Walther, Winfried; Marten, Silke-Mareike; Obst, Ursula

    2014-09-05

    The cementation of implant-supported restorations always poses the risk of excess cement retained in the peri-implant sulcus despite careful clinical control. Excess cement can become the basis of colonization by oral microorganisms. As a result of the biofilm formation peri-mucositis or peri-implantitis may develop. Complications were observed in the routine prosthetic restoration of implants when a methacrylate-based cement was used. These developed a few weeks after cementation of the suprastructure and caused bleeding on probing as well as suppuration from the peri-implant tissue. In the revision therapy, excess cement in the peri-implant sulcus was found in many cases. This excess cement was sampled from ten patients and investigated for biofilm formation. For this purpose, the cement samples were collected and analyzed for bacterial in situ colonization by 16S rDNA-based methods. In laboratory experiments, the methacrylate-based cement and two other dental cements were then investigated for their proneness to form biofilm. The results of the in situ and in vitro investigations revealed a strong tendency towards bacterial invasion of the methacrylate-based cement by opportunistic species and pathogens.

  10. Faraday Cup - it is used to measure beam intensities at low energy beams.

    CERN Multimedia

    Maximilien Brice

    2005-01-01

    A Faraday Cup is used to measure beam intensities at low energy beams. An electrically isolated metallic electrode intercepts the beam and captures all its charges. These charges are integrated using an current sensitive amplifier. When the beam impinges onto the electrode surface low energy electrons are liberated. In order to prevent these electrons from escaping the cup and thus falsifying the measurement, a repeller electrode with negative potential pushes the electrons back onto the electrode.

  11. Values and marketing communication with fragmented markets : Case study in the UEFA Euro Cup 2012

    OpenAIRE

    Koljonen, Saana

    2013-01-01

    The fundamental idea behind the research problem of the thesis is marketing communication with fragmented markets. The purpose of the study was to discover if consumer values could enrich customer segmentation and marketing communication. This study examines three research questions: what kind of values football fans have, what kind of values UEFA communicated in the Euro Cup 2012 and to what extend these values met. The study was conducted in UEFA Euro Cup 2012 in Gdansk, Poland 13....

  12. Effects of wet-cupping on blood pressure in hypertensive patients:a randomized controlled trial

    Institute of Scientific and Technical Information of China (English)

    Nouran A Aleyeidi; Khaled S Aseri; Shadia M Matbouli; Albaraa A Sulaiamani; Sumayyah A Kobeisy

    2015-01-01

    BACKGROUND: Although cupping remains a popular treatment modality worldwide, its efficacy for most diseases, including hypertension, has not been scientifical y evaluated. OBJECTIVE: We aimed to determine the efficacy of wet-cupping for high blood pressure, and the incidence of the procedure’s side effects in the intervention group. DESIGN, SETTING, PARTICIPANTS AND INTERVENTIONS: This is a randomized control ed trial conducted in the General Practice Department at King Abdulaziz University Hospital, Jeddah, Saudi Arabia, between May 2013 and February 2014. There were two groups (40 participants each):intervention group undergoing wet-cupping (hijama) in addition to conventional hypertension treatment, and a control group undergoing only conventional hypertension treatment. Three wet-cupping sessions were performed every other day. MAIN OUTCOME MEASURE: The mean systolic and diastolic blood pressures were measured using a validated automatic sphygmomanometer. The fol ow-up period was 8 weeks. RESULTS: Wet-cupping provided an immediate reduction of systolic blood pressure. After 4 weeks of fol ow-up, the mean systolic blood pressure in the intervention group was 8.4 mmHg less than in the control group (P = 0.046). After 8 weeks, there were no significant differences in blood pressures between the intervention and control groups. In this study, wet-cupping did not result in any serious side effects. CONCLUSION: Wet-cupping therapy is effective for reducing systolic blood pressure in hypertensive patients for up to 4 weeks, without serious side effects. Wet-cupping should be considered as a complementary hypertension treatment, and further studies are needed. TRIAL REGISTRATION: ClinicalTrials.gov Identifier NCT01987583.

  13. Football and sex: The 2006 FIFA World Cup and sex trafficking

    OpenAIRE

    Milivojević Sanja; Pickering Sharon

    2008-01-01

    The staging of the 2006 Federation of International Football Association (FIFA) World Cup brought together a wide ranging coalition of interests in fuelling a moral panic around sex trafficking in Europe. This coalition of diverse groups aimed to protect innocent third world women and prevent organized crime networks from luring them into the sex industry. In this article we will argue that as a result of increased attention prior to the World Cup 'protective measures' imposed by nation-state...

  14. FIFA Women's World Cup 2011: Pre-Competition Medical Assessment of female referees and assistant referees

    OpenAIRE

    Keller, Dagmar I; Bizzini, Mario; Feddermann, Nina; Junge, Astrid; Dvorak, Jiri

    2013-01-01

    BACKGROUND: Precompetition screening was implemented for male referees during the 2010 Fédération Internationale de Football Association (FIFA) Word Cup. In contrast, female football referees have been neglected in this respect although they experience similar physical work loads compared to male referees. METHODS: The standardised football-specific Pre-Competition Medical Assessment (PCMA) was performed in 51 referees and assistant referees selected for the 2011 FIFA Women's World Cup. RES...

  15. 教你正确用(二十八)%A Cup of English

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ Holidays--美国的节假日(上) My favorite days are, of course,holidays.On those days ,I don't have to go to workand can put my up feet to enjoy a cup of tea and catch up with the writing of "A Cup ofEnglish."There are many holidays in the U.s.,on some of which you can take a day off but on others you can't.

  16. The influence of cement type and temperature on chloride binding in cement paste

    DEFF Research Database (Denmark)

    Jensen, Ole Mejlhede; Korzen, Migge Sofie Hoffmann; Skibsted, Jørgen

    1998-01-01

    cement clinker. Both theoretical considerations and experimental data for chloride binding in cement pastes are presented. A physico-chemically based model to describe the influence of temperature on physical binding of chloride is presented. Solid-state 27Al and 29Si magic-angle spinning (MAS) nuclear......This paper describes effects of cement type and temperature on chloride binding in cement paste, which is an important subject in relation to life-time modelling of reinforced concrete structures. The influence of cement type on chloride binding is investigated by substituting cement with pure...... magnetic resonance (NMR) spectroscopy has been used for quantification of the anhydrous and hydrated aluminate and silicate phases in the chloride exposed cement pastes. The 27Al isotropic chemical shift and nuclear quadrupole coupling is reported for a synthetic sample of Friedel's salt, Ca2Al(OH)6Cl×2H2O....

  17. Copper Slag Blended Cement: An Environmental Sustainable Approach for Cement Industry in India

    Directory of Open Access Journals (Sweden)

    Jagmeet Singh

    2016-04-01

    Full Text Available Indian cement industry is facing environmental issue of emission of carbon dioxide (CO2, a greenhouse gas. Blended cements including supplementary cementitious materials are substitute of Portland cement to reduce CO2 emission. The present paper investigates theappropriateness of copper slag (CS as supplementary cementitious material. Strength properties and hydration of mixes were determined at different replacement levels of CS with cement. Compressive, flexural and tensile strength of each mix was found out at different curing periods. The hydration of cement was investigated through X-ray diffraction (XRD. The strength test results showed that substitution of up to 20% of CS can significantly replace Portland cement.XRD test results were corresponding to strength test results. The present study encourages the utilization of CS as supplementary cementitious material to make economical and environmentally sustainable blended cement

  18. Cements in radioactive waste management. Characterization requirements of cement products for acceptance and quality assurance purposes

    International Nuclear Information System (INIS)

    Cementitious materials are used as immobilizing matrices for low (LLW) and medium-level wastes (MLW) and are also components of the construction materials in the secondary barriers and the repositories. This report has concerned itself with a critical assessment of the quality assurance aspects of the immobilization and disposal of MLW and LLW cemented wastes. This report has collated the existing knowledge of the use and potential of cementitious materials in radioactive waste immobilization and highlighted the physico-chemical parameters. Subject areas include an assessment of immobilization objectives and cement as a durable material, waste stream and matrix characterization, quality assurance concepts, nature of cement-based systems, chemistry and modelling of cement hydration, role and effect of blending agents, radwaste-cement interaction, assessment of durability, degradative and radiolytic processes in cements and the behaviour of cement-based matrices and their near-field interactions with the environment and the repository conditions

  19. Alternative Fuels in Cement Production

    DEFF Research Database (Denmark)

    Larsen, Morten Boberg

    in particular is influenced by insufficient carbon burnout in the calciner system, which results in reducing conditions in the material inlet of the rotary kiln and consequently an increased tendency to form deposits induced by sticky eutectic melts. Clinker quality is mainly affected by minor components from...... a decisive influence on the fuel carbon burnout in cement kiln systems. The oxidation kinetics of a char from TDF was investigated experimentally and by mathematical modelling. Experiments were performed in a fixed bed reactor under well - iii - defined conditions, where small particles (102-212μm) of TDF...

  20. A note on cement in asteroids

    Science.gov (United States)

    Bilalbegović, G.

    2016-09-01

    Cement mineral tobermorite was formed in hydrothermal experiments on alternation of calcium-aluminum-rich inclusions (CAIs) in carbonaceous chondrite meteorites. Unidentified bands at 14 μm were measured for CAIs and the matrix of the Allende meteorite sample, as well as for Hektor and Agamemnon asteroids. The presence of cement nanoparticles may explain the feature at 14 μm.

  1. Basic Chemistry for the Cement Industry.

    Science.gov (United States)

    Turner, Mason

    This combined student workbook and instructor's guide contains nine units for inplant classes on basic chemistry for employees in the cement industry. The nine units cover the following topics: chemical basics; measurement; history of cement; atoms; bonding and chemical formulas; solids, liquids, and gases; chemistry of Portland cement…

  2. Investigation of a Hardened Cement Paste Grout

    DEFF Research Database (Denmark)

    Esteves, Luis Pedro; Sørensen, Eigil Verner

    This report documents a series of tests performed on a hardened cement paste grout delivered by the client, Det Norske Veritas A/S.......This report documents a series of tests performed on a hardened cement paste grout delivered by the client, Det Norske Veritas A/S....

  3. A note on cement in asteroids

    CERN Document Server

    Bilalbegovic, G

    2016-01-01

    Cement mineral tobermorite was formed in hydrothermal experiments on alternation of calcium-aluminum-rich inclusions (CAIs) in carbonaceous chondrite meteorites. Unidentified bands at 14 microns were measured for CAIs and the matrix of the Allende meteorite sample, as well as for Hektor and Agamemnon asteroids. The presence of cement nanoparticles may explain the feature at 14 microns.

  4. Chloride ingress in cement paste and mortar

    DEFF Research Database (Denmark)

    Jensen, Ole Mejlhede; Hansen, Per Freiesleben; Coats, Alison M.;

    1999-01-01

    In this paper chloride ingress in cement paste and mortar is followed by electron probe microanalysis. The influence of several paste and exposure parameters on chloride ingress are examined (e.g., water-cement ratio, silica fume addition, exposure time, and temperature), The measurements...

  5. A Pause for China's Cement Industry

    Institute of Scientific and Technical Information of China (English)

    Li Zhen

    2009-01-01

    @@ Cement industry suffers excess productionWith the advent of global financial crisis,the Chinese government has laid out a stimulus package on infrastructure construction.Driven by the investment spree,China's cement makers are flocking to expand output capacity,which is now leading the industry into a much-higher-thanneeded state.

  6. Study on simulation and experiment of array micro Faraday cup ion detector for FAIMS

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    An array micro Faraday cup ion detector for FAIMS (High-field Asymmetric Waveform Ion Mobility Spectrometry) was introduced, with which the size of the FAIMS system was reduced. With simple structure, good stability, low noise, large measurements range, this detector can work under the condition of atmospheric pressure. The array micro Faraday cup was composed of gate electrode, sensitive electrode and shielding electrode. The sensitive electrode was made of tens of crossing silicon columns with diameter of 200 μm. It was fabricated through typical MEMS technology, which was compatible completely with plane FAIMS. It was shown from FLUENT simulation result that the resistance to gas motion was low and the flow field distribution was helpful for full absorption of the ion in this array design. Through electricity simulation, the method to reduce interference on the detection signal of the micro Faraday cup was given out. Connecting with KEITHLEY 237 ampere meter, the noise level of the array micro Faraday cup was lower than 0.5 pA. The output signal of the acetone sample measured by experiment was about 210 pA. Through contrast experiment, the design parameter of the micro Faraday cup was obtained primarily. This array micro Faraday cup can meet the requirements of the FAIMS system.

  7. The RoboCup Mixed Reality League - A Case Study

    Science.gov (United States)

    Gerndt, Reinhard; Bohnen, Matthias; da Silva Guerra, Rodrigo; Asada, Minoru

    In typical mixed reality systems there is only a one-way interaction from real to virtual. A human user or the physics of a real object may influence the behavior of virtual objects, but real objects usually cannot be influenced by the virtual world. By introducing real robots into the mixed reality system, we allow a true two-way interaction between virtual and real worlds. Our system has been used since 2007 to implement the RoboCup mixed reality soccer games and other applications for research and edutainment. Our framework system is freely programmable to generate any virtual environment, which may then be further supplemented with virtual and real objects. The system allows for control of any real object based on differential drive robots. The robots may be adapted for different applications, e.g., with markers for identification or with covers to change shape and appearance. They may also be “equipped” with virtual tools. In this chapter we present the hardware and software architecture of our system and some applications. The authors believe this can be seen as a first implementation of Ivan Sutherland’s 1965 idea of the ultimate display: “The ultimate display would, of course, be a room within which the computer can control the existence of matter …” (Sutherland, 1965, Proceedings of IFIPS Congress 2:506-508).

  8. NETWORK ANALYSIS OF PORTUGUESE TEAM ON FIFA WORLD CUP 2014

    Directory of Open Access Journals (Sweden)

    Rui Sousa Mendes,

    2015-05-01

    Full Text Available Match analysis has been using in football case to identify properties and patterns of teams (Sarmento et al., 2014. From the regular notational analysis until the most recent computational tactical metrics, a lot of different outcomes can be possible to extract from a single match (Clemente, Couceiro, Martins, & Mendes, 2015. In the specific case of football, the cooperation among team-members is one of the main factors that contribute for a better performance (Grund, 2012. Thus, to analyse such cooperation the Social Network Analysis have been used to identify how team-members are connected and if there are cooperation tendencies inside the team (Clemente et al., 2015. The prominent players have been also analysed in order to identify the central players in the team (Clemente, Couceiro, Martins, & Mendes, 2014.Objectives: Therefore, using the social network analysis approach the aim of this study was to analyse the centrality levels of Portuguese positional roles during the FIFA World Cup 2014 and to identify the prominent tactical positions that determined the moments with ball.

  9. Energetically Modified Cement (EMC) - Performance Mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Ronin, Vladimir; Elfgren, Lennart [Luleaa Univ. of Technology (Sweden). Centre for High Performance Cement

    2003-03-01

    Energetically Modified Cements, EMC, made of intensively milled cement (50%) and fillers (50%) of quartz or fly ash have been compared to blends of Ordinary Portland Cement, OPC, and fillers. The EMCs have better properties than other blends and are comparable to unblended OPC. This remarkable fact can probably be explained as follows. The grinding process reduces the size of both cement grains and fillers. This combined with the creation of micro defects gives the ground cement a very high degree of hydration. The increased early hydration and a better distribution of hydration products results in an extensive pore size refinement of the hardened binder. This pore size refinement leads to a favorably reduced permeability and diffusivity and very good mechanical properties.

  10. CO2 Capture by Cement Raw Meal

    DEFF Research Database (Denmark)

    Pathi, Sharat Kumar; Lin, Weigang; Illerup, Jytte Boll;

    2013-01-01

    The cement industry is one of the major sources of CO2 emissions and is likely to contribute to further increases in the near future. The carbonate looping process has the potential to capture CO2 emissions from the cement industry, in which raw meal for cement production could be used...... as the sorbent. Cyclic experiments were carried out in a TGA apparatus using industrial cement raw meal and synthetic raw meal as sorbents, with limestone as the reference. The results show that the CO2 capture capacities of the cement raw meal and the synthetic raw meal are comparable to those of pure limestone....... The CO2 capture capacity of limestone in the raw meal is lower than for pure limestone. The difference in the CO2 capture capacity decreases with an increase in cycle number. The calcination conditions and composition are major factors that influence the CO2 capture capacity of limestone. At 850 °C in N2...

  11. Conditioning of radioactive waste solutions by cementation

    International Nuclear Information System (INIS)

    For the cementation of the low and intermediate level evaporator concentrates resulting from the reprocessing of spent fuel numerous experiments were performed to optimize the waste form composition and to characterize the final waste form. Concerning the cementation process, properties of the waste/cement suspension were investigated. These investigations include the dependence of viscosity, bleeding, setting time and hydration heat from the waste cement slurry composition. For the characterization of the waste forms, the mechanical, thermal and chemical stability were determined. For special cases detailed investigations were performed to determine the activity release from waste packages under defined mechanical and thermal stresses. The investigations of the interaction of the waste forms with aqueous solutions include the determination of the Cs/Sr release, the corrosion resistance and the release of actinides. The Cs/Sr release was determined in dependence of the cement type, additives, setting time and sample size. (orig./DG)

  12. Economic analysis of a volume reduction/polyethylene solidification system for low-level radioactive wastes

    International Nuclear Information System (INIS)

    A study was conducted at Brookhaven National Laboratory to determine the economic feasibility of a fluidized bed volume reduction/polyethylene solidification system for low-level radioactive wastes. These results are compared with the ''null'' alternative of no volume reduction and solidification of aqueous waste streams in hydraulic cement. The economic analysis employed a levelized revenue requirement (LRR) technique conducted over a ten year period. An interactive computer program was written to conduct the LRR calculations. Both of the treatment/solidification options were considered for a number of scenarios including type of plant (BWR or PWR) and transportation distance to the disposal site. If current trends in the escalation rates of cost components continue, the volume reduction/polyethylene solidification option will be cost effective for both BWRs and PWRs. Data indicate that a minimum net annual savings of $0.8 million per year (for a PWR shipping its waste 750 miles) and a maximum net annual savings of $9 million per year (for a BWR shipping its waste 2500 miles) can be achieved. A sensitivity analysis was performed for the burial cost escalation rate, which indicated that variation of this factor will impact the total levelized revenue requirement. The burial cost escalation rate which yields a break-even condition was determined for each scenario considered. 11 refs., 8 figs., 39 tabs

  13. Cements with low Clinker Content

    Science.gov (United States)

    García-Lodeiro, I.; Fernández-Jiménez, A.; Palomo, A.

    2015-11-01

    Hybrid alkaline cements are multi-component systems containing a high percentage of mineral additions (fly ash, blast furnace slag), low proportions (alkaline activators. The substantially lower amount of clinker needed to manufacture these binders in comparison to ordinary Portland cement is both economically and ecologically beneficial. Their enormous versatility in terms of the raw materials used has made them the object of considerable interest. The present study explored the mechanical strength of binary blends mixes; B1= 20% clinker (CK) + 80% fly ash (FA) and B2=20% clinker + 80% blast furnace slag (BFS), both hydrated in the presence and absence of an alkaline activator specifically designed for this purpose. The use of the activator enhanced the development of early age strength considerably. All the hydrated matrices were characterised with XRD, SEM/EDX and (29Si and 27Al) NMR. The use of the alkaline activator generated reaction products consisting primarily of a mix of gels ((N,C)-A-S-H and C-A-S-H) whose respective proportions were found to depend upon system composition and initial reactivity.

  14. ROTARY SCREW SYSTEMS IN CEMENT

    Directory of Open Access Journals (Sweden)

    Taratuta V. D.

    2016-01-01

    Full Text Available The article presents results of research of rotary-screw systems in relation to the creation of rotary kilns for the annealing of-cuttings in the preparation of cement clinker. Using the proposed design, in comparison with known designs of similar purpose, it significantly improves performance, reduces size and power consumption through the use of rotary screw systems in the form of screw rotors and drums made hollow with sidewalls assembled from separate strips or plates of different geometrical shapes with form inside the screw breaks or smooth edges, screw surfaces and screw grooves. It is shown that the housing of the rotary kiln is expedient to produce helical surfaces whose centers of curvature are located within the housing. Using the proposed constructions rotary kiln during the firing when preparing cement wedge can increase the speed of rotation of the housing, furnaces 5-10 times due to changes in the rotary-screw systems increase efficiency and reduce the size of furnaces

  15. Pack cementation coatings for alloys

    Energy Technology Data Exchange (ETDEWEB)

    He, Yi-Rong; Zheng, Minhui; Rapp, R.A. [Ohio State Univ., Columbus, OH (United States)

    1996-08-01

    The halide-activated pack cementation process was modified to produce a Ge-doped silicide diffusion coating on a Cr-Cr{sub 2}Nb alloy in a single processing step. The morphology and composition of the coating depended both on the composition of the pack and on the composition and microstructure of the substrate. Higher Ge content in the pack suppressed the formation of CrSi{sub 2} and reduced the growth kinetics of the coating. Ge was not homogeneously distributed in the coatings. In cyclic and isothermal oxidation in air at 700 and 1050{degrees}C, the Ge-doped silicide coating protected the Cr-Nb alloys from significant oxidation by the formation of a Ge-doped silica film. The codeposition and diffusion of aluminum and chromium into low alloy steel have been achieved using elemental Al and Cr powders and a two-step pack cementation process. Sequential process treatments at 925{degrees}C and 1150{degrees}C yield dense and uniform ferrite coatings, whose compositions are close to either Fe{sub 3}Al or else FeAl plus a lower Cr content, when processed under different conditions. The higher content of Al in the coatings was predicted by thermodynamic calculations of equilibrium in the gas phase. The effect of the particle size of the metal powders on the surface composition of the coating has been studied for various combinations of Al and Cr powders.

  16. Short-term survival analysis of the all-polyethylene tibial component in total knee arthroplasty

    Institute of Scientific and Technical Information of China (English)

    SHEN Bin; YANG Jing; PEI Fu-xing

    2005-01-01

    Objective: To report the clinical and radiological results of 24 total knee arthroplasty in which all-polyethylene tibial components were used. Methods: Between December 2000 and December 2002, 24 cemented total knee arthroplasty in 21 patients were performed using all-polyethylene tibial components. The mean age of the 21 patients (9 men and 12 women) at operation was 55 years, ranging 48-61 years. The mean preoperative hospital for special surgery (HSS)score was 40.2 (range, 36-43). The diagnoses were degenerative osteoarthritis in 15 patients, rheumatoid arthritis in 5 and traumatic arthritis in 1. All the operations were performed by the same surgeon group and there were unilateral operations in 18 patients and bilateral operations in 3.Results: Eighteen patients were followed up with a follow-up rate of 85.7%. The mean follow-up is 2.5 years (range, 1-3 years) and mean postoperative HSS scores was 87.5 (range, 83-89). Among them, 18 were excellent, 3 good, 3 poor and none was fair (the results of three lost patients were classified as poor). Of those reviewed, the prosthesis was all in situ and no revision occurred. Radiological assessment of these patients revealed 4 (16.67%) tibial components with radiolucent lines (mean width≤2 mm) distributed mainly in zone 1 and zone 4. None of these knees was symptomatic.Conclusions: The result of total knee arthroplasty using all-polyethylene tibial components is encouraging. The operative techniques are similar to those in arthroplasty using metal-backed tibial component.

  17. Enzymatic hydrolysis of poly(ethylene furanoate).

    Science.gov (United States)

    Pellis, Alessandro; Haernvall, Karolina; Pichler, Christian M; Ghazaryan, Gagik; Breinbauer, Rolf; Guebitz, Georg M

    2016-10-10

    The urgency of producing new environmentally-friendly polyesters strongly enhanced the development of bio-based poly(ethylene furanoate) (PEF) as an alternative to plastics like poly(ethylene terephthalate) (PET) for applications that include food packaging, personal and home care containers and thermoforming equipment. In this study, PEF powders of various molecular weights (6, 10 and 40kDa) were synthetized and their susceptibility to enzymatic hydrolysis was investigated for the first time. According to LC/TOF-MS analysis, cutinase 1 from Thermobifida cellulosilytica liberated both 2,5-furandicarboxylic acid and oligomers of up to DP4. The enzyme preferentially hydrolyzed PEF with higher molecular weights but was active on all tested substrates. Mild enzymatic hydrolysis of PEF has a potential both for surface functionalization and monomers recycling. PMID:26854948

  18. IMPORTANT DEGRADATIONS IN POLYETHYLENE TERAPHTALATE EXTRUSION PROCESS

    OpenAIRE

    Şule ALTUN; ULCAY, Yusuf

    2003-01-01

    Polyethylene terephthalate (PET) is one of the most used thermo-plastic polymers. The total consumption of PET has been about 30 million tons in the year 2000. Polyester fibers constitute about 60 % of total synthetic fibers consumption. During extrusion, PET polymer is faced to thermal, thermo-oxidative and hydrolytic degradation, which result in severe reduction in its molecular weight, thereby adversely affecting its subsequent melt processability. Therefore, it is essential to understan...

  19. The mechanical behaviour of polyethylene pipe systems

    OpenAIRE

    Barker, Michael

    1982-01-01

    This thesis was submitted for the degree of Doctor of Philosophy and awarded by Brunel University. The design of polyethylene (PE) pipelines for applications in the gas, water and chemical process industries has been based on data mainly obtained from stress rupture testing pipes only. In practice, installations are composed of both extruded pipe and injection moulded fittings which are joined by a fusion welding technique and are very often subjected to internal pressures of a fl...

  20. Poly(ethylene oxide) surfactant polymers

    OpenAIRE

    VACHEETHASANEE, KATANCHALEE; WANG, SHUWU; QIU, YONGXING; Marchant, Roger E.

    2004-01-01

    We report on a series of structurally well-defined surfactant polymers that undergo surface-induced self-assembly on hydrophobic biomaterial surfaces. The surfactant polymers consist of a poly(vinyl amine) backbone with poly(ethylene oxide) and hexanal pendant groups. The poly(vinyl amine) (PVAm) was synthesized by hydrolysis of poly(N-vinyl formamide) following free radical polymerization of N-vinyl formamide. Hexanal and aldehyde-terminated poly (ethyleneoxide) (PEO) were simultaneously att...

  1. Degradation of Green Polyethylene by Pleurotus ostreatus

    OpenAIRE

    José Maria Rodrigues da Luz; Sirlaine Albino Paes; Karla Veloso Gonçalves Ribeiro; Igor Rodrigues Mendes; Maria Catarina Megumi Kasuya

    2015-01-01

    We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus...

  2. Thermal Analyse sof Cross-Linked Polyethylene

    Directory of Open Access Journals (Sweden)

    Radek Polansky

    2007-01-01

    Full Text Available The paper summarizes results obtained during the structural analyses measurements (Differential Scanning Calorimetry DSC, Thermogravimetry TG, Thermomechanical analysis TMA and Fourier transform infrared spectroscopy FT-IR. The samples of cross-linked polyethylene cable insulation were tested via these analyses. The DSC and TG were carried out using simultaneous thermal analyzer TA Instruments SDT Q600 with connection of Fourier transform infrared spectrometer Nicolet 380. Thermomechanical analysis was carried out by TMA Q400EM TA Instruments apparatus.

  3. Extraoral Cementation Technique to Minimize Cement-Associated Peri-implant Marginal Bone Loss: Can a Thin Layer of Zinc Oxide Cement Provide Sufficient Retention?

    Science.gov (United States)

    Frisch, Eberhard; Ratka-Krüger, Petra; Weigl, Paul; Woelber, Johan

    2016-01-01

    This report describes the use of laboratory-fabricated crown intaglio replicas for extraorally prepared cementation of fixed restorations to implants. This technique minimizes excess cement and may therefore reduce the risk of cement-related marginal peri-implant bone loss. It is unclear whether the remaining thin layer of luting agent provides sufficient retention if low-adhesive zinc oxide (ZnO) cement is used. In 85 consecutive patients, 113 single crowns were cemented to implants using extraoral cementation technique (ECT) and ZnO cement. All patients were followed for 6 months and investigated for decementation. Seven events of decementation (incidence: 6.19%) were found in 7 patients (8.24%). ECT may represent a viable cementation technique for implant-supported single crowns, even using low-adhesion cements. PMID:27479343

  4. In vivo evaluation of the effects of hydraulic calcium silicate dental cements on plasma and liver aluminium levels in rats.

    Science.gov (United States)

    Demirkaya, Kadriye; Can Demirdöğen, Birsen; Öncel Torun, Zeynep; Erdem, Onur; Çetinkaya, Serdar; Akay, Cemal

    2016-02-01

    Our aim was to test whether the presence of three hydraulic calcium silicate dental cements--MTA Angelus, MTA Fillapex, and Theracal LC--in the dental extraction socket of an in vivo model, would affect the levels of aluminium (Al) in the plasma and liver. Following anesthesia, the right upper incisor of each male Wistar albino rat was extracted and polyethylene tubes filled with MTA Angelus, MTA Fillapex, or Theracal LC were inserted into the depth of the extraction socket and gingival tissue was sutured. The rats were killed 7, 30, or 60 d after the operation. Blood and liver samples were obtained from the rats before they were killed, and the levels of Al were measured by atomic absorption spectrometry. Plasma Al levels were higher in the rats in which the mineral trioxide aggregate (MTA) cements were implanted, especially MTA Angelus and MTA Fillapex, compared with control rats. In liver samples, however, the differences in Al level were not statistically significant. Our results show that Al might have been released into the circulation from the three dental cements tested, especially MTA Angelus and MTA Fillapex. Further research should be carried out on the possible biological effects of Al liberated from dental cements. PMID:26706154

  5. A new device designed for direct yield stress measurements of cement spacer

    Energy Technology Data Exchange (ETDEWEB)

    Gordon, C.L.; Tonmukayakul, P.; Morgan, R.L. [Halliburton Energy Services, Houston, TX (United States)

    2007-07-01

    The rheological properties of spacer fluids and cement slurries have a significant impact on the hydraulic shear stress of well casing walls. This paper described experimental studies and numerical models of a device designed to measure the yield stress and rheological properties of spacer and cement samples. The device was designed using the Couette principle for rheological measurements, and measured the yield stress of particle-laden samples between 4 and 150 degrees C. A sample contained in a gap between a stator and a blade located along the inside wall of a steel cup was analyzed using the device. A stator was attached to a torque device and remained static during the rheological measurement. Yield stress was measured by rotating the device at a low speed at 3 rpm and at steady state torque. Torque was recorded when the rotation stopped. Two aqueous mixtures of titanium oxide (TiO{sub 2}) particles were used for the experiment. A cement spacer comprised of a blend of barite, citric acid and water was also measured. A volume-averaged shear method was used to calculate shear rate and shear stress. Key dimensionless variables were the impeller Reynolds number; the Froude number; the Weber number; and the Weissenberg number. Accuracy was assessed by examining the data obtained with a model fluid where yield stress data was already determined. Results of the comparison showed that values obtained using the device were consistent and comparable with results obtained using other techniques. It was concluded that further research is needed to characterize the elastic fluids in the device. 13 refs., 2 tabs., 3 figs.

  6. Polyethylene solidification of low-level wastes

    International Nuclear Information System (INIS)

    This topical report describes the results of an investigation on the solidification of low-level radioactive waste in polyethylene. Waste streams selected for this study included those which result from advanced volume reduction technologies (dry evaporator concentrate salts and incinerator ash) and those which remain problematic for solidification using contemporary agents (ion exchange resins). Four types of commercially available low-density polyethylenes were employed which encompass a range of processing and property characteristics. Process development studies were conducted to ascertain optimal process control parameters for successful solidification. Maximum waste loadings were determined for each waste and polyethylene type. Property evaluation testing was performed on laboratory-scale specimens to assess the potential behavior of actual waste forms in a disposal environment. Waste form property tests included water immersion, deformation under compressive load, thermal cycling and radionuclide leaching. Recommended waste loadings of 70 wt % sodium sulfate, 50 wt % boric acid, 40 wt % incinerator ash, and 30 wt % ion exchange resins, which are based on process control and waste form performance considerations are reported. 37 refs., 33 figs., 22 tabs

  7. Grafting functional antioxidants on highly crosslinked polyethylene

    Science.gov (United States)

    Al-Malaika, S.; Riasat, S.; Lewucha, C.

    2016-05-01

    The problem of interference of antioxidants, such as hindered phenols, with peroxide-initiated crosslinking of polyethylene was addressed through the use of functional (reactive) graftable antioxidants (g-AO). Reactive derivatives of hindered phenol and hindered amine antioxidants were synthesised, characterised and used to investigate their grafting reactions in high density polyethylene; both non-crosslinked (PE) and highly peroxide-crosslinked (PEXa). Assessment of the extent of in-situ grafting of the antioxidants, their retention after exhaustive solvent extraction in PE and PEXa, and the stabilising performance of the grafted antioxidants (g-AO) in the polymer were examined and benchmarked against conventionally stabilised crosslinked & non-crosslinked polyethylene. It was shown that the functional antioxidants graft to a high extent in PEXa, and that the level of interference of the g-AOs with the polymer crosslinking process was minimal compared to that of conventional antioxidants which bear the same antioxidant function. The much higher level of retention of the g-AOs in PEXa after exhaustive solvent extraction, compared to that of the corresponding conventional antioxidants, accounts for their superior long-term thermal stabilising performance under severe extractive conditions.

  8. Phase behaviour of polyethylene knotted ring chains

    Institute of Scientific and Technical Information of China (English)

    Wen Xiao-Hui; Zhang Lin-Xi; Xia A-Gen; Chen Hong-Ping

    2011-01-01

    The phase behaviour of polyethylene knotted ring chains is investigated by using molecular dynamics simulations.In this paper, we focus on the collapse of the polyethylene knotted ring chain, and also present the results of linear and ring chains for comparison. At high temperatures, a fully extensive knot structure is observed. The mean-square radius of gyration per bond〈S2〉/(Nb2)and the shape factor(δ*)depend on not only the chain length but also the knot type.With temperature decreasing, chain collapse is observed, and the collapse temperature decreases with the chain length increasing. The actual collapse transition can be determined by the specific heat capacity Cv, and the knotted ring chain undergoes gas-liquid-solid-like transition directly. The phase transition of a knotted ring chain is only one-stage collapse, which is different from the polyethylene linear and ring chains. This investigation can provide some insights into the statistical properties of knotted polymer chains.

  9. Dermatoses in cement workers in southern Taiwan.

    Science.gov (United States)

    Guo, Y L; Wang, B J; Yeh, K C; Wang, J C; Kao, H H; Wang, M T; Shih, H C; Chen, C J

    1999-01-01

    Construction workers are known to have occupational dermatoses. The prevalence of such dermatoses was unknown in Taiwanese construction workers. The objective of this study was to determine the work exposure, prevalence of skin manifestations, and sensitivity to common contact allergens in cement workers of southern Taiwan. A total of 1147 current regular cement workers were telephone-interviewed about skin problems during the past 12 months, work exposure, and personal protection. Among those interviewed, 166 were examined and patch tested with common contact allergens. A high % of cement workers reported skin problems in the past 12 months. More men (13.9%) reported skin problems possibly related to work than women (5.4%). Prevalence was associated with lower use of gloves, duration of work as cement worker, and more time in jobs involving direct manual handling of cement, especially tiling. A high % of dermatitis was noted in the 166 workers examined, which correlated with reported skin problems. On patch testing, construction workers had a high frequency of sensitivity to chromate. Sensitivity to chromate or cobalt was associated with reported skin problems, or dorsal hand dermatitis on examination. These workers' dermatitis was under-diagnosed and inadequately managed. It is concluded that cement workers in southern Taiwan had a high prevalence of skin problems related to cement use. Protective measures, work practice, and physician education should be improved to prevent or manage such problems.

  10. Aerobic power and peak power of elite America's Cup sailors.

    Science.gov (United States)

    Neville, Vernon; Pain, Matthew T G; Folland, Jonathan P

    2009-05-01

    Big-boat yacht racing is one of the only able bodied sporting activities where standing arm-cranking ('grinding') is the primary physical activity. However, the physiological capabilities of elite sailors for standing arm-cranking have been largely unreported. The purpose of the study was to assess aerobic parameters, VO(2peak) and onset of blood lactate (OBLA), and anaerobic performance, torque-crank velocity and power-crank velocity relationships and therefore peak power (P (max)) and optimum crank-velocity (omega(opt)), of America's Cup sailors during standing arm-cranking. Thirty-three elite professional sailors performed a step test to exhaustion, and a subset of ten grinders performed maximal 7 s isokinetic sprints at different crank velocities, using a standing arm-crank ergometer. VO(2peak) was 4.7 +/- 0.5 L/min (range 3.6-5.5 L/min) at a power output of 332 +/- 44 W (range 235-425 W). OBLA occurred at a power output of 202 +/- 31 W (61% of W(max)) and VO(2) of 3.3 +/- 0.4 L/min (71% of VO(2peak)). The torque-crank velocity relationship was linear for all participants (r = 0.9 +/- 0.1). P (max) was 1,420 +/- 37 W (range 1,192-1,617 W), and omega(opt) was 125 +/- 6 rpm. These data are among the highest upper-body anaerobic and aerobic power values reported. The unique nature of these athletes, with their high fat-free mass and specific selection and training for standing arm cranking, likely accounts for the high values. The influence of crank velocity on peak power implies that power production during on-board 'grinding' may be optimised through the use of appropriate gear-ratios and the development of efficient gear change mechanisms. PMID:19234715

  11. Aerobic power and peak power of elite America's Cup sailors.

    Science.gov (United States)

    Neville, Vernon; Pain, Matthew T G; Folland, Jonathan P

    2009-05-01

    Big-boat yacht racing is one of the only able bodied sporting activities where standing arm-cranking ('grinding') is the primary physical activity. However, the physiological capabilities of elite sailors for standing arm-cranking have been largely unreported. The purpose of the study was to assess aerobic parameters, VO(2peak) and onset of blood lactate (OBLA), and anaerobic performance, torque-crank velocity and power-crank velocity relationships and therefore peak power (P (max)) and optimum crank-velocity (omega(opt)), of America's Cup sailors during standing arm-cranking. Thirty-three elite professional sailors performed a step test to exhaustion, and a subset of ten grinders performed maximal 7 s isokinetic sprints at different crank velocities, using a standing arm-crank ergometer. VO(2peak) was 4.7 +/- 0.5 L/min (range 3.6-5.5 L/min) at a power output of 332 +/- 44 W (range 235-425 W). OBLA occurred at a power output of 202 +/- 31 W (61% of W(max)) and VO(2) of 3.3 +/- 0.4 L/min (71% of VO(2peak)). The torque-crank velocity relationship was linear for all participants (r = 0.9 +/- 0.1). P (max) was 1,420 +/- 37 W (range 1,192-1,617 W), and omega(opt) was 125 +/- 6 rpm. These data are among the highest upper-body anaerobic and aerobic power values reported. The unique nature of these athletes, with their high fat-free mass and specific selection and training for standing arm cranking, likely accounts for the high values. The influence of crank velocity on peak power implies that power production during on-board 'grinding' may be optimised through the use of appropriate gear-ratios and the development of efficient gear change mechanisms.

  12. Yeast CUP1 protects HeLa cells against copper-induced stress

    Energy Technology Data Exchange (ETDEWEB)

    Xie, X.X. [Department of Animal Sciences, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai (China); Shanghai Key Laboratory of Veterinary Biotechnology, Shanghai (China); College of Biological and Environmental Engineering, Zhejiang University of Technology, Hangzhou (China); Ma, Y.F.; Wang, Q.S.; Chen, Z.L.; Liao, R.R.; Pan, Y.C. [Department of Animal Sciences, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai (China); Shanghai Key Laboratory of Veterinary Biotechnology, Shanghai (China)

    2015-06-12

    As an essential trace element, copper can be toxic in mammalian cells when present in excess. Metallothioneins (MTs) are small, cysteine-rich proteins that avidly bind copper and thus play an important role in detoxification. YeastCUP1 is a member of the MT gene family. The aim of this study was to determine whether yeast CUP1 could bind copper effectively and protect cells against copper stress. In this study,CUP1 expression was determined by quantitative real-time PCR, and copper content was detected by inductively coupled plasma mass spectrometry. Production of intracellular reactive oxygen species (ROS) was evaluated using the 2',7'-dichlorofluorescein-diacetate (DCFH-DA) assay. Cellular viability was detected using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, and the cell cycle distribution of CUP1 was analyzed by fluorescence-activated cell sorting. The data indicated that overexpression of yeast CUP1 in HeLa cells played a protective role against copper-induced stress, leading to increased cellular viability (P<0.05) and decreased ROS production (P<0.05). It was also observed that overexpression of yeast CUP1 reduced the percentage of G1 cells and increased the percentage of S cells, which suggested that it contributed to cell viability. We found that overexpression of yeast CUP1 protected HeLa cells against copper stress. These results offer useful data to elucidate the mechanism of the MT gene on copper metabolism in mammalian cells.

  13. Effect of cements on fracture resistance of monolithic zirconia crowns

    OpenAIRE

    Nakamura, Keisuke; Mouhat, Mathieu; Nergård, John Magnus; Lægreid, Solveig Jenssen; Kanno, Taro; Milleding, Percy; Örtengren, Ulf

    2016-01-01

    Abstract Objectives The present study investigated the effect of cements on fracture resistance of monolithic zirconia crowns in relation to their compressive strength. Materials and methods Four different cements were tested: zinc phosphate cement (ZPC), glass-ionomer cement (GIC), self-adhesive resin-based cement (SRC) and resin-based cement (RC). RC was used in both dual cure mode (RC-D) and chemical cure mode (RC-C). First, the compressive strength of each cement was tested according to a...

  14. Laboratory studies on the longevity of cement grouts

    International Nuclear Information System (INIS)

    This paper describes laboratory studies of the longevity of cement-based grouts being carried out as part of the International Stripa Project Phase III. The longevity properties determined for a reference grout (90% Sulphate Resistant Portland Cement, 10% silica fume, 0.4< water/cement<0.6 and superplasticizer) are compared with those of a slag cement grout. Laboratory tests have been carried out to determine the following: the mechanistic function of superplasticizer in fresh cement pastes; the leachability of the sorbed superplasticizer and its location in the structure of hardened cement paste; and the general leaching properties of selected cement-based grouts

  15. A porous tantalum uncemented acetabular cup in acetabular revision arthroplasty%生物学固定骨小梁金属杯在髋臼翻修中的应用

    Institute of Scientific and Technical Information of China (English)

    徐卫东; 陈刚; 张东华

    2009-01-01

    前后X射线平片显示无假体移位下沉等不稳迹象,骨小梁金属杯周围骨质向内长入.本组患者无置换后并发症发生,截至最后1次随访有14例行走时无疼痛,2例轻度疼痛伴轻度跛行.未出现症状性深静脉血栓或神经损伤.无需要再度翻修病例.结论:初次固定人工髋臼杯失败的病例,若无骨缺损,翻修时使用骨小梁金属杯可以获得良好的早期效果.%BACKGROUND: Biological fixation refers to the treatment of coarse or porous prosthetic surface. It is favorable to "bone ingrowth" prosthesis to achieve long-term stability. Porous tantalum is the latest scientific product that appears suitable to prosthetic surface owing to its porous feature and has been attracting a great deal attention.OBJECTIVE: To investigate the therapeutic efficacy of a porous tantalum uncemented acetabular cup in acetabular revision arthroplasty.DESIGN, TIME AND SETTING: A retrospective case analysis was performed at the Department of Orthopedics, Changhai Hospital, Second Military Medical University of Chinese PLA between April and November 2006.PARTICIPANTS/MATERIALS: Sixteen patients (16 hips), 7 males and 9 females, aged 54-81 years old, who received treatment at the Department of Orthopedics, Changhai Hospital, Second Military Medical University of Chinese PLA were included in this study. Of these patients, 2 suffered from femoral neck fracture, 6 from aseptic femoral head necrosis, and 8 from osteoarthritis. Trabecular metal cup (Zimmer, Warsaw, Indiana) provided a titanium alloy bottom layer and porous tantalum-coated surface, which was realized by technical combination of bone trabecular tantalum and titanium alloy. The prosthesis contained an ultrahigh modulus polyethylene lining.METHODS: All patients underwent acetabular revision with modular porous tantalum uncemented acetabular cup. Prior to replacement, acetabular defects and femoral prosthesis were evaluated. A posterolateral approach of hip joint was made. Following

  16. Synthesis of pure Portland cement phases

    DEFF Research Database (Denmark)

    Wesselsky, Andreas; Jensen, Ole Mejlhede

    2009-01-01

    Pure phases commonly found in Portland cement clinkers are often used to test cement hydration behaviour in simplified experimental conditions. The synthesis of these phases is covered in this paper, starting with a description of phase relations and possible polymorphs of the four main phases...... in Portland cement, i.e. tricalcium silicate, dicalcium silicate, tricalcium aluminate and tetracalcium alumino ferrite. Details of the The process of solid state synthesis are is described in general including practical advice on equipment and techniques. Finally In addition, some exemplary mix compositions...

  17. Silica Transport and Cementation in Quartz Aggregates

    Science.gov (United States)

    Pebble, C.; Farver, J.; Onasch, C.; Winslow, D.

    2008-12-01

    Silica transport and cementation in quartz aggregates have been experimentally investigated. Starting materials include a natural quartz arenite (Pocono sandstone), sized clasts of synthetic quartz, and sized grains of disaggregated natural sandstones. Experimental charges consisted of amorphous silica powder (~25 mg), AlCl3 powder (~3 mg), 25 wt% NaCl brine solution (~20 mg), and the starting material (~150 mg). The charges were weld-sealed in gold capsules and run in cold-seal pressure vessels at 300°C to 600°C at 150 MPa confining pressure for up to 4 weeks. Detailed calibrations of the furnaces indicate the maximum temperature variation across the length of the sample charges (3-7mm) was vacuum impregnated with epoxy containing a blue dye and sawn in half along the long axis of the sample charge. The nature and amount of silica transport and cementation in the samples was determined by a combination of Cathodoluminescence (CL), Light Microscopy (LM), and Scanning Electron Microscopy (SEM). Photomosaics of the samples were collected and the amount of cement, porosity, and average grain sizes were determined by point-counting. The cement was easily recognized from the quartz grains by the difference in luminescence. The experiments indicate that the presence of amorphous silica results in rapid silica cementation in quartz aggregates (e.g., up to 12% cement by volume in 4 weeks at 450°C). The amount of cementation is a function of substrate type, time, temperature, and ionic strength of the brine. The rate of silica transport through the length of the experimental charge appears to be limited by the silica solubility and its rapid depletion by cementation. Although most of the cement was derived from the amorphous silica, evidence for local dissolution-precipitation was observed. The experiments demonstrate that the mobility of silica, and consequent precipitation of cement, does not require a temperature or pressure gradient as is commonly assumed. Rather

  18. INFLUENCE OF GLASS CULLET IN CEMENT PASTES

    Institute of Scientific and Technical Information of China (English)

    A.Karamberi; E.Chaniotakis; D.Papageorgiou; A.Moutsatsou

    2006-01-01

    The present study investigates glass and cement compatibility with a view to use glass as a cement replacement. Amber, flint and green glasses were chosen due to their prevalence in the Greek market as packaging materials. The factors under investigation were the pozzolanicity of the glass cullet, the hydration rate and the mechanical strength development of the cement pastes, as well as the expansion of the specimens due to alkali-silica reaction.Moreover, the potential enhancement of glass pozzolanic activity was examined. The results of the study were encouraging to show the potentiality of utilising glass cullet in cementitious products.

  19. Reinforcement of osteosynthesis screws with brushite cement.

    Science.gov (United States)

    Van Landuyt, P; Peter, B; Beluze, L; Lemaître, J

    1999-08-01

    The fixation of osteosynthesis screws remains a severe problem for fracture repair among osteoporotic patients. Polymethyl-methacrylate (PMMA) is routinely used to improve screw fixation, but this material has well-known drawbacks such as monomer toxicity, exothermic polymerization, and nonresorbability. Calcium phosphate cements have been developed for several years. Among these new bone substitution materials, brushite cements have the advantage of being injectable and resorbable. The aim of this study is to assess the reinforcement of osteosynthesis screws with brushite cement. Polyurethane foams, whose density is close to that of cancellous bone, were used as bone model. A hole was tapped in a foam sample, then brushite cement was injected. Trabecular osteosynthesis screws were inserted. After 24 h of aging in water, the stripping force was measured by a pull-out test. Screws (4.0 and 6.5 mm diameter) and two foam densities (0.14 and 0.28 g/cm3) were compared. Cements with varying solid/liquid ratios and xanthan contents were used in order to obtain the best screw reinforcement. During the pull-out test, the stripping force first increases to a maximum, then drops to a steady-state value until complete screw extraction. Both maximum force and plateau value increase drastically in the presence of cement. The highest stripping force is observed for 6.5-mm screws reinforced with cement in low-density foams. In this case, the stripping force is multiplied by 3.3 in the presence of cement. In a second experiment, cements with solid/liquid ratio ranging from 2.0 to 3.5 g/mL were used with 6.5-mm diameter screws. In some compositions, xanthan was added to improve injectability. The best results were obtained with 2.5 g/mL cement containing xanthan and with 3.0 g/mL cements without xanthan. A 0.9-kN maximal stripping force was observed with nonreinforced screws, while 1.9 kN was reached with reinforced screws. These first results are very promising regarding screw

  20. Operating experience with KRAFTWERK UNION cementation line

    International Nuclear Information System (INIS)

    A facility is described designed for fixation in a cement matrix of the radioactive concentrate produced by thickening waste water from the Bohunice nuclear power plant. The cementation line output is 0.6 m3 concentrate/h. The concentrate is put in 200 l drums. The individual operating units, cement management, air conditioning, dosimetric monitoring and the building part are described. The requirements for the operators and the assessment of the quality of raw materials and the product are discussed. (M.D.). 3 figs., 4 refs

  1. Thermal behavior of asphalt cements

    International Nuclear Information System (INIS)

    Asphalt cements are highly complex mixtures of hydrocarbon molecules whose thermal behavior is of prime importance for petroleum and road industry. From DSC, the determination of several thermal properties of asphalts is given, e.g. glass-transition temperature and crystallized fraction content.The dissolution of a pure n-paraffin CnH2n+2 in an asphalt, as seen by DSC, should be a single peak. For 20g of these glasses change with time and temperature. The formation of the crystallized phases is superposed to the enthalpic relaxation of the glasses, making a kinetic study very difficult. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  2. Effect of cementing technique and cement type on thermal necrosis in hip resurfacing arthroplasty - a numerical study

    NARCIS (Netherlands)

    Janssen, D.; Srinivasan, P.; Scheerlinck, T.; Verdonschot, N.J.J.

    2012-01-01

    Femoral fractures within resurfacing implants have been associated with bone necrosis, possibly resulting from heat generated by cement polymerization. The amount of heat generated depends on cement mantle volume and type of cement. Using finite element analysis, the effect of cement type and volume

  3. The behavior of the micro-mechanical cement-bone interface affects the cement failure in total hip replacement

    NARCIS (Netherlands)

    Waanders, D.; Janssen, D.; Mann, K.A.; Verdonschot, N.J.J.

    2011-01-01

    In the current study, the effects of different ways to implement the complex micro-mechanical behavior of the cement-bone interface on the fatigue failure of the cement mantle were investigated. In an FEA-model of a cemented hip reconstruction the cement-bone interface was modeled and numerically im

  4. Preliminary study using pulsating water jet for bone cement demolition

    OpenAIRE

    S. Hloch; Kloc, J.; Foldyna, J.; Pude, F.; Smolko, I.; M. Zeleňák; Sitek, L. (Libor); Hvizdoš, P.; Monka, P.; Monková, K.; Kozak, D.; A. Stoić; A. Sedmak; Milosevic, M; Lehocká, D.

    2015-01-01

    The paper deals with the study of using the selective property of ultrasonic pulsating water jet for the disintegration of bone cement which creates the interface between femoral stem and trabecular bone tissue. For investigation, commercial bone cements were used. Bone cements were tested by nanoindentation in order to review their mechanical properties. A representative sample Palacos R+G was selected for disintegration of bone cement. Bone cements samples fixed between two plexiglass...

  5. ANALYSIS OF UNCERTAINTIES IN CEMENT INDUSTRY IN TURKEY

    OpenAIRE

    Kemal Yildirim; Omer Arioz

    2013-01-01

    Cement industry having 4,5 billion Dollars revenue and 1 billion Dollar export volume plays very important role in Turkey’s economy. Turkish cement industry is very sensitive to economic crisis and involves many uncertainties. In this study, price uncertainties, technological uncertainties, and price-technological uncertainties in Turkish cement industry were analyzed. The cement demand is mostly affected by demand to ready mixed concrete. Demand to cement is also related to the picture of co...

  6. Composite cements containing natural pozzolan and granulated blast furnace slag

    OpenAIRE

    Irassar, E. F.; Rahhal, V. F.; Donza, H. A.; Menéndez, G.; Bonavetti, V. L.

    2006-01-01

    For reasons of market demand and Portland cement production,the manufacture of cements with two or more separately ground additions to produce customized cements is becoming common practice.When pozzolan or slag content in this type of cements is high, however, the initial strength of the resulting product may be adversely impacted. This problem can be minimized by activating one or both of the replacement materials. The present study analyzes the effect of Portland cement additions such as p...

  7. Effect of Abutment Modification and Cement Type on Retention of Cement-Retained Implant Supported Crowns

    OpenAIRE

    Mitra Farzin; Kianoosh Torabi; Ahmad Hasan Ahangari; Reza Derafshi

    2014-01-01

    Objective: Provisional cements are commonly used to facilitate retrievability of cement-retained fixed implant restorations; but compromised abutment preparation may affect the retention of implant-retained crowns.The purpose of this study was to investigate the effect of abutment design and type of luting agent on the retentive strength of cement-retained implant restorations. Materials and Method: Two prefabricated abutments were attached to their corresponding analogs and embedded in an ac...

  8. Slagment Cement Improve the Cement Resistance Toward Acids Attack During Acidizing Treatment

    Directory of Open Access Journals (Sweden)

    Nik Khairul Irfan Bin Nik Ab. Lah.

    2013-05-01

    Full Text Available Acidizing treatment in past experience shows several zonal isolation problems after the treatment. This study presents the effect of the acid treatment toward class G cement and slagment cement as the improvement method to improve the cement resistance toward the acid. Lab experiments were conducted by immerge the respective cement cubes into 12% HCl/3% HF solution for 40 min before several analysis were conducted. Based on the result, the mass loss and compressive strength loss of the cement cubes decrease as the curing temperature and pressure increase due to more evenly distributed cement chemical composition crystal in high curing condition as shown in Scanning Electron Microscopy (SEM analysis. From X-Ray Diffraction (XRD and X-Ray Fluorescence (XRF analysis, only the first layer of the cement cubes shows chemical component change due to the reaction between the acid. This study found that, replacing class G cement to slagment cement can reduce the mass loss and compressive strength loss up to 72% and 82%, respectively.

  9. Exposure to cement dust at a Portland cement factory and the risk of cancer.

    OpenAIRE

    Vestbo, J; Knudsen, K.M.; Raffn, E; Korsgaard, B; Rasmussen, F V

    1991-01-01

    The relation between exposure to cement dust and cancer was examined in a population of 546 cement workers and a reference population of 858 randomly sampled men of similar age and area of residence. In 1974 all men gave lifelong occupational and smoking histories; information on incidence of cancer in the period 1974-85 was obtained from the Danish Cancer Registry. No increased risk of overall cancer was found among cement workers. Among men with more than 20 years exposure to cement dust, 1...

  10. INFLUENCE OF WINE ACID ON RHEOLOGICAL PROPERTIES OF WELL BORE CEMENT SLURRIES AND HARDENED CEMENT PROPERTIES

    Directory of Open Access Journals (Sweden)

    Nediljka Gaurina-Međimurec

    1989-12-01

    Full Text Available Adaptation of commercial types of domestic cements for use in cementing the deep wells is a process by which Yugoslav oil industry tends to solve problems of completion of those wells independently. In order to design a domestic, cheep and effective retarder, tests of applicability of wine acid on cement slurries have been carried out. Besides examining the necessary wine acid content to achieve desirable Theological properties, the influence of this additive on properties of hardened cement samples has been tested too (the paper is published in Croatian.

  11. Radiological and migration results of the DURALOC(R)-cup after two years

    CERN Document Server

    Juen, F

    2000-01-01

    4 years of implantation was assessed to be 1.23 mm, however a decreasing speed of migration over the final 2-year-period was indicated. Our results demonstrate that statements relating to migration results of particular cups are more accurate after four years. However, statements about mean migration values are possible after two years. A migration speed of 1 mm total migration within the first 2 years after operation was predictive for radiological loosening of the cup after four years (p=0,0004). Further, appearance of postoperative gaps in zone one of the cup correlate with high migration values later leading to radiological loosening and may be a result of errors during implantation. However, we could demonstrate that presence of gaps around the cup postoperatively is an important factor for later loosening. With consideration to the findings concerning the DURALOC(R) cup within four years of implantation, predictions of results over a long term may be undesirable. In 1997 a study was conduced concerning ...

  12. Development of cup-shaped micro-electromechanical systems-based vector hydrophone

    Science.gov (United States)

    Xu, Wei; Liu, Yuan; Zhang, Guojun; Wang, Renxin; Xue, Chenyang; Zhang, Wendong; Liu, Jun

    2016-09-01

    Similar to the vital performance factors, the receiving sensitivity and the bandwidth exist interactively in the micro-electromechanical systems (MEMS)-based vector hydrophones. Some existing methods can improve the sensitivity of the hydrophone, but these improvements are usually gained at a cost of the bandwidth. However, the cup-shaped MEMS vector hydrophone that is presented in this paper can improve its sensitivity while retaining a sufficient bandwidth. The cup-shaped structure acts as a new sensing unit in the MEMS vector hydrophone, replacing the bionic columnar hair that was previously used for sensing. The relationships between the parameters of the cup-shaped structure and the sensitivity of the vector hydrophone were determined by a theoretical deduction. In addition, simulation analyses were performed, and optimized structural parameters were obtained in this work. ANSYS 15.0 simulation was used to derive the optimum characteristics for the cup-shaped structure. The results of the calibration experiments showed that the sensitivity reached up to -188.5 dB (gain of 40 dB, 1 kHz, 0 dB@1 V/μPa), and the bandwidth was in the 20 Hz-1 kHz range, which is sufficient for an underwater acoustic detection at low frequencies. This work has, thus, proved that the cup-shaped vector hydrophone has superior properties for the engineering applications.

  13. The Effects of Dry Cupping Therapy on the Shoulder Pain and Fatigue of Nurses

    Directory of Open Access Journals (Sweden)

    Dorina Sohn

    2011-06-01

    Full Text Available Objective: This research was done to identify the effects of dry cupping therapy on the shoulder pain and fatigue of nurses. Methods: The research design was time series design. The participants were 27 nurses with shoulder pain at P University Hospital in Busan metropolitan city from July 6, 2009 to August 3, 2009. The dry cupping therapy was done 4 times, twice a week for 2 weeks. Before intervention, the severity and frequency of pain and fatigue were measured three times at one week intervals, and then those were measured after one week and two weeks of experimental treatment. The results were analyzed using descriptive statistics, paired t-test and repeated measure ANOVA with the SPSS program. Results: There were statistically significant difference in severity and frequency of shoulder pain,and fatigue after dry cupping therapy. Dry cupping therapy was effective for the management of shoulder pain and fatigue among nurses in this study. Conclusion: Therefore dry cupping therapy can be considered an effective nursing intervention that relieves shoulder pain and fatigue of nurses.

  14. Radiographic appearance of commonly used cements in implant dentistry.

    Science.gov (United States)

    Pette, Gregory A; Ganeles, Jeffrey; Norkin, Frederic J

    2013-01-01

    Cement-retained restorations allow for a conventional fixed partial denture approach to restoring dental implants. However, inadequate removal of excess cement at the time of cementation may introduce a severe complication: cement-induced peri-implantitis. Radiopaque cements are more easily detected on radiographs and should improve the recognition of extravasated cement at the time of insertion. The purpose of this study was to evaluate the radiopacity of commercially available cements in vitro. Eighteen different cements commonly used for luting restorations to implants were tested at both 0.5- and 1.0-mm thicknesses. The cements examined were zinc oxide eugenol, zinc oxide, zinc polycarboxylate, zinc phosphate, resin-reinforced glass ionomer, urethane resin, resin, and composite resin. Two samples of each cement thickness underwent standardized radiography next to an aluminum step wedge as a reference. The mean grayscale value of each of the nine 1-mm steps in the step wedge were used as reference values and compared to each of the cement samples. Temp Bond Clear (resin), IMProv (urethane resin), Premier Implant Cement (resin), and Temrex NE (resin) were not radiographically detectable at either sample thickness. Cements containing zinc were the most detectable upon radiographic analysis. There are significant differences in the radiopacity of many commonly used cements. Since cementinduced peri-implantitis can lead to late implant failure, cements that can be visualized radiographically may reduce the incidence of this problem.

  15. Catastrophic failure of ceramic-polyethylene bearing total hip arthroplasty.

    Science.gov (United States)

    Needham, Justin; Burns, Travis; Gerlinger, Tad

    2008-06-01

    Complications of ceramic-polyethylene bearing total hip arthroplasty (THA) include osteolysis, loosening, dislocation, and component failure. Catastrophic acetabular component failure involves severe damage to both the polyethylene liner and metal shell. This case study presents the first reported complete wear-through of the acetabular portion of a ceramic-polyethylene arthroplasty presenting as a dislocation and a review of the literature. In this study, a patient's alumina ceramic femoral head penetrated the polyethylene liner and titanium shell and presented as a dislocated THA. The contributing factors for this catastrophic failure include young patient age, high activity level, thin polyethylene liner, backside wear, component positioning, polyethylene sterilization with gamma irradiation in air, and lack of appropriate follow-up. Revision THA was performed without complications. PMID:18514888

  16. Influence of using slag cement on the microstructure and durability related properties of cement grouts for micropiles

    OpenAIRE

    Ortega Álvarez, José Marcos; Albaladejo Ruiz, Arturo; Pastor Navarro, José Luis; Sánchez Martín, Isidro; Climent, Miguel-Ángel

    2013-01-01

    Today, the use of micropiles for different applications has become very common. In Spain, the cement grouts for micropiles are prepared using ordinary Portland cement and w:c ratio 0.5, although the micropiles standards do not restrict the cement type to use, provided that it reaches a certain compressive strength. In this study, the influence of using slag cement on the microstructure and durability related properties of cement grouts for micropiles have been studied until 90 hardening days,...

  17. The Setting Chemistry of Glass Ionomer Cement

    Institute of Scientific and Technical Information of China (English)

    CHENG Hanting; LIU Hanxing; ZHANG Guoqing

    2005-01-01

    The setting chemistry of glass ionomer cement was investigated by using mechanical determination of compressive strength at predetermined intervals, and measurement of structure changes of corresponding fracture sample by means of IR spectra and differential scanning calorimetry ( DSC). Zinc polycarboxylate cement was used as a comparison sample. The compressive strength of glass ionomer cement (GIC) increases with aging. IR spectra and DSC of corresponding fracture sample show the structure changes of the matrix and interface layer comprising of silica gel during the predetermined intervals studied, however, no significant changes occur in the zinc polycarxyolate cement. Hence the structure changes of the matrix and/or interface layer are responsible for compressive strength increasing with aging. The structure changes include the crosslink density, the ratio of complex form to ionic form, the content ratio of Al-PAA to Ca-PAA, the forming and mauring process of the interface layer comprising of silica gel.

  18. Calcium phosphate cements properties with polymers addition

    International Nuclear Information System (INIS)

    Calcium phosphate cements (CPC) have attracted great interest to use in orthopedics and dentistry as replacements for damaged parts of the skeletal system, showing good biocompatibility and osseointegration, allowing its use as bone graft. Several studies have shown that the addition of polymer additives have a strong influence on the cement properties. The low mechanical strength is the main obstacle to greater use of CPC as an implant material. The objective of this study was to evaluate properties of a cement based on α-tricalcium phosphate (α-TCP), added polymers. PVA (10%, 8%, 6%), sodium alginate (2%) and polyacrylate ammonia (3%), all in weight, were added to the synthesized α-TCP powder. The samples were molded and evaluated for density, porosity in vitro test (Simulated Body Fluid), crystalline phases and mechanical strength. The results show increased the mechanical properties of the cement when added these polymers

  19. Low-cycle fatigue of surgical cements

    Directory of Open Access Journals (Sweden)

    A. Balin

    2007-01-01

    Full Text Available Purpose: In case when surgical cement is used to fix endoprostheses of joints the fatigue character of mechanicalinterraction in the cement seems to be a significant importance. The paper suggests to adapt the research methodof low cycle fatigue for modelling the loads on surgical cements in an artificial hip joint. Surgical cements havealso been modified in order to improve their functional properties.Design/methodology/approach: Low cycle fatigue tests were conducted on samples made from Palamedcement without an addition and on samples modified with glassy carbon and titanium. The tests were conductedon a servohydraulic fatigue testing machine, MTS-810, with displacement control.Findings: Fatigue tests proved viscoelastic character of all the tested materials. During the fatigue tests, thephenomenon of stress cyclic relaxation was observed.Research limitations/implications: Modelling the loadings of cement in endoprostheses of joints with the lowcycle fatigue method takes into account all high value stresses, while cement is being used for endoprosthesesfor many years in the conditions of random stress and deformation courses. Therefore the obtained stress anddeformation values are bigger than those which would have been obtained in real conditions in the same time.Practical implications: The low cycle fatigue tests carried out showed how important is the factor of timefor the behavior of surgical cement in the conditions of changeable loadings. This fact is essential to assessits usability for endoprosthesoplasty of joints, specially of a hip joint. Post deformation return which is acharacteristic feature for material viscoelasticity enables its regeneration conditioning expected durability ofendoprosthesis of joints.Originality/value: Low cycle fatigue testing method for modelling of loads on surgical cement in artificial hipjoint enables to carry out the tests in a shorter period of time.

  20. Acrylic Bone Cements Modified with Starch

    OpenAIRE

    Krilova, V; Vītiņš, V

    2010-01-01

    The successful result of restorative and replacement surgical operation depends significantly on properties of used bone cement. Acrylic bone cements are usually based on methylmethacrylate polymer, while monomer polymerization begins after mixing of components in mixing device and terminates in living tissue. Polymerization of methylmethacrylate is exothermic process, and temperature increase might cause tissue necrosis with concomitant implant aseptic loosening. Developed non-ionogenic and ...

  1. Radiological changes in asbestos cement workers.

    OpenAIRE

    Jakobsson, K; Strömberg, U; Albin, M; Welinder, H; Hagmar, L

    1995-01-01

    OBJECTIVE--To explore associations between exposure to asbestos cement dust and radiographic findings in lung parenchyma and pleura. METHODS--Radiographs from 174 blue collar workers and 29 white collar workers from an asbestos cement plant formed one part of the study. Progression of small opacities was further studied in those 124 blue collar workers, for whom two radiographs taken after the end of employment were available. The median readings from five readers who used the full ILO 1980 c...

  2. Microstructure Analysis of Heated Portland Cement Paste

    OpenAIRE

    Q. Zhang; Ye, G.

    2011-01-01

    When a concrete structure is exposed to high temperature, the mechanical damage and chemical transformation take place simultaneously, which will change the microstructure of material. On the other hand, the mechanical properties and transport properties depend on the development of microstructure of cement paste. In order to study the microstructure changes at high temperature, in this contribution the cement paste samples were firstly heated to varied temperatures from 100 °C to 1000 °C wit...

  3. Dynamic properties of composite cemented clay

    Institute of Scientific and Technical Information of China (English)

    蔡袁强; 梁旭

    2004-01-01

    In this work,the dynamic properties of composite cemented clay under a wide range of strains were studied considering the effect of different mixing ratio and the change of confining pressures through dynamic triaxial test. A simple and practical method to estimate the dynamic elastic modulus and damping ratio is proposed in this paper and a related empirical normalized formula is also presented. The results provide useful guidelines for preliminary estimation of cement requirements to improve the dynamic properties of clays.

  4. Topics in Cement and Concrete Research

    OpenAIRE

    Brouwers, H. J. H.

    2006-01-01

    The present paper addresses several topics in regard to the sustainable design and use of concrete. First, major features concerning the sustainable aspects of the material concrete are summarised. Then the major constituent, from an environmental point of view, cement is discussed in detail, particularly the hydration and application of slag cement. The intelligent combining of mineral oxides, which are found in clinker, slag, fly ashes etc., is designated as mineral oxide engineering. It re...

  5. Improvement of Cement Strength by Induction Method

    Institute of Scientific and Technical Information of China (English)

    YANG Li-yuan; LIN Zong-shou

    2004-01-01

    The induction method of improving the strength of Portland cement by adding fine slag powder,high aluminate component and hydrated paste was investigated through determining the physical properties,hydration heat and pore size distribution,and its mechanism was discussed.The experimental results reveal that a certain content of high aluminate component,fine slag powder and hydrated paste can improve remarkably the strength of Portland cement.

  6. Estimating the chloride transport in cement paste

    OpenAIRE

    Princigallo, A.

    2012-01-01

    A method was developed to measure the diffusion coefficient of chloride ions in cement paste based on an analytical solution to Fick’s 2nd law in a cylindrical coordinate system. This natural method yielded diffusivity results within as little as a month. Testing time was reduced by exploiting the three-dimensional inward flux in the specimen. In an attempt to determine the saturation concentration, dense portland cement pastes were exposed to a concentrated chloride solution. The method prov...

  7. Case Study of the California Cement Industry

    Energy Technology Data Exchange (ETDEWEB)

    Coito, Fred; Powell, Frank; Worrell, Ernst; Price, Lynn; Friedmann, Rafael

    2005-05-01

    California is the largest cement producing state in theU.S., accounting for between 10 percent and 15 percent of U.S. cementproduction and cement industry employment. The cement industry inCalifornia consists of 31 sites that consume large amounts of energy,annually: 1,600 GWh of electricity, 22 million therms of natural gas, 2.3million tons of coal, 0.25 tons of coke, and smaller amounts of wastematerials, including tires. The case study summarized in this paperfocused on providing background information, an assessment ofenergy-efficiency opportunities and barriers, and program recommendationsthat can be used by program planners to better target products to thecement industry. The primary approach to this case study involvedwalk-through surveys of customer facilities and in depth interviews withcustomer decision makers and subsequent analysis of collected data. Inaddition, a basic review of the cement production process was developed,and summary cement industry energy and economic data were collected, andanalyzed. The analysis of secondary data provides background informationon the cement industry and identification of potential energy-efficiencyopportunities. The interviews provide some understanding of the customerperspective about implementation of energy-efficiencyprojects.

  8. Chemical interaction of polyethylene matrix with vegetable fillers in biocomposites

    Science.gov (United States)

    Pantyukhov, Petr; Monakhova, Tatiana; Popov, Anatoly; Zykova, Anna

    2016-05-01

    The paper studies the diffusion of low molecular weight components from vegetable fillers into polyethylene matrix during the preparation of biocomposites. In order to identify the diffusible substances a model experiment used where the hexadecane acted as a model of polyethylene. It was determined that polyphenolic compounds and chlorophyll penetrate from vegetable fillers to hexadecane to the maximum extent. There was found a correlation between the amount of polyphenolic compounds diffusible from the fillers to hexadecane and thermal oxidation kinetics of real biocomposites based on polyethylene and vegetable fillers. Thus, it has been assumed the diffusion of polyphenols and chlorophyll from vegetable fillers into polyethylene matrix during the preparation of biocomposites.

  9. ACCUWIND - Classification of five cup anemometers according to IEC61400-12-1

    Energy Technology Data Exchange (ETDEWEB)

    Friis Pedersen, T.; Dahlberg, J.Aa.; Busche, P.

    2006-05-15

    The characteristics of five cup anemometers were investigated in detail, and data are presented in figures and tables. The characteristics include: normal wind tunnel calibrations; angular response measurements at 5, 8 and 11m/s; torque coefficient curve measurements from combined tilt and ramp-gust tests, torque coefficient curve measurements for non-tilted conditions; rotor inertia measurements and measurements of friction of bearings at temperatures -10 deg. C to 40 deg. C. The characteristics are fitted to two different time domain cup anemometer models, and simulations of the cup anemometers are made with artificial wind generators to make classifications according to annex I and J of the standard IEC 61400-12-1 on power performance measurements. Results of classification are shown in graphs of systematic deviations and class index tables. (au)

  10. Acupuncture and Cupping for Treatment of Hiccup in Cases of Cerebrovascular Accident

    Institute of Scientific and Technical Information of China (English)

    Xie Hongliang; Cao Xuemei; Huang Shizhao; Liao Chaofeng

    2006-01-01

    Objective:To observe the therapeutic effects of acupuncture and cupping for hiccup in cases of cerebrovascular accident.Method:80 cases of hiccup due to cerebrovascular accident were randomly divided into the treatment group of 40 cases treated by acupuncture and cupping and the control group of 40 cases treated with Ritaline.Result:In the treatment group,24 cases were cured,8 cases markedly effective,5 cases improved,and 3 cases failed,with a total effective rate of 92.5%.In the control group,9 cases were cured,12 cases markedly effective,8 cases improved,and 11 cases failed,with a total effective rate of 72.5%.There was a statistically significant difference in the therapeutic effects between the two groups(μ=3.3259,P=0.0009).Conclusion:The effect of acupuncture and cupping for hiccup due to cerebrovascular accident was noticeably superior to Ritaline.

  11. Validation of 3D sonic-anemometer against cup anemometer response

    DEFF Research Database (Denmark)

    Hansen, Kurt Schaldemose; Larsen, Gunner Chr.; Courtney, Michael

    2004-01-01

    Determination and validation of wind turbine power curves traditionally rely on single point wind speed measurements recorded with a calibrated cup-anemometer. The power curve verification process, which is typically performed in different terrain types, does not always result in satisfactory...... agreement between measures- and predicted power curves. The observed disagreement is premarily believed to relate to the cup-anemometers being sensitive to tilted flow i.e. that the measurement of the horizontal flow component is sensible to flow in a plane perpendicular to the horizontal plane. Furthermore......, the limited cup-anemometer response due to high turbulence can explain some of the diviations. The present paper investigates this problem, by analysing full-scale time series data extracted from "Database on Wind Characteristics" (http://www.winddata.com/), which represents a wide range of sites...

  12. Numerical simulation of wrinkle phenomenon during multi-point forming process of shallow rectangle cup

    Institute of Scientific and Technical Information of China (English)

    裴永生; 李明哲; 李雪; 隋振

    2004-01-01

    In this paper, the principle of multi-point forming (MPF) technique is presented. One of the most serious defects, wrinkling, during the multi-point forming process of a shallow rectangle cup is discussed by means of numerical simulation on the shallow rectangle cup forming process. The effects of thickness, material of sheet metal and the pressure of the blank holder are investigated. Based on the simulation results, the reasons and control methods of wrinkling are pointed out. Moreover, the experiment on the multi-point die forming of the shallow rectangle cup by the MPF machine is done to validate the efficiency of the numerical simulation,and the result proves that the application of an elastic cushion in the forming can restrain wrinkling efficiently.

  13. Sintering of ultra high molecular weight polyethylene

    Indian Academy of Sciences (India)

    Sangeeta Hambir; J P Jog

    2000-06-01

    Ultra high molecular weight polyethylene (UHMWPE) is a high performance polymer having low coefficient of friction, good abrasion resistance, good chemical resistance etc. It is used in shipbuilding, textile industries and also in biomedical applications. UHMWPE is processed by powder processing technique because of its high melt viscosity at the processing temperature. Powder processing technique involves compaction of polymeric powder under pressure and sintering of the preforms at temperature above its melting point. In this study, we report our results on compaction and sintering behaviour of two grades of UHMWPE with reference to the powder morphology, sintering temperatures and strength development.

  14. Submicron Polyethylene Particles from Catalytic Emulsion Polymerization

    OpenAIRE

    Bauers, Florian Martin; Thomann, Ralf; Mecking, Stefan

    2003-01-01

    Particles of linear polyethylene (Mn = (2-3)X 10000 g mol-1; Mw/Mn = 2-4) obtained by catalytic emulsion polymerization of ethylene possess a nonspherical, lentil-like shape with an average aspect ratio of ca. 10 and diameters from 30 to > 300 nm, as determined by TEM and AFM. The particle structure results from a stacking of the lamellae along the one shorter axis of the lentils (i.e., their height, by contrast to the diameter). In addition to these multilamellae particles, remarkably, a con...

  15. Initial Stages of the Pyrolysis of Polyethylene.

    Science.gov (United States)

    Popov, Konstantin V; Knyazev, Vadim D

    2015-12-10

    An experimental study of the kinetics of the initial stages of the pyrolysis of high-density polyethylene (PE) was performed. Quantitative yields of gas-phase products (C1-C8 alkanes and alkenes) and functional groups within the remaining polyethylene melt (methyl, vinyl, vinylene, vinylidene, and branching sites) were obtained as a function of time (0-20 min) at five temperatures in the 400-440 °C range. Gas chromatography and NMR ((1)H and (13)C) were used to detect the gas- and condensed-phase products, respectively. Modeling of polyethylene pyrolysis was performed, with the primary purpose of determining the rate constants of several critical reaction types important at the initial pyrolysis stages. Detailed chemical mechanisms were created (short and extended mechanisms) and used with both the steady-state approximation and numerical integration of the differential kinetic equations. Rate constants of critical elementary reactions (C-C backbone scission, two kinds of H-atom transfer, radical addition to the double bond, and beta-scission of tertiary alkyl radicals) were adjusted, resulting in an agreement between the model and the experiment. The values of adjusted rate constants are in general agreement with those of cognate reactions of small molecules in the gas phase, with the exception of the rate constants of the backbone C-C scission, which is found to be approximately 1-2 orders of magnitude lower. This observation provides tentative support to the hypothesis that congested PE melt molecular environment impedes the tumbling motions of separating fragments in C-C bond scission, thus resulting in less "loose" transition state and lower rate constant values. Sensitivity of the calculations to selected uncertainties in model properties was studied. Values and estimated uncertainties of four combinations of rate constants are reported as derived from the experimental results via modeling. The dependence of the diffusion-limited rate constant for radical

  16. IMPORTANT DEGRADATIONS IN POLYETHYLENE TERAPHTALATE EXTRUSION PROCESS

    Directory of Open Access Journals (Sweden)

    Şule ALTUN

    2003-01-01

    Full Text Available Polyethylene terephthalate (PET is one of the most used thermo-plastic polymers. The total consumption of PET has been about 30 million tons in the year 2000. Polyester fibers constitute about 60 % of total synthetic fibers consumption. During extrusion, PET polymer is faced to thermal, thermo-oxidative and hydrolytic degradation, which result in severe reduction in its molecular weight, thereby adversely affecting its subsequent melt processability. Therefore, it is essential to understand degradation processes of PET during melt extrusion.

  17. Thermoviscoelastic models for polyethylene thin films

    DEFF Research Database (Denmark)

    Li, Jun; Kwok, Kawai; Pellegrino, Sergio

    2016-01-01

    This paper presents a constitutive thermoviscoelastic model for thin films of linear low-density polyethylene subject to strains up to yielding. The model is based on the free volume theory of nonlinear thermoviscoelasticity, extended to orthotropic membranes. An ingredient of the present approach...... is that the experimentally inaccessible out-of-plane material properties are determined by fitting the model predictions to the measured nonlinear behavior of the film. Creep tests, uniaxial tension tests, and biaxial bubble tests are used to determine the material parameters. The model has been validated experimentally...

  18. Surface modification of polyethylene by plasma

    International Nuclear Information System (INIS)

    The products made of polyethylene (PE) go from construction materials, electric insulating until packing material. The films for bags and pack occupy 83.6% of the distribution of the market of PE approximately. The enormous quantity of PE that is generated by its indiscriminate use brings as consequence a deterioration to the atmosphere, due to the long life that they present as waste. This work is a study on the modification of low density polyethylene films. In this type of thin materials, the changes in the surface meet with largely on the conformation of the rest of the material. To induce changes that modify the surface of PE, plasmas were used with reactive atmospheres of air, oxygen and nitrogen. The experimentation that was carries out went to introduce the PE to a cylindrical reactor where it was generated the plasma of air, oxygen and nitrogen to different times of exposure. After having carried out the exposure to the plasma, it was found that in the polyethylene it modifies their morphology, crystallinity, hydrophobicity, composition and electric conductivity. The analytical techniques that were used to characterize later to the polyethylene of being in contact with the plasma were: X-ray diffraction, Scanning Electron Microscopy, Infrared spectroscopy, Electric conductivity, Angle of contact and finally Thermal Gravimetric Analysis. The content of this work it is presented in five chapters: In the chapter 1 there are presented some general concepts of plasma and of the one polymer in study PE. In the chapter 2 it is made a general revision on modification of surfaces, as well as the properties that were modified in polymeric materials that were exposed to plasma in previous works. In the chapter 3 the experimental part and the conditions used are described in the modification of the PE. Also in this chapter a brief description it is made of the used characterization techniques. The results and discussion are presented in the chapter 4. These results

  19. An analytical incremental model for the analysis of the cup drawing

    Directory of Open Access Journals (Sweden)

    H. Gharib

    2006-04-01

    Full Text Available Purpose: of this paper Develop an analytical model for the cup drawing process to solve for the induced stresses and strains over the deforming sheet at any stage of deformation until a full cup is formed.Design/methodology/approach: An analytical model is developed for the cup drawing process by determining the variation of stresses and strains over the deforming sheet. The model uses finite difference approach and numerical procedures to solve for equilibrium, continuity, and plasticity equations in an incremental fashion.Findings: The developed analytical model results showed good correlation with experimental ones from the literature. Also, the analytical model was found to be useful in conducting parametric studies in order to determine how the different process parameters can affect the deforming cup.Research limitations/implications: This paper includes the development of an analytical model to analyze the deep drawing of axisymmetric cups. This model is then used as the solution engine for the optimization of the blank holder force for such cups avoiding failure by wrinkling or tearing. This model also gives an insight of the modes of deformation in the deep drawing process.Practical implications: This paper is part of a procedure that leads to the optimization of the blank holder loading scheme. The full procedure as presented in the two parts of the work may be applied in industry to minimize the maximum punch load or the work done during deep drawing process by modifying the blank holder force and at the same time avoid failures by wrinkling or tearing.Originality/value: Developing a predictive/corrective technique for solving the unknown boundaries of the deforming sheet.

  20. Influence of Cellulose Ethers on Hydration Products of Portland Cement

    Institute of Scientific and Technical Information of China (English)

    MA Baoguo; OU Zhihua; JIAN Shouwei; XU Rulin

    2011-01-01

    Cellulose ethers are widely used to mortar formulations, and it is significant to understand the interaction between cellulose ethers and cement pastes. FT-IR spectra, thermal analysis and SEM are used to investigate hydration products in the cement pastes modified by HEMC and HPMC in this article. The results show that the hydration products in modified cement pastes were finally identical with those in the unmodified cement paste, but the major hydration products, such as CH (calcium hydroxide), ettringite and C-S-H, appeared later in the modified cement pastes than in the unmodified cement paste. The cellulose ethers decrease the outer products and increase inner products of C-S-H gels. Compared to unmodified cement pastes, no new products are found in the modified cement pastes in the present experiment. The HEMC and HPMC investigation shows almost the same influence on the hydration products of Portland cement.

  1. Investigation of Possible Wellbore Cement Failures During Hydraulic Fracturing Operations

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jihoon; Moridis, George

    2014-11-01

    We model and assess the possibility of shear failure, using the Mohr-Coulomb model ? along the vertical well by employing a rigorous coupled flow-geomechanic analysis. To this end, we vary the values of cohesion between the well casing and the surrounding cement to representing different quality levels of the cementing operation (low cohesion corresponds to low-quality cement and/or incomplete cementing). The simulation results show that there is very little fracturing when the cement is of high quality.. Conversely, incomplete cementing and/or weak cement can causes significant shear failure and the evolution of long fractures/cracks along the vertical well. Specifically, low cohesion between the well and cemented areas can cause significant shear failure along the well, but the same cohesion as the cemented zone does not cause shear failure. When the hydraulic fracturing pressure is high, low cohesion of the cement can causes fast propagation of shear failure and of the resulting fracture/crack, but a high-quality cement with no weak zones exhibits limited shear failure that is concentrated near the bottom of the vertical part of the well. Thus, high-quality cement and complete cementing along the vertical well appears to be the strongest protection against shear failure of the wellbore cement and, consequently, against contamination hazards to drinking water aquifers during hydraulic fracturing operations.

  2. Electronic Nose for Quality Control of Colombian Coffee Through the Detection of Defects in ``Cup Tests''

    Science.gov (United States)

    Rodríguez, Juan C.; Duran, Cristhian M.; Reyes, Adriana X.

    2009-05-01

    This article presents a preliminary study on the analysis of samples of Colombian coffee for the detection and classification of defects (i.e. using "Cup Tests"), which was conducted in Almacafé quality control laboratory Almacafé in Cúcuta, Colombia). The results obtained show the application of an Electronic Nose (EN), called "A-NOSE," used in the coffee sector for the cupping tests. The results show that e-nose technology can be a useful tool as quality control of coffee grain.

  3. Multi Stage Strategies for Single Point Incremental Forming of a Cup

    DEFF Research Database (Denmark)

    Skjødt, Martin; Bay, Niels; Endelt, Benny;

    2008-01-01

    comparing explicit FE analysis with experiments. Good agreement is found between calculated and measured thickness distribution, overall geometry and strains. Using the proposed multi stage strategy it is shown possible to produce a cup with a height close to the radius and side parallel to the symmetry......A five stage forming strategy for forming of a circular cylindrical cup with a height/radius ratio of one is presented. Geometrical relations are discussed and theoretical strains are calculated. The influence of forming direction (upwards or downwards) is investigated for the second stage...

  4. Machine Learning of Multi Agents for RoboCup Soccer Domain:A Survey

    Institute of Scientific and Technical Information of China (English)

    Nadeem Iqbal; LUO Qing(罗青); LU Tian-sheng(吕恬生)

    2003-01-01

    Machine learning has been widely applied to deal with problems in complex environment such asRoboCup, which is assumed as the ideal platform for research on AI and robotic. In RoboCup simulation league,software agents play soccer games on an official soccer server over the network. When constructing these softwareagents, issues in area of agents learning techniques arise to satisfy the properties specified by agent theorists. Thispaper presented an overview of the agents learning used in the simulator teams. Many kinds of agents learningtechniques were reported and compared. It also provided open questions for discussing and pointed out some possi-ble answers to verify in near future.

  5. Fooled by bursts. A Goal per Minute model for the World Cup

    OpenAIRE

    Mingotti, Nicola

    2014-01-01

    On the occasion of the last FIFA World Cup in Brazil, The Economist published a plot depicting how many goals have been scored in all World Cup competitions until present, minute by minute. The plot was followed by a naive and poorly grounded qualitative analysis. In the present article we use The Economist dataset to check its conclusions, update previous results from literature and offer a new model. In particular, it will be shown that first and second half game have different scoring rate...

  6. Learning for RoboCup Soccer : Policy Gradient Reinforcement Learning inmulti-agent systems

    OpenAIRE

    Lidström, Christian; Leskelä, Hannes

    2014-01-01

    Robo Cup Soccer is a long-running yearly world wide robotics competition,in which teams of autonomous robot agents play soccer against each other.This report focuses on the 2D simulator variant, where no actual robots are needed and the agents instead communicate with a server which keeps trackof the game state. RoboCup Soccer 2D simulation has become a major topic of research for articial intelligence, cooperative behaviour in multi-agent systems, and the learning thereof. Some form of machi...

  7. 76 FR 76760 - Gray Portland Cement and Cement Clinker From Japan

    Science.gov (United States)

    2011-12-08

    ... review. Background The Commission instituted this review on May 2, 2011 (76 FR 24519) and determined on August 5, 2011 that it would conduct an expedited review (76 FR 50252, August 12, 2011). The Commission... COMMISSION Gray Portland Cement and Cement Clinker From Japan Determination On the basis of the record...

  8. Characterization of cement minerals, cements and their reaction products at the atomic and nano scale

    DEFF Research Database (Denmark)

    Skibsted, Jørgen; Hall, Christopher

    2008-01-01

    Recent advances and highlights in characterization methods are reviewed for cement minerals, cements and their reaction products. The emphasis is on X-ray and neutron diffraction, and on nuclear magnetic resonance methods, although X-ray absorption and Raman spectroscopies are discussed briefly...

  9. Analysis of world biathlon leaders’ participation in biathlon World Cup (on example of women’s biathlon

    Directory of Open Access Journals (Sweden)

    Zubrilov R.A.

    2015-11-01

    Full Text Available Purpose: optimization of elite female biathlons’ training, considering modern structure of international competitions. Material: we analyzed materials of three recent IBU Congresses and more than 3300 protocols of competitions of World cup stages, world championships, winter Olympic Games (women, sport seasons from 2005 to 2015. Results: it was found that, when preparing for winter Olympic Games 63.9% of sportsmen - prize winners missed 13.6% of stages of World Cup, when preparing for world championships 47.2% of prize-winners missed 9.5% of stages. Before the main start of the season in Europe prize winners missed in conditions of plain: 42.1% - 7.9% of World Cup stages; in midlands conditions 61.9% - 13.9%; in competitions with preliminary trans-meridian travel 54.2% of prize-winners missed 13.1% of stages. Conclusions: most of medals are won at world championships and Olympic Games by sportswomen, who are in top-10 of World Cup. The World Cup calendar of events forces sportsmen to miss some stages of World Cup, when they prepare to main start of season. Attitude of world biathlon leaders to missing of World Cup stages before main start of season depends on main character of main start of season. With it main condition for taking decision about missing of World Cup stages is rank of competitions and geographical characteristics of places of competitions.

  10. Cancers of unknown primary origin (CUP) are characterized by chromosomal instability (CIN) compared to metastasis of know origin

    DEFF Research Database (Denmark)

    Vikeså, Jonas; Møller, Anne Kirstine H; Kaczkowski, Bogumil;

    2015-01-01

    genome wide transcriptome analysis, Linear Discriminant Analysis (LDA) and Quadratic Discriminant Analysis (QDA), we defined the putative origins of a large series of CUP and how closely related a particular CUP was to corresponding metastases of known origin. LDA predictions were subsequently used...

  11. Chromium content in human skin after in vitro application of ordinary cement and ferrous-sulphate-reduced cement

    DEFF Research Database (Denmark)

    Fullerton, A; Gammelgaard, Bente; Avnstorp, C;

    1993-01-01

    The amount of chromium found in human skin after in vitro application of cement suspensions on full-thickness human skin in diffusion cells was investigated. Cement suspensions made from ordinary Portland cement or Portland cement with the chromate reduced with added ferrous sulphate were used....... The cement suspensions were either applied on the skin surface under occlusion for 48 h or applied repeatedly every 24 h for 96 h. No statistically significant difference in chromium content of skin layers between skin exposed to ordinary Portland cement, skin exposed to cement with added ferrous sulphate...... and unexposed skin was observed, despite a more permeable skin barrier at the alkaline pH of the cement suspensions, i.e., pH 12.5. Increased chromium levels in epidermis and dermis were seen when ordinary Portland cement was applied as a suspension with added sodium sulphate (20%) on the skin surface for 96 h...

  12. Alternative Fuel for Portland Cement Processing

    Energy Technology Data Exchange (ETDEWEB)

    Schindler, Anton K; Duke, Steve R; Burch, Thomas E; Davis, Edward W; Zee, Ralph H; Bransby, David I; Hopkins, Carla; Thompson, Rutherford L; Duan, Jingran; ; Venkatasubramanian, Vignesh; Stephen, Giles

    2012-06-30

    The production of cement involves a combination of numerous raw materials, strictly monitored system processes, and temperatures on the order of 1500 °C. Immense quantities of fuel are required for the production of cement. Traditionally, energy from fossil fuels was solely relied upon for the production of cement. The overarching project objective is to evaluate the use of alternative fuels to lessen the dependence on non-renewable resources to produce portland cement. The key objective of using alternative fuels is to continue to produce high-quality cement while decreasing the use of non-renewable fuels and minimizing the impact on the environment. Burn characteristics and thermodynamic parameters were evaluated with a laboratory burn simulator under conditions that mimic those in the preheater where the fuels are brought into a cement plant. A drop-tube furnace and visualization method were developed that show potential for evaluating time- and space-resolved temperature distributions for fuel solid particles and liquid droplets undergoing combustion in various combustion atmospheres. Downdraft gasification has been explored as a means to extract chemical energy from poultry litter while limiting the throughput of potentially deleterious components with regards to use in firing a cement kiln. Results have shown that the clinkering is temperature independent, at least within the controllable temperature range. Limestone also had only a slight effect on the fusion when used to coat the pellets. However, limestone addition did display some promise in regards to chlorine capture, as ash analyses showed chlorine concentrations of more than four times greater in the limestone infused ash as compared to raw poultry litter. A reliable and convenient sampling procedure was developed to estimate the combustion quality of broiler litter that is the best compromise between convenience and reliability by means of statistical analysis. Multi-day trial burns were conducted

  13. Alternative Fuel for Portland Cement Processing

    Energy Technology Data Exchange (ETDEWEB)

    Anton K. Schindler; Steve R. Duke; Thomas E. Burch; Edward W. Davis; Ralph H. Zee; David I. Bransby; Carla Hopkins; Rutherford L. Thompson; Jingran Duan; Vignesh Venkatasubramanian; Stephen Giles.

    2012-06-30

    The production of cement involves a combination of numerous raw materials, strictly monitored system processes, and temperatures on the order of 1500 °C. Immense quantities of fuel are required for the production of cement. Traditionally, energy from fossil fuels was solely relied upon for the production of cement. The overarching project objective is to evaluate the use of alternative fuels to lessen the dependence on non-renewable resources to produce portland cement. The key objective of using alternative fuels is to continue to produce high-quality cement while decreasing the use of non-renewable fuels and minimizing the impact on the environment. Burn characteristics and thermodynamic parameters were evaluated with a laboratory burn simulator under conditions that mimic those in the preheater where the fuels are brought into a cement plant. A drop-tube furnace and visualization method were developed that show potential for evaluating time- and space-resolved temperature distributions for fuel solid particles and liquid droplets undergoing combustion in various combustion atmospheres. Downdraft gasification has been explored as a means to extract chemical energy from poultry litter while limiting the throughput of potentially deleterious components with regards to use in firing a cement kiln. Results have shown that the clinkering is temperature independent, at least within the controllable temperature range. Limestone also had only a slight effect on the fusion when used to coat the pellets. However, limestone addition did display some promise in regards to chlorine capture, as ash analyses showed chlorine concentrations of more than four times greater in the limestone infused ash as compared to raw poultry litter. A reliable and convenient sampling procedure was developed to estimate the combustion quality of broiler litter that is the best compromise between convenience and reliability by means of statistical analysis. Multi-day trial burns were conducted

  14. Degradation of Green Polyethylene by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi

    2015-01-01

    We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers. PMID:26076188

  15. Recycling of irradiated high-density polyethylene

    International Nuclear Information System (INIS)

    Radiation crosslinking of high-density polyethylene (HDPE) is a well-recognized modification of improving basic material characteristics. This research paper deals with the utilization of electron beam irradiated HDPE (HDPEx) after the end of its lifetime. Powder of recycled HDPEx (irradiation dose 165 kGy) was used as a filler into powder of virgin low-density polyethylene (LDPE) in concentrations ranging from 10% to 60%. The effect of the filler on processability and mechanical behavior of the resulting mixtures was investigated. The results indicate that the processability, as well as mechanical behavior, highly depends on the amount of the filler. Melt flow index dropped from 13.7 to 0.8 g/10 min comparing the lowest and the highest concentration; however, the higher shear rate the lower difference between each concentration. Toughness and hardness, on the other hand, grew with increasing addition of the recycled HDPEx. Elastic modulus increased from 254 to 450 MPa and material hardness increased from 53 to 59 ShD. These results indicate resolving the problem of further recycling of irradiated polymer materials while taking advantage of the improved mechanical properties. - Highlights: • Utilization of recycled irradiated material as a filler is proposed. • LDPE/HDPEx mixtures were prepared in six concentrations. • Processability and mechanical behavior were investigated and compared. • Possible utilization of irradiated material after the end of its lifetime was proven

  16. Degradation of Green Polyethylene by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available We studied the biodegradation of green polyethylene (GP by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

  17. Carbonation Resistance of Sulphoaluminate Cement-based High Performance Concrete

    Institute of Scientific and Technical Information of China (English)

    ZHANG Decheng; XU Dongyu; CHENG Xin; CHEN Wen

    2009-01-01

    The influences of water/cement ratio and admixtures on carbonation resistance of sulphoaluminate cement-based high performance concrete(HPC)were investigated.The experimental results show that with the decreasing water/cement ratio,the carbonation depth of sulphoaluminate cement-based HPC is decreased remarkably,and the carbonation resistance capability is also improved with the adding admixtures.The morphologies and structure characteristics of sulphoaluminate cement hydration products before and after carbonation were analyzed using SEM and XRD.The analysis results reveal that the main hydration product of sulphoaluminate cement,that is ettringite(AFt),de-composes after carbonation.

  18. [Burns caused by cement mortar (based on expert opinion)].

    Science.gov (United States)

    Kleinhans, D

    1984-01-01

    A 35-year-old farmer with scars on his right arm, following erosion obviously due to wet cement (case of an expert opinion), was examined. Cement water had continuously soaked his shirt while he was planing a freshly applied wet cement ceiling with his right arm upwards. The cement did not contain special additives, so the normal alkalinity of wet cement and occlusion effects caused the erosion. The farmer sued the manufacturer of the cement for damages because of missing warning notices. The court decided in his favor.

  19. Immobilization of radioactive waste in cement based matrices

    International Nuclear Information System (INIS)

    Experimental and theoretical studies of hydrated cement systems are described. The behaviour of slag-based cement is described with a view to predicting their long term pH, Esub(n) and mineralogical balance. Modelling studies which enable the prediction at long ages of cement composites are advanced and a base model of the CaO-SiO2-H2O system presented. The behaviour of U and I in cements is explored. The tolerance of cement systems for a wide range of miscellaneous waste stream components and environmental hazards is described. The redox potential in cements is effectively lowered by irradiation. (author)

  20. A Blended Cement Containing Blast Furnace Slag and Phosphorous Slag

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Blended cement containing blast furnace slag(BFS) and phosphorous slag(PS) is a new kind of cement.The total content of blended materials could increase if two additives were used. Using the same admixtures, the properties of the blended cement with 70% additives could reach the standard of 525-grade slag cement according to GB.The strength of cement with 80% additives could reach the standard of 425-grade slag cement.The tests of strength, pore structure,hydration products,inhibiting alkali-aggregate reaction, resistance to sulfate corrosion of BFS-PSC were performed.

  1. Measuring splash erosion potential under vegetation using sand-filled splash cups

    Science.gov (United States)

    Geißler, C.; Scholten, T.; Kühn, P.

    2009-04-01

    In soil erosion research it is widely accepted that vegetation is not only protecting the soil from the erosive power of rainfall. Under specific circumstances (like they occur e.g. in forests) vegetation can enhance the erosive power of rainfall by modifying its properties (esp. drop size distribution, kinetic energy). The adjacent processes are very complex and variable in time and space and depend on numerous variables (e.g. rainfall intensity, drop size distribution, drop fall velocity, height of the canopy, density of the canopy, crown and leaf traits, LAI). In the last decades a large number of studies focused this process-system using different methods and came to often different results (Brandt 1989; Calder 2001; Foot & Morgan 2005; Hall & Calder 1993; Mosley 1982; Nanko et al. 2006; Park & Cameron 2008; Vis 1986). The main objective of our field experiments in subtropical China is to quantify the modification of precipitation by its pass through the canopy layer for six different tree species, three different successional stages and three different biodiversity classes. For this, new splash cups were developed based on the archetype of Ellison (1947). In contrast to previous studies with splash cups (Vis 1986) or other forms of splash cups (Kinnell 1974; Morgan 1981) we measured the unit sand remaining inside the cup after single natural rainfall events. The new splash cups contain of a PE-flask to which a carrier system has been attached. In this carrier system a cup filled with unit sand of 125-200 µm particle size is inserted. At the bottom of the cup a silk cover is attached to avoid the loss of sand and to guarantee free drainage of water from the cup to the carrier and vice versa. Cup and PE-flask are hydraulically connected by a cotton wick to assure constant moisture content throughout the time of measuring. Additionally, vents in the carrier system ensure that the pressure arising from the insertion of the cup doesn't lead to a loss of sand. The

  2. Quality control of cemented waste forms

    Energy Technology Data Exchange (ETDEWEB)

    Slate, L.J.

    1994-12-31

    To insure that cemented radwaste remains immobilized after disposal, certain standards have been set in Europe by the Commission of the European Communities. One such standard is compressive strength. If the compressive strength can be predicted during the early curing stages, time and money can be saved and the quality of the final waste form guaranteed. It was determined that the 7- and 28-day compressive strength from radwaste cementation can be predicted during the mixing and early curing stages by at least three methods. The three that were studied were maturity, rheology, and impedance. Maturity is a temperature-to-time measurement, rheology is a shear stress-to-shear rate measurement, and impedance is the opposition offered to the flow of alternating current. These three methods were employed on five different cemented radwaste concentrations with three different water-to-cement ratios; thus, a total of 15 different mix designs were considered. The results showed that the impedance was the easiest to employ for an on-line process. The results of the impedance method showed a very good relationship between impedance and water-to-cement ratio; therefore, an accurate prediction of compressive strength of cemented radwaste can be drawn from this method. The results of the theology method were very good. The method showed that concrete conforms to the Bingham plastic rheologic model, and the theology method can be used to predict the compressive strength of cemented radwaste, but may be too cumbersome. The results of the maturity method were shown to be limited in accuracy for determining compressive strength.

  3. Experimental Study on Artificial Cemented Sand Prepared with Ordinary Portland Cement with Different Contents

    Directory of Open Access Journals (Sweden)

    Dongliang Li

    2015-07-01

    Full Text Available Artificial cemented sand test samples were prepared by using ordinary Portland cement (OPC as the cementing agent. Through uniaxial compression tests and consolidated drained triaxial compression tests, the stress-strain curves of the artificial cemented sand with different cementing agent contents (0.01, 0.03, 0.05 and 0.08 under various confining pressures (0.00 MPa, 0.25 MPa, 0.50 MPa and 1.00 MPa were obtained. Based on the test results, the effect of the cementing agent content (Cv on the physical and mechanical properties of the artificial cemented sand were analyzed and the Mohr-Coulomb strength theory was modified by using Cv. The research reveals that when Cv is high (e.g., Cv = 0.03, 0.05 or 0.08, the stress-strain curves of the samples indicate a strain softening behavior; under the same confining pressure, as Cv increases, both the peak strength and residual strength of the samples show a significant increase. When Cv is low (e.g., Cv = 0.01, the stress-strain curves of the samples indicate strain hardening behavior. From the test data, a function of Cv (the cementing agent content with c′ (the cohesion force of the sample and Δϕ′ (the increment of the angle of shearing resistance is obtained. Furthermore, through modification of the Mohr-Coulomb strength theory, the effect of cementing agent content on the strength of the cemented sand is demonstrated.

  4. Colorectal cancer and non-malignant respiratory disease in asbestos cement and cement workers

    International Nuclear Information System (INIS)

    Radiologically visible parenchymal changes (small opacities >= 1/0;ILO 1980 classification) were present in 20% of a sample of workers (N=174), employed for 20 years (median) in an asbestos cement plant. Exposure-response relationships were found, after controlling for age and smoking habits. In a sample of asbestos cement workers with symptoms and signs suggestive of pulmonary disease (N=33), increased lung density measured by x-ray computed tomography, and reduced static lung volumes and lung compliance was found. In a cohort of asbestos cement workers (N=1.929) with an estimated median exposure of 1.2 fibres/ml, the mortality from non-malignant respiratory disease was increased in comparison to a regional reference cohort (N=1.233). A two-to three-fold increase of non-malignant respiratory mortality was noted among workers employed for more than a decade in the asbestos cement plant, compared to cement workers (N=1.526), who in their turn did not experience and increased risk compared to the general population. In the cohorts of asbestos cement and cement workers, there was a tow-to three-fold increased incidence of cancer in the right part of the colon, compared to the general population as well as to external reference cohorts of other industrial workers (N=3.965) and fishermen (N=8.092). A causal relation with the exposure to mineral dust and fibres was supported by the findings of higher risk estimated in subgroups with high cumulated asbestos doses or longer duration of cement work. The incidence of cancer in the left part of the colon was not increased. Morbidity data, but not mortality data, disclosed the subsite-specific risk pattern. Both asbestos cement workers and cement workers has an increased incidence of rectal cancer, compared with the general population, and with the fishermen. The risk was, however, of the same magnitude among the other industrial workers. 181 refs

  5. Assessment of Natural Radioactivity Levels of Cements and Cement Composites in the Slovak Republic

    Directory of Open Access Journals (Sweden)

    Adriana Eštoková

    2013-12-01

    Full Text Available The radionuclide activities of 226Ra, 232Th and 40K and radiological parameters (radium equivalent activity, gamma and alpha indices, the absorbed gamma dose rate and external and internal hazard indices of cements and cement composites commonly used in the Slovak Republic have been studied in this paper. The cement samples of 8 types of cements from Slovak cement plants and five types of composites made from cement type CEM I were analyzed in the experiment. The radionuclide activities in the cements ranged from 8.58–19.1 Bq·kg−1, 9.78–26.3 Bq·kg−1 and 156.5–489.4 Bq·kg−1 for 226Ra, 232Th and 40K, respectively. The radiological parameters in cement samples were calculated as follows: mean radium equivalent activity Raeq = 67.87 Bq·kg−1, gamma index Iγ = 0.256, alpha index Iα = 0.067, the absorbed gamma dose rate D = 60.76 nGy·h−1, external hazard index Hex = 0.182 and internal hazard index Hin was 0.218. The radionuclide activity in composites ranged from 6.84–10.8 Bq·kg−1 for 226Ra, 13.1–20.5 Bq·kg−1 for 232Th and 250.4–494.4 Bq·kg−1 for 40K. The calculated radiological parameters of cements were lower than calculated radiological parameters of cement composites.

  6. Roles of CUP-5, the Caenorhabditis elegans orthologue of human TRPML1, in lysosome and gut granule biogenesis

    Directory of Open Access Journals (Sweden)

    Fares Hanna

    2010-06-01

    Full Text Available Abstract Background CUP-5 is a Transient Receptor Potential protein in C. elegans that is the orthologue of mammalian TRPML1. Loss of TRPML1 results in the lysosomal storage disorder Mucolipidosis type IV. Loss of CUP-5 results in embryonic lethality and the accumulation of enlarged yolk granules in developing intestinal cells. The embryonic lethality of cup-5 mutants is rescued by mutations in mrp-4, which is required for gut granule differentiation. Gut granules are intestine-specific lysosome-related organelles that accumulate birefringent material. This link between CUP-5 and gut granules led us to determine the roles of CUP-5 in lysosome and gut granule biogenesis in developing intestinal cells. Results We show that CUP-5 protein localizes to lysosomes, but not to gut granules, in developing intestinal cells. Loss of CUP-5 results in defects in endo-lysosomal transport in developing intestinal cells of C. elegans embryos. This ultimately leads to the appearance of enlarged terminal vacuoles that show defective lysosomal degradation and that have lysosomal and endosomal markers. In contrast, gut granule biogenesis is normal in the absence of CUP-5. Furthermore, loss of CUP-5 does not result in inappropriate fusion or mixing of content between lysosomes and gut granules. Conclusions Using an in vivo model of MLIV, we show that there is a defect in lysosomal transport/biogenesis that is earlier than the presumed function of TRPML1 in terminal lysosomes. Our results indicate that CUP-5 is required for the biogenesis of lysosomes but not of gut granules. Thus, cellular phenotypes in Mucolipidosis type IV are likely not due to defects in lysosome-related organelle biogenesis, but due to progressive defects in lysosomal transport that lead to severe lysosomal dysfunction.

  7. 21 CFR 177.1630 - Polyethylene phthalate polymers.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Polyethylene phthalate polymers. 177.1630 Section 177.1630 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Basic Components of Single and Repeated Use Food Contact Surfaces § 177.1630 Polyethylene...

  8. Young Modulus of Crystalline Polyethylene from ab Initio Molecular Dynamics

    NARCIS (Netherlands)

    Hageman, J.C.L.; Meier, Robert J.; Heinemann, M.; Groot, R.A. de

    1997-01-01

    The Young modulus for crystalline polyethylene is calculated using ab initio molecular dynamics based on density functional theory in the local density approximation (DFT-LDA). This modulus, which can be seen as the ultimate value for the Young modulus of polyethylene fibers, is found to be 334 GPa.

  9. 76 FR 8770 - Polyethylene Terephthalate (Pet) Film From Korea

    Science.gov (United States)

    2011-02-15

    ... COMMISSION Polyethylene Terephthalate (Pet) Film From Korea AGENCY: United States International Trade... full five-year review concerning the antidumping duty order on polyethylene terephthalate (PET) film... whether revocation of the antidumping order on PET film from Korea would be likely to lead to...

  10. 76 FR 54791 - Polyethylene Terephthalate (PET) Film From Korea

    Science.gov (United States)

    2011-09-02

    ... COMMISSION Polyethylene Terephthalate (PET) Film From Korea Determination On the basis of the record \\1... antidumping duty order on polyethylene terephthalate (PET) film from Korea would not be likely to lead to... Procedure (19 CFR 207.2(f)). Background The Commission instituted this review on September 1, 2010 (75...

  11. Analysis of system and methods for improved cementing of oil- and gas wells

    OpenAIRE

    Stensrud, Magnus

    2011-01-01

    Cement is a crucial part of well construction. If a good cement bond between the casing and well bore wall cannot be achieved in the primary cementing, expensive remedial cementing jobs or possible loss of the well bore can occur.When cementing casings and liners in deep waters or pressure depleted reservoirs there is often a small pressure margin between pore pressure and fracture pressure, this makes cement operations more complex. New cementing techniques and cements are being developed to...

  12. Chemical and Physical Reactions of Wellbore Cement under CO2 Storage Conditions: Effects of Cement Additives

    Science.gov (United States)

    Kutchko, B. G.; Strazisar, B. R.; Huerta, N.; Lowry, G. V.; Dzombak, D. A.; Thaulow, N.

    2008-12-01

    Sequestration of CO2 into geologic formations requires long-term storage and low leakage rates to be effective. Active and abandoned wells in candidate storage formations must be evaluated as potential leakage points. Wellbore integrity is an important part of an overall integrated assessment program being developed at NETL to assess potential risks at CO2 storage sites. Such a program is needed for ongoing policy and regulatory decisions for geologic carbon sequestration. The permeability and integrity of the cement in the well is a primary factor affecting its ability to prevent leakage. Cement must be able to maintain low permeability over lengthy exposure to reservoir conditions in a CO2 injection and storage scenario. Although it is known that cement may be altered by exposure to CO2, the results of ongoing research indicate that cement curing conditions, fluid properties, and cement additives play a significant role in the rate of alteration and reaction. The objective of this study is to improve understanding of the factors affecting wellbore cement integrity for large-scale geologic carbon sequestration projects. Due to the high frequency use of additives (pozzolan) in wellbore cement, it is also essential to understand the reaction of these cement-pozzolan systems upon exposure to CO2 under sequestration conditions (15.5 MPa and 50°C). Laboratory experiments were performed to determine the physical and chemical changes, as well as the rate of alteration of commonly used pozzolan-cement systems under simulated sequestration reservoir conditions, including both supercritical CO2 and CO2-saturated brine. The rate of alteration of the cement-pozzolan systems is considerably faster than with neat cement. However, the alteration of physical properties is much less significant with the pozzolanic blends. Permeability of a carbonated pozzolanic cement paste remains sufficiently small to block significant vertical migration of CO2 in a wellbore. All of the

  13. EFFECT OF NANOMATERIALS IN CEMENT MORTAR CHARACTERISTICS

    Directory of Open Access Journals (Sweden)

    WAIL N. AL-RIFAIE

    2016-09-01

    Full Text Available Concrete is considered as brittle materials and widely used due to high compressive strength but unfortunately having and has low tensile strength that has a numerous negative impacts on the lifespan of concrete made structures. Therefore, mechanical properties of cement mortar have been investigated experimentally using different types and ratios of nano material to improve the properties. Since the strength of the concrete is of high importance, different materials have been used to enhance the compressive and the tensile characteristics of the cement mortar compressive and tensile strength. Mainly, this objective has been implemented through using micro cement, micro sand, nano silica, and nano clay in developing a nano-cement mortar which can to improve the concrete for the constructional applications. The samples were prepared and tested under tensile and compressive mode according to ASTM-2011 regulations for concrete. The parameters that are taken consideration during the investigation were micro sand, micro cement, nano silica, developed nano clay, and naphthalene sulphonate as super- plasticizers. In general, it has been observed that the results showed a significant increase in both compressive and tensile strength of the mortar at early stages of hardening, where a maximum increase of 22% in the compressive strength was achieved , whereas 3.7 time increase in the compressive strength was recorded over the tradition levels of the concrete strength.

  14. Pulmonary Artery Cement Embolism after a Vertebroplasty

    Directory of Open Access Journals (Sweden)

    Anas Nooh

    2015-01-01

    Full Text Available Background Context. Vertebroplasty is a minimally invasive procedure most commonly used for the treatment of vertebral compression fractures. Although it is relatively safe, complications have been reported over time. Among those complications, massive cement pulmonary embolism is considered a rare complication. Here we report a case of massive diffuse cement pulmonary embolism following percutaneous vertebroplasty for a vertebral compression fracture. Study Design. Case report. Methods. This is a 70-year-old female who underwent vertebroplasty for T11 and T12 vertebral compression fracture. Results. CT-scan revealed an incidental finding of cement embolism in the pulmonary trunk and both pulmonary arteries. Since the patient was asymptomatic, she was monitored closely and she did not need any intervention. Conclusion. Vertebroplasty is a minimally invasive procedure used for treatment of vertebral compression fracture. Despite the low rate of complications, a pulmonary cement embolism can occur. The consequences of cement embolism range widely from being asymptomatic to embolism that can cause paralysis, radiculopathy, or a fatal pulmonary embolism.

  15. Microbial-influenced cement degradation: Literature review

    International Nuclear Information System (INIS)

    The Nuclear Regulatory Commission stipulates that disposed low-level radioactive waste (LLW) be stabilized. Because of apparent ease of use and normal structural integrity, cement has been widely used as a binder to solidify LLW. However, the resulting waste forms are sometimes susceptible to failure due to the actions of waste constituents, stress, and environment. This report reviews literature which addresses the effect of microbiologically influenced chemical attack on cement-solidified LLW. Groups of microorganisms are identified, which are capable of metabolically converting organic and inorganic substrates into organic and mineral acids. Such acids aggressively react with concrete and can ultimately lead to structural failure. Mechanisms inherent in microbial-influenced degradation of cement-based material are the focus of this report. This report provides sufficient evidence of the potential for microbial-influenced deterioration of cement-solidified LLW to justify the enumeration of the conditions necessary to support the microbiological growth and population expansion, as well as the development of appropriate tests necessary to determine the resistance of cement-solidified LLW to microbiological-induced degradation that could impact the stability of the waste form

  16. 78 FR 21260 - Safety Zone; Lubbers Cup Regatta; Spring Lake, MI

    Science.gov (United States)

    2013-04-10

    .... SUPPLEMENTARY INFORMATION: Table of Acronyms DHS Department of Homeland Security FR Federal Register NPRM Notice... SECURITY Coast Guard 33 CFR PART 165 RIN 1625-AA00 Safety Zone; Lubbers Cup Regatta; Spring Lake, MI AGENCY... safety zone on Spring Lake in Spring Lake, Michigan. This safety zone is intended to restrict...

  17. Offside decision making in the 2002 and 2006 FIFA World Cups.

    Science.gov (United States)

    Catteeuw, Peter; Gilis, Bart; García-Aranda, José-María; Tresaco, Fernando; Wagemans, Johan; Helsen, Werner

    2010-08-01

    The first objective of the present study was to examine the accuracy of offside judgements of assistant referees during the 2006 World Cup and to compare overall results with performances of assistant referees during the 2002 World Cup. Second, we also examined underlying mechanisms leading to incorrect decisions. According to the definition used for the 2002 World Cup, the results revealed a decrease in the number of incorrect flag signals during the 2006 (24/240 or 10.0%) compared with the 2002 World Cup (58/222 or 26.1%) (P < 0.001). For accuracy of all potential offside situations, according to a new definition (with the attacker 2 m in front or behind the second-last defender), the error percentage was 7.6% (17 flag errors and 9 non-flag errors out of 342 situations). Overall, quality of offside decisions was not influenced by the position of the assistant referee relative to the offside line. In addition, flag errors can best be explained by the perceptual illusion induced by the flash-lag effect. PMID:20686996

  18. The Role of Bee Pollinators in Improving Berry Weight and Coffee Cup Quality

    Directory of Open Access Journals (Sweden)

    Rebecca H.N. Karanja

    2013-07-01

    Full Text Available The study was conducted at Kiambu County in Kenya. The aim of this study was to investigate whether pollination improves the coffee yield and quality of processed coffee in terms of taste and aroma. Among the parameters evaluated when grading coffee for sale in world market are berry weight and cup quality. No previous work in Kenya describes the role of bee pollinators in enhancement of coffee yields and quality. Data on berry weights and the resulting processed coffee quality from different pollination levels in organically grown coffee were analyzed. Results from this study indicate that coffee benefits immensely from pollinators. The highest berry weight and coffee cup quality were recorded in open pollinated and cross pollinated coffee. There were significant differences in weight and cup quality (p<0.001 between open pollinated coffee and wind pollination, self pollination and autogamy. The study concludes that pollination not only improves the coffee yields but also enhance the coffee cup taste and aroma. High quality coffee fetches higher prices in the world coffee market.

  19. Evaluation of morphologic changes of mandibular symphysis after chin cup therapy in skeletally Cl III patients

    Directory of Open Access Journals (Sweden)

    Hosseinzadeh Nik T.

    2008-04-01

    Full Text Available Background and Aim: Chin cup is an orthopedic appliance for treating growing skeletally Cl III patients. The amount of chin forward movement in addition to morphologic changes in bony structure, determines the final profile of treated patients. The aim of this study was to evaluate the amount of morphologic changes of symphysis after chin cup therapy in skeletally Cl III patients.Materials and Methods: In this clinical trial, twenty eight cephalometries before and after chin cup therapy of 14 skeletally Cl III patients were analyzed. Landmarks introduced by Ricketts were determined to evaluate the symphysis and describe its relation to mandible. َAlso four additional measurements regarding the symphysis individually were evaluated and analyzed. Data were analyzed by paired t and pearson tests with P<0.05 as the level of significance.Results: The results showed that the height of symphysis increased after treatment (P=0.02, but its depth decreased (P=0.04. The sysmphysis turned down and back.Conclusion: These findings suggest that in Cl III malocclusions with a prognathic mandible, chin cup therapy creates changes in the horizontal dimension of symphysis morphology, which improves the Cl III profile. If the patient isn't a vertical grower, vertical changes of symphysis would be desirable. In addition, changes in the vertical dimension of the mandible (body and ramus could be observed as a backward and downward rotation.

  20. Pricking, Cupping and Qu Feng Tiao Ying Decoction for Treatment of Chronic Urticaria

    Institute of Scientific and Technical Information of China (English)

    刘代红

    2002-01-01

    @@ Chronic urticaria is a commonly encountered skin illness characterized by protracted course and recurrent episodes. The author had treated 26 cases of chronic urticaria by pricking, cupping and Qu Feng Tiao Ying (QFTY) decoction (祛风调营汤the Wind-dispelling and Ying system-regulating Decoction) with satisfactory results. A report is as follows.

  1. Extending virtual robots towards RoboCup Soccer Simulation and @Home

    NARCIS (Netherlands)

    S. van Noort; A. Visser

    2012-01-01

    The RoboCup is an initiative to promote the development of robotics in a social relevant way. The competition consists of several leagues and it would be beneficial if developments in one league could be reused in other leagues. This paper describes the development of a simulation model for a humano

  2. Simultaneous GC-MS determination of seven phthalates in total and migrated portions of paper cups.

    Science.gov (United States)

    Park, Yu Na; Choi, Min Sun; Rehman, Shaheed Ur; Gye, Myung Chan; Yoo, Hye Hyun

    2016-05-01

    Phthalate acid esters are widely used as plasticizers to impart plastic flexibility in various industrial applications. In this study, the content of seven phthalates, dibutyl phthalate (DBP), benzyl butyl phthalate (BBP), di-(2-ethylhexyl) adipate (DEHA), di-2-ethylhexyl phthalate (DEHP), di-n-octyl phthalate (DNOP), di-isononyl phthalate (DINP), and di-isodecyl phthalate (DIDP) were determined in paper cups using gas chromatography-mass spectrometry (GC-MS). In addition, the potential migration of these seven phthalates from paper cups into various food stimulants under different conditions was evaluated. The levels of DBP, DEHA, DEHP, and DNOP were in the ranges of 0.07-3.14, 0.16-42.69, 0.45-58.56, and 0.3-2.4 mg/kg, respectively. Meanwhile, BBP, DINP, and DIDP were not detected in most of the tested samples. In the migration test, DEHA was released to 50 % ethanol and n-heptane in a time-dependent manner and the maximum migration levels were 65.62 ± 3.61 and 95.56 ± 19.76 μg/L, respectively. The release of other phthalates was very low or negligible. These results demonstrated that paper cups are not a significant source of phthalate exposure; however, DEHA could be released from paper cups into alcoholic beverages or oily liquid beverages in the human diet. PMID:27053047

  3. Multiple data sets and modelling choices in a comparative LCA of disposable beverage cups

    NARCIS (Netherlands)

    Harst, van der E.J.M.; Potting, J.; Kroeze, C.

    2014-01-01

    This study used multiple data sets and modelling choices in an environmental life cycle assessment (LCA) to compare typical disposable beverage cups made from polystyrene (PS), polylactic acid (PLA; bioplastic) and paper lined with bioplastic (biopaper). Incineration and recycling were considered as

  4. Electrochemical propertiesand thermal stability of cup-like shape gold nanostructures

    OpenAIRE

    Kynclová, H.

    2015-01-01

    Nanostructured surfaces are useful in enlargement of electroactive area of sensing electrodes. The electrodes are very sensitive with maintaining small electrode geometry. In this study, surfaces modified by cup-like gold nanoparticles were fabricated by electrochemical methods. Subsequently, electrochemical properties and thermal stability of fabricated nanostructured electrodes were studied. Thereafter, the electrochemical results were compared with unmodified flat gold layer and contributi...

  5. Cupping Therapy for 103 Cases of High Fever due to Infection of the Upper Respiratory Tract

    Institute of Scientific and Technical Information of China (English)

    刘颖东

    2002-01-01

    @@ The cupping therapy has remarkable antipyretic effect in the treatment of fever. In recent years, the author has treated 103 cases of high fever caused by infection of the upper respiratory tract and obtained quite satisfactory therapeutic results. A report follows.

  6. Microstructure and mechanical properties of hypereutectic Al-Si alloy modified with Cu-P

    Institute of Scientific and Technical Information of China (English)

    ZHANG Henghua; DUAN Haiti; SHAO Guangjie; XU Luoping

    2008-01-01

    The microstructure and mechanical properties of Al-14.6Si castings modified by Cu-P master alloy under different conditions were studied with optical microscope (OM) and mechanical testing and simulation (MTS).The results indicate that the Cu-P master alloy possesses not only obvious modification effect,but also longevity effect with more than 8 h on the hypereutectic Al-Si alloy.It is shown from thermal calculation,scanning electron microscope (SEM),and energy dispersive analysis of X-rays (EDAX) that the modification mechanism of Cu-P on primary silicon in the castings is heterogeneous nucleation around AlP particles.The Cu-P master alloy has no or little modifying effect on eutectic silicon,even though it has obvious modification on primary silicon in the castings.This may be because of the fast transformation of eutectic silicon at a very narrow temperature,which will notably weaken the role of AlP particles as heterogeneous nuclei for eutectic silicon.

  7. Analytical and Experimental Studies on Critical Blank-holder Forces in Cylindrical cup deep drawing

    Institute of Scientific and Technical Information of China (English)

    Lin Zhongqin; Sun Chengzhi; Chen Guanlong; Yu Haiyan

    2004-01-01

    Based on the plastic deformation theory and energy method, the critical blank-holder forces (BHF) of wrinkling and fracture in the cylindrical cup deep-drawing are analyzed. The verify experiments were performed and compared with the theory analysis results. The predictions agree well with the experiment results. Thus, the validated presenttheoretical analysis model may be applied to determinate the suitable BHF.

  8. The dislocating hip replacement - revision with a dual mobility cup in 56 consecutive patients

    DEFF Research Database (Denmark)

    Jakobsen, Thomas; Kappel, Andreas; Hansen, Flemming;

    2014-01-01

    with a Saturne dual mobility cup (Amplitude, Neyron, France). The mean follow-up period was 44 months (SD 30, range 0.1-119). RESULTS: One patient (1.8%) experienced a re-dislocation. Three patients (5.3%) had to be revised. One due to disintegration between the femoral head and inner shell, one due to loosening...

  9. Taking up an event: Brand image transfer during the FIFA World Cup

    NARCIS (Netherlands)

    P. Neijens; E. Smit; M. Moorman

    2009-01-01

    A real-life study (N = 1299) into brand images during and after the 2006 FIFA World Cup football tournament showed that the event was a good platform for the creation of brand images through ‘take-up’ advertising in which the brand was associated with the event. Exposure level and involvement with t

  10. Simultaneous GC-MS determination of seven phthalates in total and migrated portions of paper cups.

    Science.gov (United States)

    Park, Yu Na; Choi, Min Sun; Rehman, Shaheed Ur; Gye, Myung Chan; Yoo, Hye Hyun

    2016-05-01

    Phthalate acid esters are widely used as plasticizers to impart plastic flexibility in various industrial applications. In this study, the content of seven phthalates, dibutyl phthalate (DBP), benzyl butyl phthalate (BBP), di-(2-ethylhexyl) adipate (DEHA), di-2-ethylhexyl phthalate (DEHP), di-n-octyl phthalate (DNOP), di-isononyl phthalate (DINP), and di-isodecyl phthalate (DIDP) were determined in paper cups using gas chromatography-mass spectrometry (GC-MS). In addition, the potential migration of these seven phthalates from paper cups into various food stimulants under different conditions was evaluated. The levels of DBP, DEHA, DEHP, and DNOP were in the ranges of 0.07-3.14, 0.16-42.69, 0.45-58.56, and 0.3-2.4 mg/kg, respectively. Meanwhile, BBP, DINP, and DIDP were not detected in most of the tested samples. In the migration test, DEHA was released to 50 % ethanol and n-heptane in a time-dependent manner and the maximum migration levels were 65.62 ± 3.61 and 95.56 ± 19.76 μg/L, respectively. The release of other phthalates was very low or negligible. These results demonstrated that paper cups are not a significant source of phthalate exposure; however, DEHA could be released from paper cups into alcoholic beverages or oily liquid beverages in the human diet.

  11. [Recommendations for Chilean travelers to the FIFA World Cup 2014 in Brazil].

    Science.gov (United States)

    Perret, Cecilia; Weitzel, Thomas

    2014-04-01

    This article provides a checklist of precautions and vaccines for Chilean travelers attending the FIFA World Cup 2014 in Brazil. It aims to help physicians to prepare visitors of this mass gathering and summarizes useful hints to avoid infectious diseases considering the circumstances and availabilities in Chile.

  12. Football and sex: The 2006 FIFA World Cup and sex trafficking

    Directory of Open Access Journals (Sweden)

    Milivojević Sanja

    2008-01-01

    Full Text Available The staging of the 2006 Federation of International Football Association (FIFA World Cup brought together a wide ranging coalition of interests in fuelling a moral panic around sex trafficking in Europe. This coalition of diverse groups aimed to protect innocent third world women and prevent organized crime networks from luring them into the sex industry. In this article we will argue that as a result of increased attention prior to the World Cup 'protective measures' imposed by nation-states and the international community to prevent "disastrous human right abuses" (Crouse, 2006 have seriously undermined women's human rights, especially in relation to migration and mobility. We survey media sources in the lead up to the World Cup to identify the nature of the coalition seeking to protect women considered to be vulnerable to trafficking and the discourses relied upon that have served to undermine women's agency and diverse experiences of increased border and mobility controls. We conclude that measures introduced around the 2006 World Cup in relation to sex trafficking did not end with its final whistle.

  13. [Constructing recombinant plasmid pSH-CUP and knockout of acid trehalase gene in baker's yeast].

    Science.gov (United States)

    He, Dongqin; Xiao, Dongguang; Lv, Ye

    2008-02-01

    The ATH1 gene encoded acid trehalase in Saccharomyces cerevisiae. The gene disruption cassette combined the heterologous dominant kan(r) resistance marker with a Cre/loxP-mediated marker removal procedure. The gene disruption cassette was produced by PCR using the same long oligonucleotides comprising 50 nucleotides that annealed to sites upstream or downstream of the genomic target sequence to be deleted. After transformation of the linear disruption cassettes with a Cre/loxP-mediated marker into the cells of Saccharomyces cerevisiae BY-6, selected transformants were checked by PCR for correct the integration of the cassette and concurrent deletion of the chromosomal target sequence. The copper-resistance gene (CUP1-MT1) was cloned into pSH47, which yielded pSH-CUP. The recombinant plasmid pSH-CUP was transformed into the cells of Saccharomyces cerevisiae BY-6(delta ATH1, G418(r)), and transformants were selected for copper resistance. Upon expression of the Cre recombinase results in removal of the kan(r) gene, leaving behind a single loxP site at the chromosomal locus. Construction of the recombinant plasmid pSH-CUP avoided inserting non-yeast gene and made the loxP - kanMX - loxP gene disruption cassette more conventional for eukaryotic organism gene disruption.

  14. Spinal Epidural Hematoma Following Cupping Glass Treatment in an Infant With Hemophilia A.

    Science.gov (United States)

    Fruchtman, Yariv; Dardik, Rima; Barg, Assaf Arie; Livnat, Tami; Feldman, Zeev; Rubinstein, Marina; Grinberg, Gahl; Rosenberg, Nurit; Kenet, Gili

    2016-06-01

    A 6 months old infant, diagnosed with a rare mutation causing severe hemophilia A, presented with spinal epidural hematoma. Parents later admitted the infant had glass cupping therapy performed within 2 weeks of the onset of symptoms. The rare mutation, rare bleeding complication, and the eventual course of therapy applied in this case will be discussed in our case report.

  15. Measurement of polyethylene wear and its clinical significance in total hip arthroplasty%全髋关节置换术后聚乙烯内衬磨损的测量及其临床意义

    Institute of Scientific and Technical Information of China (English)

    戴雪松; 严世贵; 潘志军; 黄宗坚

    2001-01-01

    Objective To measure the linear polyethylene wear with use of a computer-assisted two-dimensional method, and to evaluate the relationship between wear and long-term clinic-radiological findings. Methods Radiographs of 104 cementless total hip arthroplasties were examined for osteolysis, radiolucent line, cup abduction angle, cup migration, cancellous condensation, stem subsidence, distal pedestal formation and so on. To measure the linear polyethylene wear, migration in the femoral head center relative to the cup shell center was calculated on digitized consecutive radiographs with special computer software program, the degree and direction of wear were also determined. Patients were followed-up for an average period of 8.4 years. Results The average Harris Hip Score was 53.8 points preoperatively and 88.5 points at the latest follow-up. Fourteen hips ( 13.5 % ) were loose. Total linear wear was 1. 14 mm,wear rate was 0. 15 mm/year. Acetabular osteolysis was correlated to polyethylene wear, and a high wear rate was associated with loosening of the components. Multivariate regression analysis showed a lack of correlation between wear rate and patients' age, body weight, cup size, cup abduction angle, activity level and Harris Hip Score. Conclusion The method is preferable for measuring the polyethylene wear of metal-backed acetabular component and other components of various designs. There was clear relationship between wear and acetabular osteolysis or loosening of the prostheses. Therefore, polyethylene wear is important in evaluating the clinical and radiological outcomes of total hip arthroplasty.%目的以计算机数字化方法计测人工全髋假体二维线性磨损,并探讨磨损程度与长期随访结果的临床相关性.方法利用计算机软件测量股骨头中心相对于髋臼中心的矢量位移,来决定关节面磨损的大小和方向.对104髋非骨水泥型人工假体进行磨损计测、临床和放射学检查,平均随访时间为8

  16. The importance of a thick cement mantle depends on stem geometry and stem-cement interfacial bonding.

    Science.gov (United States)

    Caruana, J; Janssen, D; Verdonschot, N; Blunn, G W

    2009-04-01

    The thickness of the cement mantle around the femoral component of total hip replacements is a contributing factor to aseptic loosening and revision. Nevertheless, various designs of stems and surgical tooling lead to cement mantles of different thicknesses. Opinion is divided on whether a thick mantle enhances implant longevity. This study investigates the effect of cement mantle thickness on accumulated damage in the cement, and how this is influenced by the presence or absence of a proximal collar and on whether the stem-cement interface remains bonded. Three-dimensional finite element simulations incorporating creep and non-linear damage accumulation were performed to investigate cracking in the cement mantles around Stanmore Hips under physiologically informed stair-climbing and gait loads. Cement mantle thickness, stem-cement interfacial bonding, and collar design were varied to assess the interactive effects of these parameters. In all cases, damage levels were three to six times higher when the stem-cement interface remained bonded. Cement mantle thickness had little effect on cement damage accumulation around debonded collared stems but was critical in both bonded and collarless cases, where a thicker mantle reduced cement cracking. Damage around a smooth debonded stem with a collar is thus much less sensitive to cement thickness than around bonded or collarless stems. PMID:19405437

  17. Present Situation and Perspective of Chinese Cement Industry

    Institute of Scientific and Technical Information of China (English)

    Gao Changming

    2003-01-01

    @@ Totally, there are 12 types of cement kiln pro-duction lines in China and running with a quite differenttechnical- economical levels. The cement productionof different types product lines in 1997 ~ 2002 is shownin Table 1.

  18. Effect of aluminium phosphate as admixture on oxychloride cement

    Indian Academy of Sciences (India)

    M P S Chandrawat; R N Yadav

    2000-02-01

    The effect of admixing of aluminium phosphate on oxychloride cement in the matrix has been investigated. It is shown that aluminium phosphate retards the setting process of the cement and improves water-tightness.

  19. Migration of ions in cement paste as studied by SIMS

    Energy Technology Data Exchange (ETDEWEB)

    Prince, K.E.; Aldridge, L.P. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia); Rougeron, P. [Electricite de France Direction des Etudes et Recherches, Les Renardiers (France)

    1998-06-01

    Cement is often used to condition and encapsulate low level radioactive waste before it is disposed of in a repository. Ground water can attack these waste-forms by transporting aggressive ions into the cement paste and by removing radioactive ions from the paste. The extent of the attack will be governed by the diffusion of the ions in the cement paste. In this study we examine the migration of aggressive carbonate ions and inactive Cs and Sr through cement pastes. The use of SIMS for establishing the penetration depths and diffusion profiles for Cs and Sr in cement will be explored. The penetration profiles of Cs and Sr in a non-zeolite cement paste were examined and compared to those of a paste made with zeolite. The effects of the non-homogeneous nature of the cement was most pronounced in the study of the zeolite rich cement; Cs being preferentially accumulated in the zeolite material. (authors). 4 refs., 2 figs.

  20. Exposure to cement dust at a Portland cement factory and the risk of cancer.

    Science.gov (United States)

    Vestbo, J; Knudsen, K M; Raffn, E; Korsgaard, B; Rasmussen, F V

    1991-01-01

    The relation between exposure to cement dust and cancer was examined in a population of 546 cement workers and a reference population of 858 randomly sampled men of similar age and area of residence. In 1974 all men gave lifelong occupational and smoking histories; information on incidence of cancer in the period 1974-85 was obtained from the Danish Cancer Registry. No increased risk of overall cancer was found among cement workers. Among men with more than 20 years exposure to cement dust, 14 cases of respiratory cancer were observed (observed/expected (O/E) 1.52, 95% confidence interval (95% CI) 0.90-2.57) when compared with all Danish men. Men with 1-20 years exposure had O/E 1.14 (95% CI 0.59-2.19) based on nine cases of cancer. After excluding all men with documented exposure to asbestos during employment in an asbestos cement factory no increased risk of overall cancer or respiratory cancer was found among cement workers compared with white collar workers from the local reference population, using a Cox regression model controlling for age and smoking habits. Relative risks were 0.5 (95% CI 0.1-1.5) and 1.0 (95% CI 0.4-2.6) for men with 1-20 and more than 20 years of exposure to cement dust respectively compared with white collar workers. PMID:1772795